Science.gov

Sample records for 4-phenylbutyric acid pba

  1. The therapeutic effects of 4-phenylbutyric acid in maintaining proteostasis.

    PubMed

    Kolb, P S; Ayaub, E A; Zhou, W; Yum, V; Dickhout, J G; Ask, K

    2015-04-01

    Recently, there has been an increasing amount of literature published on the effects of 4-phenylbutyric acid (4-PBA) in various biological systems. 4-PBA is currently used clinically to treat urea cycle disorders under the trade name Buphenyl. Recent studies however have explored 4-PBA in the context of a low weight molecular weight chemical chaperone. Its properties as a chemical chaperone prevent misfolded protein aggregation and alleviate endoplasmic reticulum (ER) stress. As the ER is responsible for folding proteins targeted for use in membranes or secreted out of the cell, failure of maintaining adequate ER homeostasis may lead to protein misfolding and subsequent cell and organ pathology. Accumulation of misfolded proteins within the ER activates the unfolded protein response (UPR), a molecular repair response. The activation of the UPR aims to restore ER and cellular proteostasis by regulating the rate of synthesis of newly formed proteins as well as initiating molecular programs aimed to help fold or degrade misfolded proteins. If proteostasis is not restored, the UPR may initiate pro-apoptotic pathways. It is suggested that 4-PBA may help fold proteins in the ER, attenuating the activation of the UPR, and thus potentially alleviating various pathologies. This review discusses the biomedical research exploring the potential therapeutic effects of 4-PBA in various in vitro and in vivo model systems and clinical trials, while also commenting on the possible mechanisms of action. PMID:25660369

  2. 4-Phenylbutyric Acid Induces Protection against Pulmonary Arterial Hypertension in Rats

    PubMed Central

    Long, Mei; Wang, Jie; Liu, Fen; Gai, Min-Tao; Aierken, Alidan; Li, Ming-Yuan; Li, Qian; Wu, Lei-Qi; Ma, Yi-Tong; Hujiaaihemaiti, Minawaer

    2016-01-01

    Background Endoplasmic reticulum (ER) stress has been implicated in the pathophysiology of various pulmonary diseases via the activation of the unfolded protein response. However, the role of ER stress in pulmonary arterial hypertension (PAH) remains unclear. The well-known chemical chaperone 4-phenylbutyric acid (4-PBA) inhibits ER stress signaling. We hypothesized that known chemical chaperones, including 4-PBA, would inhibit the activation of ER stress and prevent and/or reverse PAH. Methods and Results Male Wistar rats were randomly divided into four groups: a normal control group (NORMAL group), a PAH group, and two PAH model plus 4-PBA treatment groups. The latter two groups included rats receiving 4-PBA by gavage each day as a preventive measure (the PRE group, with PBA starting on the day of PAH induction and continuing for 4 weeks) or as a reversal measure (the REV group, with PBA starting on the third week of PAH induction and continuing for 2 weeks). The PAH model was induced by intraperitoneally administering monocrotaline. The mean pulmonary artery pressure and mean right ventricular pressure were lower in the REV and PRE groups than in the NORMAL group. Furthermore, 4-PBA improved pulmonary arterial remodeling and suppressed the expression of ER stress indicators. Conclusion Our findings indicate that PAH induces ER stress and provokes pulmonary arterial and right ventricular remodeling. Additionally, we show that attenuation of ER stress has the potential to be an effective therapeutic strategy for protecting pulmonary arteries. PMID:27304885

  3. Ursodeoxycholic acid and 4-phenylbutyrate prevent endoplasmic reticulum stress-induced podocyte apoptosis in diabetic nephropathy.

    PubMed

    Cao, Ai-Li; Wang, Li; Chen, Xia; Wang, Yun-Man; Guo, Heng-Jiang; Chu, Shuang; Liu, Cheng; Zhang, Xue-Mei; Peng, Wen

    2016-06-01

    Endoplasmic reticulum (ER) stress, resulting from the accumulation of misfolded and/or unfolded proteins in ER membranes, is involved in the pathogenesis of diabetic nephropathy (DN). The aim of this study was to investigate the role of ER stress inhibitors ursodeoxycholic acid (UDCA) and 4-phenylbutyrate (4-PBA) in the treatment of DN in db/db mice. Findings have revealed that diabetic db/db mice were more hyperglycemic than their non-diabetic controls, and exhibited a marked increase in body weight, water intake, urine volume, fasting plasma glucose, systolic blood pressure, glucose and insulin tolerance. UDCA (40 mg/kg/day) or 4-PBA (100 mg/kg/day) treatment for 12 weeks resulted in an improvement in these biochemical and physical parameters. Moreover, UDCA or 4-PBA intervention markedly decreased urinary albuminuria and attenuated mesangial expansion in diabetic db/db mice, compared with db/db mice treated with vehicle. These beneficial effects of UDCA or 4-PBA on DN were associated with the inhibition of ER stress, as evidenced by the decreased expression of BiP, phospho-IRE1α, phospho-eIF2α, CHOP, ATF-6 and spliced X-box binding protein-1 in vitro and in vivo. UDCA or 4-PBA prevented hyperglycemia-induced or high glucose (HG)-induced apoptosis in podocytes in vivo and in vitro via the inhibition of caspase-3 and caspase-12 activation. Autophagy deficiency was also seen in glomeruli in diabetic mice and HG-incubated podocytes, exhibiting decreased expression of LC3B and Beclin-1, which could be restored by UDCA or 4-PBA treatment. Taken together, our results have revealed an important role of ER stress in the development of DN, and UDCA or 4-PBA treatment may be a potential novel therapeutic approach for the treatment of DN. PMID:26999661

  4. Evidence that Chemical Chaperone 4-Phenylbutyric Acid Binds to Human Serum Albumin at Fatty Acid Binding Sites

    PubMed Central

    James, Joel; Shihabudeen, Mohamed Sham; Kulshrestha, Shweta; Goel, Varun; Thirumurugan, Kavitha

    2015-01-01

    Endoplasmic reticulum stress elicits unfolded protein response to counteract the accumulating unfolded protein load inside a cell. The chemical chaperone, 4-Phenylbutyric acid (4-PBA) is a FDA approved drug that alleviates endoplasmic reticulum stress by assisting protein folding. It is found efficacious to augment pathological conditions like type 2 diabetes, obesity and neurodegeneration. This study explores the binding nature of 4-PBA with human serum albumin (HSA) through spectroscopic and molecular dynamics approaches, and the results show that 4-PBA has high binding specificity to Sudlow Site II (Fatty acid binding site 3, subdomain IIIA). Ligand displacement studies, RMSD stabilization profiles and MM-PBSA binding free energy calculation confirm the same. The binding constant as calculated from fluorescence spectroscopic studies was found to be kPBA = 2.69 x 105 M-1. Like long chain fatty acids, 4-PBA induces conformational changes on HSA as shown by circular dichroism, and it elicits stable binding at Sudlow Site II (fatty acid binding site 3) by forming strong hydrogen bonding and a salt bridge between domain II and III of HSA. This minimizes the fluctuation of HSA backbone as shown by limited conformational space occupancy in the principal component analysis. The overall hydrophobicity of W214 pocket (located at subdomain IIA), increases upon occupancy of 4-PBA at any FA site. Descriptors of this pocket formed by residues from other subdomains largely play a role in compensating the dynamic movement of W214. PMID:26181488

  5. Attenuation of endoplasmic reticulum stress using the chemical chaperone 4-phenylbutyric acid prevents cardiac fibrosis induced by isoproterenol.

    PubMed

    Ayala, Pedro; Montenegro, José; Vivar, Raúl; Letelier, Alan; Urroz, Pablo Aránguiz; Copaja, Miguel; Pivet, Deisy; Humeres, Claudio; Troncoso, Rodrigo; Vicencio, José Miguel; Lavandero, Sergio; Díaz-Araya, Guillermo

    2012-02-01

    Increasing evidence indicates that endoplasmic reticulum (ER) stress is involved in various diseases. In the human heart, ischemia/reperfusion has been correlated to ER stress, and several markers of the unfolded protein response (UPR) participate during cardiac remodeling and fibrosis. Here, we used isoproterenol (ISO) injection as a model for in vivo cardiac fibrosis. ISO induced significant cardiomyocyte loss and collagen deposition in the damaged areas of the endocardium. These responses were accompanied by an increase in the protein levels of the luminal ER chaperones BIP and PDI, as well as an increase in the UPR effector CHOP. The use of the chemical chaperone 4-phenylbutyric acid (4-PBA) prevented the activation of the UPR, the increase in luminal chaperones and also, leads to decreased collagen deposition, cardiomyocyte loss into the damaged zones. Our results suggest that cardiac damage and fibrosis induced in vivo by the beta-adrenergic agonist ISO are tightly related to ER stress signaling pathways, and that increasing the ER luminal folding capacity with exogenously administrated 4-PBA is a powerful strategy for preventing the development of cardiac fibrosis. Additionally, 4-PBA might prevent the loss of cardiomyocytes. Our data suggests that the attenuation of ER stress pathways with pharmacological compounds such as the chemical chaperone 4-PBA can prevent the development of cardiac fibrosis and adverse remodeling. PMID:22101259

  6. Effects of 4-phenylbutyric acid on the process and development of diabetic nephropathy induced in rats by streptozotocin: Regulation of endoplasmic reticulum stress-oxidative activation

    SciTech Connect

    Luo Zhifeng; Feng Bing; Mu Jiao; Qi Wei; Zeng Wei; Guo Yanhong; Pang Qi; Ye Zilin; Liu Li; Yuan Fahuan

    2010-07-15

    Oxidative stress may contribute to the pathogenesis of diabetic nephropathy (DN), although the precise regulatory mechanism is still unclear. Recent reports have shown that chemical molecular chaperone 4-phenylbutyric acid (4-PBA) can suppress oxidative stress by attenuating endoplasmic reticulum (ER) stress. We therefore hypothesized that 4-PBA could provide renoprotection through the suppression of oxidative stress in DN rats. Male Sprague-Dawley (SD) rats were randomly divided into three groups: a normal control (NC) group, a streptozotocin (STZ)-induced DN model group, and a DN plus 4-PBA (1 g/kg) treatment group. At the end of 4, 8, and 12 weeks, hydroxyproline content, NADPH oxidase activity and the expression of phosphorylation of inositol-requiring enzyme-1{alpha} (p-IRE1{alpha}), p47phox, nitrotyrosine (NT) and NF-E2-related factor 2 (Nrf2) in the kidneys of all rats were determined; malondialdehyde (MDA) levels and superoxide dismutase (SOD) activity in serum and urine were also detected; renal nuclear factor {kappa}B (NF-{kappa}B) activity in all of the rats was examined at the end of 12 weeks. Compared with the NC group, the DN rats showed a significant increase in hydroxyproline content, NADPH oxidase activity, NF-{kappa}B activity, the expression of p-IRE1{alpha}, p47phox, NT and Nrf2 in renal tissue; markedly, MDA levels were higher and SOD activity was lower in serum and urine of DN rats than in NC rats for the indicated time. These alterations were inhibited by the administration of 4-PBA. These findings first demonstrated that treatment with 4-PBA significantly inhibits the process and development of diabetic nephropathy in rats through the regulation of ER stress-oxidative activation.

  7. Amelioration of ER stress by 4-phenylbutyric acid reduces chronic hypoxia induced cardiac damage and improves hypoxic tolerance through upregulation of HIF-1α.

    PubMed

    Jain, Kanika; Suryakumar, Geetha; Ganju, Lilly; Singh, Shashi Bala

    2016-08-01

    While endoplasmic reticulum (ER) stress has been observed in several human diseases, few studies have reported the involvement of ER stress in chronic hypoxia (CH) induced cardiac damage. Hypoxia, such as that prevalent at high altitude (HA), forms the underlying cause of several maladies including cardiovascular diseases. While the role of hypoxia inducible factor-1 (HIF-1α) in the adaptive responses to hypoxia is known, the role of the unfolded protein response (UPR) is only recently being explored in the HA pathophysiologies. The present study investigates the effect of ER stress modulation on CH mediated injury and the cardioprotective action of 4-phenylbutyric acid (PBA) in enhancing survival response under hypoxia. Here, we observed that exposure of rats, for 1, 7 and 14days CH to a simulated altitude of 7620m, led to cardiac hypertrophy and significant protein oxidation. This induced the activation of UPR signaling mechanisms, mediated by PERK, IRE1α and ATF6. By 14days, there was a marked upregulation of apoptosis, evident in increased CHOP and caspase-3/9 activity. PBA reduced CH induced right ventricular enlargement and apoptosis. Further, in contrast to tunicamycin, PBA considerably enhanced hypoxic tolerance. An elevation in the level of antioxidant enzymes, HIF-1α and its regulated proteins (HO-1, GLUT-1) was observed in the PBA administered animals, along with a concomitant suppression of UPR markers. Our study thus emphasizes upon the attenuation of ER stress by PBA as a mechanism to diminish CH induced cardiac injury and boost hypoxic survival, providing an insight into the novel relationship between the HIF-1α and UPR under hypoxia. PMID:27058435

  8. 4-Phenylbutyric acid reduces mutant-TGFBIp levels and ER stress through activation of ERAD pathway in corneal fibroblasts of granular corneal dystrophy type 2.

    PubMed

    Choi, Seung-Il; Lee, Eunhee; Jeong, Jang Bin; Akuzum, Begum; Maeng, Yong-Sun; Kim, Tae-Im; Kim, Eung Kweon

    2016-09-01

    Granular corneal dystrophy type 2 (GCD2) is caused by a point mutation (R124H) in the transforming growth factor β-induced (TGFBI) gene. In GCD2 corneal fibroblasts, secretion of the accumulated mutant TGFBI-encoded protein (TGFBIp) is delayed via the endoplasmic reticulum (ER)/Golgi-dependent secretory pathway. However, ER stress as the pathogenic mechanism underlying GCD2 has not been fully characterized. The aim of this study was to confirm whether ER stress is linked to GCD2 pathogenesis and whether the chemical chaperone, 4-phenylbutyric acid (4-PBA), could be exploited as a therapy for GCD2. We found that the ER chaperone binding immunoglobulin protein (BiP) and the protein disulfide isomerase (PDI) were elevated in GCD2. Western bolt analysis also showed a significant increase in both the protein levels and the phosphorylation of the key ER stress kinases, inositol-requiring enzyme 1α (IRE1α) and double stranded RNA activated protein kinase (PKR)-like ER kinase, as well as in levels of their downstream targets, X box-binding protein 1 (XBP1) and activating transcription factor 4, respectively, in GCD2 corneal fibroblasts. GCD2 cells were found to be more susceptible to ER stress-induced cell death than were wild-type corneal fibroblasts. Treatment with 4-PBA considerably reduced the levels of BiP, IRE1α, and XBP1 in GCD2 cells; notably, 4-PBA treatment significantly reduced the levels of TGFBIp without change in TGFBI mRNA levels. In addition, TGFBIp levels were significantly reduced under ER stress and this reduction was considerably suppressed by the ubiquitin proteasome inhibitor MG132, indicating TGFBIp degradation via the ER-associated degradation pathway. Treatment with 4-PBA not only protected against the GCD2 cell death induced by ER stress but also significantly suppressed the MG132-mediated increase in TGFBIp levels under ER stress. Together, these results suggest that ER stress might comprise an important factor in GCD2 pathophysiology and

  9. Improvement of mTORC1-driven overproduction of apoB-containing triacylglyceride-rich lipoproteins by short-chain fatty acids, 4-phenylbutyric acid and (R)-α-lipoic acid, in human hepatocellular carcinoma cells.

    PubMed

    Roberts, Joseph L; He, Bo; Erickson, Anjeza; Moreau, Régis

    2016-03-01

    The activation of hepatic kinase mechanistic target of rapamycin complex 1 (mTORC1) is implicated in the development of obesity-related metabolic disorders. This study investigated the metabolic sequelae of mTORC1 hyperactivation in human hepatoma cells and the lipid-regulating mechanisms of two short-chain fatty acids: 4-phenylbutyric acid (PBA) and (R)-α-lipoic acid (LA). We created three stable cell lines that exhibit low, normal, or high mTORC1 activity. mTORC1 hyperactivation induced the expression of lipogenic (DGAT1 and DGAT2) and lipoprotein assembly (MTP and APOB) genes, thereby raising cellular triacylglyceride (TG) and exacerbating secretion of apoB-containing TG-rich lipoproteins. LYS6K2, a specific inhibitor of the p70 S6 kinase branch of mTORC1 signaling, reversed these effects. PBA and LA decreased secreted TG through distinct mechanisms. PBA repressed apoB expression (both mRNA and protein) and lowered secreted TG without mitigation of mTORC1 hyperactivity or activation of AMPK. LA decreased cellular and secreted TG by attenuating mTORC1 signaling in an AMPK-independent manner. LA did not regulate apoB expression but led to the secretion of apoB-containing TG-poor lipoproteins by repressing the expression of lipogenic genes, FASN, DGAT1, and DGAT2. Our studies provide new mechanistic insight into the hypolipidemic activity of PBA and LA in the context of mTORC1 hyperactivation and suggest that the short-chain fatty acids may aid in the prevention and treatment of hypertriglyceridemia. PMID:26680362

  10. Transformation of microcystins to 2-methyl-3-methoxy-4-phenylbutyric acid by room temperature ozone oxidation for rapid quantification of total microcystins.

    PubMed

    Zhang, L L; Yu, R P; Wang, L P; Wu, S F; Song, Q J

    2016-04-20

    Microcystins (MCs) are cyanobacterial hepatotoxins capable of accumulation into animal tissues. To determine the total microcystins in water, a novel analytical method, including ozonolysis, methylation of 2-methyl-3-methoxy-4-phenylbutyric acid (MMPB) with methylchloroformate (MCF) and gas chromatography mass spectrometry (GC-MS) detection was developed. The results show that MCs can be oxidized by ozone to produce MMPB at ambient temperature, proving ozonation is an effective, rapid and green method for the transformation of MCs to MMPB without secondary pollution. The oxidation conditions as well as the esterification process were optimized and, subsequently applied to analysis of environmental samples. The method shows wide linear range and high sensitivity with a detection limit of 0.34 μg L(-1). The established method was successfully applied to the analysis of microcystins in water samples. PMID:26975781

  11. 4-Phenylbutyrate protects rat skin flaps against ischemia-reperfusion injury and apoptosis by inhibiting endoplasmic reticulum stress

    PubMed Central

    YUE, ZHEN-SHUANG; ZENG, LIN-RU; QUAN, REN-FU; TANG, YANG-HUA; ZHENG, WEN-JIE; QU, GANG; XU, CAN-DA; ZHU, FANG-BING; HUANG, ZHONG-MING

    2016-01-01

    4-phenylbutyrate (4-PBA) is a low molecular weight fatty acid, which has been demonstrated to regulate endoplasmic reticulum (ER) stress. ER stress-induced cell apoptosis has an important role in skin flap ischemia; however, a pharmacological approach for treating ischemia-induced ER dysfunction has yet to be reported. In the present study, the effects of 4-PBA-induced ER stress inhibition on ischemia-reperfusion injury were investigated in the skin flap of rats, and transcriptional regulation was examined. 4-PBA attenuated ischemia-reperfusion injury and inhibited cell apoptosis in the skin flap. Furthermore, 4-PBA reversed the increased expression levels of two ER stress markers: CCAAT/enhancer-binding protein-homologous protein and glucose-regulated protein 78. These results suggested that 4-PBA was able to protect rat skin flaps against ischemia-reperfusion injury and apoptosis by inhibiting ER stress marker expression and ER stress-mediated apoptosis. The beneficial effects of 4-PBA may prove useful in the treatment of skin flap ischemia-reperfusion injury. PMID:26648447

  12. Catabolism of Arylboronic Acids by Arthrobacter nicotinovorans Strain PBA

    PubMed Central

    Negrete-Raymond, Ana C.; Weder, Barbara; Wackett, Lawrence P.

    2003-01-01

    Arthrobacter sp. strain PBA metabolized phenylboronic acid to phenol. The oxygen atom in phenol was shown to be derived from the atmosphere using 18O2. 1-Naphthalene-, 2-naphthalene-, 3-cyanophenyl-, 2,5-fluorophenyl-, and 3-thiophene-boronic acids were also transformed to monooxygenated products. The oxygen atom in the product was bonded to the ring carbon atom originally bearing the boronic acid substituent with all the substrates tested. PMID:12839810

  13. pH- and sugar-sensitive multilayer films composed of phenylboronic acid (PBA)-modified poly(allylamine hydrochloride) (PBA-PAH) and poly(vinyl alcohol) (PVA): A significant effect of PBA content on the film stability.

    PubMed

    Seno, Masaru; Yoshida, Kentaro; Sato, Katsuhiko; Anzai, Jun-Ichi

    2016-05-01

    Multilayer thin films composed of phenylboronic acid (PBA)-modified poly(allylamine hydrochloride) (PAH), PBA-PAH, with different PBA contents were prepared to study the effect of PBA content on the stability of the films. An alternate deposition of PBA-PAH and poly(vinyl alcohol) (PVA) on the surface of a quartz slide afforded multilayer films through forming boronate ester bonds between PBA-PAH and PVA. The 10-layered (PBA-PAH/PVA)10 films constructed using PBA-PAHs containing 16% and 26% PBA residues were stable in aqueous solutions over the range of pH4.0-10.0, whereas the multilayer films composed of PBA-PAHs with 5.9% and 8.3% PBA decomposed at pH8.0 or lower. The pH-sensitive decomposition of the films was rationalized based on the destabilization of the boronate ester bonds in neutral and acidic solutions. In addition, the (PBA-PAH/PVA)10 films decomposed in glucose and fructose solutions as a result of competitive binding of sugars to PBA-PAH in the films. The sugar response of the films depended on the PBA content in PBA-PAH. The (PBA-PAH/PVA)10 films consisting of 16% and 26% PBA-substituted PBA-PAHs are sensitive to physiological relevant level of glucose at pH7.4 while stable in glucose-free solution, suggesting a potential use of the films in constructing glucose-induced delivery systems. PMID:26952449

  14. Potentiometric and NMR complexation studies of phenylboronic acid PBA and its aminophosphonate analog with selected catecholamines

    NASA Astrophysics Data System (ADS)

    Ptak, Tomasz; Młynarz, Piotr; Dobosz, Agnieszka; Rydzewska, Agata; Prokopowicz, Monika

    2013-05-01

    Boronic acids are a class of intensively explored compounds, which according to their specific properties have been intensively explored in last decades. Among them phenylboronic acids and their derivatives are most frequently examined as receptors for diverse carbohydrates. In turn, there is a large gap in basic research concerning complexation of catecholamines by these compounds. Therefore, we decided to undertake studies on interaction of chosen catecholamines, namely: noradrenaline (norephinephrine), dopamine, L-DOPA, DOPA-P (phosphonic analog of L-DOPA) and catechol, with simple phenyl boronic acid PBA by means of potentiometry and NMR spectroscopy. For comparison, the binding properties of recently synthesized phenylboronic receptor 1 bearing aminophosphonate function in meta-position were investigated and showed promising ability to bind catecholamines. The protonation and stability constants of PBA and receptor 1 complexes were examined by potentiometry. The obtained results demonstrated that PBA binds the catecholamines with the following affinity order: noradrenaline ⩾ dopamine ≈ L-DOPA > catechol > DOPA-P, while its modified analog 1 reveals slightly different preferences: dopamine > noradrenaline > catechol > L-DOPA > DOPA-P.

  15. 4-Phenylbutyrate Attenuates the ER Stress Response and Cyclic AMP Accumulation in DYT1 Dystonia Cell Models

    PubMed Central

    Cho, Jin A.; Zhang, Xuan; Miller, Gregory M.; Lencer, Wayne I.; Nery, Flavia C.

    2014-01-01

    Dystonia is a neurological disorder in which sustained muscle contractions induce twisting and repetitive movements or abnormal posturing. DYT1 early-onset primary dystonia is the most common form of hereditary dystonia and is caused by deletion of a glutamic acid residue (302/303) near the carboxyl-terminus of encoded torsinA. TorsinA is localized primarily within the contiguous lumen of the endoplasmic reticulum (ER) and nuclear envelope (NE), and is hypothesized to function as a molecular chaperone and an important regulator of the ER stress-signaling pathway, but how the mutation in torsinA causes disease remains unclear. Multiple lines of evidence suggest that the clinical symptoms of dystonia result from abnormalities in dopamine (DA) signaling, and possibly involving its down-stream effector adenylate cyclase that produces the second messenger cyclic adenosine-3′, 5′-monophosphate (cAMP). Here we find that mutation in torsinA induces ER stress, and inhibits the cyclic adenosine-3′, 5′-monophosphate (cAMP) response to the adenylate cyclase agonist forskolin. Both defective mechanins are corrected by the small molecule 4-phenylbutyrate (4-PBA) that alleviates ER stress. Our results link torsinA, the ER-stress-response, and cAMP-dependent signaling, and suggest 4-PBA could also be used in dystonia treatment. Other pharmacological agents known to modulate the cAMP cascade, and ER stress may also be therapeutic in dystonia patients and can be tested in the models described here, thus supplementing current efforts centered on the dopamine pathway. PMID:25379658

  16. 4-PBA prevents pressure overload-induced myocardial hypertrophy and interstitial fibrosis by attenuating endoplasmic reticulum stress.

    PubMed

    Luo, Tao; Chen, Baihe; Wang, Xianbao

    2015-12-01

    Our previous study indicated that attenuation of endoplasmic reticulum (ER) stress by administration of 4-phenylbutyric acid (4-PBA) could prevent cardiac rupture and remodeling in a mouse model of myocardial infarction (MI). However, whether 4-PBA is protective in hypertrophic heart disease is unclear. Thus, we tested the therapeutic effect of 4-PBA on pressure-overload induced myocardial hypertrophy. Transverse aortic constriction (TAC) was used to create myocardial hypertrophy in C57BL/6 male mice for 4 weeks. Immediately after surgery, the mice were administrated either 4-PBA (20 mg/kg/day) or 0.9% NaCl by intraperitoneal injection. At the end of 4 weeks, the mice underwent high-resolution echocardiographic imaging. Our results showed that both the left ventricular posterior wall thickness at end systole (LVPWs) and diastole (LVPWd) were increased in the TAC group, compared to control. 4-PBA administration attenuated hypertrophy and decreased the heart weight over body weight ratio. Masson's trichrome staining showed that myocardial interstitial fibrosis and collagen deposition were also decreased by 4-PBA. We next detected the ER stress response in the heart tissues of TAC mice in different time points. Western blotting showed that the expression of ER stress marker, GRP78, CHOP and phosphor-PERK, were persistently increased 4 weeks after TAC. The treatment of 4-PBA inhibited the expression of ER stress markers. We also demonstrated that the 4-PBA at 20 mg/kg/day had no effect on histone 3 deacetylation inhibition, while attenuating ER stress and TAC-induced hypertrophy. These findings suggest that 4-PBA may be a therapeutic strategy to consider in preventing pressure-overload induced myocardial hypertrophy and interstitial fibrosis by selectively attenuating ER stress. PMID:26428355

  17. Chemical chaperon 4-phenylbutyrate protects against the endoplasmic reticulum stress-mediated renal fibrosis in vivo and in vitro.

    PubMed

    Liu, Shing-Hwa; Yang, Ching-Chin; Chan, Ding-Cheng; Wu, Cheng-Tien; Chen, Li-Ping; Huang, Jenq-Wen; Hung, Kuan-Yu; Chiang, Chih-Kang

    2016-04-19

    Renal tubulointerstitial fibrosis is the common and final pathologic change of kidney in end-stage renal disease. Interesting, endoplasmic reticulum (ER) stress is known to contribute to the pathophysiological mechanisms during the development of renal fibrosis. Here, we investigated the effects of chemical chaperon sodium 4-phenylbutyrate (4-PBA) on renal fibrosis in vivo and in vitro. In a rat unilateral ureteral obstruction (UUO) model, 4-PBA mimicked endogenous ER chaperon in the kidneys and significantly reduced glucose regulated protein 78 (GRP78), CCAAT/enhancer binding protein (C/EBP) homologous protein (CHOP), activating transcription factor 4 (ATF4), and phosphorylated JNK protein expressions as well as restored spliced X-box-binding protein 1 (XBP1) expressions in the kidneys of UUO rats. 4-PBA also attenuated the increases of α-smooth muscle actin (α-SMA), connective tissue growth factor (CTGF) protein expressions, tubulointerstitial fibrosis, and apoptosis in the kidneys of UUO rats. Moreover, transforming growth factor (TGF)-β markedly increased ER stress-associated molecules, profibrotic factors, and apoptotic markers in the renal tubular cells (NRK-52E), all of which could be significantly counteracted by 4-PBA treatment. 4-PBA also diminished TGF-β-increased CTGF promoter activity and CTGF mRNA expression in NRK-52E cells. Taken together, our results indicated that 4-PBA acts as an ER chaperone to ameliorate ER stress-induced renal tubular cell apoptosis and renal fibrosis. PMID:26959118

  18. Chemical chaperon 4-phenylbutyrate protects against the endoplasmic reticulum stress-mediated renal fibrosis in vivo and in vitro

    PubMed Central

    Wu, Cheng-Tien; Chen, Li-Ping; Huang, Jenq-Wen; Hung, Kuan-Yu; Chiang, Chih-Kang

    2016-01-01

    Renal tubulointerstitial fibrosis is the common and final pathologic change of kidney in end-stage renal disease. Interesting, endoplasmic reticulum (ER) stress is known to contribute to the pathophysiological mechanisms during the development of renal fibrosis. Here, we investigated the effects of chemical chaperon sodium 4-phenylbutyrate (4-PBA) on renal fibrosis in vivo and in vitro. In a rat unilateral ureteral obstruction (UUO) model, 4-PBA mimicked endogenous ER chaperon in the kidneys and significantly reduced glucose regulated protein 78 (GRP78), CCAAT/enhancer binding protein (C/EBP) homologous protein (CHOP), activating transcription factor 4 (ATF4), and phosphorylated JNK protein expressions as well as restored spliced X-box-binding protein 1 (XBP1) expressions in the kidneys of UUO rats. 4-PBA also attenuated the increases of α-smooth muscle actin (α-SMA), connective tissue growth factor (CTGF) protein expressions, tubulointerstitial fibrosis, and apoptosis in the kidneys of UUO rats. Moreover, transforming growth factor (TGF)-β markedly increased ER stress-associated molecules, profibrotic factors, and apoptotic markers in the renal tubular cells (NRK-52E), all of which could be significantly counteracted by 4-PBA treatment. 4-PBA also diminished TGF-β-increased CTGF promoter activity and CTGF mRNA expression in NRK-52E cells. Taken together, our results indicated that 4-PBA acts as an ER chaperone to ameliorate ER stress-induced renal tubular cell apoptosis and renal fibrosis. PMID:26959118

  19. Protection afforded by pre- or post-treatment with 4-phenylbutyrate against liver injury induced by acetaminophen overdose in mice.

    PubMed

    Shimizu, Daisuke; Ishitsuka, Yoichi; Miyata, Keishi; Tomishima, Yoshiro; Kondo, Yuki; Irikura, Mitsuru; Iwawaki, Takao; Oike, Yuichi; Irie, Tetsumi

    2014-09-01

    Acetaminophen (paracetamol, N-acetyl-p-aminophenol; APAP) is a widely used analgesic/antipyretic drug with few adverse effects at therapeutic doses; suicidal or unintentional overdose of APAP frequently induces severe hepatotoxicity. To explore a new and effective antidote for APAP hepatotoxicity, this study examined the effects of sodium 4-phenylbutyrate (4-PBA) on liver injury induced by APAP overdose in mice. Liver injury was induced in C57BL/6 male mice by intraperitoneal injection of APAP (400mg/kg). The effects of 4-PBA (100-200mg/kg) treatment at 1h before the APAP injection were evaluated with serum alanine aminotransferase (ALT) and blood ammonia levels, hepatic pathological changes, including histopathology, DNA damage, nitrotyrosine formation, and mRNA or protein expression involved in the development of hepatotoxicity, such as X-box binding protein-1 (XBP1), c-Jun N-terminal kinase (JNK), C/EBP homologous protein (CHOP) and B-cell lymphoma 2 interacting mediator of cell death (Bim). In addition, glutathione depletion and CYP2E1 protein expression, which are measures of the metabolic conversion of APAP to a toxic metabolite, were examined. Furthermore, we examined the effects of post-treatment with 4-PBA against APAP-induced hepatotoxicity in mice. When administered at 1h before APAP injection, 4-PBA significantly prevented the increase in serum ALT and blood ammonia levels, centrilobular necrosis of hepatocytes, DNA fragmentation, and nitrotyrosine formation induced by APAP in mice. 4-PBA also inhibited hepatic Xbp1 mRNA splicing and JNK phosphorylation induced by APAP, but did not suppress CHOP and Bim mRNA and protein expression. In addition, 4-PBA had little effect on hepatic glutathione depletion and CYP2E1 expression, parameters of toxic APAP metabolite production. Post-treatment with 4-PBA administration at 1 or 2h after APAP injection also attenuated the increase in serum ALT and blood ammonia levels and hepatic pathological changes in APAP

  20. Retinal ischemic injury rescued by sodium 4-phenylbutyrate in a rat model.

    PubMed

    Jeng, Yung-Yue; Lin, Nien-Ting; Chang, Pen-Heng; Huang, Yuan-Ping; Pang, Victor Fei; Liu, Chen-Hsuan; Lin, Chung-Tien

    2007-03-01

    Retinal ischemia is a common cause of visual impairment for humans and animals. Herein, the neuroprotective effects of phenylbutyrate (PBA) upon retinal ischemic injury were investigated using a rat model. Retinal ganglion cells (RGCs) were retrograde labeled with the fluorescent tracer fluorogold (FG) applied to the superior collicoli of test Sprague-Dawley rats. High intraocular pressure and retinal ischemia were induced seven days subsequent to such FG labeling. A dose of either 100 or 400 mg/kg PBA was administered intraperitoneally to test rats at two time points, namely 30 min prior to the induction of retinal ischemia and 1 h subsequent to the cessation of the procedure inducing retinal ischemia. The test-rat retinas were collected seven days subsequent to the induction of retinal ischemia, and densities of surviving RGCs were estimated by counting FG-labeled RGCs within the retina. Histological analysis revealed that ischemic injury caused the loss of retinal RGCs and a net decrease in retinal thickness. For PBA-treated groups, almost 100% of the RGCs were preserved by a pre-ischemia treatment with PBA (at a dose of either 100 or 400 mg/kg), while post-ischemia treatment of RGCs with PBA did not lead to the preservation of RGCs from ischemic injury by PBA as determined by the counting of whole-mount retinas. Pre-ischemia treatment of RGCs with PBA (at a dose of either 100 or 400 mg/kg) significantly reduced the level of ischemia-associated loss of thickness of the total retina, especially the inner retina, and the inner plexiform layer of retina. Besides, PBA treatment significantly reduced the ischemia-induced loss of cells in the ganglion-cell layer of the retina. Taken together, these results suggest that PBA demonstrates a marked neuroprotective effect upon high intraocular pressure-induced retinal ischemia when the PBA is administered prior to ischemia induction. PMID:17178414

  1. Phenylbutyric acid induces the cellular senescence through an Akt/p21{sup WAF1} signaling pathway

    SciTech Connect

    Kim, Hag Dong; Jang, Chang-Young; Choe, Jeong Min; Sohn, Jeongwon; Kim, Joon

    2012-06-01

    Highlights: Black-Right-Pointing-Pointer Phenylbutyric acid induces cellular senescence. Black-Right-Pointing-Pointer Phenylbutyric acid activates Akt kinase. Black-Right-Pointing-Pointer The knockdown of PERK also can induce cellular senescence. Black-Right-Pointing-Pointer Akt/p21{sup WAF1} pathway activates in PERK knockdown induced cellular senescence. -- Abstract: It has been well known that three sentinel proteins - PERK, ATF6 and IRE1 - initiate the unfolded protein response (UPR) in the presence of misfolded or unfolded proteins in the ER. Recent studies have demonstrated that upregulation of UPR in cancer cells is required to survive and proliferate. Here, we showed that long exposure to 4-phenylbutyric acid (PBA), a chemical chaperone that can reduce retention of unfolded and misfolded proteins in ER, induced cellular senescence in cancer cells such as MCF7 and HT1080. In addition, we found that treatment with PBA activates Akt, which results in p21{sup WAF1} induction. Interestingly, the depletion of PERK but not ATF6 and IRE1 also induces cellular senescence, which was rescued by additional depletion of Akt. This suggests that Akt pathway is downstream of PERK in PBA induced cellular senescence. Taken together, these results show that PBA induces cellular senescence via activation of the Akt/p21{sup WAF1} pathway by PERK inhibition.

  2. Enhanced effects by 4-phenylbutyrate in combination with RTK inhibitors on proliferation in brain tumor cell models

    SciTech Connect

    Marino, Ana-Maria; Sofiadis, Anastasios; Baryawno, Ninib; Johnsen, John Inge; Larsson, Catharina; Vukojevic, Vladana; Ekstroem, Tomas J.

    2011-07-22

    Highlights: {yields} The histone deacetylase inhibitor 4-phenylbutyrate substantially enhance efficacy of the receptor tyrosine kinase inhibitors gefitinib or vandetanib in glioma and medulloblastoma cell lines. {yields} Cell death increases and clonogenic survival is reduced in the combination treatments, over mono-therapy. {yields} Combination treatments with these drugs may improve clinical outcome for cancer therapy. -- Abstract: We have investigated in vitro effects of anticancer therapy with the histone deacetylase inhibitor (HDACi) 4-phenylbutyrate (4-PB) combined with receptor tyrosine kinase inhibitors (RTKi) gefitinib or vandetanib on the survival of glioblastoma (U343MGa) and medulloblastoma (D324Med) cells. In comparison with individual effects of these drugs, combined treatment with gefitinib/4-PB or vandetanib/4-PB resulted in enhanced cell killing and reduced clonogenic survival in both cell lines. Our results suggest that combined treatment using HDACi and RTKi may beneficially affect the outcome of cancer therapy.

  3. Intractable itch relieved by 4-phenylbutyrate therapy in patients with progressive familial intrahepatic cholestasis type 1

    PubMed Central

    2014-01-01

    Background Progressive familial intrahepatic cholestasis type 1 (PFIC1), an inherited liver disease caused by mutations in ATP8B1, progresses to severe cholestasis with a sustained intractable itch. Currently, no effective therapy has been established for PFIC1. Decreased function of the bile salt export pump (BSEP) in hepatocytes is suggested to be responsible for the severe cholestasis observed in PFIC1. We found a previously unidentified pharmacological effect of 4-phenylbutyrate (4PB) that increases the expression and function of BSEP. Here, we tested 4PB therapy in three patients with PFIC1. Methods The therapeutic potency of 4PB in these patients was tested by oral administration of this drug with gradually increasing dosage (200, 350, and 500 mg/kg/day) for 6 months. Biochemical, histological, and clinical data were collected. Results 4PB therapy had no beneficial effect on the patients’ liver functions, as assessed by biochemical and histological analyses, despite an increase in hepatic BSEP expression. However, therapy with 4PB at a dosage of 350 or 500 mg/kg/day significantly relieved the intractable itch. Serum levels of potential pruritogens in cholestasis were much higher than the reference ranges during the 4PB therapy. Conclusions 4PB therapy may be a new medication for patients with intractable cholestatic pruritus and may improve quality of life for patients and their families. PMID:25022842

  4. Chemical Analysis and Aqueous Solution Properties of Charged Amphiphilic Block Copolymers PBA-b-PAA Synthesized by MADIX

    SciTech Connect

    Jacquin,M.; Muller, P.; Talingting-Pabalan, R.; Cottet, H.; Berret, J.; Futterer, T.; Theodoly, O.

    2007-01-01

    We have linked the structural and dynamic properties in aqueous solution of amphiphilic charged diblock copolymers poly(butyl acrylate)-b-poly(acrylic acid), PBA-b-PAA, synthesized by controlled radical polymerization, with the physico-chemical characteristics of the samples. Despite product imperfections, the samples self-assemble in melt and aqueous solutions as predicted by monodisperse microphase separation theory. However, the PBA core are abnormally large; the swelling of PBA cores is not due to AA (the Flory parameter ?PBA/PAA, determined at 0.25, means strong segregation), but to h-PBA homopolymers (content determined by liquid chromatography at the point of exclusion and adsorption transition, LC-PEAT). Beside the dominant population of micelles detected by scattering experiments, capillary electrophoresis CE analysis permitted detection of two other populations, one of h-PAA, and the other of free PBA-b-PAA chains, that have very short PBA blocks and never self-assemble. Despite the presence of these free unimers, the self-assembly in solution was found out of equilibrium: the aggregation state is history dependant and no unimer exchange between micelles occurs over months (time-evolution SANS). The high PBA/water interfacial tension, measured at 20 mN/m, prohibits unimer exchange between micelles. PBA-b-PAA solution systems are neither at thermal equilibrium nor completely frozen systems: internal fractionation of individual aggregates can occur.

  5. PbaR, an IclR family transcriptional activator for the regulation of the 3-phenoxybenzoate 1',2'-dioxygenase gene cluster in Sphingobium wenxiniae JZ-1T.

    PubMed

    Cheng, Minggen; Chen, Kai; Guo, Suhui; Huang, Xing; He, Jian; Li, Shunpeng; Jiang, Jiandong

    2015-12-01

    The 3-phenoxybenzoate (3-PBA) 1',2'-dioxygenase gene cluster (pbaA1A2B cluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed in Sphingobium wenxiniae strain JZ-1(T) by its substrate 3-PBA. In this study, we identified a transcriptional activator of the pbaA1A2B cluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 in Sphingomonas sp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of the pbaA1A2B cluster in response to 3-PBA in strain JZ-1(T). However, PbaR does not regulate the reductase component gene pbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in the pbaA1A2B promoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the -10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1(T), and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators. PMID:26386050

  6. PbaR, an IclR Family Transcriptional Activator for the Regulation of the 3-Phenoxybenzoate 1′,2′-Dioxygenase Gene Cluster in Sphingobium wenxiniae JZ-1T

    PubMed Central

    Cheng, Minggen; Chen, Kai; Guo, Suhui; Huang, Xing; He, Jian; Li, Shunpeng

    2015-01-01

    The 3-phenoxybenzoate (3-PBA) 1′,2′-dioxygenase gene cluster (pbaA1A2B cluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed in Sphingobium wenxiniae strain JZ-1T by its substrate 3-PBA. In this study, we identified a transcriptional activator of the pbaA1A2B cluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 in Sphingomonas sp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of the pbaA1A2B cluster in response to 3-PBA in strain JZ-1T. However, PbaR does not regulate the reductase component gene pbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in the pbaA1A2B promoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the −10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1T, and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators. PMID:26386050

  7. Docosahexaenoic Acid Ameliorates Fructose-Induced Hepatic Steatosis Involving ER Stress Response in Primary Mouse Hepatocytes

    PubMed Central

    Zheng, Jinying; Peng, Chuan; Ai, Yanbiao; Wang, Heng; Xiao, Xiaoqiu; Li, Jibin

    2016-01-01

    The increase in fructose consumption is considered to be a risk factor for developing nonalcoholic fatty liver disease (NAFLD). We investigated the effects of docosahexaenoic acid (DHA) on hepatic lipid metabolism in fructose-treated primary mouse hepatocytes, and the changes of Endoplasmic reticulum (ER) stress pathways in response to DHA treatment. The hepatocytes were treated with fructose, DHA, fructose plus DHA, tunicamycin (TM) or fructose plus 4-phenylbutyric acid (PBA) for 24 h. Intracellular triglyceride (TG) accumulation was assessed by Oil Red O staining. The mRNA expression levels and protein levels related to lipid metabolism and ER stress response were determined by real-time PCR and Western blot. Fructose treatment led to obvious TG accumulation in primary hepatocytes through increasing expression of fatty acid synthase (FAS) and acetyl-CoA carboxylase (ACC), two key enzymes in hepatic de novo lipogenesis. DHA ameliorates fructose-induced TG accumulation by upregulating the expression of carnitine palmitoyltransferase 1A (CPT-1α) and acyl-CoA oxidase 1 (ACOX1). DHA treatment or pretreatment with the ER stress inhibitor PBA significantly decreased TG accumulation and reduced the expression of glucose-regulated protein 78 (GRP78), total inositol-requiring kinase 1 (IRE1α) and p-IRE1α. The present results suggest that DHA protects against high fructose-induced hepatocellular lipid accumulation. The current findings also suggest that alleviating the ER stress response seems to play a role in the prevention of fructose-induced hepatic steatosis by DHA. PMID:26805874

  8. Development and study the performance of PBA cladding modified fiber optic intrinsic biosensor for urea detection

    NASA Astrophysics Data System (ADS)

    Botewad, S. N.; Pahurkar, V. G.; Muley, G. G.

    2016-05-01

    The fabrication and study of a cladding modified fiber optic intrinsic urea biosensor based on evanescent wave absorbance has been presented. The sensor was prepared using cladding modification technique by removing a small portion of cladding of an optical fiber and modifying with an active cladding of porous polyaniline-boric acid (PBA) matrix to immobilize enzyme-urease through cross-linking via glutaraldehyde. The nature of as-synthesized and deposited PBA film on fiber optic sensing element was studied by ultraviolet-visible (UV-vis) spectroscopy and X-ray diffraction (XRD) analysis. The performance of the developed sensor was studied for different urea concentrations in solutions prepared in phosphate buffer.

  9. Characterising coarse PBA dynamics in real-time above and below a tropical rainforest canopy using a dual channel UV fluorescence aerosol spectrometer.

    NASA Astrophysics Data System (ADS)

    Gabey, A.; Gallagher, M. W.; Burgess, R.; Coe, H.; McFiggans, G.,; Kaye, P. H.; Stanley, W. R.; Davies, F.; Foot, V. E.

    2009-04-01

    single-particle dual channel UV fluorescence spectrometer (Kaye et al., 2008) capable of detecting PBA by inducing fluorescence in two so-called biofluorophores - one present during metabolism and the other an amino acid - in the particle size range 1 m < Dp < 20 m. Real-time PBA measurements were performed above and below the canopy of a tropical rainforest in Borneo, Malaysia as part of the Oxidant and Particle Photochemical Processes (OP3) and the Aerosol Coupling in the Earth System (ACES) projects. PBA were found to dominate the coarse loading at Dp > 2 m. In qualitative agreement with measurements of culturable airborne material in a tropical forest's understory (Gilbert, 2005) a diurnal cycle of PBA number concentration is present, reaching a maximum of ~4000 l-1 at local midnight and falling to ~100 l-1 around midday. The role of the planetary boundary layer's collapse and re-establishment in dictating this variation in is also investigated using LIDAR data. Transient PBA concentration spikes lasting several minutes are superposed on the smooth underlying diurnal variation and occur at similar times each day. Nucleopore filter samples were also taken in-situ and analysed under an Environmental scanning electron microscope (ESEM) in Manchester. The images obtained showed the PBA fraction to be dominated by fungal spores of diameter 2-5 m, from various species including ABM. Since such species tend to release spores in bursts at regular times this appears to account for the PBA concentration spikes.

  10. PBA regulates neurogenesis and cognition dysfunction after repeated electroconvulsive shock in a rat model.

    PubMed

    Yao, Zhao-Hui; Kang, Xiang; Yang, Liu; Niu, Yi; Lu, Ye; Nie, Li

    2015-12-15

    Electroconvulsive therapy (ECT) was widely used to treat the refractory depression. But ECT led to the cognitive deficits plaguing the depression patients. The underlying mechanisms of the cognitive deficits remain elusive. Repeated electroconvulsive shock (rECS) was used to simulate ECT and explore the mechanisms of ECT during the animal studies. Previous studies showed rECS could lead to neurogenesis and cognitive impairment. But it was well known that neurogenesis could improve the cognition. So these suggested that the mechanism of the cognitive deficit after rECS was very complex. In present study, we explored the probable mechanisms of the cognitive deficit after rECS from neurogenesis aspect. We found the cognitive deficit was reversible and neurogenesis could bring a long-term beneficial effect on cognition. Astrogliosis and NR1 down-regulation probably participated in the reversible cognitive deficits after rECS. Phenylbutyric acid (PBA), generally as an agent to investigate the roles of histone acetylation, could prevent the reversible cognitive dysfunction, but PBA could diminish the long-term effect of enhanced cognition by rECS. These suggested that ECT could possibly bring the long-term beneficial cognitive effect by regulating neurogenesis. PMID:26381183

  11. Uric acid enhances PKC-dependent eNOS phosphorylation and mediates cellular ER stress: A mechanism for uric acid-induced endothelial dysfunction

    PubMed Central

    LI, PENG; ZHANG, LINA; ZHANG, MEI; ZHOU, CHANGYONG; LIN, NAN

    2016-01-01

    The mechanism by which hyperuricemia induced-endothelial dysfunction contributes to cardiovascular diseases (CVDs) is not yet fully understood. In the present study, we used uric acid (UA) to trigger endothelial dysfunction in cultured endothelial cells, and investigated the effects of induced reactive oxygen species (ROS) generation, endoplasmic reticulum (ER) stress induction, and the protein kinase C (PKC)-dependent endothelial nitric oxide synthase (eNOS) signaling pathway. Human umbilical vein endothelial cells (HUVECs) were incubated with 6, 9 or 12 mg/dl UA, ROS scavenger polyethylene glycol-superoxide dismutase (PEG-SOD), ER stress inhibitor 4-phenylbutyric acid (4-PBA), and PKC inhibitor polymyxin B for 6–48 h. Nitric oxide (NO) production, eNOS activity, intracellular ROS, ER stress levels, and the interaction between eNOS and calmodulin (CaM) and cytosolic calcium levels were assessed using fluorescence microscopy and western blot analysis. Apoptosis was assessed by annexin V staining. UA increased HUVEC apoptosis and reduced eNOS activity and NO production in a dose- and time-dependent manner. Intracellular ROS was elevated after 3 h, while ER stress level increased after 6 h. UA did not alter intracellular Ca2+, CaM, or eNOS concentration, or eNOS Ser1177 phosphorylation. However, PKC-dependent eNOS phosphorylation at Thr495 was greatly enhanced, and consequently interaction between eNOS and CaM was reduced. Cellular ROS depletion, ER stress inhibition and PKC activity reduction inhibited the effect of UA on eNOS activity, NO release and apoptosis in HUVECs. Thus, we concluded that UA induced HUVEC apoptosis and endothelial dysfunction by triggering oxidative and ER stress through PKC/eNOS-mediated eNOS activity and NO production. PMID:26935704

  12. [Microbial degradation of 3-phenoxybenzoic acid--A review].

    PubMed

    Deng, Weiqin; Liu, Shuliang; Yao, Kai

    2015-09-01

    3-phenoxybenzoic acid (3-PBA) with estrogen toxicity is one of the intermediate products of most pyrethroid pesticides. 3-PBA is difficult to degrade in the natural environment, and threatens food safety and human health. Microbial degradation of pyrethroids and their intermediate product (3-PBA) has become a hot topic in recent years. Here, we reviewed microbial species, degrading enzymes and degradation genes, degradation pathways of 3-PBA degrading and the application of 3-PBA degradation strains. This article provides references for the study of 3-PBA degradation by microorganisms. PMID:26762020

  13. Neuronal Dysregulation in Stroke-Associated Pseudobulbar Affect (PBA): Diagnostic Scales and Current Treatment Options

    PubMed Central

    Lapchak, Paul A

    2015-01-01

    Until recently there was little understanding of the exact pathophysiology and treatment choices for stroke patients with Pseudobulbar affect (PBA). PBA is typically characterized by outbursts or uncontrollable laughing or crying and in the majority of patients, the outbursts being involuntary and incompatible with the patients’ emotional state. PBA is a behavioral syndrome reported to be displayed in 28–52% of stroke patients with first or multiple strokes, and incidence may be higher in patients who have had prior stroke events, and higher in females. There is typically involvement of glutaminergic, serotoninergic and dopaminergic neuronal circuits of the corticolimbic-subcorticothalamic-pontocerebellar network. PBA is now understood to be a disinhibition syndrome in which specific pathways involving serotonin and glutamate are disrupted or modulated causing reduced cortical inhibition of a cerebellar/brainstem-situated “emotional” laughing or crying focal center. Stroke-induced disruption of one or more neuronal pathway circuits may “disinhibit” voluntary laughing and crying making the process involuntary. With a “new” treatment currently being marketed to treat PBA patients, this article will delve into the neurological and physiological basis for PBA in stroke, and review progress with the diagnosis and treatment of PBA. PMID:26693049

  14. 34 CFR 12.10 - How is a Public Benefit Allowance (PBA) calculated?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 34 Education 1 2010-07-01 2010-07-01 false How is a Public Benefit Allowance (PBA) calculated? 12... accredited university, has an ROTC unit, and proposes to use the surplus Federal real property for a school... of 50% (as a college or university), a 20% accreditation organization allowance (accredited...

  15. mulPBA: an efficient multiple protein structure alignment method based on a structural alphabet.

    PubMed

    Léonard, Sylvain; Joseph, Agnel Praveen; Srinivasan, Narayanaswamy; Gelly, Jean-Christophe; de Brevern, Alexandre G

    2014-04-01

    The increasing number of available protein structures requires efficient tools for multiple structure comparison. Indeed, multiple structural alignments are essential for the analysis of function, evolution and architecture of protein structures. For this purpose, we proposed a new web server called multiple Protein Block Alignment (mulPBA). This server implements a method based on a structural alphabet to describe the backbone conformation of a protein chain in terms of dihedral angles. This 'sequence-like' representation enables the use of powerful sequence alignment methods for primary structure comparison, followed by an iterative refinement of the structural superposition. This approach yields alignments superior to most of the rigid-body alignment methods and highly comparable with the flexible structure comparison approaches. We implement this method in a web server designed to do multiple structure superimpositions from a set of structures given by the user. Outputs are given as both sequence alignment and superposed 3D structures visualized directly by static images generated by PyMol or through a Jmol applet allowing dynamic interaction. Multiple global quality measures are given. Relatedness between structures is indicated by a distance dendogram. Superimposed structures in PDB format can be also downloaded, and the results are quickly obtained. mulPBA server can be accessed at www.dsimb.inserm.fr/dsimb_tools/mulpba/ . PMID:23659291

  16. Decomposition Studies of Triphenylboron, Diphenylborinic Acid and Phenylboric Acid in Aqueous Alkaline Solutions Containing Copper

    SciTech Connect

    Crawford, C.L.; Peterson, R. A.

    1997-02-11

    This report documents the copper-catalyzed chemical kinetics of triphenylboron, diphenylborinic acid and phenylboric acid (3PB, 2PB and PBA) in aqueous alkaline solution contained in carbon-steel vessels between 40 and 70 degrees C.

  17. Sodium phenylbutyrate decreases plasma branched-chain amino acids in patients with urea cycle disorders.

    PubMed

    Burrage, Lindsay C; Jain, Mahim; Gandolfo, Laura; Lee, Brendan H; Nagamani, Sandesh C S

    2014-01-01

    Sodium phenylbutyrate (NaPBA) is a commonly used medication for the treatment of patients with urea cycle disorders (UCDs). Previous reports involving small numbers of patients with UCDs have shown that NaPBA treatment can result in lower plasma levels of the branched-chain amino acids (BCAA) but this has not been studied systematically. From a large cohort of patients (n=553) with UCDs enrolled in the Longitudinal Study of Urea Cycle Disorders, a collaborative multicenter study of the Urea Cycle Disorders Consortium, we evaluated whether treatment with NaPBA leads to a decrease in plasma BCAA levels. Our analysis shows that NaPBA use independently affects the plasma BCAA levels even after accounting for multiple confounding covariates. Moreover, NaPBA use increases the risk for BCAA deficiency. This effect of NaPBA seems specific to plasma BCAA levels, as levels of other essential amino acids are not altered by its use. Our study, in an unselected population of UCD subjects, is the largest to analyze the effects of NaPBA on BCAA metabolism and potentially has significant clinical implications. Our results indicate that plasma BCAA levels should to be monitored in patients treated with NaPBA since patients taking the medication are at increased risk for BCAA deficiency. On a broader scale, these findings could open avenues to explore NaPBA as a therapy in maple syrup urine disease and other common complex disorders with dysregulation of BCAA metabolism. PMID:25042691

  18. Development of phenylboronic acid-functionalized nanoparticles for emodin delivery

    PubMed Central

    Wang, Bo; Chen, Limin; Sun, Yingjuan; Zhu, Youliang; Sun, Zhaoyan; An, Tiezhu; Li, Yuhua; Lin, Yuan; Fan, Daping; Wang, Qian

    2015-01-01

    Stable and monodisperse phenylboronic acid-functionalized nanoparticles (PBA-NPs) were fabricated using 3-((acrylamido)methyl)phenylboronic acid homopolymer (PBAH) via solvent displacement technique. The effect of operating parameters, including stirring time, initial polymer concentration and the proportion of methanol on the self-assembly process were systematically investigated. The diameters of the PBA-NPs were increased as increasing the initial PBAH concentration and the proportion of methanol. Likewise, there was a linear dependence between the size of self-assembled nanoparticles and the polymer concentration. Moreover, the dissipative particle dynamics (DPD) simulation technique was used to investigate the mechanism of self-assembly behavior of PBAH, which indicated that the interior of PBA-NPs was hydrophobic and compact, and the boronic acid groups were displayed on both the outermost and interior of PBA-NPs. The resulting PBA-NPs could successfully encapsulate emodin through PBA-diol interaction and the encapsulation efficiency (EE%) and drug loading content (DLC%) of drug-loaded PBA-NPs were 78% and 2.1%, respectively. Owing to the acid-labile feature of the boronate linkage, a reduction in environmental pH from pH 7.4 to 5.0 could trigger the disassociation of the boronate ester bonds, which could accelerate the drug release from PBA-Emodin-NPs. Besides, PBA-Emodin-NPs showed a much higher cytotoxicity to HepG2 cells (cancer cells) than that to MC-3T3-E1 cells (normal cells). These results imply that PBA-NPs would be a promising scaffold for the delivery of polyphenolic drugs. PMID:25960874

  19. Biological Monitoring of 3-Phenoxybenzoic Acid in Urine by an Enzyme -Linked Immunosorbent Assay

    EPA Science Inventory

    An enzyme-linked immunosorbent assay (ELISA) method was employed for determination of the pyrethroid biomarker, 3-phenoxybenzoic acid (3-PBA) in human urine samples. The optimized coating antigen concentration was 0.5 ng/mL with a dilution of 1:4000 for the 3-PBA antibody and 1:6...

  20. Correlating Physicochemical Properties of Boronic Acid-Chitosan Conjugates to Glucose Adsorption Sensitivity

    PubMed Central

    Asantewaa, Yaa; Aylott, Jonathan; Burley, Jonathan C.; Billa, Nashiru; Roberts, Clive J.

    2012-01-01

    Phenyl boronic acid (PBA), which is known to interact with glucose, was covalently bonded to chitosan by direct reductive N-alkylation of chitosan with 4-formylphenylboronic acid (4-FPBA). Evidence of PBA bonding on chitosan was assessed by FTIR, ToF-SIMS, SEM, DSC and glucose adsorption sensitivity measurements. FTIR spectra showed strong signals at 1560 and 630 cm−1 indicating the formation of p-substituted benzene. Similarly, ToF-SIMS analyses on the conjugates registered fragments of boron ion (B−) at 11.0 m/z whose intensity increased in proportion to 4-FPBA loading. The degree to which PBA was bonded to chitosan was related to the 4-FPBA load used in the reaction (termed F1 through to F6 with increasing 4-FPBA load). Glucose adsorption sensitivity to PBA-bonded chitosan was directly related to the amount of PBA functionality within the conjugates and the physical nature of the matrices (porous or crystalline). Topographic analysis by SEM revealed that PBA-chitosan conjugates F1, F2 and F3 have porous matrices and their sensitivity to glucose adsorption was directly proportional to the degree of PBA substitution onto chitosan. Conversely, conjugates F4, F5 and F6 appeared crystalline under SEM and glucose adsorption sensitivity decreased in proportion to amount of PBA bonded to chitosan. The crystalline nature of the conjugates was confirmed by DSC, where the exothermic event related to the melting of the bonded PBA moiety, occurred at 338 °C. Thus, decreased sensitivity to glucose adsorption by the conjugates can be ascribed to the crystallinity imparted by increased content of the bonded PBA moiety, providing an optimal loading of PBA in terms of maximizing response to glucose. PMID:24300397

  1. Populus nigra (Salicaceae) absolute rich in phenolic acids, phenylpropanoïds and flavonoids as a new potent tyrosinase inhibitor.

    PubMed

    Maack, A; Pegard, A

    2016-06-01

    The purpose of this study was to evaluate the tyrosinase inhibitory capacity of Populus nigra buds absolute (PBA) and compare it to kojic acid (KA), controversial reference tyrosinase inhibitor. Populus nigra buds were extracted with hexane and ethanol to obtain PBA. The inhibitory effect of this absolute was first tested on the mushroom Agaricus bisporus tyrosinase. Then the depigmenting potential of PBA was tested on B16F10 murine melanocytes by assaying the activity of tyrosinase and melanin content. Consecutively, a microscopic analysis of intracellular melanin granules was performed. Finally, melanised reconstructed human epidermis (RHE) were used to assess the lightening potential activity of this PBA on human skin. Results show that PBA inhibits A. bisporus tyrosinase (IC50=77±8ppm) and inhibits melanocytes B16F10 tyrosinase (IC50=27±1ppm). PBA decreases intracellular melanin levels, with 50% loss at 39±9ppm. Finally, PBA at 1000ppm lightens RHE and decreases their melanin content of 20%. PBA is a strong inhibitor of tyrosinase and reduces melanogenesis in melanocytes B16F10. Thus, PBA has potential applications in skin-lightening cosmetics. PMID:27091790

  2. Synthesis of novel amphiphilic hyaluronan containing-aromatic fatty acids for fabrication of polymeric micelles.

    PubMed

    Matelová, Alena; Huerta-Angeles, Gloria; Šmejkalová, Daniela; Brůnová, Zdislava; Dušek, Jan; Vícha, Robert; Velebný, Vladimír

    2016-10-20

    Novel hydrophobized hyaluronan (HA) derivatives, containing ω-phenylalkanoic acids (ω-PAA, 4-phenylbutyric acid, 6-phenylhexanoic, 8-phenyloctanoic or 11-tolylundecanoic acids) were prepared by esterification. Mixed anhydrides obtained after reaction of the carboxyl acid moiety and benzoyl chloride were found to be active acylating agents, affording hydrophobized HA in good yield and under mild conditions. The reactivity of the aromatic fatty acids towards esterification has decreased with the increasing length of the aliphatic spacer between the aromatic substituent and carboxylic acid moiety. The novel HA derivatives self-assembled from very low concentrations and were found to be non-cytotoxic. The potential use of ω-phenylalkanoic acids grafted-HA towards drug delivery applications was demonstrated by hydrophobic drugs (resveratrol and retinyl palmitate) encapsulation. The drug loading capacity of the novel HA derivatives was significantly improved most likely because of π⋯π interactions between the micelle core and loaded hydrophobic aromatic compound. PMID:27474668

  3. Determination of the pyrethroid insecticide metabolite 3-PBA in plasma and urine samples from farmer and consumer groups in northern Thailand

    PubMed Central

    THIPHOM, SARUNYA; PRAPAMONTOL, TIPPAWAN; CHANTARA, SOMPORN; MANGKLABRUKS, AMPICA; SUPHAVILAI, CHAISUREE; AHN, KI CHANG; GEE, SHIRLEY J.; HAMMOCK, BRUCE D.

    2014-01-01

    In this study, the enzyme-linked immunosorbent assays (ELISA) were modified to detect 3-PBA in plasma (including the adducted form) and urine among a large group of consumers and farmers in an agricultural area. The samples were collected on the same day in the morning from 100 consumers (50 females, 50 males) and 100 farmers (50 females, 50 males) in the Fang district, Chiang Mai province, northern Thailand. The ELISA was very sensitive having an IC50 value of 26.7 and 15.3 ng/mL, a limit of quantitation of 5 and 2.5 ng/mL and a limit of detection of 1.08 and 1.94 ng/mL for plasma and urine, respectively. These methods had low (< 5%) intra- and inter-assay coefficients of variation. The extraction technique satisfactorily eliminated the matrix effect from samples before ELISA analysis, yielding good recoveries (85.9–99.4% and 87.3–98.0%, respectively). For the volunteer study, the detection rate for plasma 3-PBA was 24% in consumers and 42% in farmers, but the median and range values were similar (median 5.87 ng/mL, range 5.16–8.44 ng/mL in consumers and 6.27 ng/mL, range 4.29–9.57 ng/mL in farmers). The rate of detection in the urine was similar (76% and 69%, in consumers and in farmers), yet the median concentration was significantly higher in farmers (8.86 μg/g creatinine in consumers vs 16.1 μg/g creatinine in farmers) and the range also much wider in farmers (1.62–80.5 μg/g creatinine in consumers and 0.80–256.2 μg/g creatinine in farmers). There was no correlation between plasma 3-PBA and urinary 3-PBA concentrations in the study presumably because plasma 3-PBA is a measure of cumulative exposures while urinary 3-PBA reflects acute exposures. In addition, metabolism and excretion of pyrethroids varies by individual. Nevertheless, this study demonstrated that these volunteers were exposed to pyrethroids. To our knowledge, this is the first report that compared plasma 3-PBA and urinary 3-PBA in a large group of volunteers. The ELISA method

  4. Phenylbutyric acid protects against carbon tetrachloride-induced hepatic fibrogenesis in mice

    SciTech Connect

    Wang, Jian-Qing; Chen, Xi; Zhang, Cheng; Tao, Li; Zhang, Zhi-Hui; Liu, Xiao-Qian; Xu, Yuan-Bao; Wang, Hua; Li, Jun; Xu, De-Xiang

    2013-01-15

    A recent report showed that the unfolded protein response (UPR) signaling was activated in the pathogenesis of carbon tetrachloride (CCl{sub 4})-induced hepatic fibrosis. Phenylbutyric acid (PBA) is a well-known chemical chaperone that inhibits endoplasmic reticulum (ER) stress and unfolded protein response (UPR) signaling. In the present study, we investigated the effects of PBA on CCl{sub 4}-induced hepatic fibrosis in mice. All mice were intraperitoneally (i.p.) injected with CCl{sub 4} (0.15 ml/kg BW, twice per week) for 8 weeks. In CCl{sub 4} + PBA group, mice were i.p. injected with PBA (150 mg/kg, twice per day) from the beginning of CCl{sub 4} injection to the end. As expected, PBA significantly attenuated CCl{sub 4}-induced hepatic ER stress and UPR activation. Although PBA alleviated, only to a less extent, hepatic necrosis, it obviously inhibited CCl{sub 4}-induced tumor necrosis factor alpha (TNF-α) and transforming growth factor beta (TGF-β). Moreover, PBA inhibited CCl{sub 4}-induced hepatic nuclear factor kappa B (NF-κB) p65 translocation and extracellular signal-regulated kinase (ERK) and c-Jun N-terminal Kinase (JNK) phosphorylation. Interestingly, CCl{sub 4}-induced α-smooth muscle actin (α-SMA), a marker for the initiation phase of HSC activation, was significantly attenuated in mice pretreated with PBA. Correspondingly, CCl{sub 4}-induced hepatic collagen (Col)1α1 and Col1α2, markers for the perpetuation phase of HSC activation, were inhibited in PBA-treated mice. Importantly, CCl{sub 4}-induced hepatic fibrosis, as determined using Sirius red staining, was obviously attenuated by PBA. In conclusion, PBA prevents CCl{sub 4}-induced hepatic fibrosis through inhibiting hepatic inflammatory response and HSC activation. Highlights: ► CCl{sub 4} induces hepatic ER stress, inflammation, HSC activation and hepatic fibrosis. ► PBA alleviates CCl{sub 4}-induced hepatic ER stress and UPR signaling activation. ► PBA inhibits CCl{sub 4}-induced

  5. pH-Activated Targeting Drug Delivery System Based on the Selective Binding of Phenylboronic Acid.

    PubMed

    Zhao, Dan; Xu, Jia-Qi; Yi, Xiao-Qing; Zhang, Quan; Cheng, Si-Xue; Zhuo, Ren-Xi; Li, Feng

    2016-06-15

    Phenylboronic acid (PBA) is a tumor-targeting molecule, but its nonspecific interaction with normal cells or other components containing cis-diol residues undoubtedly limits its potential application in tumor-targeting drug delivery. Herein, we developed fructose-coated mixed micelles via PBA-terminated polyethylene glycol monostearate (PBA-PEG-C18) and Pluronic P123 (PEG20-PPG70-PEG20) to solve this problem, as the stability of borate formed by PBA and fructose was dramatically dependent on pH. The fluorescence spectroscopic results indicated that the borate formed by PBA and fructose decomposed at a decreased pH, and better binding between PBA and sialic acid (SA) was observed at a low pH. These results implied that the fructose groups decorated on the surface of the micelles could be out-competed by SA at a low pH. In vitro uptake and cytotoxicity studies demonstrated that the fructose coating on the mixed micelles improved the endocytosis and enhanced the cytotoxicity of drug-loaded mixed micelles in HepG2 cells but reduced the cytotoxicity in normal cells. These results demonstrate that a simple decorating strategy may facilitate PBA-targeted nanoparticles for tumor-specific drug delivery. PMID:27229625

  6. Recent progress in electrochemical biosensors based on phenylboronic acid and derivatives.

    PubMed

    Anzai, Jun-Ichi

    2016-10-01

    This review provides an overview of recent progress made in the development of electrochemical biosensors based on phenylboronic acid (PBA) and its derivatives. PBAs are known to selectively bind 1,2- and 1,3-diols to form negatively charged boronate esters in neutral aqueous media and have been used to construct electrochemical glucose sensors because of this selective binding. PBA-modified metal and carbon electrodes have been widely studied as voltammetric and potentiometric glucose sensors. In some cases, ferroceneboronic acid or ferrocene-modified phenylboronic acids are used as sugar-selective redox compounds. Another option for sensors using PBA-modified electrodes is potentiometric detection, in which the changes in surface potential of the electrodes are detected as an output signal. An ion-sensitive field effect transistor (FET) has been used as a signal transducer in potentiometric sensors. Glycoproteins, such as glycated hemoglobin (HbA1c), avidin, and serum albumin can also be detected by PBA-modified electrodes because they contain hydrocarbon chains on the surface. HbA1c sensors are promising alternatives to enzyme-based glucose sensors for monitoring blood glucose levels over the preceding 2-3months. In addition, PBA-modified electrodes can be used to detect a variety of compounds including hydroxy acids and fluoride (F(-)) ions. PBA-based F(-) ion sensors may be useful if reagentless sensors can be developed. PMID:27287174

  7. Key techniques and risk management for the application of the Pile-Beam-Arch (PBA) excavation method: a case study of the Zhongjie subway station.

    PubMed

    Guan, Yong-ping; Zhao, Wen; Li, Shen-gang; Zhang, Guo-bin

    2014-01-01

    The design and construction of shallow-buried tunnels in densely populated urban areas involve many challenges. The ground movements induced by tunneling effects pose potential risks to infrastructure such as surface buildings, pipelines, and roads. In this paper, a case study of the Zhongjie subway station located in Shenyang, China, is examined to investigate the key construction techniques and the influence of the Pile-Beam-Arch (PBA) excavation method on the surrounding environment. This case study discusses the primary risk factors affecting the environmental safety and summarizes the corresponding risk mitigation measures and key techniques for subway station construction using the PBA excavation method in a densely populated urban area. PMID:25221783

  8. Key Techniques and Risk Management for the Application of the Pile-Beam-Arch (PBA) Excavation Method: A Case Study of the Zhongjie Subway Station

    PubMed Central

    Guan, Yong-ping; Zhao, Wen; Li, Shen-gang; Zhang, Guo-bin

    2014-01-01

    The design and construction of shallow-buried tunnels in densely populated urban areas involve many challenges. The ground movements induced by tunneling effects pose potential risks to infrastructure such as surface buildings, pipelines, and roads. In this paper, a case study of the Zhongjie subway station located in Shenyang, China, is examined to investigate the key construction techniques and the influence of the Pile-Beam-Arch (PBA) excavation method on the surrounding environment. This case study discusses the primary risk factors affecting the environmental safety and summarizes the corresponding risk mitigation measures and key techniques for subway station construction using the PBA excavation method in a densely populated urban area. PMID:25221783

  9. Amidation inhibitors 4-phenyl-3-butenoic acid and 5-(acetylamino)-4-oxo-6-phenyl-2-hexenoic acid methyl ester are novel HDAC inhibitors with anti-tumorigenic properties.

    PubMed

    Ali, Amna; Burns, Timothy J; Lucrezi, Jacob D; May, Sheldon W; Green, George R; Matesic, Diane F

    2015-08-01

    4-Phenyl-3-butenoic acid (PBA) is an inhibitor of peptidylglycine alpha-amidating monooxygenase with anti-inflammatory properties that has been shown to inhibit the growth of ras-mutated epithelial and human lung carcinoma cells. In this report, we show that PBA also increases the acetylation levels of selected histone subtypes in a dose and time dependent manner, an effect that is attributable to the inhibition of histone deacetylase (HDAC) enzymes. Comparison studies with the known HDAC inhibitor suberoylanilide hydroxamic acid (SAHA) using high resolution two-dimensional polyacrylamide gels and Western analysis provide evidence that PBA acts as an HDAC inhibitor within cells. PBA and a more potent amidation inhibitor, 5-(acetylamino)-4-oxo-6-phenyl-2-hexenoic acid methyl ester (AOPHA-Me), inhibit HDAC enzymes in vitro at micromolar concentrations, with IC50 values approximately 30 fold lower for AOPHA-Me than PBA for selected HDAC isoforms. Overall, these results indicate that PBA and AOPHA-Me are novel anti-tumorigenic HDAC inhibitors. PMID:26065689

  10. Growth and characterization studies of pure and tartaric acid doped benzilic acid crystals

    NASA Astrophysics Data System (ADS)

    Gilda, M. J. Jarald Brigit; Devarajan, Prem Anand

    2016-04-01

    The organic nonlinear optical crystals of pure benzilic acid (PBA) and tartaric acid doped benzilic acid (TADBA) single crystals were grown by using slow evaporation method utilizing dimethyl formamide (DMF) as a solvent. Transparent single crystals of PBA and TADBA of dimensions 9×4×1 mm3 and 7×5×2 mm3 were grown after thirty days. Lattice parameters and space groups of PBA and TADBA were evaluated using single crystal X-ray diffraction analysis. Employing Fourier transform infrared spectral analysis, various functional groups in pure and doped crystals were ascertained. 1H and C13 nuclear magnetic resonance spectral analysis suggests the presence of hydrogen- and carbon-bonded network. Optical transparency of PBA and TADBA was investigated using ultraviolet-visible (UV-vis) spectral analysis whereas thermal properties of the grown crystals were studied by thermogravimetric and differential scanning calorimetry analyses. Second harmonic generation efficiency of PBA and TADBA was found to be 2.2 and 2.7 times higher than that of potassium dihydrogen phosphate.

  11. Endoplasmic reticulum stress drives proteinuria-induced kidney lesions via Lipocalin 2

    PubMed Central

    El Karoui, Khalil; Viau, Amandine; Dellis, Olivier; Bagattin, Alessia; Nguyen, Clément; Baron, William; Burtin, Martine; Broueilh, Mélanie; Heidet, Laurence; Mollet, Géraldine; Druilhe, Anne; Antignac, Corinne; Knebelmann, Bertrand; Friedlander, Gérard; Bienaimé, Frank; Gallazzini, Morgan; Terzi, Fabiola

    2016-01-01

    In chronic kidney disease (CKD), proteinuria results in severe tubulointerstitial lesions, which ultimately lead to end-stage renal disease. Here we identify 4-phenylbutyric acid (PBA), a chemical chaperone already used in humans, as a novel therapeutic strategy capable to counteract the toxic effect of proteinuria. Mechanistically, we show that albumin induces tubular unfolded protein response via cytosolic calcium rise, which leads to tubular apoptosis by Lipocalin 2 (LCN2) modulation through ATF4. Consistent with the key role of LCN2 in CKD progression, Lcn2 gene inactivation decreases ER stress-induced apoptosis, tubulointerstitial lesions and mortality in proteinuric mice. More importantly, the inhibition of this pathway by PBA protects kidneys from morphological and functional degradation in proteinuric mice. These results are relevant to human CKD, as LCN2 is increased in proteinuric patients. In conclusion, our study identifies a therapeutic strategy susceptible to improve the benefit of RAS inhibitors in proteinuria-induced CKD progression. PMID:26787103

  12. Endoplasmic reticulum stress drives proteinuria-induced kidney lesions via Lipocalin 2.

    PubMed

    El Karoui, Khalil; Viau, Amandine; Dellis, Olivier; Bagattin, Alessia; Nguyen, Clément; Baron, William; Burtin, Martine; Broueilh, Mélanie; Heidet, Laurence; Mollet, Géraldine; Druilhe, Anne; Antignac, Corinne; Knebelmann, Bertrand; Friedlander, Gérard; Bienaimé, Frank; Gallazzini, Morgan; Terzi, Fabiola

    2016-01-01

    In chronic kidney disease (CKD), proteinuria results in severe tubulointerstitial lesions, which ultimately lead to end-stage renal disease. Here we identify 4-phenylbutyric acid (PBA), a chemical chaperone already used in humans, as a novel therapeutic strategy capable to counteract the toxic effect of proteinuria. Mechanistically, we show that albumin induces tubular unfolded protein response via cytosolic calcium rise, which leads to tubular apoptosis by Lipocalin 2 (LCN2) modulation through ATF4. Consistent with the key role of LCN2 in CKD progression, Lcn2 gene inactivation decreases ER stress-induced apoptosis, tubulointerstitial lesions and mortality in proteinuric mice. More importantly, the inhibition of this pathway by PBA protects kidneys from morphological and functional degradation in proteinuric mice. These results are relevant to human CKD, as LCN2 is increased in proteinuric patients. In conclusion, our study identifies a therapeutic strategy susceptible to improve the benefit of RAS inhibitors in proteinuria-induced CKD progression. PMID:26787103

  13. Electrochemical Determination of Glycoalkaloids Using a Carbon Nanotubes-Phenylboronic Acid Modified Glassy Carbon Electrode

    PubMed Central

    Wang, Huiying; Liu, Mingyue; Hu, Xinxi; Li, Mei; Xiong, Xingyao

    2013-01-01

    A versatile strategy for electrochemical determination of glycoalkaloids (GAs) was developed by using a carbon nanotubes-phenylboronic acid (CNTs-PBA) modified glassy carbon electrode. PBA reacts with α-solanine and α-chaconine to form a cyclic ester, which could be utilized to detect GAs. This method allowed GA detection from 1 μM to 28 μM and the detection limit was 0.3 μM. Affinity interaction of GAs and immobilized PBA caused an essential change of the peak current. The CNT-PBA modified electrodes were sensitive for detection of GAs, and the peak current values were in quite good agreement with those measured by the sensors. PMID:24287539

  14. Controllable layer-by-layer assembly of PVA and phenylboronic acid-derivatized chitosan.

    PubMed

    Zhang, Dan; Yu, Guanghua; Long, Zhu; Yang, Guihua; Wang, Bin

    2016-04-20

    Phenylboronic acid-derivatized chitosan (chitosan-PBA) were prepared by grafting small molecules bearing phenylboronic acid groups onto chitosan with N-hydroxysuccinimide (NHS) and N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (EDC) as a coupling reagent pair. Self-assembly multilayer thin films of chitosan-PBA and poly(vinyl alcohol) were subsequently produced under pH control on supporting surfaces, either a silicon wafer or polystyrene latex particles. The driving force of the self-assembly was the ester formation of phenylboronic acid containing polymers with PVA, which can be "turned off" by simple pH control. PMID:26876848

  15. An enzyme-linked immunosorbent assay for detecting 3-phenoxybenzoic acid in plasma and its application in farmers and consumers

    PubMed Central

    Thiphom, Sarunya; Prapamontol, Tippawan; Chantara, Somporn; Mangklabruks, Ampica; Suphavilai, Chaisuree; Ahn, Ki Chang; Gee, Shirley J.; Hammock, Bruce D.

    2013-01-01

    The aim of this study was to identify a plasma biomarker of exposure to pyrethroid insecticides. A major metabolite, 3-phenoxybenzoic acid (3-PBA), can be detected in urine but urinary 3-PBA cannot be used to assess the active dose. The 3-PBA-adduct represents a much more persistent class of biomarkers than metabolites excreted into urine, having half lives up to several weeks or months. We developed an enzyme-linked immunosorbent assay (ELISA) for total 3-PBA including adduct formed after alkaline hydrolysis, liquid-liquid extraction (LLE) and solid phase extraction (SPE) of the sample. The developed ELISA had an IC50 value of 26.7 ng/mL. The intra- and inter-assay coefficients of variation (%CV) were lower than 5% and were within the optimum condition variance (OCV) range. The LLE cleanup technique satisfactorily eliminated the matrix effect from plasma samples before SPE and ELISA analysis yielding good recoveries (85.9–99.4%) with a limit of quantitation (LOQ, 5 ng/mL) that was 30- to 47-fold more sensitive than previous studies. Moreover, the developed method could separate more than 80% of 3-PBA from adduct form. The method was successfully applied to the detection of the target in real samples obtained from consumers (n=50) and farmers (n=50). To our knowledge, this is the first ELISA method for detecting 3-PBA in human plasma and applied to a field study. PMID:23667388

  16. The fluorescence properties of aerosol larger than 0.8 μm in an urban and a PBA-dominated location

    NASA Astrophysics Data System (ADS)

    Gabey, A. M.; Stanley, W. R.; Gallagher, M. W.; Kaye, P. H.

    2011-01-01

    Dual-wavelength Ultraviolet light-induced fluorescence (UV-LIF) measurements were performed on ambient environmental aerosol in Manchester, UK (urban city centre, winter) and Borneo, Malaysia (remote, tropical), which are taken to represent environments with negligible and significant primary biological aerosol (PBA) influences, respectively. Single-particle fluorescence intensity and optical equivalent diameter were measured with a Wide Issue Bioaerosol Sensor, version 3 (WIBS3) in the diameter range 0.8 μm≤DP≤20 μm for 2-3 weeks and filters were analysed using energy dispersive X-ray (EDX) spectroscopy, which revealed mostly non-PBA dominated particle sizes larger than 1 μm in Manchester. The WIBS3 features three fluorescence channels: Fluorescence excited at 280 nm is recorded at 310-400 nm and 400-600 nm and fluorescence excited at 370 nm is detected at 400-600 nm. In Manchester the primary size mode of fluorescent and non-fluorescent material was at 1.2 μm. In Borneo non-fluorescent material peaked at 1.2 μm and fluorescent at 3-4 μm. The fluorescence intensity at 400-600 nm generally increased with DP at both sites, as did the 310-400 nm intensity in Borneo. In Manchester the 310-400 m fluorescence decreased at DP>4 μm, suggesting this channel offers additional discrimination between fluorescent particle types. Finally, the ratio of fluorescence intensity in two pairs of channels was investigated as a function of particle diameter and this varied significantly between the two environments, demonstrating that the fluorescent aerosol in each can in principle be distinguished using a combination of fluorescence and elastic scattering measurements.

  17. Enhanced Sensitivity for Hydrogen Peroxide Detection: Polydiacetylene Vesicles with Phenylboronic Acid Head Group.

    PubMed

    Jia, Chen; Tang, Jie; Lu, Shengguo; Han, Yuwang; Huang, He

    2016-01-01

    It was recently reported that, besides UV irradiated polymerization, polymerization of diacetylene compounds could also been initiated by radicals generated from enzyme catalyzed hydrogen peroxide (H2O2) decomposition. A new optical sensing method for H2O2 was proposed based on this phenomenon. However, the sensitivity of this method is relatively lower than existed ones. In the present work, phenylboronic acid (PBA) functionalized 10, 12-pentacosadiynoic acid (PDA-PBA) was synthesized and its vesicles were formed successfully as colorimetric sensor for H2O2 detection. It was found that color change during the polymerization of vesicles composed of the PBA modified monomer is much stronger than that of the non-modified one. The response of PDA-PBA vesicles to H2O2 is 16 times more sensitive than that of the PDA. The absorption of PDA-PBA at 650 nm is linearly related to the concentration of H2O2 and a detection limit of ~5 μM could be achieved. PMID:26511954

  18. Urinary concentration of 3-phenoxybenzoic acid in elementary students in South Korea

    PubMed Central

    Jo, Hye Mi; Ha, Mina; Lee, Won Jin

    2015-01-01

    Objectives Pyrethroid pesticides are among the most commonly using insecticides in South Korean households and have been the subject of considerable interest among public health professionals for their potential health effects. The objective of this study is to examine the level of urinary 3-phenoxybenzoic acid (3-PBA) among elementary students in South Korea. Methods We conducted a cross-sectional study to evaluate pyrethroid pesticide exposure levels by measuring the urinary metabolites of 3-PBA using a gas chromatography-mass spectrometry method in March 2011. Study participants were 70 Asan-area and Incheon-area elementary students. Results All respondents had values above the detection limit, and the geometric means of 3-PBA in all children were 1.85 μg/L and 1.46 μg/g creatinine. Children with the top 10% urinary levels of 3-PBA were more likely to be girls, under nine years of age, living in a rural area, and living in a residential type apartment. Conclusions South Korean children have a higher concentration of urinary 3-PBA compared with those of other countries. Further research identifying exposure pathways and intervention efforts to reduce environmental pesticide use are needed in South Korea. PMID:26602560

  19. Addition of Phenylboronic Acid to Malus domestica Pollen Tubes Alters Calcium Dynamics, Disrupts Actin Filaments and Affects Cell Wall Architecture.

    PubMed

    Fang, Kefeng; Gao, Sai; Zhang, Weiwei; Xing, Yu; Cao, Qingqin; Qin, Ling

    2016-01-01

    A key role of boron in plants is to cross-link the cell wall pectic polysaccharide rhamnogalacturonan-II (RG-II) through borate diester linkages. Phenylboronic acid (PBA) can form the same reversible ester bonds but cannot cross-link two molecules, so can be used as an antagonist to study the function of boron. This study aimed to evaluate the effect of PBA on apple (Malus domestica) pollen tube growth and the underlying regulatory mechanism. We observed that PBA caused an inhibition of pollen germination, tube growth and led to pollen tube morphological abnormalities. Fluorescent labeling, coupled with a scanning ion-selective electrode technique, revealed that PBA induced an increase in extracellular Ca2+ influx, thereby elevating the cytosolic Ca2+ concentration [Ca2+]c and disrupting the [Ca2+]c gradient, which is critical for pollen tube growth. Moreover the organization of actin filaments was severely perturbed by the PBA treatment. Immunolocalization studies and fluorescent labeling, together with Fourier-transform infrared analysis (FTIR) suggested that PBA caused an increase in the abundance of callose, de-esterified pectins and arabinogalactan proteins (AGPs) at the tip. However, it had no effect on the deposition of the wall polymers cellulose. These effects are similar to those of boron deficiency in roots and other organs, indicating that PBA can induce boron deficiency symptoms. The results provide new insights into the roles of boron in pollen tube development, which likely include regulating [Ca2+]c and the formation of the actin cytoskeleton, in addition to the synthesis and assembly of cell wall components. PMID:26886907

  20. Addition of Phenylboronic Acid to Malus domestica Pollen Tubes Alters Calcium Dynamics, Disrupts Actin Filaments and Affects Cell Wall Architecture

    PubMed Central

    Fang, Kefeng; Gao, Sai; Zhang, Weiwei; Xing, Yu; Cao, Qingqin; Qin, Ling

    2016-01-01

    A key role of boron in plants is to cross-link the cell wall pectic polysaccharide rhamnogalacturonan-II (RG-II) through borate diester linkages. Phenylboronic acid (PBA) can form the same reversible ester bonds but cannot cross-link two molecules, so can be used as an antagonist to study the function of boron. This study aimed to evaluate the effect of PBA on apple (Malus domestica) pollen tube growth and the underlying regulatory mechanism. We observed that PBA caused an inhibition of pollen germination, tube growth and led to pollen tube morphological abnormalities. Fluorescent labeling, coupled with a scanning ion-selective electrode technique, revealed that PBA induced an increase in extracellular Ca2+ influx, thereby elevating the cytosolic Ca2+ concentration [Ca2+]c and disrupting the [Ca2+]c gradient, which is critical for pollen tube growth. Moreover the organization of actin filaments was severely perturbed by the PBA treatment. Immunolocalization studies and fluorescent labeling, together with Fourier-transform infrared analysis (FTIR) suggested that PBA caused an increase in the abundance of callose, de-esterified pectins and arabinogalactan proteins (AGPs) at the tip. However, it had no effect on the deposition of the wall polymers cellulose. These effects are similar to those of boron deficiency in roots and other organs, indicating that PBA can induce boron deficiency symptoms. The results provide new insights into the roles of boron in pollen tube development, which likely include regulating [Ca2+]c and the formation of the actin cytoskeleton, in addition to the synthesis and assembly of cell wall components. PMID:26886907

  1. [Study on cooperating degradation of cypermethrin and 3-phenoxybenzoic acid by two bacteria strains].

    PubMed

    Xu, Yu-Xin; Sun, Ji-Quan; Li, Xiao-Hui; Li, Shun-Peng; Chen, Yi

    2007-10-01

    The microbial cooperated reaction is one of the most important forms of microbial degradation of organic pollutants. Although there were many research reports of cooperating degradation, less report on the microbial cooperated of pyrethroid degradation to be found. We have isolated one degrading-bacteria strain named CDT3 for degradation of cypermethrin, which can degraded the cypermethrin into 3-PBA and DCVA. At the same time, we also isolated another degrading-bacteria strain named as PBM11, which could get multiplication on 3-PBA as its C source and energy source. The cooperative degradation process of cypermethrin and 3-Phenoxybenzoic acid (3-PBA) using the two degrading-bacteria strain CDT3 and PBM11 was investigated. An obvious inhibition to the cypermethrin degrading-bacterium strain CDT3 (Rhodococcus sp.) by its metabolic mediate 3-PBA was found; meanwhile there is no effect on the growth of 3-PBA degrading-bacterium strain PBM11 (Pesudomonas sp.) when the concentration of cypermethrin was lower than 200 mg/L. The degradation rate of cypermethrin by both strain CDT3 and PBM11 was higher than that by CDT3 alone. The biomass of PBM11 increased along with the degradation of cypermethrin and 3-PBA, but that of CDT3 not. There was no the accumulation of 3-PBA when the simultaneous addition of strain CDT3 and PBM11, however, an obvious one within 24h if inoculation of strain PBM11 was later 24h after inoculation of strain CDT3, Subsequently the 3-PBA was degraded rapidly by strain PBM11. The strains CDT3 and PBM11 showed some characteristics of co-metabolism, however it is not actual degradation form of co-metabolism. For examples, although the degrading sub product of cypermethrin by CDT3 could be utilized, the multiplication of PBM11 could not enhance the multiplication of CDT3, implied there is no obvious relationship between the two strains. Also, to add PBM11 could eliminate the inhibition of 3-PBA to CDT3. Thus, the cooperating degradation of strains CDT3

  2. Diet and Nondiet Predictors of Urinary 3-Phenoxybenzoic Acid in NHANES 1999–2002

    PubMed Central

    Riederer, Anne M.; Bartell, Scott M.; Barr, Dana B.; Ryan, P. Barry

    2008-01-01

    Background 3-Phenoxybenzoic acid (3PBA), a pyrethroid metabolite, was detected in 75% of urine samples analyzed for pesticides in the U.S. National Health and Nutrition Examination Survey (NHANES) 1999–2002. NHANES also includes 24-hr diet data and information on household pesticide use, activities, occupation, demographics, and other exposure factors. Objectives The objective of our study was to explore the relative importance of diet versus nondiet predictors in explaining variability in urinary 3PBA. A secondary objective was to explore whether the NHANES data could be used to identify particular foods driving 3PBA levels. Methods We divided subjects into child (6–10 years of age), teen (11–18 years), and adult (≥ 19 years) age groups and restricted our analyses to subjects in the morning sampling session who fasted for ≥ 8 hr beforehand. Regression modeling consisted of several model-building steps and a final Tobit regression on the left-censored log 3PBA measurements. We also conducted bootstrap analyses to evaluate the stability of the regression parameters. Results Reported household pesticide use was not significantly associated with urinary 3PBA in any age group. Diet was significant for all three groups, and certain foods appeared to contribute more than others. Among adults, tobacco use was positively associated with 3PBA (p = 0.0326), and positive associations were suggested with the number of cytochrome p450–inhibiting medications taken (p = 0.0652) and minutes spent gardening (p = 0.0613) in the past month. Conclusions Although exploratory, our findings underline the importance of collecting accurate data on household pesticide use and dietary intake when evaluating pyrethroid exposure–biomarker relationships. PMID:18709153

  3. Continuous colorimetric screening assays for the detection of specific L- or D-α-amino acid transaminases in enzyme libraries.

    PubMed

    Heuson, Egon; Petit, Jean-Louis; Debard, Adrien; Job, Aurélie; Charmantray, Franck; de Berardinis, Véronique; Gefflaut, Thierry

    2016-01-01

    In the course of a project devoted to the stereoselective synthesis of non-proteinogenic α-amino acids using α-transaminases (α-TA), we report the design and optimization of generic high-throughput continuous assays for the screening of α-TA libraries. These assays are based on the use of L- or D-cysteine sulfinic acid (CSA) as irreversible amino donor and subsequent sulfite titration by colorimetry. The assays' quality was assessed under screening conditions. Hit selection thresholds were accurately determined for every couple of substrates and a library of 232 putative transaminases expressed in Escherichia coli host cells was screened. The reported high throughput screening assays proved very sensitive allowing the detection with high confidence of activities as low as 10 μU (i.e., 0.01 nmol substrate converted per min). The assays were also evidenced to be stereochemically discriminant since L-CSA and D-CSA allowed the exclusive detection of L-TA and D-TA, respectively. These generic assays thus allow testing the stereoselective conversion of a wide range of α-keto acids into α-amino acids of interest. As a proof of principle, the use of 2-oxo-4-phenylbutyric acid as acceptor substrate led to the identification of 54 new α-TA offering an access to valuable L- or D-homophenylalanine. PMID:26452497

  4. Microarray immunoassay for phenoxybenzoic acid using polymer-functionalized lanthanide oxide nanoparticles as fluorescent labels

    NASA Astrophysics Data System (ADS)

    Nichkova, Mikaela; Dosev, Dosi; Gee, Shirley J.; Hammock, Bruce D.; Kennedy, Ian M.

    2005-11-01

    Fluorescent properties and low production cost makes lanthanide oxide nanoparticles attractive labels in biochemistry. Nanoparticles with different fluorescent spectra were produced by doping of oxides such as Y IIO 3 and Gd IIO 3 with different lanthanide ions (Eu, Tb, Sm) giving the possibility for multicolor labeling. Protein microarrays have the potential to play a fundamental role in the miniaturization of biosensors, clinical immunological assays, and protein-protein interaction studies. Here we present the application of fluorescent lanthanide oxide nanoparticles as labels in microarray-based immunoassay for phenoxybenzoic acid (PBA), a generic biomarker of human exposure to the highly potent insecticides pyrethroids. A novel polymer-based protocol was developed for biochemical functionalization of the nanoparticles. Microarrays of antibodies were fabricated by microcontact printing in line patterns onto glass substrates and immunoassays were successfully performed using the corresponding functionalized nanoparticles. The applicability of the fluorophore nanoparticles as reporters for detection of antibody-antigen interactions has been demonstrated for phenoxybenzoic acid (PBA)/anti-PBA IgG. The sensitivity of the competitive fluorescent immunoassay for PBA was similar to that of the corresponding ELISA.

  5. Characterization of a subcloned fragment (pBA0.6) of pCMM86 located on 17q21 and its potential use in generating an individual-specific DNA profile.

    PubMed

    Saha, A; Husain, S; Bamezai, R

    2000-04-01

    Sequence analysis was carried out of a human clone pBA0.6 generated after exonuclease III/S1 nuclease digestion and subcloning of pCMM86 (GDB: 168382, D17S74), which was not available in the database. It revealed the presence of a reiterating core motif of 24mer GTGGGTGTGTTGGAGGGGGTGAGG, present 23 times, which was GC-rich and minisatellitic in nature. Genomic blots of HaeIII-digested human DNA, when hybridized with pBA0.6, generated a ladder of bands between 29.0 kb and 2.1 kb. Hybridization analyses of 88 unrelated individuals belonging to four regions of India using this probe revealed polymorphic bands which were individual specific. The probability of identity ranged from 5.07x10(-14) in Punjabis to 2.64x10(-16) in Bengalis and was found to be 3.06x10(-16) in UPites, whereas in the case of South Indians, it was 3.9x10(-15). Three sets of isomorphic bands at 29.0 kb, 2.4 kb, and 2.1 kb were common between the individuals of all the regions and served as internal markers. The 29.0-kb band was observed to be Homo sapiens specific. Construction of dendrograms based on the UPGMA method with Jaccard's coefficient values suggested less genetic similarity/high genetic diversity in all the population groups, indicating that the samples taken were random. Maximum likelihood estimates through the bootstrap sampling method showed that Punjabis, Bengalis, and UPites formed one cluster, whereas South Indians formed a separate cluster, altogether thus showing the proximity of these three population groups compared with that from South India. A preliminary study by Northern hybridization with pBA0.6 resulted in two transcripts of 0.63 kb and 0.29 kb. This finding was corroborated with RT-PCR results where 2 amplicons, matching the expected size of two open reading frames within the minisatellite sequence, were obtained. The role of the two transcripts from the minisatellite sequence is not clear as yet, and it is probable that these messages may not get translated because of

  6. Real-time monitoring of voltage shift based on enzymatically released pyrophosphate using phenylboronic acid-immobilized gate field-effect transistor

    NASA Astrophysics Data System (ADS)

    Nishida, Hirokazu; Takahashi, Kiyofumi; Tabuse, Yuki; Kambara, Hideki; Sakata, Toshiya

    2014-01-01

    Pyrophosphate (PPi) is ubiquitous in living cells and is often produced by enzymatic reactions, e.g., DNA synthesis by DNA polymerase. We have developed a novel detection system for the voltage shift associated with the change in PPi concentration resulting from an enzymatic reaction using a phenylboronic acid (PBA)-coated gate field-effect transistor (FET), since PBA coating is effective for detecting ion accumulation associated with PPi production from enzymatic reactions. To detect enzymatic reactions more efficiently, we employed the enzyme-electrode conjugation method using specific peptide sequences, which are spontaneously tethered to a gold substrate. The combination of the enzyme-electrode conjugation method with the charge detection using the PBA-coated FET enables the effective detection of enzymatic reactions.

  7. Docosahexaenoic acid and palmitic acid reciprocally modulate monocyte activation in part through endoplasmic reticulum stress.

    PubMed

    Snodgrass, Ryan G; Huang, Shurong; Namgaladze, Dmitry; Jandali, Ola; Shao, Tiffany; Sama, Spandana; Brüne, Bernhard; Hwang, Daniel H

    2016-06-01

    Palmitic acid (C16:0) and TLR2 ligand induce, but docosahexaenoic acid (DHA) inhibits monocyte activation. C16:0 and TLR2 or TLR4 ligand induce certain ER stress markers; thus, we determined whether ER stress induced by these agonists is sufficient to induce monocyte activation, and whether the ER stress is inhibited by DHA which is known to inhibit C16:0- or ligand-induced TLR activation. Monocyte activation and ER stress were assessed by TLR/inflammasome-induced IL-1β production, and phosphorylation of IRE-1 and eIF2 and expression of CHOP, respectively in THP-1 cells. TLR2 ligand Pam3CSK4 induced phosphorylation of eIF2, but not phosphorylation of IRE-1 and CHOP expression. LPS also induced phosphorylation of both IRE-1 and eIF2 but not CHOP expression suggesting that TLR2 or TLR4 ligand, or C16:0 induces different ER stress responses. C16:0-, Pam3CSK4-, or LPS-induced IL-1β production was inhibited by 4-phenylbutyric acid, an inhibitor of ER stress suggesting that IL-1β production induced by these agonists is partly mediated through ER stress. Among two ER stress-inducing molecules, thapsigargin but not tunicamycin led to the expression of pro-IL-1β and secretion of IL-1β. Thus, not all types of ER stress are sufficient to induce inflammasome-mediated IL-1β secretion in monocytes. Although both C16:0 and thapsigargin-induced IL-1β secretion was inhibited by DHA, only C16:0-mediated ER stress was responsive to DHA. These findings suggest that the anti-inflammatory effects of DHA are at least in part mediated through modulating ER homeostasis and that the propensity of ER stress can be differentially modulated by the types of dietary fat we consume. PMID:27142735

  8. Unsaturated FAs prevent palmitate-induced LOX-1 induction via inhibition of ER stress in macrophages

    PubMed Central

    Ishiyama, Junichi; Taguchi, Ryoko; Akasaka, Yunike; Shibata, Saiko; Ito, Minoru; Nagasawa, Michiaki; Murakami, Koji

    2011-01-01

    Palmitic acid (PA) upregulates oxidized LDL receptor-1 (LOX-1), a scavenger receptor responsible for uptake of oxidized LDL (oxLDL), and enhances oxLDL uptake in macrophages. However, the precise underlying mechanism remains to be elucidated. PA is known to induce endoplasmic reticulum (ER) stress in various cell types. Therefore, we investigated whether ER stress is involved in PA-induced LOX-1 upregulation. PA induced ER stress, as determined by phosphorylation of PERK, eIF2α, and JNK, as well as induction of CHOP in macrophage-like THP-1 cells. Inhibitors [4-phenylbutyric acid (PBA), sodium tauroursodeoxycholate (TUDCA), and salubrinal] and small interfering RNA (siRNA) for the ER stress response decreased PA-induced LOX-1 upregulation. Thapsigargin, an ER stress inducer, upregulated LOX-1, which was decreased by PBA and TUDCA. We next examined whether unsaturated FAs could counteract the effect of PA. Both oleic acid (OA) and linoleic acid (LA) suppressed PA-induced LOX-1. Activation of the ER stress response observed in the PA-treated cells was markedly attenuated when the cells were cotreated with OA or LA. In addition, OA and LA suppressed thapsigargin-induced LOX-1 upregulation with reduced activation of ER stress markers. Our results indicate that activation of ER stress is involved in PA-induced LOX-1 upregulation in macrophages, and that OA and LA inhibit LOX-1 induction through suppression of ER stress. PMID:21078775

  9. Novel short chain fatty acids restore chloride secretion in cystic fibrosis

    SciTech Connect

    Nguyen, Toan D. . E-mail: T1Nguyen@u.washington.edu; Kim, Ug-Sung; Perrine, Susan P.

    2006-03-31

    Phenylalanine deletion at position 508 of the cystic fibrosis transmembrane conductance regulator ({delta}F508-CFTR), the most common mutation in cystic fibrosis (CF), causes a misfolded protein exhibiting partial chloride conductance and impaired trafficking to the plasma membrane. 4-Phenylbutyrate corrects defective {delta}F508-CFTR trafficking in vitro, but is not clinically efficacious. From a panel of short chain fatty acid derivatives, we showed that 2,2-dimethyl-butyrate (ST20) and {alpha}-methylhydrocinnamic acid (ST7), exhibiting high oral bioavailability and sustained plasma levels, correct the {delta}F508-CFTR defect. Pre-incubation ({>=}6 h) of CF IB3-1 airway cells with {>=}1 mM ST7 or ST20 restored the ability of 100 {mu}M forskolin to stimulate an {sup 125}I{sup -} efflux. This efflux was fully inhibited by NPPB, DPC, or glibenclamide, suggesting mediation through CFTR. Partial inhibition by DIDS suggests possible contribution from an additional Cl{sup -} channel regulated by CFTR. Thus, ST7 and ST20 offer treatment potential for CF caused by the {delta}F508 mutation.

  10. Properties and substrate specificities of the phenylalanyl-transfer-ribonucleic acid synthetases of Aesculus species

    PubMed Central

    Anderson, J. W.; Fowden, L.

    1970-01-01

    1. Phenylalanyl-tRNA synthetases have been partially purified from cotyledons of seeds of Aesculus californica, which contains 2-amino-4-methylhex-4-enoic acid, and from four other species of Aesculus that do not contain this amino acid. The A. californica preparation was free from other aminoacyl-tRNA synthetases, and the contaminating synthetase activity in preparations from A. hippocastanum was decreased to acceptable limits by conducting assays of pyrophosphate exchange activity in 0.5m-potassium chloride. 2. The phenylalanyl-tRNA synthetase from each species activated 2-amino-4-methylhex-4-enoic acid with Km 30–40 times that for phenylalanine. The maximum velocity for 2-amino-4-methylhex-4-enoic acid was only 30% of that for phenylalanine with the A. californica enzyme, but the maximum velocities for the two substrates were identical for the other four species. 3. 2-Amino-4-methylhex-4-enoic acid was not found in the protein of A. californica, so discrimination against this amino acid probably occurs in the step of transfer to tRNA, though subcellular localization, or subsequent steps of protein synthesis could be involved. 4. Crotylglycine, methallylglycine, ethallylglycine, 2-aminohex-4,5-dienoic acid, 2-amino-5-methylhex-4-enoic acid, 2-amino-4-methylhex-4-enoic acid, β-(thien-2-yl)alanine, β-(pyrazol-1-yl)alanine, phenylserine and m-fluorophenylalanine were substrates for pyrophosphate exchange catalysed by the phenylalanyl-tRNA synthetases of A. californica or A. hippocastanum. Allylglycine, phenylglycine and 2-amino-4-phenylbutyric acid were inactive. PMID:5493504

  11. Association of urinary 3-phenoxybenzoic acid levels with self-reported depression symptoms in a rural elderly population in Asan, South Korea

    PubMed Central

    Kim, Bokyeong; Jung, Ara; Yun, Dongmin; Lee, Mira; Lee, Mee-Ri; Choi, Yoon-Hyeong; Kim, Yongbae; Park, Choonghee; Hong, Yun-Chul; Kim, Sungroul

    2015-01-01

    Objectives: This study aimed to evaluate the association between presence of depression symptoms and the exposure level to insecticides among aged population in rural area, determined via measured levels of urinary 3-phenoxybenzoic acid (3-PBA), after controlling for socioeconomic confounding factors. Methods: Using a cross-sectional study design, we randomly recruited participants for our study (161 male and 239 female) from rural areas of Asan, Chungnam, Korea. Environmental risk factor exposure was assessed using a questionnaire, and gas chromatography- mass spectrometry was used to analyze urinary 3-PBA levels. We used a logistic regression analysis to assess the association of urinary 3-PBA levels with the presence of self-reported depression symptoms. Results: After controlling for creatinine levels, the median (interquartile range) concentration of 3-PBA was approximately 1.5 times (p<0.05) higher among female (1.54 [0.90 to 2.35]) μg/g) than among male (1.06 [0.64 to 1.81] μg/g). Our study found that among female participants, the unit increase in 3-PBA levels exhibited a likely positive association (odds ratio, 1.12; 95% confidence interval, 1.00 to 1.25) with an increased risk of presence of self-reported depression symptoms, after adjusting for socioeconomic insurance type, daily physical condition, marital status, smoking status, and age. Conclusions: Given our finding of a potential association between the presence of selfreported depression symptoms and 3-PBA levels, precautions should be considered to minimize exposure to insecticides and thus protect the health of aged residents in rural areas. PMID:25997450

  12. c-Jun NH2-Terminal Kinase 1/2 and Endoplasmic Reticulum Stress as Interdependent and Reciprocal Causation in Diabetic Embryopathy

    PubMed Central

    Li, Xuezheng; Xu, Cheng; Yang, Peixin

    2013-01-01

    Embryos exposed to high glucose exhibit aberrant maturational and cytoarchitectural cellular changes, implicating cellular organelle stress in diabetic embryopathy. c-Jun-N-terminal kinase 1/2 (JNK1/2) activation is a causal event in maternal diabetes–induced neural tube defects (NTD). However, the relationship between JNK1/2 activation and endoplasmic reticulum (ER) stress in diabetic embryopathy has never been explored. We found that maternal diabetes significantly increased ER stress markers and induced swollen/enlarged ER lumens in embryonic neuroepithelial cells during neurulation. Deletion of either jnk1 or jnk2 gene diminished hyperglycemia-increased ER stress markers and ER chaperone gene expression. In embryos cultured under high-glucose conditions (20 mmol/L), the use of 4-phenylbutyric acid (4-PBA), an ER chemical chaperone, diminished ER stress markers and abolished the activation of JNK1/2 and its downstream transcription factors, caspase 3 and caspase 8, and Sox1 neural progenitor apoptosis. Consequently, both 1 and 2 mmol/L 4-PBA significantly ameliorated high glucose–induced NTD. We conclude that hyperglycemia induces ER stress, which is responsible for the proapoptotic JNK1/2 pathway activation, apoptosis, and NTD induction. Suppressing JNK1/2 activation by either jnk1 or jnk2 gene deletion prevents ER stress. Thus, our study reveals a reciprocal causation of ER stress and JNK1/2 in mediating the teratogenicity of maternal diabetes. PMID:22961085

  13. High-density lipoprotein inhibits ox-LDL-induced adipokine secretion by upregulating SR-BI expression and suppressing ER Stress pathway.

    PubMed

    Song, Guohua; Wu, Xia; Zhang, Pu; Yu, Yang; Yang, Mingfeng; Jiao, Peng; Wang, Ni; Song, Haiming; Wu, You; Zhang, Xiangjian; Liu, Huaxia; Qin, Shucun

    2016-01-01

    Endoplasmic reticulum stress (ERS) in adipocytes can modulate adipokines secretion. The aim of this study was to explore the protective effect of high-density lipoprotein (HDL) on oxidized low-density lipoprotein (ox-LDL)-induced ERS-C/EBP homologous protein (CHOP) pathway-mediated adipokine secretion. Our results showed that serum adipokines, including visfatin, resistin and TNF-α, correlated inversely with serum HDL cholesterol level in patients with abdominal obesity. In vitro, like ERS inhibitor 4-phenylbutyric acid (PBA), HDL inhibited ox-LDL- or tunicamycin (TM, an ERS inducer)-induced increase in visfatin and resistin secretion. Moreover, HDL inhibited ox-LDL-induced free cholesterol (FC) accumulation in whole cell lysate and in the endoplasmic reticulum. Additionally, like PBA, HDL inhibited ox-LDL- or TM-induced activation of ERS response as assessed by the decreased phosphorylation of protein kinase-like ER kinase and eukaryotic translation initiation factor 2α and reduced nuclear translocation of activating transcription factor 6 as well as the downregulation of Bip and CHOP. Furthermore, HDL increased scavenger receptor class B type I (SR-BI) expression and SR-BI siRNA treatment abolished the inhibitory effects of HDL on ox-LDL-induced FC accumulation and CHOP upregulation. These data indicate that HDL may suppress ox-LDL-induced FC accumulation in adipocytes through upregulation of SR-BI, subsequently preventing ox-LDL-induced ER stress-CHOP pathway-mediated adipocyte inflammation. PMID:27468698

  14. High-density lipoprotein inhibits ox-LDL-induced adipokine secretion by upregulating SR-BI expression and suppressing ER Stress pathway

    PubMed Central

    Song, Guohua; Wu, Xia; Zhang, Pu; Yu, Yang; Yang, Mingfeng; Jiao, Peng; Wang, Ni; Song, Haiming; Wu, You; Zhang, Xiangjian; Liu, Huaxia; Qin, Shucun

    2016-01-01

    Endoplasmic reticulum stress (ERS) in adipocytes can modulate adipokines secretion. The aim of this study was to explore the protective effect of high-density lipoprotein (HDL) on oxidized low-density lipoprotein (ox-LDL)-induced ERS-C/EBP homologous protein (CHOP) pathway-mediated adipokine secretion. Our results showed that serum adipokines, including visfatin, resistin and TNF-α, correlated inversely with serum HDL cholesterol level in patients with abdominal obesity. In vitro, like ERS inhibitor 4-phenylbutyric acid (PBA), HDL inhibited ox-LDL- or tunicamycin (TM, an ERS inducer)-induced increase in visfatin and resistin secretion. Moreover, HDL inhibited ox-LDL-induced free cholesterol (FC) accumulation in whole cell lysate and in the endoplasmic reticulum. Additionally, like PBA, HDL inhibited ox-LDL- or TM-induced activation of ERS response as assessed by the decreased phosphorylation of protein kinase-like ER kinase and eukaryotic translation initiation factor 2α and reduced nuclear translocation of activating transcription factor 6 as well as the downregulation of Bip and CHOP. Furthermore, HDL increased scavenger receptor class B type I (SR-BI) expression and SR-BI siRNA treatment abolished the inhibitory effects of HDL on ox-LDL-induced FC accumulation and CHOP upregulation. These data indicate that HDL may suppress ox-LDL-induced FC accumulation in adipocytes through upregulation of SR-BI, subsequently preventing ox-LDL-induced ER stress-CHOP pathway-mediated adipocyte inflammation. PMID:27468698

  15. Predictors of urinary levels of 2,4-dichlorophenoxyacetic acid, 3,5,6-trichloro-2-pyridinol, 3-phenoxybenzoic acid, and pentachlorophenol in 121 adults in Ohio.

    PubMed

    Morgan, Marsha K

    2015-07-01

    Limited data exist on the driving factors that influence the non-occupational exposures of adults to pesticides using urinary biomonitoring. In this work, the objectives were to quantify the urinary levels of 2,4-dichlorophenoxyacetic acid (2,4-D), 3,5,6-trichloro-2-pyridinol (TCP), 3-phenoxybenzoic acid (3-PBA), and pentachlorophenol (PCP) in 121 adults over a 48-h monitoring period and to examine the associations between selected sociodemographic and lifestyle factors and urinary levels of each pesticide biomarker. Adults, ages 20-49 years old, were recruited from six counties in Ohio (OH) in 2001. The participants collected 4-6 spot urine samples and completed questionnaires and diaries at home over a 48-h monitoring period. Urine samples were analyzed for 2,4-D, TCP, 3-PBA, and PCP by gas chromatography/mass spectrometry. Multiple regression modeling was used to determine the impact of selected sociodemographic and lifestyle factors on the log-transformed (ln) levels of each pesticide biomarker in adults. The pesticide biomarkers were detected in ≥ 89% of the urine samples, except for 3-PBA (66%). Median urinary levels of 2,4-D, TCP, 3-PBA, and PCP were 0.7, 3.4, 0.3, and 0.5 ng/mL, respectively. Results showed that 48-h sweet/salty snack consumption, 48-h time spend outside at home, and ln(creatinine) levels were significant predictors (p < 0.05), and race was a marginally significant predictor (p = 0.093) of the adults' ln(urinary 2,4-D) concentrations. Strong predictors (p < 0.05) of the adults' ln(urinary TCP) concentrations were urbanicity, employment status, sampling season, and ln(creatinine) levels. For 3-PBA, sampling season, pet ownership and removal of shoes before entering the home were significant predictors (p < 0.05) of the adults' ln(urinary 3-PBA) levels. Finally for PCP, removal of shoes before entering the home and ln(creatinine) levels were significant predictors (p < 0.05), and pet ownership was a marginally significant predictor (p = 0

  16. Concentrations of the urinary pyrethroid metabolite 3-phenoxybenzoic acid in farm worker families in the MICASA study

    SciTech Connect

    Trunnelle, Kelly J.; Bennett, Deborah H.; Ahn, Ki Chang; Schenker, Marc B.; Tancredi, Daniel J.; Gee, Shirley J.; Stoecklin-Marois, Maria T.; Hammock, Bruce D.

    2014-05-01

    Indoor pesticide exposure is a growing concern, particularly from pyrethroids, a commonly used class of pesticides. Pyrethroid concentrations may be especially high in homes of immigrant farm worker families who often live in close proximity to agricultural fields, and are faced with poor housing conditions, causing higher pest infestation and more pesticide use. We investigate exposure of farm worker families to pyrethroids in a study of mothers and children living in Mendota, CA within the population-based Mexican Immigration to California: Agricultural Safety and Acculturation (MICASA) Study. We present pyrethroid exposure based on an ELISA analysis of urinary metabolite 3-phenoxybenzoic acid (3PBA) levels among 105 women and 103 children. The median urinary 3PBA levels (children=2.56 ug/g creatinine, mothers=1.46 ug/g creatinine) were higher than those reported in population based studies for the United States general population, but similar to or lower than studies with known high levels of pyrethroid exposure. A positive association was evident between poor housing conditions and the urinary metabolite levels, showing that poor housing conditions are a contributing factor to the higher levels of 3PBA seen in the urine of these farm worker families. Further research is warranted to fully investigate sources of exposure. - Highlights: • We investigate exposure of farm worker families to pyrethroids. • We present pyrethroid exposure based on an ELISA analysis of urinary 3PBA levels. • 3PBA levels were higher than those reported for the U.S. general population. • Poor housing conditions may be associated with pyrethroid exposure.

  17. Cationic Mucic Acid Polymer-Based siRNA Delivery Systems.

    PubMed

    Pan, Dorothy W; Davis, Mark E

    2015-08-19

    Nanoparticle (NP) delivery systems for small interfering RNA (siRNA) that have good systemic circulation and high nucleic acid content are highly desired for translation into clinical use. Here, a family of cationic mucic acid-containing polymers is synthesized and shown to assemble with siRNA to form NPs. A cationic mucic acid polymer (cMAP) containing alternating mucic acid and charged monomers is synthesized. When combined with siRNA, cMAP forms NPs that require steric stabilization by poly(ethylene glycol) (PEG) that is attached to the NP surface via a 5-nitrophenylboronic acid linkage (5-nitrophenylboronic acid-PEGm (5-nPBA-PEGm)) to diols on mucic acid in the cMAP in order to inhibit aggregation in biological fluids. As an alternative, cMAP is covalently conjugated with PEG via two methods. First, a copolymer is prepared with alternating cMAP-PEG units that can form loops of PEG on the surface of the formulated siRNA-containing NPs. Second, an mPEG-cMAP-PEGm triblock polymer is synthesized that could lead to a PEG brush configuration on the surface of the formulated siRNA-containing NPs. The copolymer and triblock polymer are able to form stable siRNA-containing NPs without and with the addition of 5-nPBA-PEGm. Five formulations, (i) cMAP with 5-nPBA-PEGm, (ii) cMAP-PEG copolymer both (a) with and (b) without 5-nPBA-PEGm, and (iii) mPEG-cMAP-PEGm triblock polymer both (a) with and (b) without 5-nPBA-PEGm, are used to produce NPs in the 30-40 nm size range, and their circulation times are evaluated in mice using tail vein injections. The mPEG-cMAP-PEGm triblock polymer provides the siRNA-containing NP with the longest circulation time (5-10% of the formulation remains in circulation at 60 min postdosing), even when a portion of the excess cationic components used in the formulation is filtered away prior to injection. A NP formulation using the mPEG-cMAP-PEGm triblock polymer that is free of excess components could contain as much as ca. 30 wt % siRNA. PMID

  18. Immunochemical analysis of 3-phenoxybenzoic acid, a biomarker of forestry worker exposure to pyrethroid insecticides

    PubMed Central

    Ahn, Ki Chang; Gee, Shirley J.; Kim, Hee-Joo; Aronov, Pavel A.; Vega, Helen; Krieger, Robert I.

    2013-01-01

    Pyrethroid insecticides widely used in forestry, agricultural, industrial, and residential applications have potential for human exposure. Short sample preparation time and sensitive, economical high-throughput assays are needed for biomonitoring studies that analyze a large number of samples. An enzyme-linked immunosorbent assay (ELISA) was used for determining 3-phenoxybenzoic acid (3-PBA), a general urinary biomarker of exposure to some pyrethroid insecticides. A mixed-mode solid-phase extraction reduced interferences from acid hydrolyzed urine and gave 110±6% recoveries from spiked samples. The method limit of quantification was 2 μg/L. Urine samples were collected from forestry workers that harvest pine cone seeds where pyrethroid insecticides were applied at ten different orchards. At least four samples for each worker were collected in a 1-week period. The 3-PBA in workers classified as high, low, or no exposure based on job analysis over all sampling days was 6.40± 9.60 (n=200), 5.27±5.39 (n=52), and 3.56±2.64 ng/mL (n=34), respectively. Pair-wise comparison of the differences in least squares means of 3-PBA concentrations among groups only showed a significant difference between high and no exposure. Although this difference was not significant when 3-PBA excretion was normalized by creatinine excretion, the general trend was still apparent. No significant differences were observed among days or orchards. This ELISA method using a 96-well plate was performed as a high-throughput tool for analyzing around 300 urine samples measured in triplicate to provide data for workers exposure assessment. PMID:21717113

  19. Phenylboronic acid functionalized SBA-15 for sugar capture.

    PubMed

    Zhao, Yong-Hong; Shantz, Daniel F

    2011-12-01

    The synthesis and characterization of organic-inorganic hybrid materials that selectively capture sugars from model biomass hydrolysis mixtures are reported. 3-Aminophenylboronic acid (PBA) groups that can reversibly form cyclic esters with 1,2-diols, and 1,3-diols including sugars are attached to mesoporous SBA-15 via different synthetic protocols. In the first route, a coupling agent is used to link PBA and SBA-15, while in the second route poly(acrylic acid) brushes are first grafted from the surface of SBA-15 by surface-initiated atom transfer radical polymerization and PBA is then immobilized. The changes in pore structure, porosity, and pore size due to the loading of organic content are measured by powder X-ray diffraction and nitrogen porosimetry. The increase in organic content after each synthesis step is monitored by thermal gravimetric analysis. Fourier transform infrared spectroscopy and elemental analysis are used to characterize the chemical compositions of the hybrid materials synthesized. D-(+)-Glucose and D-(+)-xylose, being the most commonly present sugars in biomass, are chosen to evaluate the sugar adsorption capacity of the hybrid materials. It is found that the sugar adsorption capacity is determined by the loading of boronic acid groups on the hybrid materials, and the hybrid material synthesized via route two is much better than that through route one for sugar adsorption. Mathematical modeling of the adsorption data indicates that the Langmuir model best describes the sugar adsorption behavior of the hybrid material synthesized through route one, while the Freundlich model fits the data most satisfactorily for the hybrid material prepared via route two. The adsorption kinetics, reusability, and selectivity toward some typical chemicals in cellulose acidic hydrolysis mixtures are also investigated. PMID:22023050

  20. Neuroprotective Effects of Germinated Brown Rice in Rotenone-Induced Parkinson's-Like Disease Rats.

    PubMed

    Chompoopong, Supin; Jarungjitaree, Sunit; Punbanlaem, Tideeporn; Rungruang, Thanaporn; Chongthammakun, Sukumal; Kettawan, Aikkarach; Taechowisan, Thongchai

    2016-09-01

    The effects of germinated brown rice (GBR) on the motor deficits and the dopaminergic (DA) cell death were investigated in Parkinson's-like disease (PD) rats. Reactive oxidative species generated by chronic subcutaneous injection of rotenone (RT) lead to neuronal apoptosis particularly in the nigrostriatal DA system and produce many features of PD, bradykinesis, postural instability and rigidity. In this study, 4-phenylbutyric acid (4-PBA), previously reported to inhibit RT-induced DA cell death, was used as the positive control. Results show that pretreatment with GBR as well as 4-PBA significantly enhanced the motor activity after RT injection, and GBR affected significantly in open field test, only in the ambulation but not the mobility duration, and ameliorated the time to orient down (t-turn) and total time to descend the pole (t-total) in pole test as compared to RT group, but significantly lowered both t-turn and t-total only in 4-PBA group. The percentage of apoptotic cells in brain measured by flow cytometry and the inflammatory effect measured by ELISA of TNF-α showed significant increase in RT group as compared to the control (CT) group at P < 0.05. Apoptotic cells in RT group (85.98 %) showed a significant (P < 0.05) increase versus CT group (17.50 %), and this effect was attenuated in GBR+RT group by decreasing apoptotic cells (79.32 %), whereas, increased viable cells (17.94 %) versus RT group (10.79 %). GBR in GBR + RT group could decrease TNF-α both in the serum and in brain. In summary, GBR showed a neuroprotective effect in RT-induced PD rats, and it may be useful as a value-added functional food to prevent neurodegenerative disease or PD. PMID:27430236

  1. Peroxisome proliferator-activated receptor alpha acts as a mediator of endoplasmic reticulum stress-induced hepatocyte apoptosis in acute liver failure

    PubMed Central

    Zhang, Li; Ren, Feng; Zhang, Xiangying; Wang, Xinxin; Shi, Hongbo; Zhou, Li; Zheng, Sujun; Chen, Yu; Chen, Dexi; Li, Liying; Duan, Zhongping

    2016-01-01

    ABSTRACT Peroxisome proliferator-activated receptor α (PPARα) is a key regulator to ameliorate liver injury in cases of acute liver failure (ALF). However, its regulatory mechanisms remain largely undetermined. Endoplasmic reticulum stress (ER stress) plays an important role in a number of liver diseases. This study aimed to investigate whether PPARα activation inhibits ER stress-induced hepatocyte apoptosis, thereby protecting against ALF. In a murine model of D-galactosamine (D-GalN)- and lipopolysaccharide (LPS)-induced ALF, Wy-14643 was administered to activate PPARα, and 4-phenylbutyric acid (4-PBA) was administered to attenuate ER stress. PPARα activation ameliorated liver injury, because pre-administration of its specific inducer, Wy-14643, reduced the serum aminotransferase levels and preserved liver architecture compared with that of controls. The protective effect of PPARα activation resulted from the suppression of ER stress-induced hepatocyte apoptosis. Indeed, (1) PPARα activation decreased the expression of glucose-regulated protein 78 (Grp78), Grp94 and C/EBP-homologous protein (CHOP) in vivo; (2) the liver protection by 4-PBA resulted from the induction of PPARα expression, as 4-PBA pre-treatment promoted upregulation of PPARα, and inhibition of PPARα by small interfering RNA (siRNA) treatment reversed liver protection and increased hepatocyte apoptosis; (3) in vitro PPARα activation by Wy-14643 decreased hepatocyte apoptosis induced by severe ER stress, and PPARα inhibition by siRNA treatment decreased the hepatocyte survival induced by mild ER stress. Here, we demonstrate that PPARα activation contributes to liver protection and decreases hepatocyte apoptosis in ALF, particularly through regulating ER stress. Therefore, targeting PPARα could be a potential therapeutic strategy to ameliorate ALF. PMID:27482818

  2. Peroxisome proliferator-activated receptor alpha acts as a mediator of endoplasmic reticulum stress-induced hepatocyte apoptosis in acute liver failure.

    PubMed

    Zhang, Li; Ren, Feng; Zhang, Xiangying; Wang, Xinxin; Shi, Hongbo; Zhou, Li; Zheng, Sujun; Chen, Yu; Chen, Dexi; Li, Liying; Zhao, Caiyan; Duan, Zhongping

    2016-07-01

    Peroxisome proliferator-activated receptor α (PPARα) is a key regulator to ameliorate liver injury in cases of acute liver failure (ALF). However, its regulatory mechanisms remain largely undetermined. Endoplasmic reticulum stress (ER stress) plays an important role in a number of liver diseases. This study aimed to investigate whether PPARα activation inhibits ER stress-induced hepatocyte apoptosis, thereby protecting against ALF. In a murine model of D-galactosamine (D-GalN)- and lipopolysaccharide (LPS)-induced ALF, Wy-14643 was administered to activate PPARα, and 4-phenylbutyric acid (4-PBA) was administered to attenuate ER stress. PPARα activation ameliorated liver injury, because pre-administration of its specific inducer, Wy-14643, reduced the serum aminotransferase levels and preserved liver architecture compared with that of controls. The protective effect of PPARα activation resulted from the suppression of ER stress-induced hepatocyte apoptosis. Indeed, (1) PPARα activation decreased the expression of glucose-regulated protein 78 (Grp78), Grp94 and C/EBP-homologous protein (CHOP) in vivo; (2) the liver protection by 4-PBA resulted from the induction of PPARα expression, as 4-PBA pre-treatment promoted upregulation of PPARα, and inhibition of PPARα by small interfering RNA (siRNA) treatment reversed liver protection and increased hepatocyte apoptosis; (3) in vitro PPARα activation by Wy-14643 decreased hepatocyte apoptosis induced by severe ER stress, and PPARα inhibition by siRNA treatment decreased the hepatocyte survival induced by mild ER stress. Here, we demonstrate that PPARα activation contributes to liver protection and decreases hepatocyte apoptosis in ALF, particularly through regulating ER stress. Therefore, targeting PPARα could be a potential therapeutic strategy to ameliorate ALF. PMID:27482818

  3. Study on Synthesis, Characterization and Antiproliferative Activity of Novel Diisopropylphenyl Esters of Selected Fatty Acids.

    PubMed

    Reddy, Yasa Sathyam; Kaki, Shiva Shanker; Rao, Bala Bhaskara; Jain, Nishant; Vijayalakshmi, Penumarthy

    2016-01-01

    The present study describes the synthesis, characterization and evaluation of antiproliferative activity of novel diisopropylphenyl esters of alpha-linolenic acid (ALA), valproic acid (VA), butyric acid (BA) and 2-ethylhexanoic acid (2-EHA). These esters were chemically synthesized by the esterification of fatty acids with 2,6-diisopropylphenol and 2,4-diisopropylphenol (propofol). The structure of new conjugates viz. propofol-(alpha-linolenic acid) (2,6P-ALA and 2,4P-ALA), propofol-valproic acid (2,6P-VA and 2,4P-VA), propofol-butyric acid (2,6P-BA and 2,4P-BA) and propofol-(2-ethylhexanoic acid) (2,6P2-EHA and 2,4P-2-EHA) were characterized by FT-IR, NMR ((1)H, (13)C) and mass spectral data. The synthesized conjugates having more lipophilic character were tested for antiproliferative in vitro studies on A549, MDA-MB-231, HeLa, Mia-Pa-Ca and HePG2 cancer cell lines. All the conjugates showed specific growth inhibition on studied cancer cell lines. Among the synthesized esters, the conjugates synthesized from BA, VA and 2-EHA exhibited prominent growth inhibition against A549, HeLa, Mia-Pa-Ca and HePG2 cancer cell lines. The preliminary results suggest that the entire novel conjugates possess antiproliferative properties that reduce the proliferation of cancer cells in vitro. PMID:26666272

  4. Phenylboronic acid-functionalized polyamidoamine-mediated Bcl-2 siRNA delivery for inhibiting the cell proliferation.

    PubMed

    Wu, Di; Yang, Jiebing; Xing, Zhen; Han, Haobo; Wang, Tingting; Zhang, Aijun; Yang, Yan; Li, Quanshun

    2016-10-01

    In this study, the conjugation of phenylboronic acid (PBA) to amine-terminated polyamidoamine (PAMAM) was successfully conducted to prepare a tumor-targeted gene carrier PBA-functionalized PAMAM (PPP) for Bcl-2 siRNA delivery, using a heterobifunctional crosslinker NHS-PEG5k-Mal. The carrier possessed favorable capacity for siRNA condensation and could protect siRNA from the degradation against RNase and serum. The introduction of PBA could facilitate the cellular uptake and further transfection of Bcl-2 siRNA demonstrated by confocal laser scanning microscopy and flow cytometry. Meanwhile, PPP-mediated transfection of Bcl-2 siRNA could significantly inhibit the expression of Bcl-2 gene at both mRNA and protein levels. Furthermore, owing to the knock-down of Bcl-2, PPP/siRNA could significantly inhibit the cell proliferation by inducing the cell apoptosis, and also enhance the antitumor efficiency of doxorubicin by suppressing the resistance of tumor cells to chemotherapeutics. In conclusion, the PPP-mediated Bcl-2 siRNA delivery could potentially be an effective platform for solving the drug resistance and further achieving the combined chemotherapy and gene therapy in tumor treatment. PMID:27371891

  5. ER stress and autophagy are involved in the apoptosis induced by cisplatin in human lung cancer cells

    PubMed Central

    SHI, SHAOMIN; TAN, PING; YAN, BINGDI; GAO, RONG; ZHAO, JIANJUN; WANG, JING; GUO, JIA; LI, NING; MA, ZHONGSEN

    2016-01-01

    Cisplatin [cis-diamminedichloroplatinum II (CDDP)] is one of the most classical and effective chemotherapeutic drugs for the treatment of cancers including lung cancer. However, the presence of cisplatin resistance in cancer lowers its curative effect and limits its usage in the clinic. The aim of the present study was to investigate the underlying mechanisms of cisplatin resistance in lung cancer involving endoplasmic reticulum (ER) stress and autophagy. In the present study, we detected the effect of cisplatin on cell viability, ER stress and autophagy in lung cancer cell lines A549 and H460. We also tested the effects of ER stress and autophagy on apoptosis induced by cisplatin. The results showed that cisplatin induced apoptosis, ER stress and autophagy in lung cancer cell lines. In addition, the inhibition of ER stress by 4-phenylbutyric acid (4-PBA) or tauroursodeoxycholic acid sodium (TUDC) enhanced cisplatin-induced apoptosis in the human lung cancer cells. Meanwhile, combination treatment with the autophagic inhibitor 3-methyladenine (3-MA) or chloroquine (CQ) further increased the apoptosis induced by cisplatin in the human lung cancer cells. The present study provides a novel treatment strategy - cisplatin in combination with an autophagic inhibitor or an ER stress inhibitor leads to increased apoptosis in human lung cancer cells. PMID:26985651

  6. ER stress and autophagy are involved in the apoptosis induced by cisplatin in human lung cancer cells.

    PubMed

    Shi, Shaomin; Tan, Ping; Yan, Bingdi; Gao, Rong; Zhao, Jianjun; Wang, Jing; Guo, Jia; Li, Ning; Ma, Zhongsen

    2016-05-01

    Cisplatin [cis-diamminedichloroplatinum II (CDDP)] is one of the most classical and effective chemotherapeutic drugs for the treatment of cancers including lung cancer. However, the presence of cisplatin resistance in cancer lowers its curative effect and limits its usage in the clinic. The aim of the present study was to investigate the underlying mechanisms of cisplatin resistance in lung cancer involving endoplasmic reticulum (ER) stress and autophagy. In the present study, we detected the effect of cisplatin on cell viability, ER stress and autophagy in lung cancer cell lines A549 and H460. We also tested the effects of ER stress and autophagy on apoptosis induced by cisplatin. The results showed that cisplatin induced apoptosis, ER stress and autophagy in lung cancer cell lines. In addition, the inhibition of ER stress by 4-phenylbutyric acid (4-PBA) or tauroursodeoxycholic acid sodium (TUDC) enhanced cisplatin-induced apoptosis in the human lung cancer cells. Meanwhile, combination treatment with the autophagic inhibitor 3-methyladenine (3-MA) or chloroquine (CQ) further increased the apoptosis induced by cisplatin in the human lung cancer cells. The present study provides a novel treatment strategy - cisplatin in combination with an autophagic inhibitor or an ER stress inhibitor leads to increased apoptosis in human lung cancer cells. PMID:26985651

  7. Efficient nuclear drug translocation and improved drug efficacy mediated by acidity-responsive boronate-linked dextran/cholesterol nanoassembly.

    PubMed

    Zhu, Jing-Yi; Lei, Qi; Yang, Bin; Jia, Hui-Zhen; Qiu, Wen-Xiu; Wang, Xuli; Zeng, Xuan; Zhuo, Ren-Xi; Feng, Jun; Zhang, Xian-Zheng

    2015-06-01

    The present study reported a lysosome-acidity-targeting bio-responsive nanovehicle self-assembled from dextran (Dex) and phenylboronic acid modified cholesterol (Chol-PBA), aiming at the nucleus-tropic drug delivery. The prominent advantage of this assembled nanoconstruction arose from its susceptibility to acidity-labile dissociation concurrently accompanied with the fast liberation of encapsulated drugs, leading to efficient nuclear drug translocation and consequently favorable drug efficacy. By elaborately exploiting NH4Cl pretreatment to interfere with the cellular endosomal acidification progression, this study clearly evidenced at a cellular level the strong lysosomal-acidity dependency of nuclear drug uptake efficiency, which was shown to be the main factor influencing the drug efficacy. The boronate-linked nanoassembly displayed nearly no cytotoxicity and can remain structural stability under the simulated physiological conditions including 10% serum and the normal blood sugar concentration. The cellular exposure to cholesterol was found to bate the cellular uptake of nanoassembly in a dose-dependent manner, suggesting a cholesterol-associated mechanism of the intracellular internalization. The in vivo antitumor assessment in xenograft mouse models revealed the significant superiority of DOX-loaded Dex/Chol-PBA nanoassembly over the controls including free DOX and the DOX-loaded non-sensitive Dex-Chol, as reflected by the more effective tumor-growth inhibition and the better systematic safety. In terms of the convenient preparation, sensitive response to lysosomal acidity and efficient nuclear drug translocation, Dex/Chol-PBA nanoassembly derived from natural materials shows promising potentials as the nanovehicle for nucleus-tropic drug delivery especially for antitumor agents. More attractively, this study offers a deeper insight into the mechanism concerning the contribution of acidity-responsive delivery to the enhanced chemotherapy performance. PMID

  8. Induction of Apoptosis Coupled to Endoplasmic Reticulum Stress through Regulation of CHOP and JNK in Bone Marrow Mesenchymal Stem Cells from Patients with Systemic Lupus Erythematosus.

    PubMed

    Guo, Genkai; Meng, Yan; Tan, Wei; Xia, Yunfei; Cheng, Chun; Chen, Xiaolan; Gu, Zhifeng

    2015-01-01

    Previous studies indicated that bone marrow mesenchymal stem cells (BM-MSCs) from patients with systemic lupus erythematosus (SLE) exhibited the phenomenon of apoptosis. In this study, we aimed to investigate whether apoptosis of BM-MSCs from SLE patients were dysregulated. In this paper, endoplasmic reticulum stress (ERS) was evidenced by increased expression of phosphorylated protein kinase RNA-like ER kinase (PERK) and inositol-requiring protein-1 (IRE-1). We also found the activation of downstream target eukaryotic translation initiator factor 2α (eIF 2α) and CCAAT/enhancer-binding protein- (C/EBP-) homologous protein (CHOP) in BM-MSCs from SLE patients. Interestingly, we discovered that 4-phenylbutyric acid (4-PBA), a selective inhibitor of ERS, blocked the apoptosis of BM-MSCs from SLE patients and alleviated the level of Jun N-terminal kinase1/2 (JNK1/2) and CHOP. Furthermore, blockage of PERK signaling expression by siRNA not only significantly reduced the expression of CHOP, but also activated the anti-apoptotic regulator B-cell lymphoma-2 (Bcl-2). Blockage of IRE-1 or JNK1/2 by siRNA resulted in the decreased expression of JNK1/2 and proapoptosis protein Bcl-2 associated protein X (BAX). These results implicated that ERS-mediated apoptosis was a critical determinant of BM-MSCs from SLE patients. PMID:26090483

  9. Human Surfactant Protein A2 Gene Mutations Impair Dimmer/Trimer Assembly Leading to Deficiency in Protein Sialylation and Secretion

    PubMed Central

    Shen, Haitao; Li, Hui; Yang, Wenbing; Pan, Bing; Huang, Guowei; Lin, Guangyu; Ma, Lian; Willard, Belinda; Gu, Jiang; Zheng, Lemin; Wang, Yongyu

    2012-01-01

    Surfactant protein A2 (SP-A2) plays an essential role in surfactant metabolism and lung host defense. SP-A2 mutations in the carbohydrate recognition domain have been related to familial pulmonary fibrosis and can lead to a recombinant protein secretion deficiency in vitro. In this study, we explored the molecular mechanism of protein secretion deficiency and the subsequent biological effects in CHO-K1 cells expressing both wild-type and several different mutant forms of SP-A2. We demonstrate that the SP-A2 G231V and F198S mutants impair the formation of dimmer/trimer SP-A2 which contributes to the protein secretion defect. A deficiency in sialylation, but not N-linked glycosylation, is critical to the observed dimmer/trimer impairment-induced secretion defect. Furthermore, both mutant forms accumulate in the ER and form NP-40-insoluble aggregates. In addition, the soluble mutant SP-A2 could be partially degraded through the proteasome pathway but not the lysosome or autophagy pathway. Intriguingly, 4-phenylbutyrate acid (4-PBA), a chemical chaperone, alleviates aggregate formation and partially rescued the protein secretion of SP-A2 mutants. In conclusion, SP-A2 G231V and F198S mutants impair the dimmer/trimer assembly, which contributes to the protein sialylation and secretion deficiency. The intracellular protein mutants could be partially degraded through the proteasome pathway and also formed aggregates. The treatment of the cells with 4-PBA resulted in reduced aggregation and rescued the secretion of mutant SP-A2. PMID:23056344

  10. Thermo-responsive behavior of borinic acid polymers: experimental and molecular dynamics studies.

    PubMed

    Wan, Wen-Ming; Zhou, Peng; Cheng, Fei; Sun, Xiao-Li; Lv, Xin-Hu; Li, Kang-Kang; Xu, Hai; Sun, Miao; Jäkle, Frieder

    2015-09-28

    The thermo-responsive properties of borinic acid polymers were investigated by experimental and molecular dynamics simulation studies. The homopolymer poly(styrylphenyl(tri-iso-propylphenyl)borinic acid) (PBA) exhibits an upper critical solution temperature (UCST) in polar organic solvents that is tunable over a wide temperature range by addition of small amounts of H2O. The UCST of a 1 mg mL(-1) PBA solution in DMSO can be adjusted from 20 to 100 °C by varying the H2O content from ∼0-2.5%, in DMF from 0 to 100 °C (∼3-17% H2O content), and in THF from 0 to 60 °C (∼4-19% H2O). The UCST increases almost linearly from the freezing point of the solvent with higher freezing point to the boiling point of the solvent with the lower boiling point. The mechanistic aspects of this process were investigated by molecular dynamics simulations. The latter indicate rapid and strong hydrogen-bond formation between BOH moieties and H2O molecules, which serve as crosslinkers to form an insoluble network. Our results suggest that borinic acid-containing polymers are promising as new "smart" materials, which display thermo-responsive properties that are tunable over a wide temperature range. PMID:26256052

  11. Direct block of the cystic fibrosis transmembrane conductance regulator Cl(-) channel by butyrate and phenylbutyrate.

    PubMed

    Linsdell, P

    2001-01-12

    Chloride permeation through the cystic fibrosis transmembrane conductance regulator (CFTR) Cl(-) channel is inhibited by a broad range of intracellular organic anions. Here it is shown, using patch clamp recording from CFTR-transfected mammalian cell lines, that the fatty acids butyrate and 4-phenylbutyrate cause a voltage-dependent block of CFTR Cl(-) currents when applied to the cytoplasmic face of membrane patches, with apparent K(d)s (at 0 mV) of 29.6 mM for butyrate and 6.6 mM for 4-phenylbutyrate. At the single channel level, both these fatty acids caused an apparent reduction in CFTR current amplitude, suggesting a kinetically fast blocking mechanism. The concentration-dependence of block suggests that CFTR-mediated Cl(-) currents in vivo may be affected by both 4-phenylbutyrate used in the treatment of various diseases, including cystic fibrosis, and by butyrate produced endogenously within the colonic lumen. PMID:11164382

  12. Phenylbutyric acid protects against spatial memory deficits in a model of repeated electroconvulsive therapy.

    PubMed

    Yao, Zhao-Hui; Kang, Xiang; Yang, Liu; Niu, Yi; Lu, Ye; Gong, Cheng-Xin; Tian, Qing; Wang, Jian-Zhi

    2014-05-01

    Repeated electroconvulsive therapy (rECT) is widely applied in the treatment of refractory depression. Among the side effects of rECT, memory impairment is noticeable and needs effective protection. In this study, by employing a recognized repeated electroconvulsive shock (rECS) rat model, we found that rECS induced the significant spatial memory retention deficits with the simultaneous decreases in long-term potential (LTP), enhanced excitable postsynaptic potentials (EPSP), population spike (PS) and input/output curve in perforant pathway-dentate gyrus (PP-DG), but had no obvious neuron loss or dentritic spine loss in the brain by Nissle or Golgi stainings. Furthermore, the increased synaptic proteins of NR2A/B, PSD93, PSD95, the immediate early gene c-Fos and CREB protein were detected in hippocampus of rECS rats. rECS was also found to cause enhanced axon reorganization in DG region of hippocampus by Timm staining. Intraperitoneal injection of phenylbutyric acid (PBA), an aromatic short chain fatty acid acting as a molecule chaperon, could prevent rats from the rECS-induced memory deficits and synaptic potential enhancement by decreasing the levels of the abnormally increased memory-associated proteins and enhanced axon reorganization in hippocampus. Our data suggested that PBA might be potentially used to attenuate the rECS-induced memory impairment. PMID:24712645

  13. Bushen Zhuangjin decoction inhibits TM-induced chondrocyte apoptosis mediated by endoplasmic reticulum stress

    PubMed Central

    LIN, PINGDONG; WENG, XIAPING; LIU, FAYUAN; MA, YUHUAN; CHEN, HOUHUANG; SHAO, XIANG; ZHENG, WENWEI; LIU, XIANXIANG; YE, HONGZHI; LI, XIHAI

    2015-01-01

    Chondrocyte apoptosis triggered by endoplasmic reticulum (ER) stress plays a vital role in the pathogenesis of osteoarthritis (OA). Bushen Zhuangjin decoction (BZD) has been widely used in the treatment of OA. However, the cellular and molecular mechanisms responsible for the inhibitory effects of BZD on chondrocyte apoptosis remain to be elucidated. In the present study, we investigated the effects of BZD on ER stress-induced chondrocyte apoptosis using a chondrocyte in vitro model of OA. Chondrocytes obtained from the articular cartilage of the knee joints of Sprague Dawley (SD) rats were detected by immunohistochemical staining for type II collagen. The ER stress-mediated apoptosis of tunicamycin (TM)-stimulated chondrocytes was detected using 4-phenylbutyric acid (4-PBA). We found that 4-PBA inhibited TM-induced chondrocyte apoptosis, which confirmed the successful induction of chondrocyte apoptosis. BZD enhanced the viability of the TM-stimulated chondrocytes in a dose- and time-dependent manner, as shown by MTT assay. The apoptotic rate and the loss of mitochondrial membrane potential (ΔΨm) of the TM-stimulated chondrocytes treated with BZD was markedly decreased compared with those of chondrocytes not treated with BZD, as shown by 4′,6-diamidino-2-phenylindole (DAPI) staining, Annexin V-FITC binding assay and JC-1 assay. To further elucidate the mechanisms responsible for the inhibitory effects of BZD on TM-induced chondrocyte apoptosis mediated by ER stress, the mRNA and protein expression levels of binding immunoglobulin protein (Bip), X-box binding protein 1 (Xbp1), activating transcription factor 4 (Atf4), C/EBP-homologous protein (Chop), caspase-9, caspase-3, B-cell lymphoma 2 (Bcl-2) and Bcl-2-associated X protein (Bax) were measured by reverse transcription-polymerase chain reaction (RT-PCR) and western blot analysis. In the TM-stimulated chondrocytes treated with BZD, the mRNA and protein expression levels of Bip, Atf4, Chop, caspase-9, caspase-3

  14. Junctional abnormalities in human airway epithelial cells expressing F508del CFTR

    PubMed Central

    Stauffer, Brandon; Moriarty, Hannah K.; Kim, Agnes H.; McCarty, Nael A.; Koval, Michael

    2015-01-01

    Cystic fibrosis (CF) has a profound impact on airway physiology. Accumulating evidence suggests that intercellular junctions are impaired in CF. We examined changes to CF transmembrane conductance regulator (CFTR) function, tight junctions, and gap junctions in NuLi-1 (CFTRwt/wt) and CuFi-5 (CFTRΔF508/ΔF508) cells. Cells were studied at air-liquid interface (ALI) and compared with primary human bronchial epithelial cells. On the basis of fluorescent lectin binding, the phenotype of the NuLi-1 and CuFi-5 cells at week 8 resembled that of serous, glycoprotein-rich airway cells. After week 7, CuFi-5 cells possessed 130% of the epithelial Na+ channel activity and 17% of the CFTR activity of NuLi-1 cells. In both cell types, expression levels of CFTR were comparable to those in primary airway epithelia. Transepithelial resistance of NuLi-1 and CuFi-5 cells stabilized during maturation in ALI culture, with significantly lower transepithelial resistance for CuFi-5 than NuLi-1 cells. We also found that F508del CFTR negatively affects gap junction function in the airway. NuLi-1 and CuFi-5 cells express the connexins Cx43 and Cx26. While both connexins were properly trafficked by NuLi-1 cells, Cx43 was mistrafficked by CuFi-5 cells. Cx43 trafficking was rescued in CuFi-5 cells treated with 4-phenylbutyric acid (4-PBA), as assessed by intracellular dye transfer. 4-PBA-treated CuFi-5 cells also exhibited an increase in forskolin-induced CFTR-mediated currents. The Cx43 trafficking defect was confirmed using IB3-1 cells and found to be corrected by 4-PBA treatment. These data support the use of NuLi-1 and CuFi-5 cells to examine the effects of F508del CFTR expression on tight junction and gap junction function in the context of serous human airway cells. PMID:26115671

  15. Junctional abnormalities in human airway epithelial cells expressing F508del CFTR.

    PubMed

    Molina, Samuel A; Stauffer, Brandon; Moriarty, Hannah K; Kim, Agnes H; McCarty, Nael A; Koval, Michael

    2015-09-01

    Cystic fibrosis (CF) has a profound impact on airway physiology. Accumulating evidence suggests that intercellular junctions are impaired in CF. We examined changes to CF transmembrane conductance regulator (CFTR) function, tight junctions, and gap junctions in NuLi-1 (CFTR(wt/wt)) and CuFi-5 (CFTR(ΔF508/ΔF508)) cells. Cells were studied at air-liquid interface (ALI) and compared with primary human bronchial epithelial cells. On the basis of fluorescent lectin binding, the phenotype of the NuLi-1 and CuFi-5 cells at week 8 resembled that of serous, glycoprotein-rich airway cells. After week 7, CuFi-5 cells possessed 130% of the epithelial Na(+) channel activity and 17% of the CFTR activity of NuLi-1 cells. In both cell types, expression levels of CFTR were comparable to those in primary airway epithelia. Transepithelial resistance of NuLi-1 and CuFi-5 cells stabilized during maturation in ALI culture, with significantly lower transepithelial resistance for CuFi-5 than NuLi-1 cells. We also found that F508del CFTR negatively affects gap junction function in the airway. NuLi-1 and CuFi-5 cells express the connexins Cx43 and Cx26. While both connexins were properly trafficked by NuLi-1 cells, Cx43 was mistrafficked by CuFi-5 cells. Cx43 trafficking was rescued in CuFi-5 cells treated with 4-phenylbutyric acid (4-PBA), as assessed by intracellular dye transfer. 4-PBA-treated CuFi-5 cells also exhibited an increase in forskolin-induced CFTR-mediated currents. The Cx43 trafficking defect was confirmed using IB3-1 cells and found to be corrected by 4-PBA treatment. These data support the use of NuLi-1 and CuFi-5 cells to examine the effects of F508del CFTR expression on tight junction and gap junction function in the context of serous human airway cells. PMID:26115671

  16. Polymeric assembly of hyperbranched building blocks to establish tunable nanoplatforms for lysosome acidity-responsive gene/drug co-delivery.

    PubMed

    Jia, Hui-Zhen; Zhang, Wei; Wang, Xu-Li; Yang, Bin; Chen, Wei-Hai; Chen, Si; Chen, Gang; Zhao, Yi-Fang; Zhuo, Ren-Xi; Feng, Jun; Zhang, Xian-Zheng

    2015-07-01

    This study plans to develop a nanoparticle technology that can assemble different polymeric "building blocks" with various desired functionalities into one nanosystem in a pH-dependent manner. For this purpose, polymeric building blocks were specifically designed with hyperbranched architectures, and orthogonal pH-reversible phenylboronic acid-diols were taken as "joints" to integrate them together. To verify the idea, a corona-core dual-polymer nanoassembly was prepared as the vehicle for lysosomotropic gene/drug co-delivery. Phenylboronic acid modified hyperbranched oligoethylenimine (OEI-PBA) was arranged to cluster around the hydrophobic core composed of hyperbranched polyglycerol, just by mixing two polymers in an appropriate ratio at neutral conditions. Compared with the parent OEI-PBA, this nanoassembly demonstrated better capture of plasmid DNA, highly enhanced activity for cellular transport and gene transfection (up to 100 fold), the ability to further load hydrophobic drugs, lysosome acidity-targeting pH-dependent release of both carried cargoes, and improved cell-biocompatibility. To evaluate its potential for combinational gene/drug therapy, in vitro experiments using the therapeutic p53 gene and antitumor doxorubicin as models were carried out. This intracellular co-delivery led to apparently synergetic anti-cancer effects in cultured cancer cells. This dynamic paradigm shows interesting features including easy manipulation, reversible conjugation, lysosome-targeting pH-responsiveness, high co-delivery efficiency, and functional expandability by further accommodating other building blocks. PMID:26221940

  17. Phenylboronic Acid Solid Phase Extraction Cleanup and Isotope Dilution Liquid Chromatography-Tandem Mass Spectrometry for the Determination of Florfenicol Amine in Fish Muscles.

    PubMed

    Sin, Della Wai-Mei; Ho, Clare; Wong, Yiu-Tung

    2015-01-01

    Florfenicol (FFC) residues in foods are regulated as the sum of florfenicol and its metabolites measured as florfenicol amine (FFA). An isotope dilution LC-MS/MS method utilizing phenylboronic acid (PBA) SPE cleanup is established for the accurate determination of FFA in fish muscles (i.e., salmon and tilapia) after acid catalyzed hydrolysis. Comparisons of the PBA SPE cleanup procedure with other cleanup procedures such as mixed-mode cationic (MCX) SPE and solid supported liquid-liquid extraction were performed. Quantification of FFA in fish muscles was accomplished by using matrix-matched calibration with FFA-D3 as the internal standard. The method was validated with FFA fortified fish muscles at three different levels (50, 100, and 200 μg/kg). Conversion of FFC to FFA by acid catalyzed hydrolysis was evaluated and found to be ≥88%. The recoveries of FFA in fish muscles at the three fortification levels ranged from 89 to 106%, and RSDs were ≤9% in all cases. The LOD values in salmon and tilapia muscles were 0.13 and 1.64 μg/kg, respectively. The LOQ values in salmon and tilapia muscles were 0.29 and 4.13 μg/kg, respectively. This method is suitable for the application in routine control of FFC in fishes according to its residue definition. PMID:26025252

  18. Angiotensin 1-7 Protects against Angiotensin II-Induced Endoplasmic Reticulum Stress and Endothelial Dysfunction via Mas Receptor

    PubMed Central

    Murugan, Dharmani; Lau, Yeh Siang; Lau, Wai Chi; Mustafa, Mohd Rais; Huang, Yu

    2015-01-01

    Angiotensin 1–7 (Ang 1–7) counter-regulates the cardiovascular actions of angiotensin II (Ang II). The present study investigated the protective effect of Ang 1–7 against Ang II-induced endoplasmic reticulum (ER) stress and endothelial dysfunction. Ex vivo treatment with Ang II (0.5 μM, 24 hours) impaired endothelium-dependent relaxation in mouse aortas; this harmful effect of Ang II was reversed by co-treatment with ER stress inhibitors, l4-phenylbutyric acid (PBA) and tauroursodeoxycholic acid (TUDCA) as well as Ang 1–7. The Mas receptor antagonist, A779, antagonized the effect of Ang 1–7. The elevated mRNA expression of CHOP, Grp78 and ATF4 or protein expression of p-eIF2α and ATF6 (ER stress markers) in Ang II-treated human umbilical vein endothelial cells (HUVECs) and mouse aortas were blunted by co-treatment with Ang 1–7 and the latter effect was reversed by A779. Furthermore, Ang II-induced reduction in both eNOS phosphorylation and NO production was inhibited by Ang 1–7. In addition, Ang 1–7 decreased the levels of ER stress markers and augmented NO production in HUVECs treated with ER stress inducer, tunicamycin. The present study provides new evidence for functional antagonism between the two arms of the renin-angiotensin system in endothelial cells by demonstrating that Ang 1–7 ameliorates Ang II-stimulated ER stress to raise NO bioavailability, and subsequently preserves endothelial function. PMID:26709511

  19. Phenylbutyrate Is Bacteriostatic against Mycobacterium tuberculosis and Regulates the Macrophage Response to Infection, Synergistically with 25-Hydroxy-Vitamin D3.

    PubMed

    Coussens, Anna K; Wilkinson, Robert J; Martineau, Adrian R

    2015-07-01

    Adjunctive vitamin D treatment for pulmonary tuberculosis enhances resolution of inflammation but has modest effects on bacterial clearance. Sodium 4-phenylbutyrate (PBA) is in clinical use for a range of conditions and has been shown to synergise with vitamin D metabolites to upregulate cathelicidin antimicrobial peptide (CAMP) expression. We investigated whether clinically attainable plasma concentrations of PBA (0.4-4 mM) directly affect Mycobacterium tuberculosis (Mtb) growth and human macrophage and PBMC response to infection. We also tested the ability of PBA to enhance the immunomodulatory actions of the vitamin D metabolite 25(OH)D3 during infection and synergistically inhibit intracellular Mtb growth. PBA inhibited Mtb growth in broth with an MIC99 of 1 mM, which was reduced to 0.25 mM by lowering pH. During human macrophage infection, PBA treatment restricted Mtb uptake, phagocytic receptor expression and intracellular growth in a dose-dependent manner. PBA independently regulated CCL chemokine secretion and induced expression of the antimicrobial LTF (lactoferrin), the anti-inflammatory PROC (protein C) and multiple genes within the NLRP3 inflammasome pathway. PBA co-treatment with 25(OH)D3 synergistically modulated expression of numerous vitamin D-response genes, including CAMP, CYP24A1, CXCL10 and IL-37. This synergistic effect was dependent on MAPK signalling, while the effect of PBA on LTF, PROC and NLRP3 was MAPK-independent. During PBA and 25(OH)D3 co-treatment of human macrophages, in the absence of exogenous proteinase 3 (PR3) to activate cathelicidin, Mtb growth restriction was dominated by the effect of PBA, while the addition of PR3 enhanced growth restriction by 25(OH)D3 and PBA co-treatment. This suggests that PBA augments vitamin D-mediated cathelicidin-dependent Mtb growth restriction by human macrophages and independently induces antimicrobial and anti-inflammatory action. Therefore through both host-directed and bacterial

  20. Mechanical properties of a waterborne pressure-sensitive adhesive with a percolating poly(acrylic acid)-based diblock copolymer network: effect of pH.

    PubMed

    Gurney, Robert S; Morse, Andrew; Siband, Elodie; Dupin, Damien; Armes, Steven P; Keddie, Joseph L

    2015-06-15

    Copolymerizing an acrylic acid comonomer is often beneficial for the adhesive properties of waterborne pressure-sensitive adhesives (PSAs). Here, we demonstrate a new strategy in which poly(acrylic acid) (PAA) is distributed as a percolating network within a PSA film formed from a polymer colloid. A diblock copolymer composed of PAA and poly(n-butyl acrylate) (PBA) blocks was synthesized using reversible addition-fragmentation chain transfer (RAFT) polymerization and adsorbed onto soft acrylic latex particles prior to their film formation. The thin adsorbed shells on the particles create a percolating network that raises the elastic modulus, creep resistance and tensile strength of the final film. When the film formation occurs at pH 10, ionomeric crosslinking occurs, and high tack adhesion is obtained in combination with high creep resistance. The results show that the addition of an amphiphilic PAA-b-PBA diblock copolymer (2.0 wt.%) to a soft latex provides a simple yet effective means of adjusting the mechanical and adhesive properties of the resulting composite film. PMID:25706199

  1. IIT B52 Antifoam Impact Upon PBA Hydrolysis Kinetics

    SciTech Connect

    Baich, M.A.

    2001-06-04

    One of the alternatives to processing the highly radioactive salt solutions in the SRS Waste Tanks is to precipitate the radioactive cesium with sodium tetraphenylborate and then concentrate and wash the precipitate slurry for subsequent processing in the Defense Waste Processing Facility (DWPF). This alternative salt disposition process is called the Small Tank Tetraphenylborate Precipitation process (STTP). In the STTP precipitation process, soluble ions of cesium, potassium and ammonium are precipitated as insoluble TPB (tetraphenylborate) salts. Strontium, uranium, and plutonium are sorbed on solid monosodium titanate (MST). The resulting slurry, which now contains most of the radionuclides as insoluble solids, is filtered to concentrate the solids. After washing the solids to reduce the concentration of soluble sodium salts in the slurry, the precipitate is stored until it can be further processed and incorporated into glass in the DWPF. The decontaminated salt solution or filtrate is transferred to Z Area for processing and disposal as Saltstone.

  2. ER stress drives Lipocalin 2 upregulation in prostate cancer cells in an NF-κB-dependent manner

    PubMed Central

    2011-01-01

    Background Tumor cells adapt to endoplasmic reticulum (ER) stress through a set of conserved intracellular pathways, as part of a process termed the unfolded protein response (UPR). The expression of UPR genes/proteins correlates with increasing progression and poor clinical outcome of several tumor types, including prostate cancer. UPR signaling can activate NF-κB, a master regulator of transcription of pro-inflammatory, tumorigenic cytokines. Previous studies have shown that Lipocalin 2 (Lcn2) is upregulated in several epithelial cancers, including prostate cancer, and recently Lcn2 was implicated as a key mediator of breast cancer progression. Here, we hypothesize that the tumor cell UPR regulates Lcn2 production. Methods We interrogated Lcn2 regulation in murine and human prostate cancer cells undergoing pharmacological and physiological ER stress, and tested UPR and NF-κB dependence by using pharmacological inhibitors of these signaling pathways. Results Induction of ER stress using thapsigargin (Tg), a canonical pharmacologic ER stress inducer, or via glucose deprivation, a physiologic ER stressor present in the tumor microenvironment, upregulates LCN2 production in murine and human prostate cancer cells. Inhibition of the UPR using 4-phenylbutyric acid (PBA) dramatically decreases Lcn2 transcription and translation. Inhibition of NF-κB in prostate cancer cells undergoing Tg-mediated ER stress by BAY 11-7082 abrogates Lcn2 upregulation. Conclusions We conclude that the UPR activates Lcn2 production in prostate cancer cells in an NF-κB-dependent manner. Our results imply that the observed upregulation of Lipocalin 2 in various types of cancer cells may be the direct consequence of concomitant UPR activation, and that the ER stress/Lipocalin 2 axis is a potential new target for intervention in cancer progression. PMID:21649922

  3. Unfolded protein response (UPR) signaling regulates arsenic trioxide-mediated macrophage innate immune function disruption

    SciTech Connect

    Srivastava, Ritesh K.; Li, Changzhao; Chaudhary, Sandeep C.; Ballestas, Mary E.; Elmets, Craig A.; Robbins, David J.; Matalon, Sadis; Deshane, Jessy S.; Afaq, Farrukh; Bickers, David R.; Athar, Mohammad

    2013-11-01

    Arsenic exposure is known to disrupt innate immune functions in humans and in experimental animals. In this study, we provide a mechanism by which arsenic trioxide (ATO) disrupts macrophage functions. ATO treatment of murine macrophage cells diminished internalization of FITC-labeled latex beads, impaired clearance of phagocytosed fluorescent bacteria and reduced secretion of pro-inflammatory cytokines. These impairments in macrophage functions are associated with ATO-induced unfolded protein response (UPR) signaling pathway characterized by the enhancement in proteins such as GRP78, p-PERK, p-eIF2α, ATF4 and CHOP. The expression of these proteins is altered both at transcriptional and translational levels. Pretreatment with chemical chaperon, 4-phenylbutyric acid (PBA) attenuated the ATO-induced activation in UPR signaling and afforded protection against ATO-induced disruption of macrophage functions. This treatment also reduced ATO-mediated reactive oxygen species (ROS) generation. Interestingly, treatment with antioxidant N-acetylcysteine (NAC) prior to ATO exposure, not only reduced ROS production and UPR signaling but also improved macrophage functions. These data demonstrate that UPR signaling and ROS generation are interdependent and are involved in the arsenic-induced pathobiology of macrophage. These data also provide a novel strategy to block the ATO-dependent impairment in innate immune responses. - Highlights: • Inorganic arsenic to humans and experimental animals disrupt innate immune responses. • The mechanism underlying arsenic impaired macrophage functions involves UPR signaling. • Chemical chaperon attenuates arsenic-mediated macrophage function impairment. • Antioxidant, NAC blocks impairment in arsenic-treated macrophage functions.

  4. Monitoring of Total Type II Pyrethroid Pesticides in Citrus Oils and Water by Converting to a Common Product 3-Phenoxybenzoic Acid

    PubMed Central

    McCoy, Mark R.; Yang, Zheng; Fu, Xun; Ahn, Ki Chang; Gee, Shirley J.; Bom, David C.; Zhong, Ping; Chang, Dan; Hammock, Bruce D.

    2012-01-01

    Pyrethroids are a class of insecticides that are becoming increasingly popular in agricultural and home use applications. Sensitive assays for pyrethroid insecticides in complex matrices are difficult both with instrumental and immunochemical methods. Environmental analysis of the pyrethroids by immunoassay requires either knowing which pyrethroids contaminate the source or the use of non-specific antibodies with cross reactivities to a class of compounds. We describe an alternative method that converts the type-II-pyrethroids to a common chemical product, 3-phenoxybenzoic acid (3-PBA), prior to analysis. This method is much more sensitive than detecting the parent compound, and it is much easier to detect a single compound rather than an entire class of compounds. This is useful in screening for pyrethroids as a class or in situations where a single type of pyrethroid is used. We demonstrated this technique in both citrus oils and environmental water samples with conversion rates of the pyrethroid to 3-PBA that range from 45%-75% and methods that require no extraction steps for either the immunoassay or LC-MS/MS techniques. Limits of detection for this technique applied to orange oil are 5 nM, 2 μM, and 0.8 μM when detected by LC-MS/MS, GC-MS, and immunoassay respectively. The limit of detection for pyrethroids in water when detected by immunoassay was 2 nM. PMID:22486225

  5. Aging induced endoplasmic reticulum stress alters sleep and sleep homeostasis.

    PubMed

    Brown, Marishka K; Chan, May T; Zimmerman, John E; Pack, Allan I; Jackson, Nicholas E; Naidoo, Nirinjini

    2014-06-01

    Alterations in the quality, quantity, and architecture of baseline and recovery sleep have been shown to occur during aging. Sleep deprivation induces endoplasmic reticular (ER) stress and upregulates a protective signaling pathway termed the unfolded protein response. The effectiveness of the adaptive unfolded protein response is diminished by age. Previously, we showed that endogenous chaperone levels altered recovery sleep in Drosophila melanogaster. We now report that acute administration of the chemical chaperone sodium 4-phenylbutyrate (PBA) reduces ER stress and ameliorates age-associated sleep changes in Drosophila. PBA consolidates both baseline and recovery sleep in aging flies. The behavioral modifications of PBA are linked to its suppression of ER stress. PBA decreased splicing of X-box binding protein 1 and upregulation of phosphorylated elongation initiation factor 2 α, in flies that were subjected to sleep deprivation. We also demonstrate that directly activating ER stress in young flies fragments baseline sleep and alters recovery sleep. Alleviating prolonged or sustained ER stress during aging contributes to sleep consolidation and improves recovery sleep or sleep debt discharge. PMID:24444805

  6. Reversible Bacterial Adhesion on Mixed Poly(dimethylaminoethyl methacrylate)/Poly(acrylamidophenyl boronic acid) Brush Surfaces.

    PubMed

    Xiong, Xinhong; Wu, Zhaoqiang; Yu, Qian; Xue, Lulu; Du, Jun; Chen, Hong

    2015-11-10

    A simple and versatile method for the preparation of surfaces to control bacterial adhesion is described. Substrates were first treated with two catechol-based polymerization initiators, one for thermal initiation and one for visible-light photoinitiation. Graft polymerization in sequence of dimethylaminoethyl methacrylate (DMAEMA) and 3-acrylamidebenzene boronic acid (BA) from the surface-bound initiators to form mixed polymer brushes on the substrate was then carried out. The PDMAEMA grafts were thermally initiated and the PBA grafts were visible-light-photoinitiated. Gold, poly(vinyl chloride) (PVC), and poly(dimethylsiloxane) (PDMS) were used as model substrates. X-ray photoelectron spectroscopy (XPS), Fourier transform infrared (FT-IR), and ellipsometry analysis confirmed the successful grafting of PDMAEMA/PBA mixed brushes. We demonstrated that the resulting surfaces showed charge-reversal properties in response to change of pH. The transition in surface charge at a specific pH allowed the surface to be reversibly switched from bacteria-adhesive to bacteria-resistant. At pH 4.5, below the isoelectric points (IEP, pH 5.3) of the mixed brushes, the surfaces are positively charged and the negatively charged Gram-positive S. aureus adheres at high density (2.6 × 10(6) cells/cm(2)) due to attractive electrostatic interactions. Subsequently, upon increasing the pH to 9.0 to give negatively charged polymer brush surface, ∼90% of the adherent bacteria are released from the surface, presumably due to repulsive electrostatic interactions. This approach provides a simple method for the preparation of surfaces on which bacterial adhesion can be controlled and is applicable to a wide variety of substrates. PMID:26509287

  7. Phenylboronic Acid Appended Pyrene-Based Low-Molecular-Weight Injectable Hydrogel: Glucose-Stimulated Insulin Release.

    PubMed

    Mandal, Deep; Mandal, Subhra Kanti; Ghosh, Moumita; Das, Prasanta Kumar

    2015-08-17

    A pyrene-containing phenylboronic acid (PBA) functionalized low-molecular-weight hydrogelator was synthesized with the aim to develop glucose-sensitive insulin release. The gelator showed the solvent imbibing ability in aqueous buffer solutions of pH values, ranging from 8-12, whereas the sodium salt of the gelator formed a hydrogel at physiological pH 7.4 with a minimum gelation concentration (MGC) of 5 mg mL(-1) . The aggregation behavior of this thermoreversible hydrogel was studied by using microscopic and spectroscopic techniques, including transmission electron microscopy, FTIR, UV/Vis, luminescence, and CD spectroscopy. These investigations revealed that hydrogen bonding, π-π stacking, and van der Waals interactions are the key factors for the self-assembled gelation. The diol-sensitive PBA part and the pyrene unit in the gelator were judiciously used in fluorimetric sensing of minute amounts of glucose at physiological pH. The morphological change of the gel due to addition of glucose was investigated by scanning electron microscopy, which denoted the glucose-responsive swelling of the hydrogel. A rheological study indicated the loss of the rigidity of the native gel in the presence of glucose. Hence, the glucose-induced swelling of the hydrogel was exploited in the controlled release of insulin from the hydrogel. The insulin-loaded hydrogel showed thixotropic self-recovery property, which hoisted it as an injectable soft composite. Encouragingly, the gelator was found to be compatible with HeLa cells. PMID:26184777

  8. Amino acids

    MedlinePlus

    Amino acids are organic compounds that combine to form proteins . Amino acids and proteins are the building blocks of life. When proteins are digested or broken down, amino acids are left. The human body uses amino acids ...

  9. Palmitate-induced Endoplasmic Reticulum stress and subsequent C/EBPα Homologous Protein activation attenuates leptin and Insulin-like growth factor 1 expression in the brain.

    PubMed

    Marwarha, Gurdeep; Claycombe, Kate; Schommer, Jared; Collins, David; Ghribi, Othman

    2016-11-01

    The peptide hormones Insulin-like growth factor-1 (IGF1) and leptin mediate a myriad of biological effects - both in the peripheral and central nervous systems. The transcription of these two hormones is regulated by the transcription factor C/EBPα, which in turn is negatively regulated by the transcription factor C/EBP Homologous Protein (CHOP), a specific marker of endoplasmic reticulum (ER) stress. In the peripheral system, disturbances in leptin and IGF-1 levels are implicated in a variety of metabolic diseases including obesity, diabetes, atherosclerosis and cardiovascular diseases. Current research suggests a positive correlation between consumption of diets rich in saturated free fatty acids (sFFA) and metabolic diseases. Induction of ER stress and subsequent dysregulation in the expression levels of leptin and IGF-1 have been shown to mediate sFFA-induced metabolic diseases in the peripheral system. Palmitic acid (palmitate), the most commonly consumed sFFA, has been shown to be up-taken by the brain, where it may promote neurodegeneration. However, the extent to which palmitate induces ER stress in the brain and attenuates leptin and IGF1 expression has not been determined. We fed C57BL/6J mice a palmitate-enriched diet and determined effects on the expression levels of leptin and IGF1 in the hippocampus and cortex. We further determined the extent to which ER stress and subsequent CHOP activation mediate the palmitate effects on the transcription of leptin and IGF1. We demonstrate that palmitate induces ER stress and decreases leptin and IGF1 expression by inducing the expression of CHOP. The molecular chaperone 4-phenylbutyric acid (4-PBA), an inhibitor of ER stress, precludes the palmitate-evoked down-regulation of leptin and IGF1 expression. Furthermore, the activation of CHOP in response to ER stress is pivotal in the attenuation of leptin and IGF1 expression as knocking-down CHOP in mice or in SH-SY5Y and Neuro-2a (N2a) cells rescues the palmitate

  10. Folic Acid

    MedlinePlus

    Folic acid is a B vitamin. It helps the body make healthy new cells. Everyone needs folic acid. For women who may get pregnant, it is really important. Getting enough folic acid before and during pregnancy can prevent major birth ...

  11. Folic Acid

    MedlinePlus

    Folic acid is used to treat or prevent folic acid deficiency. It is a B-complex vitamin needed by ... Folic acid comes in tablets. It usually is taken once a day. Follow the directions on your prescription label ...

  12. Aspartic acid

    MedlinePlus

    ... also called asparaginic acid. Aspartic acid helps every cell in the body work. It plays a role in: Hormone production and release Normal nervous system function Plant sources of aspartic acid include: Legumes such as ...

  13. Dachtal Isomers and Acidic Herbicides and Pesticides in Eggs of Osprey (Pandion haliaetus) from the Seattle and Everett Areas, Washington, U.S.A

    USGS Publications Warehouse

    Chu, S.; Henny, Charles J.; Kaiser, James L.; Drouillard, K.G.; Haffner, G.D.; Letcher, R.J.

    2007-01-01

    Current-use chlorophenoxy herbicides including 2,4-dichlorophenoxyacetic acid, dicamba, triclopyr, dicamba, dimethyl tetrachloroterephthalate (DCPA or dacthal), and the metabolite of pyrethroids, 3-phenoxybenzoic acid (3-PBA), and the fungicide, chlorothalonil, were investigated in the eggs of osprey (Pandion haliaetus) that were collected from 15 sites from five study areas Puget Sound/Seattle area of Washington State, USA. DCPA differs from acidic chlorophenoxy herbicides, and is not readily hydrolyzed to free acid or acid metabolites, and thus we developed a new method. Of the 12 chlorophenoxy herbicides and chlorothalonil analyzed only DCPA could be quantified at six of these sites (2.0 to 10.3 pg/g fresh weight). However, higher levels (6.9 to 85.5 pg/g fresh weight) of the unexpected DCPA structural isomer, dimethyl tetrachlorophthalate (diMe-TCP) were quantified in eggs from all sites. diMe-TCP concentrations tended to be higher in eggs from the Everett Harbor area. As diMe-TCP is not an industrial product, and not commercially available, the source of diMe-TCP is unclear. Regardless, these findings indicate that DCPA and diMe-TCP can be accumulated in the food chain of fish-eating osprey, and transferred in ovo to eggs, and thus may be of concern to the health of the developing chick and the general reproductive health of this osprey population.

  14. Acid Rain.

    ERIC Educational Resources Information Center

    Openshaw, Peter

    1987-01-01

    Provides some background information on acid deposition. Includes a historical perspective, describes some effects of acid precipitation, and discusses acid rain in the United Kingdom. Contains several experiments that deal with the effects of acid rain on water quality and soil. (TW)

  15. Amino acids

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/002222.htm Amino acids To use the sharing features on this page, please enable JavaScript. Amino acids are organic compounds that combine to form proteins . ...

  16. Mefenamic Acid

    MedlinePlus

    Mefenamic acid is used to relieve mild to moderate pain, including menstrual pain (pain that happens before or during a menstrual period). Mefenamic acid is in a class of medications called NSAIDs. ...

  17. Aminocaproic Acid

    MedlinePlus

    Aminocaproic acid is used to control bleeding that occurs when blood clots are broken down too quickly. This type ... the baby is ready to be born). Aminocaproic acid is also used to control bleeding in the ...

  18. Ascorbic Acid

    MedlinePlus

    Ascorbic acid is used to prevent and treat scurvy, a disease caused by a lack of vitamin C in ... Ascorbic acid comes in extended-release (long-acting) capsules and tablets, lozenges, syrup, chewable tablets, and liquid drops to ...

  19. Acid mucopolysaccharides

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/003368.htm Acid mucopolysaccharides To use the sharing features on this page, please enable JavaScript. Acid mucopolysaccharides is a test that measures the amount ...

  20. Ethacrynic Acid

    MedlinePlus

    Ethacrynic acid, a 'water pill,' is used to treat swelling and fluid retention caused by various medical problems. It ... Ethacrynic acid comes as a tablet to take by mouth. It is usually taken once or twice a day ...

  1. Foam injection molding of poly(lactic acid) with physical blowing agents

    NASA Astrophysics Data System (ADS)

    Pantani, R.; Sorrentino, A.; Volpe, V.; Titomanlio, G.

    2014-05-01

    Foam injection molding uses environmental friendly blowing agents under high pressure and temperature to produce parts having a cellular core and a compact solid skin (the so-called "structural foam"). The addition of a supercritical gas reduces the part weight and at the same time improves some physical properties of the material through the promotion of a faster crystallization; it also leads to the reduction of both the viscosity and the glass transition temperature of the polymer melt, which therefore can be injection molded adopting lower temperatures and pressures. These aspects are of extreme interest for biodegradable polymers, which often present a very narrow processing window, with the suitable processing temperatures close to the degradation conditions. In this work, foam injection molding was carried out by an instrumented molding machine, able to measure the pressure evolution in different positions along the flow-path. The material adopted was a biodegradable polymer, namely the Poly(lactic acid), PLA. The effect of a physical blowing agent (PBA) on the viscosity was measured. The density reduction and the morphology of parts obtained by different molding conditions was assessed.

  2. Biocompatibility of a novel poly(butyl succinate) and polylactic acid blend.

    PubMed

    Kun, Hua; Wei, Zhang; Xuan, Liu; Xiubin, Yang

    2012-01-01

    A novel poly(butyl succinate) (PBS) and polylactic acid (PLA) blend with the favorable mechanical and degradable properties may be applied in the field of biomedicine. The purpose of this study was to investigate the in vitro and in vivo biocompatibilities of the PBS/PLA blend for future application. For in vitro analysis, the L929 fibroblasts and bone marrow stem cells (BMSCs) had been chosen to assess the cytocompatibility. The extract of PBS/PLA blend did not show any cytotoxicity to the L929 and BMSCs by Cell Counting Kit-8 and lactate dehydrogenase assays. Meanwhile, the results of the cytocompatibility showed no difference between the PBA/PLA blend and pure PLA and PBS. Subsequently, they were implanted into rats subcutaneously for in vivo study. It was found that similar with pure PLA and PBS, PBS/PLA blend caused the mild inflammation and foreign body reaction in rats during the consecutive 9 month implantation. However, the status of fibrosis surrounding PBS/PLA blend was superior to the pure PLA and PBS. In all, it was demonstrated that the novel PBS/PLA blend had excellent biocompatibilities in vitro and in vivo. PMID:22285977

  3. Valproic Acid

    MedlinePlus

    Valproic acid is used alone or with other medications to treat certain types of seizures. Valproic acid is also used to treat mania (episodes of ... to relieve headaches that have already begun. Valproic acid is in a class of medications called anticonvulsants. ...

  4. Fatty acids - trans fatty acids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The data supporting a negative effect of dietary trans fatty acids on cardiovascular disease risk is consistent. The primary dietary sources of trans fatty acids include partially hydrogenated fat and rudiment fat. The adverse effect of trans fatty acids on plasma lipoprotein profiles is consisten...

  5. Acid Deposition

    EPA Science Inventory

    This indicator presents acid deposition trends in the contiguous U.S. from 1989 to 2007. Data are broken down by wet and dry deposition and deposition of nitrogen and sulfur compounds. Acid deposition is particularly damaging to lakes, streams, and forests and the plants and a...

  6. Acid rain

    SciTech Connect

    White, J.C. )

    1988-01-01

    This book presents the proceedings of the third annual conference sponsored by the Acid Rain Information Clearinghouse (ARIC). Topics covered include: Legal aspects of the source-receptor relationship: an energy perspective; Scientific uncertainty, agency inaction, and the courts; and Acid rain: the emerging legal framework.

  7. Acid rain

    SciTech Connect

    Elsworth, S.

    1985-01-01

    This book was written in a concise and readable style for the lay public. It's purpose was to make the public aware of the damage caused by acid rain and to mobilize public opinion to favor the elimination of the causes of acid rain.

  8. Acid rain

    SciTech Connect

    Sweet, W.

    1980-06-20

    Acid precipitation includes not only rain but also acidified snow, hail and frost, as well as sulfur and nitrogen dust. The principal source of acid precipitation is pollution emitted by power plants and smelters. Sulfur and nitrogen compounds contained in the emissions combine with moisture to form droplets with a high acid content - sometimes as acidic as vinegar. When sufficiently concentrated, these acids can kill fish and damage material structures. Under certain circumstances they may reduce crop and forest yields and cause or aggravate respiratory diseases in humans. During the summer, especially, pollutants tend to collect over the Great Lakes in high pressure systems. Since winds typically are westerly and rotate clockwise around high pressure systems, the pollutants gradually are dispersed throughout the eastern part of the continent.

  9. Asparagusic acid.

    PubMed

    Mitchell, Stephen C; Waring, Rosemary H

    2014-01-01

    Asparagusic acid (1,2-dithiolane-4-carboxylic acid) is a simple sulphur-containing 5-membered heterocyclic compound that appears unique to asparagus, though other dithiolane derivatives have been identified in non-food species. This molecule, apparently innocuous toxicologically to man, is the most probable culprit responsible for the curious excretion of odorous urine following asparagus ingestion. The presence of the two adjacent sulphur atoms leads to an enhanced chemical reactivity, endowing it with biological properties including the ability to substitute potentially for α-lipoic acid in α-keto-acid oxidation systems. This brief review collects the scattered data available in the literature concerning asparagusic acid and highlights its properties, intermediary metabolism and exploratory applications. PMID:24099657

  10. The zebrafish as a model to study polycystic liver disease.

    PubMed

    Tietz Bogert, Pamela S; Huang, Bing Q; Gradilone, Sergio A; Masyuk, Tetyana V; Moulder, Gary L; Ekker, Stephen C; Larusso, Nicholas F

    2013-06-01

    In the polycystic liver diseases (PLD), genetic defects initiate the formation of cysts in the liver and kidney. In rodent models of PLD (i.e., the PCK rat and Pkd2(WS25/-) mouse), we have studied hepatorenal cystic disease and therapeutic approaches. In this study, we employed zebrafish injected with morpholinos against genes involved in the PLD, including sec63, prkcsh, and pkd1a. We calculated the liver cystic area, and based on our rodent studies, we exposed the embryos to pasireotide [1 μM] or vitamin K3 [100 μM] and assessed the endoplasmic reticulum (ER) in cholangiocytes in embryos treated with 4-phenylbutyrate (4-PBA). Our results show that (a) morpholinos against sec63, prkcsh, and pkd1a eliminate expression of the respective proteins; (b) phenotypic body changes included curved tail and the formation of hepatic cysts in zebrafish larvae; (c) exposure of embryos to pasireotide inhibited hepatic cystogenesis in the zebrafish models; and (d) exposure of embryos to 4-PBA resulted in the ER in cholangiocytes resolving from a curved to a smooth appearance. Our results suggest that the zebrafish model of PLD may provide a means to screen drugs that could inhibit hepatic cystogenesis. PMID:23668934

  11. Activation of CFTR by genistein in human airway epithelial cell lines.

    PubMed

    Andersson, Charlotte; Servetnyk, Zhanna; Roomans, Godfried M

    2003-08-29

    Cystic fibrosis (CF) is caused by a mutation in the cystic fibrosis transmembrane conductance regulator (CFTR), a chloride channel expressed in epithelial cells. The effects of genistein and 4-phenylbutyrate (PBA) on CFTR were studied in three human airway epithelial cell lines expressing wild-type or DeltaF508 CFTR: Calu-3, CFSMEo-, and CFBE41o- cells. The cells were loaded with the fluorescent dye N-(ethoxycarbonylmethyl)-6-methoxyquinolinium bromide (MQAE) and chloride efflux was studied. Forskolin and 3-isobutyl-1-methylxanthine (IBMX) induced chloride efflux in Calu-3 cells but not in CF lines. Genistein (2.5-50 microM) alone was able to induce chloride efflux in all cell lines. Genistein did not enhance the effect of forskolin and IBMX. PBA had little or no effect on genistein-induced chloride efflux. The effect of genistein seen at low concentrations makes genistein interesting for possible pharmacological treatment of CF, since it is known that similar concentrations can be obtained in plasma by a soy-rich diet. PMID:12914781

  12. Functional Rescue of Retinal Degeneration-Associated Mutant RPE65 Proteins.

    PubMed

    Jin, Minghao; Li, Songhua; Hu, Jane; Jin, Heather H; Jacobson, Samuel G; Bok, Dean

    2016-01-01

    More than 100 different mutations in the RPE65 gene are associated with inherited retinal degeneration. Although some missense mutations have been shown to abolish isomerase activity of RPE65, the molecular bases leading to loss of function and retinal degeneration remain incompletely understood. Here we show that several missense mutations resulted in significant decrease in expression level of RPE65 in the human retinal pigment epithelium cells. The 26S proteasome non-ATPase regulatory subunit 13, a newly identified negative regulator of RPE65, mediated degradation of mutant RPE65s, which were misfolded and formed aggregates in the cells. Many mutations, including L22P, T101I, and L408P, were mapped on nonactive sites of RPE65. Enzyme activities of these mutant RPE65s were significantly rescued at low temperature, whereas mutant RPE65s with a distinct active site mutation could not be rescued under the same conditions. 4-phenylbutyrate (PBA) displayed a significant synergistic effect on the low temperature-mediated rescue of the mutant RPE65s. Our results suggest that a low temperature eye mask and PBA, a FDA-approved oral medicine, may provide a promising "protein repair therapy" that can enhance the efficacy of gene therapy for delaying retinal degeneration caused by RPE65 mutations. PMID:26427455

  13. [Gastric Acid].

    PubMed

    Ruíz Chávez, R

    1996-01-01

    Gastric acid, a product of parietal cells secretion, full fills multiple biological roles which are absolutely necessary to keep corporal homeostasis. The production of the acid depends upon an effector cellular process represented in the first step by histamine, acetilcholine and gastrin, first messengers of the process. These interact with specific receptors than in sequence activate second messengers -cAMP and the calcium-calmodulin system- which afterwards activate a kinase. An specific protein is then phosphorilated by this enzyme, being the crucial factor that starts the production of acid. Finally, a proton bomb, extrudes the acid towards the gastric lumen. The secretion process mentioned above, is progressive lyactivated in three steps, two of which are stimulators -cephalic and gastric phases- and the other one inhibitor or intestinal phase. These stages are started by mental and neurological phenomena -thought, sight, smell or memory-; by food, drugs or other ingested substances; and by products of digestion. Changes in regulation of acid secretion, in the structure of gastro-duodenal mucosal barrier by a wide spectrum of factors and agents including food, drugs and H. pylori, are the basis of acid-peptic disease, entity in which gastric acid plays a fundamental role. From the therapeutic point of view, so at the theoretical as at the practical levels, t is possible to interfere with the secretion of acid by neutralization of some of the steps of the effector cellular process. An adequate knowledge of the basics related to gastric acid, allows to create strategies for the clinical handling of associated pathology, specifically in relation to peptic acid disease in all of the known clinical forms. PMID:12165790

  14. Acid fog

    SciTech Connect

    Hileman, B.

    1983-03-01

    Fog in areas of southern California previously thought to be pollution-free has been shown to have a pH as low as 1.69. It has been found to be most acidic after smoggy days, suggesting that it forms on the aerosol associated with the previously exiting smog. Studies on Whiteface Mountain in the Adirondacks show that fog water is often 10 times as acidic as rainwater. As a result of their studies, California plans to spend $4 million on acid deposition research in the coming year. (JMT)

  15. A non enzymatic glucose biosensor based on an ultrasensitive calix[4]arene functionalized boronic acid gold nanoprobe for sensing in human blood serum.

    PubMed

    Pandya, Alok; Sutariya, Pinkesh G; Menon, Shobhana K

    2013-04-21

    We developed a new, advanced, simple and non enzymatic approach for the colorimetric detection of glucose based on calix[4]arene/phenyl boronic acid (CX-PBA)functionalized gold nanoparticles (AuNPs). This molecular receptor proficiently and selectively recognizes glucose due to its ability to reversibly bind diol-containing compounds. The assembly was characterized by transmission electron micrograph (TEM), dynamic light scattering (DLS), UV-Vis, FT-IR, ESI-MS and (1)H NMR spectrometry, which demonstrates the binding affinity for glucose via a boronic acid-diol interaction. The linear range for glucose was found to be 5-100 nM with phosphate buffer pH 10, with a lower detection limit of 4.3 nM. Interference by other saccharides was negligible. The biosensor has been successfully applied to estimate the glucose in human blood serum samples and the results compared well to an automatic analyzer. With the advantages of high sensitivity, selectivity and low sample volume, this method is potentially suitable for the on-site monitoring of glucose. PMID:23476922

  16. Folic acid

    MedlinePlus

    ... in the blood vessel to keep it open. Bipolar disorder. Taking folic acid does not appear to improve the antidepressant effects of lithium in people with bipolar disorder. However, taking folate with the medication valproate improves ...

  17. Mefenamic Acid

    MedlinePlus

    ... as mefenamic acid may cause ulcers, bleeding, or holes in the stomach or intestine. These problems may ... like coffee grounds, blood in the stool, or black and tarry stools.Keep all appointments with your ...

  18. ACID RAIN

    EPA Science Inventory

    Acid precipitation has become one of the major environmental problems of this decade. It is a challenge to scientists throughout the world. Researchers from such diverse disciplines as plant pathology, soil science, bacteriology, meteorology and engineering are investigating diff...

  19. Acid Precipitation

    ERIC Educational Resources Information Center

    Likens, Gene E.

    1976-01-01

    Discusses the fact that the acidity of rain and snow falling on parts of the U.S. and Europe has been rising. The reasons are still not entirely clear and the consequences have yet to be well evaluated. (MLH)

  20. Carnosic acid.

    PubMed

    Birtić, Simona; Dussort, Pierre; Pierre, François-Xavier; Bily, Antoine C; Roller, Marc

    2015-07-01

    Carnosic acid (salvin), which possesses antioxidative and antimicrobial properties, is increasingly exploited within the food, nutritional health and cosmetics industries. Since its first extraction from a Salvia species (∼70 years ago) and its identification (∼50 years ago), numerous articles and patents (∼400) have been published on specific food and medicinal applications of Rosmarinus and Salvia plant extracts abundant in carnosic acid. In contrast, relevant biochemical, physiological or molecular studies in planta have remained rare. In this overview, recent advances in understanding of carnosic acid distribution, biosynthesis, accumulation and role in planta, and its applications are summarised. We also discuss the deficiencies in our understanding of the relevant biochemical processes, and suggest the molecular targets of carnosic acid. Finally, future perspectives and studies related to its potential roles are highlighted. PMID:25639596

  1. Aminocaproic Acid

    MedlinePlus

    Amicar® Oral Solution ... Aminocaproic acid comes as a tablet and a solution (liquid) to take by mouth. It is usually ... it at room temperature and away from excess heat and moisture (not in the bathroom). Throw away ...

  2. Tranexamic Acid

    MedlinePlus

    ... is used to treat heavy bleeding during the menstrual cycle (monthly periods) in women. Tranexamic acid is in ... tablets for more than 5 days in a menstrual cycle or take more than 6 tablets in a ...

  3. Acidic precipitation

    SciTech Connect

    Martin, H.C.

    1987-01-01

    At the International Symposium on Acidic Precipitation, over 400 papers were presented, and nearly 200 of them are included here. They provide an overview of the present state of the art of acid rain research. The Conference focused on atmospheric science (monitoring, source-receptor relationships), aquatic effects (marine eutrophication, lake acidification, impacts on plant and fish populations), and terrestrial effects (forest decline, soil acidification, etc.).

  4. Salicylic acids

    PubMed Central

    Hayat, Shamsul; Irfan, Mohd; Wani, Arif; Nasser, Alyemeni; Ahmad, Aqil

    2012-01-01

    Salicylic acid is well known phytohormone, emerging recently as a new paradigm of an array of manifestations of growth regulators. The area unleashed yet encompassed the applied agriculture sector to find the roles to strengthen the crops against plethora of abiotic and biotic stresses. The skipped part of integrated picture, however, was the evolutionary insight of salicylic acid to either allow or discard the microbial invasion depending upon various internal factors of two interactants under the prevailing external conditions. The metabolic status that allows the host invasion either as pathogenesis or symbiosis with possible intermediary stages in close systems has been tried to underpin here. PMID:22301975

  5. Folic acid

    MedlinePlus

    ... disease called vitiligo, and an inherited disease called Fragile-X syndrome. It is also used for reducing harmful side ... to blood clots (ischemic stroke). Inherited disease called Fragile-X syndrome.Taking folic acid by mouth does not improve ...

  6. Acid rain

    SciTech Connect

    Not Available

    1984-06-01

    An overview is presented of acid rain and the problems it causes to the environment worldwide. The acidification of lakes and streams is having a dramatic effect on aquatic life. Aluminum, present in virtually all forest soils, leaches out readily under acid conditions and interferes with the gills of all fish, some more seriously than others. There is evidence of major damage to forests in European countries. In the US, the most severe forest damage appears to be in New England, New York's Adirondacks, and the central Appalachians. This small region is part of a larger area of the Northeast and Canada that appears to have more acid rainfall than the rest of the country. It is downwind from major coal burning states, which produce about one quarter of US SO/sub 2/ emissions and one sixth of nitrogen oxide emissions. Uncertainties exist over the causes of forest damage and more research is needed before advocating expensive programs to reduce rain acidity. The President's current budget seeks an expansion of research funds from the current $30 million per year to $120 million.

  7. Formic acid

    Integrated Risk Information System (IRIS)

    Formic acid ; CASRN 64 - 18 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic Effect

  8. Selenious acid

    Integrated Risk Information System (IRIS)

    Selenious acid ; CASRN 7783 - 00 - 8 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic E

  9. Benzoic acid

    Integrated Risk Information System (IRIS)

    Benzoic acid ; CASRN 65 - 85 - 0 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic Effec

  10. Trichloroacetic acid

    Integrated Risk Information System (IRIS)

    Trichloroacetic acid ( TCA ) ; CASRN 76 - 03 - 9 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Nonca

  11. Dichloroacetic acid

    Integrated Risk Information System (IRIS)

    Dichloroacetic acid ; CASRN 79 - 43 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogeni

  12. Acrylic acid

    Integrated Risk Information System (IRIS)

    Acrylic acid ( CASRN 79 - 10 - 7 ) Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic Eff

  13. Cacodylic acid

    Integrated Risk Information System (IRIS)

    Cacodylic acid ; CASRN 75 - 60 - 5 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic Eff

  14. Phosphoric acid

    Integrated Risk Information System (IRIS)

    Phosphoric acid ; CASRN 7664 - 38 - 2 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic

  15. Stearic Acid

    ERIC Educational Resources Information Center

    Young, Jay A.

    2004-01-01

    A chemical laboratory information profile (CLIP) is presented for the chemical, stearic acid. The profile lists the chemical's physical and harmful characteristics, exposure limits, and symptoms of major exposure, for the benefit of teachers and students, who use the chemical in the laboratory.

  16. The Dichotomy of Endoplasmic Reticulum Stress Response in Liver Ischemia-Reperfusion Injury.

    PubMed

    Zhou, Haomming; Zhu, Jianjun; Yue, Shi; Lu, Ling; Busuttil, Ronald W; Kupiec-Weglinski, Jerzy W; Wang, Xuehao; Zhai, Yuan

    2016-02-01

    Endoplasmic reticulum (ER) stress plays critical roles in the pathogenesis of liver ischemia-reperfusion injury (IRI). As ER stress triggers an adaptive cellular response, the question of what determines its functional outcome in liver IRI remains to be defined. In a murine liver partial warm ischemia model, we studied how transient (30 minutes) or prolonged (90 minutes) liver ischemia regulated local ER stress response and autophagy activities and their relationship with liver IRI. Effects of chemical chaperon 4-phenylbutyrate (4-PBA) or autophagy inhibitor 3-methyladenine (3-MA) were evaluated. Our results showed that although the activating transcription factor 6 branch of ER stress response was induced in livers by both types of ischemia, liver autophagy was activated by transient, but inhibited by prolonged, ischemia. Although 3-MA had no effects on liver IRI after prolonged ischemia, it significantly increased liver IRI after transient ischemia. The 4-PBA treatment protected livers from IRI after prolonged ischemia by restoring autophagy flux, and the adjunctive 3-MA treatment abrogated its liver protective effect. The same 4-PBA treatment, however, increased liver IRI and disrupted autophagy flux after transient ischemia. Although both types of ischemia activated 5' adenosine monophosphate-activated protein kinase and inactivated protein kinase B (Akt), prolonged ischemia also resulted in downregulations of autophagy-related gene 3 and autophagy-related gene 5 in ischemic livers. These results indicate a functional dichotomy of ER stress response in liver IRI via its regulation of autophagy. Transient ischemia activates autophagy to protect livers from IRI, whereas prolonged ischemia inhibits autophagy to promote the development of liver IRI. PMID:26683513

  17. Functional Rescue of Trafficking-Impaired ABCB4 Mutants by Chemical Chaperones

    PubMed Central

    Gordo-Gilart, Raquel; Andueza, Sara; Hierro, Loreto; Jara, Paloma; Alvarez, Luis

    2016-01-01

    Multidrug resistance protein 3 (MDR3, ABCB4) is a hepatocellular membrane protein that mediates biliary secretion of phosphatidylcholine. Null mutations in ABCB4 gene give rise to severe early-onset cholestatic liver disease. We have previously shown that the disease-associated mutations p.G68R, p.G228R, p.D459H, and p.A934T resulted in retention of ABCB4 in the endoplasmic reticulum, thus failing to target the plasma membrane. In the present study, we tested the ability of two compounds with chaperone-like activity, 4-phenylbutyrate and curcumin, to rescue these ABCB4 mutants by assessing their effects on subcellular localization, protein maturation, and phospholipid efflux capability. Incubation of transfected cells at a reduced temperature (30°C) or exposure to pharmacological doses of either 4-PBA or curcumin restored cell surface expression of mutants G228R and A934T. The delivery of these mutants to the plasma membrane was accompanied by a switch in the ratio of mature to inmature protein forms, leading to a predominant expression of the mature protein. This effect was due to an improvement in the maturation rate and not to the stabilization of the mature forms. Both mutants were also functionally rescued, displaying bile salt-dependent phospholipid efflux activity after addition of 4-PBA or curcumin. Drug-induced rescue was mutant specific, given neither 4-PBA nor curcumin had an effect on the ABCB4 mutants G68R and A934T. Collectively, these data indicate that the functionality of selected trafficking-defective ABCB4 mutants can be recovered by chemical chaperones through restoration of membrane localization, suggesting a potential treatment for patients carrying such mutations. PMID:26900700

  18. Functional Rescue of Trafficking-Impaired ABCB4 Mutants by Chemical Chaperones.

    PubMed

    Gordo-Gilart, Raquel; Andueza, Sara; Hierro, Loreto; Jara, Paloma; Alvarez, Luis

    2016-01-01

    Multidrug resistance protein 3 (MDR3, ABCB4) is a hepatocellular membrane protein that mediates biliary secretion of phosphatidylcholine. Null mutations in ABCB4 gene give rise to severe early-onset cholestatic liver disease. We have previously shown that the disease-associated mutations p.G68R, p.G228R, p.D459H, and p.A934T resulted in retention of ABCB4 in the endoplasmic reticulum, thus failing to target the plasma membrane. In the present study, we tested the ability of two compounds with chaperone-like activity, 4-phenylbutyrate and curcumin, to rescue these ABCB4 mutants by assessing their effects on subcellular localization, protein maturation, and phospholipid efflux capability. Incubation of transfected cells at a reduced temperature (30°C) or exposure to pharmacological doses of either 4-PBA or curcumin restored cell surface expression of mutants G228R and A934T. The delivery of these mutants to the plasma membrane was accompanied by a switch in the ratio of mature to inmature protein forms, leading to a predominant expression of the mature protein. This effect was due to an improvement in the maturation rate and not to the stabilization of the mature forms. Both mutants were also functionally rescued, displaying bile salt-dependent phospholipid efflux activity after addition of 4-PBA or curcumin. Drug-induced rescue was mutant specific, given neither 4-PBA nor curcumin had an effect on the ABCB4 mutants G68R and A934T. Collectively, these data indicate that the functionality of selected trafficking-defective ABCB4 mutants can be recovered by chemical chaperones through restoration of membrane localization, suggesting a potential treatment for patients carrying such mutations. PMID:26900700

  19. Hydroxycarboxylic acids and salts

    DOEpatents

    Kiely, Donald E; Hash, Kirk R; Kramer-Presta, Kylie; Smith, Tyler N

    2015-02-24

    Compositions which inhibit corrosion and alter the physical properties of concrete (admixtures) are prepared from salt mixtures of hydroxycarboxylic acids, carboxylic acids, and nitric acid. The salt mixtures are prepared by neutralizing acid product mixtures from the oxidation of polyols using nitric acid and oxygen as the oxidizing agents. Nitric acid is removed from the hydroxycarboxylic acids by evaporation and diffusion dialysis.

  20. Methylmalonic acid blood test

    MedlinePlus

    ... acid is a substance produced when proteins, called amino acids, in the body break down. The health care ... Cederbaum S, Berry GT. Inborn errors of carbohydrate, ammonia, amino acid, and organic acid metabolism. In: Gleason CA, Devaskar ...

  1. Folic acid - test

    MedlinePlus

    Folic acid is a type of B vitamin. This article discusses the test to measure the amount of folic acid in the blood. ... that may interfere with test results, including folic acid supplements. Drugs that can decrease folic acid measurements ...

  2. Uric acid urine test

    MedlinePlus

    The uric acid urine test measures the level of uric acid in urine. Uric acid level can also be checked using a blood ... help determine the cause of a high uric acid level in the blood. It may also be ...

  3. Methylmalonic acid blood test

    MedlinePlus

    The methylmalonic acid blood test measures the amount of methylmalonic acid in the blood. ... Methylmalonic acid is a substance produced when proteins, called amino acids, in the body break down. The health care ...

  4. Folic Acid and Pregnancy

    MedlinePlus

    ... 5 Things to Know About Zika & Pregnancy Folic Acid and Pregnancy KidsHealth > For Parents > Folic Acid and ... before conception and during early pregnancy . About Folic Acid Folic acid, sometimes called folate, is a B ...

  5. Understanding Acid Rain

    ERIC Educational Resources Information Center

    Damonte, Kathleen

    2004-01-01

    The term acid rain describes rain, snow, or fog that is more acidic than normal precipitation. To understand what acid rain is, it is first necessary to know what an acid is. Acids can be defined as substances that produce hydrogen ions (H+), when dissolved in water. Scientists indicate how acidic a substance is by a set of numbers called the pH…

  6. New bioactive fatty acids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Many oxygenated fatty acids are bioactive compounds. Nocardia cholesterolicum and Flavobacterium DS5 convert oleic acid to 10 hydroxy stearic acid and linoleic acid to 10-hydroxy-12(Z)-octadecanoic acid. Pseudomonas aeruginosa PR3 converts oleic acid to the new compounds, 7,10-dihydroxy-8(E)-octad...

  7. New Bioactive Fatty Acids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Many oxygenated fatty acids are bioactive compounds. Nocardia cholesterolicum and Flavobacterium DS5 convert oleic acid to 10 hydroxy stearic acid and linoleic acid to 10-hydroxy-12(Z)-octadecanoic acid. Pseudomonas aeruginosa PR3 converts oleic acid to new compounds, 7,10-dihydroxy-8(E)-octadecen...

  8. Experimental (FT-IR, FT-Raman, UV-Vis, 1H and 13C NMR) and computational (density functional theory) studies on 3-bromophenylboronic acid

    NASA Astrophysics Data System (ADS)

    Karabacak, M.; Kose, E.; Atac, A.; Sas, E. B.; Asiri, A. M.; Kurt, M.

    2014-11-01

    Structurally, boronic acids are trivalent boron-containing organic compounds that possess one alkyl substituent (i.e., C-Br bond) and two hydroxyl groups to fill the remaining valences on the boron atom. We studied 3-bromophenylboronic acid (3BrPBA); a derivative of boronic acid. This study includes the experimental (FT-IR, FT-Raman, 1H and 13C NMR, UV-Vis) techniques and theoretical (DFT-density functional theory) calculations. The experimental data are recorded, FT-IR (4000-400 cm-1) and FT-Raman spectra (3500-10 cm-1) in the solid phase. 1H and 13C NMR spectra are recorded in DMSO solution. UV-Vis spectrum is recorded in the range of 200-400 nm for each solution (in ethanol and water). The theoretical calculations are computed DFT/B3LYP/6-311++G(d,p) basis set. The optimum geometry is also obtained from inside for possible four conformers using according to position of hydrogen atoms after the scan coordinate of these structures. The fundamental vibrations are assigned on the basis of the total energy distribution (TED) of the vibrational modes, calculated with scaled quantum mechanics (SQM) method and parallel quantum solutions (PQS) program. 1H and 13C NMR chemical shifts are racked on by using the gauge-invariant atomic orbital (GIAO) method. The time-dependent density functional theory (TD-DFT) is used to find HOMO and LUMO energies, excitation energies, oscillator strengths. The density of state of the studied molecule is investigated as total and partial density of state (TDOS and PDOS) and overlap population density of state (OPDOS or COOP) diagrams have been presented. Besides, frontier molecular orbitals (FMOs), molecular electrostatic potential surface (MEPs) and thermodynamic properties are performed. At the end of this work, the results are ensured beneficial for the literature contribution.

  9. Bioactive Fatty Acids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Oxygenated fatty acids are useful as specialty chemicals, plasticizers, and biomedicals. Microbial enzymes convert fatty acids to mono-, di-, and trihydroxy fatty acid products. Among them, Bacillus megaterium ALA2 converted n-6 and n-3 PUFAs to many new oxygenated fatty acids. Linoleic acid was ...

  10. Uric acid test (image)

    MedlinePlus

    Uric acid urine test is performed to check for the amount of uric acid in urine. Urine is collected over a 24 ... testing. The most common reason for measuring uric acid levels is in the diagnosis or treatment of ...

  11. Amino Acid Metabolism Disorders

    MedlinePlus

    ... defects & other health conditions > Amino acid metabolism disorders Amino acid metabolism disorders E-mail to a friend Please ... baby’s newborn screening may include testing for certain amino acid metabolism disorders. These are rare health conditions that ...

  12. Plasma amino acids

    MedlinePlus

    Amino acids blood test ... types of methods used to determine the individual amino acid levels in the blood. ... test is done to measure the level of amino acids in the blood. An increased level of a ...

  13. Stomach acid test

    MedlinePlus

    Gastric acid secretion test ... of the cells in the stomach to release acid. The stomach contents are then removed and analyzed. ... 3.5). These numbers are converted to actual acid production in units of milliequivalents per hour in ...

  14. Azelaic Acid Topical

    MedlinePlus

    Azelaic acid gel is used to clear the bumps, lesions, and swelling caused by rosacea (a skin disease that ... redness, flushing, and pimples on the face). Azelaic acid cream is used to treat acne. Azelaic acid ...

  15. Facts about Folic Acid

    MedlinePlus

    ... Information For... Media Policy Makers Facts About Folic Acid Language: English Español (Spanish) Recommend on Facebook Tweet ... of the baby's brain and spine. About folic acid Folic acid is a B vitamin. Our bodies ...

  16. Acid Lipase Disease

    MedlinePlus

    ... Awards Enhancing Diversity Find People About NINDS NINDS Acid Lipase Disease Information Page Synonym(s): Cholesterol Ester Storage ... Trials Related NINDS Publications and Information What is Acid Lipase Disease ? Acid lipase disease or deficiency occurs ...

  17. Folic acid - test

    MedlinePlus

    ... folic acid measurements include: Alcohol Aminosalicylic acid Birth control pills Estrogens Tetracyclines Ampicillin Chloramphenicol Erythromycin Methotrexate Penicillin Aminopterin Phenobarbital Phenytoin Drugs to treat malaria

  18. Oxalic acid poisoning

    MedlinePlus

    Symptoms of oxalic acid poisoning include: Abdominal pain Burns and blisters where the acid contacted the skin Collapse Convulsions Mouth pain Shock Throat pain Tremors (unintentional trembling) Vomiting

  19. Acid distribution in phosphoric acid fuel cells

    SciTech Connect

    Okae, I.; Seya, A.; Umemoto, M.

    1996-12-31

    Electrolyte acid distribution among each component of a cell is determined by capillary force when the cell is not in operation, but the distribution under the current load conditions had not been clear so far. Since the loss of electrolyte acid during operation is inevitable, it is necessary to store enough amount of acid in every cell. But it must be under the level of which the acid disturbs the diffusion of reactive gases. Accordingly to know the actual acid distribution during operation in a cell is very important. In this report, we carried out experiments to clarify the distribution using small single cells.

  20. Acid tolerance in amphibians

    SciTech Connect

    Pierce, B.A.

    1985-04-01

    Studies of amphibian acid tolerance provide information about the potential effects of acid deposition on amphibian communities. Amphibians as a group appear to be relatively acid tolerant, with many species suffering increased mortality only below pH 4. However, amphibians exhibit much intraspecific variation in acid tolerance, and some species are sensitive to even low levels of acidity. Furthermore, nonlethal effects, including depression of growth rates and increases in developmental abnormalities, can occur at higher pH.

  1. Blockade of Interplay between IL-17A and Endoplasmic Reticulum Stress Attenuates LPS-Induced Lung Injury

    PubMed Central

    Kim, So Ri; Kim, Hee Jung; Kim, Dong Im; Lee, Kyung Bae; Park, Hae Jin; Jeong, Jae Seok; Cho, Seong Ho; Lee, Yong Chul

    2015-01-01

    IL-17 is a cytokine mainly from IL-17-producing T cells, which are one of subsets of CD4+ T cells and play a role in adaptive immune system. Recent studies have demonstrated that IL-17A can act rapidly as an innate immune responder during infection before the onset of its classic adaptive immune response. This role of IL-17A in innate immune response is implicated in lipopolysaccharide (LPS)-induced lung inflammation. Very recently, we have reported that endoplasmic reticulum (ER) stress is involved in LPS-induced lung inflammation in vivo and in vitro. This study aimed to elucidate the role of IL-17A in LPS-induced lung injury, focusing on the link with ER stress. We treated a murine model of LPS-induced lung injury with IL-17A neutralizing antibody and 4-phenylbutyrate (4-PBA), a representative ER stress inhibitor. In addition, we evaluated the effects of IL-17A on ER stress in LPS-stimulated bronchial epithelial cells. Our results showed that inhibition of IL-17A decreased LPS-induced pulmonary neutrophilia, vascular leakage, nuclear translocation of nuclear factor-κB (NF-κB), infiltration of dendritic cells, increased expression of Toll-like receptor 4 (TLR4), activation of NLRP3 inflammasome, and increased ER stress in the lung. 4-PBA or TAK-242, a TLR4 inhibitor attenuated expression of IL-17A thereby improving LPS-induced lung inflammation. Intriguingly, we observed that stimulation with LPS increased expression of IL-17A in airway epithelial cells and co-stimulation with IL-17A further increased ER stress and NF-κB activation. This study indicates that the interrelationship between IL-17A and ER stress plays an important role in LPS-induced injury showing a positive feedback in airway epithelial cells and suggests that targeting their interaction can be a potential therapeutic approach to overcome one of severe refractory pulmonary disorders. PMID:26516372

  2. Toxicity of adipic acid.

    PubMed

    Kennedy, Gerald L

    2002-05-01

    Adipic acid has very low acute toxicity in rats with an LD50 > 5000 mg/kg. Adipic acid produced mild to no skin irritation on intact guinea pig skin as a 50% concentration in propylene glycol; it was not a skin sensitizer. Adipic acid caused mild conjunctival irritation in washed rabbit eyes; in unwashed rabbit eyes, there was mild conjunctival irritation, minimal iritis, but no corneal effects. Adipic acid dust may irritate the mucous membranes of the lungs and nose. In a 2-year feeding study, rats fed adipic acid at concentrations up to 5% in the diet exhibited only weight loss. Adipic acid is not genetically active in a wide variety of assay systems. Adipic acid caused no developmental toxicity in mice, rats, rabbits, or hamsters when administered orally. Adipic acid is partially metabolized in humans; the balance is eliminated unchanged in the urine. Adipic acid is slightly to moderately toxic to fish, daphnia, and algae in acute tests. PMID:12024802

  3. Acid Thunder: Acid Rain and Ancient Mesoamerica

    ERIC Educational Resources Information Center

    Kahl, Jonathan D. W.; Berg, Craig A.

    2006-01-01

    Much of Mesoamerica's rich cultural heritage is slowly eroding because of acid rain. Just as water dissolves an Alka-Seltzer tablet, acid rain erodes the limestone surfaces of Mexican archaeological sites at a rate of about one-half millimeter per century (Bravo et al. 2003). A half-millimeter may not seem like much, but at this pace, a few…

  4. Quantity of acid in acid fog

    SciTech Connect

    Deal, W.J.

    1983-07-01

    This communication notes the actual magnitude of the acidity in acidic fog particles and suggests a possible line of inquiry into the health effects of such fog so that it can be determined whether a typical fog is detrimental or beneficial relative to dry air.

  5. [Amino acids in saliva].

    PubMed

    Klinger, G; Gruhn, K

    1984-01-01

    Total amino acids in saliva and free and peptide-bound amino acids from 21 saliva samples were determined. The contents of amino acids was 25 mmol/1; total nitrogen content was 78-80 mmol/1. Amino acids consist of Prolin in 25%. Some patients were examined before and after application of the depot estrogen ethinyl estradiosulfonat, which stimulates the assimilation of protein. After application, amino acids increased and the authors found a shift between the single amino acids. Estrogen medication induced an increase in proteins with the character of collagens. Clinical effects are discussed. (author's modified) PMID:6240853

  6. Hydrochloric acid poisoning

    MedlinePlus

    Hydrochloric acid is a clear, poisonous liquid. It is highly corrosive, which means it immediately causes severe damage, ... discusses poisoning due to swallowing or breathing in hydrochloric acid. This article is for information only. Do NOT ...

  7. Omega-3 Fatty Acids

    MedlinePlus

    Omega-3 fatty acids are used together with lifestyle changes (diet, weight-loss, exercise) to reduce the amount ... the blood in people with very high triglycerides. Omega-3 fatty acids are in a class of medications ...

  8. Omega-6 Fatty Acids

    MedlinePlus

    Omega-6 fatty acids are types of fats. Some types are found in vegetable oils, including corn, evening primrose seed, safflower, and soybean oils. Other types of omega-6 fatty acids are found in black currant seed, borage seed, ...

  9. Zoledronic Acid Injection

    MedlinePlus

    Zoledronic acid (Reclast) is used to prevent or treat osteoporosis (condition in which the bones become thin and weak ... of life,' end of regular menstrual periods). Zoledronic acid (Reclast) is also used to treat osteoporosis in ...

  10. Aminolevulinic Acid Topical

    MedlinePlus

    Aminolevulinic acid is used in combination with photodynamic therapy (PDT; special blue light) to treat actinic keratoses (small crusty ... skin cancer) of the face or scalp. Aminolevulinic acid is in a class of medications called photosensitizing ...

  11. Acid-fast stain

    MedlinePlus

    The acid-fast stain is a laboratory test that determines if a sample of tissue, blood, or other body ... dye. The slide is then washed with an acid solution and a different stain is applied. Bacteria ...

  12. Uric acid - blood

    MedlinePlus

    Uric acid is a chemical created when the body breaks down substances called purines. Purines are found in some ... dried beans and peas, and beer. Most uric acid dissolves in blood and travels to the kidneys. ...

  13. Hydrochloric acid poisoning

    MedlinePlus

    Hydrochloric acid is a clear, poisonous liquid. It is highly corrosive, which means it immediately causes severe damage, such ... poisoning due to swallowing or breathing in hydrochloric acid. This article is for information only. Do NOT ...

  14. Omega-6 Fatty Acids

    MedlinePlus

    ... types of fats. Some types are found in vegetable oils, including corn, evening primrose seed, safflower, and soybean ... from studying specific omega-6 fatty acids or plant oils containing omega-6 fatty acids. See the separate ...

  15. Uric Acid Test

    MedlinePlus

    ... limited. Home Visit Global Sites Search Help? Uric Acid Share this page: Was this page helpful? Also known as: Serum Urate; UA Formal name: Uric Acid Related tests: Synovial Fluid Analysis , Kidney Stone Analysis , ...

  16. Acid-fast stain

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/003766.htm Acid-fast stain To use the sharing features on this page, please enable JavaScript. The acid-fast stain is a laboratory test that determines ...

  17. Aminocaproic Acid Injection

    MedlinePlus

    Aminocaproic acid injection is used to control bleeding that occurs when blood clots are broken down too quickly. This ... the baby is ready to be born). Aminocaproic acid injection is also used to control bleeding in ...

  18. Deoxycholic Acid Injection

    MedlinePlus

    Deoxycholic acid injection is used to improve the appearance and profile of moderate to severe submental fat ('double chin'; fatty tissue located under the chin). Deoxycholic acid injection is in a class of medications called ...

  19. Methylmalonic Acid Test

    MedlinePlus

    ... limited. Home Visit Global Sites Search Help? Methylmalonic Acid Share this page: Was this page helpful? Also known as: MMA Formal name: Methylmalonic Acid Related tests: Vitamin B12 and Folate , Homocysteine , Intrinsic ...

  20. Fatty acid analogs

    DOEpatents

    Elmaleh, David R.; Livni, Eli

    1985-01-01

    In one aspect, a radioactively labeled analog of a fatty acid which is capable of being taken up by mammalian tissue and which exhibits an in vivo beta-oxidation rate below that with a corresponding radioactively labeled fatty acid.

  1. Boric acid poisoning

    MedlinePlus

    ... boric acid poisoning usually occurs when someone swallows powdered roach-killing products that contain the chemical. Chronic ... vein (IV) Medicines to treat symptoms Note: Activated charcoal does not effectively treat (absorb) boric acid. For ...

  2. Lactic acid test

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/003507.htm Lactic acid test To use the sharing features on this page, please enable JavaScript. Lactic acid is mainly produced in muscle cells and red ...

  3. PRODUCTION OF TRIFLUOROACETIC ACID

    DOEpatents

    Haworth, W.N.; Stacey, M.

    1949-07-19

    A method is given for the production of improved yields of trifluoroacetic acid. The compound is prepared by oxidizing m-aminobenzotrifluoride with an alkali metal or alkaline earth metal permanganate at a temperature in the range of 80 deg C to 100 deg C while dissolved ln a mixture of water with glacial acetic acid and/or trifluoroacetic acid. Preferably a mixture of water and trifluoroacetic acid ls used as the solvent.

  4. Plant fatty acid hydroxylases

    DOEpatents

    Somerville, Chris; Broun, Pierre; van de Loo, Frank

    2001-01-01

    This invention relates to plant fatty acyl hydroxylases. Methods to use conserved amino acid or nucleotide sequences to obtain plant fatty acyl hydroxylases are described. Also described is the use of cDNA clones encoding a plant hydroxylase to produce a family of hydroxylated fatty acids in transgenic plants. In addition, the use of genes encoding fatty acid hydroxylases or desaturases to alter the level of lipid fatty acid unsaturation in transgenic plants is described.

  5. Quantity of acid in acid fog

    SciTech Connect

    Deal, W.J.

    1983-07-01

    The chemical composition of fog particles has become of considerable interest, because of both the possibility of interpreting atmospheric- chemistry processes in fog particles in terms of the principles of aqueous chemistry and the potential health effects of species present in fog particles. The acidity of fog particles has received wide attention. This communication noted the actual magnitude of the excess acidity in acidic fog particles and suggested a possible line of inquiry into the health effects of such fog so that it can be determined whether a typical fog is detrimental or beneficial relative to dry air. (DP)

  6. The Acid Rain Reader.

    ERIC Educational Resources Information Center

    Stubbs, Harriett S.; And Others

    A topic which is often not sufficiently dealt with in elementary school textbooks is acid rain. This student text is designed to supplement classroom materials on the topic. Discussed are: (1) "Rain"; (2) "Water Cycle"; (3) "Fossil Fuels"; (4) "Air Pollution"; (5) "Superstacks"; (6) "Acid/Neutral/Bases"; (7) "pH Scale"; (8) "Acid Rain"; (9)…

  7. What Is Acid Rain?

    ERIC Educational Resources Information Center

    Likens, Gene E.

    2004-01-01

    Acid rain is the collective term for any type of acidified precipitation: rain, snow, sleet, and hail, as well as the presence of acidifying gases, particles, cloud water, and fog in the atmosphere. The increased acidity, primarily from sulfuric and nitric acids, is generated as a by-product of the combustion of fossil fuels such as coal and oil.…

  8. Acid Rain Study Guide.

    ERIC Educational Resources Information Center

    Hunger, Carolyn; And Others

    Acid rain is a complex, worldwide environmental problem. This study guide is intended to aid teachers of grades 4-12 to help their students understand what acid rain is, why it is a problem, and what possible solutions exist. The document contains specific sections on: (1) the various terms used in conjunction with acid rain (such as acid…

  9. [alpha]-Oxocarboxylic Acids

    ERIC Educational Resources Information Center

    Kerber, Robert C.; Fernando, Marian S.

    2010-01-01

    Several [alpha]-oxocarboxylic acids play key roles in metabolism in plants and animals. However, there are inconsistencies between the structures as commonly portrayed and the reported acid ionization constants, which result because the acids are predominantly hydrated in aqueous solution; that is, the predominant form is RC(OH)[subscript 2]COOH…

  10. Cleavage of nucleic acids

    DOEpatents

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor L.; Brow, Mary Ann D.; Dahlberg, James E.

    2007-12-11

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  11. Amino acid analysis

    NASA Technical Reports Server (NTRS)

    Winitz, M.; Graff, J. (Inventor)

    1974-01-01

    The process and apparatus for qualitative and quantitative analysis of the amino acid content of a biological sample are presented. The sample is deposited on a cation exchange resin and then is washed with suitable solvents. The amino acids and various cations and organic material with a basic function remain on the resin. The resin is eluted with an acid eluant, and the eluate containing the amino acids is transferred to a reaction vessel where the eluant is removed. Final analysis of the purified acylated amino acid esters is accomplished by gas-liquid chromatographic techniques.

  12. Editorial: Acid precipitation

    SciTech Connect

    1995-09-01

    This editorial focuses on acid rain and the history of public and governmental response to acid rain. Comments on a book by Gwineth Howell `Acid Rain and Acid Waters` are included. The editor feels that Howells has provide a service to the environmental scientific community, with a textbook useful to a range of people, as well as a call for decision makers to learn from the acid rain issue and use it as a model for more sweeping global environmental issues. A balance is needed among several parameters such as level of evidence, probability that the evidence will lead to a specific direction and the cost to the global community. 1 tab.

  13. Cleavage of nucleic acids

    SciTech Connect

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow; Mary Ann D.; Dahlberg, James E.

    2010-11-09

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  14. Cleavage of nucleic acids

    DOEpatents

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann D.; Dahlberg, James E.

    2000-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  15. Nucleic acid detection assays

    DOEpatents

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann; Dahlberg, James E.

    2005-04-05

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  16. Nucleic acid detection compositions

    DOEpatents

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann; Dahlberg, James L.

    2008-08-05

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  17. Acidic Ionic Liquids.

    PubMed

    Amarasekara, Ananda S

    2016-05-25

    Ionic liquid with acidic properties is an important branch in the wide ionic liquid field and the aim of this article is to cover all aspects of these acidic ionic liquids, especially focusing on the developments in the last four years. The structural diversity and synthesis of acidic ionic liquids are discussed in the introduction sections of this review. In addition, an unambiguous classification system for various types of acidic ionic liquids is presented in the introduction. The physical properties including acidity, thermo-physical properties, ionic conductivity, spectroscopy, and computational studies on acidic ionic liquids are covered in the next sections. The final section provides a comprehensive review on applications of acidic ionic liquids in a wide array of fields including catalysis, CO2 fixation, ionogel, electrolyte, fuel-cell, membrane, biomass processing, biodiesel synthesis, desulfurization of gasoline/diesel, metal processing, and metal electrodeposition. PMID:27175515

  18. Nucleic acid detection kits

    DOEpatents

    Hall, Jeff G.; Lyamichev, Victor I.; Mast, Andrea L.; Brow, Mary Ann; Kwiatkowski, Robert W.; Vavra, Stephanie H.

    2005-03-29

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based on charge. The present invention also provides methods for the detection of non-target cleavage products via the formation of a complete and activated protein binding region. The invention further provides sensitive and specific methods for the detection of nucleic acid from various viruses in a sample.

  19. Demospongic Acids Revisited

    PubMed Central

    Kornprobst, Jean-Michel; Barnathan, Gilles

    2010-01-01

    The well-known fatty acids with a Δ5,9 unsaturation system were designated for a long period as demospongic acids, taking into account that they originally occurred in marine Demospongia sponges. However, such acids have also been observed in various marine sources with a large range of chain-lengths (C16–C32) and from some terrestrial plants with short acyl chains (C18–C19). Finally, the Δ5,9 fatty acids appear to be a particular type of non-methylene-interrupted fatty acids (NMA FAs). This article reviews the occurrence of these particular fatty acids in marine and terrestrial organisms and shows the biosynthetic connections between Δ5,9 fatty acids and other NMI FAs. PMID:21116406

  20. Process for the preparation of lactic acid and glyceric acid

    DOEpatents

    Jackson, James E [Haslett, MI; Miller, Dennis J [Okemos, MI; Marincean, Simona [Dewitt, MI

    2008-12-02

    Hexose and pentose monosaccharides are degraded to lactic acid and glyceric acid in an aqueous solution in the presence of an excess of a strongly anionic exchange resin, such as AMBERLITE IRN78 and AMBERLITE IRA400. The glyceric acid and lactic acid can be separated from the aqueous solution. Lactic acid and glyceric acid are staple articles of commerce.

  1. Microorganisms for producing organic acids

    SciTech Connect

    Pfleger, Brian Frederick; Begemann, Matthew Brett

    2014-09-30

    Organic acid-producing microorganisms and methods of using same. The organic acid-producing microorganisms comprise modifications that reduce or ablate AcsA activity or AcsA homolog activity. The modifications increase tolerance of the microorganisms to such organic acids as 3-hydroxypropionic acid, acrylic acid, propionic acid, lactic acid, and others. Further modifications to the microorganisms increase production of such organic acids as 3-hydroxypropionic acid, lactate, and others. Methods of producing such organic acids as 3-hydroxypropionic acid, lactate, and others with the modified microorganisms are provided. Methods of using acsA or homologs thereof as counter-selectable markers are also provided.

  2. Acid-Base Homeostasis

    PubMed Central

    Nakhoul, Nazih; Hering-Smith, Kathleen S.

    2015-01-01

    Acid-base homeostasis and pH regulation are critical for both normal physiology and cell metabolism and function. The importance of this regulation is evidenced by a variety of physiologic derangements that occur when plasma pH is either high or low. The kidneys have the predominant role in regulating the systemic bicarbonate concentration and hence, the metabolic component of acid-base balance. This function of the kidneys has two components: reabsorption of virtually all of the filtered HCO3− and production of new bicarbonate to replace that consumed by normal or pathologic acids. This production or generation of new HCO3− is done by net acid excretion. Under normal conditions, approximately one-third to one-half of net acid excretion by the kidneys is in the form of titratable acid. The other one-half to two-thirds is the excretion of ammonium. The capacity to excrete ammonium under conditions of acid loads is quantitatively much greater than the capacity to increase titratable acid. Multiple, often redundant pathways and processes exist to regulate these renal functions. Derangements in acid-base homeostasis, however, are common in clinical medicine and can often be related to the systems involved in acid-base transport in the kidneys. PMID:26597304

  3. Citric Acid Alternative to Nitric Acid Passivation

    NASA Technical Reports Server (NTRS)

    Lewis, Pattie L. (Compiler)

    2013-01-01

    The Ground Systems Development and Operations GSDO) Program at NASA John F. Kennedy Space Center (KSC) has the primary objective of modernizing and transforming the launch and range complex at KSC to benefit current and future NASA programs along with other emerging users. Described as the launch support and infrastructure modernization program in the NASA Authorization Act of 2010, the GSDO Program will develop and implement shared infrastructure and process improvements to provide more flexible, affordable, and responsive capabilities to a multi-user community. In support of the GSDO Program, the purpose of this project is to demonstratevalidate citric acid as a passivation agent for stainless steel. Successful completion of this project will result in citric acid being qualified for use as an environmentally preferable alternative to nitric acid for passivation of stainless steel alloys in NASA and DoD applications.

  4. A longitudinal study of the relation of lead in blood to lead in air concentrations among battery workers.

    PubMed

    Hodgkins, D G; Robins, T G; Hinkamp, D L; Schork, M A; Krebs, W H

    1992-04-01

    The relation between lead in air (PbA) and lead in blood (PbB), concentrations was investigated among 44 workers in five major operations in a United States high volume, lead acid battery plant. The study covered a 30 month period in which workers received frequent PbA and PbB determinations, workers remained in a single job, and PbA concentrations averaged below the US Occupational Safety and Health Administration (OSHA) permissible exposure limit of 50 micrograms/m3. In both univariate and multivariable linear regressions, longitudinal analyses averaging PbA concentrations over the 30 month study period appeared superior to cross sectional analyses using only six month PbA averages to model PbB concentrations. The covariate adjusted coefficient (alpha value) for PbA (mu/m3) in models of PbB (micrograms/100 g) was 1.14. This figure is strikingly higher than that reported in previous studies in the lead acid battery industry in all of which PbA concentrations were substantially higher than in the current study. Plausible explanations for the difference in alpha values include non-linearity of the PbA-PbB curve, a higher fraction of large size particulate associated with higher PbA concentrations, survivor bias among workers exposed to higher PbA concentrations, and the cross sectional designs of most previous studies. Despite previously reported problems with the model used by OSHA to predict PbA-PbB relations, the findings of this study are in good agreement with the predictions of that model. PMID:1571294

  5. USGS Tracks Acid Rain

    USGS Publications Warehouse

    Gordon, John D.; Nilles, Mark A.; Schroder, LeRoy J.

    1995-01-01

    The U.S. Geological Survey (USGS) has been actively studying acid rain for the past 15 years. When scientists learned that acid rain could harm fish, fear of damage to our natural environment from acid rain concerned the American public. Research by USGS scientists and other groups began to show that the processes resulting in acid rain are very complex. Scientists were puzzled by the fact that in some cases it was difficult to demonstrate that the pollution from automobiles and factories was causing streams or lakes to become more acidic. Further experiments showed how the natural ability of many soils to neutralize acids would reduce the effects of acid rain in some locations--at least as long as the neutralizing ability lasted (Young, 1991). The USGS has played a key role in establishing and maintaining the only nationwide network of acid rain monitoring stations. This program is called the National Atmospheric Deposition Program/National Trends Network (NADP/NTN). Each week, at approximately 220 NADP/NTN sites across the country, rain and snow samples are collected for analysis. NADP/NTN site in Montana. The USGS supports about 72 of these sites. The information gained from monitoring the chemistry of our nation's rain and snow is important for testing the results of pollution control laws on acid rain.

  6. Recovery of organic acids

    DOEpatents

    Verser, Dan W.; Eggeman, Timothy J.

    2009-10-13

    A method is disclosed for the recovery of an organic acid from a dilute salt solution in which the cation of the salt forms an insoluble carbonate salt. A tertiary amine and CO.sub.2 are introduced to the solution to form the insoluble carbonate salt and a complex between the acid and an amine. A water immiscible solvent, such as an alcohol, is added to extract the acid/amine complex from the dilute salt solution to a reaction phase. The reaction phase is continuously dried and a product between the acid and the solvent, such as an ester, is formed.

  7. Recovery of organic acids

    SciTech Connect

    Verser, Dan W.; Eggeman, Timothy J.

    2011-11-01

    A method is disclosed for the recovery of an organic acid from a dilute salt solution in which the cation of the salt forms an insoluble carbonate salt. A tertiary amine and CO.sub.2 are introduced to the solution to form the insoluble carbonate salt and a complex between the acid and an amine. A water immiscible solvent, such as an alcohol, is added to extract the acid/amine complex from the dilute salt solution to a reaction phase. The reaction phase is continuously dried and a product between the acid and the solvent, such as an ester, is formed.

  8. THIN-LAYER SEPARATION OF CITRIC ACID CYCLE INTERMEDIATES, LACTIC ACID, AND THE AMINO ACID TAURINE

    EPA Science Inventory

    This paper describes a two-dimensional mixed-layer method for separating citric acid cycle intermediates, lactic acid and the amino acid taurine. The method cleanly separates all citric acid cycle intermediates tested, excepting citric acid and isocitric acid. The solvents are in...

  9. Selective phosphorescence chemosensor for homocysteine based on an iridium(III) complex.

    PubMed

    Chen, Huili; Zhao, Qiang; Wu, Yanbo; Li, Fuyou; Yang, Hong; Yi, Tao; Huang, Chunhui

    2007-12-24

    A new homocysteine-selective sensor based on the iridium(III) complex Ir(pba)2(acac) (Hpba = 4-(2-pyridyl)benzaldehyde; acac = acetylacetone) was synthesized, and its' photophysical properties were studied. Upon the addition of homocysteine (Hcy) to a semi-aqueous solution of Ir(pba)2(acac), a color change from orange to yellow and a luminescent variation from deep red to green were evident to the naked eye. The blue-shift of the absorption spectrum and enhancement of the phosphorescence emission upon the addition of Hcy can be attributed to the formation of a thiazinane group by selective reaction of the aldehyde group of Ir(pba)2(acac) with Hcy, which was confirmed by 1H NMR studies. Importantly, Ir(pba)2(acac) shows uniquely luminescent recognition of Hcy over other amino acids (including cysteine) and thiol-related peptides (reduced glutathione), in agreement with the higher luminescent quantum yield of the adduct of Ir(pba)2(acac) with Hcy (0.038) compared with that of the adduct with Cys (~0.002). Both surface charge analysis and the electrochemical measurement indicated that a photoinduced electron-transfer process for Ir(pba)2(acac)-Cys might be responsible for the high specificity of Ir(pba)2(acac) toward Hcy over Cys. PMID:18044954

  10. Toxicology of Perfluoroalkyl acids

    EPA Science Inventory

    The Perfluoroalkyl acids(PFAAs) area a family of organic chemicals consisting of a perflurinated carbon backbone (4-12in length) and a acidic functional moiety (Carboxylate or sulfonate). These compounds have excellent surface-tension reducing properties and have numerous industr...

  11. Toxicology of Perfluoroalkyl Acids*

    EPA Science Inventory

    The perfluoroalkyl acids (PFAAs) are a family of organic chemicals consisting of a perfluorinated carbon backbone (4-12 in length) and an acidic functional moiety (carboxylate or sulfonate). These compounds are chemically stable, have excellent surface-tension reducing properties...

  12. Lead-acid cell

    SciTech Connect

    Hradcovsky, R.J.; Kozak, O.R.

    1980-12-09

    A lead-acid storage battery is described that has a lead negative electrode, a lead dioxide positive electrode and a sulfuric acid electrolyte having an organic catalyst dissolved therein which prevents dissolution of the electrodes into lead sulfate whereby in the course of discharge, the lead dioxide is reduced to lead oxide and the lead is oxidized.

  13. Proteins and Amino Acids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Proteins are the most abundant substances in living organisms and cells. All proteins are constructed from the same twenty amino acids that are linked together by covalent bonds. Shorter chains of two or more amino acids can be linked by covalent bonds to form polypeptides. There are twenty amino...

  14. EFFECTS OF ACID PRECIPITATION

    EPA Science Inventory

    Recent reviews of available data indicate that precipitation in a large region of North America is highly acidic when its pH is compared with the expected pH value of 5.65 for pure rain water in equilibrium with CO2. A growing body of evidence suggests that acid rain is responsib...

  15. Bile acid transporters

    PubMed Central

    Dawson, Paul A.; Lan, Tian; Rao, Anuradha

    2009-01-01

    In liver and intestine, transporters play a critical role in maintaining the enterohepatic circulation and bile acid homeostasis. Over the past two decades, there has been significant progress toward identifying the individual membrane transporters and unraveling their complex regulation. In the liver, bile acids are efficiently transported across the sinusoidal membrane by the Na+ taurocholate cotransporting polypeptide with assistance by members of the organic anion transporting polypeptide family. The bile acids are then secreted in an ATP-dependent fashion across the canalicular membrane by the bile salt export pump. Following their movement with bile into the lumen of the small intestine, bile acids are almost quantitatively reclaimed in the ileum by the apical sodium-dependent bile acid transporter. The bile acids are shuttled across the enterocyte to the basolateral membrane and effluxed into the portal circulation by the recently indentified heteromeric organic solute transporter, OSTα-OSTβ. In addition to the hepatocyte and enterocyte, subgroups of these bile acid transporters are expressed by the biliary, renal, and colonic epithelium where they contribute to maintaining bile acid homeostasis and play important cytoprotective roles. This article will review our current understanding of the physiological role and regulation of these important carriers. PMID:19498215

  16. Fats and fatty acids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The absolute fat requirement of the human species is the amount of essential fatty acids needed to maintain optimal fatty acid composition of all tissues and normal eicosanoid synthesis. At most, this requirement is no more than about 5% of an adequate energy intake. However, fat accounts for appro...

  17. Analysis of Organic Acids.

    ERIC Educational Resources Information Center

    Griswold, John R.; Rauner, Richard A.

    1990-01-01

    Presented are the procedures and a discussion of the results for an experiment in which students select unknown carboxylic acids, determine their melting points, and investigate their solubility behavior in water and ethanol. A table of selected carboxylic acids is included. (CW)

  18. EXPOSURES TO ACIDIC AEROSOLS

    EPA Science Inventory

    Ambient monitoring of acid aerosol in four U.S. cities and in a rural region of southern Ontario clearly show distinct periods of strong acidity. easurements made in Kingston, TN, and Stuebenville, OH, resulted in 24-hr H+ ion concentrations exceeding 100 nmole/m3 more than 10 ti...

  19. Mutant fatty acid desaturase

    DOEpatents

    Shanklin, John; Cahoon, Edgar B.

    2004-02-03

    The present invention relates to a method for producing mutants of a fatty acid desaturase having a substantially increased activity towards fatty acid substrates with chains containing fewer than 18 carbons relative to an unmutagenized precursor desaturase having an 18 carbon atom chain length substrate specificity. The method involves inducing one or more mutations in the nucleic acid sequence encoding the precursor desaturase, transforming the mutated sequence into an unsaturated fatty acid auxotroph cell such as MH13 E. coli, culturing the cells in the absence of supplemental unsaturated fatty acids, thereby selecting for recipient cells which have received and which express a mutant fatty acid desaturase with an elevated specificity for fatty acid substrates having chain lengths of less than 18 carbon atoms. A variety of mutants having 16 or fewer carbon atom chain length substrate specificities are produced by this method. Mutant desaturases produced by this method can be introduced via expression vectors into prokaryotic and eukaryotic cells and can also be used in the production of transgenic plants which may be used to produce specific fatty acid products.

  20. Omega-3 Fatty Acids

    MedlinePlus

    Omega-3 fatty acids are used together with lifestyle changes (diet, weight-loss, exercise) to reduce the amount of triglycerides (a fat-like ... people with very high triglycerides. Omega-3 fatty acids are in a class of medications called antilipemic ...

  1. Salicylic Acid Topical

    MedlinePlus

    Propa pH® Peel-Off Acne Mask ... pimples and skin blemishes in people who have acne. Topical salicylic acid is also used to treat ... medications called keratolytic agents. Topical salicylic acid treats acne by reducing swelling and redness and unplugging blocked ...

  2. Amino Acid Crossword Puzzle

    ERIC Educational Resources Information Center

    Sims, Paul A.

    2011-01-01

    Learning the 20 standard amino acids is an essential component of an introductory course in biochemistry. Later in the course, the students study metabolism and learn about various catabolic and anabolic pathways involving amino acids. Learning new material or concepts often is easier if one can connect the new material to what one already knows;…

  3. Chemorheology of phenylboronate-salicylhydroxamate crosslinked hydrogel networks with a sulfonated polymer backbone

    PubMed Central

    Roberts, Meredith C.; Mahalingam, Alamelu; Hanson, Melissa C.; Kiser, Patrick F.

    2012-01-01

    Hydrogel networks crosslinked with polymer-bound phenylboronic acid (PBA) and salicylhydroxamic acid (SHA) demonstrate pH-reversible gel behavior due to the pH-dependent equilibrium of the crosslinking moieties that form the gel network. Furthermore, the pH at which gels behave dynamically can be controlled by use of a polyelectrolyte backbone. Here we report on the frequency-dependent chemorheological characterization of PBA-SHA crosslinked hydrogel networks with a sulfonated polymer backbone. Our results suggest that the anionic nature of the polymers allows reversible crosslinking at neutral pH that an otherwise neutral-backboned PBA-SHA crosslinked network cannot, and that these charge-induced dynamics can be effectively screened by ions in solution. Moreover, moduli-frequency data can effectively be reduced into a single master curve with a neutral-backboned PBA-SHA gel data set as the reference condition. PMID:23132956

  4. Discovery of a new type of scaffold for the creation of novel tyrosinase inhibitors.

    PubMed

    Oyama, Takahiro; Takahashi, Satoshi; Yoshimori, Atsushi; Yamamoto, Tetsuya; Sato, Akira; Kamiya, Takanori; Abe, Hideaki; Abe, Takehiko; Tanuma, Sei-Ichi

    2016-09-15

    Tyrosinase is known as the key enzyme for melanin biosynthesis, which is effective in preventing skin injury by ultra violet (UV). In past decades, tyrosinase has been well studied in the field of cosmetics, medicine, agriculture and environmental sciences, and a lot of tyrosinase inhibitors have been developed for their needs. Here, we searched for new types of tyrosinase inhibitors and found phenylbenzoic acid (PBA) as a unique scaffold. Among three isomers of PBA, 3-phenylbenzoic acid (3-PBA) was revealed to be the most potent inhibitor against mushroom tyrosinase (IC50=6.97μM, monophenolase activity; IC50=36.3μM, diphenolase activity). The kinetic studies suggested that the apparent inhibition modes for the monophenolase and diphenolase activities were noncompetitive and mixed type inhibition, respectively. Analyses by in silico docking studies using the crystallographic structure of mushroom tyrosinase indicated that the carboxylic acid group of the 3-PBA could adequately bind to two cupric ions in the tyrosinase. To prove this hypothesis, we examined the effect of modification of the carboxylic acid group of the 3-PBA on its inhibitory activity. As expected, the esterification abrogated the inhibitory activity. These observations suggest that 3-PBA is a useful lead compound for the generation of novel tyrosinase inhibitors and provides a new insight into the molecular basis of tyrosinase catalytic mechanisms. PMID:27507110

  5. Trans Fatty Acids

    NASA Astrophysics Data System (ADS)

    Doyle, Ellin

    1997-09-01

    Fats and their various fatty acid components seem to be a perennial concern of nutritionists and persons concerned with healthful diets. Advice on the consumption of saturated, polyunsaturated, monounsaturated, and total fat bombards us from magazines and newspapers. One of the newer players in this field is the group of trans fatty acids found predominantly in partially hydrogenated fats such as margarines and cooking fats. The controversy concerning dietary trans fatty acids was recently addressed in an American Heart Association (AHA) science advisory (1) and in a position paper from the American Society of Clinical Nutrition/American Institute of Nutrition (ASCN/AIN) (2). Both reports emphasize that the best preventive strategy for reducing risk for cardiovascular disease and some types of cancer is a reduction in total and saturated fats in the diet, but a reduction in the intake of trans fatty acids was also recommended. Although the actual health effects of trans fatty acids remain uncertain, experimental evidence indicates that consumption of trans fatty acids adversely affects serum lipid levels. Since elevated levels of serum cholesterol and triacylglycerols are associated with increased risk of cardiovascular disease, it follows that intake of trans fatty acids should be minimized.

  6. Sulfuric Acid on Europa

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Frozen sulfuric acid on Jupiter's moon Europa is depicted in this image produced from data gathered by NASA's Galileo spacecraft. The brightest areas, where the yellow is most intense, represent regions of high frozen sulfuric acid concentration. Sulfuric acid is found in battery acid and in Earth's acid rain.

    This image is based on data gathered by Galileo's near infrared mapping spectrometer.

    Europa's leading hemisphere is toward the bottom right, and there are enhanced concentrations of sulfuric acid in the trailing side of Europa (the upper left side of the image). This is the face of Europa that is struck by sulfur ions coming from Jupiter's innermost moon, Io. The long, narrow features that crisscross Europa also show sulfuric acid that may be from sulfurous material extruded in cracks.

    Galileo, launched in 1989, has been orbiting Jupiter and its moons since December 1995. JPL manages the Galileo mission for NASA's Office of Space Science, Washington DC. JPL is a division of the California Institute of Technology, Pasadena, CA.

  7. Strongly Acidic Auxin Indole-3-Methanesulfonic Acid

    PubMed Central

    Cohen, Jerry D.; Baldi, Bruce G.; Bialek, Krystyna

    1985-01-01

    A radiochemical synthesis is described for [14C]indole-3-methanesulfonic acid (IMS), a strongly acidic auxin analog. Techniques were developed for fractionation and purification of IMS using normal and reverse phase chromatography. In addition, the utility of both Fourier transform infrared spectrometry and fast atom bombardment mass spectrometry for analysis of IMS has been demonstrated. IMS was shown to be an active auxin, stimulating soybean hypocotyl elongation, bean first internode curvature, and ethylene production. IMS uptake by thin sections of soybean hypocotyl was essentially independent of solution pH and, when applied at a 100 micromolar concentration, IMS exhibited a basipetal polarity in its transport in both corn coleoptile and soybean hypocotyl sections. [14C]IMS should, therefore, be a useful compound to study fundamental processes related to the movement of auxins in plant tissues and organelles. PMID:16664007

  8. Understanding acid rain

    SciTech Connect

    Budiansky, S.

    1981-06-01

    The complexities of the phenomenon of acid rain are described. Many factors, including meteorology, geology, chemistry, and biology, all play parts. Varying weather, varying soils, the presence of other pollutants and species differences all act to blur the connections between industrial emissions, acid rain, and environmental damage. Some experts believe that the greatest pH shock to lakes occurs during snow melt and runoff in the spring; others believe that much of the plant damage ascribed to acid rain is actually due to the effects of ozone. Much work needs to be done in the area of sampling. Historical data are lacking and sampling methods are not sufficiently accurate. (JMT)

  9. WASTE ACID DETOXIFICATION AND RECLAMATION

    EPA Science Inventory

    This Environmental Security Technology Certification Program (ESTCP) project demonstrated the Waste Acid Detoxification and Reclamation (WADR) systems ability to recover waste electropolish acid solutions generated during the manufacturing of gun-tubes, and reuse the clean acid. ...

  10. Disorders of Amino Acid Metabolism

    MedlinePlus

    ... Aspiration Syndrome Additional Content Medical News Disorders of Amino Acid Metabolism By Lee M. Sanders, MD, MPH NOTE: ... Metabolic Disorders Disorders of Carbohydrate Metabolism Disorders of Amino Acid Metabolism Disorders of Lipid Metabolism Amino acids are ...

  11. Acid soldering flux poisoning

    MedlinePlus

    The harmful substances in soldering fluxes are called hydrocarbons. They include: Ammonium chloride Rosin Hydrochloric acid Zinc ... Lee DC. Hydrocarbons. In: Marx JA, Hockberger RS, Walls RM, et ... Rosen's Emergency Medicine: Concepts and Clinical Practice . 8th ...

  12. Aminolevulinic Acid Topical

    MedlinePlus

    ... in combination with photodynamic therapy (PDT; special blue light) to treat actinic keratoses (small crusty or scaly ... photosensitizing agents. When aminolevulinic acid is activated by light, it damages the cells of actinic keratosis lesions.

  13. Difficult Decisions: Acid Rain.

    ERIC Educational Resources Information Center

    Miller, John A.; Slesnick, Irwin L.

    1989-01-01

    Discusses some of the contributing factors and chemical reactions involved in the production of acid rain, its effects, and political issues pertaining to who should pay for the clean up. Supplies questions for consideration and discussion. (RT)

  14. Uric acid - urine

    MedlinePlus

    ... to filter fluids and waste normally (chronic glomerulonephritis ) Lead poisoning Long-term (chronic) alcohol use Risks There are ... Elsevier Saunders; 2011:chap 28. Read More Gout Lead poisoning Liver disease Polycythemia vera Uric acid - blood Update ...

  15. Amoxicillin and Clavulanic Acid

    MedlinePlus

    ... is used to treat certain infections caused by bacteria, including infections of the ears, lungs, sinus, skin, ... antibiotics. It works by stopping the growth of bacteria. Clavulanic acid is in a class of medications ...

  16. Hydrofluoric acid poisoning

    MedlinePlus

    Chemical Emergencies: Case Definition: Hydrofluoric Acid . Centers for Disease Control and Prevention, U.S. Dept of Health and Human Services; 2005. Goldfrank LR, ed. Goldfrank's Toxicologic Emergencies . 8th ed. New ...

  17. Lead/acid batteries

    NASA Astrophysics Data System (ADS)

    Bullock, Kathryn R.

    Lead/acid batteries are produced in sizes from less than 1 to 3000 Ah for a wide variety of portable, industrial and automotive applications. Designs include Planté, Fauré or pasted, and tubular electrodes. In addition to the traditional designs which are flooded with sulfuric acid, newer 'valve-regulated" designs have the acid immolibized in a silica gel or absorbed in a porous glass separator. Development is ongoing worldwide to increase the specific power, energy and deep discharge cycle life of this commercially successful system to meet the needs of new applications such as electric vehicles, load leveling, and solar energy storage. The operating principles, current status, technical challenges and commercial impact of the lead/acid battery are reviewed.

  18. Citric acid urine test

    MedlinePlus

    ... used to diagnose renal tubular acidosis and evaluate kidney stone disease. ... tubular acidosis and a tendency to form calcium kidney stones. The following may decrease urine citric acid levels: ...

  19. Pantothenic acid and biotin

    MedlinePlus

    ... JavaScript. Pantothenic acid and biotin are types of B vitamins. They are water-soluble, which means that the ... found in foods that are good sources of B vitamins, including the following: Animal proteins Avocado Broccoli, kale, ...

  20. (Acid rain workshop)

    SciTech Connect

    Turner, R.S.

    1990-12-05

    The traveler presented a paper entitled Susceptibility of Asian Ecosystems to Soil-Mediated Acid Rain Damage'' at the Second Workshop on Acid Rain in Asia. The workshop was organized by the Asian Institute of Technology (Bangkok, Thailand), Argonne National Laboratory (Argonne, Illinois), and Resource Management Associates (Madison, Wisconsin) and was sponsored by the US Department of Energy, the United Nations Environment Program, the United Nations Economic and Social Commission for Asia and the Pacific, and the World Bank. Papers presented on the first day discussed how the experience gained with acid rain in North America and Europe might be applied to the Asian situation. Papers describing energy use projections, sulfur emissions, and effects of acid rain in several Asian countries were presented on the second day. The remaining time was allotted to discussion, planning, and writing plans for a future research program.

  1. Stomach acid test

    MedlinePlus

    Gastric acid secretion test ... The test is done after you have not eaten for a while so fluid is all that remains in ... injected into your body. This is done to test the ability of the cells in the stomach ...

  2. Deoxycholic Acid Injection

    MedlinePlus

    ... severe submental fat ('double chin'; fatty tissue located under the chin). Deoxycholic acid injection is in a ... as a liquid to be injected subcutaneously (just under the skin) by a doctor. Your doctor will ...

  3. Amino Acids and Chirality

    NASA Technical Reports Server (NTRS)

    Cook, Jamie E.

    2012-01-01

    Amino acids are among the most heavily studied organic compound class in carbonaceous chondrites. The abundance, distributions, enantiomeric compositions, and stable isotopic ratios of amino acids have been determined in carbonaceous chondrites fi'om a range of classes and petrographic types, with interesting correlations observed between these properties and the class and typc of the chondritcs. In particular, isomeric distributions appear to correlate with parent bodies (chondrite class). In addition, certain chiral amino acids are found in enantiomeric excess in some chondrites. The delivery of these enantiomeric excesses to the early Earth may have contributed to the origin of the homochirality that is central to life on Earth today. This talk will explore the amino acids in carbonaceous chondritcs and their relevance to the origin of life.

  4. Valproic Acid and Pregnancy

    MedlinePlus

    ... in the treatment of epilepsy, and to treat bipolar disorder and migraines. I have been taking valproic acid ... that women with seizure disorders and women with bipolar disorder might have menstrual problems and difficulty getting pregnant. ...

  5. Amino Acid Metabolism Disorders

    MedlinePlus

    Metabolism is the process your body uses to make energy from the food you eat. Food is ... One group of these disorders is amino acid metabolism disorders. They include phenylketonuria (PKU) and maple syrup ...

  6. Uric acid - blood

    MedlinePlus

    ... High levels of uric acid can sometimes cause gout or kidney disease. You may have this test ... Alcoholism Chemotherapy-related side effects Diabetes Excessive exercise Gout Hypoparathyroidism Lead poisoning Leukemia Medullary cystic kidney disease ...

  7. Citric acid urine test

    MedlinePlus

    ... The test is used to diagnose renal tubular acidosis and evaluate kidney stone disease. Normal Results The ... level of citric acid may mean renal tubular acidosis and a tendency to form calcium kidney stones. ...

  8. Folic Acid Quiz

    MedlinePlus

    ... more easily than natural food folate. Close × Answer: D CORRECT: Folic acid reduces the risk for spina ... g., orange juice and green vegetables). Close × Answer: D CORRECT: Spina bifida and anencephaly are neural tube ...

  9. Folic acid in diet

    MedlinePlus

    ... green leafy vegetables Dried beans and peas (legumes) Citrus fruits and juices Fortified means that vitamins have ... A.D.A.M. Editorial team. Related MedlinePlus Health Topics Folic Acid Browse the Encyclopedia A.D. ...

  10. Amoxicillin and Clavulanic Acid

    MedlinePlus

    ... Amoxicillin is in a class of medications called penicillin-like antibiotics. It works by stopping the growth ... allergic to amoxicillin (Amoxil, Trimox, Wymox), clavulanic acid, penicillin, cephalosporins, or any other medications.tell your doctor ...

  11. Boric Acid Poisoning

    PubMed Central

    Wong, L. C.; Heimbach, M. D.; Truscott, D. R.; Duncan, B. D.

    1964-01-01

    Boric acid poisoning in 11 infants, occurring in the newborn nursery as a result of the accidental and inadvertent use of 2.5% boric acid in the preparation of the formulae, is reported. Five of the infants died. All except two exhibited the classical symptomatology of acute boric acid poisoning, namely, diarrhea, vomiting, erythema, exfoliation, desquamation of the skin, and marked central nervous system irritation. Early manifestations of poisoning were nonspecific, and one patient died before skin manifestations were noted. Peritoneal dialysis, instituted in nine cases, was found to be the most effective method of treatment. It is recommended that boric acid, which is of doubtful therapeutic value, should be completely removed from hospitals, dispensaries and pharmacopoeias. ImagesFig. 1Fig. 2 PMID:14166459

  12. Polymers for acid thickening

    SciTech Connect

    Dixon, K.W.

    1980-09-30

    Acids, thickened with branched emulsion or suspension polymers of diallyldimethylammonium chloride are useful as oil well drilling and fracturing fluids for stimulating well production and in other applications, such as thickeners for cosmetics, paints, adhesives, textiles and printing inks.

  13. Acid-base chemistry

    SciTech Connect

    Hand, C.W.; Blewit, H.L.

    1985-01-01

    The book is not a research compendium and there are no references to the literature. It is a teaching text covering the entire range of undergraduate subject matter dealing with acid-base chemistry (some of it remotely) as taught in inorganic, analytical, and organic chemistry courses. The excellent chapters VII through IX deal in detail with the quantitative aspects of aqueous acid-base equilibria (salt hydrolysis and buffer, titrations, polyprotic and amphoteric substances).

  14. Utilization of acid tars

    SciTech Connect

    Frolov, A.F.; Denisova, T.L.; Aminov, A.N.

    1987-01-01

    Freshly produced acid tar (FPAT), obtained as refinery waste in treating petroleum oils with sulfuric acid and oleum, contains 80% or more sulfuric acid. Of such tars, pond acid tars, which contain up to 80% neutral petroleum products and sulfonated resins, are more stable, and have found applications in the production of binders for paving materials. In this article the authors are presenting results obtained in a study of the composition and reactivity of FPAT and its stability in storage in blends with asphalts obtained in deasphalting operations, and the possibility of using the FPAT in road construction has been examined. In this work, wastes were used which were obtained in treating the oils T-750, KhF-12, I-8A, and MS-14. Data on the change in group chemical composition of FPAT are shown, and the acidity, viscosity, needle penetration, and softening point of acid tars obtained from different grades of oils are plotted as functions of the storage time. It is also shown that the fresh and hardened FPATs differ in their solubilities in various solvents.

  15. Mammalian Fatty Acid Elongases

    PubMed Central

    Jump, Donald B.

    2009-01-01

    Summary Very long chain fatty acids confer functional diversity on cells by variations in their chain length and degree of unsaturation. Microsomal fatty acid elongation represents the major pathway for determining the chain length of saturated, monounsaturated, and polyunsaturated fatty acids in cellular lipids. The overall reaction for fatty acid elongation involves four enzymes and utilizes malonyl CoA, NADPH, and fatty acyl CoA as substrates. While the fundamental pathway and its requirements have been known for many years, recent advances have revealed a family of enzymes involved in the first step of the reaction, i.e., the condensation reaction. Seven fatty acid elongase subtypes (Elovl #1–7) have been identified in the mouse, rat, and human genomes. These enzymes determine the rate of overall fatty acid elongation. Moreover, these enzymes also display differential substrate specificity, tissue distribution, and regulation, making them important regulators of cellular lipid composition as well as specific cellular functions. Herein, methods are described to measure elongase activity, analyze elongation products, and alter cellular elongase expression. PMID:19763486

  16. Neutron Nucleic Acid Crystallography.

    PubMed

    Chatake, Toshiyuki

    2016-01-01

    The hydration shells surrounding nucleic acids and hydrogen-bonding networks involving water molecules and nucleic acids are essential interactions for the structural stability and function of nucleic acids. Water molecules in the hydration shells influence various conformations of DNA and RNA by specific hydrogen-bonding networks, which often contribute to the chemical reactivity and molecular recognition of nucleic acids. However, X-ray crystallography could not provide a complete description of structural information with respect to hydrogen bonds. Indeed, X-ray crystallography is a powerful tool for determining the locations of water molecules, i.e., the location of the oxygen atom of H2O; however, it is very difficult to determine the orientation of the water molecules, i.e., the orientation of the two hydrogen atoms of H2O, because X-ray scattering from the hydrogen atom is very small.Neutron crystallography is a specialized tool for determining the positions of hydrogen atoms. Neutrons are not diffracted by electrons, but are diffracted by atomic nuclei; accordingly, neutron scattering lengths of hydrogen and its isotopes are comparable to those of non-hydrogen atoms. Therefore, neutron crystallography can determine both of the locations and orientations of water molecules. This chapter describes the current status of neutron nucleic acid crystallographic research as well as the basic principles of neutron diffraction experiments performed on nucleic acid crystals: materials, crystallization, diffraction experiments, and structure determination. PMID:26227050

  17. Autophagy on acid.

    PubMed

    Wojtkowiak, Jonathan W; Gillies, Robert J

    2012-11-01

    The microenvironment of solid tumors tends to be more acidic (6.5-7.0) than surrounding normal (7.2-7.4) tissue. Chaotic vasculature, oxygen limitation and major metabolic changes all contribute to the acidic microenvironment. We have previously proposed that low extracellular pH (pHe) plays a critical role in the development and progression of solid tumors. While extracellular acidosis is toxic to most normal cells, cancer cells can adapt and survive under this harsh condition. In this study, we focused on identifying survival strategies employed by cancer cells when challenged with an acidic pHe (6.6-6.7) either acutely or for many generations. While acutely acidic cells did not grow, those acclimated over many generations grew at the same rate as control cells. We observed that these cells induce autophagy in response to acidosis both acutely and chronically, and that this adaptation appears to be necessary for survival. Inhibition of autophagy in low pH cultured cells results in cell death. Histological analysis of tumor xenografts reveals a strong correlation of LC3 protein expression in regions projected to be acidic. Furthermore, in vivo buffering experiments using sodium bicarbonate, previously shown to raise extracellular tumor pH, decreases LC3 protein expression in tumor xenografts. These data imply that autophagy can be induced by extracellular acidosis and appears to be chronically employed as a survival adaptation to acidic microenvironments. PMID:22874557

  18. Method for isolating nucleic acids

    DOEpatents

    Hurt, Jr., Richard Ashley; Elias, Dwayne A.

    2015-09-29

    The current disclosure provides methods and kits for isolating nucleic acid from an environmental sample. The current methods and compositions further provide methods for isolating nucleic acids by reducing adsorption of nucleic acids by charged ions and particles within an environmental sample. The methods of the current disclosure provide methods for isolating nucleic acids by releasing adsorbed nucleic acids from charged particles during the nucleic acid isolation process. The current disclosure facilitates the isolation of nucleic acids of sufficient quality and quantity to enable one of ordinary skill in the art to utilize or analyze the isolated nucleic acids for a wide variety of applications including, sequencing or species population analysis.

  19. Acidification and Acid Rain

    NASA Astrophysics Data System (ADS)

    Norton, S. A.; Veselã½, J.

    2003-12-01

    Air pollution by acids has been known as a problem for centuries (Ducros, 1845; Smith, 1872; Camuffo, 1992; Brimblecombe, 1992). Only in the mid-1900s did it become clear that it was a problem for more than just industrially developed areas, and that precipitation quality can affect aquatic resources ( Gorham, 1955). The last three decades of the twentieth century saw tremendous progress in the documentation of the chemistry of the atmosphere, precipitation, and the systems impacted by acid atmospheric deposition. Chronic acidification of ecosystems results in chemical changes to soil and to surface waters and groundwater as a result of reduction of base cation supply or an increase in acid (H+) supply, or both. The most fundamental changes during chronic acidification are an increase in exchangeable H+ or Al3+ (aluminum) in soils, an increase in H+ activity (˜concentration) in water in contact with soil, and a decrease in alkalinity in waters draining watersheds. Water draining from the soil is acidified and has a lower pH (=-log [H+]). As systems acidify, their biotic community changes.Acidic surface waters occur in many parts of the world as a consequence of natural processes and also due to atmospheric deposition of strong acid (e.g., Canada, Jeffries et al. (1986); the United Kingdom, Evans and Monteith (2001); Sweden, Swedish Environmental Protection Board (1986); Finland, Forsius et al. (1990); Norway, Henriksen et al. (1988a); and the United States (USA), Brakke et al. (1988)). Concern over acidification in the temperate regions of the northern hemisphere has been driven by the potential for accelerating natural acidification by pollution of the atmosphere with acidic or acidifying compounds. Atmospheric pollution ( Figure 1) has resulted in an increased flux of acid to and through ecosystems. Depending on the ability of an ecosystem to neutralize the increased flux of acidity, acidification may increase only imperceptibly or be accelerated at a rate that

  20. Discovery of essential fatty acids

    PubMed Central

    Spector, Arthur A.; Kim, Hee-Yong

    2015-01-01

    Dietary fat was recognized as a good source of energy and fat-soluble vitamins by the first part of the 20th century, but fatty acids were not considered to be essential nutrients because they could be synthesized from dietary carbohydrate. This well-established view was challenged in 1929 by George and Mildred Burr who reported that dietary fatty acid was required to prevent a deficiency disease that occurred in rats fed a fat-free diet. They concluded that fatty acids were essential nutrients and showed that linoleic acid prevented the disease and is an essential fatty acid. The Burrs surmised that other unsaturated fatty acids were essential and subsequently demonstrated that linolenic acid, the omega-3 fatty acid analog of linoleic acid, is also an essential fatty acid. The discovery of essential fatty acids was a paradigm-changing finding, and it is now considered to be one of the landmark discoveries in lipid research. PMID:25339684

  1. Acid Rain, pH & Acidity: A Common Misinterpretation.

    ERIC Educational Resources Information Center

    Clark, David B.; Thompson, Ronald E.

    1989-01-01

    Illustrates the basis for misleading statements about the relationship between pH and acid content in acid rain. Explains why pH cannot be used as a measure of acidity for rain or any other solution. Suggests that teachers present acidity and pH as two separate and distinct concepts. (RT)

  2. Nitric acid-formic acid compatibility in DWPF

    SciTech Connect

    Eibling, R.E.

    1992-10-20

    The addition of the Nitric Acid Flowsheet to the DWPF feed preparation process introduces nitric acid into a vessel which will subsequently receive a formic acid solution. The combination of these two acids suggests that a denitration reaction might occur. This memorandum reviews the conditions under which a denitration reaction is possible and compares these conditions to DWPF operating conditions.

  3. Amino-acid contamination of aqueous hydrochloric acid.

    NASA Technical Reports Server (NTRS)

    Wolman, Y.; Miller, S. L.

    1971-01-01

    Considerable amino-acid contamination in commercially available analytical grade hydrochloric acid (37% HCl) was found. One bottle contained 8,300 nmol of amino-acids per liter. A bottle from another supplier contained 6,700 nmol per liter. The contaminants were mostly protein amino-acids and several unknowns. Data on the volatility of the amino-acids during HCl distillation were also obtained.

  4. Optical high acidity sensor

    DOEpatents

    Jorgensen, B.S.; Nekimken, H.L.; Carey, W.P.; O`Rourke, P.E.

    1997-07-22

    An apparatus and method for determining acid concentrations in solutions having acid concentrations of from about 0.1 Molar to about 16 Molar is disclosed. The apparatus includes a chamber for interrogation of the sample solution, a fiber optic light source for passing light transversely through the chamber, a fiber optic collector for receiving the collimated light after transmission through the chamber, a coating of an acid resistant polymeric composition upon at least one fiber end or lens, the polymeric composition in contact with the sample solution within the chamber and having a detectable response to acid concentrations within the range of from about 0.1 Molar to about 16 Molar, a measurer for the response of the polymeric composition in contact with the sample solution, and a comparer of the measured response to predetermined standards whereby the acid molarity of the sample solution within the chamber can be determined. Preferably, a first lens is attached to the end of the fiber optic light source, the first lens adapted to collimate light from the fiber optic light source, and a second lens is attached to the end of the fiber optic collector for focusing the collimated light after transmission through the chamber. 10 figs.

  5. Domoic Acid Epileptic Disease

    PubMed Central

    Ramsdell, John S.; Gulland, Frances M.

    2014-01-01

    Domoic acid epileptic disease is characterized by spontaneous recurrent seizures weeks to months after domoic acid exposure. The potential for this disease was first recognized in a human case study of temporal lobe epilepsy after the 1987 amnesic shellfish-poisoning event in Quebec, and was characterized as a chronic epileptic syndrome in California sea lions through investigation of a series of domoic acid poisoning cases between 1998 and 2006. The sea lion study provided a breadth of insight into clinical presentations, unusual behaviors, brain pathology, and epidemiology. A rat model that replicates key observations of the chronic epileptic syndrome in sea lions has been applied to identify the progression of the epileptic disease state, its relationship to behavioral manifestations, and to define the neural systems involved in these behavioral disorders. Here, we present the concept of domoic acid epileptic disease as a delayed manifestation of domoic acid poisoning and review the state of knowledge for this disease state in affected humans and sea lions. We discuss causative mechanisms and neural underpinnings of disease maturation revealed by the rat model to present the concept for olfactory origin of an epileptic disease; triggered in dendodendritic synapases of the olfactory bulb and maturing in the olfactory cortex. We conclude with updated information on populations at risk, medical diagnosis, treatment, and prognosis. PMID:24663110

  6. Domoic acid epileptic disease.

    PubMed

    Ramsdell, John S; Gulland, Frances M

    2014-03-01

    Domoic acid epileptic disease is characterized by spontaneous recurrent seizures weeks to months after domoic acid exposure. The potential for this disease was first recognized in a human case study of temporal lobe epilepsy after the 1987 amnesic shellfish-poisoning event in Quebec, and was characterized as a chronic epileptic syndrome in California sea lions through investigation of a series of domoic acid poisoning cases between 1998 and 2006. The sea lion study provided a breadth of insight into clinical presentations, unusual behaviors, brain pathology, and epidemiology. A rat model that replicates key observations of the chronic epileptic syndrome in sea lions has been applied to identify the progression of the epileptic disease state, its relationship to behavioral manifestations, and to define the neural systems involved in these behavioral disorders. Here, we present the concept of domoic acid epileptic disease as a delayed manifestation of domoic acid poisoning and review the state of knowledge for this disease state in affected humans and sea lions. We discuss causative mechanisms and neural underpinnings of disease maturation revealed by the rat model to present the concept for olfactory origin of an epileptic disease; triggered in dendodendritic synapases of the olfactory bulb and maturing in the olfactory cortex. We conclude with updated information on populations at risk, medical diagnosis, treatment, and prognosis. PMID:24663110

  7. Optical high acidity sensor

    DOEpatents

    Jorgensen, Betty S.; Nekimken, Howard L.; Carey, W. Patrick; O'Rourke, Patrick E.

    1997-01-01

    An apparatus and method for determining acid concentrations in solutions having acid concentrations of from about 0.1 Molar to about 16 Molar is disclosed. The apparatus includes a chamber for interrogation of the sample solution, a fiber optic light source for passing light transversely through the chamber, a fiber optic collector for receiving the collimated light after transmission through the chamber, a coating of an acid resistant polymeric composition upon at least one fiber end or lens, the polymeric composition in contact with the sample solution within the chamber and having a detectable response to acid concentrations within the range of from about 0.1 Molar to about 16 Molar, a measurer for the response of the polymeric composition in contact with the sample solution, and, a comparer of the measured response to predetermined standards whereby the acid molarity of the sample solution within the chamber can be determined. Preferably, a first lens is attached to the end of the fiber optic light source, the first lens adapted to collimate light from the fiber optic light source, and a second lens is attached to the end of the fiber optic collector for focusing the collimated light after transmission through the chamber.

  8. A Demonstration of Acid Rain

    ERIC Educational Resources Information Center

    Fong, Man Wai

    2004-01-01

    A demonstration showing acid rain formation is described. Oxides of sulfur and nitrogen that result from the burning of fossil fuels are the major pollutants of acid rain. In this demonstration, SO[subscript 2] gas is produced by the burning of matches. An acid-base indicator will show that the dissolved gas turns an aqueous solution acidic.

  9. Oleanolic acid ethanol monosolvate

    PubMed Central

    Froelich, Anna; Gzella, Andrzej K.

    2010-01-01

    Crystals of the title compound (systematic name: 3β-hy­droxy­olean-12-en-28-oic acid ethanol monosolvate), C30H48O3·C2H5OH, were obtained from unsuccessful co-crystallization trials. The asymmetric unit contains two symmetry-independent oleanolic acid mol­ecules, as well as two ethanol solvent mol­ecules. Inter­molecular O—H⋯O hydrogen bonds stabilize the crystal packing. In the oleanolic acid mol­ecules, ring C has a slightly distorted envelope conformation, while rings A, B, D and E adopt chair conformations and rings D and E are cis-fused. Both independent ethanol mol­ecules are orientationally disordered [occupancy ratios of 0.742 (8):0.258 (8) and 0.632 (12):0.368 (12). PMID:21588987

  10. Amino acid analysis.

    PubMed

    Crabb, J W; West, K A; Dodson, W S; Hulmes, J D

    2001-05-01

    Amino acid analysis (AAA) is one of the best methods to quantify peptides and proteins. Two general approaches to quantitative AAA exist, namely, classical postcolumn derivatization following ion-exchange chromatography and precolumn derivatization followed by reversed-phase HPLC (RP-HPLC). Excellent instrumentation and several specific methodologies are available for both approaches, and both have advantages and disadvantages. This unit focuses on picomole-level AAA of peptides and proteins using the most popular precolumn-derivatization method, namely, phenylthiocarbamyl amino acid analysis (PTC-AAA). It is directed primarily toward those interested in establishing the technology with a modest budget. PTC derivatization and analysis conditions are described, and support and alternate protocols describe additional techniques necessary or useful for most any AAA method--e.g., sample preparation, hydrolysis, instrument calibration, data interpretation, and analysis of difficult or unusual residues such as cysteine, tryptophan, phosphoamino acids, and hydroxyproline. PMID:18429107

  11. Acid rain: Controllable?

    NASA Astrophysics Data System (ADS)

    Machta, Lester

    Acid rain is one of a growing number of environmental issues in which impacts are far removed from the source o f the irritants. Those who suffer may differ in geographical area from those who benefit from the activity which releases pollution to the atmosphere. Like the issue concerning the depletion of ozone by manufactured chemicals, the acid rain issue further emphasizes the need for continuing atmospheric chemistry research, a science whose history dates back but a few decades. Examination of the acid rain issue also calls for intimate collaboration of atmospheric scientists with ecologists, biologists, and other scientists, who must advise the geophysicists regarding what chemicals in the environment produce damage, their mode of entry into an ecosystem, and the need to understand acute or chronic impacts.

  12. Acid rain in Asia

    NASA Astrophysics Data System (ADS)

    Bhatti, Neeloo; Streets, David G.; Foell, Wesley K.

    1992-07-01

    Acid rain has been an issue of great concern in North America and Europe during the past several decades. However, due to the passage of a number of recent regulations, most notably the Clean Air Act in the United States in 1990, there is an emerging perception that the problem in these Western nations is nearing solution. The situation in the developing world, particularly in Asia, is much bleaker. Given the policies of many Asian nations to achieve levels of development comparable with the industrialized world—which necessitate a significant expansion of energy consumption (most derived from indigenous coal reserves)—the potential for the formation of, and damage from, acid deposition in these developing countries is very high. This article delineates and assesses the emissions patterns, meteorology, physical geology, and biological and cultural resources present in various Asian nations. Based on this analysis and the risk factors to acidification, it is concluded that a number of areas in Asia are currently vulnerable to acid rain. These regions include Japan, North and South Korea, southern China, and the mountainous portions of Southeast Asia and southwestern India. Furthermore, with accelerated development (and its attendant increase in energy use and production of emissions of acid deposition precursors) in many nations of Asia, it is likely that other regions will also be affected by acidification in the near future. Based on the results of this overview, it is clear that acid deposition has significant potential to impact the Asian region. However, empirical evidence is urgently needed to confirm this and to provide early warning of increases in the magnitude and spread of acid deposition and its effects throughout this part of the world.

  13. NITRIC ACID PICKLING PROCESS

    DOEpatents

    Boller, E.R.; Eubank, L.D.

    1958-08-19

    An improved process is described for the treatment of metallic uranium surfaces preparatory to being given hot dip coatings. The process consists in first pickling the uraniunn surInce with aqueous 50% to 70% nitric acid, at 60 to 70 deg C, for about 5 minutes, rinsing the acid solution from the uranium article, promptly drying and then passing it through a molten alkali-metal halide flux consisting of 42% LiCl, 53% KCla and 5% NaCl into a molten metal bath consisting of 85 parts by weight of zinc and 15 parts by weight of aluminum

  14. [Nicotinic acid and nicotinamide].

    PubMed

    Kobayashi, M; Shimizu, S

    1999-10-01

    Nicotinic acid and nicotinamide are called niacin. They are the antipellagra vitamin essential to many animals for growth and health. In human being, niacin is believed necessary together with other vitamins for the prevention and cure of pellagra. Niacin is widely distributed in nature; appreciable amounts are found in liver, fish, yeast and cereal grains. Nicotinamide is a precursor of the coenzyme NAD and NADP. Some of the most understood metabolic processes that involve niacin are glycolysis, fatty acid synthesis and respiration. Niacin is also related to the following diseases: Hartnup disease; blue diaper syndrome; tryptophanuria; hydroxykynureninuria; xanthurenic aciduria; Huntington's disease. PMID:10540864

  15. Fatty Acids of Thiobacillus thiooxidans

    PubMed Central

    Levin, Richard A.

    1971-01-01

    Fatty acid spectra were made on Thiobacillus thiooxidans cultures both in the presence and absence of organic compounds. Small additions of glucose or acetate had no significant effect either on growth or fatty acid content. The addition of biotin had no stimulatory effect but did result in slight quantitative changes in the fatty acid spectrum. The predominant fatty acid was a C19 cyclopropane acid. PMID:4945206

  16. A cost-effective and practical polybenzanthrone-based fluorescent sensor for efficient determination of palladium (II) ion and its application in agricultural crops and environment.

    PubMed

    Zhang, Ge; Wen, Yangping; Guo, Chaoqun; Xu, Jingkun; Lu, Baoyang; Duan, Xuemin; He, Haohua; Yang, Jun

    2013-12-17

    A highly selective and sensitive fluorescent chemosensor suitable for practical measurement of palladium ion (Pd(2+)) in agricultural crops and environment samples has been successfully fabricated using polybenzanthrone (PBA). PBA was facilely electrosynthesized in the mixed electrolyte of acetonitrile and boron trifluoride diethyl etherate. The fluorescence intensity of PBA showed a linear response to Pd(2+) in the concentration range of 5 nM-0.12 mM with a detection limit of 0.277 nM and quantification limit of 0.925 nM. Different compounds existing in agricultural crops and environment such as common metal ions, anions, natural amino acids, carbohydrates, and organic acids were used to examine the selectivity of the as-fabricated sensor, and no obvious fluorescence change could be observed in these interferents and their mixtures. A possible mechanism was proposed that the coordination of PBA and Pd(2+) enhance the aggregation of polymer chains, which led to a significant quenching of PBA emission, and this was further confirmed by absorption spectra monitoring and transmission electron microscopy. The excellent performance of the proposed sensor and satisfactory results of the Pd(2+) determination in practical samples suggested that the PBA-based fluorescent sensor for the determination of Pd(2+) will be a good candidate for application in agriculture and environment. PMID:24296147

  17. The Acid-Base Titration of a Very Weak Acid: Boric Acid

    ERIC Educational Resources Information Center

    Celeste, M.; Azevedo, C.; Cavaleiro, Ana M. V.

    2012-01-01

    A laboratory experiment based on the titration of boric acid with strong base in the presence of d-mannitol is described. Boric acid is a very weak acid and direct titration with NaOH is not possible. An auxiliary reagent that contributes to the release of protons in a known stoichiometry facilitates the acid-base titration. Students obtain the…

  18. Comparison of Buffer Effect of Different Acids During Sandstone Acidizing

    NASA Astrophysics Data System (ADS)

    Umer Shafiq, Mian; Khaled Ben Mahmud, Hisham; Hamid, Mohamed Ali

    2015-04-01

    The most important concern of sandstone matrix acidizing is to increase the formation permeability by removing the silica particles. To accomplish this, the mud acid (HF: HCl) has been utilized successfully for many years to stimulate the sandstone formations, but still it has many complexities. This paper presents the results of laboratory investigations of different acid combinations (HF: HCl, HF: H3PO4 and HF: HCOOH). Hydrofluoric acid and fluoboric acid are used to dissolve clays and feldspar. Phosphoric and formic acids are added as a buffer to maintain the pH of the solution; also it allows the maximum penetration of acid into the core sample. Different tests have been performed on the core samples before and after the acidizing to do the comparative study on the buffer effect of these acids. The analysis consists of permeability, porosity, color change and pH value tests. There is more increase in permeability and porosity while less change in pH when phosphoric and formic acids were used compared to mud acid. From these results it has been found that the buffer effect of phosphoric acid and formic acid is better than hydrochloric acid.

  19. Alkyl phosphonic acids and sulfonic acids in the Murchison meteorite

    NASA Technical Reports Server (NTRS)

    Cooper, George W.; Onwo, Wilfred M.; Cronin, John R.

    1992-01-01

    Homologous series of alkyl phosphonic acids and alkyl sulfonic acids, along with inorganic orthophosphate and sulfate, are identified in water extracts of the Murchison meteorite after conversion to their t-butyl dimethylsilyl derivatives. The methyl, ethyl, propyl, and butyl compounds are observed in both series. Five of the eight possible alkyl phosphonic acids and seven of the eight possible alkyl sulfonic acids through C4 are identified. Abundances decrease with increasing carbon number as observed of other homologous series indigenous to Murchison. Concentrations range downward from approximately 380 nmol/gram in the alkyl sulfonic acid series, and from 9 nmol/gram in the alkyl phosphonic acid series.

  20. Docosahexaenoic acid and lactation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Docosahexaenoic acid (DHA) is an important component of membrane phospholipids in the retina, and brain, and accumulates rapidly in these tissues during early infancy. DHA is present in human milk, but the amount varies considerably and is largely dependent on maternal diet. This article reviews dat...

  1. ACID AEROSOL MEASUREMENT WORKSHOP

    EPA Science Inventory

    This report documents the discussion and results of the U.S. EPA Acid Aerosol Measurement Workshop, conducted February 1-3, 1989, in Research Triangle Park, North Carolina. t was held in response to recommendations by the Clean Air Scientific Advisory Committee (CASAC) regarding ...

  2. Acid Rain Classroom Projects.

    ERIC Educational Resources Information Center

    Demchik, Michael J.

    2000-01-01

    Describes a curriculum plan in which students learn about acid rain through instructional media, research and class presentations, lab activities, simulations, design, and design implementation. Describes the simulation activity in detail and includes materials, procedures, instructions, examples, results, and discussion sections. (SAH)

  3. Acid rain bibliography

    SciTech Connect

    Sayers, C.S.

    1983-09-01

    This bibliography identifies 900 citations on various aspects of Acid Rain, covering published bibliographies, books, reports, conference and symposium proceedings, audio visual materials, pamphlets and newsletters. It includes five sections: citations index (complete record of author, title, source, order number); KWIC index; title index; author index; and source index. 900 references.

  4. The Acid Rain Debate.

    ERIC Educational Resources Information Center

    Oates-Bockenstedt, Catherine

    1997-01-01

    Details an activity designed to motivate students by incorporating science-related issues into a classroom debate. Includes "The Acid Rain Bill" and "Position Guides" for student roles as committee members, consumers, governors, industry owners, tourism professionals, senators, and debate directors. (DKM)

  5. The Acid Rain Debate.

    ERIC Educational Resources Information Center

    Bybee, Rodger; And Others

    1984-01-01

    Describes an activity which provides opportunities for role-playing as industrialists, ecologists, and government officials. The activity involves forming an international commission on acid rain, taking testimony, and, based on the testimony, making recommendations to governments on specific ways to solve the problem. Includes suggestions for…

  6. The Acid Rain Game.

    ERIC Educational Resources Information Center

    Rakow, Steven J.; Glenn, Allen

    1982-01-01

    Provides rationale for and description of an acid rain game (designed for two players), a problem-solving model for elementary students. Although complete instructions are provided, including a copy of the game board, the game is also available for Apple II microcomputers. Information for the computer program is available from the author.…

  7. Acid Rain Investigations.

    ERIC Educational Resources Information Center

    Hugo, John C.

    1992-01-01

    Presents an activity in which students investigate the formation of solid ammonium chloride aerosol particles to help students better understand the concept of acid rain. Provides activity objectives, procedures, sample data, clean-up instructions, and questions and answers to help interpret the data. (MDH)

  8. Brain amino acid sensing.

    PubMed

    Tsurugizawa, T; Uneyama, H; Torii, K

    2014-09-01

    The 20 different amino acids, in blood as well as in the brain, are strictly maintained at the same levels throughout the day, regardless of food intake. Gastric vagal afferents only respond to free glutamate and sugars, providing recognition of food intake and initiating digestion. Metabolic control of amino acid homeostasis and diet-induced thermogenesis is triggered by this glutamate signalling in the stomach through the gut-brain axis. Rats chronically fed high-sugar and high-fat diets do not develop obesity when a 1% (w/v) monosodium glutamate (MSG) solution is available in a choice paradigm. Deficiency of the essential amino acid lysine (Lys) induced a plasticity in rats in response to Lys. This result shows how the body is able to identify deficient nutrients to maintain homeostasis. This plastic effect is induced by activin A activity in the brain, particularly in certain neurons in the lateral hypothalamic area (LHA) which is the centre for amino acid homeostasis and appetite. These neurons respond to glutamate signalling in the oral cavity by which umami taste is perceived. They play a quantitative role in regulating ingestion of deficient nutrients, thereby leading to a healthier life. After recovery from malnutrition, rats prefer MSG solutions, which serve as biomarkers for protein nutrition. PMID:25200295

  9. Targeting tumor acidity

    NASA Astrophysics Data System (ADS)

    Reshetnyak, Yana K.; Engelman, Donald M.; Andreev, Oleg A.

    2012-02-01

    One of the main features of solid tumors is extracellular acidity, which correlates with tumor aggressiveness and metastatic potential. We introduced novel approach in targeting of acidic tumors, and translocation of cell-impermeable cargo molecules across cellular membrane. Our approach is based on main principle of insertion and folding of a polypeptide in lipid bilayer of membrane. We have identified family of pH Low Insertion Peptides (pHLIPs), which are capable spontaneous insertion and folding in membrane at mild acidic conditions. The affinity of peptides of pHLIP family to membrane at low pH is several times higher than at neutral pH. The process of peptides folding occurs within milliseconds. The energy released in a result of folding (about 2 kcal/mol) could be used to move polar cargo across a membrane, which is a novel concept in drug delivery. pHLIP peptides could be considered as a pH-sensitive single peptide molecular transporters and conjugated with imaging probes for fluorescence, MR, PET and SPECT imaging, they represent a novel in vivo marker of acidity. The work is supported by NIH grants CA133890 and GM073857 to OAA, DME, YRK.

  10. Synthesis of (+)-Coronafacic Acid

    PubMed Central

    Taber, Douglass F.; Sheth, Ritesh B.; Tian, Weiwei

    2009-01-01

    An enantioselective synthesis of (+)-coronafacic acid has been achieved. Rhodium catalyzed cyclization of an α-diazoester provided the intermediate cyclopentanone in high enantiomeric purity. Subsequent Fe-mediated cyclocarbonylation of a derived alkenyl cyclopropane gave a bicyclic enone, that then was hydrogenated and carried on to the natural product. PMID:19231870

  11. Plant fatty acid hydroxylase

    DOEpatents

    Somerville, Chris; van de Loo, Frank

    2000-01-01

    The present invention relates to the identification of nucleic acid sequences and constructs, and methods related thereto, and the use of these sequences and constructs to produce genetically modified plants for the purpose of altering the composition of plant oils, waxes and related compounds.

  12. Spermatotoxicity of dichloroacetic acid

    EPA Science Inventory

    The testicular toxicity of dichloroacetic acid (DCA), a disinfection byproduct of drinking water, was evaluated in adult male rats given both single and multiple (up to 14 d) oral doses. Delayed spermiation and altered resorption of residual bodies were observed in rats given sin...

  13. A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid-Mediated Deoxygenation of the Glucose-Derived Materials Quinic Acid and Shikimic Acid

    SciTech Connect

    Arceo, Elena; Ellman, Jonathan; Bergman, Robert

    2010-05-03

    An alternative biomass-based route to benzoic acid from the renewable starting materials quinic acid and shikimic acid is described. Benzoic acid is obtained selectively using a highly efficient, one-step formic acid-mediated deoxygenation method.

  14. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  15. Photostabilization of ascorbic acid with citric acid, tartaric acid and boric acid in cream formulations.

    PubMed

    Ahmad, I; Ali Sheraz, M; Ahmed, S; Shad, Z; Vaid, F H M

    2012-06-01

    This study involves the evaluation of the effect of certain stabilizers, that is, citric acid (CT), tartaric acid (TA) and boric acid (BA) on the degradation of ascorbic acid (AH(2) ) in oil-in-water cream formulations exposed to the UV light and stored in the dark. The apparent first-order rate constants (0.34-0.95 × 10(-3) min(-1) in light, 0.38-1.24 × 10(-2) day(-1) in dark) for the degradation reactions in the presence of the stabilizers have been determined. These rate constants have been used to derive the second-order rate constants (0.26-1.45 × 10(-2) M(-1) min(-1) in light, 3.75-8.50 × 10(-3) M(-1) day(-1) in dark) for the interaction of AH(2) and the individual stabilizers. These stabilizers are effective in causing the inhibition of the rate of degradation of AH(2) both in the light and in the dark. The inhibitory effect of the stabilizers is in the order of CT > TA > BA. The rate of degradation of AH(2) in the presence of these stabilizers in the light is about 120 times higher than that in the dark. This could be explained on the basis of the deactivation of AH(2) -excited triplet state by CT and TA and by the inhibition of AH(2) degradation through complex formation with BA. AH(2) leads to the formation of dehydroascorbic acid (A) by chemical and photooxidation in cream formulations. PMID:22296174

  16. Fatty acid-producing hosts

    SciTech Connect

    Pfleger, Brian F; Lennen, Rebecca M

    2013-12-31

    Described are hosts for overproducing a fatty acid product such as a fatty acid. The hosts include an exogenous nucleic acid encoding a thioesterase and, optionally, an exogenous nucleic acid encoding an acetyl-CoA carboxylase, wherein an acyl-CoA synthetase in the hosts are functionally delected. The hosts prefereably include the nucleic acid encoding the thioesterase at an intermediate copy number. The hosts are preferably recominantly stable and growth-competent at 37.degree. C. Methods of producing a fatty acid product comprising culturing such hosts at 37.degree. C. are also described.

  17. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis. PMID:27349116

  18. Circulating folic acid in plasma: relation to folic acid fortification

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The implementation of folic acid fortification in the United States has resulted in unprecedented amounts of this synthetic form of folate in the American diet. Folic acid in circulation may be a useful measure of physiologic exposure to synthetic folic acid, and there is a potential for elevated co...

  19. College Chemistry Students' Mental Models of Acids and Acid Strength

    ERIC Educational Resources Information Center

    McClary, LaKeisha; Talanquer, Vicente

    2011-01-01

    The central goal of this study was to characterize the mental models of acids and acid strength expressed by advanced college chemistry students when engaged in prediction, explanation, and justification tasks that asked them to rank chemical compounds based on their relative acid strength. For that purpose we completed a qualitative research…

  20. NAPAP (National Acid Precipitation Assessment Program) results on acid rain

    SciTech Connect

    Not Available

    1990-06-01

    The National Acid Precipitation Assessment Program (NAPAP) was mandated by Congress in 1980 to study the effects of acid rain. The results of 10 years of research on the effect of acid deposition and ozone on forests, particularly high elevation spruce and fir, southern pines, eastern hardwoods and western conifers, will be published this year.

  1. Acid Earth--The Global Threat of Acid Pollution.

    ERIC Educational Resources Information Center

    McCormick, John

    Acid pollution is a major international problem, but the debate it has elicited has often clouded the distinction between myth and facts. This publication attempts to concerning the acid pollution situation. This publication attempts to identify available facts. It is the first global review of the problem of acid pollution and the first to…

  2. Industrial ecotoxicology "acid rain".

    PubMed

    Astolfi, E; Gotelli, C; Higa, J

    1986-01-01

    The acid rain phenomenon was studied in the province of Cordoba, Argentina. This study, based on a previously outlined framework, determined the anthropogenic origin of the low pH due to the presence of industrial hydrochloric acid wastage. This industrial ecotoxicological phenomenon seriously affected the forest wealth, causing a great defoliation of trees and shrubs, with a lower effect on crops. A survey on its effects on human beings has not been carried out, but considering the corrosion caused to different metals and its denouncing biocide effect on plants and animals, we should expect to find some kind of harm to the health of the workers involved or others engaged in farming, and even to those who are far away from the polluting agent. PMID:3758667

  3. [Progress in glucaric acid].

    PubMed

    Qiu, Yuying; Fang, Fang; Du, Guocheng; Chen, Jian

    2015-04-01

    Glucaric acid (GA) is derived from glucose and commonly used in chemical industry. It is also considered as one of the "Top value-added chemicals from biomass" as carbohydrate monomers to produce various synthetic polymers and bioenergy. The demand for GA in food manufacture is increasing. GA has also attracted public attentions due to its therapeutic uses such as regulating hormones, increasing the immune function and reducing the risks of cancers. Currently GA is produced by chemical oxidation. Research on production of GA via microbial synthesis is still at preliminary stage. We reviewed the advances of glucaric acid applications, preparation and quantification methods. The prospects on production of GA by microbial fermentation were also discussed. PMID:26380405

  4. Acid hydrolysis of cellulose

    SciTech Connect

    Salazar, H.

    1980-12-01

    One of the alternatives to increase world production of etha nol is by the hydrolysis of cellulose content of agricultural residues. Studies have been made on the types of hydrolysis: enzimatic and acid. Data obtained from the sulphuric acid hydrolysis of cellulose showed that this process proceed in two steps, with a yield of approximately 95% glucose. Because of increases in cost of alternatives resources, the high demand of the product and the more economic production of ethanol from cellulose materials, it is certain that this technology will be implemented in the future. At the same time further studies on the disposal and reuse of the by-products of this production must be undertaken.

  5. Eucomic acid methanol monosolvate

    PubMed Central

    Li, Guo-Qiang; Li, Yao-Lan; Wang, Guo-Cai; Liang, Zhi-Hong; Jiang, Ren-Wang

    2011-01-01

    In the crystal structure of the title compound [systematic name: 2-hy­droxy-2-(4-hy­droxy­benz­yl)butane­dioic acid methanol monosolvate], C11H12O6·CH3OH, the dihedral angles between the planes of the carboxyl groups and the benzene ring are 51.23 (9) and 87.97 (9)°. Inter­molecular O—H⋯O hydrogen-bonding inter­actions involving the hy­droxy and carb­oxy­lic acid groups and the methanol solvent mol­ecule give a three-dimensional structure. PMID:22091200

  6. (Radioiodinated free fatty acids)

    SciTech Connect

    Knapp, Jr., F. F.

    1987-12-11

    The traveler participated in the Second International Workshop on Radioiodinated Free Fatty Acids in Amsterdam, The Netherlands where he presented an invited paper describing the pioneering work at the Oak Ridge National Laboratory (ORNL) involving the design, development and testing of new radioiodinated methyl-branched fatty acids for evaluation of heart disease. He also chaired a technical session on the testing of new agents in various in vitro and in vivo systems. He also visited the Institute for Clinical and Experimental Nuclear Medicine in Bonn, West Germany, to review, discuss, plan and coordinate collaborative investigations with that institution. In addition, he visited the Cyclotron Research Center in Liege, Belgium, to discuss continuing collaborative studies with the Osmium-191/Iridium-191m radionuclide generator system, and to complete manuscripts and plan future studies.

  7. Tunnelling in carbonic acid.

    PubMed

    Wagner, J Philipp; Reisenauer, Hans Peter; Hirvonen, Viivi; Wu, Chia-Hua; Tyberg, Joseph L; Allen, Wesley D; Schreiner, Peter R

    2016-06-14

    The cis,trans-conformer of carbonic acid (H2CO3), generated by near-infrared radiation, undergoes an unreported quantum mechanical tunnelling rotamerization with half-lives in cryogenic matrices of 4-20 h, depending on temperature and host material. First-principles quantum chemistry at high levels of theory gives a tunnelling half-life of about 1 h, quite near those measured for the fastest rotamerizations. PMID:27248671

  8. Optimize acid gas removal

    SciTech Connect

    Nicholas, D.M.; Wilkins, J.T.

    1983-09-01

    Innovative design of physical solvent plants for acid gas removal can materially reduce both installation and operating costs. A review of the design considerations for one physical solvent process (Selexol) points to numerous arrangements for potential improvement. These are evaluated for a specific case in four combinations that identify an optimum for the case in question but, more importantly, illustrate the mechanism for use for such optimization elsewhere.

  9. Studies on terreic acid.

    PubMed

    Yamamoto, H; Moriyama, K; Jinnouchi, H; Yagishita, K

    1980-03-01

    It was found that Aspergillus sp. No. Y-8980 which was isolated from a soil sample collected at Yoron Island in Kagoshima Prefecture belonged to Aspergillus terreus group by morphological observation. The active substance produced by the strain was obtained with a high yield in sucrose-yeast extract medium and extracted by chloroform, ethyl acetate and n-butanol at pH 2.4 approximately 2.6 from the culture broth. The substance was crystallized from chloroform and ethyl acetate after charcoal treatment of the crude crystal. From various physico-chemical properties, it was found that the substance was identical to terreic acid. Terreic acid showed MICs of 25 approximately 100 mcg/ml, 12.5 mcg/ml and 50 mcg/ml against Gram-positive and Gram-negative bacteria, Xanthomonas oryzae and Xanthomonas citri, respectively, but it did not control Pseudomonas, fungi and yeast. The LD50 was 75 mg/kg i.p. and i.v. in mice. With regards to the anti-tumor effect, the morphological degeneration on HeLa cells (human carcinoma cells) was observed in the concentrations of more than 6.25 mcg/ml of terreic acid. An increase of body weight of mice caused by Ehrlich ascites carcinoma cells was not definitely observed by the daily administration of 150 mcg of terreic acid per mouse for 8 consecutive days. Above showed the enough survival effect in dd mice implanted with Ehrlich ascites carcinoma cells, and the effect also was demonstrated by anatomies of mice. PMID:7190624

  10. Perfluorooctanoic acid and environmental risks

    EPA Science Inventory

    Perfluorooctanoic acid (PFOA) is a member of the perfluoroalkyl acids (PFAA) family of chemicals, which consist of a carbon backbone typically four to fourteen carbons in length and a charged functional moiety.

  11. Folic Acid Questions and Answers

    MedlinePlus

    ... swallow large pills. How can I take a vitamin with folic acid? A : These days, multivitamins with folic acid come in chewable chocolate or fruit flavors, liquids, and large oval or smaller round ...

  12. Pantothenic acid (Vitamin B5)

    MedlinePlus

    Pantothenic acid is a vitamin, also known as vitamin B5. It is widely found in both plants and animals ... Vitamin B5 is commercially available as D-pantothenic acid, as well as dexpanthenol and calcium pantothenate, which ...

  13. Bile acid sequestrants for cholesterol

    MedlinePlus

    Bile acid sequestrants are medicines that help lower your LDL (bad) cholesterol . Too much cholesterol in your blood can ... block them. These medicines work by blocking bile acid in your stomach from being absorbed in your ...

  14. Omega-3 fatty acids (image)

    MedlinePlus

    Omega-3 fatty acids are a form of polyunsaturated fat that the body derives from food. Omega-3s (and omega-6s) are known as essential fatty acids (EFAs) because they are important for good health. ...

  15. Pantothenic acid (Vitamin B5)

    MedlinePlus

    ... D-pantothenic acid, as well as dexpanthenol and calcium pantothenate, which are chemicals made in the lab from ... Early research suggests that pantothenic acid (given as calcium pantothenate) does not reduce symptoms of osteoarthritis. Recovery after ...

  16. Amino acid imbalance in cystinuria

    PubMed Central

    Asatoor, A. M.; Freedman, P. S.; Gabriel, J. R. T.; Milne, M. D.; Prosser, D. I.; Roberts, J. T.; Willoughby, C. P.

    1974-01-01

    After oral ingestion of a free amino acid mixture by three cystinuric patients, plasma increments of lysine and arginine were lower and those of many other amino acids were significantly higher than those found in control subjects. Similar results were obtained in control subjects after amino acid imbalance had been artificially induced by the omission of cystine, lysine, and arginine from the amino acid mixture. Especially high increments of alanine and proline provided the best evidence of amino acid imbalance caused by a temporary lysine and, to a lesser extent, arginine and cystine deficit. No such amino acid imbalance was found to occur in the cystinuric patients after ingestion of whole protein, indicating that absorption of oligopeptides produced by protein digestion provided a balanced physiological serum amino acid increment. This is considered to explain the lack of any unequivocal nutritional deficit in cystinuric patients despite poor absorption of the essential free amino acid, lysine. PMID:4411931

  17. Immunomodulatory spherical nucleic acids

    PubMed Central

    Radovic-Moreno, Aleksandar F.; Chernyak, Natalia; Mader, Christopher C.; Nallagatla, Subbarao; Kang, Richard S.; Hao, Liangliang; Walker, David A.; Halo, Tiffany L.; Merkel, Timothy J.; Rische, Clayton H.; Anantatmula, Sagar; Burkhart, Merideth; Mirkin, Chad A.; Gryaznov, Sergei M.

    2015-01-01

    Immunomodulatory nucleic acids have extraordinary promise for treating disease, yet clinical progress has been limited by a lack of tools to safely increase activity in patients. Immunomodulatory nucleic acids act by agonizing or antagonizing endosomal toll-like receptors (TLR3, TLR7/8, and TLR9), proteins involved in innate immune signaling. Immunomodulatory spherical nucleic acids (SNAs) that stimulate (immunostimulatory, IS-SNA) or regulate (immunoregulatory, IR-SNA) immunity by engaging TLRs have been designed, synthesized, and characterized. Compared with free oligonucleotides, IS-SNAs exhibit up to 80-fold increases in potency, 700-fold higher antibody titers, 400-fold higher cellular responses to a model antigen, and improved treatment of mice with lymphomas. IR-SNAs exhibit up to eightfold increases in potency and 30% greater reduction in fibrosis score in mice with nonalcoholic steatohepatitis (NASH). Given the clinical potential of SNAs due to their potency, defined chemical nature, and good tolerability, SNAs are attractive new modalities for developing immunotherapies. PMID:25775582

  18. Cannabinoid acids analysis.

    PubMed

    Lercker, G; Bocci, F; Frega, N; Bortolomeazzi, R

    1992-03-01

    The cannabinoid pattern of vegetable preparations from Cannabis sativa (hashish, marijuana) allows to recognize the phenotype of the plants, to be used as drug or for fiber. Cannabinoid determination by analytical point of view has represented some problems caused by the complex composition of the hexane extract. Capillary gas chromatography of the hexane extracts of vegetable samples, shows the presence of rather polar constituents that eluted, with noticeable interactions, only on polar phase. The compounds can be methylated by diazomethane and silanized (TMS) by silylating reagents. The methyl and methyl-TMS derivatives are analyzed by high resolution gas chromatography (HRGC) and by gas chromatography-mass spectrometry (GC-MS). The identification of the compounds shows their nature of cannabinoid acids, which the main by quantitative point of view results the cannabidiolic acid (CBDA). It is known that the cannabinoid acids are thermally unstable and are transformed in the corresponding cannabinoids by decarboxilation. This is of interest in forensic analysis with the aim to establish the total amount of THC in the Cannabis preparations, as the active component. PMID:1503600

  19. Acid rain: Reign of controversy

    SciTech Connect

    Kahan, A.M.

    1986-01-01

    Acid Rain is a primer on the science and politics of acid rain. Several introductory chapters describe in simple terms the relevant principles of water chemistry, soil chemistry, and plant physiology and discuss the demonstrated or postulated effects of acid rain on fresh waters and forests as well as on statuary and other exposed objects. There follow discussions on the economic and social implications of acid rain (for example, possible health effects) and on the sources, transport, and distribution of air pollutants.

  20. Carboxylic acid sorption regeneration process

    DOEpatents

    King, C. Judson; Poole, Loree J.

    1995-01-01

    Carboxylic acids are sorbed from aqueous feedstocks into an organic liquid phase or onto a solid adsorbent. The acids are freed from the sorbent phase by treating it with aqueous alkylamine thus forming an alkylammonium carboxylate which is dewatered and decomposed to the desired carboxylic acid and the alkylamine.

  1. Carboxylic acid sorption regeneration process

    DOEpatents

    King, C.J.; Poole, L.J.

    1995-05-02

    Carboxylic acids are sorbed from aqueous feedstocks into an organic liquid phase or onto a solid adsorbent. The acids are freed from the sorbent phase by treating it with aqueous alkylamine thus forming an alkylammonium carboxylate which is dewatered and decomposed to the desired carboxylic acid and the alkylamine. 10 figs.

  2. An Umbrella for Acid Rain.

    ERIC Educational Resources Information Center

    Randal, Judith

    1979-01-01

    The Environmental Protection Agency has awarded several grants to study effects of and possible solutions to the problem of "acid rain"; pollution from atmospheric nitric and sulfuric acids. The research program is administered through North Carolina State University at Raleigh and will focus on biological effects of acid rain. (JMF)

  3. BACTERIAL OXIDATION OF DIPICOLINIC ACID

    PubMed Central

    Kobayashi, Yasuo; Arima, Kei

    1962-01-01

    Kobayashi, Yasuo (University of Tokyo, Tokyo, Japan) and Kei Arima. Bacterial oxidation of dipicolinic acid. II. Identification of α-ketoglutaric acid and 3-hydroxydipicolinic acid and some properties of cell-free extracts. J. Bacteriol. 84:765–771. 1962—When a dipicolinic acid (DPA)-decomposing bacterium, Achromobacter strain 1–2, was incubated at 30 C with shaking in a DPA solution containing 10−3m arsenite, a keto acid was accumulated. The 2,4-dinitrophenylhydrazone of this acid was synthesized and identified as α-ketoglutaric acid by paper chromatography, visible absorption spectrum, infrared analysis, elemental analysis, and mixed melting point. During this incubation, oxalic acid equivalent to the consumed dipicolinic acid was produced. A fluorescent material was also isolated from culture fluid and identified as 3-hydroxydipicolinic acid by paper chromatography and the ultraviolet absorption spectrum. Further, cell-free extracts were prepared by sonic oscillation. Ferrous ion and a reduced di- or triphosphopyridine nucleotide-generating system were proven to be required for enzymic oxidation of DPA. And 3-hydroxydipicolinic acid was also oxidized by this preparation. From the results obtained, a possible metabolic pathway of dipicolinic acid was proposed. PMID:14033954

  4. Pantothenic acid biosynthesis in zymomonas

    SciTech Connect

    Tao, Luan; Tomb, Jean-Francois; Viitanen, Paul V.

    2014-07-01

    Zymomonas is unable to synthesize pantothenic acid and requires this essential vitamin in growth medium. Zymomonas strains transformed with an operon for expression of 2-dehydropantoate reductase and aspartate 1-decarboxylase were able to grow in medium lacking pantothenic acid. These strains may be used for ethanol production without pantothenic acid supplementation in seed culture and fermentation media.

  5. Scientists Puzzle Over Acid Rain

    ERIC Educational Resources Information Center

    Chemical and Engineering News, 1975

    1975-01-01

    Reports on a growing concern over increased acidity in atmospheric percipitation. Explores possible causes of the increased acidity, identifies chemical components of precipitation in various parts of the world, and presents environmental changes that might be attributed to the acidity. (GS)

  6. Serum Uric Acid in Smokers

    PubMed Central

    Hanna, Bassam E.; Hamed, Jamal M.; Touhala, Luma M.

    2008-01-01

    Objectives To demonstrate the possible effect of smoking on serum uric acid. Methods Subjects enrolled in study were divided into two groups; nonsmokers and smokers, each with 60 male volunteers of the same social class and dietary habit without history of alcohol consumption, diabetes mellitus, hyperuricemia and gout, renal, joint, lung or heart diseases. Fasting blood and random urine samples were obtained from both groups for measurement of uric acid and creatinine. Calculation of both urine uric acid/urine creatinine ratio and fraction excretion of uric acid were done. The results were statistically evaluated by standard statistical methods. Results No significant differences in the age, serum creatinine, spot urine uric acid/urine creatinine ratio and fraction excretion of uric acid between the two groups, serum uric acid was significantly lower in smokers. In smokers there was significant negative correlation of smoking status (average number of cigarette smoked/day, duration of smoking and cumulative amount of smoking) with serum uric acid. Conclusion After exclusion of other factors affecting uric acid level, the significant low serum uric acid level in smokers was attributed to reduce endogenous production as a result of chronic exposure to cigarette smoke that is a significant source of oxidative stress. As this reduction is proportionate with smoking status and predisposes to cardiovascular disease, it is, therefore, recommended for smokers to stop or reduce smoking and introduce serum uric acid estimation as routine test since its cheap and simple to reflect their antioxidant level. Keywords Smokers; Uric acid; CVD. PMID:22334840

  7. Experimental study of the hydrothermal reactivity of organic acids and acid anions: II. Acetic acid, acetate, and valeric acid

    NASA Astrophysics Data System (ADS)

    McCollom, Thomas M.; Seewald, Jeffrey S.

    2003-10-01

    Organic acids and acid anions occur in substantial concentrations in many aqueous geologic fluids and are thought to take part in a variety of geochemical processes ranging from the transport of metals in ore-forming fluids to the formation of natural gas to serving as a metabolic energy source for microbes in subsurface habitats. The widespread occurrence of organic acids and their potential role in diverse geologic processes has led to numerous experimental studies of their thermal stability, yet there remain substantial gaps in our knowledge of the factors that control the rates and reaction pathways for the decomposition of these compounds under geologic conditions. In order to address some of these uncertainties, a series of laboratory experiments were conducted to examine the behavior of organic acids and acid anions under hydrothermal conditions in the presence of minerals. Reported here are results of experiments where aqueous solutions of acetic acid, sodium acetate, or valeric acid ( n-pentanoic acid) were heated at 325°C, 350 bars in the presence of the mineral assemblages hematite + magnetite + pyrite, pyrite + pyrrhotite + magnetite, and hematite + magnetite. The results indicate that aqueous acetic acid and acetate decompose by a combination of two reaction pathways: decarboxylation and oxidation. Both reactions are promoted by minerals, with hematite catalyzing the oxidation reaction while magnetite catalyzes decarboxylation. The oxidation reaction is much faster, so that oxidation dominates the decomposition of acetic acid and acetate when hematite is present. In contrast to previous reports that acetate decomposed more slowly than acetic acid, we found that acetate decomposed at slightly faster rates than the acid in the presence of minerals. Although longer-chain monocarboxylic acids are generally thought to decompose by decarboxylation, valeric acid appeared to decompose primarily by "deformylation" to 1-butene plus formic acid. Subsequent

  8. Role of acid diffusion in matrix acidizing of carbonates

    SciTech Connect

    Hoefner, M.L.; Fogler, H.S.; Stenius, P.; Sjoblom, J.

    1987-02-01

    To increase the efficiency of matrix treatments in carbonates, a new type of retarded acid-in-oil microemulsion system has ben developed. The microemulsion is of low viscosity but can exhibit acid diffusion rates two orders of magnitude lower than aqueous HCl. Decreased acid diffusion delays spending and allows live acid to penetrate the rock matrix more uniformly and to greater distances. Coreflood results show that the microemulsion can stimulate cores in fewer PV's and under conditions of low injection rates where aqueous HCl fails completely. The microemulsion could also conceivably increase acid penetration along any natural fractures and fissures that may be present, thus increasing acidizing efficiency in this type of treatment. The relationship between the acid diffusion rate and the ability of the fluid to matrix-stimulate limestone is investigated.

  9. Exposure of flight attendants to pyrethroid insecticides on commercial flights: urinary metabolite levels and implications

    PubMed Central

    Wei, Binnian; Mohan, Krishnan R.; Weisel, Clifford P.

    2011-01-01

    Pyrethroid insecticides have been used for disinsection of commercial aircrafts. However, little is known about the pyrethroids exposure of flight attendants. The objective of the study was to assess pyrethroids exposure of flight attendants working on commercial aircrafts through monitoring the urinary pyrethroids metabolite levels. Eighty four urine samples were collected from 28 flight attendants, 18 – 65 years of age, with seventeen working on planes that were non-disinsected, and eleven working on planes that had been disinsected. Five urinary metabolites of pyrethroids were measured using gas chromatographic–mass spectrometric method: 3-phenoxybenzoic acid (3-PBA), cis-/trans-3-(2,2-Dichlorovinyl)-2,2-dimethylcyclo-propane carboxylic acid (cis-/trans-Cl2CA), cis-3-(2,2-dibromovinyl)-2,2-dimethylcyclo-propane-1-carboxylic acid (cis-Br2CA) and 4-fluoro-3-phenoxybenzoic acid (4F-3-PBA). Flight attendants working on disinsected planes had significantly higher urinary levels of 3-PBA, cis- and trans-Cl2CA in pre, post- and 24hr-post flight samples than those on planes which did not report having been disinsected. Urinary levels of cis-Br2CA and 4F-3-PBA did not show significant differences between the two groups. Flight attendants working on international flights connected to Australia had higher urinary levels of 3-PBA, cis- and trans-Cl2CA than those on either domestic and other international flights flying among Asia, Europe and North America. Post-disinsection duration (number of days from disinsection date to flight date) was the most significant factor affecting the urinary pyrethroid metabolites levels of 3-PBA, cis- and trans-Cl2CA of the group flying on disinsected aircraft. It was concluded that working on commercial aircrafts disinsected by pyrethroids resulted in elevated body burden of 3-PBA, cis- and trans-Cl2CA. PMID:21937269

  10. Characterization of a novel β-cypermethrin-degrading Aspergillus niger YAT strain and the biochemical degradation pathway of β-cypermethrin.

    PubMed

    Deng, Weiqin; Lin, Derong; Yao, Kai; Yuan, Huaiyu; Wang, Zhilong; Li, Jianlong; Zou, Likou; Han, Xinfeng; Zhou, Kang; He, Li; Hu, Xinjie; Liu, Shuliang

    2015-10-01

    Aspergillus niger YAT strain was obtained from Chinese brick tea (Collection number: CGMCC 10,568) and identified on the basis of morphological characteristics and internal transcribed spacer (ITS) sequence. The strain could degrade 54.83 % of β-cypermethrin (β-CY; 50 mg L(-1)) in 7 days and 100 % of 3-phenoxybenzoic acid (3-PBA; 100 mg L(-1)) in 22 h. The half-lives of β-CY and 3-PBA range from 3.573 to 11.748 days and from 5.635 to 12.160 h, respectively. The degradation of β-CY and 3-PBA was further described using first-order kinetic models. The pathway and mechanism of β-CY degraded by YAT were investigated by analyzing the degraded metabolites through high-performance liquid chromatography (HPLC) and liquid chromatography-mass spectrometry (LC-MS). Relevant enzymatic activities and substrate utilization were also investigated. β-CY degradation products were analyzed. Results indicated that YAT strain transformed β-CY into 3-PBA. 3-PBA was then gradually transformed into permethric acid, protocatechuic acid, 3-hydroxy-5-phenoxy benzoic acid, gallic acid, and phenol gradually. The YAT strain can also effectively degrade these metabolites. The results indicated that YAT strain has potential applications in bioremediation of pyrethroid insecticide (PI)-contaminated environments and fermented food. PMID:26022858

  11. Composition for nucleic acid sequencing

    DOEpatents

    Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

    2008-08-26

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  12. Evolution of rosmarinic acid biosynthesis.

    PubMed

    Petersen, Maike; Abdullah, Yana; Benner, Johannes; Eberle, David; Gehlen, Katja; Hücherig, Stephanie; Janiak, Verena; Kim, Kyung Hee; Sander, Marion; Weitzel, Corinna; Wolters, Stefan

    2009-01-01

    Rosmarinic acid and chlorogenic acid are caffeic acid esters widely found in the plant kingdom and presumably accumulated as defense compounds. In a survey, more than 240 plant species have been screened for the presence of rosmarinic and chlorogenic acids. Several rosmarinic acid-containing species have been detected. The rosmarinic acid accumulation in species of the Marantaceae has not been known before. Rosmarinic acid is found in hornworts, in the fern family Blechnaceae and in species of several orders of mono- and dicotyledonous angiosperms. The biosyntheses of caffeoylshikimate, chlorogenic acid and rosmarinic acid use 4-coumaroyl-CoA from the general phenylpropanoid pathway as hydroxycinnamoyl donor. The hydroxycinnamoyl acceptor substrate comes from the shikimate pathway: shikimic acid, quinic acid and hydroxyphenyllactic acid derived from l-tyrosine. Similar steps are involved in the biosyntheses of rosmarinic, chlorogenic and caffeoylshikimic acids: the transfer of the 4-coumaroyl moiety to an acceptor molecule by a hydroxycinnamoyltransferase from the BAHD acyltransferase family and the meta-hydroxylation of the 4-coumaroyl moiety in the ester by a cytochrome P450 monooxygenase from the CYP98A family. The hydroxycinnamoyltransferases as well as the meta-hydroxylases show high sequence similarities and thus seem to be closely related. The hydroxycinnamoyltransferase and CYP98A14 from Coleus blumei (Lamiaceae) are nevertheless specific for substrates involved in RA biosynthesis showing an evolutionary diversification in phenolic ester metabolism. Our current view is that only a few enzymes had to be "invented" for rosmarinic acid biosynthesis probably on the basis of genes needed for the formation of chlorogenic and caffeoylshikimic acid while further biosynthetic steps might have been recruited from phenylpropanoid metabolism, tocopherol/plastoquinone biosynthesis and photorespiration. PMID:19560175

  13. The politics of acid rain

    SciTech Connect

    Wilcher, M.E. )

    1989-01-01

    This work examines and compares the acid rain policies through the different political systems of Canada, Great Britain and the United States. Because the flow of acid rain can transcend national boundaries, acid rain has become a crucial international problem. According to the author, because of differences in governmental institutions and structure, the extent of governmental intervention in the industrial economy, the degree of reliance on coal for power generation, and the extent of acid rain damage, national responses to the acid rain problem have varied.

  14. Invasive cleavage of nucleic acids

    DOEpatents

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann D.; Dahlberg, James E.

    1999-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  15. Invasive cleavage of nucleic acids

    DOEpatents

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann D.; Dahlberg, James E.

    2002-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  16. Involvement of endoplasmic reticulum stress in the necroptosis of microglia/macrophages after spinal cord injury.

    PubMed

    Fan, H; Tang, H-B; Kang, J; Shan, L; Song, H; Zhu, K; Wang, J; Ju, G; Wang, Y-Z

    2015-12-17

    Microglia/macrophages play a crucial role in inflammation after spinal cord injury (SCI). Although extensive studies have been performed on the mechanisms of microglia/macrophage activation and recruitment, how microglia/macrophages are eliminated remains unclear. In the present study, we observed a high-level expression of mixed lineage kinase domain-like protein (MLKL), a key molecule in the execution of necroptosis, in microglia/macrophages after SCI in mice. In vivo PI-labeling and Necrostatin-1 treatment confirmed the necroptosis of microglia/macrophages. Interestingly, our electronic microscopic (EM) study revealed that MLKL localized not only at the membrane but also on the endoplasmic reticulum (ER) of necroptotic microglia/macrophages. Furthermore, receptor-interacting protein 3 (RIP3), another necrosome component, was also found on the ER of necroptotic microglia/macrophages. And Glucose-regulated protein 78 (GRP78), an ER stress sensor, was up-regulated in MLKL-positive microglia/macrophages after SCI, suggesting a possible link between necroptosis and ER stress. In vitro, oxygen-glucose deprivation (OGD) stress induced ER stress and necroptosis in microglia. Inhibiting ER stress by 4-phenylbutyrate (4-PBA) significantly blocked the OGD-induced necroptosis of microglia. In the end, our data showed that, GRP78 and phosphorylated MLKL were co-expressed by the microglia/macrophages in the injured human spinal cord. Taken together, these results suggested that microglia/macrophages undergo an ER-stress involved necroptosis after SCI, implying that ER stress and necroptosis could be manipulated for modulating inflammation post-SCI. PMID:26523978

  17. Tested Demonstrations: Color Oscillations in the Formic Acid-Nitric Acid-Sulfuric Acid System.

    ERIC Educational Resources Information Center

    Raw, C. J. G.; And Others

    1983-01-01

    Presented are procedures for demonstrating the production of color oscillations when nitric acid is added to a formic acid/concentrated sulfuric acid mixture. Because of safety considerations, "Super-8" home movie of the color changes was found to be satisfactory for demonstration purposes. (JN)

  18. Amino acids in Arctic aerosols

    NASA Astrophysics Data System (ADS)

    Scalabrin, E.; Zangrando, R.; Barbaro, E.; Kehrwald, N. M.; Gabrieli, J.; Barbante, C.; Gambaro, A.

    2012-11-01

    Amino acids are significant components of atmospheric aerosols, affecting organic nitrogen input to marine ecosystems, atmospheric radiation balance, and the global water cycle. The wide range of amino acid reactivities suggest that amino acids may serve as markers of atmospheric transport and deposition of particles. Despite this potential, few measurements have been conducted in remote areas to assess amino acid concentrations and potential sources. Polar regions offer a unique opportunity to investigate atmospheric processes and to conduct source apportionment studies of such compounds. In order to better understand the importance of amino acid compounds in the global atmosphere, we determined free amino acids (FAAs) in seventeen size-segregated aerosol samples collected in a polar station in the Svalbard Islands from 19 April until 14 September 2010. We used an HPLC coupled with a tandem mass spectrometer (ESI-MS/MS) to analyze 20 amino acids and quantify compounds at fmol m-3 levels. Mean total FAA concentration was 1070 fmol m-3 where serine and glycine were the most abundant compounds in almost all samples and accounted for 45-60% of the total amino acid relative abundance. The other eighteen compounds had average concentrations between 0.3 and 98 fmol m-3. The higher amino acid concentrations were present in the ultrafine aerosol fraction (< 0.49 μm) and accounted for the majority of the total amino acid content. Local marine sources dominate the boreal summer amino acid concentrations, with the exception of the regional input from Icelandic volcanic emissions.

  19. Amino acids in Arctic aerosols

    NASA Astrophysics Data System (ADS)

    Scalabrin, E.; Zangrando, R.; Barbaro, E.; Kehrwald, N. M.; Gabrieli, J.; Barbante, C.; Gambaro, A.

    2012-07-01

    Amino acids are significant components of atmospheric aerosols, affecting organic nitrogen input to marine ecosystems, atmospheric radiation balance, and the global water cycle. The wide range of amino acid reactivities suggest that amino acids may serve as markers of atmospheric transport and deposition of particles. Despite this potential, few measurements have been conducted in remote areas to assess amino acid concentrations and potential sources. Polar regions offer a unique opportunity to investigate atmospheric processes and to conduct source apportionment studies of such compounds. In order to better understand the importance of amino acid compounds in the global atmosphere, we determined free amino acids (FAAs) in seventeen size-segregated aerosol samples collected in a polar station in the Svalbard Islands from 19 April until 14 September 2010. We used an HPLC coupled with a tandem mass spectrometer (ESI-MS/MS) to analyze 20 amino acids to quantify compounds at fmol m-3 levels. Mean total FAA concentration was 1070 fmol m-3 where serine and glycine were the most abundant compounds in almost all samples and accounted for 45-60% of the total amino acid relative abundance. The other eighteen compounds had average concentrations between 0.3 and 98 fmol m-3. The higher amino acid concentrations were present in the ultrafine aerosol fraction (<0.49 μm) and accounted for the majority of the total amino acid content. Local marine sources dominate the boreal summer amino acid concentrations, with the exception of the regional input from Icelandic volcanics.

  20. Twinning of dodecanedicarboxylic acid

    NASA Technical Reports Server (NTRS)

    Sen, R.; Wilcox, W. R.

    1986-01-01

    Twinning of 1,10-dodecanedicarboxyl acid (DDA) was observed in 0.1 mm thick films with a polarizing microscope. Twins originated from polycrystalline regions which tended to nucleate on twin faces, and terminated by intersection gone another. Twinning increased dramatically with addition of organic compounds with a similar molecular size and shape. Increasing the freezing rate, increasing the temperature gradient, and addition of silica particles increased twinning. It is proposed that twins nucleate with polycrystals and sometimes anneal out before they become observable. The impurities may enhance twinning either by lowering the twin energy or by adsorbing on growing faces.

  1. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  2. Controlling acid rain

    SciTech Connect

    Cannon, J.S.

    1987-01-01

    This book examines recent transfer of electric power among 48 states and present evidence of significant transfers of electric power from so-called ''perpetrator'' to ''victim'' states. The book compares the efforts of several midwestern and northeastern states during the 1970's to control the sulfur dioxide (SO/sub 2/) emissions causing acid rain. The report includes utility and government data on electricity production and sales, on purchase of out-of-state electricity, and on coal use and sulfur dioxide emissions, state by state, for 48 states.

  3. Efficient Activation of Pathogenic ΔPhe501 Mutation in Monocarboxylate Transporter 8 by Chemical and Pharmacological Chaperones.

    PubMed

    Braun, Doreen; Schweizer, Ulrich

    2015-12-01

    Monocarboxylate transporter 8 (MCT8) is a thyroid hormone transmembrane transporter expressed in many cell types, including neurons. Mutations that inactivate transport activity of MCT8 cause severe X-linked psychomotor retardation in male patients, a syndrome originally described as the Allan-Herndon-Dudley syndrome. Treatment options currently explored the focus on finding thyroid hormone-like compounds that bypass MCT8 and enter cells through different transporters. Because MCT8 is a multipass transmembrane protein, some pathogenic mutations affect membrane trafficking while potentially retaining some transporter activity. We explore here the effects of chemical and pharmacological chaperones on the expression and transport activity of the MCT8 mutant ΔPhe501. Dimethylsulfoxide, 4-phenylbutyric acid as well as its sodium salt, and the isoflavone genistein increase T3 uptake into MDCK1 cells stably transfected with mutant MCT8-ΔPhe501. We show that ΔPhe501 represents a temperature-sensitive mutant protein that is stabilized by the proteasome inhibitor MG132. 4-Phenylbutyrate has been used to stabilize ΔPhe508 mutant cystic fibrosis transmembrane conductance regulator protein and is in clinical use in patients with urea cycle defects. Genistein is enriched in soy and available as a nutritional supplement. It is effective in stabilizing MCT8-ΔPhe501 at 100 nM concentration. Expression of the L471P mutant is increased in response to phenylbutyrate, but T3 uptake activity is not induced, supporting the notion that the chaperone specifically increases membrane expression. Our findings suggest that certain pathogenic MCT8 mutants may be responsive to (co-)treatment with readily available compounds, which increase endogenous protein function. PMID:26368820

  4. Activation of autophagy by unfolded proteins during endoplasmic reticulum stress.

    PubMed

    Yang, Xiaochen; Srivastava, Renu; Howell, Stephen H; Bassham, Diane C

    2016-01-01

    Endoplasmic reticulum stress is defined as the accumulation of unfolded proteins in the endoplasmic reticulum, and is caused by conditions such as heat or agents that cause endoplasmic reticulum stress, including tunicamycin and dithiothreitol. Autophagy, a major pathway for degradation of macromolecules in the vacuole, is activated by these stress agents in a manner dependent on inositol-requiring enzyme 1b (IRE1b), and delivers endoplasmic reticulum fragments to the vacuole for degradation. In this study, we examined the mechanism for activation of autophagy during endoplasmic reticulum stress in Arabidopsis thaliana. The chemical chaperones sodium 4-phenylbutyrate and tauroursodeoxycholic acid were found to reduce tunicamycin- or dithiothreitol-induced autophagy, but not autophagy caused by unrelated stresses. Similarly, over-expression of BINDING IMMUNOGLOBULIN PROTEIN (BIP), encoding a heat shock protein 70 (HSP70) molecular chaperone, reduced autophagy. Autophagy activated by heat stress was also found to be partially dependent on IRE1b and to be inhibited by sodium 4-phenylbutyrate, suggesting that heat-induced autophagy is due to accumulation of unfolded proteins in the endoplasmic reticulum. Expression in Arabidopsis of the misfolded protein mimics zeolin or a mutated form of carboxypeptidase Y (CPY*) also induced autophagy in an IRE1b-dependent manner. Moreover, zeolin and CPY* partially co-localized with the autophagic body marker GFP-ATG8e, indicating delivery to the vacuole by autophagy. We conclude that accumulation of unfolded proteins in the endoplasmic reticulum is a trigger for autophagy under conditions that cause endoplasmic reticulum stress. PMID:26616142

  5. Cryoprotection from lipoteichoic acid

    NASA Astrophysics Data System (ADS)

    Rice, Charles V.; Middaugh, Amy; Wickham, Jason R.; Friedline, Anthony; Thomas, Kieth J.; Johnson, Karen; Zachariah, Malcolm; Garimella, Ravindranth

    2012-10-01

    Numerous chemical additives lower the freezing point of water, but life at sub-zero temperatures is sustained by a limited number of biological cryoprotectants. Antifreeze proteins in fish, plants, and insects provide protection to a few degrees below freezing. Microbes have been found to survive at even lower temperatures, and with a few exceptions, antifreeze proteins are missing. Survival has been attributed to external factors, such as the high salt concentration of brine veins and adhesion to particulates or ice crystal defects. We have discovered an endogenous cryoprotectant in the cell wall of bacteria, lipoteichoic acid biopolymers. Adding 1% LTA to bacteria cultures immediately prior to freezing provides 50% survival rate, similar to the results obtained with 1% glycerol. In the absence of an additive, bacterial survival is negligible as measured with the resazurin cell viability assay. The mode of action for LTA cryoprotection is unknown. With a molecular weight of 3-5 kDa, it is unlikely to enter the cell cytoplasm. Our observations suggest that teichoic acids could provide a shell of liquid water around biofilms and planktonic bacteria, removing the need for brine veins to prevent bacterial freezing.

  6. Nucleic acid detection methods

    DOEpatents

    Smith, C.L.; Yaar, R.; Szafranski, P.; Cantor, C.R.

    1998-05-19

    The invention relates to methods for rapidly determining the sequence and/or length a target sequence. The target sequence may be a series of known or unknown repeat sequences which are hybridized to an array of probes. The hybridized array is digested with a single-strand nuclease and free 3{prime}-hydroxyl groups extended with a nucleic acid polymerase. Nuclease cleaved heteroduplexes can be easily distinguish from nuclease uncleaved heteroduplexes by differential labeling. Probes and target can be differentially labeled with detectable labels. Matched target can be detected by cleaving resulting loops from the hybridized target and creating free 3-hydroxyl groups. These groups are recognized and extended by polymerases added into the reaction system which also adds or releases one label into solution. Analysis of the resulting products using either solid phase or solution. These methods can be used to detect characteristic nucleic acid sequences, to determine target sequence and to screen for genetic defects and disorders. Assays can be conducted on solid surfaces allowing for multiple reactions to be conducted in parallel and, if desired, automated. 18 figs.

  7. Nucleic Acid Detection Methods

    DOEpatents

    Smith, Cassandra L.; Yaar, Ron; Szafranski, Przemyslaw; Cantor, Charles R.

    1998-05-19

    The invention relates to methods for rapidly determining the sequence and/or length a target sequence. The target sequence may be a series of known or unknown repeat sequences which are hybridized to an array of probes. The hybridized array is digested with a single-strand nuclease and free 3'-hydroxyl groups extended with a nucleic acid polymerase. Nuclease cleaved heteroduplexes can be easily distinguish from nuclease uncleaved heteroduplexes by differential labeling. Probes and target can be differentially labeled with detectable labels. Matched target can be detected by cleaving resulting loops from the hybridized target and creating free 3-hydroxyl groups. These groups are recognized and extended by polymerases added into the reaction system which also adds or releases one label into solution. Analysis of the resulting products using either solid phase or solution. These methods can be used to detect characteristic nucleic acid sequences, to determine target sequence and to screen for genetic defects and disorders. Assays can be conducted on solid surfaces allowing for multiple reactions to be conducted in parallel and, if desired, automated.

  8. Ribonucleic acid purification.

    PubMed

    Martins, R; Queiroz, J A; Sousa, F

    2014-08-15

    Research on RNA has led to many important biological discoveries and improvement of therapeutic technologies. From basic to applied research, many procedures employ pure and intact RNA molecules; however their isolation and purification are critical steps because of the easy degradability of RNA, which can impair chemical stability and biological functionality. The current techniques to isolate and purify RNA molecules still have several limitations and the requirement for new methods able to improve RNA quality to meet regulatory demands is growing. In fact, as basic research improves the understanding of biological roles of RNAs, the biopharmaceutical industry starts to focus on them as a biotherapeutic tools. Chromatographic bioseparation is a high selective unit operation and is the major option in the purification of biological compounds, requiring high purity degree. In addition, its application in biopharmaceutical manufacturing is well established. This paper discusses the importance and the progress of RNA isolation and purification, considering RNA applicability both in research and clinical fields. In particular and in view of the high specificity, affinity chromatography has been recently applied to RNA purification processes. Accordingly, recent chromatographic investigations based on biorecognition phenomena occurring between RNA and amino acids are focused. Histidine and arginine have been used as amino acid ligands, and their ability to isolate different RNA species demonstrated a multipurpose applicability in molecular biology analysis and RNA therapeutics preparation, highlighting the potential contribution of these methods to overcome the challenges of RNA purification. PMID:24951289

  9. Growth of nitric acid hydrates on thin sulfuric acid films

    NASA Technical Reports Server (NTRS)

    Iraci, Laura T.; Middlebrook, Ann M.; Wilson, Margaret A.; Tolbert, Margaret A.

    1994-01-01

    Type I polar stratospheric clouds (PSCs) are thought to nucleate and grow on stratospheric sulfate aerosols (SSAs). To model this system, thin sulfuric acid films were exposed to water and nitric acid vapors (1-3 x 10(exp -4) Torr H2O and 1-2.5 x 10(exp -6) Torr HNO3) and subjected to cooling and heating cycles. Fourier Transform Infrared (FTIR) spectroscopy was used to probe the phase of the sulfuric acid and to identify the HNO3/H2O films that condensed. Nitric acid trihydrate (NAT) was observed to grow on crystalline sulfuric acid tetrahydrate (SAT) films. NAT also condensed in/on supercooled H2SO4 films without causing crystallization of the sulfuric acid. This growth is consistent with NAT nucleation from ternary solutions as the first step in PSC formation.

  10. Growth of nitric acid hydrates on thin sulfuric acid films

    NASA Astrophysics Data System (ADS)

    Iraci, Laura T.; Middlebrook, Ann M.; Wilson, Margaret A.; Tolbert, Margaret A.

    1994-05-01

    Type I polar stratospheric clouds (PSCs) are thought to nucleate and grow on stratospheric sulfate aerosols (SSAs). To model this system, thin sulfuric acid films were exposed to water and nitric acid vapors (1 - 3 × 10-4 Torr H2O and 1 - 2.5 × 10-6 Torr HNO3) and subjected to cooling and heating cycles. FTIR spectroscopy was used to probe the phase of the sulfuric acid and to identify the HNO3/H2O films that condensed. Nitric acid trihydrate (NAT) was observed to grow on crystalline sulfuric acid tetrahydrate (SAT) films. NAT also condensed in/on supercooled H2SO4 films without causing crystallization of the sulfuric acid. This growth is consistent with NAT nucleation from ternary solutions as the first step in PSC formation.

  11. Interaction of silicic acid with sulfurous acid scale inhibitor

    SciTech Connect

    Gallup, D.L.

    1997-12-31

    The solubility of amorphous silica and the inhibition of silica polymerization in the presence of sulfurous acid and sulfite salts has been investigated to 260{degrees}C. Investigations of inhibition of silica scaling from geothermal brines by sulfurous acid have produced unusual results. Bisulfite/sulfite increases amorphous silica solubility by {open_quotes}salting in{close_quotes} effects resulting from apparent complexation. Silica-sulfite complexes are postulated to form via hydrogen bonding, and appear to be much stronger than silica-sulfate complexes. Treatment of brines with sulfurous acid inhibits silica scaling by (1) retarding the kinetics of silicic acid polymerization, and (2) forming soluble sulfito-silicate complexes. Sulfurous acid offers several advantages over sulfuric acid in controlling scale deposition-reduced corrosion potential, reduced by-product scale formation potential, oxygen scavenging and inhibition of certain metal silicate scales.

  12. Determination of benzoic acid, chlorobenzoic acids and chlorendic acid in water

    SciTech Connect

    Dietz, E.A.; Cortellucci, N.J.; Singley, K.F. )

    1993-01-01

    To characterize and conduct treatment studies of a landfill leachate an analysis procedure was required to determine concentrations of benzoic acid, the three isomers of chlorobenzoic acid and chlorendic acid. The title compounds were isolated from acidified (pH 1) water by extraction with methyl t-butyl ether. Analytes were concentrated by back-extracting the ether with 0.1 N sodium hydroxide which was separated and acidified. This solution was analyzed by C[sub 18] reversed-phase HPLC with water/acetonitrile/acetic acid eluent and UV detection at 222 nm. The method has detection limits of 200 [mu]g/L for chlorendic acid and 100 [mu]g/L for benzoic acid and each isomer of chlorobenzoic acid. Validation studies with water which was fortified with the analytes at concentrations ranging from one to ten times detection limits resulted in average recoveries of >95%.

  13. Acid rain: Rhetoric and reality

    SciTech Connect

    Park, C.C.

    1987-01-01

    Acid rain is now one of the most serious environmental problems in developed countries. Emissions and fallout were previously extremely localized, but since the introduction of tall stacks policies in both Britain and the US - pardoxically to disperse particulate pollutants and hence reduce local damage - emissions are now lifted into the upper air currents and carried long distances downwind. The acid rain debate now embraces many western countries - including Canada, the US, England, Scotland, Wales, Sweden, Norway, Denmark, West Germany, the Netherlands, Austria, Switzerland - and a growing number of eastern countries - including the Soviet Union, Poland, East Germany, and Czechoslovakia. The problem of acid rain arises, strictly speaking, not so much from the rainfall itself as from its effects on the environment. Runoff affects surface water and groundwater, as well as soils and vegetation. Consequently changes in rainfall acidity can trigger off a range of impacts on the chemistry and ecology of lakes and rivers, soil chemistry and processes, the health and productivity of plants, and building materials, and metallic structures. The most suitable solutions to the problems of acid rain require prevention rather than cure, and there is broad agreement in both the political scientific communities on the need to reduce emissions of sulfur and nitrogen oxides to the atmosphere. Book divisions discuss: the problem of acid rain, the science of acid rain, the technology of acid rain, and the politics of acid rain, in an effort to evaluate this growing global problem of acid rain.

  14. Increased formation of ursodeoxycholic acid in patients treated with chenodeoxycholic acid.

    PubMed Central

    Salen, G; Tint, G S; Eliav, B; Deering, N; Mosbach, E H

    1974-01-01

    The formation of ursodeoxycholic acid, the 7 beta-hydroxy epimer of chenodeoxycholic acid, was investigated in three subjects with cerebrotendinous xanthomatosis and in four subjects with gallstones. Total biliary bile acid composition was analyzed by gas-liquid chromatography before and after 4 months of treatment with 0.75 g/day of chenodeoxycholic acid. Individual bile acids were identified by mass spectrometry. Before treatment, bile from cerebrotendinous xanthomatosis (CTX) subjects contained cholic acid, 85%; chenodeoxycholic acid, 7%; deoxycholic acid, 3%; allocholic acid, 3%; and unidentified steroids, 2%; while bile from gallstone subjects contained cholic acid, 45%; chenodeoxycholic acid, 43%; deoxycholic acid, 11%, and lithocholic acid, 1%. In all subjects, 4 months of chenodeoxycholic acid therapy increased the proportion of this bile acid to approximately 80% and decreased cholic acid to 3% of the total biliary bile acids, the remaining 17% of bile acids were identified as ursodeoxycholic acid. After the intravenous injection of [3H]chenodeoxycholic acid, the specific activity of biliary ursodeoxycholic acid exceeded the specific activity of chenodeoxycholic acid, and the resulting specific activity decay curves suggested precursor-product relationships. When [3H]7-ketolithocholic acid was administrated to another patient treated with chenodeoxycholic acid, radioactivity was detected in both the ursodeoxycholic acid and chenodeoxycholic acid fractions. These results indicate that substantial amounts of ursodeoxycholic acid are formed in patients treated with chenodeoxycholic acid. The ursodeoxycholic acid was synthesized from chenodeoxycholic acid presumably via 7-ketolithocholic acid. Images PMID:11344576

  15. Interactions of amino acids, carboxylic acids, and mineral acids with different quinoline derivatives

    NASA Astrophysics Data System (ADS)

    Kalita, Dipjyoti; Deka, Himangshu; Samanta, Shyam Sundar; Guchait, Subrata; Baruah, Jubaraj B.

    2011-03-01

    A series of quinoline containing receptors having amide and ester bonds are synthesized and characterised. The relative binding abilities of these receptors with various amino acids, carboxylic acids and mineral acids are determined by monitoring the changes in fluorescence intensity. Among the receptors bis(2-(quinolin-8-yloxy)ethyl) isophthalate shows fluorescence enhancement on addition of amino acids whereas the other receptors shows fluorescence quenching on addition of amino acids. The receptor N-(quinolin-8-yl)-2-(quinolin-8-yloxy) propanamide has higher binding affinity for amino acids. However, the receptor N-(quinolin-8-yl)-2-(quinolin-8-yloxy)acetamide having similar structure do not bind to amino acids. This is attributed to the concave structure of the former which is favoured due to the presence of methyl substituent. The receptor bis(2-(quinolin-8-yloxy)ethyl) isophthalate do not bind to hydroxy carboxylic acids, but is a good receptor for dicarboxylic acids. The crystal structure of bromide and perchlorate salts of receptor 2-bromo-N-(quinolin-8-yl)-propanamide are determined. In both the cases the amide groups are not in the plane of quinoline ring. The structure of N-(quinolin-8-yl)-2-(quinolin-8-yloxy)acetamide, N-(2-methoxyphenethyl)-2-(quinolin-8-yloxy)acetamide and their salts with maleic acid as well as fumaric acid are determined. It is observed that the solid state structures are governed by the double bond geometry of these two acid. Maleic acid forms salt in both the cases, whereas fumaric acid forms either salt or co-crystals.

  16. Acidity of Strong Acids in Water and Dimethyl Sulfoxide.

    PubMed

    Trummal, Aleksander; Lipping, Lauri; Kaljurand, Ivari; Koppel, Ilmar A; Leito, Ivo

    2016-05-26

    Careful analysis and comparison of the available acidity data of HCl, HBr, HI, HClO4, and CF3SO3H in water, dimethyl sulfoxide (DMSO), and gas-phase has been carried out. The data include experimental and computational pKa and gas-phase acidity data from the literature, as well as high-level computations using different approaches (including the W1 theory) carried out in this work. As a result of the analysis, for every acid in every medium, a recommended acidity value is presented. In some cases, the currently accepted pKa values were revised by more than 10 orders of magnitude. PMID:27115918

  17. 49 CFR 173.158 - Nitric acid.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... material. (b) Nitric acid in any concentration which does not contain sulfuric acid or hydrochloric acid as... sulfuric acid or hydrochloric acid as impurities, when offered for transportation or transported by rail... 49 Transportation 2 2014-10-01 2014-10-01 false Nitric acid. 173.158 Section...

  18. 49 CFR 173.158 - Nitric acid.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... material. (b) Nitric acid in any concentration which does not contain sulfuric acid or hydrochloric acid as... sulfuric acid or hydrochloric acid as impurities, when offered for transportation or transported by rail... 49 Transportation 2 2011-10-01 2011-10-01 false Nitric acid. 173.158 Section...

  19. 49 CFR 173.158 - Nitric acid.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... material. (b) Nitric acid in any concentration which does not contain sulfuric acid or hydrochloric acid as... sulfuric acid or hydrochloric acid as impurities, when offered for transportation or transported by rail... 49 Transportation 2 2010-10-01 2010-10-01 false Nitric acid. 173.158 Section...

  20. 49 CFR 173.158 - Nitric acid.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... material. (b) Nitric acid in any concentration which does not contain sulfuric acid or hydrochloric acid as... sulfuric acid or hydrochloric acid as impurities, when offered for transportation or transported by rail... 49 Transportation 2 2013-10-01 2013-10-01 false Nitric acid. 173.158 Section...

  1. Shaping up nucleic acid computation

    PubMed Central

    Chen, Xi

    2010-01-01

    Summary of recent advances (abstract) Nucleic acid-based nanotechnology has always been perceived as novel, but has begun to move from theoretical demonstrations to practical applications. In particular, the large address spaces available to nucleic acids can be exploited to encode algorithms and/or act as circuits, and thereby process molecular information. In this review we revisit several milestones in the field of nucleic acid-based computation, but also highlight how the prospects for nucleic acid computation go beyond just a large address space. Functional nucleic acid elements (aptamers, ribozymes, and deoxyribozymes) can serve as inputs and outputs to the environment, and can act as logical elements. Into the future, the chemical dynamics of nucleic acids may prove as useful as hybridization for computation. PMID:20538451

  2. Clinical use of acid steatocrit.

    PubMed

    Van den Neucker, A; Pestel, N; Tran, T M; Forget, P P; Veeze, H J; Bouquet, J; Sinaasappel, M

    1997-05-01

    Malabsorption of fat is an important gastrointestinal cause of malnutrition and growth retardation in childhood. The gold standard for the evaluation of fat malabsorption is the faecal fat balance method. The acid steatocrit method has recently been introduced as a simple method to evaluate faecal fat. The present study was aimed at evaluating the acid steatocrit in clinical practice. Faecal fat excretion and acid steatocrit results were determined in 42 children, half with and half without fat malabsorption. Acid steatocrit results correlated significantly with both faecal fat excretion (p < 0.01) and faecal fat concentration (p < 0.001). Sensitivity and specificity of the acid steatocrit for the diagnosis of malabsorption were 90% and 100%, respectively. We consider the acid steatocrit method useful for the screening and monitoring of patients with steatorrhoea. PMID:9183483

  3. Acid rain degradation of nylon

    SciTech Connect

    Kyllo, K.E.

    1984-01-01

    Acid rain, precipitation with a pH less than 5.6, is known to damage lakes, vegetation and buildings. Degradation of outdoor textiles by acid rain is strongly suspected but not well documented. This study reports the effects of sunlight, aqueous acid, heat and humidity (acid rain conditions) on spun delustered nylon 6,6 fabric. Untreated nylon and nylon treated with sulfuric acid of pH 2.0, 3.0, and 4.4 were exposed to light in an Atlas Xenon-arc fadeometer at 63/sup 0/C and 65% R.H. for up to 640 AATCC Fading Units. The untreated and acid treated nylon fabrics were also exposed to similar temperature and humidity condition without light. Nylon degradation was determined by changes in breaking strength, elongation, molecular weight, color, amino end group concentration (NH/sub 2/) and /sup 13/C NMR spectra. Physical damage was assessed using SEM.

  4. A Simpler Nucleic Acid

    NASA Technical Reports Server (NTRS)

    Orgel, Leslie

    2000-01-01

    It has been supposed that for a nucleic acid analog to pair with RNA it must, like RNA, have a backbone with at least a sixatom repeat; a shorter backbone presumably would not stretch far enough to bind RNA properly. The Eschenmoser group has shown, however, that this first impression is incorrect.As they report in their new paper, Eschenmoser and co-workers ( I ) have now synthesized a substantial number of these polymers, which are called (L)-a-threofuranosyl oligonucleotides or TNAs. They are composed of bases linked to a threose sugar-phosphate backbone, with phosphodiester bonds connecting the nucleotides. The investigators discovered that pairs of complementary TNAs do indeed form stable Watson-Crick double helices and, perhaps more importantly, that TNAs form stable double helices with complementary RNAs and DNAs.

  5. Ghrelin and gastric acid secretion

    PubMed Central

    Yakabi, Koji; Kawashima, Junichi; Kato, Shingo

    2008-01-01

    Ghrelin, a novel growth hormone-releasing peptide, was originally isolated from rat and human stomach. Ghrelin has been known to increase the secretion of growth hormone (GH), food intake, and body weight gain when administered peripherally or centrally. Ghrelin is also known to stimulate the gastric motility and the secretion of gastric acid. In the previous studies, the action of ghrelin on acid secretion was shown to be as strong as that of histamine and gastrin in in-vivo experiment. In the studies, the mechanism for the action of ghrelin was also investigated. It was shown that vagotomy completely inhibited the action of ghrelin on the secretion of gastric acid suggesting that vagal nerve is involved in the mechanism for the action of ghrelin on acid secretion. As famotidine did not inhibit ghrelin-induced acid secretion in the study by Masuda et al, they concluded that histamine was not involved in the action of ghrelin on acid secretion. However, we have shown that famotidine completely inhibited ghrelin-induced acid secretion and histidine decarboxylase (HDC) mRNA was increased in gastric mucosa by ghrelin injection which is inhibited by vagotomy Our results indicate that histamine is involved in the action of ghrelin on acid secretion. Furthermore synergistic action of gastrin and ghrelin on gastric acid secretion was shown. Although gastrin has important roles in postprandial secretion of gastric acid, ghrelin may be related to acid secretion during fasting period or at night. However, further studies are needed to elucidate the physiological role of ghrelin in acid secretion. PMID:19009648

  6. Organic Acids by Ion Chromatography

    NASA Astrophysics Data System (ADS)

    Rich, William E.; Johnson, Edward; Lois, Louis; Stafford, Brian E.; Kabra, Pokar M.; Marton, Laurence J.

    The presence of increased levels of various organic acids in physiological fluids such as serum, plasma, and urine has been correlated with a variety of diseases (1). Although some are rare, others such as lactic acidosis and hyperoxaluria are more widespread (2, 3). The estimation of organic acids in biological fluids has long been an analytical problem owing to the nature of the samples and the hydrophilic behavior of the various acids.

  7. All-trans retinoic acid regulates hepatic bile acid homeostasis

    PubMed Central

    Yang, Fan; He, Yuqi; Liu, Hui-Xin; Tsuei, Jessica; Jiang, Xiaoyue; Yang, Li; Wang, Zheng-Tao; Wan, Yu-Jui Yvonne

    2014-01-01

    Retinoic acid (RA) and bile acids share common roles in regulating lipid homeostasis and insulin sensitivity. In addition, the receptor for RA (retinoid x receptor) is a permissive partner of the receptor for bile acids, farnesoid x receptor (FXR/NR1H4). Thus, RA can activate the FXR-mediated pathway as well. The current study was designed to understand the effect of all-trans RA on bile acid homeostasis. Mice were fed an all-trans RA-supplemented diet and the expression of 46 genes that participate in regulating bile acid homeostasis was studied. The data showed that all-trans RA has a profound effect in regulating genes involved in synthesis and transport of bile acids. All-trans RA treatment reduced the gene expression levels of Cyp7a1, Cyp8b1, and Akr1d1, which are involved in bile acid synthesis. All-trans RA also decreased the hepatic mRNA levels of Lrh-1 (Nr5a2) and Hnf4α (Nr2a1), which positively regulate the gene expression of Cyp7a1 and Cyp8b1. Moreover, all-trans RA induced the gene expression levels of negative regulators of bile acid synthesis including hepatic Fgfr4, Fxr, and Shp (Nr0b2) as well as ileal Fgf15. All-trans RA also decreased the expression of Abcb11 and Slc51b, which have a role in bile acid transport. Consistently, all-trans RA reduced hepatic bile acid levels and the ratio of CA/CDCA, as demonstrated by liquid chromatography-mass spectrometry. The data suggest that all-trans RA-induced SHP may contribute to the inhibition of CYP7A1 and CYP8B1, which in turn reduces bile acid synthesis and affects lipid absorption in the gastrointestinal tract. PMID:25175738

  8. Preparation and characterization Al3+-bentonite Turen Malang for esterification fatty acid (palmitic acid, oleic acid and linoleic acid)

    NASA Astrophysics Data System (ADS)

    Abdulloh, Abdulloh; Aminah, Nanik Siti; Triyono, Mudasir, Trisunaryanti, Wega

    2016-03-01

    Catalyst preparation and characterization of Al3+-bentonite for esterification of palmitic acid, oleic acid and linoleic acid has been done. Al3+-bentonite catalyst was prepared from natural bentonite of Turen Malang through cation exchange reaction using AlCl3 solution. The catalysts obtained were characterized by XRD, XRF, pyridine-FTIR and surface area analyser using the BET method. Catalyst activity test of Al3+-bentonite for esterification reaction was done at 65°C using molar ratio of metanol-fatty acid of 30:1 and 0.25 g of Al3+-bentonite catalyst for the period of ½, 1, 2, 3, 4 and 5 hours. Based on the characterization results, the Al3+-bentonite Turen Malang catalyst has a d-spacing of 15.63 Ǻ, acid sites of Brönsted and Lewis respectively of 230.79 µmol/g and 99.39 µmol/g, surface area of 507.3 m2/g and the average of radius pore of 20.09 Å. GC-MS analysis results of the oil phase after esterification reaction showed the formation of biodiesel (FAME: Fatty acid methyl ester), namely methyl palmitate, methyl oleate and methyl linoleate. The number of conversions resulted in esterification reaction using Al3+-bentonite Turen Malang catalyst was 74.61%, 37.75%, and 20, 93% for the esterification of palmitic acid, oleic acid and linoleic acid respectively.

  9. Acidity of frozen electrolyte solutions.

    PubMed

    Robinson, Carmen; Boxe, C S; Guzman, M I; Colussi, A J; Hoffmann, M R

    2006-04-20

    Ice is selectively intolerant to impurities. A preponderance of implanted anions or cations generates electrical imbalances in ice grown from electrolyte solutions. Since the excess charges are ultimately neutralized via interfacial (H(+)/HO(-)) transport, the acidity of the unfrozen portion can change significantly and permanently. This insufficiently recognized phenomenon should critically affect rates and equilibria in frozen media. Here we report the effective (19)F NMR chemical shift of 3-fluorobenzoic acid as in situ probe of the acidity of extensively frozen electrolyte solutions. The sign and magnitude of the acidity changes associated with freezing are largely determined by specific ion combinations, but depend also on solute concentration and/or the extent of supercooling. NaCl solutions become more basic, those of (NH(4))(2)SO(4) or Na(2)SO(4) become more acidic, while solutions of the 2-(N-morpholino)ethanesulfonic acid zwitterion barely change their acidity upon freezing. We discuss how acidity scales based on solid-state NMR measurements could be used to assess the degree of ionization of weak acids and bases in frozen media. PMID:16610849

  10. Acidic gas capture by diamines

    DOEpatents

    Rochelle, Gary; Hilliard, Marcus

    2011-05-10

    Compositions and methods related to the removal of acidic gas. In particular, the present disclosure relates to a composition and method for the removal of acidic gas from a gas mixture using a solvent comprising a diamine (e.g., piperazine) and carbon dioxide. One example of a method may involve a method for removing acidic gas comprising contacting a gas mixture having an acidic gas with a solvent, wherein the solvent comprises piperazine in an amount of from about 4 to about 20 moles/kg of water, and carbon dioxide in an amount of from about 0.3 to about 0.9 moles per mole of piperazine.

  11. MedlinePlus: Folic Acid

    MedlinePlus

    ... and Tests Homocysteine Test (American Association for Clinical Chemistry) Vitamin B12 and Folate Test (American Association for Clinical Chemistry) Related Issues Folic Acid Supplements: Can They Slow ...

  12. Bacterial Decarboxylation of o-Phthalic Acids

    PubMed Central

    Taylor, Barrie F.; Ribbons, Douglas W.

    1983-01-01

    The decarboxylation of phthalic acids was studied with Bacillus sp. strain FO, a marine mixed culture ON-7, and Pseudomonas testosteroni. The mixed culture ON-7, when grown anaerobically on phthalate but incubated aerobically with chloramphenicol, quantitatively converted phthalic acid to benzoic acid. Substituted phthalic acids were also decarboxylated: 4,5-dihydroxyphthalic acid to protocatechuic acid; 4-hydroxyphthalic and 4-chlorophthalic acids to 3-hydroxybenzoic and 3-chlorobenzoic acids, respectively; and 3-fluorophthalic acid to 2-and 3-fluorobenzoic acids. Bacillus sp. strain FO gave similar results except that 4,5-dihydroxyphthalic acid was not metabolized, and both 3- and 4-hydroxybenzoic acids were produced from 4-hydroxyphthalic acid. P. testosteroni decarboxylated 4-hydroxyphthalate (to 3-hydroxybenzoate) and 4,5-dihydroxyphthalate but not phthalic acid and halogenated phthalates. Thus, P. testosteroni and the mixed culture ON-7 possessed 4,5-dihydroxyphthalic acid decarboxylase, previously described in P. testosteroni, that metabolized 4,5-dihydroxyphthalic acid and specifically decarboxylated 4-hydroxyphthalic acid to 3-hydroxybenzoic acid. The mixed culture ON-7 and Bacillus sp. strain FO also possessed a novel decarboxylase that metabolized phthalic acid and halogenated phthalates, but not 4,5-dihydroxyphthalate, and randomly decarboxylated 4-hydroxyphthalic acid. The decarboxylation of phthalic acid is suggested to involve an initial reduction to 1,2-dihydrophthalic acid followed by oxidative decarboxylation to benzoic acid. PMID:16346440

  13. Fatty acid-amino acid conjugates diversification in Lepidopteran caterpillars

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fatty acid amino acid conjugates (FACs) have been found in Noctuid as well as Sphingid caterpillar oral secretions and especially volicitin [N-(17-hydroxylinolenoyl)-L-Glutamine] and its biochemical precursor, N-linolenoyl-L-glutamine, are known elicitors of induced volatile emissions in corn plants...

  14. Fatty Acid Desaturases, Polyunsaturated Fatty Acid Regulation, and Biotechnological Advances.

    PubMed

    Lee, Je Min; Lee, Hyungjae; Kang, SeokBeom; Park, Woo Jung

    2016-01-01

    Polyunsaturated fatty acids (PUFAs) are considered to be critical nutrients to regulate human health and development, and numerous fatty acid desaturases play key roles in synthesizing PUFAs. Given the lack of delta-12 and -15 desaturases and the low levels of conversion to PUFAs, humans must consume some omega-3 and omega-6 fatty acids in their diet. Many studies on fatty acid desaturases as well as PUFAs have shown that fatty acid desaturase genes are closely related to different human physiological conditions. Since the first front-end desaturases from cyanobacteria were cloned, numerous desaturase genes have been identified and animals and plants have been genetically engineered to produce PUFAs such as eicosapentaenoic acid and docosahexaenoic acid. Recently, a biotechnological approach has been used to develop clinical treatments for human physiological conditions, including cancers and neurogenetic disorders. Thus, understanding the functions and regulation of PUFAs associated with human health and development by using biotechnology may facilitate the engineering of more advanced PUFA production and provide new insights into the complexity of fatty acid metabolism. PMID:26742061

  15. Fatty Acid Desaturases, Polyunsaturated Fatty Acid Regulation, and Biotechnological Advances

    PubMed Central

    Lee, Je Min; Lee, Hyungjae; Kang, SeokBeom; Park, Woo Jung

    2016-01-01

    Polyunsaturated fatty acids (PUFAs) are considered to be critical nutrients to regulate human health and development, and numerous fatty acid desaturases play key roles in synthesizing PUFAs. Given the lack of delta-12 and -15 desaturases and the low levels of conversion to PUFAs, humans must consume some omega-3 and omega-6 fatty acids in their diet. Many studies on fatty acid desaturases as well as PUFAs have shown that fatty acid desaturase genes are closely related to different human physiological conditions. Since the first front-end desaturases from cyanobacteria were cloned, numerous desaturase genes have been identified and animals and plants have been genetically engineered to produce PUFAs such as eicosapentaenoic acid and docosahexaenoic acid. Recently, a biotechnological approach has been used to develop clinical treatments for human physiological conditions, including cancers and neurogenetic disorders. Thus, understanding the functions and regulation of PUFAs associated with human health and development by using biotechnology may facilitate the engineering of more advanced PUFA production and provide new insights into the complexity of fatty acid metabolism. PMID:26742061

  16. A comparison of chromic acid and sulfuric acid anodizing

    NASA Technical Reports Server (NTRS)

    Danford, M. D.

    1992-01-01

    Because of federal and state mandates restricting the use of hexavalent chromium, it was deemed worthwhile to compare the corrosion protection afforded 2219-T87 aluminum alloy by both Type I chromic acid and Type II sulfuric acid anodizing per MIL-A-8625. Corrosion measurements were made on large, flat 2219-T87 aluminum alloy sheet material with an area of 1 cm(exp 2) exposed to a corrosive medium of 3.5-percent sodium chloride at pH 5.5. Both ac electrochemical impedance spectroscopy and the dc polarization resistance techniques were employed. The results clearly indicate that the corrosion protection obtained by Type II sulfuric acid anodizing is superior, and no problems should result by substituting Type II sulfuric acid anodizing for Type I chromic acid anodizing.

  17. Effect of propionic acid on fatty acid oxidation and ureagenesis.

    PubMed

    Glasgow, A M; Chase, H P

    1976-07-01

    Propionic acid significantly inhibited 14CO2 production from [1-14C] palmitate at a concentration of 10 muM in control fibroblasts and 100 muM in methylmalonic fibroblasts. This inhibition was similar to that produced by 4-pentenoic acid. Methylmalonic acid also inhibited 14CO2 production from [1-14C] palmitate, but only at a concentration of 1 mM in control cells and 5 mM in methylmalonic cells. Propionic acid (5 mM) also inhibited ureagenesis in rat liver slices when ammonia was the substrate but not with aspartate and citrulline as substrates. Propionic acid had no direct effect on either carbamyl phosphate synthetase or ornithine transcarbamylase. These findings may explain the fatty degeneration of the liver and the hyperammonemia in propionic and methylmalonic acidemia. PMID:934734

  18. Microbial desulfonation of substituted naphthalenesulfonic acids and benzenesulfonic acids.

    PubMed Central

    Zürrer, D; Cook, A M; Leisinger, T

    1987-01-01

    Sulfur-limited batch enrichment cultures containing one of nine multisubstituted naphthalenesulfonates and an inoculum from sewage yielded several taxa of bacteria which could quantitatively utilize 19 sulfonated aromatic compounds as the sole sulfur source for growth. Growth yields were about 4 kg of protein per mol of sulfur. Specific degradation rates were about 4 to 14 mu kat/kg of protein. A Pseudomonas sp., an Arthrobacter sp., and an unidentified bacterium were examined. Each desulfonated at least 16 aromatic compounds, none of which served as a carbon source. Pseudomonas sp. strain S-313 converted 1-naphthalenesulfonic acid, 2-naphthalenesulfonic acid, 5-amino-1-naphthalenesulfonic acid, benzenesulfonic acid, and 3-aminobenzenesulfonic acid to 1-naphthol, 2-naphthol, 5-amino-1-naphthol, phenol, and 3-aminophenol, respectively. Experiments with 18O2 showed that the hydroxyl group was derived from molecular oxygen. PMID:3662502

  19. Carbonic Acid Retreatment of Biomass

    SciTech Connect

    Baylor university

    2003-06-01

    This project sought to address six objectives, outlined below. The objectives were met through the completion of ten tasks. (1) Solidify the theoretical understanding of the binary CO{sub 2}/H{sub 2}O system at reaction temperatures and pressures. The thermodynamics of pH prediction have been improved to include a more rigorous treatment of non-ideal gas phases. However it was found that experimental attempts to confirm theoretical pH predictions were still off by a factor of about 1.8 pH units. Arrhenius experiments were carried out and the activation energy for carbonic acid appears to be substantially similar to sulfuric acid. Titration experiments have not yet confirmed or quantified the buffering or acid suppression effects of carbonic acid on biomass. (2) Modify the carbonic acid pretreatment severity function to include the effect of endogenous acid formation and carbonate buffering, if necessary. It was found that the existing severity functions serve adequately to account for endogenous acid production and carbonate effects. (3) Quantify the production of soluble carbohydrates at different reaction conditions and severity. Results show that carbonic acid has little effect on increasing soluble carbohydrate concentrations for pretreated aspen wood, compared to pretreatment with water alone. This appears to be connected to the release of endogenous acids by the substrate. A less acidic substrate such as corn stover would derive benefit from the use of carbonic acid. (4) Quantify the production of microbial inhibitors at selected reaction conditions and severity. It was found that the release of inhibitors was correlated to reaction severity and that carbonic acid did not appear to increase or decrease inhibition compared to pretreatment with water alone. (5) Assess the reactivity to enzymatic hydrolysis of material pretreated at selected reaction conditions and severity. Enzymatic hydrolysis rates increased with severity, but no advantage was detected for

  20. Carbonic Acid Pretreatment of Biomass

    SciTech Connect

    G. Peter van Walsum; Kemantha Jayawardhana; Damon Yourchisin; Robert McWilliams; Vanessa Castleberry

    2003-05-31

    This project sought to address six objectives, outlined below. The objectives were met through the completion of ten tasks. 1) Solidify the theoretical understanding of the binary CO2/H2O system at reaction temperatures and pressures. The thermodynamics of pH prediction have been improved to include a more rigorous treatment of non-ideal gas phases. However it was found that experimental attempts to confirm theoretical pH predictions were still off by a factor of about 1.8 pH units. Arrhenius experiments were carried out and the activation energy for carbonic acid appears to be substantially similar to sulfuric acid. Titration experiments have not yet confirmed or quantified the buffering or acid suppression effects of carbonic acid on biomass. 2) Modify the carbonic acid pretreatment severity function to include the effect of endogenous acid formation and carbonate buffering, if necessary. It was found that the existing severity functions serve adequately to account for endogenous acid production and carbonate effects. 3) Quantify the production of soluble carbohydrates at different reaction conditions and severity. Results show that carbonic acid has little effect on increasing soluble carbohydrate concentrations for pretreated aspen wood, compared to pretreatment with water alone. This appears to be connected to the release of endogenous acids by the substrate. A less acidic substrate such as corn stover would derive benefit from the use of carbonic acid. 4) Quantify the production of microbial inhibitors at selected reaction conditions and severity. It was found that the release of inhibitors was correlated to reaction severity and that carbonic acid did not appear to increase or decrease inhibition compared to pretreatment with water alone. 5) Assess the reactivity to enzymatic hydrolysis of material pretreated at selected reaction conditions and severity. Enzymatic hydrolysis rates increased with severity, but no advantage was detected for the use of carbonic

  1. Anacardic Acid, Salicylic Acid, and Oleic Acid Differentially Alter Cellular Bioenergetic Function in Breast Cancer Cells.

    PubMed

    Radde, Brandie N; Alizadeh-Rad, Negin; Price, Stephanie M; Schultz, David J; Klinge, Carolyn M

    2016-11-01

    Anacardic acid is a dietary and medicinal phytochemical that inhibits breast cancer cell proliferation and uncouples oxidative phosphorylation (OXPHOS) in isolated rat liver mitochondria. Since mitochondrial-targeted anticancer therapy (mitocans) may be useful in breast cancer, we examined the effect of anacardic acid on cellular bioenergetics and OXPHOS pathway proteins in breast cancer cells modeling progression to endocrine-independence: MCF-7 estrogen receptor α (ERα)+ endocrine-sensitive; LCC9 and LY2 ERα+, endocrine-resistant, and MDA-MB-231 triple negative breast cancer (TNBC) cells. At concentrations similar to cell proliferation IC50 s, anacardic acid reduced ATP-linked oxygen consumption rate (OCR), mitochondrial reserve capacity, and coupling efficiency while increasing proton leak, reflecting mitochondrial toxicity which was greater in MCF-7 compared to endocrine-resistant and TNBC cells. These results suggest tolerance in endocrine-resistant and TNBC cells to mitochondrial stress induced by anacardic acid. Since anacardic acid is an alkylated 2-hydroxybenzoic acid, the effects of salicylic acid (SA, 2-hydroxybenzoic acid moiety) and oleic acid (OA, monounsaturated alkyl moiety) were tested. SA inhibited whereas OA stimulated cell viability. In contrast to stimulation of basal OCR by anacardic acid (uncoupling effect), neither SA nor OA altered basal OCR- except OA inhibited basal and ATP-linked OCR, and increased ECAR, in MDA-MB-231 cells. Changes in OXPHOS proteins correlated with changes in OCR. Overall, neither the 2-hydroxybenzoic acid moiety nor the monounsaturated alky moiety of anacardic acid is solely responsible for the observed mitochondria-targeted anticancer activity in breast cancer cells and hence both moieties are required in the same molecule for the observed effects. J. Cell. Biochem. 117: 2521-2532, 2016. © 2016 Wiley Periodicals, Inc. PMID:26990649

  2. Production of Succinic Acid from Citric Acid and Related Acids by Lactobacillus Strains

    PubMed Central

    Kaneuchi, Choji; Seki, Masako; Komagata, Kazuo

    1988-01-01

    A number of Lactobacillus strains produced succinic acid in de Man-Rogosa-Sharpe broth to various extents. Among 86 fresh isolates from fermented cane molasses in Thailand, 30 strains (35%) produced succinic acid; namely, 23 of 39 Lactobacillus reuteri strains, 6 of 18 L. cellobiosus strains, and 1 of 6 unidentified strains. All of 10 L. casei subsp. casei strains, 5 L. casei subsp. rhamnosus strains, 6 L. mali strains, and 2 L. buchneri strains did not produce succinic acid. Among 58 known strains including 48 type strains of different Lactobacillus species, the strains of L. acidophilus, L. crispatus, L. jensenii, and L. parvus produced succinic acid to the same extent as the most active fresh isolates, and those of L. alimentarius, L. collinoides, L. farciminis, L. fructivorans (1 of 2 strains tested), L. malefermentans, and L. reuteri were also positive, to lesser extents. Diammonium citrate in de Man-Rogosa-Sharpe broth was determined as a precursor of the succinic acid produced. Production rates were about 70% on a molar basis with two fresh strains tested. Succinic acid was also produced from fumaric and malic acids but not from dl-isocitric, α-ketoglutaric, and pyruvic acids. The present study is considered to provide the first evidence on the production of succinic acid, an important flavoring substance in dairy products and fermented beverages, from citrate by lactobacilli. PMID:16347795

  3. Acid rain: effects on fish and wildlife

    SciTech Connect

    Mayer, K.S.; Multer, E.P.; Schreiber, R.K.

    1984-01-01

    The following questions concerning acid rain are discussed: what is acid rain; what causes acid rain; where do sulfur and nitrogen oxides originate; what areas in the U.S. are susceptible to acid rain; are there early warning signals of acidification to aquatic resources; how does acid rain affect fishery resources; does acid rain affect wildlife; and how can effects of acid rain be reduced.

  4. Synthesis of (+) and (-)-phaselic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    (2S)-Phaselic acid (2S-O-caffeoylmalate) is a common plant metabolite belonging to the o-diphenol subclass of phenolic secondary metabolites. Our interest in this metabolite stems from previous studies showing that the presence of (2S)-phaselic acid in red clover is crucial to the preservation of ut...

  5. Synthesis of (+)- and (-)-phaselic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    (2S)-Phaselic acid (2S-O-caffeoylmalate) is a common plant metabolite belonging to the o-diphenol subclass of phenolic secondary metabolites. Our interest in this metabolite stems from previous studies showing that the presence of (2S)-phaselic acid in red clover is crucial to the preservation of ut...

  6. BOTANICAL ASPECTS OF ACIDIC PRECIPITATION

    EPA Science Inventory

    Acidic precipitation can be characterized as wet or frozen atmospheric deposition with a hydrogen ion concentration greater than 2.5 microequivalents liter-1. Acidic precipitation is perceived as a significant air pollution problem derived chiefly from combustion of fossil fuels,...

  7. SOIL REACTION AND ACIDIC DEPOSITION

    EPA Science Inventory

    This chapter discusses the major chemical processes by which acidic deposition interacts with soils. he focus is on forest soils, as the effects of acidic deposition on soils used for production of food and fiber are generally small compared to effects of agricultural practices s...

  8. Acid Rain: The Scientific Challenge.

    ERIC Educational Resources Information Center

    Godfrey, Paul J.

    1991-01-01

    Documents the workings and findings of the Massachusetts Acid Rain Monitoring Project, which has pooled the volunteer efforts of more than 1,000 amateur and professional scientists since 1983. Reports on the origins of air pollution, the prediction of acid rain, and its effects on both water life and land resources. (JJK)

  9. Acid Rain: An Educational Opportunity?

    ERIC Educational Resources Information Center

    Marion, James I.

    1984-01-01

    Deals with how educators can handle the subject of acid rain; illustrates suggestions with experiences of grade nine students visiting Frost Valley Environmental Education Center (Oliverea, New York) to learn scientific concepts through observation of outdoor phenomena, including a stream; and discusses acid rain, pH levels, and pollution control…

  10. Acid Rain: What's the Forecast?

    ERIC Educational Resources Information Center

    Bybee, Rodger

    1984-01-01

    Discusses various types of acid rain, considered to be a century-old problem. Topics include: wet and dry deposition, effects on a variety of environments, ecosystems subject to detrimental effects, and possible solutions to the problem. A list of recommended resources on acid rain is provided. (BC)

  11. Acid rain & electric utilities II

    SciTech Connect

    1997-12-31

    This document presents reports which were presented at the Acid Rain and Electric Utilities Conference. Topics include environmental issues and electric utilities; acid rain program overview; global climate change and carbon dioxide; emissions data management; compliance; emissions control; allowance and trading; nitrogen oxides; and assessment. Individual reports have been processed separately for the United States Department of Energy databases.

  12. Acid Precipitation: Causes and Consequences.

    ERIC Educational Resources Information Center

    Babich, Harvey; And Others

    1980-01-01

    This article is the first of three articles in a series on the acid rain problem in recent years. Discussed are the causes of acid precipitation and its consequences for the abiotic and biotic components of the terrestrial and aquatic ecosystems, and for man-made materials. (Author/SA)

  13. TRANS ACIDS IN SPECIALTY LIPIDS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The role of trans acids in human health and nutrition is highly controversial and a search of the Internet reveals the interest in the subject. Trans acids are perceived as "killer fats" at one end of the spectrum to having no adverse effects at the other. In addition, saturated fats are perceived...

  14. Acid precipitation in historical perspective

    SciTech Connect

    Cowling, E.B.

    1982-02-01

    The history of acid precipitation is traced from the first awareness of the problem in the mid-17th century to the present. An outline of the National Acid Precipitation Assessment program is also given, and the author makes recommendations for future research. (JMT)

  15. SIMULATED ACID RAIN ON CROPS

    EPA Science Inventory

    In 1981, simulated H2SO4 acid rain was applied to alfalfa and tall fescue and a 2:1 ratio of H2SO4:HNO3 acid rain was applied to alfalfa, tall fescue, barley, wheat, potato, tomato, radish, and corn crops growing in the open field at Corvallis, Oregon. Careful attention was given...

  16. Acid rain: a background report

    SciTech Connect

    Glustrom, L.; Stolzenberg, J.

    1982-07-08

    This Staff Brief was prepared for the Wisconsin Legislative Council's Special Committee on Acid Rain to provide an introduction to the issue of acid rain. It is divided into four parts. Part I provides an overview on the controversies surrounding the measurement, formation and effects of acid rain. As described in Part I, the term acid rain is used to describe the deposition of acidic components through both wet deposition (e.g., rain or snow) and dry deposition (e.g., direct contact between atmospheric constituents and the land, water or vegetation of the earth). Part II presents background information on state agency activities relating to acid rain in Wisconsin, describes what is known about the occurrence of, susceptibility to and effects of acid rain in Wisconsin, and provides information related to man-made sources of sulfur and nitrogen oxides in Wisconsin. Part III describes major policies and regulations relating to acid rain which have been or are being developed jointly by the United States and Canadian governments, by the United States government and by the State of Wisconsin. Part IV briefly discusses possible areas for Committee action.

  17. Getting Back to Basics (& Acidics)

    ERIC Educational Resources Information Center

    Rhodes, Sam

    2006-01-01

    This article describes a few novel acid-base experiments intended to introduce students to the basic concepts of acid-base chemistry and provide practical examples that apply directly to the study of biology and the human body. Important concepts such as the reaction between carbon dioxide and water, buffers and protein denaturation, are covered.…

  18. ACID DEPOSITION AND FOREST DECLINE

    EPA Science Inventory

    The location, topography and other characteristics of the high-elevation forests of eastern North America cause them to be receptors of high levels of acid deposition and airborn trace metals. No other major forested areas in the U.S. are subjected to such intensely acid cloud mo...

  19. Acid Tests and Basic Fun.

    ERIC Educational Resources Information Center

    McBride, John W.

    1995-01-01

    Explores acids and bases using different indicators, such as turmeric, purple grape juice, and lichens. Because some of these indicators are not as sensitive as cabbage juice or litmus paper, determining to which acids and bases each indicator is sensitive presents an enjoyable, problem-solving challenge for students. Presents directions for…

  20. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  1. Lead-acid battery

    SciTech Connect

    Rowlette, J.J.

    1983-09-20

    A light weight lead-acid battery is disclosed having a positive terminal and a negative terminal and including one or more cells or grid stacks having a plurality of vertically stacked conductive monoplates with positive active material and negative active material deposited on alternating plates in the cell or grid stack. Electrolyte layers positioned between each monoplate are included to provide a battery cell having four sides which is capable of being electrically charged and discharged. Two vertical positive bus bars are provided on opposite sides of the battery cell for connecting the monoplates with positive active material together in parallel current conducting relation. In addition, two negative bus bars on opposite sides of the battery cell each being adjacent the positive bus bars are provided for connecting the monoplates with negative active material together in parallel current conducting relation. The positive and negative bus bars not only provide a low resistance method for connecting the plurality of conductive monoplates of their respective battery terminals but also provides support and structural strength to the battery cell structure. In addition, horizontal orientation of monoplates is provided in a vertical stacking arrangement to reduce electrolyte stratification and short circuiting due to flaking of positive and negative active materials from the monoplates.

  2. Lead-acid battery

    NASA Technical Reports Server (NTRS)

    Rowlette, John J. (Inventor)

    1983-01-01

    A light weight lead-acid battery (30) having a positive terminal (36) and a negative terminal (34) and including one or more cells or grid stacks having a plurality of vertically stacked conductive monoplates (10, 20) with positive active material and negative active material deposited on alternating plates in the cell or grid stack. Electrolyte layers (26, 28) positioned between each monoplate are included to provide a battery cell having four sides which is capable of being electrically charged and discharged. Two vertical positive bus bars (42, 43) are provided on opposite sides of the battery cell for connecting the monoplates (10) with positive active material together in parallel current conducting relation. In addition, two negative bus bars (38, 39) on opposite sides of the battery cell each being adjacent the positive bus bars are provided for connecting the monoplates (20) with negative active material together in parallel current conducting relation. The positive (42, 43) and negative (38, 39) bus bars not only provide a low resistance method for connecting the plurality of conductive monoplates of their respective battery terminals (36, 34) but also provides support and structural strength to the battery cell structure. In addition, horizontal orientation of monoplates (10, 20) is provided in a vertical stacking arrangement to reduce electrolyte stratification and short circuiting due to flaking of positive and negative active materials from the monoplates.

  3. Atmospheric dust and acid rain

    SciTech Connect

    Hedin, L.O.; Likens, G.E.

    1996-12-01

    Why is acid rain still an environmental problem in Europe and North America despite antipollution reforms? The answer really is blowing in the wind: atmospheric dust. These airborne particles can help neutralize the acids falling on forests, but dust levels are unusually low these days. In the air dust particles can neutralize acid rain. What can we do about acid rain and atmospheric dust? Suggestions range from the improbable to the feasible. One reasonable suggestion is to reduce emissions of acidic pollutants to levels that can be buffered by natural quantities of basic compounds in the atmosphere; such a goal would mean continued reductions in sulfur dioxide and nitrogen oxides, perhaps even greater than those prescribed in the 1990 Amendments to the Clean Air Act in the U.S. 5 figs.

  4. Microfluidics in amino acid analysis.

    PubMed

    Pumera, Martin

    2007-07-01

    Microfluidic devices have been widely used to derivatize, separate, and detect amino acids employing many different strategies. Virtually zero-dead volume interconnections and fast mass transfer in small volume microchannels enable dramatic increases in on-chip derivatization reaction speed, while only minute amounts of sample and reagent are needed. Due to short channel path, fast subsecond separations can be carried out. With sophisticated miniaturized detectors, the whole analytical process can be integrated on one platform. This article reviews developments of lab-on-chip technology in amino acid analysis, it shows important design features such as sample preconcentration, precolumn and postcolumn amino acid derivatization, and unlabeled and labeled amino acid detection with focus on advanced designs. The review also describes important biomedical and space exploration applications of amino acid analysis on microfluidic devices. PMID:17542043

  5. Synthesis of higher monocarboxylic acids

    SciTech Connect

    Taikov, B.F.; Novakovskii, E.M.; Zhelkovskaya, V.P.; Shadrova, V.N.; Shcherbik, P.K.

    1981-01-01

    Brown-coal and peat waxes contain higher monocarboxylic acids, alcohols and esters of them as their main components. In view of this, considerable interest is presented by the preparation of individual compounds among those mentioned above, which is particularly important in the study of the composition and development of the optimum variants of the chemical processing of the waxes. In laboratory practice, to obtain higher monocarboxylic acids use is generally made of electrosynthesis according to Kolbe which permits unbranched higher aliphatic acids with given lengths of the hydrocarbon chain to be obtained. The aim of the present work was to synthesize higher monocarboxylic acids: arachidic, behenic, lignoceric, pentacosanoic, erotic, heptacosanoic, montanic, nonacosanoic, melissic, dotriacontanoic and tetratriacontanoic, which are present in waxes. Characteristics of synthesized acids are tabulated. 20 refs.

  6. Fumaric acid production by fermentation

    PubMed Central

    Roa Engel, Carol A.; Zijlmans, Tiemen W.; van Gulik, Walter M.; van der Wielen, Luuk A. M.

    2008-01-01

    The potential of fumaric acid as a raw material in the polymer industry and the increment of cost of petroleum-based fumaric acid raises interest in fermentation processes for production of this compound from renewable resources. Although the chemical process yields 112% w/w fumaric acid from maleic anhydride and the fermentation process yields only 85% w/w from glucose, the latter raw material is three times cheaper. Besides, the fermentation fixes CO2. Production of fumaric acid by Rhizopus species and the involved metabolic pathways are reviewed. Submerged fermentation systems coupled with product recovery techniques seem to have achieved economically attractive yields and productivities. Future prospects for improvement of fumaric acid production include metabolic engineering approaches to achieve low pH fermentations. PMID:18214471

  7. Sialic acids and autoimmune disease.

    PubMed

    Mahajan, Vinay S; Pillai, Shiv

    2016-01-01

    An important underlying mechanism that contributes to autoimmunity is the loss of inhibitory signaling in the immune system. Sialic acid-recognizing Ig superfamily lectins or Siglecs are a family of cell surface proteins largely expressed in hematopoietic cells. The majority of Siglecs are inhibitory receptors expressed in immune cells that bind to sialic acid-containing ligands and recruit SH2-domain-containing tyrosine phosphatases to their cytoplasmic tails. They deliver inhibitory signals that can contribute to the constraining of immune cells, and thus protect the host from autoimmunity. The inhibitory functions of CD22/Siglec-2 and Siglec-G and their contributions to tolerance and autoimmunity, primarily in the B lymphocyte context, are considered in some detail in this review. The relevance to autoimmunity and unregulated inflammation of modified sialic acids, enzymes that modify sialic acid, and other sialic acid-binding proteins are also reviewed. PMID:26683151

  8. Nucleic acid based molecular devices.

    PubMed

    Krishnan, Yamuna; Simmel, Friedrich C

    2011-03-28

    In biology, nucleic acids are carriers of molecular information: DNA's base sequence stores and imparts genetic instructions, while RNA's sequence plays the role of a messenger and a regulator of gene expression. As biopolymers, nucleic acids also have exciting physicochemical properties, which can be rationally influenced by the base sequence in myriad ways. Consequently, in recent years nucleic acids have also become important building blocks for bottom-up nanotechnology: as molecules for the self-assembly of molecular nanostructures and also as a material for building machinelike nanodevices. In this Review we will cover the most important developments in this growing field of nucleic acid nanodevices. We also provide an overview of the biochemical and biophysical background of this field and the major "historical" influences that shaped its development. Particular emphasis is laid on DNA molecular motors, molecular robotics, molecular information processing, and applications of nucleic acid nanodevices in biology. PMID:21432950

  9. Molten fatty acid based microemulsions.

    PubMed

    Noirjean, Cecile; Testard, Fabienne; Dejugnat, Christophe; Jestin, Jacques; Carriere, David

    2016-06-21

    We show that ternary mixtures of water (polar phase), myristic acid (MA, apolar phase) and cetyltrimethylammonium bromide (CTAB, cationic surfactant) studied above the melting point of myristic acid allow the preparation of microemulsions without adding a salt or a co-surfactant. The combination of SANS, SAXS/WAXS, DSC, and phase diagram determination allows a complete characterization of the structures and interactions between components in the molten fatty acid based microemulsions. For the different structures characterized (microemulsion, lamellar or hexagonal phases), a similar thermal behaviour is observed for all ternary MA/CTAB/water monophasic samples and for binary MA/CTAB mixtures without water: crystalline myristic acid melts at 52 °C, and a thermal transition at 70 °C is assigned to the breaking of hydrogen bounds inside the mixed myristic acid/CTAB complex (being the surfactant film in the ternary system). Water determines the film curvature, hence the structures observed at high temperature, but does not influence the thermal behaviour of the ternary system. Myristic acid is partitioned in two "species" that behave independently: pure myristic acid and myristic acid associated with CTAB to form an equimolar complex that plays the role of the surfactant film. We therefore show that myristic acid plays the role of a solvent (oil) and a co-surfactant allowing the fine tuning of the structure of oil and water mixtures. This solvosurfactant behaviour of long chain fatty acid opens the way for new formulations with a complex structure without the addition of any extra compound. PMID:27241163

  10. Acid soil and acid rain, 2nd edition

    SciTech Connect

    Kennedy, I.R.

    1992-01-01

    This book examines the basic chemical processes involved in acidification in order to better assess their long-term effects on the status of soils, the health of plants and other living species that depend on them. It also discusses acidity, pH and protons their significance in bioenergetics and the consequent role of autotrophic organisms in acidifying ecosystems. This edition incorporates and integrates recent findings that render more explanations of the causes of the environmental impacts of acidity, especially in forests and lakes. Also explores current research into acid rain and soil in order to devise appropriate measures for their amelioration.

  11. Functional nucleic acid probes and uses thereof

    DOEpatents

    Nilsen-Hamilton, Marit

    2006-10-03

    The present invention provides functional nucleic acid probes, and methods of using functional nucleic acid probes, for binding a target to carry out a desired function. The probes have at least one functional nucleic acid, at least one regulating nucleic acid, and at least one attenuator. The functional nucleic acid is maintained in an inactive state by the attenuator and activated by the regulating nucleic acid only in the presence of a regulating nucleic acid target. In its activated state the functional nucleic acid can bind to its target to carry out a desired function, such as generating a signal, cleaving a nucleic acid, or catalyzing a reaction.

  12. Polyglycolic acid induced inflammation

    PubMed Central

    Ceonzo, Kathleen; Gaynor, Anne; Shaffer, Lisa; Kojima, Koji; Vacanti, Charles A.; Stahl, Gregory L.

    2005-01-01

    Tissue and organ replacement have quickly outpaced available supply. Tissue bioengineering holds the promise for additional tissue availability. Various scaffolds are currently used, whereas polyglycolic acid (PGA), which is currently used in absorbable sutures and orthopedic pins, provides an excellent support for tissue development. Unfortunately, PGA can induce a local inflammatory response following implantation, so we investigated the molecular mechanism of inflammation in vitro and in vivo. Degraded PGA induced an acute peritonitis, characterized by neutrophil (PMN) infiltration following intraperitoneal injection in mice. Similar observations were observed using the metabolite of PGA, glycolide. Dissolved PGA or glycolide, but not native PGA, activated the classical complement pathway in human sera, as determined by classical complement pathway hemolytic assays, C3a and C5a production, C3 and immunoglobulin deposition. To investigate whether these in vitro observations translated to in vivo findings, we used genetically engineered mice. Intraperitoneal administration of glycolide or dissolved PGA in mice deficient in C1q, factor D, C1q and factor D or C2 and factor B demonstrated significantly reduced PMN infiltration compared to congenic controls (WT). Mice deficient in C6 also demonstrated acute peritonitis. However, treatment of WT or C6 deficient mice with a monoclonal antibody against C5 prevented the inflammatory response. These data suggest that the hydrolysis of PGA to glycolide activates the classical complement pathway. Further, complement is amplified via the alternative pathway and inflammation is induced by C5a generation. Inhibition of C5a may provide a potential therapeutic approach to limit the inflammation associated with PGA derived materials following implantation. PMID:16548688

  13. 21 CFR 189.155 - Monochloroacetic acid.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Monochloroacetic acid. 189.155 Section 189.155... Human Food § 189.155 Monochloroacetic acid. (a) Monochloroacetic acid is the chemical chloroacetic acid... in alcoholic and nonalcoholic beverages. Monochloroacetic acid is permitted in food package...

  14. 21 CFR 184.1021 - Benzoic acid.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Benzoic acid. 184.1021 Section 184.1021 Food and... Substances Affirmed as GRAS § 184.1021 Benzoic acid. (a) Benzoic acid is the chemical benzenecarboxylic acid (C7H6O2), occurring in nature in free and combined forms. Among the foods in which benzoic acid...

  15. 21 CFR 184.1021 - Benzoic acid.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Benzoic acid. 184.1021 Section 184.1021 Food and....1021 Benzoic acid. (a) Benzoic acid is the chemical benzenecarboxylic acid (C7H6O2), occurring in nature in free and combined forms. Among the foods in which benzoic acid occurs naturally are...

  16. 21 CFR 184.1021 - Benzoic acid.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Benzoic acid. 184.1021 Section 184.1021 Food and... Substances Affirmed as GRAS § 184.1021 Benzoic acid. (a) Benzoic acid is the chemical benzenecarboxylic acid (C7H6O2), occurring in nature in free and combined forms. Among the foods in which benzoic acid...

  17. 21 CFR 184.1021 - Benzoic acid.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Benzoic acid. 184.1021 Section 184.1021 Food and... Substances Affirmed as GRAS § 184.1021 Benzoic acid. (a) Benzoic acid is the chemical benzenecarboxylic acid (C7H6O2), occurring in nature in free and combined forms. Among the foods in which benzoic acid...

  18. 21 CFR 184.1021 - Benzoic acid.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Benzoic acid. 184.1021 Section 184.1021 Food and... Substances Affirmed as GRAS § 184.1021 Benzoic acid. (a) Benzoic acid is the chemical benzenecarboxylic acid (C7H6O2), occurring in nature in free and combined forms. Among the foods in which benzoic acid...

  19. Cycloadditions for Studying Nucleic Acids.

    PubMed

    Kath-Schorr, Stephanie

    2016-02-01

    Cycloaddition reactions for site-specific or global modification of nucleic acids have enabled the preparation of a plethora of previously inaccessible DNA and RNA constructs for structural and functional studies on naturally occurring nucleic acids, the assembly of nucleic acid nanostructures, therapeutic applications, and recently, the development of novel aptamers. In this chapter, recent progress in nucleic acid functionalization via a range of different cycloaddition (click) chemistries is presented. At first, cycloaddition/click chemistries already used for modifying nucleic acids are summarized, ranging from the well-established copper(I)-catalyzed alkyne-azide cycloaddition reaction to copper free methods, such as the strain-promoted azide-alkyne cycloaddition, tetrazole-based photoclick chemistry and the inverse electron demand Diels-Alder cycloaddition reaction between strained alkenes and tetrazine derivatives. The subsequent sections contain selected applications of nucleic acid functionalization via click chemistry; in particular, site-specific enzymatic labeling in vitro, either via DNA and RNA recognizing enzymes or by introducing unnatural base pairs modified for click reactions. Further sections report recent progress in metabolic labeling and fluorescent detection of DNA and RNA synthesis in vivo, click nucleic acid ligation, click chemistry in nanostructure assembly and click-SELEX as a novel method for the selection of aptamers. PMID:27572987

  20. Phytic acid in green leaves.

    PubMed

    Hadi Alkarawi, H; Zotz, G

    2014-07-01

    Phytic acid or phytate, the free-acid form of myo-inositolhexakiphosphate, is abundant in many seeds and fruits, where it represents the major storage form of phosphorus. Although also known from other plant tissues, available reports on the occurrence of phytic acid, e.g. in leaves, have never been compiled, nor have they been critically reviewed. We found 45 published studies with information on phytic acid content in leaves. Phytic acid was almost always detected when studies specifically tried to detect it, and accounted for up to 98% of total P. However, we argue that such extreme values, which rival findings from storage organs, are dubious and probably result from measurement errors. Excluding these high values from further quantitative analysis, foliar phytic acid-P averaged 2.3 mg·g(-1) , and represented, on average, 7.6% of total P. Remarkably, the ratio of phytic acid-P to total P did not increase with total P, we even detected a negative correlation of the two variables within one species, Manihot esculenta. This enigmatic finding warrants further attention. PMID:24341824

  1. Diabetes and Alpha Lipoic Acid

    PubMed Central

    Golbidi, Saeid; Badran, Mohammad; Laher, Ismail

    2011-01-01

    Diabetes mellitus is a multi-faceted metabolic disorder where there is increased oxidative stress that contributes to the pathogenesis of this debilitating disease. This has prompted several investigations into the use of antioxidants as a complementary therapeutic approach. Alpha lipoic acid, a naturally occurring dithiol compound which plays an essential role in mitochondrial bioenergetic reactions, has gained considerable attention as an antioxidant for use in managing diabetic complications. Lipoic acid quenches reactive oxygen species, chelates metal ions, and reduces the oxidized forms of other antioxidants such as vitamin C, vitamin E, and glutathione. It also boosts antioxidant defense system through Nrf-2-mediated antioxidant gene expression and by modulation of peroxisome proliferator activated receptors-regulated genes. ALA inhibits nuclear factor kappa B and activates AMPK in skeletal muscles, which in turn have a plethora of metabolic consequences. These diverse actions suggest that lipoic acid acts by multiple mechanisms, many of which have only been uncovered recently. In this review we briefly summarize the known biochemical properties of lipoic acid and then discussed the oxidative mechanisms implicated in diabetic complications and the mechanisms by which lipoic acid may ameliorate these reactions. The findings of some of the clinical trials in which lipoic acid administration has been tested in diabetic patients during the last 10 years are summarized. It appears that the clearest benefit of lipoic acid supplementation is in patients with diabetic neuropathy. PMID:22125537

  2. Terahertz spectrum of gallic acid

    NASA Astrophysics Data System (ADS)

    Wu, Meng; Zhao, Guozhong; Wang, Haiyan; Liang, Chengshen

    2009-11-01

    Gallic acid is natural polyphenol compound found in many green plants. More and more experiments have demonstrated that the gallic acid has comprehensive applications. In the field of medicine, the gallic acid plays an important role in antianaphylaxis, antineoplastic, antimycotic, anti-inflammatory, antivirotic, antiasthmatic and inhibiting the degradation of insulin. It also has a lot of applications in chemical industry, food industry and light industry. So it is important to study the terahertz time-domain spectroscopy of gallic acid. Terahertz time-domain spectroscopy (THz-TDS) is a new coherent spectral technology based on the femtosecond laser. In this work, the spectral characteristics of gallic acid in the range of 0.4 THz to 2.6 THz have been measured by THz-TDS. We obtained its absorption and refraction spectra at room temperature. The vibration absorption spectrum of the single molecule between 0.4 THz and 2.6 THz is simulated based on the Density Functional Theory (DFT). It is found that the gallic acid has the spectral response to THz wave in this frequency range. The results show the abnormal dispersion at 1.51 THz and 2.05 THz. These results can be used in the qualitative analysis of gallic acid and the medicine and food inspection.

  3. Pyroligneous acid-the smoky acidic liquid from plant biomass.

    PubMed

    Mathew, Sindhu; Zakaria, Zainul Akmar

    2015-01-01

    Pyroligneous acid (PA) is a complex highly oxygenated aqueous liquid fraction obtained by the condensation of pyrolysis vapors, which result from the thermochemical breakdown or pyrolysis of plant biomass components such as cellulose, hemicellulose, and lignin. PA produced by the slow pyrolysis of plant biomass is a yellowish brown or dark brown liquid with acidic pH and usually comprises a complex mixture of guaiacols, catechols, syringols, phenols, vanillins, furans, pyrans, carboxaldehydes, hydroxyketones, sugars, alkyl aryl ethers, nitrogenated derivatives, alcohols, acetic acid, and other carboxylic acids. The phenolic components, namely guaiacol, alkyl guaiacols, syringol, and alkyl syringols, contribute to the smoky odor of PA. PA finds application in diverse areas, as antioxidant, antimicrobial, antiinflammatory, plant growth stimulator, coagulant for natural rubber, and termiticidal and pesticidal agent; is a source for valuable chemicals; and imparts a smoky flavor for food. PMID:25467926

  4. Drilling fluids containing amps, acrylic acid, itaconic acid polymer

    SciTech Connect

    Bardoliwalla, D.F.

    1987-10-13

    This patent describes an aqueous drilling fluid having present in an amount sufficient to reduce fluid loss of the drilling fluid, at least one polymer of (1) from about 5% to about 50% by weight of 2-acrylamido-2-methylpropane sulfonic acid and (2) from about 95% to about 50% by weight of a second component, there being from 100% to about 80% by weight of acrylic acid and from 0% by weight to about 20% by weight of itaconic acid in the second component. The polymer has a weight average molecular weight of between about 50,000 to about 1,000,000 being in its free acid or partially or completely neutralized form and being at least water dispersible. A method is described of drilling a well into a subterranean formation in which an aqueous drilling fluid is circulated into the well. The step of circulating the drilling fluid contains in an amount sufficient to reduce fluid loss of the drilling fluid, at least one polymer of (1) from about 5% to about 50% by weight of 2-acrylamido-2-methylpropane sulfonic acid and (2) from about 95% to about 50% by weight of a second component. There is from 100% to about 80% by weight of acrylic acid and from 0% by weight to about 20% by weight of itaconic acid in the second component. The polymer has weight average molecular weight of between about 50,000 to about 1,000,000 in its free acid or partially or completely neutralized form and is at least water dispersible.

  5. PRODUCTION OF TRIFLUOROACETIC ACID COMPOUNDS

    DOEpatents

    Haworth, W.N.; Stacey, M.

    1949-08-30

    A process is described for the preparation of trifluoroacetic acid. Acetone vapor diluted wlth nitrogen and fluorine also diluted with nltrogen are fed separately at a temperature of about 210 deg C into a reaction vessel containing a catalyst mass selected from-the group consisting of silver and gold. The temperature in the reaction vessel is maintained in the range of 200 deg to 250 deg C. The reaction product, trifluoroacetyl fluoride, is absorbed in aqueous alkali solution. Trifluoroacetic acid is recovered from the solution by acidification wlth an acid such as sulfuric followed by steam distillation.

  6. Chemiluminescent measurement of atmospheric acid

    NASA Technical Reports Server (NTRS)

    Stedman, D. H.; Kok, G. L.

    1974-01-01

    The design and construction of a gas phase acid sensitive analyzer are reported. These studies showed that the chemical system was a practical analytical method. A complete instrument was developed and prepared for field testing. A Titan 3-C rocket was scheduled for launching on February 11, 1974. Through preparations made by NASA Langley the instrument was set up to monitor the acid concentration in the rocket exhaust. Due to adverse wind conditions no acid was detected. This entire trip is described in detail.

  7. PHARMACOLOGICAL ACTIVITIES OF PROTOCATECHUIC ACID.

    PubMed

    Khan, Abida Kalsoom; Rashid, Rehana; Fatima, Nighat; Mahmood, Sadaf; Mir, Sadullah; Khan, Sara; Jabeen, Nyla; Murtaza, Ghulam

    2015-01-01

    Protocatechuic acid (3,4-dihydroxybenzoic acid, PCA) is a simple phenolic acid. It is found in a large variety of edible plants and possesses various pharmacological activities. This article aims to review the modern trends in phytochemical isolation and extraction of PCA from plants and other natural resources. Moreover, this article also encompasses pharmacological and biological activities of PCA. It is well known to have anti-inflammatory, antioxidant, anti-hyperglycemia, antibacterial, anticancer, anti-ageing, anti-athro- genic, anti-tumoral, anti-asthma, antiulcer, antispasmodic and neurological properties. PMID:26647619

  8. Can crops tolerate acid rain

    SciTech Connect

    Kaplan, J.K.

    1989-11-01

    This brief article describes work by scientists at the ARS Air Quality-Plant Growth and Development Laboratory in Raleigh, North Carolina, that indicates little damage to crops as a result of acid rain. In studies with simulated acid rain and 216 exposed varieties of 18 crops, there were no significant injuries nor was there reduced growth in most species. Results of chronic and acute exposures were correlated in sensitive tomato and soybean plants and in tolerant winter wheat and lettuce plants. These results suggest that 1-hour exposures could be used in the future to screen varieties for sensitivity to acid rain.

  9. Amino Acids from a Comet

    NASA Technical Reports Server (NTRS)

    Cook, Jamie Elisla

    2009-01-01

    NASA's Stardust spacecraft returned samples from comet 81P/Wild 2 to Earth in January 2006. Examinations of the organic compounds in cometary samples can reveal information about the prebiotic organic inventory present on the early Earth and within the early Solar System, which may have contributed to the origin of life. Preliminary studies of Stardust material revealed the presence of a suite of organic compounds including several amines and amino acids, but the origin of these compounds (cometary- vs. terrestrial contamination) could not be identified. We have recently measured the carbon isotopic ratios of these amino acids to determine their origin, leading to the first detection of a coetary amino acid.

  10. Be an acid rain detective

    SciTech Connect

    Atwill, L.

    1982-07-01

    Acid rain is discussed in a question and answer format. The article is aimed at educating sport fishermen on the subject, and also to encourage them to write their congressmen, senators, and the President about the acid rain problem. The article also announces the availability of an acid rain test kit available through the magazine, ''Sports Afield.'' The kit consists of pH-test paper that turns different shades of pink and blue according to the pH of the water tested. The color of the test paper is then compared to a color chart furnished in the kit and an approximate pH can be determined.

  11. Abscission: Role of Abscisic Acid

    PubMed Central

    Cracker, L. E.; Abeles, F. B.

    1969-01-01

    The effect of abscisic acid on cotton (Gossypium hirsutum L. cv. Acala 4-42) and bean (Phaseolus vulgaris L. cv. Red Kidney) explants was 2-fold. It increased ethylene production from the explants, which was found to account for some of its ability to accelerate abscission. Absci is acid also increased the activity of cellulase. Increased synthesis of cellulase was not du to an increase in aging of the explants but rather was an effect of abscisic acid on the processes that lead to cellulase synthesis or activity. PMID:16657181

  12. Treatment of Amino Acid Metabolism Disorders

    MedlinePlus

    ... Treatment of amino acid metabolism disorders Treatment of amino acid metabolism disorders E-mail to a friend Please ... this page It's been added to your dashboard . Amino acid metabolism disorders are rare health conditions that affect ...

  13. Genetics Home Reference: sialic acid storage disease

    MedlinePlus

    ... Home Health Conditions sialic acid storage disease sialic acid storage disease Enable Javascript to view the expand/ ... Download PDF Open All Close All Description Sialic acid storage disease is an inherited disorder that primarily ...

  14. Treatment of Fatty Acid Oxidation Disorders

    MedlinePlus

    ... of fatty acid oxidation disorders Treatment of fatty acid oxidation disorders E-mail to a friend Please ... page It's been added to your dashboard . Fatty acid oxidation disorders are rare health conditions that affect ...

  15. Molar extinction coefficients of some fatty acids

    NASA Astrophysics Data System (ADS)

    Sandhu, G. K.; Singh, Kulwant; Lark, B. S.; Gerward, L.

    2002-10-01

    The attenuation of gamma rays in some fatty acids, viz. formic acid (CH 2O 2), acetic acid (C 2H 4O 2), propionic acid (C 3H 6O 2), butyric acid (C 4H 8O 2), n-hexanoic acid (C 6H 12O 2), n-caprylic acid (C 8H 16O 2), lauric acid (C 12H 24O 2), myristic acid (C 14H 28O 2), palmitic acid (C 16H 32O 2), oleic acid (C 18H 34O 2) and stearic acid (C 18H 36O 2), has been measured at the photon energies 81, 356, 511, 662, 1173 and 1332 keV. Experimental values for the molar extinction coefficient, the effective atomic number and the electron density have been derived and compared with theoretical calculations. There is good agreement between experiment and theory.

  16. Phosphonic acid based exchange resins

    DOEpatents

    Horwitz, E. Philip; Alexandratos, Spiro D.; Gatrone, Ralph C.; Chiarizia, Ronato

    1995-01-01

    An ion exchange resin for extracting metal ions from a liquid waste stream. An ion exchange resin is prepared by copolymerizing a vinylidene diphosphonic acid with styrene, acrylonitrile and divinylbenzene.

  17. Microbial production of lactic acid.

    PubMed

    Eiteman, Mark A; Ramalingam, Subramanian

    2015-05-01

    Lactic acid is an important commodity chemical having a wide range of applications. Microbial production effectively competes with chemical synthesis methods because biochemical synthesis permits the generation of either one of the two enantiomers with high optical purity at high yield and titer, a result which is particularly beneficial for the production of poly(lactic acid) polymers having specific properties. The commercial viability of microbial lactic acid production relies on utilization of inexpensive carbon substrates derived from agricultural or waste resources. Therefore, optimal lactic acid formation requires an understanding and engineering of both the competing pathways involved in carbohydrate metabolism, as well as pathways leading to potential by-products which both affect product yield. Recent research leverages those biochemical pathways, while researchers also continue to seek strains with improved tolerance and ability to perform under desirable industrial conditions, for example, of pH and temperature. PMID:25604523

  18. Low acid producing solid propellants

    NASA Technical Reports Server (NTRS)

    Bennett, Robert R.

    1995-01-01

    The potential environmental effects of the exhaust products of conventional rocket propellants have been assessed by various groups. Areas of concern have included stratospheric ozone, acid rain, toxicity, air quality and global warming. Some of the studies which have been performed on this subject have concluded that while the impacts of rocket use are extremely small, there are propellant development options which have the potential to reduce those impacts even further. This paper discusses the various solid propellant options which have been proposed as being more environmentally benign than current systems by reducing HCI emissions. These options include acid neutralized, acid scavenged, and nonchlorine propellants. An assessment of the acid reducing potential and the viability of each of these options is made, based on current information. Such an assessment is needed in order to judge whether the potential improvements justify the expenditures of developing the new propellant systems.

  19. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  20. Bile acid sequestrants for cholesterol

    MedlinePlus

    ... ency/patientinstructions/000787.htm Bile acid sequestrants for cholesterol To use the sharing features on this page, ... are medicines that help lower your LDL (bad) cholesterol . Too much cholesterol in your blood can stick ...

  1. Biopreservation by lactic acid bacteria.

    PubMed

    Stiles, M E

    1996-10-01

    Biopreservation refers to extended storage life and enhanced safety of foods using the natural microflora and (or) their antibacterial products. Lactic acid bacteria have a major potential for use in biopreservation because they are safe to consume and during storage they naturally dominate the microflora of many foods. In milk, brined vegetables, many cereal products and meats with added carbohydrate, the growth of lactic acid bacteria produces a new food product. In raw meats and fish that are chill stored under vacuum or in an environment with elevated carbon dioxide concentration, the lactic acid bacteria become the dominant population and preserve the meat with a "hidden' fermentation. The same applies to processed meats provided that the lactic acid bacteria survive the heat treatment or they are inoculated onto the product after heat treatment. This paper reviews the current status and potential for controlled biopreservation of foods. PMID:8879414

  2. Antibiofilm Properties of Acetic Acid

    PubMed Central

    Bjarnsholt, Thomas; Alhede, Morten; Jensen, Peter Østrup; Nielsen, Anne K.; Johansen, Helle Krogh; Homøe, Preben; Høiby, Niels; Givskov, Michael; Kirketerp-Møller, Klaus

    2015-01-01

    Bacterial biofilms are known to be extremely tolerant toward antibiotics and other antimicrobial agents. These biofilms cause the persistence of chronic infections. Since antibiotics rarely resolve these infections, the only effective treatment of chronic infections is surgical removal of the infected implant, tissue, or organ and thereby the biofilm. Acetic acid is known for its antimicrobial effect on bacteria in general, but has never been thoroughly tested for its efficacy against bacterial biofilms. In this article, we describe complete eradication of both Gram-positive and Gram-negative biofilms using acetic acid both as a liquid and as a dry salt. In addition, we present our clinical experience of acetic acid treatment of chronic wounds. In conclusion, we here present the first comprehensive in vitro and in vivo testing of acetic acid against bacterial biofilms. PMID:26155378

  3. Biotechnological production of citric acid

    PubMed Central

    Max, Belén; Salgado, José Manuel; Rodríguez, Noelia; Cortés, Sandra; Converti, Attilio; Domínguez, José Manuel

    2010-01-01

    This work provides a review about the biotechnological production of citric acid starting from the physicochemical properties and industrial applications, mainly in the food and pharmaceutical sectors. Several factors affecting citric acid fermentation are discussed, including carbon source, nitrogen and phosphate limitations, pH of culture medium, aeration, trace elements and morphology of the fungus. Special attention is paid to the fundamentals of biochemistry and accumulation of citric acid. Technologies employed at industrial scale such as surface or submerged cultures, mainly employing Aspergillus niger, and processes carried out with Yarrowia lipolytica, as well as the technology for recovering the product are also described. Finally, this review summarizes the use of orange peels and other by-products as feedstocks for the bioproduction of citric acid. PMID:24031566

  4. Simulated acid rain on crops

    SciTech Connect

    Plocher, M.D.; Perrigan, S.C.; Hevel, R.J.; Cooper, R.M.; Moss, D.N.

    1985-10-01

    In 1981, simulated H/sub 2/SO/sub 4/ acid rain was applied to alfalfa and tall fescue and a 2:1 ratio of H/sub 2/SO/sub 4/:HNO/sub 3/ acid rain was applied to alfalfa, tall fescue, barley, wheat, potato, tomato, radish, and corn crops growing in the open field at Corvallis, Oregon. Careful attention was given to effects of the acid rain on the appearance of the foliage, and the effects on yield were measured. Because the effect of pH 4.0 rain on corn yield was the only significant effect noted in the 1981 studies, in 1982, more-extensive studies of the effect of simulated H/sub 2/SO/sub 4//HNO/sub 3/ rain on corn were conducted. No significant effects of acid rain were found on foliage appearance, or on yield of grain or stover in the 1982 studies.

  5. [Treatment of hydrofluoric acid burns].

    PubMed

    Thiele, B; Winter, U J; Mahrle, G; Steigleder, G K

    1986-01-31

    A chemical-plant worker sustained hydrofluoric acid burns during cleaning procedures. Intra-arterial perfusion and intralesional injections of calcium gluconate solution prevented progression of the burns into deeper tissue layers. PMID:3943470

  6. Making cents of acid recovery

    SciTech Connect

    Ondrey, G.; Shanley, A.

    1993-04-01

    Acid recovery may be expensive, but rising transportation and landfill costs may soon make it the only alternative. Traditionally, acids used in processes from titanium dioxide production to gasoline alkylation and metal pickling were neutralized and discharged into waterways or injected into deep wells. Today, however, discharge permits are being phased out in many countries, and deep well injection is coming under closer scrutiny. An even cheaper option was selling spent acid to fertilizer producers, who used it to dissolve phosphate ores. Health concerns, a depressed fertilizer market and tightening disposal regulations for gypsum byproduct have dried up this option. The paper discusses the processes and costs involved in spent acid regeneration, gypsum-free gas treatments, and problems with explosive contaminants.

  7. EXPOSURE MODELING OF ACID AEROSOLS

    EPA Science Inventory

    The U.S. Environmental Protection Agency (EPA) is conducting an intensive characterization and human exposure monitoring program of acid species and related air pollutants in an urban environment. he EPA's Atmospheric Research and Exposure Assessment Laboratory (AREAL) in coopera...

  8. Phosphonic acid based exchange resins

    DOEpatents

    Horwitz, E.P.; Alexandratos, S.D.; Gatrone, R.C.; Chiarizia, R.

    1995-09-12

    An ion exchange resin is described for extracting metal ions from a liquid waste stream. An ion exchange resin is prepared by copolymerizing a vinylidene diphosphonic acid with styrene, acrylonitrile and divinylbenzene. 10 figs.

  9. Glucaric acids from Leonurus japonicus.

    PubMed

    Jiang, Jianshuang; Li, Yixiu; Feng, Ziming; Yang, Yanan; Zhang, Peicheng

    2015-12-01

    Three new glucaric acids, namely 2-feruloyl-4-syringoyl or 5-feruloyl-3-syringoyl glucaric acid (1), 2-syringoyl-4-feruloyl or 5-syringoyl-3-feruloyl glucaric acid (2), and 3-feruloyl-4-syringoyl or 4-feruloyl-3-syringoyl glucaric acid (3), were isolated from Leonurus japonicus Houtt. Their structures were elucidated by detailed spectroscopic means including UV, IR, HR-ESI-MS, 1D and 2D NMR data spectra. The bioactive assays of compounds 1-3 against hepatoprotection activity were determined. The result suggested that compound 2 exhibited a moderate hepatoprotection activity and the cell survival rate was 74% (10(-5)mol/L), using bicyclol (survival rate: 66%, 10(-5)mol/L) as a positive control. Furthermore, compounds 1-3 were evaluated cytotoxic activities in vitro using HCT-8, Bel-7402, BGC-823, A-549, and A2780 model and the results exhibited no obvious cytotoxicity activity. PMID:26526024

  10. Acid diffusion through polymer films

    NASA Astrophysics Data System (ADS)

    Zhang, P. Linda; Eckert, Andrew R.; Willson, C. Grant; Webber, Stephen E.; Byers, Jeffrey D.

    1997-07-01

    In order to perform 0.2 micrometer processes, one needs to study the diffusion of photoacid generators within the photoresist system, since diffusion during post exposure bake time has an influence on the critical dimension (CD). We have developed a new method to study the diffusion of photoacid generators within a polymer film. This new method is based on monitoring the change of the fluorescence intensity of a pH- sensitive fluorescent dye caused by the reaction with photoacid. A simplified version of this experiment has been conducted by introducing acid vapor to quench the fluorescence intensity of this pH sensor. A thin polymer film is spin cast onto the sensor to create a barrier to the acid diffusion process. During the acid diffusion process, the fluorescence intensity of this pH sensor is measured in situ, using excitation and emission wavelengths at 466 nm and 516 nm, respectively. Fluoresceinamine, the pH sensitive fluorescent dye, is covalently bonded onto the treated quartz substrate to form a single dye layer. Poly(hydroxystyrene) (Mn equals 13k, Tg equals 180 degrees Celsius) in PGMEA (5% - 18% by weight) is spin cast onto this quartz substrate to form films with varying thickness. The soft bake time is 60 seconds at 90 degrees Celsius and a typical film has a thickness of 1.4 micrometers. Trifluoroacetic acid is introduced into a small chamber while the fluorescence from this quartz window is observed. Our study focuses on finding the diffusion constant of the vaporized acid (trifluoroacetic acid) in the poly(hydroxystyrene) polymer film. By applying the Fick's second law, (It - Io)/(I(infinity ) - Io) equals erfc [L/(Dt)1/2] is obtained. The change of fluorescence intensity with respect to the diffusion time is monitored. The above equation is used for the data analysis, where L represents the film thickness and t represents the average time for the acid to diffuse through the film. The diffusion constant is calculated to be at the order of 10

  11. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  12. 21 CFR 184.1091 - Succinic acid.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Succinic acid. 184.1091 Section 184.1091 Food and... Substances Affirmed as GRAS § 184.1091 Succinic acid. (a) Succinic acid (C4H6O4, CAS Reg. No. 110-15-6), also referred to as amber acid and ethylenesuccinic acid, is the chemical 1,4-butanedioic acid. It...

  13. 21 CFR 184.1009 - Adipic acid.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Adipic acid. 184.1009 Section 184.1009 Food and....1009 Adipic acid. (a) Adipic acid (C6H10O4, CAS Reg. No. 00124-04-9) is also known as 1,4-butanedicarboxylic acid or hexane-dioic acid. It is prepared by nitric acid oxidation of cyclohexanol...

  14. 21 CFR 184.1091 - Succinic acid.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Succinic acid. 184.1091 Section 184.1091 Food and... Substances Affirmed as GRAS § 184.1091 Succinic acid. (a) Succinic acid (C4H6O4, CAS Reg. No. 110-15-6), also referred to as amber acid and ethylenesuccinic acid, is the chemical 1,4-butanedioic acid. It...

  15. 21 CFR 184.1009 - Adipic acid.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Adipic acid. 184.1009 Section 184.1009 Food and... Substances Affirmed as GRAS § 184.1009 Adipic acid. (a) Adipic acid (C6H10O4, CAS Reg. No. 00124-04-9) is also known as 1,4-butanedicarboxylic acid or hexane-dioic acid. It is prepared by nitric acid...

  16. 21 CFR 184.1091 - Succinic acid.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Succinic acid. 184.1091 Section 184.1091 Food and... Substances Affirmed as GRAS § 184.1091 Succinic acid. (a) Succinic acid (C4H6O4, CAS Reg. No. 110-15-6), also referred to as amber acid and ethylenesuccinic acid, is the chemical 1,4-butanedioic acid. It...

  17. 21 CFR 184.1091 - Succinic acid.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Succinic acid. 184.1091 Section 184.1091 Food and... Substances Affirmed as GRAS § 184.1091 Succinic acid. (a) Succinic acid (C4H6O4, CAS Reg. No. 110-15-6), also referred to as amber acid and ethylenesuccinic acid, is the chemical 1,4-butanedioic acid. It...

  18. 21 CFR 184.1009 - Adipic acid.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Adipic acid. 184.1009 Section 184.1009 Food and... Substances Affirmed as GRAS § 184.1009 Adipic acid. (a) Adipic acid (C6H10O4, CAS Reg. No. 00124-04-9) is also known as 1,4-butanedicarboxylic acid or hexane-dioic acid. It is prepared by nitric acid...

  19. 21 CFR 184.1091 - Succinic acid.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Succinic acid. 184.1091 Section 184.1091 Food and....1091 Succinic acid. (a) Succinic acid (C4H6O4, CAS Reg. No. 110-15-6), also referred to as amber acid and ethylenesuccinic acid, is the chemical 1,4-butanedioic acid. It is commercially prepared...

  20. 40 CFR 721.10512 - Fatty acid maleic acid amides (generic).

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Fatty acid maleic acid amides (generic... Specific Chemical Substances § 721.10512 Fatty acid maleic acid amides (generic). (a) Chemical substance... fatty acid maleic acid amides (PMNs P-07-563 and P-07-564) are subject to reporting under this...

  1. 40 CFR 721.10512 - Fatty acid maleic acid amides (generic).

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Fatty acid maleic acid amides (generic... Specific Chemical Substances § 721.10512 Fatty acid maleic acid amides (generic). (a) Chemical substance... fatty acid maleic acid amides (PMNs P-07-563 and P-07-564) are subject to reporting under this...

  2. 21 CFR 172.862 - Oleic acid derived from tall oil fatty acids.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Oleic acid derived from tall oil fatty acids. 172... FOOD FOR HUMAN CONSUMPTION Multipurpose Additives § 172.862 Oleic acid derived from tall oil fatty acids. The food additive oleic acid derived from tall oil fatty acids may be safely used in food and...

  3. 21 CFR 172.862 - Oleic acid derived from tall oil fatty acids.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Oleic acid derived from tall oil fatty acids. 172... FOOD FOR HUMAN CONSUMPTION Multipurpose Additives § 172.862 Oleic acid derived from tall oil fatty acids. The food additive oleic acid derived from tall oil fatty acids may be safely used in food and...

  4. 21 CFR 172.862 - Oleic acid derived from tall oil fatty acids.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Oleic acid derived from tall oil fatty acids. 172... FOOD FOR HUMAN CONSUMPTION Multipurpose Additives § 172.862 Oleic acid derived from tall oil fatty acids. The food additive oleic acid derived from tall oil fatty acids may be safely used in food and...

  5. 21 CFR 172.862 - Oleic acid derived from tall oil fatty acids.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Oleic acid derived from tall oil fatty acids. 172... FOOD FOR HUMAN CONSUMPTION Multipurpose Additives § 172.862 Oleic acid derived from tall oil fatty acids. The food additive oleic acid derived from tall oil fatty acids may be safely used in food and...

  6. Aqueous Photochemistry of Glyoxylic Acid.

    PubMed

    Eugene, Alexis J; Xia, Sha-Sha; Guzman, Marcelo I

    2016-06-01

    Aerosols affect climate change, the energy balance of the atmosphere, and public health due to their variable chemical composition, size, and shape. While the formation of secondary organic aerosols (SOA) from gas phase precursors is relatively well understood, studying aqueous chemical reactions contributing to the total SOA budget is the current focus of major attention. Field measurements have revealed that mono-, di-, and oxo-carboxylic acids are abundant species present in SOA and atmospheric waters. This work explores the fate of one of these 2-oxocarboxylic acids, glyoxylic acid, which can photogenerate reactive species under solar irradiation. Additionally, the dark thermal aging of photoproducts is studied by UV-visible and fluorescence spectroscopies to reveal that the optical properties are altered by the glyoxal produced. The optical properties display periodicity in the time domain of the UV-visible spectrum of chromophores with absorption enhancement (thermochromism) or loss (photobleaching) during nighttime and daytime cycles, respectively. During irradiation, excited state glyoxylic acid can undergo α-cleavage or participate in hydrogen abstractions. The use of (13)C nuclear magnetic resonance spectroscopy (NMR) analysis shows that glyoxal is an important intermediate produced during direct photolysis. Glyoxal quickly reaches a quasi-steady state as confirmed by UHPLC-MS analysis of its corresponding (E) and (Z) 2,4-dinitrophenylhydrazones. The homolytic cleavage of glyoxylic acid is proposed as a fundamental step for the production of glyoxal. Both carbon oxides, CO2(g) and CO(g) evolving to the gas-phase, are quantified by FTIR spectroscopy. Finally, formic acid, oxalic acid, and tartaric acid photoproducts are identified by ion chromatography (IC) with conductivity and electrospray (ESI) mass spectrometry (MS) detection and (1)H NMR spectroscopy. A reaction mechanism is proposed based on all experimental observations. PMID:27192089

  7. Chemical composition of acid fog

    SciTech Connect

    Waldman, J.M.; Munger, J.W.; Jacob, D.J.; Flagan, R.C.; Morgan, J.J.; Hoffmann, M.R.

    1982-11-12

    Fog water collected at three sites in Los Angeles and Bakersfield, California, was found to have higher acidity and higher concentrations of sulfate, nitrate, and ammonium than previously observed in atmospheric water droplets. The pH of the fog water was in the range of 2.2 to 4.0. the dominant processes controlling the fog water chemistry appear to be the condensation and evaporation of water vapor on preexisting aerosol and the scavenging of gas-phase nitric acid.

  8. Bile acids as metabolic regulators

    PubMed Central

    Li, Tiangang; Chiang, John Y. L.

    2015-01-01

    Summary Small molecule ligands that target to TGR5 and FXR have shown promise in treating various metabolic and inflammation-related human diseases. New insights into the mechanisms underlying the bariatric surgery and bile acid sequestrant treatment suggest that targeting the enterohepatic circulation to modulate gut-liver bile acid signaling, incretin production and microbiota represents a new strategy to treat obesity and type-2 diabetes. PMID:25584736

  9. Acidic extracellular microenvironment and cancer

    PubMed Central

    2013-01-01

    Acidic extracellular pH is a major feature of tumor tissue, extracellular acidification being primarily considered to be due to lactate secretion from anaerobic glycolysis. Clinicopathological evidence shows that transporters and pumps contribute to H+ secretion, such as the Na+/H+ exchanger, the H+-lactate co-transporter, monocarboxylate transporters, and the proton pump (H+-ATPase); these may also be associated with tumor metastasis. An acidic extracellular pH not only activates secreted lysosomal enzymes that have an optimal pH in the acidic range, but induces the expression of certain genes of pro-metastatic factors through an intracellular signaling cascade that is different from hypoxia. In addition to lactate, CO2 from the pentose phosphate pathway is an alternative source of acidity, showing that hypoxia and extracellular acidity are, while being independent from each other, deeply associated with the cellular microenvironment. In this article, the importance of an acidic extracellular pH as a microenvironmental factor participating in tumor progression is reviewed. PMID:24004445

  10. Photodissociation dynamics of hydroxybenzoic acids

    SciTech Connect

    Yang Yilin; Dyakov, Yuri; Lee, Y. T.; Ni, Chi-Kung; Sun Yilun; Hu Weiping

    2011-01-21

    Aromatic amino acids have large UV absorption cross-sections and low fluorescence quantum yields. Ultrafast internal conversion, which transforms electronic excitation energy to vibrational energy, was assumed to account for the photostability of amino acids. Recent theoretical and experimental investigations suggested that low fluorescence quantum yields of phenol (chromophore of tyrosine) are due to the dissociation from a repulsive excited state. Radicals generated from dissociation may undergo undesired reactions. It contradicts the observed photostability of amino acids. In this work, we explored the photodissociation dynamics of the tyrosine chromophores, 2-, 3- and 4-hydroxybenzoic acid in a molecular beam at 193 nm using multimass ion imaging techniques. We demonstrated that dissociation from the excited state is effectively quenched for the conformers of hydroxybenzoic acids with intramolecular hydrogen bonding. Ab initio calculations show that the excited state and the ground state potential energy surfaces change significantly for the conformers with intramolecular hydrogen bonding. It shows the importance of intramolecular hydrogen bond in the excited state dynamics and provides an alternative molecular mechanism for the photostability of aromatic amino acids upon irradiation of ultraviolet photons.

  11. Evaluation of ascorbic acid in protecting labile folic acid derivatives.

    PubMed Central

    Wilson, S D; Horne, D W

    1983-01-01

    The use of ascorbic acid as a reducing agent to protect labile, reduced derivatives of folic acid has been evaluated by high-performance liquid chromatographic separations and Lactobacillus casei microbiological assay of eluate fractions. Upon heating for 10 min at 100 degrees C, solutions of tetrahydropteroylglutamic acid (H4PteGlu) in 2% sodium ascorbate gave rise to 5,10-methylene-H4PteGlu and 5-methyl-H4PteGlu. H2PteGlu acid gave rise to 5-methyl-H4PteGlu and PteGlu. 10-Formyl-H4PteGlu gave rise to 5-formyl-H4PteGlu and 10-formyl-PteGlu. 5-Formyl-H4-PteGlu gave rise to a small amount of 10-formyl-PteGlu. 5-Methyl-H4PteGlu and PteGlu appeared stable to these conditions. These interconversions were not seen when solutions of these folate derivatives were kept at 0 degrees C in 1% ascorbate. These observations indicate that elevated temperatures are necessary for the interconversions of folates in ascorbate solutions. Assays of ascorbic acid solutions indicated the presence of formaldehyde (approximately equal to 6 mM). This was confirmed by the identification of 3,5-diacetyl-1,4-dihydrolutidine by UV, visible, and fluorescence spectroscopy and by thin-layer chromatography of chloroform extracts of the reaction mixture of ascorbic acid solutions, acetylacetone, and ammonium acetate. These results indicate that solutions of sodium ascorbate used at elevated temperatures are not suitable for extracting tissue for the subsequent assay of the individual folic acid derivatives. PMID:6415653

  12. Gas-Phase Acidities of Phosphorylated Amino Acids.

    PubMed

    Stover, Michele L; Plummer, Chelsea E; Miller, Sean R; Cassady, Carolyn J; Dixon, David A

    2015-11-19

    Gas-phase acidities and heats of formation have been predicted at the G3(MP2)/SCRF-COSMO level of theory for 10 phosphorylated amino acids and their corresponding amides, including phospho-serine (pSer), -threonine (pThr), and -tyrosine (pTyr), providing the first reliable set of these values. The gas-phase acidities (GAs) of the three named phosphorylated amino acids and their amides have been determined using proton transfer reactions in a Fourier transform ion cyclotron mass spectrometer. Excellent agreement was found between the experimental and predicted GAs. The phosphate group is the deprotonation site for pSer and pThr and deprotonation from the carboxylic acid generated the lowest energy anion for pTyr. The infrared spectra were calculated for six low energy anions of pSer, pThr, and pTyr. For deprotonated pSer and pThr, good agreement is found between the experimental IRMPD spectra and the calculated spectra for our lowest energy anion structure. For pTyr, the IR spectra for a higher energy phosphate deprotonated structure is in good agreement with experiment. Additional experiments tested electrospray ionization (ESI) conditions for pTyr and determined that variations in solvent, temperature, and voltage can result in a different experimental GA value, indicating that ESI conditions affect the conformation of the pTyr anion. PMID:26492552

  13. Recovery of uranium from acid media by macroporous bifunctional phosphinic acid resin

    SciTech Connect

    Sabharwal, K.N.; Srinivasan, T.G.; Rao, P.R.V.; Nandy, K.K.

    1996-11-01

    The extraction of uranium from various acid media such as nitric acid, sulphuric acid, hydrochloric acid, phosphoric acid and perchloric acid by a macroporous bifunctional phosphinic acid resin (MPBPA) has been studied. The distribution coefficients for the extraction of uranium by the MPBPA resin are compared with the corresponding values reported in literature for the conventional sulphonic acid resin. The results clearly indicate the suitability of the MPBPA resin to recover uranium from different types of acid solutions of widely ranging acidities. 17 refs., 6 figs., 5 tabs.

  14. Extractive fermentation of acetic acid

    SciTech Connect

    Busche, R.M.

    1991-12-31

    In this technoeconomic evaluation of the manufacture of acetic acid by fermentation, the use of the bacterium: Acetobacter suboxydans from the old vinegar process was compared with expected performance of the newer Clostridium thermoaceticum bacterium. Both systems were projected to operate as immobilized cells in a continuous, fluidized bed bioreactor, using solvent extraction to recover the product. Acetobacter metabolizes ethanol aerobically to produce acid at 100 g/L in a low pH medium. This ensures that the product is in the form of a concentrated extractable free acid, rather than as an unextractable salt. Unfortunately, yields from glucose by way of the ethanol fermentation are poor, but near the biological limits of the organisms involved. Conversely, C. thermoaceticum is a thermophilic anaerobe that operates at high fermentation rates on glucose at neutral pH to produce acetate salts directly in substantially quantitative yields. However, it is severely inhibited by product, which restricts concentration to a dilute 20 g/L. An improved Acetobacter system operating with recycled cells at 50 g/L appears capable of producing acid at $0.38/lb, as compared with a $0.29/lb price for synthetic acid. However, this system has only a limited margin for process improvement. The present Clostridium system cannot compete, since the required selling price would be $0.42/lb. However, if the organism could be adapted to tolerate higher product concentrations at acid pH, selling price could be reduced to $0.22/lb, or about 80% of the price of synthetic acid.

  15. Anaerobic biotransformation of organoarsenical pesticides monomethylarsonic acid and dimethylarsinic acid

    USGS Publications Warehouse

    Sierra-Alvarez, R.; Yenal, U.; Feld, J.A.; Kopplin, M.; Gandolfi, A.J.; Garbarino, J.R.

    2006-01-01

    Monomethylarsonic acid (MMAV) and dimethylarsinic acid (DMAV) are extensively utilized as pesticides, introducing large quantities of arsenic into the environment. Once released into the environment, these organoarsenicals are subject to microbial reactions. Aerobic biodegradation of MMAV and DMAV has been evaluated, but little is known about their fate in anaerobic environments. The objective of this study was to evaluate the biotransformation of MMAV and DMAV in anaerobic sludge. Biologically mediated conversion occurred under methanogenic or sulfate-reducing conditions but not in the presence of nitrate. Monomethylarsonous acid (MMAIII) was consistently observed as an important metabolite of MMAV degradation, and it was recovered in molar yields ranging from 5 to 47%. The main biotransformation product identified from DMAV metabolism was MMAV, which was recovered in molar yields ranging from 8 to 65%. The metabolites indicate that reduction and demethylation are important steps in the anaerobic bioconversion of MMAV and DMAV, respectively. ?? 2006 American Chemical Society.

  16. Arterial Blood Carbonic Acid Inversely Determines Lactic and Organic Acids

    PubMed Central

    Aiken, Christopher Geoffrey Alexander

    2013-01-01

    Objective: To establish that arterial blood carbonic acid varies inversely with lactic acid in accordance with bicarbonate exchanging for lactate across cell membranes through the anion exchange mechanism to maintain the Gibbs-Donnan equilibrium. Study Design: Over 5 years, lactate was measured on all blood gases taken from neonatal admissions, as well as organic acid whenever electrolytes were required. Results: Arterial blood gases from 63 infants given high calcium TPN were analyzed. Twenty two needed continuous positive airways pressure (CPAP) only and 31 intermittent positive pressure ventilation (IPPV) and surfactant followed by CPAP to treat respiratory distress syndrome in 51 and meconium aspiration syndrome in 2. All survived and were free of infection. Excluded gases were those with high and falling lactate soon after delivery representing perinatal asphyxia, and those on dexamethasone. Strong inverse relations between carbonic and lactic acids were found at all gestational ages and, independent of glomerular filtration, between carbonic and organic acids. Lactate (mmol/L) = 62.53 X PCO2 -0.96(mmHg) r2 0.315, n 1232, p <0.001. Sixty divided by PCO2 is a convenient measure of physiological lactate at any given PCO2. In the first week, 9.13 ± 2.57% of arterial gases from infants on IPPV had lactates above 120/PCO2, significantly more than 4.74 ± 2.73% on CPAP (p<0.05) and 2.47 ± 2.39% on no support. Conclusion: Changes in arterial blood carbonic acid cause immediate inverse changes in lactic acid, because their anions interchange across cell membranes according to the Gibbs –Donnan equilibrium. Increasing PCO2 from 40 to 120 mmHg decreased lactate from 1.5 mmol/L to 0.5 mmol/L, so that the sum of carbonic and lactic acids increased from 2.72 mmol/L to only 4.17 mmol/L. This helps explain the neuroprotective effect of hypercapnoea and highlights the importance of avoiding any degree of hypocapnoea in infants on IPPV. PMID:24392387

  17. Gallic Acid, Ellagic Acid and Pyrogallol Reaction with Metallic Iron

    NASA Astrophysics Data System (ADS)

    Jaén, J. A.; González, L.; Vargas, A.; Olave, G.

    2003-06-01

    The reaction between gallic acid, ellagic acid and pyrogallol with metallic iron was studied using infrared and Mössbauer spectroscopy. Most hydrolysable tannins with interesting anticorrosive or inhibition properties are structurally related to these compounds, thus they may be used as models for the study of hydrolysable tannins and related polyphenols. The interaction was followed up to 3 months. Results indicated two different behaviors. At polyphenol concentrations higher than 1% iron converts to sparingly soluble and amorphous ferric (and ferrous) polyphenolate complexes. At lower concentrations (0.1%), the hydrolysis reactions are dominant, resulting in the formation of oxyhydroxides, which can be further reduced to compounds like magnetite by the polyphenols.

  18. Gibberellic acid stimulates acid invertase secretion in pea ovary protoplasts.

    PubMed

    Estruch, J J; Beltrán, J P

    1991-02-25

    Protoplasts purified from mesocarp of nonpollinated pea (Pisum sativum L.) ovaries released acid invertase to the incubation medium. The association of the acid invertase with microsomal fractions, and the sensitivity to energy-metabolism inhibitors and to tunicamycin, indicated the secretory nature of the release process. In the presence of GA3 (10 microM), the protoplasts increased their invertase secretion at about 60 min, this effect being counteracted by tunicamycin but not by cycloheximide. Subcellular fractionation of GA3-treated protoplasts showed that higher invertase secretion was the result of a promotion of invertase transfer from endoplasmic reticulum (ER) to Golgi apparatus. PMID:2001743

  19. Structural features of lignohumic acids

    NASA Astrophysics Data System (ADS)

    Novák, František; Šestauberová, Martina; Hrabal, Richard

    2015-08-01

    The composition and structure of humic acids isolated from lignohumate, which is produced by hydrolytic-oxidative conversion of technical lignosulfonates, were characterized by chemical and spectral methods (UV/VIS, FTIR, and 13C NMR spectroscopy). As comparative samples, humic acids (HA) were isolated also from lignite and organic horizon of mountain spruce forest soil. When compared with other HA studied, the lignohumate humic acids (LHHA) contained relatively few carboxyl groups, whose role is partly fulfilled by sulfonic acid groups. Distinctive 13C NMR signal of methoxyl group carbons, typical for lignin and related humic substances, was found at the shift of 55.9 ppm. Other alkoxy carbons were present in limited quantity, like the aliphatic carbons. Due to the low content of these carbon types, the LHHA has high aromaticity of 60.6%. Comparison with the natural HA has shown that lignohumate obtained by thermal processing of technical lignosulfonate can be regarded as an industrially produced analog of natural humic substances. Based on the chemical and spectral data evaluation, structural features of lignohumate humic acids were clarified and their hypothetical chemical structure proposed, which described typical "average" properties of the isolated fraction.

  20. Isothermal Amplification of Nucleic Acids.

    PubMed

    Zhao, Yongxi; Chen, Feng; Li, Qian; Wang, Lihua; Fan, Chunhai

    2015-11-25

    Isothermal amplification of nucleic acids is a simple process that rapidly and efficiently accumulates nucleic acid sequences at constant temperature. Since the early 1990s, various isothermal amplification techniques have been developed as alternatives to polymerase chain reaction (PCR). These isothermal amplification methods have been used for biosensing targets such as DNA, RNA, cells, proteins, small molecules, and ions. The applications of these techniques for in situ or intracellular bioimaging and sequencing have been amply demonstrated. Amplicons produced by isothermal amplification methods have also been utilized to construct versatile nucleic acid nanomaterials for promising applications in biomedicine, bioimaging, and biosensing. The integration of isothermal amplification into microsystems or portable devices improves nucleic acid-based on-site assays and confers high sensitivity. Single-cell and single-molecule analyses have also been implemented based on integrated microfluidic systems. In this review, we provide a comprehensive overview of the isothermal amplification of nucleic acids encompassing work published in the past two decades. First, different isothermal amplification techniques are classified into three types based on reaction kinetics. Then, we summarize the applications of isothermal amplification in bioanalysis, diagnostics, nanotechnology, materials science, and device integration. Finally, several challenges and perspectives in the field are discussed. PMID:26551336