Science.gov

Sample records for 4-phenylbutyric acid pba

  1. 4-Phenylbutyric Acid (4-PBA) and Lithium Cooperatively Attenuate Cell Death during Oxygen-Glucose Deprivation (OGD) and Reoxygenation.

    PubMed

    Tung, Wai-Fai; Chen, Wei-Jen; Hung, Hui-Chih; Liu, Guang-Yaw; Tung, Jai-Nien; Huang, Chien-Chih; Lin, Chih-Li

    2015-08-01

    Hypoxia is an important cause of brain injury in ischemic stroke. It is known that endoplasmic reticulum (ER) stress is an important determinant of cell survival or death during hypoxia. However, the signaling pathways and molecular mechanisms involved remain to be studied in more detail. To investigate whether inhibition of ER stress promotes neuroprotection pathways, we applied an in vitro oxygen-glucose deprivation (OGD) followed by reoxygenation model of human SK-N-MC neuronal cell cultures in this study. Our results showed that neuronal cell death was induced in this model during the OGD reoxygenation by the sustained ER stress, but not during OGD phase. However, treatment of the cultures with lithium with the OGD reoxygenation insult did not result in neuroprotection, whereas concomitant treatment of chemical chaperon 4-phenylbutyric acid (4-PBA) provides protective effects in ER stress-exposed cells. Moreover, 4-PBA rescued ER stress-suppressed Akt protein biosynthesis, which works cooperatively with lithium in the activation of Akt downstream signaling by inhibition of autophagy-induced cell death. Taken together, our finding provides a possible mechanism by which 4-PBA and lithium contribute to mediate neuroprotection cooperatively. This result may potentially be a useful therapeutic strategy for ischemic stroke.

  2. Evaluation of synthetic naphthalene derivatives as novel chemical chaperones that mimic 4-phenylbutyric acid.

    PubMed

    Mimori, Seisuke; Koshikawa, Yukari; Mashima, Yu; Mitsunaga, Katsuyoshi; Kawada, Koichi; Kaneko, Masayuki; Okuma, Yasunobu; Nomura, Yasuyuki; Murakami, Yasuoki; Kanzaki, Tetsuto; Hamana, Hiroshi

    2015-02-15

    The chemical chaperone 4-phenylbutyric acid (4-PBA) has potential as an agent for the treatment of neurodegenerative diseases. However, the requirement of high concentrations warrants chemical optimization for clinical use. In this study, novel naphthalene derivatives with a greater chemical chaperone activity than 4-PBA were synthesized with analogy to the benzene ring. All novel compounds showed chemical chaperone activity, and 2 and 5 possessed high activity. In subsequent experiments, the protective effects of the compounds were examined in Parkinson's disease model cells, and low toxicity of 9 and 11 was related to amphiphilic substitution with naphthalene.

  3. 4-Phenylbutyric Acid Induces Protection against Pulmonary Arterial Hypertension in Rats

    PubMed Central

    Long, Mei; Wang, Jie; Liu, Fen; Gai, Min-Tao; Aierken, Alidan; Li, Ming-Yuan; Li, Qian; Wu, Lei-Qi; Ma, Yi-Tong; Hujiaaihemaiti, Minawaer

    2016-01-01

    Background Endoplasmic reticulum (ER) stress has been implicated in the pathophysiology of various pulmonary diseases via the activation of the unfolded protein response. However, the role of ER stress in pulmonary arterial hypertension (PAH) remains unclear. The well-known chemical chaperone 4-phenylbutyric acid (4-PBA) inhibits ER stress signaling. We hypothesized that known chemical chaperones, including 4-PBA, would inhibit the activation of ER stress and prevent and/or reverse PAH. Methods and Results Male Wistar rats were randomly divided into four groups: a normal control group (NORMAL group), a PAH group, and two PAH model plus 4-PBA treatment groups. The latter two groups included rats receiving 4-PBA by gavage each day as a preventive measure (the PRE group, with PBA starting on the day of PAH induction and continuing for 4 weeks) or as a reversal measure (the REV group, with PBA starting on the third week of PAH induction and continuing for 2 weeks). The PAH model was induced by intraperitoneally administering monocrotaline. The mean pulmonary artery pressure and mean right ventricular pressure were lower in the REV and PRE groups than in the NORMAL group. Furthermore, 4-PBA improved pulmonary arterial remodeling and suppressed the expression of ER stress indicators. Conclusion Our findings indicate that PAH induces ER stress and provokes pulmonary arterial and right ventricular remodeling. Additionally, we show that attenuation of ER stress has the potential to be an effective therapeutic strategy for protecting pulmonary arteries. PMID:27304885

  4. 4-Phenylbutyric Acid Attenuates Pancreatic Beta-Cell Injury in Rats with Experimental Severe Acute Pancreatitis

    PubMed Central

    Guo, Wen-yi; Zhao, Liang; Xiang, Ming-wei; Mei, Fang-chao; Abliz, Ablikim; Hu, Peng; Deng, Wen-hong; Yu, Jia

    2016-01-01

    Endoplasmic reticulum (ER) stress is a particular process with an imbalance of homeostasis, which plays an important role in pancreatitis, but little is known about how ER stress is implicated in severe acute pancreatitis (SAP) induced pancreatic beta-cell injury. To investigate the effect of 4-phenylbutyric acid (4-PBA) on the beta-cell injury following SAP and the underlying mechanism, twenty-four Sprague-Dawley rats were randomly divided into sham-operation (SO) group, SAP model group, and 4-PBA treatment group. SAP model was induced by infusion of 5% sodium taurocholate into the biliopancreatic duct. 4-PBA or normal saline was injected intraperitoneally for 3 days in respective group before successful modeling. Results showed that 4-PBA attenuated the following: (1) pancreas and islet pathological injuries, (2) serum TNF-α and IL-1β, (3) serum insulin and glucose, (4) beta-cell ultrastructural changes, (5) ER stress markers (BiP, ORP150, and CHOP), Caspase-3, and insulin expression in islet. These results suggested that 4-PBA mitigates pancreatic beta-cell injury and endocrine disorder in SAP, presumably because of its role in inhibiting excessive endoplasmic reticulum stress. This may serve as a new therapeutic target for reducing pancreatic beta-cell injury and endocrine disorder in SAP upon 4-PBA treatment.

  5. 4-Phenylbutyric Acid Attenuates Pancreatic Beta-Cell Injury in Rats with Experimental Severe Acute Pancreatitis

    PubMed Central

    Guo, Wen-yi; Zhao, Liang; Xiang, Ming-wei; Mei, Fang-chao; Abliz, Ablikim; Hu, Peng; Deng, Wen-hong; Yu, Jia

    2016-01-01

    Endoplasmic reticulum (ER) stress is a particular process with an imbalance of homeostasis, which plays an important role in pancreatitis, but little is known about how ER stress is implicated in severe acute pancreatitis (SAP) induced pancreatic beta-cell injury. To investigate the effect of 4-phenylbutyric acid (4-PBA) on the beta-cell injury following SAP and the underlying mechanism, twenty-four Sprague-Dawley rats were randomly divided into sham-operation (SO) group, SAP model group, and 4-PBA treatment group. SAP model was induced by infusion of 5% sodium taurocholate into the biliopancreatic duct. 4-PBA or normal saline was injected intraperitoneally for 3 days in respective group before successful modeling. Results showed that 4-PBA attenuated the following: (1) pancreas and islet pathological injuries, (2) serum TNF-α and IL-1β, (3) serum insulin and glucose, (4) beta-cell ultrastructural changes, (5) ER stress markers (BiP, ORP150, and CHOP), Caspase-3, and insulin expression in islet. These results suggested that 4-PBA mitigates pancreatic beta-cell injury and endocrine disorder in SAP, presumably because of its role in inhibiting excessive endoplasmic reticulum stress. This may serve as a new therapeutic target for reducing pancreatic beta-cell injury and endocrine disorder in SAP upon 4-PBA treatment. PMID:27656209

  6. 4-Phenylbutyric Acid Attenuates Pancreatic Beta-Cell Injury in Rats with Experimental Severe Acute Pancreatitis.

    PubMed

    Hong, Yu-Pu; Guo, Wen-Yi; Wang, Wei-Xing; Zhao, Liang; Xiang, Ming-Wei; Mei, Fang-Chao; Abliz, Ablikim; Hu, Peng; Deng, Wen-Hong; Yu, Jia

    2016-01-01

    Endoplasmic reticulum (ER) stress is a particular process with an imbalance of homeostasis, which plays an important role in pancreatitis, but little is known about how ER stress is implicated in severe acute pancreatitis (SAP) induced pancreatic beta-cell injury. To investigate the effect of 4-phenylbutyric acid (4-PBA) on the beta-cell injury following SAP and the underlying mechanism, twenty-four Sprague-Dawley rats were randomly divided into sham-operation (SO) group, SAP model group, and 4-PBA treatment group. SAP model was induced by infusion of 5% sodium taurocholate into the biliopancreatic duct. 4-PBA or normal saline was injected intraperitoneally for 3 days in respective group before successful modeling. Results showed that 4-PBA attenuated the following: (1) pancreas and islet pathological injuries, (2) serum TNF-α and IL-1β, (3) serum insulin and glucose, (4) beta-cell ultrastructural changes, (5) ER stress markers (BiP, ORP150, and CHOP), Caspase-3, and insulin expression in islet. These results suggested that 4-PBA mitigates pancreatic beta-cell injury and endocrine disorder in SAP, presumably because of its role in inhibiting excessive endoplasmic reticulum stress. This may serve as a new therapeutic target for reducing pancreatic beta-cell injury and endocrine disorder in SAP upon 4-PBA treatment. PMID:27656209

  7. Ursodeoxycholic acid and 4-phenylbutyrate prevent endoplasmic reticulum stress-induced podocyte apoptosis in diabetic nephropathy.

    PubMed

    Cao, Ai-Li; Wang, Li; Chen, Xia; Wang, Yun-Man; Guo, Heng-Jiang; Chu, Shuang; Liu, Cheng; Zhang, Xue-Mei; Peng, Wen

    2016-06-01

    Endoplasmic reticulum (ER) stress, resulting from the accumulation of misfolded and/or unfolded proteins in ER membranes, is involved in the pathogenesis of diabetic nephropathy (DN). The aim of this study was to investigate the role of ER stress inhibitors ursodeoxycholic acid (UDCA) and 4-phenylbutyrate (4-PBA) in the treatment of DN in db/db mice. Findings have revealed that diabetic db/db mice were more hyperglycemic than their non-diabetic controls, and exhibited a marked increase in body weight, water intake, urine volume, fasting plasma glucose, systolic blood pressure, glucose and insulin tolerance. UDCA (40 mg/kg/day) or 4-PBA (100 mg/kg/day) treatment for 12 weeks resulted in an improvement in these biochemical and physical parameters. Moreover, UDCA or 4-PBA intervention markedly decreased urinary albuminuria and attenuated mesangial expansion in diabetic db/db mice, compared with db/db mice treated with vehicle. These beneficial effects of UDCA or 4-PBA on DN were associated with the inhibition of ER stress, as evidenced by the decreased expression of BiP, phospho-IRE1α, phospho-eIF2α, CHOP, ATF-6 and spliced X-box binding protein-1 in vitro and in vivo. UDCA or 4-PBA prevented hyperglycemia-induced or high glucose (HG)-induced apoptosis in podocytes in vivo and in vitro via the inhibition of caspase-3 and caspase-12 activation. Autophagy deficiency was also seen in glomeruli in diabetic mice and HG-incubated podocytes, exhibiting decreased expression of LC3B and Beclin-1, which could be restored by UDCA or 4-PBA treatment. Taken together, our results have revealed an important role of ER stress in the development of DN, and UDCA or 4-PBA treatment may be a potential novel therapeutic approach for the treatment of DN. PMID:26999661

  8. Evidence that Chemical Chaperone 4-Phenylbutyric Acid Binds to Human Serum Albumin at Fatty Acid Binding Sites

    PubMed Central

    James, Joel; Shihabudeen, Mohamed Sham; Kulshrestha, Shweta; Goel, Varun; Thirumurugan, Kavitha

    2015-01-01

    Endoplasmic reticulum stress elicits unfolded protein response to counteract the accumulating unfolded protein load inside a cell. The chemical chaperone, 4-Phenylbutyric acid (4-PBA) is a FDA approved drug that alleviates endoplasmic reticulum stress by assisting protein folding. It is found efficacious to augment pathological conditions like type 2 diabetes, obesity and neurodegeneration. This study explores the binding nature of 4-PBA with human serum albumin (HSA) through spectroscopic and molecular dynamics approaches, and the results show that 4-PBA has high binding specificity to Sudlow Site II (Fatty acid binding site 3, subdomain IIIA). Ligand displacement studies, RMSD stabilization profiles and MM-PBSA binding free energy calculation confirm the same. The binding constant as calculated from fluorescence spectroscopic studies was found to be kPBA = 2.69 x 105 M-1. Like long chain fatty acids, 4-PBA induces conformational changes on HSA as shown by circular dichroism, and it elicits stable binding at Sudlow Site II (fatty acid binding site 3) by forming strong hydrogen bonding and a salt bridge between domain II and III of HSA. This minimizes the fluctuation of HSA backbone as shown by limited conformational space occupancy in the principal component analysis. The overall hydrophobicity of W214 pocket (located at subdomain IIA), increases upon occupancy of 4-PBA at any FA site. Descriptors of this pocket formed by residues from other subdomains largely play a role in compensating the dynamic movement of W214. PMID:26181488

  9. Attenuation of endoplasmic reticulum stress using the chemical chaperone 4-phenylbutyric acid prevents cardiac fibrosis induced by isoproterenol.

    PubMed

    Ayala, Pedro; Montenegro, José; Vivar, Raúl; Letelier, Alan; Urroz, Pablo Aránguiz; Copaja, Miguel; Pivet, Deisy; Humeres, Claudio; Troncoso, Rodrigo; Vicencio, José Miguel; Lavandero, Sergio; Díaz-Araya, Guillermo

    2012-02-01

    Increasing evidence indicates that endoplasmic reticulum (ER) stress is involved in various diseases. In the human heart, ischemia/reperfusion has been correlated to ER stress, and several markers of the unfolded protein response (UPR) participate during cardiac remodeling and fibrosis. Here, we used isoproterenol (ISO) injection as a model for in vivo cardiac fibrosis. ISO induced significant cardiomyocyte loss and collagen deposition in the damaged areas of the endocardium. These responses were accompanied by an increase in the protein levels of the luminal ER chaperones BIP and PDI, as well as an increase in the UPR effector CHOP. The use of the chemical chaperone 4-phenylbutyric acid (4-PBA) prevented the activation of the UPR, the increase in luminal chaperones and also, leads to decreased collagen deposition, cardiomyocyte loss into the damaged zones. Our results suggest that cardiac damage and fibrosis induced in vivo by the beta-adrenergic agonist ISO are tightly related to ER stress signaling pathways, and that increasing the ER luminal folding capacity with exogenously administrated 4-PBA is a powerful strategy for preventing the development of cardiac fibrosis. Additionally, 4-PBA might prevent the loss of cardiomyocytes. Our data suggests that the attenuation of ER stress pathways with pharmacological compounds such as the chemical chaperone 4-PBA can prevent the development of cardiac fibrosis and adverse remodeling. PMID:22101259

  10. H/D isotopic recognition and temperature effects in IR spectra of hydrogen-bonded cyclic dimers in crystals: 3-Methylcinnamic acid and 4-phenylbutyric acid

    NASA Astrophysics Data System (ADS)

    Hachuła, Barbara; Jabłońska-Czapla, Magdalena; Flakus, Henryk T.; Nowak, Maria; Kusz, Joachim

    2015-01-01

    In the present work, the experimental and theoretical study of the nature of the inter-hydrogen bond interactions in two different carboxylic acids, 3-methylcinnamic acid (3MCA) and 4-phenylbutyric acid (4PBA), were reported. The polarized IR spectra of 3MCA and 4PBA crystals were recorded at the frequency ranges of the νOsbnd H and νOsbnd D bands. The spectral properties of 3MCA and 4PBA interpreted with the aid of the calculations based on the "strong-coupling" model. The differences in the spectral properties of the two different dimeric systems in the crystals provide a valuable information about the existence of a direct relationship between the crystal spectral properties in IR and the electronic structure of the molecular systems. In 3MCA crystals strong vibrational exciton interactions favor a "tail-to-head" (TH)-type Davydov coupling widespread via the π-electrons, whereas in 4PBA crystals a weak "through-space" (SS) exciton coupling is responsible for a "side-to-side"-type coupling. The relative contribution of each individual exciton coupling mechanism in IR spectra generation strongly depends on temperature and molecular electronic structure. The H/D isotopic recognition effect, depending on a non-random distribution of protons and deuterons in the crystal hydrogen bridges, was also analyzed.

  11. Reduction of endoplasmic reticulum stress by 4-phenylbutyric acid prevents the development of hypoxia-induced pulmonary arterial hypertension.

    PubMed

    Koyama, Masayuki; Furuhashi, Masato; Ishimura, Shutaro; Mita, Tomohiro; Fuseya, Takahiro; Okazaki, Yusuke; Yoshida, Hideaki; Tsuchihashi, Kazufumi; Miura, Tetsuji

    2014-05-01

    Pulmonary arterial hypertension (PAH) is characterized by vasoconstriction and vascular remodeling of the pulmonary artery (PA). Recently, endoplasmic reticulum (ER) stress and inappropriate adaptation through the unfolded protein response (UPR) have been disclosed in various types of diseases. Here we examined whether ER stress is involved in the pathogenesis of PAH. Four weeks of chronic normobaric hypoxia increased right ventricular (RV) systolic pressure by 63% compared with that in normoxic controls and induced RV hypertrophy and medial thickening of the PA in C57BL/6J mice. Treatment with 4-phenylbutyric acid (4-PBA), a chemical chaperone, significantly reduced RV systolic pressure by 30%, attenuated RV hypertrophy and PA muscularization, and increased total running distance in a treadmill test by 70% in hypoxic mice. The beneficial effects of 4-PBA were associated with suppressed expression of inflammatory cytokines and ER stress markers, including Grp78 and Grp94 in the activating transcription factor-6 branch, sXbp1 and Pdi in the inositol-requiring enzyme-1 branch and Atf4 in the PKR-like ER kinase branch, and reduced phosphorylation of c-Jun NH2-terminal kinase and eukaryotic translation initiation factor-2α in the lung. The pattern of changes in ER stress and inflammatory markers by 4-PBA in the lung of the PAH model was reproduced in PA smooth muscle cells by chronic stimulation of platelet-derived growth factor-BB or hypoxia. Furthermore, knockdown of each UPR branch sensor activated other branches and promoted proliferation of PA smooth muscle cells. The findings indicate that activation of all branches of the UPR and accompanying inflammation play a major role in the pathogenesis of PAH, and that chemical chaperones are potentially therapeutic agents for PAH.

  12. Whole-body pharmacokinetics of HDAC inhibitor drugs, butyric acid, valproic acid and 4-phenylbutyric acid measured with carbon-11 labeled analogs by PET

    PubMed Central

    Kim, Sung Won; Hooker, Jacob M.; Otto, Nicola; Win, Khaing; Muench, Lisa; Shea, Colleen; Carter, Pauline; King, Payton; Reid, Alicia E.; Volkow, Nora D.; Fowler, Joanna S.

    2013-01-01

    The fatty acids, n-butyric acid (BA), 4-phenylbutyric acid (PBA) and valproic acid (VPA, 2-propylpentanoic acid) have been used for many years in the treatment of a variety of CNS and peripheral organ diseases including cancer. New information that these drugs alter epigenetic processes through their inhibition of histone deacetylases (HDACs) has renewed interest in their biodistribution and pharmacokinetics and the relationship of these properties to their therapeutic and side effect profile. In order to determine the pharmacokinetics and biodistribution of these drugs in primates, we synthesized their carbon-11 labeled analogues and performed dynamic positron emission tomography (PET) in six female baboons over 90 min. The carbon-11 labeled carboxylic acids were prepared by using 11CO2 and the appropriate Grignard reagents. [11C]BA was metabolized rapidly (only 20% of the total carbon-11 in plasma was parent compound at 5 min post injection) whereas for VPA and PBA 98% and 85% of the radioactivity was the unmetabolized compound at 30 min after their administration respectively. The brain uptake of all three carboxylic acids was very low (<0.006%ID/cc, BA>VPA>PBA), which is consistent with the need for very high doses for therapeutic efficacy. Most of the radioactivity was excreted through the kidneys and accumulated in the bladder. However, the organ biodistribution between the drugs differed. [11C]BA showed relatively high uptake in spleen and pancreas whereas [11C]PBA showed high uptake in liver and heart. Notably, [11C]VPA showed exceptionally high heart uptake possibly due to its involvement in lipid metabolism. The unique biodistribution of each of these drugs may be of relevance in understanding their therapeutic and side effect profile including their teratogenic effects. PMID:23906667

  13. Effects of 4-phenylbutyric acid on the process and development of diabetic nephropathy induced in rats by streptozotocin: Regulation of endoplasmic reticulum stress-oxidative activation

    SciTech Connect

    Luo Zhifeng; Feng Bing; Mu Jiao; Qi Wei; Zeng Wei; Guo Yanhong; Pang Qi; Ye Zilin; Liu Li; Yuan Fahuan

    2010-07-15

    Oxidative stress may contribute to the pathogenesis of diabetic nephropathy (DN), although the precise regulatory mechanism is still unclear. Recent reports have shown that chemical molecular chaperone 4-phenylbutyric acid (4-PBA) can suppress oxidative stress by attenuating endoplasmic reticulum (ER) stress. We therefore hypothesized that 4-PBA could provide renoprotection through the suppression of oxidative stress in DN rats. Male Sprague-Dawley (SD) rats were randomly divided into three groups: a normal control (NC) group, a streptozotocin (STZ)-induced DN model group, and a DN plus 4-PBA (1 g/kg) treatment group. At the end of 4, 8, and 12 weeks, hydroxyproline content, NADPH oxidase activity and the expression of phosphorylation of inositol-requiring enzyme-1{alpha} (p-IRE1{alpha}), p47phox, nitrotyrosine (NT) and NF-E2-related factor 2 (Nrf2) in the kidneys of all rats were determined; malondialdehyde (MDA) levels and superoxide dismutase (SOD) activity in serum and urine were also detected; renal nuclear factor {kappa}B (NF-{kappa}B) activity in all of the rats was examined at the end of 12 weeks. Compared with the NC group, the DN rats showed a significant increase in hydroxyproline content, NADPH oxidase activity, NF-{kappa}B activity, the expression of p-IRE1{alpha}, p47phox, NT and Nrf2 in renal tissue; markedly, MDA levels were higher and SOD activity was lower in serum and urine of DN rats than in NC rats for the indicated time. These alterations were inhibited by the administration of 4-PBA. These findings first demonstrated that treatment with 4-PBA significantly inhibits the process and development of diabetic nephropathy in rats through the regulation of ER stress-oxidative activation.

  14. The chemical chaperones tauroursodeoxycholic and 4-phenylbutyric acid accelerate thyroid hormone activation and energy expenditure

    PubMed Central

    da-Silva, Wagner S.; Ribich, Scott; e Drigo, Rafael Arrojo; Castillo, Melany; Patty, Mary-Elizabeth; Bianco, Antonio C.

    2011-01-01

    Exposure of cell lines endogenously expressing the thyroid hormone activating enzyme type 2 deiodinase (D2) to the chemical chaperones tauroursodeoxycholic acid (TUDCA) or 4-phenylbutiric acid (4-PBA) increases D2 expression, activity and T3 production. In brown adipocytes, TUDCA or 4-PBA induced T3-dependent genes and oxygen consumption (~2-fold), an effect partially lost in D2 knockout cells. In wild type, but not in D2 knockout mice, administration of TUDCA lowered the respiratory quotient, doubled brown adipose tissue D2 activity and normalized the glucose intolerance associated with high fat feeding. Thus, D2 plays a critical role in the metabolic effects of chemical chaperones. PMID:21237159

  15. 4-Phenylbutyric acid reduces mutant-TGFBIp levels and ER stress through activation of ERAD pathway in corneal fibroblasts of granular corneal dystrophy type 2.

    PubMed

    Choi, Seung-Il; Lee, Eunhee; Jeong, Jang Bin; Akuzum, Begum; Maeng, Yong-Sun; Kim, Tae-Im; Kim, Eung Kweon

    2016-09-01

    Granular corneal dystrophy type 2 (GCD2) is caused by a point mutation (R124H) in the transforming growth factor β-induced (TGFBI) gene. In GCD2 corneal fibroblasts, secretion of the accumulated mutant TGFBI-encoded protein (TGFBIp) is delayed via the endoplasmic reticulum (ER)/Golgi-dependent secretory pathway. However, ER stress as the pathogenic mechanism underlying GCD2 has not been fully characterized. The aim of this study was to confirm whether ER stress is linked to GCD2 pathogenesis and whether the chemical chaperone, 4-phenylbutyric acid (4-PBA), could be exploited as a therapy for GCD2. We found that the ER chaperone binding immunoglobulin protein (BiP) and the protein disulfide isomerase (PDI) were elevated in GCD2. Western bolt analysis also showed a significant increase in both the protein levels and the phosphorylation of the key ER stress kinases, inositol-requiring enzyme 1α (IRE1α) and double stranded RNA activated protein kinase (PKR)-like ER kinase, as well as in levels of their downstream targets, X box-binding protein 1 (XBP1) and activating transcription factor 4, respectively, in GCD2 corneal fibroblasts. GCD2 cells were found to be more susceptible to ER stress-induced cell death than were wild-type corneal fibroblasts. Treatment with 4-PBA considerably reduced the levels of BiP, IRE1α, and XBP1 in GCD2 cells; notably, 4-PBA treatment significantly reduced the levels of TGFBIp without change in TGFBI mRNA levels. In addition, TGFBIp levels were significantly reduced under ER stress and this reduction was considerably suppressed by the ubiquitin proteasome inhibitor MG132, indicating TGFBIp degradation via the ER-associated degradation pathway. Treatment with 4-PBA not only protected against the GCD2 cell death induced by ER stress but also significantly suppressed the MG132-mediated increase in TGFBIp levels under ER stress. Together, these results suggest that ER stress might comprise an important factor in GCD2 pathophysiology and

  16. Improvement of mTORC1-driven overproduction of apoB-containing triacylglyceride-rich lipoproteins by short-chain fatty acids, 4-phenylbutyric acid and (R)-α-lipoic acid, in human hepatocellular carcinoma cells.

    PubMed

    Roberts, Joseph L; He, Bo; Erickson, Anjeza; Moreau, Régis

    2016-03-01

    The activation of hepatic kinase mechanistic target of rapamycin complex 1 (mTORC1) is implicated in the development of obesity-related metabolic disorders. This study investigated the metabolic sequelae of mTORC1 hyperactivation in human hepatoma cells and the lipid-regulating mechanisms of two short-chain fatty acids: 4-phenylbutyric acid (PBA) and (R)-α-lipoic acid (LA). We created three stable cell lines that exhibit low, normal, or high mTORC1 activity. mTORC1 hyperactivation induced the expression of lipogenic (DGAT1 and DGAT2) and lipoprotein assembly (MTP and APOB) genes, thereby raising cellular triacylglyceride (TG) and exacerbating secretion of apoB-containing TG-rich lipoproteins. LYS6K2, a specific inhibitor of the p70 S6 kinase branch of mTORC1 signaling, reversed these effects. PBA and LA decreased secreted TG through distinct mechanisms. PBA repressed apoB expression (both mRNA and protein) and lowered secreted TG without mitigation of mTORC1 hyperactivity or activation of AMPK. LA decreased cellular and secreted TG by attenuating mTORC1 signaling in an AMPK-independent manner. LA did not regulate apoB expression but led to the secretion of apoB-containing TG-poor lipoproteins by repressing the expression of lipogenic genes, FASN, DGAT1, and DGAT2. Our studies provide new mechanistic insight into the hypolipidemic activity of PBA and LA in the context of mTORC1 hyperactivation and suggest that the short-chain fatty acids may aid in the prevention and treatment of hypertriglyceridemia.

  17. Sodium 4-phenylbutyrate suppresses the development of dextran sulfate sodium-induced colitis in mice.

    PubMed

    Ono, Kazuhiko; Nimura, Satoshi; Nishinakagawa, Takuya; Hideshima, Yuko; Enjyoji, Munechika; Nabeshima, Kazuki; Nakashima, Manabu

    2014-03-01

    Sodium 4-phenylbutyrate (PBA) exhibits anti-inflammatory effects by suppressing nuclear factor-κB (NF-κB) activation. In the present study, the effects of PBA on a mouse model of dextran sulfate sodium (DSS)-induced colitis were investigated. The therapeutic efficacy of PBA (150 mg/kg body weight) in DSS-induced colitis was assessed based on the disease activity index (DAI), colon length, the production of inflammatory cytokines and histopathological examination. The results showed an increase in the median survival time in the PBA-treated group compared with that of the untreated DSS control group. DAI scores were lower in the PBA-treated group than in the DSS control group during the 12 days of the experiment. Additionally, PBA treatment inhibited shortening of the colon and the production of the inflammatory cytokines tumor necrosis factor-α, interleukin-1β and IL-6, which were measured in the colonic lavage fluids. Histopathological examination of the DSS control group showed diffused clusters of chronic inflammatory cells infiltrating the lamina propria, partial exfoliation of the surface epithelium and decreased numbers of mature goblet cells. By contrast, in the PBA-treated group the histopathological findings were the same as those of the normal healthy controls. These results suggest that PBA strongly prevents DSS-induced colitis by suppressing the mechanisms involved in its pathogenesis.

  18. No Amelioration of Uromodulin Maturation and Trafficking Defect by Sodium 4-Phenylbutyrate in Vivo

    PubMed Central

    Kemter, Elisabeth; Sklenak, Stefanie; Rathkolb, Birgit; Hrabě de Angelis, Martin; Wolf, Eckhard; Aigner, Bernhard; Wanke, Ruediger

    2014-01-01

    Uromodulin (UMOD)-associated kidney disease (UAKD) belongs to the hereditary progressive ER storage diseases caused by maturation defects of mutant UMOD protein. Current treatments of UAKD patients are symptomatic and cannot prevent disease progression. Two in vitro studies reported a positive effect of the chemical chaperone sodium 4-phenylbutyrate (4-PBA) on mutant UMOD maturation. Thus, 4-PBA was suggested as a potential treatment for UAKD. This study evaluated the effects of 4-PBA in two mouse models of UAKD. In contrast to previous in vitro studies, treatment with 4-PBA did not increase HSP70 expression or improve maturation and trafficking of mutant UMOD in vivo. Kidney function of UAKD mice was actually deteriorated by 4-PBA treatment. In transfected tubular epithelial cells, 4-PBA did not improve maturation but increased the expression level of both mutant and wild-type UMOD protein. Activation of NF-κB pathway in thick ascending limb of Henle's loop cells of UAKD mice was detected by increased abundance of RelB and phospho-IκB kinase α/β, an indirect activator of NF-κB. Furthermore, the abundance of NF-κB1 p105/p50, NF-κB2 p100/p52, and TRAF2 was increased in UAKD. NF-κB activation was identified as a novel disease mechanism of UAKD and might be a target for therapeutic intervention. PMID:24567330

  19. Chemical chaperon 4-phenylbutyrate protects against the endoplasmic reticulum stress-mediated renal fibrosis in vivo and in vitro.

    PubMed

    Liu, Shing-Hwa; Yang, Ching-Chin; Chan, Ding-Cheng; Wu, Cheng-Tien; Chen, Li-Ping; Huang, Jenq-Wen; Hung, Kuan-Yu; Chiang, Chih-Kang

    2016-04-19

    Renal tubulointerstitial fibrosis is the common and final pathologic change of kidney in end-stage renal disease. Interesting, endoplasmic reticulum (ER) stress is known to contribute to the pathophysiological mechanisms during the development of renal fibrosis. Here, we investigated the effects of chemical chaperon sodium 4-phenylbutyrate (4-PBA) on renal fibrosis in vivo and in vitro. In a rat unilateral ureteral obstruction (UUO) model, 4-PBA mimicked endogenous ER chaperon in the kidneys and significantly reduced glucose regulated protein 78 (GRP78), CCAAT/enhancer binding protein (C/EBP) homologous protein (CHOP), activating transcription factor 4 (ATF4), and phosphorylated JNK protein expressions as well as restored spliced X-box-binding protein 1 (XBP1) expressions in the kidneys of UUO rats. 4-PBA also attenuated the increases of α-smooth muscle actin (α-SMA), connective tissue growth factor (CTGF) protein expressions, tubulointerstitial fibrosis, and apoptosis in the kidneys of UUO rats. Moreover, transforming growth factor (TGF)-β markedly increased ER stress-associated molecules, profibrotic factors, and apoptotic markers in the renal tubular cells (NRK-52E), all of which could be significantly counteracted by 4-PBA treatment. 4-PBA also diminished TGF-β-increased CTGF promoter activity and CTGF mRNA expression in NRK-52E cells. Taken together, our results indicated that 4-PBA acts as an ER chaperone to ameliorate ER stress-induced renal tubular cell apoptosis and renal fibrosis.

  20. Chemical chaperon 4-phenylbutyrate protects against the endoplasmic reticulum stress-mediated renal fibrosis in vivo and in vitro.

    PubMed

    Liu, Shing-Hwa; Yang, Ching-Chin; Chan, Ding-Cheng; Wu, Cheng-Tien; Chen, Li-Ping; Huang, Jenq-Wen; Hung, Kuan-Yu; Chiang, Chih-Kang

    2016-04-19

    Renal tubulointerstitial fibrosis is the common and final pathologic change of kidney in end-stage renal disease. Interesting, endoplasmic reticulum (ER) stress is known to contribute to the pathophysiological mechanisms during the development of renal fibrosis. Here, we investigated the effects of chemical chaperon sodium 4-phenylbutyrate (4-PBA) on renal fibrosis in vivo and in vitro. In a rat unilateral ureteral obstruction (UUO) model, 4-PBA mimicked endogenous ER chaperon in the kidneys and significantly reduced glucose regulated protein 78 (GRP78), CCAAT/enhancer binding protein (C/EBP) homologous protein (CHOP), activating transcription factor 4 (ATF4), and phosphorylated JNK protein expressions as well as restored spliced X-box-binding protein 1 (XBP1) expressions in the kidneys of UUO rats. 4-PBA also attenuated the increases of α-smooth muscle actin (α-SMA), connective tissue growth factor (CTGF) protein expressions, tubulointerstitial fibrosis, and apoptosis in the kidneys of UUO rats. Moreover, transforming growth factor (TGF)-β markedly increased ER stress-associated molecules, profibrotic factors, and apoptotic markers in the renal tubular cells (NRK-52E), all of which could be significantly counteracted by 4-PBA treatment. 4-PBA also diminished TGF-β-increased CTGF promoter activity and CTGF mRNA expression in NRK-52E cells. Taken together, our results indicated that 4-PBA acts as an ER chaperone to ameliorate ER stress-induced renal tubular cell apoptosis and renal fibrosis. PMID:26959118

  1. Chemical chaperon 4-phenylbutyrate protects against the endoplasmic reticulum stress-mediated renal fibrosis in vivo and in vitro

    PubMed Central

    Wu, Cheng-Tien; Chen, Li-Ping; Huang, Jenq-Wen; Hung, Kuan-Yu; Chiang, Chih-Kang

    2016-01-01

    Renal tubulointerstitial fibrosis is the common and final pathologic change of kidney in end-stage renal disease. Interesting, endoplasmic reticulum (ER) stress is known to contribute to the pathophysiological mechanisms during the development of renal fibrosis. Here, we investigated the effects of chemical chaperon sodium 4-phenylbutyrate (4-PBA) on renal fibrosis in vivo and in vitro. In a rat unilateral ureteral obstruction (UUO) model, 4-PBA mimicked endogenous ER chaperon in the kidneys and significantly reduced glucose regulated protein 78 (GRP78), CCAAT/enhancer binding protein (C/EBP) homologous protein (CHOP), activating transcription factor 4 (ATF4), and phosphorylated JNK protein expressions as well as restored spliced X-box-binding protein 1 (XBP1) expressions in the kidneys of UUO rats. 4-PBA also attenuated the increases of α-smooth muscle actin (α-SMA), connective tissue growth factor (CTGF) protein expressions, tubulointerstitial fibrosis, and apoptosis in the kidneys of UUO rats. Moreover, transforming growth factor (TGF)-β markedly increased ER stress-associated molecules, profibrotic factors, and apoptotic markers in the renal tubular cells (NRK-52E), all of which could be significantly counteracted by 4-PBA treatment. 4-PBA also diminished TGF-β-increased CTGF promoter activity and CTGF mRNA expression in NRK-52E cells. Taken together, our results indicated that 4-PBA acts as an ER chaperone to ameliorate ER stress-induced renal tubular cell apoptosis and renal fibrosis. PMID:26959118

  2. Potentiometric and NMR complexation studies of phenylboronic acid PBA and its aminophosphonate analog with selected catecholamines

    NASA Astrophysics Data System (ADS)

    Ptak, Tomasz; Młynarz, Piotr; Dobosz, Agnieszka; Rydzewska, Agata; Prokopowicz, Monika

    2013-05-01

    Boronic acids are a class of intensively explored compounds, which according to their specific properties have been intensively explored in last decades. Among them phenylboronic acids and their derivatives are most frequently examined as receptors for diverse carbohydrates. In turn, there is a large gap in basic research concerning complexation of catecholamines by these compounds. Therefore, we decided to undertake studies on interaction of chosen catecholamines, namely: noradrenaline (norephinephrine), dopamine, L-DOPA, DOPA-P (phosphonic analog of L-DOPA) and catechol, with simple phenyl boronic acid PBA by means of potentiometry and NMR spectroscopy. For comparison, the binding properties of recently synthesized phenylboronic receptor 1 bearing aminophosphonate function in meta-position were investigated and showed promising ability to bind catecholamines. The protonation and stability constants of PBA and receptor 1 complexes were examined by potentiometry. The obtained results demonstrated that PBA binds the catecholamines with the following affinity order: noradrenaline ⩾ dopamine ≈ L-DOPA > catechol > DOPA-P, while its modified analog 1 reveals slightly different preferences: dopamine > noradrenaline > catechol > L-DOPA > DOPA-P.

  3. Retinal ischemic injury rescued by sodium 4-phenylbutyrate in a rat model.

    PubMed

    Jeng, Yung-Yue; Lin, Nien-Ting; Chang, Pen-Heng; Huang, Yuan-Ping; Pang, Victor Fei; Liu, Chen-Hsuan; Lin, Chung-Tien

    2007-03-01

    Retinal ischemia is a common cause of visual impairment for humans and animals. Herein, the neuroprotective effects of phenylbutyrate (PBA) upon retinal ischemic injury were investigated using a rat model. Retinal ganglion cells (RGCs) were retrograde labeled with the fluorescent tracer fluorogold (FG) applied to the superior collicoli of test Sprague-Dawley rats. High intraocular pressure and retinal ischemia were induced seven days subsequent to such FG labeling. A dose of either 100 or 400 mg/kg PBA was administered intraperitoneally to test rats at two time points, namely 30 min prior to the induction of retinal ischemia and 1 h subsequent to the cessation of the procedure inducing retinal ischemia. The test-rat retinas were collected seven days subsequent to the induction of retinal ischemia, and densities of surviving RGCs were estimated by counting FG-labeled RGCs within the retina. Histological analysis revealed that ischemic injury caused the loss of retinal RGCs and a net decrease in retinal thickness. For PBA-treated groups, almost 100% of the RGCs were preserved by a pre-ischemia treatment with PBA (at a dose of either 100 or 400 mg/kg), while post-ischemia treatment of RGCs with PBA did not lead to the preservation of RGCs from ischemic injury by PBA as determined by the counting of whole-mount retinas. Pre-ischemia treatment of RGCs with PBA (at a dose of either 100 or 400 mg/kg) significantly reduced the level of ischemia-associated loss of thickness of the total retina, especially the inner retina, and the inner plexiform layer of retina. Besides, PBA treatment significantly reduced the ischemia-induced loss of cells in the ganglion-cell layer of the retina. Taken together, these results suggest that PBA demonstrates a marked neuroprotective effect upon high intraocular pressure-induced retinal ischemia when the PBA is administered prior to ischemia induction. PMID:17178414

  4. Structure of a Proteasome Pba1-Pba2 Complex

    PubMed Central

    Stadtmueller, Beth M.; Kish-Trier, Erik; Ferrell, Katherine; Petersen, Charisse N.; Robinson, Howard; Myszka, David G.; Eckert, Debra M.; Formosa, Tim; Hill, Christopher P.

    2012-01-01

    The 20S proteasome is an essential, 28-subunit protease that sequesters proteolytic sites within a central chamber, thereby repressing substrate degradation until proteasome activators open the entrance/exit gate. Two established activators, Blm10 and PAN/19S, induce gate opening by binding to the pockets between proteasome α-subunits using C-terminal HbYX (hydrophobic-tyrosine-any residue) motifs. Equivalent HbYX motifs have been identified in Pba1 and Pba2, which function in proteasome assembly. Here, we demonstrate that Pba1-Pba2 proteins form a stable heterodimer that utilizes its HbYX motifs to bind mature 20S proteasomes in vitro and that the Pba1-Pba2 HbYX motifs are important for a physiological function of proteasomes, the maintenance of mitochondrial function. Other factors that contribute to proteasome assembly or function also act in the maintenance of mitochondrial function and display complex genetic interactions with one another, possibly revealing an unexpected pathway of mitochondrial regulation involving the Pba1-Pba2 proteasome interaction. Our determination of a proteasome Pba1-Pba2 crystal structure reveals a Pba1 HbYX interaction that is superimposable with those of known activators, a Pba2 HbYX interaction that is different from those reported previously, and a gate structure that is disrupted but not sufficiently open to allow entry of even small peptides. These findings extend understanding of proteasome interactions with HbYX motifs and suggest multiple roles for Pba1-Pba2 interactions throughout proteasome assembly and function. PMID:22930756

  5. Enhanced effects by 4-phenylbutyrate in combination with RTK inhibitors on proliferation in brain tumor cell models

    SciTech Connect

    Marino, Ana-Maria; Sofiadis, Anastasios; Baryawno, Ninib; Johnsen, John Inge; Larsson, Catharina; Vukojevic, Vladana; Ekstroem, Tomas J.

    2011-07-22

    Highlights: {yields} The histone deacetylase inhibitor 4-phenylbutyrate substantially enhance efficacy of the receptor tyrosine kinase inhibitors gefitinib or vandetanib in glioma and medulloblastoma cell lines. {yields} Cell death increases and clonogenic survival is reduced in the combination treatments, over mono-therapy. {yields} Combination treatments with these drugs may improve clinical outcome for cancer therapy. -- Abstract: We have investigated in vitro effects of anticancer therapy with the histone deacetylase inhibitor (HDACi) 4-phenylbutyrate (4-PB) combined with receptor tyrosine kinase inhibitors (RTKi) gefitinib or vandetanib on the survival of glioblastoma (U343MGa) and medulloblastoma (D324Med) cells. In comparison with individual effects of these drugs, combined treatment with gefitinib/4-PB or vandetanib/4-PB resulted in enhanced cell killing and reduced clonogenic survival in both cell lines. Our results suggest that combined treatment using HDACi and RTKi may beneficially affect the outcome of cancer therapy.

  6. Endoplasmic reticulum stress in amelogenesis imperfecta and phenotypic rescue using 4-phenylbutyrate.

    PubMed

    Brookes, Steven J; Barron, Martin J; Boot-Handford, Ray; Kirkham, Jennifer; Dixon, Michael J

    2014-05-01

    Inherited diseases caused by genetic mutations can arise due to loss of protein function. Alternatively, mutated proteins may mis-fold, impairing endoplasmic reticulum (ER) trafficking, causing ER stress and triggering the unfolded protein response (UPR). The UPR attempts to restore proteostasis but if unsuccessful drives affected cells towards apoptosis. Previously, we reported that in mice, the p.Tyr64His mutation in the enamel extracellular matrix (EEM) protein amelogenin disrupts the secretory pathway in the enamel-forming ameloblasts, resulting in eruption of malformed tooth enamel that phenocopies human amelogenesis imperfecta (AI). Defective amelogenin post-secretory self-assembly and processing within the developing EEM has been suggested to underlie the pathogenesis of X chromosome-linked AI. Here, we challenge this concept by showing that AI pathogenesis associated with the p.Tyr64His amelogenin mutation involves ameloblast apoptosis induced by ER stress. Furthermore, we show that 4-phenylbutyrate can rescue the enamel phenotype in affected female mice by promoting cell survival over apoptosis such that they are able to complete enamel formation despite the presence of the mutation, offering a potential therapeutic option for patients with this form of AI and emphasizing the importance of ER stress in the pathogenesis of this inherited conformational disease.

  7. Intractable itch relieved by 4-phenylbutyrate therapy in patients with progressive familial intrahepatic cholestasis type 1

    PubMed Central

    2014-01-01

    Background Progressive familial intrahepatic cholestasis type 1 (PFIC1), an inherited liver disease caused by mutations in ATP8B1, progresses to severe cholestasis with a sustained intractable itch. Currently, no effective therapy has been established for PFIC1. Decreased function of the bile salt export pump (BSEP) in hepatocytes is suggested to be responsible for the severe cholestasis observed in PFIC1. We found a previously unidentified pharmacological effect of 4-phenylbutyrate (4PB) that increases the expression and function of BSEP. Here, we tested 4PB therapy in three patients with PFIC1. Methods The therapeutic potency of 4PB in these patients was tested by oral administration of this drug with gradually increasing dosage (200, 350, and 500 mg/kg/day) for 6 months. Biochemical, histological, and clinical data were collected. Results 4PB therapy had no beneficial effect on the patients’ liver functions, as assessed by biochemical and histological analyses, despite an increase in hepatic BSEP expression. However, therapy with 4PB at a dosage of 350 or 500 mg/kg/day significantly relieved the intractable itch. Serum levels of potential pruritogens in cholestasis were much higher than the reference ranges during the 4PB therapy. Conclusions 4PB therapy may be a new medication for patients with intractable cholestatic pruritus and may improve quality of life for patients and their families. PMID:25022842

  8. Phenylbutyric acid induces the cellular senescence through an Akt/p21{sup WAF1} signaling pathway

    SciTech Connect

    Kim, Hag Dong; Jang, Chang-Young; Choe, Jeong Min; Sohn, Jeongwon; Kim, Joon

    2012-06-01

    Highlights: Black-Right-Pointing-Pointer Phenylbutyric acid induces cellular senescence. Black-Right-Pointing-Pointer Phenylbutyric acid activates Akt kinase. Black-Right-Pointing-Pointer The knockdown of PERK also can induce cellular senescence. Black-Right-Pointing-Pointer Akt/p21{sup WAF1} pathway activates in PERK knockdown induced cellular senescence. -- Abstract: It has been well known that three sentinel proteins - PERK, ATF6 and IRE1 - initiate the unfolded protein response (UPR) in the presence of misfolded or unfolded proteins in the ER. Recent studies have demonstrated that upregulation of UPR in cancer cells is required to survive and proliferate. Here, we showed that long exposure to 4-phenylbutyric acid (PBA), a chemical chaperone that can reduce retention of unfolded and misfolded proteins in ER, induced cellular senescence in cancer cells such as MCF7 and HT1080. In addition, we found that treatment with PBA activates Akt, which results in p21{sup WAF1} induction. Interestingly, the depletion of PERK but not ATF6 and IRE1 also induces cellular senescence, which was rescued by additional depletion of Akt. This suggests that Akt pathway is downstream of PERK in PBA induced cellular senescence. Taken together, these results show that PBA induces cellular senescence via activation of the Akt/p21{sup WAF1} pathway by PERK inhibition.

  9. Bipolar and Related Disorders Induced by Sodium 4-Phenylbutyrate in a Male Adolescent with Bile Salt Export Pump Deficiency Disease

    PubMed Central

    Simonetti, Giulia; Pirillo, Martina; Taruschio, Gianfranco; Andreone, Pietro

    2016-01-01

    Bile Salt Export Pump (BSEP) Deficiency disease, including Progressive Familial Intrahepatic Cholestasis type 2 (PFIC2), is a rare disease, usually leading within the first ten years to portal hypertension, liver failure, hepatocellular carcinoma. Often liver transplantation is needed. Sodium 4-phenylbutyrate (4-PB) seems to be a potential therapeutic compound for PFIC2. Psychiatric side effects in the adolescent population are little known and little studied since the drug used to treat children and infants. So we described a case of Caucasian boy, suffering from a late onset PFIC2, listed for a liver transplant when he was sixteen and treated with 4-FB (200 mg per kilogram of body weight per day). The drug was discontinued for the onset of bipolar and related disorders. This case illustrates possible psychiatric side effects of the drug. PMID:27757140

  10. Chemical Analysis and Aqueous Solution Properties of Charged Amphiphilic Block Copolymers PBA-b-PAA Synthesized by MADIX

    SciTech Connect

    Jacquin,M.; Muller, P.; Talingting-Pabalan, R.; Cottet, H.; Berret, J.; Futterer, T.; Theodoly, O.

    2007-01-01

    We have linked the structural and dynamic properties in aqueous solution of amphiphilic charged diblock copolymers poly(butyl acrylate)-b-poly(acrylic acid), PBA-b-PAA, synthesized by controlled radical polymerization, with the physico-chemical characteristics of the samples. Despite product imperfections, the samples self-assemble in melt and aqueous solutions as predicted by monodisperse microphase separation theory. However, the PBA core are abnormally large; the swelling of PBA cores is not due to AA (the Flory parameter ?PBA/PAA, determined at 0.25, means strong segregation), but to h-PBA homopolymers (content determined by liquid chromatography at the point of exclusion and adsorption transition, LC-PEAT). Beside the dominant population of micelles detected by scattering experiments, capillary electrophoresis CE analysis permitted detection of two other populations, one of h-PAA, and the other of free PBA-b-PAA chains, that have very short PBA blocks and never self-assemble. Despite the presence of these free unimers, the self-assembly in solution was found out of equilibrium: the aggregation state is history dependant and no unimer exchange between micelles occurs over months (time-evolution SANS). The high PBA/water interfacial tension, measured at 20 mN/m, prohibits unimer exchange between micelles. PBA-b-PAA solution systems are neither at thermal equilibrium nor completely frozen systems: internal fractionation of individual aggregates can occur.

  11. PbaR, an IclR family transcriptional activator for the regulation of the 3-phenoxybenzoate 1',2'-dioxygenase gene cluster in Sphingobium wenxiniae JZ-1T.

    PubMed

    Cheng, Minggen; Chen, Kai; Guo, Suhui; Huang, Xing; He, Jian; Li, Shunpeng; Jiang, Jiandong

    2015-12-01

    The 3-phenoxybenzoate (3-PBA) 1',2'-dioxygenase gene cluster (pbaA1A2B cluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed in Sphingobium wenxiniae strain JZ-1(T) by its substrate 3-PBA. In this study, we identified a transcriptional activator of the pbaA1A2B cluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 in Sphingomonas sp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of the pbaA1A2B cluster in response to 3-PBA in strain JZ-1(T). However, PbaR does not regulate the reductase component gene pbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in the pbaA1A2B promoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the -10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1(T), and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators. PMID:26386050

  12. PbaR, an IclR Family Transcriptional Activator for the Regulation of the 3-Phenoxybenzoate 1′,2′-Dioxygenase Gene Cluster in Sphingobium wenxiniae JZ-1T

    PubMed Central

    Cheng, Minggen; Chen, Kai; Guo, Suhui; Huang, Xing; He, Jian; Li, Shunpeng

    2015-01-01

    The 3-phenoxybenzoate (3-PBA) 1′,2′-dioxygenase gene cluster (pbaA1A2B cluster), which is responsible for catalyzing 3-phenoxybenzoate to 3-hydroxybenzoate and catechol, is inducibly expressed in Sphingobium wenxiniae strain JZ-1T by its substrate 3-PBA. In this study, we identified a transcriptional activator of the pbaA1A2B cluster, PbaR, using a DNA affinity approach. PbaR is a 253-amino-acid protein with a molecular mass of 28,000 Da. PbaR belongs to the IclR family of transcriptional regulators and shows 99% identity to a putative transcriptional regulator that is located on the carbazole-degrading plasmid pCAR3 in Sphingomonas sp. strain KA1. Gene disruption and complementation showed that PbaR was essential for transcription of the pbaA1A2B cluster in response to 3-PBA in strain JZ-1T. However, PbaR does not regulate the reductase component gene pbaC. An electrophoretic mobility shift assay and DNase I footprinting showed that PbaR binds specifically to the 29-bp motif AATAGAAAGTCTGCCGTACGGCTATTTTT in the pbaA1A2B promoter area and that the palindromic sequence (GCCGTACGGC) within the motif is essential for PbaR binding. The binding site was located between the −10 box and the ribosome-binding site (downstream of the transcriptional start site), which is distinct from the location of the binding site in previously reported IclR family transcriptional regulators. This study reveals the regulatory mechanism for 3-PBA degradation in strain JZ-1T, and the identification of PbaR increases the variety of regulatory models in the IclR family of transcriptional regulators. PMID:26386050

  13. Docosahexaenoic Acid Ameliorates Fructose-Induced Hepatic Steatosis Involving ER Stress Response in Primary Mouse Hepatocytes.

    PubMed

    Zheng, Jinying; Peng, Chuan; Ai, Yanbiao; Wang, Heng; Xiao, Xiaoqiu; Li, Jibin

    2016-01-01

    The increase in fructose consumption is considered to be a risk factor for developing nonalcoholic fatty liver disease (NAFLD). We investigated the effects of docosahexaenoic acid (DHA) on hepatic lipid metabolism in fructose-treated primary mouse hepatocytes, and the changes of Endoplasmic reticulum (ER) stress pathways in response to DHA treatment. The hepatocytes were treated with fructose, DHA, fructose plus DHA, tunicamycin (TM) or fructose plus 4-phenylbutyric acid (PBA) for 24 h. Intracellular triglyceride (TG) accumulation was assessed by Oil Red O staining. The mRNA expression levels and protein levels related to lipid metabolism and ER stress response were determined by real-time PCR and Western blot. Fructose treatment led to obvious TG accumulation in primary hepatocytes through increasing expression of fatty acid synthase (FAS) and acetyl-CoA carboxylase (ACC), two key enzymes in hepatic de novo lipogenesis. DHA ameliorates fructose-induced TG accumulation by upregulating the expression of carnitine palmitoyltransferase 1A (CPT-1α) and acyl-CoA oxidase 1 (ACOX1). DHA treatment or pretreatment with the ER stress inhibitor PBA significantly decreased TG accumulation and reduced the expression of glucose-regulated protein 78 (GRP78), total inositol-requiring kinase 1 (IRE1α) and p-IRE1α. The present results suggest that DHA protects against high fructose-induced hepatocellular lipid accumulation. The current findings also suggest that alleviating the ER stress response seems to play a role in the prevention of fructose-induced hepatic steatosis by DHA. PMID:26805874

  14. Development and study the performance of PBA cladding modified fiber optic intrinsic biosensor for urea detection

    NASA Astrophysics Data System (ADS)

    Botewad, S. N.; Pahurkar, V. G.; Muley, G. G.

    2016-05-01

    The fabrication and study of a cladding modified fiber optic intrinsic urea biosensor based on evanescent wave absorbance has been presented. The sensor was prepared using cladding modification technique by removing a small portion of cladding of an optical fiber and modifying with an active cladding of porous polyaniline-boric acid (PBA) matrix to immobilize enzyme-urease through cross-linking via glutaraldehyde. The nature of as-synthesized and deposited PBA film on fiber optic sensing element was studied by ultraviolet-visible (UV-vis) spectroscopy and X-ray diffraction (XRD) analysis. The performance of the developed sensor was studied for different urea concentrations in solutions prepared in phosphate buffer.

  15. Characterising coarse PBA dynamics in real-time above and below a tropical rainforest canopy using a dual channel UV fluorescence aerosol spectrometer.

    NASA Astrophysics Data System (ADS)

    Gabey, A.; Gallagher, M. W.; Burgess, R.; Coe, H.; McFiggans, G.,; Kaye, P. H.; Stanley, W. R.; Davies, F.; Foot, V. E.

    2009-04-01

    single-particle dual channel UV fluorescence spectrometer (Kaye et al., 2008) capable of detecting PBA by inducing fluorescence in two so-called biofluorophores - one present during metabolism and the other an amino acid - in the particle size range 1 m < Dp < 20 m. Real-time PBA measurements were performed above and below the canopy of a tropical rainforest in Borneo, Malaysia as part of the Oxidant and Particle Photochemical Processes (OP3) and the Aerosol Coupling in the Earth System (ACES) projects. PBA were found to dominate the coarse loading at Dp > 2 m. In qualitative agreement with measurements of culturable airborne material in a tropical forest's understory (Gilbert, 2005) a diurnal cycle of PBA number concentration is present, reaching a maximum of ~4000 l-1 at local midnight and falling to ~100 l-1 around midday. The role of the planetary boundary layer's collapse and re-establishment in dictating this variation in is also investigated using LIDAR data. Transient PBA concentration spikes lasting several minutes are superposed on the smooth underlying diurnal variation and occur at similar times each day. Nucleopore filter samples were also taken in-situ and analysed under an Environmental scanning electron microscope (ESEM) in Manchester. The images obtained showed the PBA fraction to be dominated by fungal spores of diameter 2-5 m, from various species including ABM. Since such species tend to release spores in bursts at regular times this appears to account for the PBA concentration spikes.

  16. PBA regulates neurogenesis and cognition dysfunction after repeated electroconvulsive shock in a rat model.

    PubMed

    Yao, Zhao-Hui; Kang, Xiang; Yang, Liu; Niu, Yi; Lu, Ye; Nie, Li

    2015-12-15

    Electroconvulsive therapy (ECT) was widely used to treat the refractory depression. But ECT led to the cognitive deficits plaguing the depression patients. The underlying mechanisms of the cognitive deficits remain elusive. Repeated electroconvulsive shock (rECS) was used to simulate ECT and explore the mechanisms of ECT during the animal studies. Previous studies showed rECS could lead to neurogenesis and cognitive impairment. But it was well known that neurogenesis could improve the cognition. So these suggested that the mechanism of the cognitive deficit after rECS was very complex. In present study, we explored the probable mechanisms of the cognitive deficit after rECS from neurogenesis aspect. We found the cognitive deficit was reversible and neurogenesis could bring a long-term beneficial effect on cognition. Astrogliosis and NR1 down-regulation probably participated in the reversible cognitive deficits after rECS. Phenylbutyric acid (PBA), generally as an agent to investigate the roles of histone acetylation, could prevent the reversible cognitive dysfunction, but PBA could diminish the long-term effect of enhanced cognition by rECS. These suggested that ECT could possibly bring the long-term beneficial cognitive effect by regulating neurogenesis.

  17. Neuronal Dysregulation in Stroke-Associated Pseudobulbar Affect (PBA): Diagnostic Scales and Current Treatment Options

    PubMed Central

    Lapchak, Paul A

    2015-01-01

    Until recently there was little understanding of the exact pathophysiology and treatment choices for stroke patients with Pseudobulbar affect (PBA). PBA is typically characterized by outbursts or uncontrollable laughing or crying and in the majority of patients, the outbursts being involuntary and incompatible with the patients’ emotional state. PBA is a behavioral syndrome reported to be displayed in 28–52% of stroke patients with first or multiple strokes, and incidence may be higher in patients who have had prior stroke events, and higher in females. There is typically involvement of glutaminergic, serotoninergic and dopaminergic neuronal circuits of the corticolimbic-subcorticothalamic-pontocerebellar network. PBA is now understood to be a disinhibition syndrome in which specific pathways involving serotonin and glutamate are disrupted or modulated causing reduced cortical inhibition of a cerebellar/brainstem-situated “emotional” laughing or crying focal center. Stroke-induced disruption of one or more neuronal pathway circuits may “disinhibit” voluntary laughing and crying making the process involuntary. With a “new” treatment currently being marketed to treat PBA patients, this article will delve into the neurological and physiological basis for PBA in stroke, and review progress with the diagnosis and treatment of PBA. PMID:26693049

  18. Pseudobulbar affect (PBA) in an incident ALS cohort: results from the Apulia registry (SLAP).

    PubMed

    Tortelli, Rosanna; Copetti, Massimiliano; Arcuti, Simona; Tursi, Marianna; Iurillo, Annalisa; Barulli, Maria Rosaria; Cortese, Rosa; Capozzo, Rosa; D'Errico, Eustachio; Marin, Benoit; Simone, Isabella Laura; Logroscino, Giancarlo

    2016-02-01

    The aim of this study is to investigate the frequency and the clinical correlations of pseudobulbar affect (PBA) in a population-based incident cohort of ALS patients. Incident ALS cases, diagnosed in 2011 and 2012, according to El Escorial criteria were enrolled from a prospective population-based registry in Apulia, Southern Italy. Neurological status was assessed using a standard neurological examination and the revised ALS Functional Rating Scale (ALSFRSr). The Center for Neurologic Study-Lability Scale (CNS-LS), a self-administered questionnaire, was used to evaluate the presence and severity of PBA. Total scores range from 7 to 35. A score ≥13 was used to identify the presence of PBA. One-hundred thirty-two sporadic incident ALS cases were enrolled. Median disease duration was 20 months (range 2-143), median onset-diagnosis interval (ODI) 12 months (range 2-131), median ALSFRSr at baseline 36/48 (range 2-47) and median ALSFRSr bulbar sub-score 10/12 (range 0-12). Neurological examination revealed presence of PBA in 34/132 patients (26%). Pathological CNS-LS score was found in 45/132 patients (34%). Median total CNS-LS score was 9/35 (range 7-29). The subgroup with pathological CNS-LS was characterized by a short disease duration from symptom onset, ODI, time to diffusion to a second region, time to generalization and ALSFRSr bulbar sub-score, bulbar onset, "definite" diagnostic category, bulbar upper motor-neuron involvement and presence of PBA at neurological examination. In population-based setting, one-third of ALS patients present PBA at diagnosis. The presence of PBA is associated with bulbar UMN involvement and markers of a more severe phenotype.

  19. 34 CFR 12.10 - How is a Public Benefit Allowance (PBA) calculated?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... health clinic and for special education of the physically handicapped. Entity C would receive a basic PBA of 50% (as a college or university), a 20% accreditation organization allowance (accredited college or university), a 10% public service training organization allowance (ROTC), a 10% student health...

  20. 34 CFR 12.10 - How is a Public Benefit Allowance (PBA) calculated?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... proposing to use the surplus Federal real property to add a new physical education program. Entity A would... 34 Education 1 2011-07-01 2011-07-01 false How is a Public Benefit Allowance (PBA) calculated? 12.10 Section 12.10 Education Office of the Secretary, Department of Education DISPOSAL AND...

  1. 34 CFR 12.10 - How is a Public Benefit Allowance (PBA) calculated?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... proposing to use the surplus Federal real property to add a new physical education program. Entity A would... 34 Education 1 2010-07-01 2010-07-01 false How is a Public Benefit Allowance (PBA) calculated? 12.10 Section 12.10 Education Office of the Secretary, Department of Education DISPOSAL AND...

  2. 34 CFR 12.10 - How is a Public Benefit Allowance (PBA) calculated?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... proposing to use the surplus Federal real property to add a new physical education program. Entity A would... 34 Education 1 2013-07-01 2013-07-01 false How is a Public Benefit Allowance (PBA) calculated? 12.10 Section 12.10 Education Office of the Secretary, Department of Education DISPOSAL AND...

  3. 34 CFR 12.10 - How is a Public Benefit Allowance (PBA) calculated?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... proposing to use the surplus Federal real property to add a new physical education program. Entity A would... 34 Education 1 2014-07-01 2014-07-01 false How is a Public Benefit Allowance (PBA) calculated? 12.10 Section 12.10 Education Office of the Secretary, Department of Education DISPOSAL AND...

  4. mulPBA: an efficient multiple protein structure alignment method based on a structural alphabet.

    PubMed

    Léonard, Sylvain; Joseph, Agnel Praveen; Srinivasan, Narayanaswamy; Gelly, Jean-Christophe; de Brevern, Alexandre G

    2014-04-01

    The increasing number of available protein structures requires efficient tools for multiple structure comparison. Indeed, multiple structural alignments are essential for the analysis of function, evolution and architecture of protein structures. For this purpose, we proposed a new web server called multiple Protein Block Alignment (mulPBA). This server implements a method based on a structural alphabet to describe the backbone conformation of a protein chain in terms of dihedral angles. This 'sequence-like' representation enables the use of powerful sequence alignment methods for primary structure comparison, followed by an iterative refinement of the structural superposition. This approach yields alignments superior to most of the rigid-body alignment methods and highly comparable with the flexible structure comparison approaches. We implement this method in a web server designed to do multiple structure superimpositions from a set of structures given by the user. Outputs are given as both sequence alignment and superposed 3D structures visualized directly by static images generated by PyMol or through a Jmol applet allowing dynamic interaction. Multiple global quality measures are given. Relatedness between structures is indicated by a distance dendogram. Superimposed structures in PDB format can be also downloaded, and the results are quickly obtained. mulPBA server can be accessed at www.dsimb.inserm.fr/dsimb_tools/mulpba/ .

  5. Decomposition Studies of Triphenylboron, Diphenylborinic Acid and Phenylboric Acid in Aqueous Alkaline Solutions Containing Copper

    SciTech Connect

    Crawford, C.L.; Peterson, R. A.

    1997-02-11

    This report documents the copper-catalyzed chemical kinetics of triphenylboron, diphenylborinic acid and phenylboric acid (3PB, 2PB and PBA) in aqueous alkaline solution contained in carbon-steel vessels between 40 and 70 degrees C.

  6. Low energy spin dynamics of a quantum ferrimagnetic chain, NiCu(pba)(H 2O) 32H 2O

    NASA Astrophysics Data System (ADS)

    Fujiwara, N.; Hagiwara, M.

    2000-01-01

    Nuclear magnetic resonance (NMR) for 1H nuclei was performed in a Heisenberg chain with alternating spins S=1 and 1/2, NiCu(pba)(H 2O) 32H 2O (pba=1,3-propylenebis (oxamato)) from 4.2 to 280 K. The relaxation rate (1/ T1) is proportional to 1/ H ( H is applied field), whereas the temperature dependence is weak and is almost constant at high temperatures. The temperature and field dependences are investigated on the basis of the spin-wave theory.

  7. Sodium phenylbutyrate decreases plasma branched-chain amino acids in patients with urea cycle disorders.

    PubMed

    Burrage, Lindsay C; Jain, Mahim; Gandolfo, Laura; Lee, Brendan H; Nagamani, Sandesh C S

    2014-01-01

    Sodium phenylbutyrate (NaPBA) is a commonly used medication for the treatment of patients with urea cycle disorders (UCDs). Previous reports involving small numbers of patients with UCDs have shown that NaPBA treatment can result in lower plasma levels of the branched-chain amino acids (BCAA) but this has not been studied systematically. From a large cohort of patients (n=553) with UCDs enrolled in the Longitudinal Study of Urea Cycle Disorders, a collaborative multicenter study of the Urea Cycle Disorders Consortium, we evaluated whether treatment with NaPBA leads to a decrease in plasma BCAA levels. Our analysis shows that NaPBA use independently affects the plasma BCAA levels even after accounting for multiple confounding covariates. Moreover, NaPBA use increases the risk for BCAA deficiency. This effect of NaPBA seems specific to plasma BCAA levels, as levels of other essential amino acids are not altered by its use. Our study, in an unselected population of UCD subjects, is the largest to analyze the effects of NaPBA on BCAA metabolism and potentially has significant clinical implications. Our results indicate that plasma BCAA levels should to be monitored in patients treated with NaPBA since patients taking the medication are at increased risk for BCAA deficiency. On a broader scale, these findings could open avenues to explore NaPBA as a therapy in maple syrup urine disease and other common complex disorders with dysregulation of BCAA metabolism. PMID:25042691

  8. Development of phenylboronic acid-functionalized nanoparticles for emodin delivery

    PubMed Central

    Wang, Bo; Chen, Limin; Sun, Yingjuan; Zhu, Youliang; Sun, Zhaoyan; An, Tiezhu; Li, Yuhua; Lin, Yuan; Fan, Daping; Wang, Qian

    2015-01-01

    Stable and monodisperse phenylboronic acid-functionalized nanoparticles (PBA-NPs) were fabricated using 3-((acrylamido)methyl)phenylboronic acid homopolymer (PBAH) via solvent displacement technique. The effect of operating parameters, including stirring time, initial polymer concentration and the proportion of methanol on the self-assembly process were systematically investigated. The diameters of the PBA-NPs were increased as increasing the initial PBAH concentration and the proportion of methanol. Likewise, there was a linear dependence between the size of self-assembled nanoparticles and the polymer concentration. Moreover, the dissipative particle dynamics (DPD) simulation technique was used to investigate the mechanism of self-assembly behavior of PBAH, which indicated that the interior of PBA-NPs was hydrophobic and compact, and the boronic acid groups were displayed on both the outermost and interior of PBA-NPs. The resulting PBA-NPs could successfully encapsulate emodin through PBA-diol interaction and the encapsulation efficiency (EE%) and drug loading content (DLC%) of drug-loaded PBA-NPs were 78% and 2.1%, respectively. Owing to the acid-labile feature of the boronate linkage, a reduction in environmental pH from pH 7.4 to 5.0 could trigger the disassociation of the boronate ester bonds, which could accelerate the drug release from PBA-Emodin-NPs. Besides, PBA-Emodin-NPs showed a much higher cytotoxicity to HepG2 cells (cancer cells) than that to MC-3T3-E1 cells (normal cells). These results imply that PBA-NPs would be a promising scaffold for the delivery of polyphenolic drugs. PMID:25960874

  9. Biological Monitoring of 3-Phenoxybenzoic Acid in Urine by an Enzyme -Linked Immunosorbent Assay

    EPA Science Inventory

    An enzyme-linked immunosorbent assay (ELISA) method was employed for determination of the pyrethroid biomarker, 3-phenoxybenzoic acid (3-PBA) in human urine samples. The optimized coating antigen concentration was 0.5 ng/mL with a dilution of 1:4000 for the 3-PBA antibody and 1:6...

  10. Correlating Physicochemical Properties of Boronic Acid-Chitosan Conjugates to Glucose Adsorption Sensitivity

    PubMed Central

    Asantewaa, Yaa; Aylott, Jonathan; Burley, Jonathan C.; Billa, Nashiru; Roberts, Clive J.

    2012-01-01

    Phenyl boronic acid (PBA), which is known to interact with glucose, was covalently bonded to chitosan by direct reductive N-alkylation of chitosan with 4-formylphenylboronic acid (4-FPBA). Evidence of PBA bonding on chitosan was assessed by FTIR, ToF-SIMS, SEM, DSC and glucose adsorption sensitivity measurements. FTIR spectra showed strong signals at 1560 and 630 cm−1 indicating the formation of p-substituted benzene. Similarly, ToF-SIMS analyses on the conjugates registered fragments of boron ion (B−) at 11.0 m/z whose intensity increased in proportion to 4-FPBA loading. The degree to which PBA was bonded to chitosan was related to the 4-FPBA load used in the reaction (termed F1 through to F6 with increasing 4-FPBA load). Glucose adsorption sensitivity to PBA-bonded chitosan was directly related to the amount of PBA functionality within the conjugates and the physical nature of the matrices (porous or crystalline). Topographic analysis by SEM revealed that PBA-chitosan conjugates F1, F2 and F3 have porous matrices and their sensitivity to glucose adsorption was directly proportional to the degree of PBA substitution onto chitosan. Conversely, conjugates F4, F5 and F6 appeared crystalline under SEM and glucose adsorption sensitivity decreased in proportion to amount of PBA bonded to chitosan. The crystalline nature of the conjugates was confirmed by DSC, where the exothermic event related to the melting of the bonded PBA moiety, occurred at 338 °C. Thus, decreased sensitivity to glucose adsorption by the conjugates can be ascribed to the crystallinity imparted by increased content of the bonded PBA moiety, providing an optimal loading of PBA in terms of maximizing response to glucose. PMID:24300397

  11. Synthesis of novel amphiphilic hyaluronan containing-aromatic fatty acids for fabrication of polymeric micelles.

    PubMed

    Matelová, Alena; Huerta-Angeles, Gloria; Šmejkalová, Daniela; Brůnová, Zdislava; Dušek, Jan; Vícha, Robert; Velebný, Vladimír

    2016-10-20

    Novel hydrophobized hyaluronan (HA) derivatives, containing ω-phenylalkanoic acids (ω-PAA, 4-phenylbutyric acid, 6-phenylhexanoic, 8-phenyloctanoic or 11-tolylundecanoic acids) were prepared by esterification. Mixed anhydrides obtained after reaction of the carboxyl acid moiety and benzoyl chloride were found to be active acylating agents, affording hydrophobized HA in good yield and under mild conditions. The reactivity of the aromatic fatty acids towards esterification has decreased with the increasing length of the aliphatic spacer between the aromatic substituent and carboxylic acid moiety. The novel HA derivatives self-assembled from very low concentrations and were found to be non-cytotoxic. The potential use of ω-phenylalkanoic acids grafted-HA towards drug delivery applications was demonstrated by hydrophobic drugs (resveratrol and retinyl palmitate) encapsulation. The drug loading capacity of the novel HA derivatives was significantly improved most likely because of π⋯π interactions between the micelle core and loaded hydrophobic aromatic compound.

  12. Synthesis of novel amphiphilic hyaluronan containing-aromatic fatty acids for fabrication of polymeric micelles.

    PubMed

    Matelová, Alena; Huerta-Angeles, Gloria; Šmejkalová, Daniela; Brůnová, Zdislava; Dušek, Jan; Vícha, Robert; Velebný, Vladimír

    2016-10-20

    Novel hydrophobized hyaluronan (HA) derivatives, containing ω-phenylalkanoic acids (ω-PAA, 4-phenylbutyric acid, 6-phenylhexanoic, 8-phenyloctanoic or 11-tolylundecanoic acids) were prepared by esterification. Mixed anhydrides obtained after reaction of the carboxyl acid moiety and benzoyl chloride were found to be active acylating agents, affording hydrophobized HA in good yield and under mild conditions. The reactivity of the aromatic fatty acids towards esterification has decreased with the increasing length of the aliphatic spacer between the aromatic substituent and carboxylic acid moiety. The novel HA derivatives self-assembled from very low concentrations and were found to be non-cytotoxic. The potential use of ω-phenylalkanoic acids grafted-HA towards drug delivery applications was demonstrated by hydrophobic drugs (resveratrol and retinyl palmitate) encapsulation. The drug loading capacity of the novel HA derivatives was significantly improved most likely because of π⋯π interactions between the micelle core and loaded hydrophobic aromatic compound. PMID:27474668

  13. Phenylbutyric acid protects against carbon tetrachloride-induced hepatic fibrogenesis in mice

    SciTech Connect

    Wang, Jian-Qing; Chen, Xi; Zhang, Cheng; Tao, Li; Zhang, Zhi-Hui; Liu, Xiao-Qian; Xu, Yuan-Bao; Wang, Hua; Li, Jun; Xu, De-Xiang

    2013-01-15

    A recent report showed that the unfolded protein response (UPR) signaling was activated in the pathogenesis of carbon tetrachloride (CCl{sub 4})-induced hepatic fibrosis. Phenylbutyric acid (PBA) is a well-known chemical chaperone that inhibits endoplasmic reticulum (ER) stress and unfolded protein response (UPR) signaling. In the present study, we investigated the effects of PBA on CCl{sub 4}-induced hepatic fibrosis in mice. All mice were intraperitoneally (i.p.) injected with CCl{sub 4} (0.15 ml/kg BW, twice per week) for 8 weeks. In CCl{sub 4} + PBA group, mice were i.p. injected with PBA (150 mg/kg, twice per day) from the beginning of CCl{sub 4} injection to the end. As expected, PBA significantly attenuated CCl{sub 4}-induced hepatic ER stress and UPR activation. Although PBA alleviated, only to a less extent, hepatic necrosis, it obviously inhibited CCl{sub 4}-induced tumor necrosis factor alpha (TNF-α) and transforming growth factor beta (TGF-β). Moreover, PBA inhibited CCl{sub 4}-induced hepatic nuclear factor kappa B (NF-κB) p65 translocation and extracellular signal-regulated kinase (ERK) and c-Jun N-terminal Kinase (JNK) phosphorylation. Interestingly, CCl{sub 4}-induced α-smooth muscle actin (α-SMA), a marker for the initiation phase of HSC activation, was significantly attenuated in mice pretreated with PBA. Correspondingly, CCl{sub 4}-induced hepatic collagen (Col)1α1 and Col1α2, markers for the perpetuation phase of HSC activation, were inhibited in PBA-treated mice. Importantly, CCl{sub 4}-induced hepatic fibrosis, as determined using Sirius red staining, was obviously attenuated by PBA. In conclusion, PBA prevents CCl{sub 4}-induced hepatic fibrosis through inhibiting hepatic inflammatory response and HSC activation. Highlights: ► CCl{sub 4} induces hepatic ER stress, inflammation, HSC activation and hepatic fibrosis. ► PBA alleviates CCl{sub 4}-induced hepatic ER stress and UPR signaling activation. ► PBA inhibits CCl{sub 4}-induced

  14. pH-Activated Targeting Drug Delivery System Based on the Selective Binding of Phenylboronic Acid.

    PubMed

    Zhao, Dan; Xu, Jia-Qi; Yi, Xiao-Qing; Zhang, Quan; Cheng, Si-Xue; Zhuo, Ren-Xi; Li, Feng

    2016-06-15

    Phenylboronic acid (PBA) is a tumor-targeting molecule, but its nonspecific interaction with normal cells or other components containing cis-diol residues undoubtedly limits its potential application in tumor-targeting drug delivery. Herein, we developed fructose-coated mixed micelles via PBA-terminated polyethylene glycol monostearate (PBA-PEG-C18) and Pluronic P123 (PEG20-PPG70-PEG20) to solve this problem, as the stability of borate formed by PBA and fructose was dramatically dependent on pH. The fluorescence spectroscopic results indicated that the borate formed by PBA and fructose decomposed at a decreased pH, and better binding between PBA and sialic acid (SA) was observed at a low pH. These results implied that the fructose groups decorated on the surface of the micelles could be out-competed by SA at a low pH. In vitro uptake and cytotoxicity studies demonstrated that the fructose coating on the mixed micelles improved the endocytosis and enhanced the cytotoxicity of drug-loaded mixed micelles in HepG2 cells but reduced the cytotoxicity in normal cells. These results demonstrate that a simple decorating strategy may facilitate PBA-targeted nanoparticles for tumor-specific drug delivery. PMID:27229625

  15. Degradation of 3-Phenoxybenzoic Acid by a Bacillus sp

    PubMed Central

    Chen, Shaohua; Hu, Wei; Xiao, Ying; Deng, Yinyue; Jia, Jianwen; Hu, Meiying

    2012-01-01

    3-Phenoxybenzoic acid (3-PBA) is of great environmental concern with regards to endocrine disrupting activity and widespread occurrence in water and soil, yet little is known about microbial degradation in contaminated regions. We report here that a new bacterial strain isolated from soil, designated DG-02, was shown to degrade 95.6% of 50 mg·L−1 3-PBA within 72 h in mineral salt medium (MSM). Strain DG-02 was identified as Bacillus sp. based on the morphology, physio-biochemical tests and 16S rRNA sequence. The optimum conditions for 3-PBA degradation were determined to be 30.9°C and pH 7.7 using response surface methodology (RSM). The isolate converted 3-PBA to produce 3-(2-methoxyphenoxy) benzoic acid, protocatechuate, phenol, and 3,4-dihydroxy phenol, and subsequently transformed these compounds with a qmax, Ks and Ki of 0.8615 h−1, 626.7842 mg·L−1 and 6.7586 mg·L−1, respectively. A novel microbial metabolic pathway for 3-PBA was proposed on the basis of these metabolites. Inoculation of strain DG-02 resulted in a higher degradation rate on 3-PBA than that observed in the non-inoculated soil. Moreover, the degradation process followed the first-order kinetics, and the half-life (t1/2) for 3-PBA was greatly reduced as compared to the non-inoculated control. This study highlights an important potential application of strain DG-02 for the in situ bioremediation of 3-PBA contaminated environments. PMID:23226289

  16. Recent progress in electrochemical biosensors based on phenylboronic acid and derivatives.

    PubMed

    Anzai, Jun-Ichi

    2016-10-01

    This review provides an overview of recent progress made in the development of electrochemical biosensors based on phenylboronic acid (PBA) and its derivatives. PBAs are known to selectively bind 1,2- and 1,3-diols to form negatively charged boronate esters in neutral aqueous media and have been used to construct electrochemical glucose sensors because of this selective binding. PBA-modified metal and carbon electrodes have been widely studied as voltammetric and potentiometric glucose sensors. In some cases, ferroceneboronic acid or ferrocene-modified phenylboronic acids are used as sugar-selective redox compounds. Another option for sensors using PBA-modified electrodes is potentiometric detection, in which the changes in surface potential of the electrodes are detected as an output signal. An ion-sensitive field effect transistor (FET) has been used as a signal transducer in potentiometric sensors. Glycoproteins, such as glycated hemoglobin (HbA1c), avidin, and serum albumin can also be detected by PBA-modified electrodes because they contain hydrocarbon chains on the surface. HbA1c sensors are promising alternatives to enzyme-based glucose sensors for monitoring blood glucose levels over the preceding 2-3months. In addition, PBA-modified electrodes can be used to detect a variety of compounds including hydroxy acids and fluoride (F(-)) ions. PBA-based F(-) ion sensors may be useful if reagentless sensors can be developed.

  17. Recent progress in electrochemical biosensors based on phenylboronic acid and derivatives.

    PubMed

    Anzai, Jun-Ichi

    2016-10-01

    This review provides an overview of recent progress made in the development of electrochemical biosensors based on phenylboronic acid (PBA) and its derivatives. PBAs are known to selectively bind 1,2- and 1,3-diols to form negatively charged boronate esters in neutral aqueous media and have been used to construct electrochemical glucose sensors because of this selective binding. PBA-modified metal and carbon electrodes have been widely studied as voltammetric and potentiometric glucose sensors. In some cases, ferroceneboronic acid or ferrocene-modified phenylboronic acids are used as sugar-selective redox compounds. Another option for sensors using PBA-modified electrodes is potentiometric detection, in which the changes in surface potential of the electrodes are detected as an output signal. An ion-sensitive field effect transistor (FET) has been used as a signal transducer in potentiometric sensors. Glycoproteins, such as glycated hemoglobin (HbA1c), avidin, and serum albumin can also be detected by PBA-modified electrodes because they contain hydrocarbon chains on the surface. HbA1c sensors are promising alternatives to enzyme-based glucose sensors for monitoring blood glucose levels over the preceding 2-3months. In addition, PBA-modified electrodes can be used to detect a variety of compounds including hydroxy acids and fluoride (F(-)) ions. PBA-based F(-) ion sensors may be useful if reagentless sensors can be developed. PMID:27287174

  18. Phase-separation-induced single-crystal morphology in poly(L-lactic acid) blended with poly(1,4-butylene adipate) at specific composition.

    PubMed

    Nurkhamidah, Siti; Woo, E M

    2011-11-17

    The single-crystal morphology of poly(L-lactic acid) (PLLA) in blending with poly(butylene adipate) (PBA) in PLLA/PBA blends was for the first time reported in melt crystallization. At crystallization temperature (T(c)) = 110 °C, by adding 30 wt % PBA into PLLA, the lamellae exhibit six-stalk dendrites with single-crystal packing. Phase separation and crystallization took place simultaneously at T(c) = 110 °C in PLLA/PBA (70/30) blend, leading to discrete PBA domains and continuous PLLA domains. For PLLA/PBA (70/30) blend, all PBA were rejected from the growth front of PLLA crystals, expelled, and crystallized at ambient temperature as ring-banded PBA spherulites inside the discrete domains only, resulting in a favorable environment for formation of PLLA single crystals in the continuous domain. Atomic force microscopy (AFM) observation on individual crystallites reveals that lozenge-shaped single crystals were packed with a clockwise spiral pattern, stacked in 1-3 layers, and these lozenge-shaped crystals are aligned six hexasected directions into hexastalk dendrites with occasional side branches that are also aligned at 60° to main branches. The monolamellar thickness of lozenge-shaped single crystals was measured to be about 13-34 nm, and the dimension is about 0.8-3 μm along the short axis and 1.6-5 μm along the long axis. Typically, three layers of single crystals are stacked one on another; the lozenge crystals on the bottom layer are about twice as large as those on the top layer, forming a pyramid shape in the depth direction. Formation mechanisms of single crystals in melt-crystallized PLLA/PBA blend from 700 nm film thickness are discussed in correlation with exact phase separation at 30 wt % PBA. PMID:21962158

  19. Endoplasmic reticulum stress drives proteinuria-induced kidney lesions via Lipocalin 2

    PubMed Central

    El Karoui, Khalil; Viau, Amandine; Dellis, Olivier; Bagattin, Alessia; Nguyen, Clément; Baron, William; Burtin, Martine; Broueilh, Mélanie; Heidet, Laurence; Mollet, Géraldine; Druilhe, Anne; Antignac, Corinne; Knebelmann, Bertrand; Friedlander, Gérard; Bienaimé, Frank; Gallazzini, Morgan; Terzi, Fabiola

    2016-01-01

    In chronic kidney disease (CKD), proteinuria results in severe tubulointerstitial lesions, which ultimately lead to end-stage renal disease. Here we identify 4-phenylbutyric acid (PBA), a chemical chaperone already used in humans, as a novel therapeutic strategy capable to counteract the toxic effect of proteinuria. Mechanistically, we show that albumin induces tubular unfolded protein response via cytosolic calcium rise, which leads to tubular apoptosis by Lipocalin 2 (LCN2) modulation through ATF4. Consistent with the key role of LCN2 in CKD progression, Lcn2 gene inactivation decreases ER stress-induced apoptosis, tubulointerstitial lesions and mortality in proteinuric mice. More importantly, the inhibition of this pathway by PBA protects kidneys from morphological and functional degradation in proteinuric mice. These results are relevant to human CKD, as LCN2 is increased in proteinuric patients. In conclusion, our study identifies a therapeutic strategy susceptible to improve the benefit of RAS inhibitors in proteinuria-induced CKD progression. PMID:26787103

  20. Key Techniques and Risk Management for the Application of the Pile-Beam-Arch (PBA) Excavation Method: A Case Study of the Zhongjie Subway Station

    PubMed Central

    Guan, Yong-ping; Zhao, Wen; Li, Shen-gang; Zhang, Guo-bin

    2014-01-01

    The design and construction of shallow-buried tunnels in densely populated urban areas involve many challenges. The ground movements induced by tunneling effects pose potential risks to infrastructure such as surface buildings, pipelines, and roads. In this paper, a case study of the Zhongjie subway station located in Shenyang, China, is examined to investigate the key construction techniques and the influence of the Pile-Beam-Arch (PBA) excavation method on the surrounding environment. This case study discusses the primary risk factors affecting the environmental safety and summarizes the corresponding risk mitigation measures and key techniques for subway station construction using the PBA excavation method in a densely populated urban area. PMID:25221783

  1. Key techniques and risk management for the application of the Pile-Beam-Arch (PBA) excavation method: a case study of the Zhongjie subway station.

    PubMed

    Guan, Yong-ping; Zhao, Wen; Li, Shen-gang; Zhang, Guo-bin

    2014-01-01

    The design and construction of shallow-buried tunnels in densely populated urban areas involve many challenges. The ground movements induced by tunneling effects pose potential risks to infrastructure such as surface buildings, pipelines, and roads. In this paper, a case study of the Zhongjie subway station located in Shenyang, China, is examined to investigate the key construction techniques and the influence of the Pile-Beam-Arch (PBA) excavation method on the surrounding environment. This case study discusses the primary risk factors affecting the environmental safety and summarizes the corresponding risk mitigation measures and key techniques for subway station construction using the PBA excavation method in a densely populated urban area. PMID:25221783

  2. Magnetization of AN S=1/2 and 1 Ferrimagnetic Chain NiCu(pba)(D2O)32D2O in High Magnetic Fields

    NASA Astrophysics Data System (ADS)

    Hagiwara, M.; Narumi, Y.; Tatani, K.; Kindo, K.; Minami, K.

    2004-11-01

    We report the results of high field magnetization measurements on a powder sample of NiCu (pba)(D2O)32D2O (pba = 1,3-propylenebis(oxamato), C7H6N2O6) which is regarded as a ferrimagnetic chain composed of spins S = 1/2 and 1. From a fit of the susceptibility of this compound to numerical calculations (exact diagonalization for ten sites), we evaluated the exchange constant J/kB = 121 K. In the magnetization measurements at 10 K up to 50 T, we observed a magnetization plateau of about 1.1 μB/(formula unit) corresponding to about one-third of the saturated magnetization. The increase of the magnetization at low magnetic fields is discussed and compared with some calculations.

  3. Electrochemical Determination of Glycoalkaloids Using a Carbon Nanotubes-Phenylboronic Acid Modified Glassy Carbon Electrode

    PubMed Central

    Wang, Huiying; Liu, Mingyue; Hu, Xinxi; Li, Mei; Xiong, Xingyao

    2013-01-01

    A versatile strategy for electrochemical determination of glycoalkaloids (GAs) was developed by using a carbon nanotubes-phenylboronic acid (CNTs-PBA) modified glassy carbon electrode. PBA reacts with α-solanine and α-chaconine to form a cyclic ester, which could be utilized to detect GAs. This method allowed GA detection from 1 μM to 28 μM and the detection limit was 0.3 μM. Affinity interaction of GAs and immobilized PBA caused an essential change of the peak current. The CNT-PBA modified electrodes were sensitive for detection of GAs, and the peak current values were in quite good agreement with those measured by the sensors. PMID:24287539

  4. Controllable layer-by-layer assembly of PVA and phenylboronic acid-derivatized chitosan.

    PubMed

    Zhang, Dan; Yu, Guanghua; Long, Zhu; Yang, Guihua; Wang, Bin

    2016-04-20

    Phenylboronic acid-derivatized chitosan (chitosan-PBA) were prepared by grafting small molecules bearing phenylboronic acid groups onto chitosan with N-hydroxysuccinimide (NHS) and N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (EDC) as a coupling reagent pair. Self-assembly multilayer thin films of chitosan-PBA and poly(vinyl alcohol) were subsequently produced under pH control on supporting surfaces, either a silicon wafer or polystyrene latex particles. The driving force of the self-assembly was the ester formation of phenylboronic acid containing polymers with PVA, which can be "turned off" by simple pH control. PMID:26876848

  5. Enhanced Sensitivity for Hydrogen Peroxide Detection: Polydiacetylene Vesicles with Phenylboronic Acid Head Group.

    PubMed

    Jia, Chen; Tang, Jie; Lu, Shengguo; Han, Yuwang; Huang, He

    2016-01-01

    It was recently reported that, besides UV irradiated polymerization, polymerization of diacetylene compounds could also been initiated by radicals generated from enzyme catalyzed hydrogen peroxide (H2O2) decomposition. A new optical sensing method for H2O2 was proposed based on this phenomenon. However, the sensitivity of this method is relatively lower than existed ones. In the present work, phenylboronic acid (PBA) functionalized 10, 12-pentacosadiynoic acid (PDA-PBA) was synthesized and its vesicles were formed successfully as colorimetric sensor for H2O2 detection. It was found that color change during the polymerization of vesicles composed of the PBA modified monomer is much stronger than that of the non-modified one. The response of PDA-PBA vesicles to H2O2 is 16 times more sensitive than that of the PDA. The absorption of PDA-PBA at 650 nm is linearly related to the concentration of H2O2 and a detection limit of ~5 μM could be achieved.

  6. Glucose-Responsive Hybrid Nanoassemblies in Aqueous Solutions: Ordered Phenylboronic Acid within Intermixed Poly(4-hydroxystyrene)-block-poly(ethylene oxide) Block Copolymer.

    PubMed

    Matuszewska, Alicja; Uchman, Mariusz; Adamczyk-Woźniak, Agnieszka; Sporzyński, Andrzej; Pispas, Stergios; Kováčik, Lubomír; Štěpánek, Miroslav

    2015-12-14

    Coassembly behavior of the double hydrophilic block copolymer poly(4-hydroxystyrene)-block-poly(ethylene oxide) (PHOS-PEO) with three amphiphilic phenylboronic acids (PBA) differing in hydrophobicity, 4-dodecyloxyphenylboronic acid (C12), 4-octyloxyphenylboronic acid (C8), and 4-isobutoxyphenylboronic acid (i-Bu) was studied in alkaline aqueous solutions and in mixtures of NaOHaq/THF by spin-echo (1)H NMR spectroscopy, dynamic and electrophoretic light scattering, and SAXS. The study reveals that only the coassembly of C12 with PHOS-PEO provides spherical nanoparticles with intermixed PHOS and PEO blocks, containing densely packed C12 micelles. NMR measurements have shown that spatial proximity of PHOS-PEO and C12 leads to the formation of ester bonds between -OH of PHOS block and hydroxyl groups of -B(OH)2. Due to the presence of PBA moieties, the release of compounds with 1,2- or 1,3-dihydroxy groups loaded in the coassembled PHOS-PEO/PBA nanoparticles by covalent binding to PBA can be triggered by addition of a surplus of glucose that bind to PBA competitively. The latter feature has been confirmed by fluorescence measurements using Alizarin Red as a model compound. Nanoparticles were proved to exhibit swelling in response to glucose as detected by light scattering.

  7. Addition of Phenylboronic Acid to Malus domestica Pollen Tubes Alters Calcium Dynamics, Disrupts Actin Filaments and Affects Cell Wall Architecture.

    PubMed

    Fang, Kefeng; Gao, Sai; Zhang, Weiwei; Xing, Yu; Cao, Qingqin; Qin, Ling

    2016-01-01

    A key role of boron in plants is to cross-link the cell wall pectic polysaccharide rhamnogalacturonan-II (RG-II) through borate diester linkages. Phenylboronic acid (PBA) can form the same reversible ester bonds but cannot cross-link two molecules, so can be used as an antagonist to study the function of boron. This study aimed to evaluate the effect of PBA on apple (Malus domestica) pollen tube growth and the underlying regulatory mechanism. We observed that PBA caused an inhibition of pollen germination, tube growth and led to pollen tube morphological abnormalities. Fluorescent labeling, coupled with a scanning ion-selective electrode technique, revealed that PBA induced an increase in extracellular Ca2+ influx, thereby elevating the cytosolic Ca2+ concentration [Ca2+]c and disrupting the [Ca2+]c gradient, which is critical for pollen tube growth. Moreover the organization of actin filaments was severely perturbed by the PBA treatment. Immunolocalization studies and fluorescent labeling, together with Fourier-transform infrared analysis (FTIR) suggested that PBA caused an increase in the abundance of callose, de-esterified pectins and arabinogalactan proteins (AGPs) at the tip. However, it had no effect on the deposition of the wall polymers cellulose. These effects are similar to those of boron deficiency in roots and other organs, indicating that PBA can induce boron deficiency symptoms. The results provide new insights into the roles of boron in pollen tube development, which likely include regulating [Ca2+]c and the formation of the actin cytoskeleton, in addition to the synthesis and assembly of cell wall components. PMID:26886907

  8. Addition of Phenylboronic Acid to Malus domestica Pollen Tubes Alters Calcium Dynamics, Disrupts Actin Filaments and Affects Cell Wall Architecture.

    PubMed

    Fang, Kefeng; Gao, Sai; Zhang, Weiwei; Xing, Yu; Cao, Qingqin; Qin, Ling

    2016-01-01

    A key role of boron in plants is to cross-link the cell wall pectic polysaccharide rhamnogalacturonan-II (RG-II) through borate diester linkages. Phenylboronic acid (PBA) can form the same reversible ester bonds but cannot cross-link two molecules, so can be used as an antagonist to study the function of boron. This study aimed to evaluate the effect of PBA on apple (Malus domestica) pollen tube growth and the underlying regulatory mechanism. We observed that PBA caused an inhibition of pollen germination, tube growth and led to pollen tube morphological abnormalities. Fluorescent labeling, coupled with a scanning ion-selective electrode technique, revealed that PBA induced an increase in extracellular Ca2+ influx, thereby elevating the cytosolic Ca2+ concentration [Ca2+]c and disrupting the [Ca2+]c gradient, which is critical for pollen tube growth. Moreover the organization of actin filaments was severely perturbed by the PBA treatment. Immunolocalization studies and fluorescent labeling, together with Fourier-transform infrared analysis (FTIR) suggested that PBA caused an increase in the abundance of callose, de-esterified pectins and arabinogalactan proteins (AGPs) at the tip. However, it had no effect on the deposition of the wall polymers cellulose. These effects are similar to those of boron deficiency in roots and other organs, indicating that PBA can induce boron deficiency symptoms. The results provide new insights into the roles of boron in pollen tube development, which likely include regulating [Ca2+]c and the formation of the actin cytoskeleton, in addition to the synthesis and assembly of cell wall components.

  9. Addition of Phenylboronic Acid to Malus domestica Pollen Tubes Alters Calcium Dynamics, Disrupts Actin Filaments and Affects Cell Wall Architecture

    PubMed Central

    Fang, Kefeng; Gao, Sai; Zhang, Weiwei; Xing, Yu; Cao, Qingqin; Qin, Ling

    2016-01-01

    A key role of boron in plants is to cross-link the cell wall pectic polysaccharide rhamnogalacturonan-II (RG-II) through borate diester linkages. Phenylboronic acid (PBA) can form the same reversible ester bonds but cannot cross-link two molecules, so can be used as an antagonist to study the function of boron. This study aimed to evaluate the effect of PBA on apple (Malus domestica) pollen tube growth and the underlying regulatory mechanism. We observed that PBA caused an inhibition of pollen germination, tube growth and led to pollen tube morphological abnormalities. Fluorescent labeling, coupled with a scanning ion-selective electrode technique, revealed that PBA induced an increase in extracellular Ca2+ influx, thereby elevating the cytosolic Ca2+ concentration [Ca2+]c and disrupting the [Ca2+]c gradient, which is critical for pollen tube growth. Moreover the organization of actin filaments was severely perturbed by the PBA treatment. Immunolocalization studies and fluorescent labeling, together with Fourier-transform infrared analysis (FTIR) suggested that PBA caused an increase in the abundance of callose, de-esterified pectins and arabinogalactan proteins (AGPs) at the tip. However, it had no effect on the deposition of the wall polymers cellulose. These effects are similar to those of boron deficiency in roots and other organs, indicating that PBA can induce boron deficiency symptoms. The results provide new insights into the roles of boron in pollen tube development, which likely include regulating [Ca2+]c and the formation of the actin cytoskeleton, in addition to the synthesis and assembly of cell wall components. PMID:26886907

  10. [Study on cooperating degradation of cypermethrin and 3-phenoxybenzoic acid by two bacteria strains].

    PubMed

    Xu, Yu-Xin; Sun, Ji-Quan; Li, Xiao-Hui; Li, Shun-Peng; Chen, Yi

    2007-10-01

    The microbial cooperated reaction is one of the most important forms of microbial degradation of organic pollutants. Although there were many research reports of cooperating degradation, less report on the microbial cooperated of pyrethroid degradation to be found. We have isolated one degrading-bacteria strain named CDT3 for degradation of cypermethrin, which can degraded the cypermethrin into 3-PBA and DCVA. At the same time, we also isolated another degrading-bacteria strain named as PBM11, which could get multiplication on 3-PBA as its C source and energy source. The cooperative degradation process of cypermethrin and 3-Phenoxybenzoic acid (3-PBA) using the two degrading-bacteria strain CDT3 and PBM11 was investigated. An obvious inhibition to the cypermethrin degrading-bacterium strain CDT3 (Rhodococcus sp.) by its metabolic mediate 3-PBA was found; meanwhile there is no effect on the growth of 3-PBA degrading-bacterium strain PBM11 (Pesudomonas sp.) when the concentration of cypermethrin was lower than 200 mg/L. The degradation rate of cypermethrin by both strain CDT3 and PBM11 was higher than that by CDT3 alone. The biomass of PBM11 increased along with the degradation of cypermethrin and 3-PBA, but that of CDT3 not. There was no the accumulation of 3-PBA when the simultaneous addition of strain CDT3 and PBM11, however, an obvious one within 24h if inoculation of strain PBM11 was later 24h after inoculation of strain CDT3, Subsequently the 3-PBA was degraded rapidly by strain PBM11. The strains CDT3 and PBM11 showed some characteristics of co-metabolism, however it is not actual degradation form of co-metabolism. For examples, although the degrading sub product of cypermethrin by CDT3 could be utilized, the multiplication of PBM11 could not enhance the multiplication of CDT3, implied there is no obvious relationship between the two strains. Also, to add PBM11 could eliminate the inhibition of 3-PBA to CDT3. Thus, the cooperating degradation of strains CDT3

  11. Fabrication of electrochemical interface based on boronic acid-modified pyrroloquinoline quinine/reduced graphene oxide composites for voltammetric determination of glycated hemoglobin.

    PubMed

    Zhou, Yanli; Dong, Hui; Liu, Lantao; Hao, Yuanqiang; Chang, Zhu; Xu, Maotian

    2015-02-15

    A voltammetric sensor for determination of glycated hemoglobin (HbA1c) was developed based on the composites of phenylboronic acid-modified pyrroloquinoline quinine (PBA-PQQ) and reduced graphene oxide. After the electrodeposition of reduced graphene oxide (ERGO) on the glassy carbon (GC) electrode, PQQ multilayer was decorated on the surface of the ERGO/GC electrode via potential cycling. Further modification with PBA would lead to the formation of the working electrode, namely PBA-PQQ/ERGO/GC electrode. PQQ on the electrode exhibited a quasi-reversible electrode process with 2-electron transfer and 2-proton participation, and the electron transfer efficiency was further enhanced by the introduction of ERGO layer. The complexation of PBA with HbA1c through specific boronic acid-diol recognition could cause the change of the oxidation peak current of PQQ on the electrode, which was utilized for HbA1c detection. Under the optimized conditions, the PBA-PQQ/ERGO/GC electrode provided high selectivity and high sensitivity for HbA1c detection with a linear range of 9.4-65.8 μg mL(-1) and a low detection limit of 1.25 μg mL(-1). The fabricated sensor was also successfully applied to determine the percentages of HbA1c in whole blood of healthy individuals.

  12. Phenylboronic acid-sugar grafted polymer architecture as a dual stimuli-responsive gene carrier for targeted anti-angiogenic tumor therapy.

    PubMed

    Kim, Jinhwan; Lee, Yeong Mi; Kim, Hyunwoo; Park, Dongsik; Kim, Jihoon; Kim, Won Jong

    2016-01-01

    We present a cationic polymer architecture composed of phenylboronic acid (PBA), sugar-installed polyethylenimine (PEI), and polyethylene glycol (PEG). The chemical bonding of PBA with the diol in the sugar enabled the crosslinking of low-molecular-weight (MW) PEI to form high-MW PEI, resulting in strong interaction with anionic DNA for gene delivery. Inside the cell, the binding of PBA and sugar was disrupted by either acidic endosomal pH or intracellular ATP, so gene payloads were released effectively. This dual stimuli-responsive gene release drove the polymer to deliver DNA for high transfection efficiency with low cytotoxicity. In addition, PBA moiety with PEGylation facilitated the binding of polymer/DNA polyplexes to sialylated glycoprotein which is overexpressed on the tumor cell membrane, and thus provided high tumor targeting ability. Therapeutic application of our polymer was demonstrated as an anti-angiogenic gene delivery agent for tumor growth inhibition. Our judicious designed polymer structure based on PBA provides enormous potential as a gene delivery agent for effective gene therapy by stimuli-responsiveness and tumor targeting.

  13. Defining cutaneous molecular pathobiology of arsenicals using phenylarsine oxide as a prototype

    PubMed Central

    Srivastava, Ritesh K.; Li, Changzhao; Weng, Zhiping; Agarwal, Anupam; Elmets, Craig A.; Afaq, Farrukh; Athar, Mohammad

    2016-01-01

    Arsenicals are painful, inflammatory and blistering causing agents developed as chemical weapons in World War I/II. However, their large stockpiles still exist posing threat to public health. Phenylarsine oxide (PAO), a strong oxidant and a prototype arsenical is tested for its suitability to defining molecular mechanisms underlying arsenicals-mediated tissue injury. Topically applied PAO induces cutaneous erythema, edema and micro-blisters. These gross inflammatory responses were accompanied by the enhanced production of pro-inflammatory cytokines, ROS and unfolded protein response (UPR) signaling activation. To demonstrate the involvement of UPR in the pathobiology of these lesions, we employed chemical chaperone, 4-phenylbutyric acid (4-PBA) which attenuates UPR. 4-PBA significantly reduced PAO-induced inflammation and blistering. Similar to its effects in murine epidermis, a dose- and time-dependent upregulation of ROS, cytokines, UPR proteins (GRP78, p-PERK, p-eIF2α, ATF4 and CHOP) and apoptosis were observed in PAO-treated human skin keratinocytes NHEK and HaCaT. In addition, 4-PBA significantly restored these molecular alterations in these cells. Employing RNA interference (RNAi)-based approaches, CHOP was found to be a key regulator of these responses. These effects are similar to those manifested by lewisite suggesting that PAO could be used as a prototype of arsenicals to define the molecular pathogenesis of chemical injury. PMID:27725709

  14. Chemical chaperones mediate increased secretion of mutant α1-antitrypsin (α1-AT) Z: A potential pharmacological strategy for prevention of liver injury and emphysema in α1-AT deficiency

    PubMed Central

    Burrows, Jon A. J.; Willis, Lauren K.; Perlmutter, David H.

    2000-01-01

    In α1-AT deficiency, a misfolded but functionally active mutant α1-ATZ (α1-ATZ) molecule is retained in the endoplasmic reticulum of liver cells rather than secreted into the blood and body fluids. Emphysema is thought to be caused by the lack of circulating α1-AT to inhibit neutrophil elastase in the lung. Liver injury is thought to be caused by the hepatotoxic effects of the retained α1-ATZ. In this study, we show that several “chemical chaperones,” which have been shown to reverse the cellular mislocalization or misfolding of other mutant plasma membrane, nuclear, and cytoplasmic proteins, mediate increased secretion of α1-ATZ. In particular, 4-phenylbutyric acid (PBA) mediated a marked increase in secretion of functionally active α1-ATZ in a model cell culture system. Moreover, oral administration of PBA was well tolerated by PiZ mice (transgenic for the human α1-ATZ gene) and consistently mediated an increase in blood levels of human α1-AT reaching 20–50% of the levels present in PiM mice and normal humans. Because clinical studies have suggested that only partial correction is needed for prevention of both liver and lung injury in α1-AT deficiency and PBA has been used safely in humans, it constitutes an excellent candidate for chemoprophylaxis of target organ injury in α1-AT deficiency. PMID:10677536

  15. Skin tumorigenic potential of benzanthrone: prevention by ascorbic acid.

    PubMed

    Dwivedi, Neelam; Kumar, Sandeep; Ansari, Kausar M; Khanna, S K; Das, Mukul

    2013-09-01

    Benzanthrone (BA) exposed occupational workers have been found to exhibit toxicological manifestations in the skin, thus it is quite likely that long term exposure may lead to skin tumorigenicity. Thus, attempts were made to elucidate the tumor initiating and promoting potentials of pure (PBA) and commercial benzanthrone (CBA). Additionally, the preventive role of ascorbic acid (AsA) was also assessed. PBA showed tumor initiating activity while CBA demonstrated tumor initiating as well as promoting activities in two-stage mouse skin tumor protocol. Further, prior treatment of AsA to PBA and CBA followed by twice weekly application of 12-o-tetradecanoyl phorbal myristate acetate (TPA) resulted into delayed onset of tumor formation and similarly single application of 7,12-dimethylbenz [α] anthracene (DMBA) followed by twice weekly application of AsA and CBA showed an increase in the latency period. Thus, AsA showed a protective effect against CBA promoted skin tumor. Furthermore, the topical application of CBA significantly increased the levels of xenobiotic enzymes. The animals topically treated with AsA along with topical application of CBA, restored all the impairment observed in enzyme activities. Thus, this study suggested that AsA can be useful in preventing PBA and CBA induced skin tumorigenicity.

  16. Continuous colorimetric screening assays for the detection of specific L- or D-α-amino acid transaminases in enzyme libraries.

    PubMed

    Heuson, Egon; Petit, Jean-Louis; Debard, Adrien; Job, Aurélie; Charmantray, Franck; de Berardinis, Véronique; Gefflaut, Thierry

    2016-01-01

    In the course of a project devoted to the stereoselective synthesis of non-proteinogenic α-amino acids using α-transaminases (α-TA), we report the design and optimization of generic high-throughput continuous assays for the screening of α-TA libraries. These assays are based on the use of L- or D-cysteine sulfinic acid (CSA) as irreversible amino donor and subsequent sulfite titration by colorimetry. The assays' quality was assessed under screening conditions. Hit selection thresholds were accurately determined for every couple of substrates and a library of 232 putative transaminases expressed in Escherichia coli host cells was screened. The reported high throughput screening assays proved very sensitive allowing the detection with high confidence of activities as low as 10 μU (i.e., 0.01 nmol substrate converted per min). The assays were also evidenced to be stereochemically discriminant since L-CSA and D-CSA allowed the exclusive detection of L-TA and D-TA, respectively. These generic assays thus allow testing the stereoselective conversion of a wide range of α-keto acids into α-amino acids of interest. As a proof of principle, the use of 2-oxo-4-phenylbutyric acid as acceptor substrate led to the identification of 54 new α-TA offering an access to valuable L- or D-homophenylalanine. PMID:26452497

  17. Continuous colorimetric screening assays for the detection of specific L- or D-α-amino acid transaminases in enzyme libraries.

    PubMed

    Heuson, Egon; Petit, Jean-Louis; Debard, Adrien; Job, Aurélie; Charmantray, Franck; de Berardinis, Véronique; Gefflaut, Thierry

    2016-01-01

    In the course of a project devoted to the stereoselective synthesis of non-proteinogenic α-amino acids using α-transaminases (α-TA), we report the design and optimization of generic high-throughput continuous assays for the screening of α-TA libraries. These assays are based on the use of L- or D-cysteine sulfinic acid (CSA) as irreversible amino donor and subsequent sulfite titration by colorimetry. The assays' quality was assessed under screening conditions. Hit selection thresholds were accurately determined for every couple of substrates and a library of 232 putative transaminases expressed in Escherichia coli host cells was screened. The reported high throughput screening assays proved very sensitive allowing the detection with high confidence of activities as low as 10 μU (i.e., 0.01 nmol substrate converted per min). The assays were also evidenced to be stereochemically discriminant since L-CSA and D-CSA allowed the exclusive detection of L-TA and D-TA, respectively. These generic assays thus allow testing the stereoselective conversion of a wide range of α-keto acids into α-amino acids of interest. As a proof of principle, the use of 2-oxo-4-phenylbutyric acid as acceptor substrate led to the identification of 54 new α-TA offering an access to valuable L- or D-homophenylalanine.

  18. Microarray immunoassay for phenoxybenzoic acid using polymer-functionalized lanthanide oxide nanoparticles as fluorescent labels

    NASA Astrophysics Data System (ADS)

    Nichkova, Mikaela; Dosev, Dosi; Gee, Shirley J.; Hammock, Bruce D.; Kennedy, Ian M.

    2005-11-01

    Fluorescent properties and low production cost makes lanthanide oxide nanoparticles attractive labels in biochemistry. Nanoparticles with different fluorescent spectra were produced by doping of oxides such as Y IIO 3 and Gd IIO 3 with different lanthanide ions (Eu, Tb, Sm) giving the possibility for multicolor labeling. Protein microarrays have the potential to play a fundamental role in the miniaturization of biosensors, clinical immunological assays, and protein-protein interaction studies. Here we present the application of fluorescent lanthanide oxide nanoparticles as labels in microarray-based immunoassay for phenoxybenzoic acid (PBA), a generic biomarker of human exposure to the highly potent insecticides pyrethroids. A novel polymer-based protocol was developed for biochemical functionalization of the nanoparticles. Microarrays of antibodies were fabricated by microcontact printing in line patterns onto glass substrates and immunoassays were successfully performed using the corresponding functionalized nanoparticles. The applicability of the fluorophore nanoparticles as reporters for detection of antibody-antigen interactions has been demonstrated for phenoxybenzoic acid (PBA)/anti-PBA IgG. The sensitivity of the competitive fluorescent immunoassay for PBA was similar to that of the corresponding ELISA.

  19. Real-time monitoring of voltage shift based on enzymatically released pyrophosphate using phenylboronic acid-immobilized gate field-effect transistor

    NASA Astrophysics Data System (ADS)

    Nishida, Hirokazu; Takahashi, Kiyofumi; Tabuse, Yuki; Kambara, Hideki; Sakata, Toshiya

    2014-01-01

    Pyrophosphate (PPi) is ubiquitous in living cells and is often produced by enzymatic reactions, e.g., DNA synthesis by DNA polymerase. We have developed a novel detection system for the voltage shift associated with the change in PPi concentration resulting from an enzymatic reaction using a phenylboronic acid (PBA)-coated gate field-effect transistor (FET), since PBA coating is effective for detecting ion accumulation associated with PPi production from enzymatic reactions. To detect enzymatic reactions more efficiently, we employed the enzyme-electrode conjugation method using specific peptide sequences, which are spontaneously tethered to a gold substrate. The combination of the enzyme-electrode conjugation method with the charge detection using the PBA-coated FET enables the effective detection of enzymatic reactions.

  20. Anti-inflammatory effects of 4-phenyl-3-butenoic acid and 5-(acetylamino)-4-oxo-6-phenyl-2-hexenoic acid methyl ester, potential inhibitors of neuropeptide bioactivation.

    PubMed

    Bauer, John D; Sunman, Jeffrey A; Foster, Michael S; Thompson, Jeremy R; Ogonowski, Alison A; Cutler, Stephen J; May, Sheldon W; Pollock, Stanley H

    2007-03-01

    Substance P (SP) and calcitonin gene-related peptide (CGRP) are well established mediators of inflammation. Therefore, inhibition of the biosynthesis of these neuropeptides is an attractive potential strategy for pharmacological intervention against a number of inflammatory diseases. The final step in the biosynthesis of SP and CGRP is the conversion of their glycine-extended precursors to the active amidated peptide, and this process is catalyzed by sequential action of the enzymes peptidylglycine alpha-monooxygenase (PAM) and peptidylamidoglycolate lyase. We have demonstrated previously that 4-phenyl-3-butenoic acid (PBA) is a PAM inhibitor, and we have also shown that in vivo inhibition of serum PAM by PBA correlates with this compound's ability to inhibit carrageenan-induced edema in the rat. Here we demonstrate the ability of PBA to inhibit all three phases of adjuvant-induced polyarthritis (AIP) in rats; this represents the first time that an amidation inhibitor has been shown to be active in a model of chronic inflammation. We recently introduced 5-(acetylamino)-4-oxo-6-phenyl-2-hexenoic acid (AOPHA) as one of a new series of mechanism-based amidation inhibitors. We now report for the first time that AOPHA and its methyl ester (AOPHA-Me) are active inhibitors of serum PAM in vivo, and we show that AOPHA-Me correspondingly inhibits carrageenan-induced edema in rats in a dose-dependent manner. Neither PBA nor AOPHA-Me exhibits significant cyclooxygenase (COX) inhibition in vitro; thus, the anti-inflammatory activities of PBA and AOPHA-Me are apparently not a consequence of COX inhibition. We discuss possible pharmacological mechanisms that may account for the activities of these new anti-inflammatory compounds.

  1. Novel short chain fatty acids restore chloride secretion in cystic fibrosis

    SciTech Connect

    Nguyen, Toan D. . E-mail: T1Nguyen@u.washington.edu; Kim, Ug-Sung; Perrine, Susan P.

    2006-03-31

    Phenylalanine deletion at position 508 of the cystic fibrosis transmembrane conductance regulator ({delta}F508-CFTR), the most common mutation in cystic fibrosis (CF), causes a misfolded protein exhibiting partial chloride conductance and impaired trafficking to the plasma membrane. 4-Phenylbutyrate corrects defective {delta}F508-CFTR trafficking in vitro, but is not clinically efficacious. From a panel of short chain fatty acid derivatives, we showed that 2,2-dimethyl-butyrate (ST20) and {alpha}-methylhydrocinnamic acid (ST7), exhibiting high oral bioavailability and sustained plasma levels, correct the {delta}F508-CFTR defect. Pre-incubation ({>=}6 h) of CF IB3-1 airway cells with {>=}1 mM ST7 or ST20 restored the ability of 100 {mu}M forskolin to stimulate an {sup 125}I{sup -} efflux. This efflux was fully inhibited by NPPB, DPC, or glibenclamide, suggesting mediation through CFTR. Partial inhibition by DIDS suggests possible contribution from an additional Cl{sup -} channel regulated by CFTR. Thus, ST7 and ST20 offer treatment potential for CF caused by the {delta}F508 mutation.

  2. Phylloseptin-PBa--A Novel Broad-Spectrum Antimicrobial Peptide from the Skin Secretion of the Peruvian Purple-Sided Leaf Frog (Phyllomedusa Baltea) Which Exhibits Cancer Cell Cytotoxicity.

    PubMed

    Wan, Yuantai; Ma, Chengbang; Zhou, Mei; Xi, Xinping; Li, Lei; Wu, Di; Wang, Lei; Lin, Chen; Lopez, Juan Chavez; Chen, Tianbao; Shaw, Chris

    2015-12-01

    Antimicrobial peptides from amphibian skin secretion display remarkable broad-spectrum antimicrobial activity and are thus promising for the discovery of new antibiotics. In this study, we report a novel peptide belonging to the phylloseptin family of antimicrobial peptides, from the skin secretion of the purple-sided leaf frog, Phyllomedusa baltea, which was named Phylloseptin-PBa. Degenerate primers complementary to putative signal peptide sites of frog skin peptide precursor-encoding cDNAs were designed to interrogate a skin secretion-derived cDNA library from this frog. Subsequently, the peptide was isolated and identified using reverse phase HPLC and MS/MS fragmentation. The synthetic replicate was demonstrated to have activity against S. aureus, E. coli and C. albicans at concentrations of 8, 128 and 8 mg/L, respectively. In addition, it exhibited anti-proliferative activity against the human cancer cell lines, H460, PC3 and U251MG, but was less active against a normal human cell line (HMEC). Furthermore, a haemolysis assay was performed to assess mammalian cell cytotoxicity of Phylloseptin-PBa. This peptide contained a large proportion of α-helical domain, which may explain its antimicrobial and anticancer activities.

  3. Mutation of Glu521 or Glu535 in Cytoplasmic Loop 5 Causes Differential Misfolding in Multiple Domains of Multidrug and Organic Anion Transporter MRP1 (ABCC1)*

    PubMed Central

    Iram, Surtaj H.; Cole, Susan P. C.

    2012-01-01

    The polytopic 5-domain multidrug resistance protein 1 (MRP1/ABCC1) extrudes a variety of drugs and organic anions across the plasma membrane. Four charged residues in the fifth cytoplasmic loop (CL5) connecting transmembrane helix 9 (TM9) to TM10 are critical for stable expression of MRP1 at the plasma membrane. Thus Ala substitution of Lys513, Lys516, Glu521, and Glu535 all cause misfolding of MRP1 and target the protein for proteasome-mediated degradation. Of four chemical chaperones tested, 4-phenylbutyric acid (4-PBA) was the most effective at restoring expression of MRP1 mutants K513A, K516A, E521A, and E535A. However, although 4-PBA treatment of K513A resulted in wild-type protein levels (and activity), the same treatment had little or no effect on the expression of K516A. On the other hand, 4-PBA treatment allowed both E521A and E535A to exit the endoplasmic reticulum and be stably expressed at the plasma membrane. However, the 4-PBA-rescued E535A mutant exhibited decreased transport activity associated with reduced substrate affinity and conformational changes in both halves of the transporter. By contrast, E521A exhibited reduced transport activity associated with alterations in the mutant interactions with ATP as well as a distinct conformational change in the COOH-proximal half of MRP1. These findings illustrate the critical and complex role of CL5 for stable expression of MRP1 at the plasma membrane and more specifically show the differential importance of Glu521 and Glu535 in interdomain interactions required for proper folding and assembly of MRP1 into a fully transport competent native structure. PMID:22232552

  4. Reduction of endoplasmic reticulum stress inhibits neointima formation after vascular injury.

    PubMed

    Ishimura, Shutaro; Furuhashi, Masato; Mita, Tomohiro; Fuseya, Takahiro; Watanabe, Yuki; Hoshina, Kyoko; Kokubu, Nobuaki; Inoue, Katsumi; Yoshida, Hideaki; Miura, Tetsuji

    2014-11-06

    Endoplasmic reticulum (ER) stress and inappropriate adaptation through the unfolded protein response (UPR) are predominant features of pathological processes. However, little is known about the link between ER stress and endovascular injury. We investigated the involvement of ER stress in neointima hyperplasia after vascular injury. The femoral arteries of 7-8-week-old male mice were subjected to wire-induced vascular injury. After 4 weeks, immunohistological analysis showed that ER stress markers were upregulated in the hyperplastic neointima. Neointima formation was increased by 54.8% in X-box binding protein-1 (XBP1) heterozygous mice, a model of compromised UPR. Knockdown of Xbp1 in human coronary artery smooth muscle cells (CASMC) in vitro promoted cell proliferation and migration. Furthermore, treatment with ER stress reducers, 4-phenylbutyrate (4-PBA) and tauroursodeoxycholic acid (TUDCA), decreased the intima-to-media ratio after wire injury by 50.0% and 72.8%, respectively. Chronic stimulation of CASMC with PDGF-BB activated the UPR, and treatment with 4-PBA and TUDCA significantly suppressed the PDGF-BB-induced ER stress markers in CASMC and the proliferation and migration of CASMC. In conclusion, increased ER stress contributes to neointima formation after vascular injury, while UPR signaling downstream of XBP1 plays a suppressive role. Suppression of ER stress would be a novel strategy against post-angioplasty vascular restenosis.

  5. High-density lipoprotein inhibits ox-LDL-induced adipokine secretion by upregulating SR-BI expression and suppressing ER Stress pathway.

    PubMed

    Song, Guohua; Wu, Xia; Zhang, Pu; Yu, Yang; Yang, Mingfeng; Jiao, Peng; Wang, Ni; Song, Haiming; Wu, You; Zhang, Xiangjian; Liu, Huaxia; Qin, Shucun

    2016-01-01

    Endoplasmic reticulum stress (ERS) in adipocytes can modulate adipokines secretion. The aim of this study was to explore the protective effect of high-density lipoprotein (HDL) on oxidized low-density lipoprotein (ox-LDL)-induced ERS-C/EBP homologous protein (CHOP) pathway-mediated adipokine secretion. Our results showed that serum adipokines, including visfatin, resistin and TNF-α, correlated inversely with serum HDL cholesterol level in patients with abdominal obesity. In vitro, like ERS inhibitor 4-phenylbutyric acid (PBA), HDL inhibited ox-LDL- or tunicamycin (TM, an ERS inducer)-induced increase in visfatin and resistin secretion. Moreover, HDL inhibited ox-LDL-induced free cholesterol (FC) accumulation in whole cell lysate and in the endoplasmic reticulum. Additionally, like PBA, HDL inhibited ox-LDL- or TM-induced activation of ERS response as assessed by the decreased phosphorylation of protein kinase-like ER kinase and eukaryotic translation initiation factor 2α and reduced nuclear translocation of activating transcription factor 6 as well as the downregulation of Bip and CHOP. Furthermore, HDL increased scavenger receptor class B type I (SR-BI) expression and SR-BI siRNA treatment abolished the inhibitory effects of HDL on ox-LDL-induced FC accumulation and CHOP upregulation. These data indicate that HDL may suppress ox-LDL-induced FC accumulation in adipocytes through upregulation of SR-BI, subsequently preventing ox-LDL-induced ER stress-CHOP pathway-mediated adipocyte inflammation. PMID:27468698

  6. High content screening for non-classical peroxisome proliferators

    PubMed Central

    Sexton, Jonathan Z; He, Qingping; Forsberg, Lawrence J; Brenman, Jay E

    2010-01-01

    Peroxisomes are ubiquitous cellular organelles that perform vital functions including fatty acid beta-oxidation, plasmalogen synthesis, and detoxification of harmful oxidative species. In rodents numerous compounds that increase peroxisome biogenesis also alleviate metabolic syndrome (MetS)/type 2 diabetes (T2D) symptoms. However, compounds that increase peroxisome biogenesis in rodents largely do not increase peroxisome biogenesis in humans. We designed a novel genetically encoded high throughput screening (HTS) high content assay to identify small molecule compounds that function as peroxisome proliferators in human cells. From this assay we have confirmed that 4-phenylbutyrate (PBA), a PPAR independent peroxisome proliferator and chemical chaperone, increases peroxisome proliferation in human cells and serves as a positive control for our screen. We performed a small pilot and larger 15,000 compound production screen with an overall Z′ factor of 0.74 for 384-well plate format, providing a valuable screening tool for identifying peroxisome modulator compounds. From this screen we have identified 4 existing drugs and 10 novel compounds, some with common scaffolds 1000X more potent than PBA. It is hoped that these novel compounds may serve as scaffolds for testing for efficacy in alleviating MetS/T2D symptoms both in mouse models and ultimately human disease. PMID:21132080

  7. High-density lipoprotein inhibits ox-LDL-induced adipokine secretion by upregulating SR-BI expression and suppressing ER Stress pathway

    PubMed Central

    Song, Guohua; Wu, Xia; Zhang, Pu; Yu, Yang; Yang, Mingfeng; Jiao, Peng; Wang, Ni; Song, Haiming; Wu, You; Zhang, Xiangjian; Liu, Huaxia; Qin, Shucun

    2016-01-01

    Endoplasmic reticulum stress (ERS) in adipocytes can modulate adipokines secretion. The aim of this study was to explore the protective effect of high-density lipoprotein (HDL) on oxidized low-density lipoprotein (ox-LDL)-induced ERS-C/EBP homologous protein (CHOP) pathway-mediated adipokine secretion. Our results showed that serum adipokines, including visfatin, resistin and TNF-α, correlated inversely with serum HDL cholesterol level in patients with abdominal obesity. In vitro, like ERS inhibitor 4-phenylbutyric acid (PBA), HDL inhibited ox-LDL- or tunicamycin (TM, an ERS inducer)-induced increase in visfatin and resistin secretion. Moreover, HDL inhibited ox-LDL-induced free cholesterol (FC) accumulation in whole cell lysate and in the endoplasmic reticulum. Additionally, like PBA, HDL inhibited ox-LDL- or TM-induced activation of ERS response as assessed by the decreased phosphorylation of protein kinase-like ER kinase and eukaryotic translation initiation factor 2α and reduced nuclear translocation of activating transcription factor 6 as well as the downregulation of Bip and CHOP. Furthermore, HDL increased scavenger receptor class B type I (SR-BI) expression and SR-BI siRNA treatment abolished the inhibitory effects of HDL on ox-LDL-induced FC accumulation and CHOP upregulation. These data indicate that HDL may suppress ox-LDL-induced FC accumulation in adipocytes through upregulation of SR-BI, subsequently preventing ox-LDL-induced ER stress-CHOP pathway-mediated adipocyte inflammation. PMID:27468698

  8. Predictors of urinary levels of 2,4-dichlorophenoxyacetic acid, 3,5,6-trichloro-2-pyridinol, 3-phenoxybenzoic acid, and pentachlorophenol in 121 adults in Ohio.

    PubMed

    Morgan, Marsha K

    2015-07-01

    Limited data exist on the driving factors that influence the non-occupational exposures of adults to pesticides using urinary biomonitoring. In this work, the objectives were to quantify the urinary levels of 2,4-dichlorophenoxyacetic acid (2,4-D), 3,5,6-trichloro-2-pyridinol (TCP), 3-phenoxybenzoic acid (3-PBA), and pentachlorophenol (PCP) in 121 adults over a 48-h monitoring period and to examine the associations between selected sociodemographic and lifestyle factors and urinary levels of each pesticide biomarker. Adults, ages 20-49 years old, were recruited from six counties in Ohio (OH) in 2001. The participants collected 4-6 spot urine samples and completed questionnaires and diaries at home over a 48-h monitoring period. Urine samples were analyzed for 2,4-D, TCP, 3-PBA, and PCP by gas chromatography/mass spectrometry. Multiple regression modeling was used to determine the impact of selected sociodemographic and lifestyle factors on the log-transformed (ln) levels of each pesticide biomarker in adults. The pesticide biomarkers were detected in ≥ 89% of the urine samples, except for 3-PBA (66%). Median urinary levels of 2,4-D, TCP, 3-PBA, and PCP were 0.7, 3.4, 0.3, and 0.5 ng/mL, respectively. Results showed that 48-h sweet/salty snack consumption, 48-h time spend outside at home, and ln(creatinine) levels were significant predictors (p < 0.05), and race was a marginally significant predictor (p = 0.093) of the adults' ln(urinary 2,4-D) concentrations. Strong predictors (p < 0.05) of the adults' ln(urinary TCP) concentrations were urbanicity, employment status, sampling season, and ln(creatinine) levels. For 3-PBA, sampling season, pet ownership and removal of shoes before entering the home were significant predictors (p < 0.05) of the adults' ln(urinary 3-PBA) levels. Finally for PCP, removal of shoes before entering the home and ln(creatinine) levels were significant predictors (p < 0.05), and pet ownership was a marginally significant predictor (p = 0

  9. Lipid bilayer permeation of aliphatic amine and carboxylic acid drugs: rates of insertion, translocation and dissociation from MD simulations.

    PubMed

    Oruç, Tuğçe; Küçük, Sami Emre; Sezer, Deniz

    2016-09-21

    Aliphatic amines (AAs) and carboxylic acids (CAs) constitute the two most commonly occurring chemical groups among orally active drugs [Manallack, et al., ChemMedChem, 2013, 8, 242]. Here, we aim to rationalize this observation in terms of molecular properties that are essential for drug bioavailability. To this end, the permeation of the AA drug dyclonine and the CA drug 4-phenylbutyrate through a lipid bilayer is studied with molecular dynamics (MD) simulations. Permeability coefficients for the neutral and ionized forms of these drugs are calculated using the inhomogeneous solubility-diffusion model. To draw conclusions about other AA and CA drugs, the permeability coefficient is expressed as a sum over contributions from drug insertion into, translocation across, and dissociation from the lipid bilayer. Simple but general expressions for each of these separate steps are obtained and validated against the MD simulations of dyclonine and phenylbutyrate. We conclude that the neutral forms of most AA and CA drugs have large permeability coefficients (>1 cm s(-1)), while their ionized forms ensure solubility in aqueous environments. Thus, a physicochemical rationale for the reported abundance of AAs and CAs among drugs is provided.

  10. Lipid bilayer permeation of aliphatic amine and carboxylic acid drugs: rates of insertion, translocation and dissociation from MD simulations.

    PubMed

    Oruç, Tuğçe; Küçük, Sami Emre; Sezer, Deniz

    2016-09-21

    Aliphatic amines (AAs) and carboxylic acids (CAs) constitute the two most commonly occurring chemical groups among orally active drugs [Manallack, et al., ChemMedChem, 2013, 8, 242]. Here, we aim to rationalize this observation in terms of molecular properties that are essential for drug bioavailability. To this end, the permeation of the AA drug dyclonine and the CA drug 4-phenylbutyrate through a lipid bilayer is studied with molecular dynamics (MD) simulations. Permeability coefficients for the neutral and ionized forms of these drugs are calculated using the inhomogeneous solubility-diffusion model. To draw conclusions about other AA and CA drugs, the permeability coefficient is expressed as a sum over contributions from drug insertion into, translocation across, and dissociation from the lipid bilayer. Simple but general expressions for each of these separate steps are obtained and validated against the MD simulations of dyclonine and phenylbutyrate. We conclude that the neutral forms of most AA and CA drugs have large permeability coefficients (>1 cm s(-1)), while their ionized forms ensure solubility in aqueous environments. Thus, a physicochemical rationale for the reported abundance of AAs and CAs among drugs is provided. PMID:27539552

  11. Reversible click reactions with boronic acids to build supramolecular architectures in water.

    PubMed

    Arzt, Matthias; Seidler, Christiane; Ng, David Y W; Weil, Tanja

    2014-08-01

    The interaction of boronic acids with various bifunctional reagents offers great potential for the preparation of responsive supramolecular architectures. Boronic acids react with 1,2-diols yielding cyclic boronate esters that are stable at pH>7.4 but can be hydrolyzed at pH<5.0. The phenylboronic acid (PBA)-salicylhydroxamic acid (SHA) system offers ultra-fast reaction kinetics and high binding affinities. This Focus Review summarizes the current advances in exploiting the bioorthogonal interaction of boronic acids to build pH-responsive supramolecular architectures in water.

  12. Concentrations of the urinary pyrethroid metabolite 3-phenoxybenzoic acid in farm worker families in the MICASA study

    SciTech Connect

    Trunnelle, Kelly J.; Bennett, Deborah H.; Ahn, Ki Chang; Schenker, Marc B.; Tancredi, Daniel J.; Gee, Shirley J.; Stoecklin-Marois, Maria T.; Hammock, Bruce D.

    2014-05-01

    Indoor pesticide exposure is a growing concern, particularly from pyrethroids, a commonly used class of pesticides. Pyrethroid concentrations may be especially high in homes of immigrant farm worker families who often live in close proximity to agricultural fields, and are faced with poor housing conditions, causing higher pest infestation and more pesticide use. We investigate exposure of farm worker families to pyrethroids in a study of mothers and children living in Mendota, CA within the population-based Mexican Immigration to California: Agricultural Safety and Acculturation (MICASA) Study. We present pyrethroid exposure based on an ELISA analysis of urinary metabolite 3-phenoxybenzoic acid (3PBA) levels among 105 women and 103 children. The median urinary 3PBA levels (children=2.56 ug/g creatinine, mothers=1.46 ug/g creatinine) were higher than those reported in population based studies for the United States general population, but similar to or lower than studies with known high levels of pyrethroid exposure. A positive association was evident between poor housing conditions and the urinary metabolite levels, showing that poor housing conditions are a contributing factor to the higher levels of 3PBA seen in the urine of these farm worker families. Further research is warranted to fully investigate sources of exposure. - Highlights: • We investigate exposure of farm worker families to pyrethroids. • We present pyrethroid exposure based on an ELISA analysis of urinary 3PBA levels. • 3PBA levels were higher than those reported for the U.S. general population. • Poor housing conditions may be associated with pyrethroid exposure.

  13. Cationic Mucic Acid Polymer-Based siRNA Delivery Systems.

    PubMed

    Pan, Dorothy W; Davis, Mark E

    2015-08-19

    Nanoparticle (NP) delivery systems for small interfering RNA (siRNA) that have good systemic circulation and high nucleic acid content are highly desired for translation into clinical use. Here, a family of cationic mucic acid-containing polymers is synthesized and shown to assemble with siRNA to form NPs. A cationic mucic acid polymer (cMAP) containing alternating mucic acid and charged monomers is synthesized. When combined with siRNA, cMAP forms NPs that require steric stabilization by poly(ethylene glycol) (PEG) that is attached to the NP surface via a 5-nitrophenylboronic acid linkage (5-nitrophenylboronic acid-PEGm (5-nPBA-PEGm)) to diols on mucic acid in the cMAP in order to inhibit aggregation in biological fluids. As an alternative, cMAP is covalently conjugated with PEG via two methods. First, a copolymer is prepared with alternating cMAP-PEG units that can form loops of PEG on the surface of the formulated siRNA-containing NPs. Second, an mPEG-cMAP-PEGm triblock polymer is synthesized that could lead to a PEG brush configuration on the surface of the formulated siRNA-containing NPs. The copolymer and triblock polymer are able to form stable siRNA-containing NPs without and with the addition of 5-nPBA-PEGm. Five formulations, (i) cMAP with 5-nPBA-PEGm, (ii) cMAP-PEG copolymer both (a) with and (b) without 5-nPBA-PEGm, and (iii) mPEG-cMAP-PEGm triblock polymer both (a) with and (b) without 5-nPBA-PEGm, are used to produce NPs in the 30-40 nm size range, and their circulation times are evaluated in mice using tail vein injections. The mPEG-cMAP-PEGm triblock polymer provides the siRNA-containing NP with the longest circulation time (5-10% of the formulation remains in circulation at 60 min postdosing), even when a portion of the excess cationic components used in the formulation is filtered away prior to injection. A NP formulation using the mPEG-cMAP-PEGm triblock polymer that is free of excess components could contain as much as ca. 30 wt % siRNA. PMID

  14. Peroxisome proliferator-activated receptor alpha acts as a mediator of endoplasmic reticulum stress-induced hepatocyte apoptosis in acute liver failure

    PubMed Central

    Zhang, Li; Ren, Feng; Zhang, Xiangying; Wang, Xinxin; Shi, Hongbo; Zhou, Li; Zheng, Sujun; Chen, Yu; Chen, Dexi; Li, Liying; Duan, Zhongping

    2016-01-01

    ABSTRACT Peroxisome proliferator-activated receptor α (PPARα) is a key regulator to ameliorate liver injury in cases of acute liver failure (ALF). However, its regulatory mechanisms remain largely undetermined. Endoplasmic reticulum stress (ER stress) plays an important role in a number of liver diseases. This study aimed to investigate whether PPARα activation inhibits ER stress-induced hepatocyte apoptosis, thereby protecting against ALF. In a murine model of D-galactosamine (D-GalN)- and lipopolysaccharide (LPS)-induced ALF, Wy-14643 was administered to activate PPARα, and 4-phenylbutyric acid (4-PBA) was administered to attenuate ER stress. PPARα activation ameliorated liver injury, because pre-administration of its specific inducer, Wy-14643, reduced the serum aminotransferase levels and preserved liver architecture compared with that of controls. The protective effect of PPARα activation resulted from the suppression of ER stress-induced hepatocyte apoptosis. Indeed, (1) PPARα activation decreased the expression of glucose-regulated protein 78 (Grp78), Grp94 and C/EBP-homologous protein (CHOP) in vivo; (2) the liver protection by 4-PBA resulted from the induction of PPARα expression, as 4-PBA pre-treatment promoted upregulation of PPARα, and inhibition of PPARα by small interfering RNA (siRNA) treatment reversed liver protection and increased hepatocyte apoptosis; (3) in vitro PPARα activation by Wy-14643 decreased hepatocyte apoptosis induced by severe ER stress, and PPARα inhibition by siRNA treatment decreased the hepatocyte survival induced by mild ER stress. Here, we demonstrate that PPARα activation contributes to liver protection and decreases hepatocyte apoptosis in ALF, particularly through regulating ER stress. Therefore, targeting PPARα could be a potential therapeutic strategy to ameliorate ALF. PMID:27482818

  15. Peroxisome proliferator-activated receptor alpha acts as a mediator of endoplasmic reticulum stress-induced hepatocyte apoptosis in acute liver failure.

    PubMed

    Zhang, Li; Ren, Feng; Zhang, Xiangying; Wang, Xinxin; Shi, Hongbo; Zhou, Li; Zheng, Sujun; Chen, Yu; Chen, Dexi; Li, Liying; Zhao, Caiyan; Duan, Zhongping

    2016-07-01

    Peroxisome proliferator-activated receptor α (PPARα) is a key regulator to ameliorate liver injury in cases of acute liver failure (ALF). However, its regulatory mechanisms remain largely undetermined. Endoplasmic reticulum stress (ER stress) plays an important role in a number of liver diseases. This study aimed to investigate whether PPARα activation inhibits ER stress-induced hepatocyte apoptosis, thereby protecting against ALF. In a murine model of D-galactosamine (D-GalN)- and lipopolysaccharide (LPS)-induced ALF, Wy-14643 was administered to activate PPARα, and 4-phenylbutyric acid (4-PBA) was administered to attenuate ER stress. PPARα activation ameliorated liver injury, because pre-administration of its specific inducer, Wy-14643, reduced the serum aminotransferase levels and preserved liver architecture compared with that of controls. The protective effect of PPARα activation resulted from the suppression of ER stress-induced hepatocyte apoptosis. Indeed, (1) PPARα activation decreased the expression of glucose-regulated protein 78 (Grp78), Grp94 and C/EBP-homologous protein (CHOP) in vivo; (2) the liver protection by 4-PBA resulted from the induction of PPARα expression, as 4-PBA pre-treatment promoted upregulation of PPARα, and inhibition of PPARα by small interfering RNA (siRNA) treatment reversed liver protection and increased hepatocyte apoptosis; (3) in vitro PPARα activation by Wy-14643 decreased hepatocyte apoptosis induced by severe ER stress, and PPARα inhibition by siRNA treatment decreased the hepatocyte survival induced by mild ER stress. Here, we demonstrate that PPARα activation contributes to liver protection and decreases hepatocyte apoptosis in ALF, particularly through regulating ER stress. Therefore, targeting PPARα could be a potential therapeutic strategy to ameliorate ALF. PMID:27482818

  16. Expression levels of heat shock protein 60 and glucose-regulated protein 78 in response to trimethylamine-N-oxide treatment in murine macrophage J774A.1 cell line.

    PubMed

    Mohammadi, A; Gholamhoseyniannajar, A; Yaghoobi, M M; Jahani, Y; Vahabzadeh, Z

    2015-09-26

    Trimethylamine N-oxide (TMAO), a common metabolite in animals and humans, can induce changes in the expression or conformation of heat shock proteins. It has also been introduced as a risk factor for atherosclerosis and a biomarker for kidney problems. On the other hand, increased levels of heat shock proteins 60 and 70 KDa are associated with increased atherosclerosis risk. This study was therefore designed to evaluate the possible effect(s) of TMAO on the expression of HSP60 and GRP78 at the mRNA and protein levels. Murine macrophage J774A.1 cells were treated with micromolar concentrations of TMAO and 4-phenylbutyric acid (4-PBA), a chemical chaperon, for different time intervals. Tunicamycin was also used as a control for induction of endoplasmic reticulum stress. Tunicamycin greatly increased both mRNA and protein levels of GRP78. Similarly but to a lesser extent compared to tunicamycin, TMAO also increased mRNA and protein levels of GRP78 in a dose and time-dependent manner. In contrast, 4-PBA failed to induce any changes. Similar to GRP78, HSP60 was also increased only at mRNA level in TMAO treated cells. 4-PBA also increased HSP60 mRNA levels, whereas, tunicamycin did not show any effect on either protein or mRNA levels of HSP60. Since both heat shock proteins are stress inducible and the elevation of GRP78 is a hallmark for endoplasmic reticulum stress induction, it can be concluded that TMAO may induce endoplasmic reticulum stress or may act through elevation of these heat shock proteins.

  17. Endoplasmic reticulum stress-activated glycogen synthase kinase 3β aggravates liver inflammation and hepatotoxicity in mice with acute liver failure.

    PubMed

    Ren, Feng; Zhou, Li; Zhang, Xiangying; Wen, Tao; Shi, Hongbo; Xie, Bangxiang; Li, Zhuo; Chen, Dexi; Wang, Zheling; Duan, Zhongping

    2015-01-01

    Endoplasmic reticulum stress (ER stress) has been increasingly recognized as an important mechanism in various liver diseases. However, its intrinsic physiological role in acute liver failure (ALF) remains largely undetermined. This study aimed to examine how ER stress orchestrates glycogen synthase kinase 3β (GSK3β) and inflammation to affect ALF. In a murine ALF model induced by D-galactosamine (D-GalN) and lipopolysaccharide (LPS), 4-phenylbutyric acid (4-PBA) is to be administered to relieve ER stress. The lethality rate, liver damage, cytokine expression, and the activity of GSK3β were evaluated. How to regulate LPS-induced inflammation and TNF-α-induced hepatocyte apoptosis by ER stress was investigated in vitro. In vivo, ER stress was triggered in the liver with the progression of mice ALF model. ER stress was essential for the development of ALF because ER stress inhibition by 4-PBA ameliorated the liver damage through decreasing liver inflammation and hepatocyte apoptosis. 4-PBA also decreased GSK3β activity in the livers of ALF mice. In vitro, ER stress induced by tunicamycin synergistically increased LPS-triggered pro-inflammatory cytokine induction and promoted the activation of nuclear factor-κB (NF-κB) and mitogen-activated protein kinase (MAPK) pathway in bone marrow-derived macrophages; moreover, tunicamycin also cooperated with TNF-α to increase hepatocyte apoptosis. ER stress promoted LPS-triggered inflammation depending on GSK3β activation because inhibition of GSK3β by SB216763, the specific inhibitor of GSK3β, resulted in downregulation of pro-inflammatory genes. ER stress contributes to liver inflammation and hepatotoxicity in ALF, particularly by regulating GSK3β, and is therefore a potential therapeutic target for ALF.

  18. Phenylboronic acid functionalized SBA-15 for sugar capture.

    PubMed

    Zhao, Yong-Hong; Shantz, Daniel F

    2011-12-01

    The synthesis and characterization of organic-inorganic hybrid materials that selectively capture sugars from model biomass hydrolysis mixtures are reported. 3-Aminophenylboronic acid (PBA) groups that can reversibly form cyclic esters with 1,2-diols, and 1,3-diols including sugars are attached to mesoporous SBA-15 via different synthetic protocols. In the first route, a coupling agent is used to link PBA and SBA-15, while in the second route poly(acrylic acid) brushes are first grafted from the surface of SBA-15 by surface-initiated atom transfer radical polymerization and PBA is then immobilized. The changes in pore structure, porosity, and pore size due to the loading of organic content are measured by powder X-ray diffraction and nitrogen porosimetry. The increase in organic content after each synthesis step is monitored by thermal gravimetric analysis. Fourier transform infrared spectroscopy and elemental analysis are used to characterize the chemical compositions of the hybrid materials synthesized. D-(+)-Glucose and D-(+)-xylose, being the most commonly present sugars in biomass, are chosen to evaluate the sugar adsorption capacity of the hybrid materials. It is found that the sugar adsorption capacity is determined by the loading of boronic acid groups on the hybrid materials, and the hybrid material synthesized via route two is much better than that through route one for sugar adsorption. Mathematical modeling of the adsorption data indicates that the Langmuir model best describes the sugar adsorption behavior of the hybrid material synthesized through route one, while the Freundlich model fits the data most satisfactorily for the hybrid material prepared via route two. The adsorption kinetics, reusability, and selectivity toward some typical chemicals in cellulose acidic hydrolysis mixtures are also investigated. PMID:22023050

  19. Study on Synthesis, Characterization and Antiproliferative Activity of Novel Diisopropylphenyl Esters of Selected Fatty Acids.

    PubMed

    Reddy, Yasa Sathyam; Kaki, Shiva Shanker; Rao, Bala Bhaskara; Jain, Nishant; Vijayalakshmi, Penumarthy

    2016-01-01

    The present study describes the synthesis, characterization and evaluation of antiproliferative activity of novel diisopropylphenyl esters of alpha-linolenic acid (ALA), valproic acid (VA), butyric acid (BA) and 2-ethylhexanoic acid (2-EHA). These esters were chemically synthesized by the esterification of fatty acids with 2,6-diisopropylphenol and 2,4-diisopropylphenol (propofol). The structure of new conjugates viz. propofol-(alpha-linolenic acid) (2,6P-ALA and 2,4P-ALA), propofol-valproic acid (2,6P-VA and 2,4P-VA), propofol-butyric acid (2,6P-BA and 2,4P-BA) and propofol-(2-ethylhexanoic acid) (2,6P2-EHA and 2,4P-2-EHA) were characterized by FT-IR, NMR ((1)H, (13)C) and mass spectral data. The synthesized conjugates having more lipophilic character were tested for antiproliferative in vitro studies on A549, MDA-MB-231, HeLa, Mia-Pa-Ca and HePG2 cancer cell lines. All the conjugates showed specific growth inhibition on studied cancer cell lines. Among the synthesized esters, the conjugates synthesized from BA, VA and 2-EHA exhibited prominent growth inhibition against A549, HeLa, Mia-Pa-Ca and HePG2 cancer cell lines. The preliminary results suggest that the entire novel conjugates possess antiproliferative properties that reduce the proliferation of cancer cells in vitro.

  20. Molecularly imprinted polymer coupled with dispersive liquid-liquid microextraction and injector port silylation: a novel approach for the determination of 3-phenoxybenzoic acid in complex biological samples using gas chromatography-tandem mass spectrometry.

    PubMed

    Mudiam, Mohana Krishna Reddy; Chauhan, Abhishek; Jain, Rajeev; Dhuriya, Yogesh Kumar; Saxena, Prem Narain; Khanna, Vinay Kumar

    2014-01-15

    A novel analytical approach based on molecularly imprinted solid phase extraction (MISPE) coupled with dispersive liquid-liquid microextraction (DLLME), and injector port silylation (IPS) has been developed for the selective preconcentration, derivatization and analysis of 3-phenoxybenzoic acid (3-PBA) using gas chromatography-tandem mass spectrometry (GC-MS/MS) in complex biological samples such as rat blood and liver. Factors affecting the synthesis of MIP were evaluated and the best monomer and cross-linker were selected based on binding affinity studies. Various parameters of MISPE, DLLME and IPS were optimized for the selective preconcentration and derivatization of 3-PBA. The developed method offers a good linearity over the calibration range of 0.02-2.5ngmg(-1) and 7.5-2000ngmL(-1) for liver and blood respectively. Under optimized conditions, the recovery of 3-PBA in liver and blood samples were found to be in the range of 83-91%. The detection limit was found to be 0.0045ngmg(-1) and 1.82ngmL(-1) in liver and blood respectively. SRM transition of 271→227 and 271→197 has been selected as quantifier and qualifier transition for 3-PBA derivative. Intra and inter-day precision for five replicates in a day and for five, successive days was found to be less than 8%. The method developed was successfully applied to real samples, i.e. rat blood and tissue for quantitative evaluation of 3-PBA. The analytical approach developed is rapid, economic, simple, eco-friendly and possess immense utility for the analysis of analytes with polar functional groups in complex biological samples by GC-MS/MS.

  1. Induction of porcine host defense peptide gene expression by short-chain fatty acids and their analogs.

    PubMed

    Zeng, Xiangfang; Sunkara, Lakshmi T; Jiang, Weiyu; Bible, Megan; Carter, Scott; Ma, Xi; Qiao, Shiyan; Zhang, Guolong

    2013-01-01

    Dietary modulation of the synthesis of endogenous host defense peptides (HDPs) represents a novel antimicrobial approach for disease control and prevention, particularly against antibiotic-resistant infections. However, HDP regulation by dietary compounds such as butyrate is species-dependent. To examine whether butyrate could induce HDP expression in pigs, we evaluated the expressions of a panel of porcine HDPs in IPEC-J2 intestinal epithelial cells, 3D4/31 macrophages, and primary monocytes in response to sodium butyrate treatment by real-time PCR. We revealed that butyrate is a potent inducer of multiple, but not all, HDP genes. Porcine β-defensin 2 (pBD2), pBD3, epididymis protein 2 splicing variant C (pEP2C), and protegrins were induced markedly in response to butyrate, whereas pBD1 expression remained largely unaltered in any cell type. Additionally, a comparison of the HDP-inducing efficacy among saturated free fatty acids of different aliphatic chain lengths revealed that fatty acids containing 3-8 carbons showed an obvious induction of HDP expression in IPEC-J2 cells, with butyrate being the most potent and long-chain fatty acids having only a marginal effect. We further investigated a panel of butyrate analogs for their efficacy in HDP induction, and found glyceryl tributyrate, benzyl butyrate, and 4-phenylbutyrate to be comparable with butyrate. Identification of butyrate and several analogs with a strong capacity to induce HDP gene expression in pigs provides attractive candidates for further evaluation of their potential as novel alternatives to antibiotics in augmenting innate immunity and disease resistance of pigs. PMID:24023657

  2. ER stress and autophagy are involved in the apoptosis induced by cisplatin in human lung cancer cells

    PubMed Central

    SHI, SHAOMIN; TAN, PING; YAN, BINGDI; GAO, RONG; ZHAO, JIANJUN; WANG, JING; GUO, JIA; LI, NING; MA, ZHONGSEN

    2016-01-01

    Cisplatin [cis-diamminedichloroplatinum II (CDDP)] is one of the most classical and effective chemotherapeutic drugs for the treatment of cancers including lung cancer. However, the presence of cisplatin resistance in cancer lowers its curative effect and limits its usage in the clinic. The aim of the present study was to investigate the underlying mechanisms of cisplatin resistance in lung cancer involving endoplasmic reticulum (ER) stress and autophagy. In the present study, we detected the effect of cisplatin on cell viability, ER stress and autophagy in lung cancer cell lines A549 and H460. We also tested the effects of ER stress and autophagy on apoptosis induced by cisplatin. The results showed that cisplatin induced apoptosis, ER stress and autophagy in lung cancer cell lines. In addition, the inhibition of ER stress by 4-phenylbutyric acid (4-PBA) or tauroursodeoxycholic acid sodium (TUDC) enhanced cisplatin-induced apoptosis in the human lung cancer cells. Meanwhile, combination treatment with the autophagic inhibitor 3-methyladenine (3-MA) or chloroquine (CQ) further increased the apoptosis induced by cisplatin in the human lung cancer cells. The present study provides a novel treatment strategy - cisplatin in combination with an autophagic inhibitor or an ER stress inhibitor leads to increased apoptosis in human lung cancer cells. PMID:26985651

  3. Extraordinary adhesion of phenylboronic acid derivatives of polyvinylamine to wet cellulose: a colloidal probe microscopy investigation.

    PubMed

    Notley, Shannon M; Chen, Wei; Pelton, Robert

    2009-06-16

    Typically, the adhesion between cellulose surfaces under aqueous conditions is very poor. Often, adsorbed polymers such as polyvinylamine (PVAm) are used to increase the wet strength; however, this provides only a minimal increase in the adhesion energy. Here, the adhesion between cellulose surfaces with adsorbed layers of phenylboronic acid derivatized polyvinylamine has been studied using colloidal probe microscopy as a function of pH. The adhesion due to the phenylboronic acid (PBA) groups grafted on the polyvinylamine backbone is almost 30 times greater, providing a new, exciting class of polymers using covalent linkages to improve the strength of the joint between cellulose surfaces. The measured surface forces on approach provided key information on the molecular conformation of the polymers at the cellulose-solution interface. At low pH, the three polymers tested, PVAm, PVAm-Ph (with pendant phenol groups), and PVAm-PBA (with phenylboronic acid groups) all had a relatively flat conformation at the interface, which is in agreement with the predictions based upon theory for highly charged polyelectrolytes adsorbing to an oppositely charged interface. With increasing pH, the charge on the polymers is reduced, eventually resulting in a more expansive conformation at the interface at pH 10 and above with the development of a steric interaction force. The onset of this steric force correlates well with the observed significant increase in the pull-off force upon separation of the cellulose surfaces. Furthermore, a greater increase in the adhesion was observed for PVAm-PBA in agreement with previous studies using macroscopic cellulose surfaces. This is attributed to the formation of boronic acid esters between the polymer and the cis diol groups on the cellulose surface.

  4. Efficient nuclear drug translocation and improved drug efficacy mediated by acidity-responsive boronate-linked dextran/cholesterol nanoassembly.

    PubMed

    Zhu, Jing-Yi; Lei, Qi; Yang, Bin; Jia, Hui-Zhen; Qiu, Wen-Xiu; Wang, Xuli; Zeng, Xuan; Zhuo, Ren-Xi; Feng, Jun; Zhang, Xian-Zheng

    2015-06-01

    The present study reported a lysosome-acidity-targeting bio-responsive nanovehicle self-assembled from dextran (Dex) and phenylboronic acid modified cholesterol (Chol-PBA), aiming at the nucleus-tropic drug delivery. The prominent advantage of this assembled nanoconstruction arose from its susceptibility to acidity-labile dissociation concurrently accompanied with the fast liberation of encapsulated drugs, leading to efficient nuclear drug translocation and consequently favorable drug efficacy. By elaborately exploiting NH4Cl pretreatment to interfere with the cellular endosomal acidification progression, this study clearly evidenced at a cellular level the strong lysosomal-acidity dependency of nuclear drug uptake efficiency, which was shown to be the main factor influencing the drug efficacy. The boronate-linked nanoassembly displayed nearly no cytotoxicity and can remain structural stability under the simulated physiological conditions including 10% serum and the normal blood sugar concentration. The cellular exposure to cholesterol was found to bate the cellular uptake of nanoassembly in a dose-dependent manner, suggesting a cholesterol-associated mechanism of the intracellular internalization. The in vivo antitumor assessment in xenograft mouse models revealed the significant superiority of DOX-loaded Dex/Chol-PBA nanoassembly over the controls including free DOX and the DOX-loaded non-sensitive Dex-Chol, as reflected by the more effective tumor-growth inhibition and the better systematic safety. In terms of the convenient preparation, sensitive response to lysosomal acidity and efficient nuclear drug translocation, Dex/Chol-PBA nanoassembly derived from natural materials shows promising potentials as the nanovehicle for nucleus-tropic drug delivery especially for antitumor agents. More attractively, this study offers a deeper insight into the mechanism concerning the contribution of acidity-responsive delivery to the enhanced chemotherapy performance. PMID

  5. Efficient nuclear drug translocation and improved drug efficacy mediated by acidity-responsive boronate-linked dextran/cholesterol nanoassembly.

    PubMed

    Zhu, Jing-Yi; Lei, Qi; Yang, Bin; Jia, Hui-Zhen; Qiu, Wen-Xiu; Wang, Xuli; Zeng, Xuan; Zhuo, Ren-Xi; Feng, Jun; Zhang, Xian-Zheng

    2015-06-01

    The present study reported a lysosome-acidity-targeting bio-responsive nanovehicle self-assembled from dextran (Dex) and phenylboronic acid modified cholesterol (Chol-PBA), aiming at the nucleus-tropic drug delivery. The prominent advantage of this assembled nanoconstruction arose from its susceptibility to acidity-labile dissociation concurrently accompanied with the fast liberation of encapsulated drugs, leading to efficient nuclear drug translocation and consequently favorable drug efficacy. By elaborately exploiting NH4Cl pretreatment to interfere with the cellular endosomal acidification progression, this study clearly evidenced at a cellular level the strong lysosomal-acidity dependency of nuclear drug uptake efficiency, which was shown to be the main factor influencing the drug efficacy. The boronate-linked nanoassembly displayed nearly no cytotoxicity and can remain structural stability under the simulated physiological conditions including 10% serum and the normal blood sugar concentration. The cellular exposure to cholesterol was found to bate the cellular uptake of nanoassembly in a dose-dependent manner, suggesting a cholesterol-associated mechanism of the intracellular internalization. The in vivo antitumor assessment in xenograft mouse models revealed the significant superiority of DOX-loaded Dex/Chol-PBA nanoassembly over the controls including free DOX and the DOX-loaded non-sensitive Dex-Chol, as reflected by the more effective tumor-growth inhibition and the better systematic safety. In terms of the convenient preparation, sensitive response to lysosomal acidity and efficient nuclear drug translocation, Dex/Chol-PBA nanoassembly derived from natural materials shows promising potentials as the nanovehicle for nucleus-tropic drug delivery especially for antitumor agents. More attractively, this study offers a deeper insight into the mechanism concerning the contribution of acidity-responsive delivery to the enhanced chemotherapy performance.

  6. Synthesis and characterisation of multifunctional alginate microspheres via the in situ formation of ZnO quantum dots and the graft of 4-(1-pyrenyl) butyric acid to sodium alginate.

    PubMed

    Luo, Guilin; Wang, Jianxin; Wang, Yingying; Feng, Bo; Weng, Jie

    2015-01-01

    Growth factor-loaded fluorescent alginate microspheres, which can realise sustained growth factor release and fluorescence imaging, were synthesised by in situ formation of ZnO quantum dots (QDs) and covalent graft of 4-(1-pyrenyl) butyric acid (PBA). BSA was chosen as a growth factor model protein to study the release kinetic of growth factors from alginate microspheres. The microsphere size and fluorescent properties were also investigated. Investigations of cell culture were used for evaluating biocompatibility of BSA-loaded fluorescent microspheres and fluorescence imaging property of ZnO QDs and PBA-grafted sodium alginate from the microspheres. The results show that they have good fluorescent property either to microspheres or to cells and fluorescent microspheres have good biocompatibility and property in sustained release of growth factors. The obtained microspheres will be expected to realise the imaging of cells and materials and also the release of growth factor in tissue engineering or in cell culture. PMID:25265058

  7. Synthesis and characterisation of multifunctional alginate microspheres via the in situ formation of ZnO quantum dots and the graft of 4-(1-pyrenyl) butyric acid to sodium alginate.

    PubMed

    Luo, Guilin; Wang, Jianxin; Wang, Yingying; Feng, Bo; Weng, Jie

    2015-01-01

    Growth factor-loaded fluorescent alginate microspheres, which can realise sustained growth factor release and fluorescence imaging, were synthesised by in situ formation of ZnO quantum dots (QDs) and covalent graft of 4-(1-pyrenyl) butyric acid (PBA). BSA was chosen as a growth factor model protein to study the release kinetic of growth factors from alginate microspheres. The microsphere size and fluorescent properties were also investigated. Investigations of cell culture were used for evaluating biocompatibility of BSA-loaded fluorescent microspheres and fluorescence imaging property of ZnO QDs and PBA-grafted sodium alginate from the microspheres. The results show that they have good fluorescent property either to microspheres or to cells and fluorescent microspheres have good biocompatibility and property in sustained release of growth factors. The obtained microspheres will be expected to realise the imaging of cells and materials and also the release of growth factor in tissue engineering or in cell culture.

  8. Development of a solid-phase extraction method for simultaneous extraction of adipic acid, succinic acid and 1,4-butanediol formed during hydrolysis of poly(butylene adipate) and poly(butylene succinate).

    PubMed

    Lindström, Annika; Albertsson, Ann-Christine; Hakkarainen, Minna

    2004-01-01

    A solid-phase extraction (SPE) method was developed for the simultaneous extraction of dicarboxylic acids and diols formed during hydrolysis of poly(butylene succinate), PBS, and poly(butylene adipate), PBA. Four commercial non-polar SPE columns, three silica based: C8, C18, C18 (EC), and one resin based: ENV+, were tested for the extraction of succinic acid, adipic acid and 1,4-butanediol, the expected final hydrolysis products of PBS and PBA. ENV+ resin was chosen as a solid-phase, because it displayed the best extraction efficiency for 1,4-butanediol and succinic acid. Linear range for the extracted analytes was 1-500 ng/microl for adipic acid and 2-500 ng/microl for 1,4-butanediol and succinic acid. Detection and quantification limits for the analytes were between 1-2 and 2-7 ng/microl, respectively, and relative standard deviations were between 3 and 7%. Good repeatability and low detection limits made the developed SPE method and subsequent gas chromatography-mass spectrometry (GC-MS) analysis a sensitive tool for identification and quantification of hydrolysis products at early stages of degradation.

  9. Inhibition of histone deacetylation does not block resilencing of p16 after 5-aza-2'-deoxycytidine treatment.

    PubMed

    Egger, Gerda; Aparicio, Ana M; Escobar, Sonia G; Jones, Peter A

    2007-01-01

    Epigenetic drugs are in use in clinical trials of various human cancers and are potent at reactivating genes silenced by DNA methylation and chromatin modifications. We report here the analysis of a set of normal fibroblast and cancer cell lines after combination treatment with the DNA methyltransferase inhibitor 5-aza-2'-deoxycytidine (5-aza-CdR) and the histone deacetylase inhibitor 4-phenylbutyric acid (PBA). Low doses of the drug combination caused cell cycle arrest, whereas high doses induced apoptosis in T24 bladder carcinoma cells. Both p16 (CDKN2A/INK4) and p21 (CIP1/SDI1/WAF1) expression were induced to similar levels in normal and cancer cells in a dose-dependent fashion after combination treatments. We detected a distinct increase of histone H3 acetylation at lysine 9/14 near the transcription start sites, in both LD419 normal fibroblasts and T24 bladder carcinoma cells, whereas the acetylation changes in the p21 locus were less apparent. Interestingly, the levels of trimethylation of histone H3 on lysine 9, which usually marks inactive chromatin regions and was associated with the p16 promoter in silenced T24 cells, did not change after drug treatments. Furthermore, we provide evidence that the remethylation of the p16 promoter CpG island in T24 cells after 5-aza-CdR treatment cannot be halted by subsequent continuous PBA treatment. The p16 gene is resilenced with kinetics similar to 5-aza-CdR only-treated cells, which is also marked by a localized loss of histone acetylation at the transcription start site. Altogether, our data provide new insights into the mechanism of epigenetic drugs and have important implications for epigenetic therapy. PMID:17210717

  10. Thermo-responsive behavior of borinic acid polymers: experimental and molecular dynamics studies.

    PubMed

    Wan, Wen-Ming; Zhou, Peng; Cheng, Fei; Sun, Xiao-Li; Lv, Xin-Hu; Li, Kang-Kang; Xu, Hai; Sun, Miao; Jäkle, Frieder

    2015-09-28

    The thermo-responsive properties of borinic acid polymers were investigated by experimental and molecular dynamics simulation studies. The homopolymer poly(styrylphenyl(tri-iso-propylphenyl)borinic acid) (PBA) exhibits an upper critical solution temperature (UCST) in polar organic solvents that is tunable over a wide temperature range by addition of small amounts of H2O. The UCST of a 1 mg mL(-1) PBA solution in DMSO can be adjusted from 20 to 100 °C by varying the H2O content from ∼0-2.5%, in DMF from 0 to 100 °C (∼3-17% H2O content), and in THF from 0 to 60 °C (∼4-19% H2O). The UCST increases almost linearly from the freezing point of the solvent with higher freezing point to the boiling point of the solvent with the lower boiling point. The mechanistic aspects of this process were investigated by molecular dynamics simulations. The latter indicate rapid and strong hydrogen-bond formation between BOH moieties and H2O molecules, which serve as crosslinkers to form an insoluble network. Our results suggest that borinic acid-containing polymers are promising as new "smart" materials, which display thermo-responsive properties that are tunable over a wide temperature range.

  11. Thermo-responsive behavior of borinic acid polymers: experimental and molecular dynamics studies.

    PubMed

    Wan, Wen-Ming; Zhou, Peng; Cheng, Fei; Sun, Xiao-Li; Lv, Xin-Hu; Li, Kang-Kang; Xu, Hai; Sun, Miao; Jäkle, Frieder

    2015-09-28

    The thermo-responsive properties of borinic acid polymers were investigated by experimental and molecular dynamics simulation studies. The homopolymer poly(styrylphenyl(tri-iso-propylphenyl)borinic acid) (PBA) exhibits an upper critical solution temperature (UCST) in polar organic solvents that is tunable over a wide temperature range by addition of small amounts of H2O. The UCST of a 1 mg mL(-1) PBA solution in DMSO can be adjusted from 20 to 100 °C by varying the H2O content from ∼0-2.5%, in DMF from 0 to 100 °C (∼3-17% H2O content), and in THF from 0 to 60 °C (∼4-19% H2O). The UCST increases almost linearly from the freezing point of the solvent with higher freezing point to the boiling point of the solvent with the lower boiling point. The mechanistic aspects of this process were investigated by molecular dynamics simulations. The latter indicate rapid and strong hydrogen-bond formation between BOH moieties and H2O molecules, which serve as crosslinkers to form an insoluble network. Our results suggest that borinic acid-containing polymers are promising as new "smart" materials, which display thermo-responsive properties that are tunable over a wide temperature range. PMID:26256052

  12. Phenylbutyric acid protects against spatial memory deficits in a model of repeated electroconvulsive therapy.

    PubMed

    Yao, Zhao-Hui; Kang, Xiang; Yang, Liu; Niu, Yi; Lu, Ye; Gong, Cheng-Xin; Tian, Qing; Wang, Jian-Zhi

    2014-05-01

    Repeated electroconvulsive therapy (rECT) is widely applied in the treatment of refractory depression. Among the side effects of rECT, memory impairment is noticeable and needs effective protection. In this study, by employing a recognized repeated electroconvulsive shock (rECS) rat model, we found that rECS induced the significant spatial memory retention deficits with the simultaneous decreases in long-term potential (LTP), enhanced excitable postsynaptic potentials (EPSP), population spike (PS) and input/output curve in perforant pathway-dentate gyrus (PP-DG), but had no obvious neuron loss or dentritic spine loss in the brain by Nissle or Golgi stainings. Furthermore, the increased synaptic proteins of NR2A/B, PSD93, PSD95, the immediate early gene c-Fos and CREB protein were detected in hippocampus of rECS rats. rECS was also found to cause enhanced axon reorganization in DG region of hippocampus by Timm staining. Intraperitoneal injection of phenylbutyric acid (PBA), an aromatic short chain fatty acid acting as a molecule chaperon, could prevent rats from the rECS-induced memory deficits and synaptic potential enhancement by decreasing the levels of the abnormally increased memory-associated proteins and enhanced axon reorganization in hippocampus. Our data suggested that PBA might be potentially used to attenuate the rECS-induced memory impairment. PMID:24712645

  13. Bushen Zhuangjin decoction inhibits TM-induced chondrocyte apoptosis mediated by endoplasmic reticulum stress

    PubMed Central

    LIN, PINGDONG; WENG, XIAPING; LIU, FAYUAN; MA, YUHUAN; CHEN, HOUHUANG; SHAO, XIANG; ZHENG, WENWEI; LIU, XIANXIANG; YE, HONGZHI; LI, XIHAI

    2015-01-01

    Chondrocyte apoptosis triggered by endoplasmic reticulum (ER) stress plays a vital role in the pathogenesis of osteoarthritis (OA). Bushen Zhuangjin decoction (BZD) has been widely used in the treatment of OA. However, the cellular and molecular mechanisms responsible for the inhibitory effects of BZD on chondrocyte apoptosis remain to be elucidated. In the present study, we investigated the effects of BZD on ER stress-induced chondrocyte apoptosis using a chondrocyte in vitro model of OA. Chondrocytes obtained from the articular cartilage of the knee joints of Sprague Dawley (SD) rats were detected by immunohistochemical staining for type II collagen. The ER stress-mediated apoptosis of tunicamycin (TM)-stimulated chondrocytes was detected using 4-phenylbutyric acid (4-PBA). We found that 4-PBA inhibited TM-induced chondrocyte apoptosis, which confirmed the successful induction of chondrocyte apoptosis. BZD enhanced the viability of the TM-stimulated chondrocytes in a dose- and time-dependent manner, as shown by MTT assay. The apoptotic rate and the loss of mitochondrial membrane potential (ΔΨm) of the TM-stimulated chondrocytes treated with BZD was markedly decreased compared with those of chondrocytes not treated with BZD, as shown by 4′,6-diamidino-2-phenylindole (DAPI) staining, Annexin V-FITC binding assay and JC-1 assay. To further elucidate the mechanisms responsible for the inhibitory effects of BZD on TM-induced chondrocyte apoptosis mediated by ER stress, the mRNA and protein expression levels of binding immunoglobulin protein (Bip), X-box binding protein 1 (Xbp1), activating transcription factor 4 (Atf4), C/EBP-homologous protein (Chop), caspase-9, caspase-3, B-cell lymphoma 2 (Bcl-2) and Bcl-2-associated X protein (Bax) were measured by reverse transcription-polymerase chain reaction (RT-PCR) and western blot analysis. In the TM-stimulated chondrocytes treated with BZD, the mRNA and protein expression levels of Bip, Atf4, Chop, caspase-9, caspase-3

  14. Junctional abnormalities in human airway epithelial cells expressing F508del CFTR

    PubMed Central

    Stauffer, Brandon; Moriarty, Hannah K.; Kim, Agnes H.; McCarty, Nael A.; Koval, Michael

    2015-01-01

    Cystic fibrosis (CF) has a profound impact on airway physiology. Accumulating evidence suggests that intercellular junctions are impaired in CF. We examined changes to CF transmembrane conductance regulator (CFTR) function, tight junctions, and gap junctions in NuLi-1 (CFTRwt/wt) and CuFi-5 (CFTRΔF508/ΔF508) cells. Cells were studied at air-liquid interface (ALI) and compared with primary human bronchial epithelial cells. On the basis of fluorescent lectin binding, the phenotype of the NuLi-1 and CuFi-5 cells at week 8 resembled that of serous, glycoprotein-rich airway cells. After week 7, CuFi-5 cells possessed 130% of the epithelial Na+ channel activity and 17% of the CFTR activity of NuLi-1 cells. In both cell types, expression levels of CFTR were comparable to those in primary airway epithelia. Transepithelial resistance of NuLi-1 and CuFi-5 cells stabilized during maturation in ALI culture, with significantly lower transepithelial resistance for CuFi-5 than NuLi-1 cells. We also found that F508del CFTR negatively affects gap junction function in the airway. NuLi-1 and CuFi-5 cells express the connexins Cx43 and Cx26. While both connexins were properly trafficked by NuLi-1 cells, Cx43 was mistrafficked by CuFi-5 cells. Cx43 trafficking was rescued in CuFi-5 cells treated with 4-phenylbutyric acid (4-PBA), as assessed by intracellular dye transfer. 4-PBA-treated CuFi-5 cells also exhibited an increase in forskolin-induced CFTR-mediated currents. The Cx43 trafficking defect was confirmed using IB3-1 cells and found to be corrected by 4-PBA treatment. These data support the use of NuLi-1 and CuFi-5 cells to examine the effects of F508del CFTR expression on tight junction and gap junction function in the context of serous human airway cells. PMID:26115671

  15. Bushen Zhuangjin decoction inhibits TM-induced chondrocyte apoptosis mediated by endoplasmic reticulum stress.

    PubMed

    Lin, Pingdong; Weng, Xiaping; Liu, Fayuan; Ma, Yuhuan; Chen, Houhuang; Shao, Xiang; Zheng, Wenwei; Liu, Xianxiang; Ye, Hongzhi; Li, Xihai

    2015-12-01

    Chondrocyte apoptosis triggered by endoplasmic reticulum (ER) stress plays a vital role in the pathogenesis of osteoarthritis (OA). Bushen Zhuangjin decoction (BZD) has been widely used in the treatment of OA. However, the cellular and molecular mechanisms responsible for the inhibitory effects of BZD on chondrocyte apoptosis remain to be elucidated. In the present study, we investigated the effects of BZD on ER stress-induced chondrocyte apoptosis using a chondrocyte in vitro model of OA. Chondrocytes obtained from the articular cartilage of the knee joints of Sprague Dawley (SD) rats were detected by immunohistochemical staining for type Ⅱ collagen. The ER stress-mediated apoptosis of tunicamycin (TM)‑stimulated chondrocytes was detected using 4-phenylbutyric acid (4‑PBA). We found that 4‑PBA inhibited TM-induced chondrocyte apoptosis, which confirmed the successful induction of chondrocyte apoptosis. BZD enhanced the viability of the TM-stimulated chondrocytes in a dose- and time-dependent manner, as shown by MTT assay. The apoptotic rate and the loss of mitochondrial membrane potential (ΔΨm) of the TM-stimulated chondrocytes treated with BZD was markedly decreased compared with those of chondrocytes not treated with BZD, as shown by 4',6-diamidino-2-phenylindole (DAPI) staining, Annexin V-FITC binding assay and JC-1 assay. To further elucidate the mechanisms responsible for the inhibitory effects of BZD on TM‑induced chondrocyte apoptosis mediated by ER stress, the mRNA and protein expression levels of binding immunoglobulin protein (Bip), X‑box binding protein 1 (Xbp1), activating transcription factor 4 (Atf4), C/EBP‑homologous protein (Chop), caspase‑9, caspase-3, B-cell lymphoma 2 (Bcl-2) and Bcl-2-associated X protein (Bax) were measured by reverse transcription-polymerase chain reaction (RT-PCR) and western blot analysis. In the TM-stimulated chondrocytes treated with BZD, the mRNA and protein expression levels of Bip, Atf4, Chop, caspase

  16. Phenylboronic acid functionalized reduced graphene oxide based fluorescence nano sensor for glucose sensing.

    PubMed

    Basiruddin, S K; Swain, Sarat K

    2016-01-01

    Reduced graphene has emerged as promising tools for detection based application of biomolecules as it has high surface area with strong fluorescence quenching property. We have used the concept of fluorescent quenching property of reduced graphene oxide to the fluorescent probes which are close vicinity of its surface. In present work, we have synthesized fluorescent based nano-sensor consist of phenylboronic acid functionalized reduced graphene oxide (rGO-PBA) and di-ol modified fluorescent probe for detection of biologically important glucose molecules. This fluorescent graphene based nano-probe has been characterized by high resolution transmission electron microscope (HRTEM), Atomic force microscope (AFM), UV-visible, Photo-luminescence (PL) and Fourier transformed infrared (FT-IR) spectroscopy. Finally, using this PBA functionalized reduced GO based nano-sensor, we were able to detect glucose molecule in the range of 2 mg/mL to 75 mg/mL in aqueous solution of pH7.4.

  17. Pyrrole-phenylboronic acid: a novel monomer for dopamine recognition and detection based on imprinted electrochemical sensor.

    PubMed

    Zhong, Min; Teng, Ying; Pang, Shufen; Yan, Liqin; Kan, Xianwen

    2015-02-15

    A molecular imprinting polymer (MIP) based electrochemical sensor was successfully prepared for dopamine (DA) recognition and detection using pyrrole-phenylboronic acid (py-PBA) as a novel electropolymerized monomer. py-PBA could form cyclic boronic ester bond with DA, thus endowing a double recognition capacity of the sensor to DA in the combination of the imprinted effect of MIP. Compared with the sensor prepared using pyrrole or phenylboronic acid as electropolymerized monomer, the present sensor exhibited a remarkable high imprinted factor to DA. The influence factors including pH value, the mole ratio between monomer and template molecule, electropolymerization scan rate, and scan cycles of electropolymerization process were investigated and optimized. Under the optimal conditions, the sensor could recognize DA from its analogs and monosaccharides. A linear ranging from 5.0 × 10(-8) to 1.0 × 10(-5) mol/L for the detection of DA was obtained with a detection limit of 3.3 × 10(-8) mol/L (S/N = 3). The sensor has been applied to analyze DA in injection samples with satisfactory results.

  18. Phenylboronic Acid Solid Phase Extraction Cleanup and Isotope Dilution Liquid Chromatography-Tandem Mass Spectrometry for the Determination of Florfenicol Amine in Fish Muscles.

    PubMed

    Sin, Della Wai-Mei; Ho, Clare; Wong, Yiu-Tung

    2015-01-01

    Florfenicol (FFC) residues in foods are regulated as the sum of florfenicol and its metabolites measured as florfenicol amine (FFA). An isotope dilution LC-MS/MS method utilizing phenylboronic acid (PBA) SPE cleanup is established for the accurate determination of FFA in fish muscles (i.e., salmon and tilapia) after acid catalyzed hydrolysis. Comparisons of the PBA SPE cleanup procedure with other cleanup procedures such as mixed-mode cationic (MCX) SPE and solid supported liquid-liquid extraction were performed. Quantification of FFA in fish muscles was accomplished by using matrix-matched calibration with FFA-D3 as the internal standard. The method was validated with FFA fortified fish muscles at three different levels (50, 100, and 200 μg/kg). Conversion of FFC to FFA by acid catalyzed hydrolysis was evaluated and found to be ≥88%. The recoveries of FFA in fish muscles at the three fortification levels ranged from 89 to 106%, and RSDs were ≤9% in all cases. The LOD values in salmon and tilapia muscles were 0.13 and 1.64 μg/kg, respectively. The LOQ values in salmon and tilapia muscles were 0.29 and 4.13 μg/kg, respectively. This method is suitable for the application in routine control of FFC in fishes according to its residue definition.

  19. A borinic acid polymer with fluoride ion- and thermo-responsive properties that are tunable over a wide temperature range.

    PubMed

    Wan, Wen-Ming; Cheng, Fei; Jäkle, Frieder

    2014-08-18

    A new type of smart borinic acid polymer with luminescence and multiple stimuli-responsive properties is reported. In DMSO with small amounts of water, the homopolymer PBA shows a tunable upper critical solution temperature (UCST). As the amount of water increases from 0 to 2.5 % (v/v), the UCST rises linearly from 20 °C to 100 °C (boiling point of water). Thus, the thermal responsive behavior can be tuned over a wide temperature range. Furthermore, polymer solutions in DMSO show a reversible response to fluoride ions, which can be correlated to the presence of the Lewis acidic borinic acid groups. Upon addition of fluoride, the polymer becomes soluble because the functional R2BOH groups are converted into ionic [R2BF2](-) groups, but turns insoluble again upon addition of H2O, which reverses this process.

  20. Phenylbutyrate Is Bacteriostatic against Mycobacterium tuberculosis and Regulates the Macrophage Response to Infection, Synergistically with 25-Hydroxy-Vitamin D3.

    PubMed

    Coussens, Anna K; Wilkinson, Robert J; Martineau, Adrian R

    2015-07-01

    Adjunctive vitamin D treatment for pulmonary tuberculosis enhances resolution of inflammation but has modest effects on bacterial clearance. Sodium 4-phenylbutyrate (PBA) is in clinical use for a range of conditions and has been shown to synergise with vitamin D metabolites to upregulate cathelicidin antimicrobial peptide (CAMP) expression. We investigated whether clinically attainable plasma concentrations of PBA (0.4-4 mM) directly affect Mycobacterium tuberculosis (Mtb) growth and human macrophage and PBMC response to infection. We also tested the ability of PBA to enhance the immunomodulatory actions of the vitamin D metabolite 25(OH)D3 during infection and synergistically inhibit intracellular Mtb growth. PBA inhibited Mtb growth in broth with an MIC99 of 1 mM, which was reduced to 0.25 mM by lowering pH. During human macrophage infection, PBA treatment restricted Mtb uptake, phagocytic receptor expression and intracellular growth in a dose-dependent manner. PBA independently regulated CCL chemokine secretion and induced expression of the antimicrobial LTF (lactoferrin), the anti-inflammatory PROC (protein C) and multiple genes within the NLRP3 inflammasome pathway. PBA co-treatment with 25(OH)D3 synergistically modulated expression of numerous vitamin D-response genes, including CAMP, CYP24A1, CXCL10 and IL-37. This synergistic effect was dependent on MAPK signalling, while the effect of PBA on LTF, PROC and NLRP3 was MAPK-independent. During PBA and 25(OH)D3 co-treatment of human macrophages, in the absence of exogenous proteinase 3 (PR3) to activate cathelicidin, Mtb growth restriction was dominated by the effect of PBA, while the addition of PR3 enhanced growth restriction by 25(OH)D3 and PBA co-treatment. This suggests that PBA augments vitamin D-mediated cathelicidin-dependent Mtb growth restriction by human macrophages and independently induces antimicrobial and anti-inflammatory action. Therefore through both host-directed and bacterial

  1. Phenylbutyrate Is Bacteriostatic against Mycobacterium tuberculosis and Regulates the Macrophage Response to Infection, Synergistically with 25-Hydroxy-Vitamin D₃

    PubMed Central

    Coussens, Anna K.; Wilkinson, Robert J.; Martineau, Adrian R.

    2015-01-01

    Adjunctive vitamin D treatment for pulmonary tuberculosis enhances resolution of inflammation but has modest effects on bacterial clearance. Sodium 4-phenylbutyrate (PBA) is in clinical use for a range of conditions and has been shown to synergise with vitamin D metabolites to upregulate cathelicidin antimicrobial peptide (CAMP) expression. We investigated whether clinically attainable plasma concentrations of PBA (0.4-4mM) directly affect Mycobacterium tuberculosis (Mtb) growth and human macrophage and PBMC response to infection. We also tested the ability of PBA to enhance the immunomodulatory actions of the vitamin D metabolite 25(OH)D3 during infection and synergistically inhibit intracellular Mtb growth. PBA inhibited Mtb growth in broth with an MIC99 of 1mM, which was reduced to 0.25mM by lowering pH. During human macrophage infection, PBA treatment restricted Mtb uptake, phagocytic receptor expression and intracellular growth in a dose-dependent manner. PBA independently regulated CCL chemokine secretion and induced expression of the antimicrobial LTF (lactoferrin), the anti-inflammatory PROC (protein C) and multiple genes within the NLRP3 inflammasome pathway. PBA co-treatment with 25(OH)D3 synergistically modulated expression of numerous vitamin D-response genes, including CAMP, CYP24A1, CXCL10 and IL-37. This synergistic effect was dependent on MAPK signalling, while the effect of PBA on LTF, PROC and NLRP3 was MAPK-independent. During PBA and 25(OH)D3 co-treatment of human macrophages, in the absence of exogenous proteinase 3 (PR3) to activate cathelicidin, Mtb growth restriction was dominated by the effect of PBA, while the addition of PR3 enhanced growth restriction by 25(OH)D3 and PBA co-treatment. This suggests that PBA augments vitamin D–mediated cathelicidin-dependent Mtb growth restriction by human macrophages and independently induces antimicrobial and anti-inflammatory action. Therefore through both host-directed and bacterial

  2. Angiotensin 1-7 Protects against Angiotensin II-Induced Endoplasmic Reticulum Stress and Endothelial Dysfunction via Mas Receptor

    PubMed Central

    Murugan, Dharmani; Lau, Yeh Siang; Lau, Wai Chi; Mustafa, Mohd Rais; Huang, Yu

    2015-01-01

    Angiotensin 1–7 (Ang 1–7) counter-regulates the cardiovascular actions of angiotensin II (Ang II). The present study investigated the protective effect of Ang 1–7 against Ang II-induced endoplasmic reticulum (ER) stress and endothelial dysfunction. Ex vivo treatment with Ang II (0.5 μM, 24 hours) impaired endothelium-dependent relaxation in mouse aortas; this harmful effect of Ang II was reversed by co-treatment with ER stress inhibitors, l4-phenylbutyric acid (PBA) and tauroursodeoxycholic acid (TUDCA) as well as Ang 1–7. The Mas receptor antagonist, A779, antagonized the effect of Ang 1–7. The elevated mRNA expression of CHOP, Grp78 and ATF4 or protein expression of p-eIF2α and ATF6 (ER stress markers) in Ang II-treated human umbilical vein endothelial cells (HUVECs) and mouse aortas were blunted by co-treatment with Ang 1–7 and the latter effect was reversed by A779. Furthermore, Ang II-induced reduction in both eNOS phosphorylation and NO production was inhibited by Ang 1–7. In addition, Ang 1–7 decreased the levels of ER stress markers and augmented NO production in HUVECs treated with ER stress inducer, tunicamycin. The present study provides new evidence for functional antagonism between the two arms of the renin-angiotensin system in endothelial cells by demonstrating that Ang 1–7 ameliorates Ang II-stimulated ER stress to raise NO bioavailability, and subsequently preserves endothelial function. PMID:26709511

  3. Phenylboronic Acid Appended Pyrene-Based Low-Molecular-Weight Injectable Hydrogel: Glucose-Stimulated Insulin Release.

    PubMed

    Mandal, Deep; Mandal, Subhra Kanti; Ghosh, Moumita; Das, Prasanta Kumar

    2015-08-17

    A pyrene-containing phenylboronic acid (PBA) functionalized low-molecular-weight hydrogelator was synthesized with the aim to develop glucose-sensitive insulin release. The gelator showed the solvent imbibing ability in aqueous buffer solutions of pH values, ranging from 8-12, whereas the sodium salt of the gelator formed a hydrogel at physiological pH 7.4 with a minimum gelation concentration (MGC) of 5 mg mL(-1) . The aggregation behavior of this thermoreversible hydrogel was studied by using microscopic and spectroscopic techniques, including transmission electron microscopy, FTIR, UV/Vis, luminescence, and CD spectroscopy. These investigations revealed that hydrogen bonding, π-π stacking, and van der Waals interactions are the key factors for the self-assembled gelation. The diol-sensitive PBA part and the pyrene unit in the gelator were judiciously used in fluorimetric sensing of minute amounts of glucose at physiological pH. The morphological change of the gel due to addition of glucose was investigated by scanning electron microscopy, which denoted the glucose-responsive swelling of the hydrogel. A rheological study indicated the loss of the rigidity of the native gel in the presence of glucose. Hence, the glucose-induced swelling of the hydrogel was exploited in the controlled release of insulin from the hydrogel. The insulin-loaded hydrogel showed thixotropic self-recovery property, which hoisted it as an injectable soft composite. Encouragingly, the gelator was found to be compatible with HeLa cells.

  4. Magnetic bead-based phage anti-immunocomplex assay (PHAIA) for the detection of the urinary biomarker 3-phenoxybenzoic acid to assess human exposure to pyrethroid insecticides.

    PubMed

    Kim, Hee-Joo; Ahn, Ki Chang; González-Techera, Andrés; González-Sapienza, Gualberto G; Gee, Shirley J; Hammock, Bruce D

    2009-03-01

    Noncompetitive immunoassays are advantageous over competitive assays for the detection of small molecular weight compounds. We recently demonstrated that phage peptide libraries can be an excellent source of immunoreagents that facilitate the development of sandwich-type noncompetitive immunoassays for the detection of small analytes, avoiding the technical challenges of producing anti-immunocomplex antibody. In this work we explore a new format that may help to optimize the performance of the phage anti-immunocomplex assay (PHAIA) technology. As a model system we used a polyclonal antibody to 3-phenoxybenzoic acid (3-PBA) and an anti-immunocomplex phage clone bearing the cyclic peptide CFNGKDWLYC. The assay setup with the biotinylated antibody immobilized onto streptavidin-coated magnetic beads significantly reduced the amount of coating antibody giving identical sensitivity (50% saturation of the signal (SC(50))=0.2-0.4ng/ml) to the best result obtained with direct coating of the antibody on ELISA plates. The bead-based assay tolerated up to 10 and 5% of methanol and urine matrix, respectively. This assay system accurately determined the level of spiked 3-PBA in different urine samples prepared by direct dilution or clean-up with solid-phase extraction after acidic hydrolysis with overall recovery of 80-120%.

  5. Magnetic bead-based phage anti-immunocomplex assay (PHAIA) for the detection of the urinary biomarker 3-phenoxybenzoic acid to assess human exposure to pyrethroid insecticides

    PubMed Central

    Kim, Hee-Joo; Ahn, Ki Chang; González-Techera, Andrés; González-Sapienza, Gualberto G.; Gee, Shirley J.; Hammock, Bruce D.

    2010-01-01

    Noncompetitive immunoassays are advantageous over competitive assays for the detection of small molecular weight compounds. We recently demonstrated that phage peptide libraries can be an excellent source of immunoreagents that facilitate the development of sandwich-type noncompetitive immunoassays for the detection of small analytes, avoiding the technical challenges of producing anti-immunocomplex antibody. In this work we explore a new format that may help to optimize the performance of the phage anti-immunocomplex assay (PHAIA) technology. As a model system we used a polyclonal antibody to 3-phenoxybenzoic acid (3-PBA) and an anti-immunocomplex phage clone bearing the cyclic peptide CFNGKDWLYC. The assay setup with the biotinylated antibody immobilized onto streptavidin-coated magnetic beads significantly reduced the amount of coating antibody giving identical sensitivity (50% saturation of the signal (SC50) = 0.2–0.4 ng/ml) to the best result obtained with direct coating of the antibody on ELISA plates. The bead-based assay tolerated up to 10 and 5% of methanol and urine matrix, respectively. This assay system accurately determined the level of spiked 3-PBA in different urine samples prepared by direct dilution or clean-up with solid-phase extraction after acidic hydrolysis with overall recovery of 80–120%. PMID:19101498

  6. L-carnitine attenuates H2O2-induced neuron apoptosis via inhibition of endoplasmic reticulum stress.

    PubMed

    Ye, Junli; Han, Yantao; Chen, Xuehong; Xie, Jing; Liu, Xiaojin; Qiao, Shunhong; Wang, Chunbo

    2014-12-01

    Both oxidative stress and endoplasmic reticulum stress (ER stress) have been linked to pathogenesis of neurodegenerative diseases. Our previous study has shown that L-carnitine may function as an antioxidant to inhibit H2O2-induced oxidative stress in neuroblastoma SH-SY5Y cells. To further explore the neuroprotection of L-carnitine, here we study the effects of L-carnitine on the ER stress response in H2O2-induced SH-SY5Y cell injury. Our results showed that L-carnitine pretreatment could increase cell viability; inhibit apoptosis and ROS accumulation caused by H2O2 or tunicamycin (TM). L-carnitine suppress the endoplasmic reticulum dilation and activation of ER stress-associated proteins including glucose-regulated protein 78 (GRP78), CCAAT/enhancer-binding protein-homologous protein (CHOP), JNK, Bax and Bim induced by H2O2 or TM. In addition, H2O2-induced cell apoptosis and activation of ER stress can also be attenuated by antioxidant N-acetylcysteine (NAC), CHOP siRNA and the inhibitor of ER stress 4-phenylbutyric acid (4-PBA). Taken together, our results demonstrated that H2O2 could trigger both oxidative stress and ER stress in SH-SY5Y cells, and ER stress participated in SH-SY5Y apoptosis mediated by H2O2-induced oxidative stress. CHOP/Bim or JNK/Bim-dependent ER stress signaling pathways maybe related to the neuroprotective effects of L-carnitine against H2O2-induced apoptosis and oxidative injury.

  7. ER stress drives Lipocalin 2 upregulation in prostate cancer cells in an NF-κB-dependent manner

    PubMed Central

    2011-01-01

    Background Tumor cells adapt to endoplasmic reticulum (ER) stress through a set of conserved intracellular pathways, as part of a process termed the unfolded protein response (UPR). The expression of UPR genes/proteins correlates with increasing progression and poor clinical outcome of several tumor types, including prostate cancer. UPR signaling can activate NF-κB, a master regulator of transcription of pro-inflammatory, tumorigenic cytokines. Previous studies have shown that Lipocalin 2 (Lcn2) is upregulated in several epithelial cancers, including prostate cancer, and recently Lcn2 was implicated as a key mediator of breast cancer progression. Here, we hypothesize that the tumor cell UPR regulates Lcn2 production. Methods We interrogated Lcn2 regulation in murine and human prostate cancer cells undergoing pharmacological and physiological ER stress, and tested UPR and NF-κB dependence by using pharmacological inhibitors of these signaling pathways. Results Induction of ER stress using thapsigargin (Tg), a canonical pharmacologic ER stress inducer, or via glucose deprivation, a physiologic ER stressor present in the tumor microenvironment, upregulates LCN2 production in murine and human prostate cancer cells. Inhibition of the UPR using 4-phenylbutyric acid (PBA) dramatically decreases Lcn2 transcription and translation. Inhibition of NF-κB in prostate cancer cells undergoing Tg-mediated ER stress by BAY 11-7082 abrogates Lcn2 upregulation. Conclusions We conclude that the UPR activates Lcn2 production in prostate cancer cells in an NF-κB-dependent manner. Our results imply that the observed upregulation of Lipocalin 2 in various types of cancer cells may be the direct consequence of concomitant UPR activation, and that the ER stress/Lipocalin 2 axis is a potential new target for intervention in cancer progression. PMID:21649922

  8. Unfolded protein response (UPR) signaling regulates arsenic trioxide-mediated macrophage innate immune function disruption

    SciTech Connect

    Srivastava, Ritesh K.; Li, Changzhao; Chaudhary, Sandeep C.; Ballestas, Mary E.; Elmets, Craig A.; Robbins, David J.; Matalon, Sadis; Deshane, Jessy S.; Afaq, Farrukh; Bickers, David R.; Athar, Mohammad

    2013-11-01

    Arsenic exposure is known to disrupt innate immune functions in humans and in experimental animals. In this study, we provide a mechanism by which arsenic trioxide (ATO) disrupts macrophage functions. ATO treatment of murine macrophage cells diminished internalization of FITC-labeled latex beads, impaired clearance of phagocytosed fluorescent bacteria and reduced secretion of pro-inflammatory cytokines. These impairments in macrophage functions are associated with ATO-induced unfolded protein response (UPR) signaling pathway characterized by the enhancement in proteins such as GRP78, p-PERK, p-eIF2α, ATF4 and CHOP. The expression of these proteins is altered both at transcriptional and translational levels. Pretreatment with chemical chaperon, 4-phenylbutyric acid (PBA) attenuated the ATO-induced activation in UPR signaling and afforded protection against ATO-induced disruption of macrophage functions. This treatment also reduced ATO-mediated reactive oxygen species (ROS) generation. Interestingly, treatment with antioxidant N-acetylcysteine (NAC) prior to ATO exposure, not only reduced ROS production and UPR signaling but also improved macrophage functions. These data demonstrate that UPR signaling and ROS generation are interdependent and are involved in the arsenic-induced pathobiology of macrophage. These data also provide a novel strategy to block the ATO-dependent impairment in innate immune responses. - Highlights: • Inorganic arsenic to humans and experimental animals disrupt innate immune responses. • The mechanism underlying arsenic impaired macrophage functions involves UPR signaling. • Chemical chaperon attenuates arsenic-mediated macrophage function impairment. • Antioxidant, NAC blocks impairment in arsenic-treated macrophage functions.

  9. Neuroprotective Effects of Ginsenoside Rb1 on High Glucose-Induced Neurotoxicity in Primary Cultured Rat Hippocampal Neurons

    PubMed Central

    Liu, Di; Zhang, Hong; Gu, Wenjuan; Liu, Yuqin; Zhang, Mengren

    2013-01-01

    Ginsenoside Rb1 is one of the main active principles in traditional herb ginseng and has been reported to have a wide variety of neuroprotective effects. Endoplasmic reticulum (ER) stress has been implicated in neurodegenerative diseases, so the present study aimed to observe the effects of ginsenoside Rb1 on ER stress signaling pathways in high glucose-treated hippocampal neurons. The results from MTT, TUNEL labeling and Annexin V-FITC/PI/Hoechst assays showed that incubating neurons with 50 mM high glucose for 72h decreased cell viability and increased the number of apoptotic cells whereas treating neurons with 1 μM Rb1 for 72h protected the neurons against high glucose-induced cell damage. Further molecular mechanism study demonstrated that Rb1 suppressed the activation of ER stress-associated proteins including protein kinase RNA (PKR)-like ER kinase (PERK) and C/EBP homology protein (CHOP) and downregulation of Bcl-2 induced by high glucose. Moreover, Rb1 inhibited both the elevation of intracellular reactive oxygen species (ROS) and the disruption of mitochondrial membrane potential induced by high glucose. In addition, the high glucose-induced cell apoptosis, activation of ER stress, ROS accumulation and mitochondrial dysfunction can also be attenuated by the inhibitor of ER stress 4-phenylbutyric acid (4-PBA) and anti-oxidant N-acetylcysteine(NAC). In conclusion, these results suggest that Rb1 may protect neurons against high glucose-induced cell injury through inhibiting CHOP signaling pathway as well as oxidative stress and mitochondrial dysfunction. PMID:24223941

  10. Phenylbutyrate induces LL-37-dependent autophagy and intracellular killing of Mycobacterium tuberculosis in human macrophages.

    PubMed

    Rekha, Rokeya Sultana; Rao Muvva, S S V Jagadeeswara; Wan, Min; Raqib, Rubhana; Bergman, Peter; Brighenti, Susanna; Gudmundsson, Gudmundur H; Agerberth, Birgitta

    2015-01-01

    LL-37 is a human antimicrobial peptide (AMP) of the cathelicidin family with multiple activities including a mediator of vitamin D-induced autophagy in human macrophages, resulting in intracellular killing of Mycobacterium tuberculosis (Mtb). In a previous trial in healthy volunteers, we have shown that LL-37 expression and subsequent Mtb-killing can be further enhanced by 4-phenylbutyrate (PBA), also an inducer of LL-37 expression. Here, we explore a potential mechanism(s) behind PBA and LL-37-induced autophagy and intracellular killing of Mtb. Mtb infection of macrophages downregulated the expression of both the CAMP transcript and LL-37 peptide as well as certain autophagy-related genes (BECN1 and ATG5) at both the mRNA and protein levels. In addition, activation of LC3-II in primary macrophages and THP-1 cells was not detected. PBA and the active form of vitamin D3 (1,25[OH]2D3), separately or particularly in combination, were able to overcome Mtb-induced suppression of LL-37 expression. Notably, reactivation of autophagy occurred by stimulation of macrophages with PBA and promoted colocalization of LL-37 and LC3-II in autophagosomes. Importantly, PBA treatment failed to induce autophagy in Mtb-infected THP-1 cells, when the expression of LL-37 was silenced. However, PBA-induced autophagy was restored when the LL-37 knockdown cells were supplemented with synthetic LL-37. Interestingly, we have found that LL-37-induced autophagy was mediated via P2RX7 receptor followed by enhanced cytosolic free Ca(2+), and activation of AMPK and PtdIns3K pathways. Altogether, these results suggest a novel activity for PBA as an inducer of autophagy, which is LL-37-dependent and promotes intracellular killing of Mtb in human macrophages.

  11. Monitoring of total type ii pyrethroid pesticides in citrus oils and water by converting to a common product 3-phenoxybenzoic acid.

    PubMed

    McCoy, Mark R; Yang, Zheng; Fu, Xun; Ahn, Ki Chang; Gee, Shirley J; Bom, David C; Zhong, Ping; Chang, Dan; Hammock, Bruce D

    2012-05-23

    Pyrethroids are a class of insecticides that are becoming increasingly popular in agricultural and home use applications. Sensitive assays for pyrethroid insecticides in complex matrices are difficult with both instrumental and immunochemical methods. Environmental analysis of the pyrethroids by immunoassay requires either knowing which pyrethroids contaminate the source or the use of nonspecific antibodies with cross-reactivities to a class of compounds. We describe an alternative method that converts the type II pyrethroids to a common chemical product, 3-phenoxybenzoic acid (3-PBA), prior to analysis. This method is much more sensitive than detecting the parent compound, and it is much easier to detect a single compound rather than an entire class of compounds. This is useful in screening for pyrethroids as a class or in situations where a single type of pyrethroid is used. We demonstrated this technique in both citrus oils and environmental water samples with conversion rates of the pyrethroid to 3-PBA that range from 45 to 75% and methods that require no extraction steps for either the immunoassay or the liquid chromatography-tandem mass spectrometry (LC-MS/MS) techniques. Limits of detection for this technique applied to orange oil are 5 nM, 2 μM, and 0.8 μM when detected by LC-MS/MS, gas chromatography-mass spectrometry, and immunoassay, respectively. The limit of detection for pyrethroids in water when detected by immunoassay was 2 nM.

  12. Tuning Acid-Base Properties Using Mg-Al Oxide Atomic Layer Deposition.

    PubMed

    Jackson, David H K; O'Neill, Brandon J; Lee, Jechan; Huber, George W; Dumesic, James A; Kuech, Thomas F

    2015-08-01

    Atomic layer deposition (ALD) was used to coat γ-Al2O3 particles with oxide films of varying Mg/Al atomic ratios, which resulted in systematic variation of the acid and base site areal densities. Variation of Mg/Al also affected morphological features such as crystalline phase, pore size distribution, and base site proximity. Areal base site density increased with increasing Mg content, while acid site density went through a maximum with a similar number of Mg and Al atoms in the coating. This behavior leads to nonlinearity in the relationship between Mg/Al and acid/base site ratio. The physical and chemical properties were elucidated using scanning electron microscopy (SEM), energy-dispersive X-ray spectroscopy (EDS), powder X-ray diffraction (XRD), X-ray photoelectron spectroscopy (XPS), N2 physisorption, and CO2 and NH3 temperature-programmed desorption (TPD). Fluorescence emission spectroscopy of samples grafted with 1-pyrenebutyric acid (PBA) was used for analysis of base site proximity. The degree of base site clustering was correlated to acid site density. Catalytic activity in the self-condensation of acetone was dependent on sample base site density and independent of acid site density. PMID:26168188

  13. Tuning Acid-Base Properties Using Mg-Al Oxide Atomic Layer Deposition.

    PubMed

    Jackson, David H K; O'Neill, Brandon J; Lee, Jechan; Huber, George W; Dumesic, James A; Kuech, Thomas F

    2015-08-01

    Atomic layer deposition (ALD) was used to coat γ-Al2O3 particles with oxide films of varying Mg/Al atomic ratios, which resulted in systematic variation of the acid and base site areal densities. Variation of Mg/Al also affected morphological features such as crystalline phase, pore size distribution, and base site proximity. Areal base site density increased with increasing Mg content, while acid site density went through a maximum with a similar number of Mg and Al atoms in the coating. This behavior leads to nonlinearity in the relationship between Mg/Al and acid/base site ratio. The physical and chemical properties were elucidated using scanning electron microscopy (SEM), energy-dispersive X-ray spectroscopy (EDS), powder X-ray diffraction (XRD), X-ray photoelectron spectroscopy (XPS), N2 physisorption, and CO2 and NH3 temperature-programmed desorption (TPD). Fluorescence emission spectroscopy of samples grafted with 1-pyrenebutyric acid (PBA) was used for analysis of base site proximity. The degree of base site clustering was correlated to acid site density. Catalytic activity in the self-condensation of acetone was dependent on sample base site density and independent of acid site density.

  14. Aortic ER stress in streptozotocin-induced diabetes mellitus in APA hamsters.

    PubMed

    Kurokawa, Masaki; Hideshima, Makoto; Ishii, Yoshiyuki; Kyuwa, Shigeru; Yoshikawa, Yasuhiro

    2009-04-01

    Atherosclerosis is thought to be associated with endoplasmic reticulum (ER) dysfunction and the accumulation of unfolded proteins. In this study, we examined the relationship between atherosclerosis and ER stress and the effect of sodium 4-phenylbutyrate (4-PBA), a kind of chemical chaperone, on atherosclerosis in streptozotocin-induced diabetic APA hamsters. Male, 8-week-old, APA hamsters were injected with streptozotocin (30 mg/kg body weight) to induce diabetes mellitus, and ER stress was evaluated immunohistochemically or by semi-quantitative RT-PCR analysis using ER stress markers such as calreticulin and GPR78. Control hamsters were injected with citrate buffer and were similarly analyzed. In the aorta of control animals, a weak ER stress was detected, and 4-PBA treatment decreased the calreticulin- and GRP78-positive areas and also reduced the mRNA levels of calreticulin and GRP78. On the other hand, strong ER stress was detected at the lesser curvature of the aortic arch of streptozotocin-induced diabetic APA hamsters. However, 4-PBA treatment failed to lessen the ER stress in the aorta and had no effect on improvement of the atherosclerotic lesions. These results may provide an explanation for the complex etiology of atherosclerosis accompanied by diabetes mellitus and various other clinical phenotypes of atherosclerosis.

  15. Palmitate-induced Endoplasmic Reticulum stress and subsequent C/EBPα Homologous Protein activation attenuates leptin and Insulin-like growth factor 1 expression in the brain.

    PubMed

    Marwarha, Gurdeep; Claycombe, Kate; Schommer, Jared; Collins, David; Ghribi, Othman

    2016-11-01

    The peptide hormones Insulin-like growth factor-1 (IGF1) and leptin mediate a myriad of biological effects - both in the peripheral and central nervous systems. The transcription of these two hormones is regulated by the transcription factor C/EBPα, which in turn is negatively regulated by the transcription factor C/EBP Homologous Protein (CHOP), a specific marker of endoplasmic reticulum (ER) stress. In the peripheral system, disturbances in leptin and IGF-1 levels are implicated in a variety of metabolic diseases including obesity, diabetes, atherosclerosis and cardiovascular diseases. Current research suggests a positive correlation between consumption of diets rich in saturated free fatty acids (sFFA) and metabolic diseases. Induction of ER stress and subsequent dysregulation in the expression levels of leptin and IGF-1 have been shown to mediate sFFA-induced metabolic diseases in the peripheral system. Palmitic acid (palmitate), the most commonly consumed sFFA, has been shown to be up-taken by the brain, where it may promote neurodegeneration. However, the extent to which palmitate induces ER stress in the brain and attenuates leptin and IGF1 expression has not been determined. We fed C57BL/6J mice a palmitate-enriched diet and determined effects on the expression levels of leptin and IGF1 in the hippocampus and cortex. We further determined the extent to which ER stress and subsequent CHOP activation mediate the palmitate effects on the transcription of leptin and IGF1. We demonstrate that palmitate induces ER stress and decreases leptin and IGF1 expression by inducing the expression of CHOP. The molecular chaperone 4-phenylbutyric acid (4-PBA), an inhibitor of ER stress, precludes the palmitate-evoked down-regulation of leptin and IGF1 expression. Furthermore, the activation of CHOP in response to ER stress is pivotal in the attenuation of leptin and IGF1 expression as knocking-down CHOP in mice or in SH-SY5Y and Neuro-2a (N2a) cells rescues the palmitate

  16. NMR, FT-IR, Raman and UV-Vis spectroscopic investigation and DFT study of 6-Bromo-3-Pyridinyl Boronic Acid

    NASA Astrophysics Data System (ADS)

    Dikmen, Gökhan; Alver, Özgür

    2015-11-01

    Possible stable conformers and geometrical molecular structures of 6-Bromo-3-Pyridinyl Boronic acid (6B3PBA; C5H5BBrNO2) were studied experimentally and theoretically using FT-IR and Raman spectroscopic methods. FT-IR and Raman spectra were recorded in the region of 4000-400 cm-1 and 3700-400 cm-1, respectively. The structural properties were investigated further, using 1H, 13C, 1H coupled 13C, HETCOR, COSY and APT NMR techniques. The optimized geometric structures were searched by Becke-3-Lee-Yang-Parr (B3LYP) hybrid density functional theory method with 6-311++G(d, p) basis set. Vibrational wavenumbers of 6B3PBA were calculated whereby B3LYP density functional methods including 6-311++G(d, p), 6-311G(d, p), 6-311G(d), 6-31G(d, p) and 6-31G(d) basis sets. The comparison of the experimentally and theoretically obtained results using mean absolute error and experimental versus calculated correlation coefficients for the vibrational wavenumbers indicates that B3LYP method with 6-311++G(d, p) gives more satisfactory results for predicting vibrational wavenumbers when compared to the 6-311G(d, p), 6-311G(d), 6-31G(d, p) and 6-31G(d) basis sets. However, this method and none of the mentioned methods here seem suitable for the calculations of OH stretching modes, most likely because increasing unharmonicity in the high wave number region and possible intra and inter molecular interactions at OH edges lead some deviations between experimental and theoretical results. Moreover, reliable vibrational assignments were made on the basis of total energy distribution (TED) calculated using scaled quantum mechanical (SQM) method.

  17. Dachtal Isomers and Acidic Herbicides and Pesticides in Eggs of Osprey (Pandion haliaetus) from the Seattle and Everett Areas, Washington, U.S.A

    USGS Publications Warehouse

    Chu, S.; Henny, Charles J.; Kaiser, James L.; Drouillard, K.G.; Haffner, G.D.; Letcher, R.J.

    2007-01-01

    Current-use chlorophenoxy herbicides including 2,4-dichlorophenoxyacetic acid, dicamba, triclopyr, dicamba, dimethyl tetrachloroterephthalate (DCPA or dacthal), and the metabolite of pyrethroids, 3-phenoxybenzoic acid (3-PBA), and the fungicide, chlorothalonil, were investigated in the eggs of osprey (Pandion haliaetus) that were collected from 15 sites from five study areas Puget Sound/Seattle area of Washington State, USA. DCPA differs from acidic chlorophenoxy herbicides, and is not readily hydrolyzed to free acid or acid metabolites, and thus we developed a new method. Of the 12 chlorophenoxy herbicides and chlorothalonil analyzed only DCPA could be quantified at six of these sites (2.0 to 10.3 pg/g fresh weight). However, higher levels (6.9 to 85.5 pg/g fresh weight) of the unexpected DCPA structural isomer, dimethyl tetrachlorophthalate (diMe-TCP) were quantified in eggs from all sites. diMe-TCP concentrations tended to be higher in eggs from the Everett Harbor area. As diMe-TCP is not an industrial product, and not commercially available, the source of diMe-TCP is unclear. Regardless, these findings indicate that DCPA and diMe-TCP can be accumulated in the food chain of fish-eating osprey, and transferred in ovo to eggs, and thus may be of concern to the health of the developing chick and the general reproductive health of this osprey population.

  18. Folic Acid

    MedlinePlus

    Folic acid is a B vitamin. It helps the body make healthy new cells. Everyone needs folic acid. For women who may get pregnant, it is really important. Getting enough folic acid before and during pregnancy can prevent major birth ...

  19. Folic Acid

    MedlinePlus

    Folic acid is used to treat or prevent folic acid deficiency. It is a B-complex vitamin needed by ... Folic acid comes in tablets. It usually is taken once a day. Follow the directions on your prescription label ...

  20. Amino acids

    MedlinePlus

    ... amino acids are: histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan , and valine. Nonessential amino acids "Nonessential" means that our bodies produce an amino ...

  1. Acid Rain.

    ERIC Educational Resources Information Center

    Openshaw, Peter

    1987-01-01

    Provides some background information on acid deposition. Includes a historical perspective, describes some effects of acid precipitation, and discusses acid rain in the United Kingdom. Contains several experiments that deal with the effects of acid rain on water quality and soil. (TW)

  2. Acid rain

    SciTech Connect

    Not Available

    1985-01-01

    This report has four parts: they discuss acid rain in relation to acid soils, agriculture, forests, and aquatic ecosystems. Among findings: modern sources of acid deposition from the atmosphere for all the acid soils in the world, nor even chiefly responsible for those of northern U.S. Agriculture has its problems, but acid precipitation is probably not one of them. More research is needed to determine to what extent acid precipitation is responsible for forest declines and for smaller detrimental effects on forest growth where no damage to the foliage is evident. Many lakes and streams are extremely sensitive to added acids.

  3. Foam injection molding of poly(lactic acid) with physical blowing agents

    NASA Astrophysics Data System (ADS)

    Pantani, R.; Sorrentino, A.; Volpe, V.; Titomanlio, G.

    2014-05-01

    Foam injection molding uses environmental friendly blowing agents under high pressure and temperature to produce parts having a cellular core and a compact solid skin (the so-called "structural foam"). The addition of a supercritical gas reduces the part weight and at the same time improves some physical properties of the material through the promotion of a faster crystallization; it also leads to the reduction of both the viscosity and the glass transition temperature of the polymer melt, which therefore can be injection molded adopting lower temperatures and pressures. These aspects are of extreme interest for biodegradable polymers, which often present a very narrow processing window, with the suitable processing temperatures close to the degradation conditions. In this work, foam injection molding was carried out by an instrumented molding machine, able to measure the pressure evolution in different positions along the flow-path. The material adopted was a biodegradable polymer, namely the Poly(lactic acid), PLA. The effect of a physical blowing agent (PBA) on the viscosity was measured. The density reduction and the morphology of parts obtained by different molding conditions was assessed.

  4. Aminocaproic Acid

    MedlinePlus

    Aminocaproic acid is used to control bleeding that occurs when blood clots are broken down too quickly. This type ... the baby is ready to be born). Aminocaproic acid is also used to control bleeding in the ...

  5. Ethacrynic Acid

    MedlinePlus

    Ethacrynic acid, a 'water pill,' is used to treat swelling and fluid retention caused by various medical problems. It ... Ethacrynic acid comes as a tablet to take by mouth. It is usually taken once or twice a day ...

  6. Aristolochic Acids

    MedlinePlus

    ... Sciences NIH-HHS www.niehs.nih.gov Aristolochic Acids Key Points Report on Carcinogens Status Known to be human carcinogens Aristolochia Clematitis Aristolochic Acids n Known human carcinogens n Found in certain ...

  7. Obeticholic Acid

    MedlinePlus

    Obeticholic acid is used alone or in combination with ursodiol (Actigall, Urso) to treat primary biliary cholangitis (PBC; a ... were not treated successfully with ursodiol alone. Obeticholic acid is in a class of medications called farnesoid ...

  8. Acid mucopolysaccharides

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/003368.htm Acid mucopolysaccharides To use the sharing features on this page, please enable JavaScript. Acid mucopolysaccharides is a test that measures the amount ...

  9. Fatty acids - trans fatty acids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The data supporting a negative effect of dietary trans fatty acids on cardiovascular disease risk is consistent. The primary dietary sources of trans fatty acids include partially hydrogenated fat and rudiment fat. The adverse effect of trans fatty acids on plasma lipoprotein profiles is consisten...

  10. Aspartic acid

    MedlinePlus

    ... Hormone production and release Normal nervous system function Plant sources of aspartic acid include: Legumes such as soybeans, garbanzo beans, and lentils Peanuts, almonds, walnuts, and flaxseeds Animal ...

  11. Usnic acid.

    PubMed

    Ingólfsdóttir, K

    2002-12-01

    Since its first isolation in 1844, usnic acid [2,6-diacetyl-7,9-dihydroxy-8,9b-dimethyl-1,3(2H,9bH)-dibenzo-furandione] has become the most extensively studied lichen metabolite and one of the few that is commercially available. Usnic acid is uniquely found in lichens, and is especially abundant in genera such as Alectoria, Cladonia, Usnea, Lecanora, Ramalina and Evernia. Many lichens and extracts containing usnic acid have been utilized for medicinal, perfumery, cosmetic as well as ecological applications. Usnic acid as a pure substance has been formulated in creams, toothpaste, mouthwash, deodorants and sunscreen products, in some cases as an active principle, in others as a preservative. In addition to antimicrobial activity against human and plant pathogens, usnic acid has been shown to exhibit antiviral, antiprotozoal, antiproliferative, anti-inflammatory and analgesic activity. Ecological effects, such as antigrowth, antiherbivore and anti-insect properties, have also been demonstrated. A difference in biological activity has in some cases been observed between the two enantiomeric forms of usnic acid. Recently health food supplements containing usnic acid have been promoted for use in weight reduction, with little scientific support. The emphasis of the current review is on the chemistry and biological activity of usnic acid and its derivatives in addition to rational and ecologically acceptable methods for provision of this natural compound on a large scale.

  12. Acid rain

    SciTech Connect

    Elsworth, S.

    1985-01-01

    This book was written in a concise and readable style for the lay public. It's purpose was to make the public aware of the damage caused by acid rain and to mobilize public opinion to favor the elimination of the causes of acid rain.

  13. Acid rain

    SciTech Connect

    White, J.C. )

    1988-01-01

    This book presents the proceedings of the third annual conference sponsored by the Acid Rain Information Clearinghouse (ARIC). Topics covered include: Legal aspects of the source-receptor relationship: an energy perspective; Scientific uncertainty, agency inaction, and the courts; and Acid rain: the emerging legal framework.

  14. How Acidic Is Carbonic Acid?

    PubMed

    Pines, Dina; Ditkovich, Julia; Mukra, Tzach; Miller, Yifat; Kiefer, Philip M; Daschakraborty, Snehasis; Hynes, James T; Pines, Ehud

    2016-03-10

    Carbonic, lactic, and pyruvic acids have been generated in aqueous solution by the transient protonation of their corresponding conjugate bases by a tailor-made photoacid, the 6-hydroxy-1-sulfonate pyrene sodium salt molecule. A particular goal is to establish the pK(a) of carbonic acid H2CO3. The on-contact proton transfer (PT) reaction rate from the optically excited photoacid to the carboxylic bases was derived, with unprecedented precision, from time-correlated single-photon-counting measurements of the fluorescence lifetime of the photoacid in the presence of the proton acceptors. The time-dependent diffusion-assisted PT rate was analyzed using the Szabo-Collins-Kimball equation with a radiation boundary condition. The on-contact PT rates were found to follow the acidity order of the carboxylic acids: the stronger was the acid, the slower was the PT reaction to its conjugate base. The pK(a) of carbonic acid was found to be 3.49 ± 0.05 using both the Marcus and Kiefer-Hynes free energy correlations. This establishes H2CO3 as being 0.37 pK(a) units stronger and about 1 pK(a) unit weaker, respectively, than the physiologically important lactic and pyruvic acids. The considerable acid strength of intact carbonic acid indicates that it is an important protonation agent under physiological conditions. PMID:26862781

  15. Acid rain

    SciTech Connect

    Sweet, W.

    1980-06-20

    Acid precipitation includes not only rain but also acidified snow, hail and frost, as well as sulfur and nitrogen dust. The principal source of acid precipitation is pollution emitted by power plants and smelters. Sulfur and nitrogen compounds contained in the emissions combine with moisture to form droplets with a high acid content - sometimes as acidic as vinegar. When sufficiently concentrated, these acids can kill fish and damage material structures. Under certain circumstances they may reduce crop and forest yields and cause or aggravate respiratory diseases in humans. During the summer, especially, pollutants tend to collect over the Great Lakes in high pressure systems. Since winds typically are westerly and rotate clockwise around high pressure systems, the pollutants gradually are dispersed throughout the eastern part of the continent.

  16. Asparagusic acid.

    PubMed

    Mitchell, Stephen C; Waring, Rosemary H

    2014-01-01

    Asparagusic acid (1,2-dithiolane-4-carboxylic acid) is a simple sulphur-containing 5-membered heterocyclic compound that appears unique to asparagus, though other dithiolane derivatives have been identified in non-food species. This molecule, apparently innocuous toxicologically to man, is the most probable culprit responsible for the curious excretion of odorous urine following asparagus ingestion. The presence of the two adjacent sulphur atoms leads to an enhanced chemical reactivity, endowing it with biological properties including the ability to substitute potentially for α-lipoic acid in α-keto-acid oxidation systems. This brief review collects the scattered data available in the literature concerning asparagusic acid and highlights its properties, intermediary metabolism and exploratory applications.

  17. Acid rain

    SciTech Connect

    Bess, F.D.

    1980-01-01

    The acid rain problem in the northeastern U.S. has been growing in severity and geographical areas affected. Acid rain has damaged, or will result in damage to visibility, physical structures and materials, aquatic life, timber, crops, and soils. The principal causes of acid rain in the northeastern U.S. are sulfur oxide and nitrogen oxide emissions from large power plants and smelters in the Ohio River Valley. Immediate corrective action and appropriate research are needed to reduce acid precipitation. Short-term programs that will define the rate of environmental deterioration, remaining environmental capacity to resist sudden deterioration, mechanisms of acid rain formation, and costs of various control options must be developed. (3 maps, 13 references, 1 table)

  18. Asparagusic acid.

    PubMed

    Mitchell, Stephen C; Waring, Rosemary H

    2014-01-01

    Asparagusic acid (1,2-dithiolane-4-carboxylic acid) is a simple sulphur-containing 5-membered heterocyclic compound that appears unique to asparagus, though other dithiolane derivatives have been identified in non-food species. This molecule, apparently innocuous toxicologically to man, is the most probable culprit responsible for the curious excretion of odorous urine following asparagus ingestion. The presence of the two adjacent sulphur atoms leads to an enhanced chemical reactivity, endowing it with biological properties including the ability to substitute potentially for α-lipoic acid in α-keto-acid oxidation systems. This brief review collects the scattered data available in the literature concerning asparagusic acid and highlights its properties, intermediary metabolism and exploratory applications. PMID:24099657

  19. Acid fog

    SciTech Connect

    Hileman, B.

    1983-03-01

    Fog in areas of southern California previously thought to be pollution-free has been shown to have a pH as low as 1.69. It has been found to be most acidic after smoggy days, suggesting that it forms on the aerosol associated with the previously exiting smog. Studies on Whiteface Mountain in the Adirondacks show that fog water is often 10 times as acidic as rainwater. As a result of their studies, California plans to spend $4 million on acid deposition research in the coming year. (JMT)

  20. Tranexamic Acid

    MedlinePlus

    ... is used to treat heavy bleeding during the menstrual cycle (monthly periods) in women. Tranexamic acid is in ... tablets for more than 5 days in a menstrual cycle or take more than 6 tablets in a ...

  1. Mefenamic Acid

    MedlinePlus

    ... as mefenamic acid may cause ulcers, bleeding, or holes in the stomach or intestine. These problems may ... like coffee grounds, blood in the stool, or black and tarry stools.Keep all appointments with your ...

  2. Acid Precipitation

    ERIC Educational Resources Information Center

    Likens, Gene E.

    1976-01-01

    Discusses the fact that the acidity of rain and snow falling on parts of the U.S. and Europe has been rising. The reasons are still not entirely clear and the consequences have yet to be well evaluated. (MLH)

  3. Acidic precipitation

    SciTech Connect

    Martin, H.C.

    1987-01-01

    At the International Symposium on Acidic Precipitation, over 400 papers were presented, and nearly 200 of them are included here. They provide an overview of the present state of the art of acid rain research. The Conference focused on atmospheric science (monitoring, source-receptor relationships), aquatic effects (marine eutrophication, lake acidification, impacts on plant and fish populations), and terrestrial effects (forest decline, soil acidification, etc.).

  4. Functional Rescue of Trafficking-Impaired ABCB4 Mutants by Chemical Chaperones

    PubMed Central

    Gordo-Gilart, Raquel; Andueza, Sara; Hierro, Loreto; Jara, Paloma; Alvarez, Luis

    2016-01-01

    Multidrug resistance protein 3 (MDR3, ABCB4) is a hepatocellular membrane protein that mediates biliary secretion of phosphatidylcholine. Null mutations in ABCB4 gene give rise to severe early-onset cholestatic liver disease. We have previously shown that the disease-associated mutations p.G68R, p.G228R, p.D459H, and p.A934T resulted in retention of ABCB4 in the endoplasmic reticulum, thus failing to target the plasma membrane. In the present study, we tested the ability of two compounds with chaperone-like activity, 4-phenylbutyrate and curcumin, to rescue these ABCB4 mutants by assessing their effects on subcellular localization, protein maturation, and phospholipid efflux capability. Incubation of transfected cells at a reduced temperature (30°C) or exposure to pharmacological doses of either 4-PBA or curcumin restored cell surface expression of mutants G228R and A934T. The delivery of these mutants to the plasma membrane was accompanied by a switch in the ratio of mature to inmature protein forms, leading to a predominant expression of the mature protein. This effect was due to an improvement in the maturation rate and not to the stabilization of the mature forms. Both mutants were also functionally rescued, displaying bile salt-dependent phospholipid efflux activity after addition of 4-PBA or curcumin. Drug-induced rescue was mutant specific, given neither 4-PBA nor curcumin had an effect on the ABCB4 mutants G68R and A934T. Collectively, these data indicate that the functionality of selected trafficking-defective ABCB4 mutants can be recovered by chemical chaperones through restoration of membrane localization, suggesting a potential treatment for patients carrying such mutations. PMID:26900700

  5. The Dichotomy of Endoplasmic Reticulum Stress Response in Liver Ischemia-Reperfusion Injury.

    PubMed

    Zhou, Haomming; Zhu, Jianjun; Yue, Shi; Lu, Ling; Busuttil, Ronald W; Kupiec-Weglinski, Jerzy W; Wang, Xuehao; Zhai, Yuan

    2016-02-01

    Endoplasmic reticulum (ER) stress plays critical roles in the pathogenesis of liver ischemia-reperfusion injury (IRI). As ER stress triggers an adaptive cellular response, the question of what determines its functional outcome in liver IRI remains to be defined. In a murine liver partial warm ischemia model, we studied how transient (30 minutes) or prolonged (90 minutes) liver ischemia regulated local ER stress response and autophagy activities and their relationship with liver IRI. Effects of chemical chaperon 4-phenylbutyrate (4-PBA) or autophagy inhibitor 3-methyladenine (3-MA) were evaluated. Our results showed that although the activating transcription factor 6 branch of ER stress response was induced in livers by both types of ischemia, liver autophagy was activated by transient, but inhibited by prolonged, ischemia. Although 3-MA had no effects on liver IRI after prolonged ischemia, it significantly increased liver IRI after transient ischemia. The 4-PBA treatment protected livers from IRI after prolonged ischemia by restoring autophagy flux, and the adjunctive 3-MA treatment abrogated its liver protective effect. The same 4-PBA treatment, however, increased liver IRI and disrupted autophagy flux after transient ischemia. Although both types of ischemia activated 5' adenosine monophosphate-activated protein kinase and inactivated protein kinase B (Akt), prolonged ischemia also resulted in downregulations of autophagy-related gene 3 and autophagy-related gene 5 in ischemic livers. These results indicate a functional dichotomy of ER stress response in liver IRI via its regulation of autophagy. Transient ischemia activates autophagy to protect livers from IRI, whereas prolonged ischemia inhibits autophagy to promote the development of liver IRI.

  6. Salicylic acids

    PubMed Central

    Hayat, Shamsul; Irfan, Mohd; Wani, Arif; Nasser, Alyemeni; Ahmad, Aqil

    2012-01-01

    Salicylic acid is well known phytohormone, emerging recently as a new paradigm of an array of manifestations of growth regulators. The area unleashed yet encompassed the applied agriculture sector to find the roles to strengthen the crops against plethora of abiotic and biotic stresses. The skipped part of integrated picture, however, was the evolutionary insight of salicylic acid to either allow or discard the microbial invasion depending upon various internal factors of two interactants under the prevailing external conditions. The metabolic status that allows the host invasion either as pathogenesis or symbiosis with possible intermediary stages in close systems has been tried to underpin here. PMID:22301975

  7. Stearic Acid

    ERIC Educational Resources Information Center

    Young, Jay A.

    2004-01-01

    A chemical laboratory information profile (CLIP) is presented for the chemical, stearic acid. The profile lists the chemical's physical and harmful characteristics, exposure limits, and symptoms of major exposure, for the benefit of teachers and students, who use the chemical in the laboratory.

  8. Trichloroacetic acid

    Integrated Risk Information System (IRIS)

    Trichloroacetic acid ( TCA ) ; CASRN 76 - 03 - 9 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Nonca

  9. Acrylic acid

    Integrated Risk Information System (IRIS)

    Acrylic acid ( CASRN 79 - 10 - 7 ) Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic Eff

  10. Selenious acid

    Integrated Risk Information System (IRIS)

    Selenious acid ; CASRN 7783 - 00 - 8 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic E

  11. Dichloroacetic acid

    Integrated Risk Information System (IRIS)

    Dichloroacetic acid ; CASRN 79 - 43 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogeni

  12. Cacodylic acid

    Integrated Risk Information System (IRIS)

    Cacodylic acid ; CASRN 75 - 60 - 5 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic Eff

  13. Phosphoric acid

    Integrated Risk Information System (IRIS)

    Phosphoric acid ; CASRN 7664 - 38 - 2 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic

  14. Benzoic acid

    Integrated Risk Information System (IRIS)

    Benzoic acid ; CASRN 65 - 85 - 0 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic Effec

  15. Formic acid

    Integrated Risk Information System (IRIS)

    Formic acid ; CASRN 64 - 18 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic Effect

  16. [Hyaluronic acid].

    PubMed

    Pomarede, N

    2008-01-01

    Hyaluronic Acid (HA) is now a leader product in esthetic procedures for the treatment of wrinkles and volumes. The structure of HA, its metabolism, its physiological function are foremost breaking down then its use in aesthetic dermatology: steps of injection, possible side effects, benefits and downsides of the use of HA in aesthetic dermatology.

  17. Analytical method for the trace determination of esterified 3- and 2-monochloropropanediol and glycidyl fatty acid esters in various food matrices.

    PubMed

    Samaras, Vasilios G; Giri, Anupam; Zelinkova, Zuzana; Karasek, Lubomir; Buttinger, Gerhard; Wenzl, Thomas

    2016-09-30

    Fatty acid esters of 3-monochloro-1,2-propanediol (3-MCPDEs), of 2-monochloro-1,3-propanediol (2-MCPDEs) and of 2,3-epoxy-1-propanol or glycidol (GEs), which are considered to be deleterious to human health, may occur in a broad variety of food samples. A proper risk assessment of those substances requires the availability of robust occurrence data; in this respect concerns have been raised regarding the reliability of results obtained with the currently available methods to determine those substances in processed food. This article presents an indirect analytical procedure for the simultaneous determination of 3-MCPDEs, 2-MCPDEs and GEs in a wide variety of food products after extraction by pressurised liquid extraction (PLE) and determination by gas chromatography mass-spectrometry (GC-MS). For the differentiation of MCPDEs and GEs, the latter were first converted to monobromopropanediol esters (MBPDEs) in acid aqueous solution of sodium bromide. MCPDEs and MBPDEs were then hydrolysed under acidic conditions followed by derivatisation of the released free (non-esterified) form in ethyl acetate with phenyl boronic acid (PBA). Quantification of the analytes was carried out using the isotopic labelled analogues of both MCPDEs and GEs. Limits of detection (LODs) and limits of quantitation (LOQs) were in the range of 7-17mgkg(-1) and 13-31mgkg(-1) respectively, while the working range of the method was between LOQ and 1850mgkg(-1) expressed on fat basis. The developed method was successfully applied for the analysis of the target compounds in more than 650 different food samples covering the following commodities: bread and rolls, fine bakery wares, smoked fish products, fried and roasted meat, potato based snacks and fried potato products, cereal-based snacks and margarines. PMID:27623063

  18. [Supramolecular nanomachines for sugar responsive insulin release systems].

    PubMed

    Egawa, Yuya; Seki, Toshinobu

    2013-01-01

    Cyclodextrins (CyDs) are cyclic oligosaccharides composed of 6, 7, or 8 glucopyranoside units, named α-, β-, or γ-CD, respectively. CyDs consist of a hydrophobic cavity in which hydrophobic molecules are encapsulated to form an inclusion complex. CyDs are widely used in pharmaceutical applications because they function as nanocapsules to improve the stability and solubility of drugs. Recently, CyDs have attracted much attention as for use as components of supramolecular nanostructures that are particularly attractive because of their unique structures. We modified CyDs with phenylboronic acid (PBA), which forms covalent bonds with the diol groups of sugar, and used the resulting PBA-CyDs to prepare supramolecular nanomachines that undergo structural transformation in the presence of a chemical signal in the form of a sugar. PBA-α-CyD formed a supramolecular polymer that showed consecutive intermolecular interactions between PBA and the cavity of another PBA-α-CyD, whereas PBA-β-CyD formed head-to-head dimers in which one PBA moiety was encapsulated in the other. These supramolecular nanostructures disintegrated in the presence of sugars because of the structural change in the PBA moiety and loss of the driving force of the supramolecular assembly. These features of disintegration can be potentially used to prepare a nanomachine that would act as a sugar-responsive insulin release system. Currently, we are studying sugar-responsive nanomachines composed of PEGylated insulin and PBA-γ-CyD.

  19. Hydroxycarboxylic acids and salts

    DOEpatents

    Kiely, Donald E; Hash, Kirk R; Kramer-Presta, Kylie; Smith, Tyler N

    2015-02-24

    Compositions which inhibit corrosion and alter the physical properties of concrete (admixtures) are prepared from salt mixtures of hydroxycarboxylic acids, carboxylic acids, and nitric acid. The salt mixtures are prepared by neutralizing acid product mixtures from the oxidation of polyols using nitric acid and oxygen as the oxidizing agents. Nitric acid is removed from the hydroxycarboxylic acids by evaporation and diffusion dialysis.

  20. Methylmalonic acid blood test

    MedlinePlus

    ... acid is a substance produced when proteins, called amino acids, in the body break down. The health care ... Cederbaum S, Berry GT. Inborn errors of carbohydrate, ammonia, amino acid, and organic acid metabolism. In: Gleason CA, Devaskar ...

  1. Folic Acid and Pregnancy

    MedlinePlus

    ... 5 Things to Know About Zika & Pregnancy Folic Acid and Pregnancy KidsHealth > For Parents > Folic Acid and ... before conception and during early pregnancy . About Folic Acid Folic acid, sometimes called folate, is a B ...

  2. Experimental (FT-IR, FT-Raman, UV-Vis, 1H and 13C NMR) and computational (density functional theory) studies on 3-bromophenylboronic acid

    NASA Astrophysics Data System (ADS)

    Karabacak, M.; Kose, E.; Atac, A.; Sas, E. B.; Asiri, A. M.; Kurt, M.

    2014-11-01

    Structurally, boronic acids are trivalent boron-containing organic compounds that possess one alkyl substituent (i.e., C-Br bond) and two hydroxyl groups to fill the remaining valences on the boron atom. We studied 3-bromophenylboronic acid (3BrPBA); a derivative of boronic acid. This study includes the experimental (FT-IR, FT-Raman, 1H and 13C NMR, UV-Vis) techniques and theoretical (DFT-density functional theory) calculations. The experimental data are recorded, FT-IR (4000-400 cm-1) and FT-Raman spectra (3500-10 cm-1) in the solid phase. 1H and 13C NMR spectra are recorded in DMSO solution. UV-Vis spectrum is recorded in the range of 200-400 nm for each solution (in ethanol and water). The theoretical calculations are computed DFT/B3LYP/6-311++G(d,p) basis set. The optimum geometry is also obtained from inside for possible four conformers using according to position of hydrogen atoms after the scan coordinate of these structures. The fundamental vibrations are assigned on the basis of the total energy distribution (TED) of the vibrational modes, calculated with scaled quantum mechanics (SQM) method and parallel quantum solutions (PQS) program. 1H and 13C NMR chemical shifts are racked on by using the gauge-invariant atomic orbital (GIAO) method. The time-dependent density functional theory (TD-DFT) is used to find HOMO and LUMO energies, excitation energies, oscillator strengths. The density of state of the studied molecule is investigated as total and partial density of state (TDOS and PDOS) and overlap population density of state (OPDOS or COOP) diagrams have been presented. Besides, frontier molecular orbitals (FMOs), molecular electrostatic potential surface (MEPs) and thermodynamic properties are performed. At the end of this work, the results are ensured beneficial for the literature contribution.

  3. Understanding Acid Rain

    ERIC Educational Resources Information Center

    Damonte, Kathleen

    2004-01-01

    The term acid rain describes rain, snow, or fog that is more acidic than normal precipitation. To understand what acid rain is, it is first necessary to know what an acid is. Acids can be defined as substances that produce hydrogen ions (H+), when dissolved in water. Scientists indicate how acidic a substance is by a set of numbers called the pH…

  4. Precipitation: its acidic nature.

    PubMed

    Frohliger, J O; Kane, R

    1975-08-01

    A comparison of the free hydrogen ion concentration and the total hydrogen ion concentration of rain samples shows that rain is a weak acid. The weak acid nature of rain casts doubt on the concepts that the acidity of rain is increasing and that these increases are due to strong acids such as sulfuric acid.

  5. Amino Acid Metabolism Disorders

    MedlinePlus

    ... defects & other health conditions > Amino acid metabolism disorders Amino acid metabolism disorders E-mail to a friend Please ... baby’s newborn screening may include testing for certain amino acid metabolism disorders. These are rare health conditions that ...

  6. Carbolic acid poisoning

    MedlinePlus

    Phenol poisoning; Phenylic acid poisoning; Hydroxybenzene poisoning; Phenic acid poisoning; Benzenol poisoning ... Below are symptoms of carbolic acid poisoning in different parts of the ... urine Decreased urine output No urine output EYES, EARS, ...

  7. Azelaic Acid Topical

    MedlinePlus

    Azelaic acid gel is used to clear the bumps, lesions, and swelling caused by rosacea (a skin disease that ... redness, flushing, and pimples on the face). Azelaic acid cream is used to treat acne. Azelaic acid ...

  8. Uric acid test (image)

    MedlinePlus

    Uric acid urine test is performed to check for the amount of uric acid in urine. Urine is collected over a 24 ... testing. The most common reason for measuring uric acid levels is in the diagnosis or treatment of ...

  9. Facts about Folic Acid

    MedlinePlus

    ... Information For... Media Policy Makers Facts About Folic Acid Language: English Español (Spanish) Recommend on Facebook Tweet ... of the baby's brain and spine. About folic acid Folic acid is a B vitamin. Our bodies ...

  10. Acid Lipase Disease

    MedlinePlus

    ... Awards Enhancing Diversity Find People About NINDS NINDS Acid Lipase Disease Information Page Synonym(s): Cholesterol Ester Storage ... Trials Related NINDS Publications and Information What is Acid Lipase Disease ? Acid lipase disease or deficiency occurs ...

  11. Involvement of Endoplasmic Reticulum Stress, Autophagy, and Apoptosis in Advanced Glycation End Products-Induced Glomerular Mesangial Cell Injury

    PubMed Central

    Chiang, Chih-Kang; Wang, Ching-Chia; Lu, Tien-Fong; Huang, Kuo-How; Sheu, Meei-Ling; Liu, Shing-Hwa; Hung, Kuan-Yu

    2016-01-01

    Advanced glycation end-products (AGEs)-induced mesangial cell death is one of major causes of glomerulus dysfunction in diabetic nephropathy. Both endoplasmic reticulum (ER) stress and autophagy are adaptive responses in cells under environmental stress and participate in the renal diseases. The role of ER stress and autophagy in AGEs-induced mesangial cell death is still unclear. Here, we investigated the effect and mechanism of AGEs on glomerular mesangial cells. AGEs dose-dependently decreased mesangial cell viability and induced cell apoptosis. AGEs also induced ER stress signals in a time- and dose-dependent manner. Inhibition of ER stress with 4-phenylbutyric acid effectively inhibited the activation of eIF2α and CHOP signals and reversed AGEs-induced cell apoptosis. AGEs also activated LC-3 cleavage, increased Atg5 expression, and decreased p62 expression, which indicated the autophagy induction in mesangial cells. Inhibition of autophagy by Atg5 siRNAs transfection aggravated AGEs-induced mesangial cell apoptosis. Moreover, ER stress inhibition by 4-phenylbutyric acid significantly reversed AGEs-induced autophagy, but autophagy inhibition did not influence the AGEs-induced ER stress-related signals activation. These results suggest that AGEs induce mesangial cell apoptosis via an ER stress-triggered signaling pathway. Atg5-dependent autophagy plays a protective role. These findings may offer a new strategy against AGEs toxicity in the kidney. PMID:27665710

  12. Using the MMPB technique to confirm microcystin concentrations in water measured by ELISA and HPLC (UV, MS, MS/MS).

    PubMed

    Foss, Amanda J; Aubel, Mark T

    2015-09-15

    Microcystins have been detected in raw and finished drinking water using a variety of techniques, including assays (immunoassay, phosphatase inhibition) and HPLC (UV, MS/(MS)). The principal challenge to microcystin analysis is accounting for the over 150 variants that have been described. A confirmatory individual variant HPLC analysis is prone to under-reporting total microcystins due to method specificity. One method that allows for total microcystin quantitation is the MMPB technique. In this study, water samples with native microcystins were oxidized to cleave the Adda moiety, common to all microcystin variants. LC-MS/MS analysis was conducted on the subsequent MMPB (3-methoxy-2-methyl-4-phenylbutyric acid) molecule and calibrated using a certified reference standard (microcystin-LR) and 4-phenylbutyric acid. Total microcystin concentrations from MMPB were compared to Adda ELISA and individual variant analyses (LC-UV, LC-MS/(MS)). Variants of microcystin, including [DAsp(3)]MC-RR, [Dha(7)]MC-RR, MC-RR, MC-YR, MC-LR, [DAsp(3)]MC-LR, [Dha(7)]MC-LR, MC-WR, MC-LA, and MC-LY were detected and quantified in samples. The individual variant analyses did not account for total microcystins present in samples, as indicated by ELISA and MMPB data. Results demonstrated the MMPB technique is a simple and valuable approach to confirm ELISA data when analyzing microcystins, with method detection limits of 0.05 μg L(-1) for total microcystins.

  13. Acid distribution in phosphoric acid fuel cells

    SciTech Connect

    Okae, I.; Seya, A.; Umemoto, M.

    1996-12-31

    Electrolyte acid distribution among each component of a cell is determined by capillary force when the cell is not in operation, but the distribution under the current load conditions had not been clear so far. Since the loss of electrolyte acid during operation is inevitable, it is necessary to store enough amount of acid in every cell. But it must be under the level of which the acid disturbs the diffusion of reactive gases. Accordingly to know the actual acid distribution during operation in a cell is very important. In this report, we carried out experiments to clarify the distribution using small single cells.

  14. Blockade of Interplay between IL-17A and Endoplasmic Reticulum Stress Attenuates LPS-Induced Lung Injury

    PubMed Central

    Kim, So Ri; Kim, Hee Jung; Kim, Dong Im; Lee, Kyung Bae; Park, Hae Jin; Jeong, Jae Seok; Cho, Seong Ho; Lee, Yong Chul

    2015-01-01

    IL-17 is a cytokine mainly from IL-17-producing T cells, which are one of subsets of CD4+ T cells and play a role in adaptive immune system. Recent studies have demonstrated that IL-17A can act rapidly as an innate immune responder during infection before the onset of its classic adaptive immune response. This role of IL-17A in innate immune response is implicated in lipopolysaccharide (LPS)-induced lung inflammation. Very recently, we have reported that endoplasmic reticulum (ER) stress is involved in LPS-induced lung inflammation in vivo and in vitro. This study aimed to elucidate the role of IL-17A in LPS-induced lung injury, focusing on the link with ER stress. We treated a murine model of LPS-induced lung injury with IL-17A neutralizing antibody and 4-phenylbutyrate (4-PBA), a representative ER stress inhibitor. In addition, we evaluated the effects of IL-17A on ER stress in LPS-stimulated bronchial epithelial cells. Our results showed that inhibition of IL-17A decreased LPS-induced pulmonary neutrophilia, vascular leakage, nuclear translocation of nuclear factor-κB (NF-κB), infiltration of dendritic cells, increased expression of Toll-like receptor 4 (TLR4), activation of NLRP3 inflammasome, and increased ER stress in the lung. 4-PBA or TAK-242, a TLR4 inhibitor attenuated expression of IL-17A thereby improving LPS-induced lung inflammation. Intriguingly, we observed that stimulation with LPS increased expression of IL-17A in airway epithelial cells and co-stimulation with IL-17A further increased ER stress and NF-κB activation. This study indicates that the interrelationship between IL-17A and ER stress plays an important role in LPS-induced injury showing a positive feedback in airway epithelial cells and suggests that targeting their interaction can be a potential therapeutic approach to overcome one of severe refractory pulmonary disorders. PMID:26516372

  15. Acid tolerance in amphibians

    SciTech Connect

    Pierce, B.A.

    1985-04-01

    Studies of amphibian acid tolerance provide information about the potential effects of acid deposition on amphibian communities. Amphibians as a group appear to be relatively acid tolerant, with many species suffering increased mortality only below pH 4. However, amphibians exhibit much intraspecific variation in acid tolerance, and some species are sensitive to even low levels of acidity. Furthermore, nonlethal effects, including depression of growth rates and increases in developmental abnormalities, can occur at higher pH.

  16. Bioconversions of ferulic acid, an hydroxycinnamic acid.

    PubMed

    Mathew, Sindhu; Abraham, T Emilia

    2006-01-01

    Ferulic acid is the most abundant hydroxycinnamic acid in the plant world and is ester linked to arabinose, in various plant polysaccharides such as arabinoxylans and pectins. It is a precursor to vanillin, one of the most important aromatic flavor compound used in foods, beverages, pharmaceuticals, and perfumes. This article presents an overview of the various biocatalytic routes, focusing on the relevant biotransformations of ferulic acid using plant sources, microorganisms, and enzymes.

  17. Acid Thunder: Acid Rain and Ancient Mesoamerica

    ERIC Educational Resources Information Center

    Kahl, Jonathan D. W.; Berg, Craig A.

    2006-01-01

    Much of Mesoamerica's rich cultural heritage is slowly eroding because of acid rain. Just as water dissolves an Alka-Seltzer tablet, acid rain erodes the limestone surfaces of Mexican archaeological sites at a rate of about one-half millimeter per century (Bravo et al. 2003). A half-millimeter may not seem like much, but at this pace, a few…

  18. Quantity of acid in acid fog

    SciTech Connect

    Deal, W.J.

    1983-07-01

    This communication notes the actual magnitude of the acidity in acidic fog particles and suggests a possible line of inquiry into the health effects of such fog so that it can be determined whether a typical fog is detrimental or beneficial relative to dry air.

  19. Lactic acid test

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/003507.htm Lactic acid test To use the sharing features on this page, please enable JavaScript. Lactic acid is mainly produced in muscle cells and red ...

  20. Omega-6 Fatty Acids

    MedlinePlus

    ... types of fats. Some types are found in vegetable oils, including corn, evening primrose seed, safflower, and soybean ... from studying specific omega-6 fatty acids or plant oils containing omega-6 fatty acids. See the separate ...

  1. Fatty acid analogs

    DOEpatents

    Elmaleh, David R.; Livni, Eli

    1985-01-01

    In one aspect, a radioactively labeled analog of a fatty acid which is capable of being taken up by mammalian tissue and which exhibits an in vivo beta-oxidation rate below that with a corresponding radioactively labeled fatty acid.

  2. Deoxycholic Acid Injection

    MedlinePlus

    Deoxycholic acid injection is used to improve the appearance and profile of moderate to severe submental fat ('double chin'; fatty tissue located under the chin). Deoxycholic acid injection is in a class of medications called ...

  3. Aminocaproic Acid Injection

    MedlinePlus

    Aminocaproic acid injection is used to control bleeding that occurs when blood clots are broken down too quickly. This ... the baby is ready to be born). Aminocaproic acid injection is also used to control bleeding in ...

  4. Zoledronic Acid Injection

    MedlinePlus

    ... acid (Reclast) is used to prevent or treat osteoporosis (condition in which the bones become thin and ... Zoledronic acid (Reclast) is also used to treat osteoporosis in men, and to prevent or treat osteoporosis ...

  5. Uric Acid Test

    MedlinePlus

    ... limited. Home Visit Global Sites Search Help? Uric Acid Share this page: Was this page helpful? Also known as: Serum Urate; UA Formal name: Uric Acid Related tests: Synovial Fluid Analysis , Kidney Stone Analysis , ...

  6. Methylmalonic Acid Test

    MedlinePlus

    ... limited. Home Visit Global Sites Search Help? Methylmalonic Acid Share this page: Was this page helpful? Also known as: MMA Formal name: Methylmalonic Acid Related tests: Vitamin B12 and Folate , Homocysteine , Intrinsic ...

  7. Hydrochloric acid poisoning

    MedlinePlus

    Hydrochloric acid is a clear, poisonous liquid. It is highly corrosive, which means it immediately causes severe ... discusses poisoning due to swallowing or breathing in hydrochloric acid. This article is for information only. Do ...

  8. Mixed Acid Oxidation

    SciTech Connect

    Pierce, R.A.

    1999-10-26

    Several non-thermal processes have been developed to destroy organic waste compounds using chemicals with high oxidation potentials. These efforts have focused on developing technologies that work at low temperatures, relative to incineration, to overcome many of the regulatory issues associated with obtaining permits for waste incinerators. One such technique with great flexibility is mixed acid oxidation. Mixed acid oxidation, developed at the Savannah River Site, uses a mixture of an oxidant (nitric acid) and a carrier acid (phosphoric acid). The carrier acid acts as a non-volatile holding medium for the somewhat volatile oxidant. The combination of acids allows appreciable amounts of the concentrated oxidant to remain in the carrier acid well above the oxidant''s normal boiling point.

  9. Plant fatty acid hydroxylases

    DOEpatents

    Somerville, Chris; Broun, Pierre; van de Loo, Frank

    2001-01-01

    This invention relates to plant fatty acyl hydroxylases. Methods to use conserved amino acid or nucleotide sequences to obtain plant fatty acyl hydroxylases are described. Also described is the use of cDNA clones encoding a plant hydroxylase to produce a family of hydroxylated fatty acids in transgenic plants. In addition, the use of genes encoding fatty acid hydroxylases or desaturases to alter the level of lipid fatty acid unsaturation in transgenic plants is described.

  10. PRODUCTION OF TRIFLUOROACETIC ACID

    DOEpatents

    Haworth, W.N.; Stacey, M.

    1949-07-19

    A method is given for the production of improved yields of trifluoroacetic acid. The compound is prepared by oxidizing m-aminobenzotrifluoride with an alkali metal or alkaline earth metal permanganate at a temperature in the range of 80 deg C to 100 deg C while dissolved ln a mixture of water with glacial acetic acid and/or trifluoroacetic acid. Preferably a mixture of water and trifluoroacetic acid ls used as the solvent.

  11. Quantity of acid in acid fog

    SciTech Connect

    Deal, W.J.

    1983-07-01

    The chemical composition of fog particles has become of considerable interest, because of both the possibility of interpreting atmospheric- chemistry processes in fog particles in terms of the principles of aqueous chemistry and the potential health effects of species present in fog particles. The acidity of fog particles has received wide attention. This communication noted the actual magnitude of the excess acidity in acidic fog particles and suggested a possible line of inquiry into the health effects of such fog so that it can be determined whether a typical fog is detrimental or beneficial relative to dry air. (DP)

  12. Acid Rain Study Guide.

    ERIC Educational Resources Information Center

    Hunger, Carolyn; And Others

    Acid rain is a complex, worldwide environmental problem. This study guide is intended to aid teachers of grades 4-12 to help their students understand what acid rain is, why it is a problem, and what possible solutions exist. The document contains specific sections on: (1) the various terms used in conjunction with acid rain (such as acid…

  13. The Acid Rain Reader.

    ERIC Educational Resources Information Center

    Stubbs, Harriett S.; And Others

    A topic which is often not sufficiently dealt with in elementary school textbooks is acid rain. This student text is designed to supplement classroom materials on the topic. Discussed are: (1) "Rain"; (2) "Water Cycle"; (3) "Fossil Fuels"; (4) "Air Pollution"; (5) "Superstacks"; (6) "Acid/Neutral/Bases"; (7) "pH Scale"; (8) "Acid Rain"; (9)…

  14. What Is Acid Rain?

    ERIC Educational Resources Information Center

    Likens, Gene E.

    2004-01-01

    Acid rain is the collective term for any type of acidified precipitation: rain, snow, sleet, and hail, as well as the presence of acidifying gases, particles, cloud water, and fog in the atmosphere. The increased acidity, primarily from sulfuric and nitric acids, is generated as a by-product of the combustion of fossil fuels such as coal and oil.…

  15. [alpha]-Oxocarboxylic Acids

    ERIC Educational Resources Information Center

    Kerber, Robert C.; Fernando, Marian S.

    2010-01-01

    Several [alpha]-oxocarboxylic acids play key roles in metabolism in plants and animals. However, there are inconsistencies between the structures as commonly portrayed and the reported acid ionization constants, which result because the acids are predominantly hydrated in aqueous solution; that is, the predominant form is RC(OH)[subscript 2]COOH…

  16. Nucleic acid detection compositions

    DOEpatents

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann; Dahlberg, James L.

    2008-08-05

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  17. Cleavage of nucleic acids

    DOEpatents

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann D.; Dahlberg, James E.

    2000-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  18. Nucleic acid detection assays

    DOEpatents

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann; Dahlberg, James E.

    2005-04-05

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  19. Cleavage of nucleic acids

    DOEpatents

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor L.; Brow, Mary Ann D.; Dahlberg, James E.

    2007-12-11

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  20. Cleavage of nucleic acids

    SciTech Connect

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow; Mary Ann D.; Dahlberg, James E.

    2010-11-09

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  1. Editorial: Acid precipitation

    SciTech Connect

    1995-09-01

    This editorial focuses on acid rain and the history of public and governmental response to acid rain. Comments on a book by Gwineth Howell `Acid Rain and Acid Waters` are included. The editor feels that Howells has provide a service to the environmental scientific community, with a textbook useful to a range of people, as well as a call for decision makers to learn from the acid rain issue and use it as a model for more sweeping global environmental issues. A balance is needed among several parameters such as level of evidence, probability that the evidence will lead to a specific direction and the cost to the global community. 1 tab.

  2. [Safety of folic acid].

    PubMed

    Ströhle, Alexander; Wolters, Maike; Hahn, Andreas

    2015-08-01

    Improving dietary folate intake is a central public health goal. However, critical voices have become louder warning of too high intake of folic acid. Safety concerns of a high folic acid exposure are usually limited to synthetic folic acid contained in drugs and food supplements. Against this background, the present article focuses on two matters: (a) How do the absorption and metabolism of synthetic folic acid differ from that of other folates? (b) How has the longterm safety of folic acid to be judged, especially regarding the risk of colorectal cancer, autism, asthma, impaired immune defence, masking vitamin B12 deficiency and interactions with the methotrexate metabolism?

  3. Amino acid analysis

    NASA Technical Reports Server (NTRS)

    Winitz, M.; Graff, J. (Inventor)

    1974-01-01

    The process and apparatus for qualitative and quantitative analysis of the amino acid content of a biological sample are presented. The sample is deposited on a cation exchange resin and then is washed with suitable solvents. The amino acids and various cations and organic material with a basic function remain on the resin. The resin is eluted with an acid eluant, and the eluate containing the amino acids is transferred to a reaction vessel where the eluant is removed. Final analysis of the purified acylated amino acid esters is accomplished by gas-liquid chromatographic techniques.

  4. Acidic Ionic Liquids.

    PubMed

    Amarasekara, Ananda S

    2016-05-25

    Ionic liquid with acidic properties is an important branch in the wide ionic liquid field and the aim of this article is to cover all aspects of these acidic ionic liquids, especially focusing on the developments in the last four years. The structural diversity and synthesis of acidic ionic liquids are discussed in the introduction sections of this review. In addition, an unambiguous classification system for various types of acidic ionic liquids is presented in the introduction. The physical properties including acidity, thermo-physical properties, ionic conductivity, spectroscopy, and computational studies on acidic ionic liquids are covered in the next sections. The final section provides a comprehensive review on applications of acidic ionic liquids in a wide array of fields including catalysis, CO2 fixation, ionogel, electrolyte, fuel-cell, membrane, biomass processing, biodiesel synthesis, desulfurization of gasoline/diesel, metal processing, and metal electrodeposition.

  5. Nucleic acid detection kits

    DOEpatents

    Hall, Jeff G.; Lyamichev, Victor I.; Mast, Andrea L.; Brow, Mary Ann; Kwiatkowski, Robert W.; Vavra, Stephanie H.

    2005-03-29

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based on charge. The present invention also provides methods for the detection of non-target cleavage products via the formation of a complete and activated protein binding region. The invention further provides sensitive and specific methods for the detection of nucleic acid from various viruses in a sample.

  6. Acidic Ionic Liquids.

    PubMed

    Amarasekara, Ananda S

    2016-05-25

    Ionic liquid with acidic properties is an important branch in the wide ionic liquid field and the aim of this article is to cover all aspects of these acidic ionic liquids, especially focusing on the developments in the last four years. The structural diversity and synthesis of acidic ionic liquids are discussed in the introduction sections of this review. In addition, an unambiguous classification system for various types of acidic ionic liquids is presented in the introduction. The physical properties including acidity, thermo-physical properties, ionic conductivity, spectroscopy, and computational studies on acidic ionic liquids are covered in the next sections. The final section provides a comprehensive review on applications of acidic ionic liquids in a wide array of fields including catalysis, CO2 fixation, ionogel, electrolyte, fuel-cell, membrane, biomass processing, biodiesel synthesis, desulfurization of gasoline/diesel, metal processing, and metal electrodeposition. PMID:27175515

  7. Boric acid and boronic acids inhibition of pigeonpea urease.

    PubMed

    Reddy, K Ravi Charan; Kayastha, Arvind M

    2006-08-01

    Urease from the seeds of pigeonpea was competitively inhibited by boric acid, butylboronic acid, phenylboronic acid, and 4-bromophenylboronic acid; 4-bromophenylboronic acid being the strongest inhibitor, followed by boric acid > butylboronic acid > phenylboronic acid, respectively. Urease inhibition by boric acid is maximal at acidic pH (5.0) and minimal at alkaline pH (10.0), i.e., the trigonal planar B(OH)3 form is a more effective inhibitor than the tetrahedral B(OH)4 -anionic form. Similarly, the anionic form of phenylboronic acid was least inhibiting in nature.

  8. Biotransformation of cinnamic acid, p-coumaric acid, caffeic acid, and ferulic acid by plant cell cultures of Eucalyptus perriniana.

    PubMed

    Katsuragi, Hisashi; Shimoda, Kei; Kubota, Naoji; Nakajima, Nobuyoshi; Hamada, Hatsuyuki; Hamada, Hiroki

    2010-01-01

    Biotransformations of phenylpropanoids such as cinnamic acid, p-coumaric acid, caffeic acid, and ferulic acid were investigated with plant-cultured cells of Eucalyptus perriniana. The plant-cultured cells of E. perriniana converted cinnamic acid into cinnamic acid β-D-glucopyranosyl ester, p-coumaric acid, and 4-O-β-D-glucopyranosylcoumaric acid. p-Coumaric acid was converted into 4-O-β-D-glucopyranosylcoumaric acid, p-coumaric acid β-D-glucopyranosyl ester, 4-O-β-D-glucopyranosylcoumaric acid β-D-glucopyranosyl ester, a new compound, caffeic acid, and 3-O-β-D-glucopyranosylcaffeic acid. On the other hand, incubation of caffeic acid with cultured E. perriniana cells gave 3-O-β-D-glucopyranosylcaffeic acid, 3-O-(6-O-β-D-glucopyranosyl)-β-D-glucopyranosylcaffeic acid, a new compound, 3-O-β-D-glucopyranosylcaffeic acid β-D-glucopyranosyl ester, 4-O-β-D-glucopyranosylcaffeic acid, 4-O-β-D-glucopyranosylcaffeic acid β-D-glucopyranosyl ester, ferulic acid, and 4-O-β-D-glucopyranosylferulic acid. 4-O-β-D-Glucopyranosylferulic acid, ferulic acid β-D-glucopyranosyl ester, and 4-O-β-D-glucopyranosylferulic acid β-D-glucopyranosyl ester were isolated from E. perriniana cells treated with ferulic acid.

  9. A longitudinal study of the relation of lead in blood to lead in air concentrations among battery workers.

    PubMed

    Hodgkins, D G; Robins, T G; Hinkamp, D L; Schork, M A; Krebs, W H

    1992-04-01

    The relation between lead in air (PbA) and lead in blood (PbB), concentrations was investigated among 44 workers in five major operations in a United States high volume, lead acid battery plant. The study covered a 30 month period in which workers received frequent PbA and PbB determinations, workers remained in a single job, and PbA concentrations averaged below the US Occupational Safety and Health Administration (OSHA) permissible exposure limit of 50 micrograms/m3. In both univariate and multivariable linear regressions, longitudinal analyses averaging PbA concentrations over the 30 month study period appeared superior to cross sectional analyses using only six month PbA averages to model PbB concentrations. The covariate adjusted coefficient (alpha value) for PbA (mu/m3) in models of PbB (micrograms/100 g) was 1.14. This figure is strikingly higher than that reported in previous studies in the lead acid battery industry in all of which PbA concentrations were substantially higher than in the current study. Plausible explanations for the difference in alpha values include non-linearity of the PbA-PbB curve, a higher fraction of large size particulate associated with higher PbA concentrations, survivor bias among workers exposed to higher PbA concentrations, and the cross sectional designs of most previous studies. Despite previously reported problems with the model used by OSHA to predict PbA-PbB relations, the findings of this study are in good agreement with the predictions of that model.

  10. Process for the preparation of lactic acid and glyceric acid

    DOEpatents

    Jackson, James E [Haslett, MI; Miller, Dennis J [Okemos, MI; Marincean, Simona [Dewitt, MI

    2008-12-02

    Hexose and pentose monosaccharides are degraded to lactic acid and glyceric acid in an aqueous solution in the presence of an excess of a strongly anionic exchange resin, such as AMBERLITE IRN78 and AMBERLITE IRA400. The glyceric acid and lactic acid can be separated from the aqueous solution. Lactic acid and glyceric acid are staple articles of commerce.

  11. Well acidizing compositions and methods

    SciTech Connect

    Swanson, B. L.

    1980-12-23

    Gelled acidic compositions suitable for matrix acidizing or fracture acidizing of subterranean formations are provided comprising water, a water-dispersible polymeric viscosifier such as a polymer of acrylamide, an acid, and a polyphenolic material such as lignite.

  12. Bile acids but not acidic acids induce Barrett's esophagus.

    PubMed

    Sun, Dongfeng; Wang, Xiao; Gai, Zhibo; Song, Xiaoming; Jia, Xinyong; Tian, Hui

    2015-01-01

    Barrett's esophagus (BE) is associated with the development of esophageal adenocarcinoma (EAC). Bile acids (BAs) refluxing into the esophagus contribute to esophageal injury, which results in BE and subsequent EAC. We developed two animal models to test the role of BAs in the pathogenesis of BE. We surgically generated BA reflux, with or without gastric acid, in rats. In a second experiment, we fed animals separately with BAs and gastric acid. Pathologic changes were examined and the expression of Muc2 and Cdx2 in BE tissue was tested by immunostaining. Inflammatory factors in the plasma, as well as differentiation genes in BE were examined through highly sensitive ELISA and semi-quantitative RT-PCR techniques. We found that BAs are sufficient for the induction of esophagitis and Barrett's-like metaplasia in the esophagus. Overexpression of inflammatory cells, IL-6, and TNF-α was observed both in animals fed with BAs and surgically generated BA reflux. Furthermore, elevated levels of Cdx2, Muc2, Bmp4, Kit19, and Tff2 (differentiation genes in BE) were found in BA-treated rats. In conclusion, BAs, but not gastric acid, are a major causative factor for BE. We confirmed that BAs contribute to the development of BE by inducing the inflammatory response in the esophagus. Inhibiting BAs may be a promising therapy for BE.

  13. Histone Deacetylase Inhibitor Phenylbutyrate Exaggerates Heart Failure in Pressure Overloaded Mice independently of HDAC inhibition

    PubMed Central

    Ma, Jing; Luo, Tao; Zeng, Zhi; Fu, Haiying; Asano, Yoshihiro; Liao, Yulin; Minamino, Tetsuo; Kitakaze, Masafumi

    2016-01-01

    4-Sodium phenylbutyrate (PBA) has been reported to inhibit endoplasmic reticulum stress and histone deacetylation (HDAC), both of which are novel therapeutic targets for cardiac hypertrophy and heart failure. However, it is unclear whether PBA can improve heart function. Here, we tested the effects of PBA and some other HDAC inhibitors on cardiac dysfunction induced by pressure overload. Transverse aortic constriction (TAC) was performed on male C57BL/6 mice. PBA treatment (100 mg/kg, 6 weeks) unexpectedly led to a higher mortality, exacerbated cardiac remodelling and dysfunction. Similar results were noted in TAC mice treated with butyrate sodium (BS), a PBA analogue. In contrast, other HDAC inhibitors, valproic acid (VAL) and trichostatin A (TSA), improved the survival. All four HDAC inhibitors induced histone H3 acetylation and inhibited HDAC total activity. An individual HDAC activity assay showed that rather than class IIa members (HDAC4 and 7), PBA and BS predominantly inhibited class I members (HDAC2 and 8), whereas VAL and TSA inhibited all of them. These findings indicate that PBA and BS accelerate cardiac hypertrophy and dysfunction, whereas VAL and TSA have opposing effects. PMID:27667442

  14. Microorganisms for producing organic acids

    DOEpatents

    Pfleger, Brian Frederick; Begemann, Matthew Brett

    2014-09-30

    Organic acid-producing microorganisms and methods of using same. The organic acid-producing microorganisms comprise modifications that reduce or ablate AcsA activity or AcsA homolog activity. The modifications increase tolerance of the microorganisms to such organic acids as 3-hydroxypropionic acid, acrylic acid, propionic acid, lactic acid, and others. Further modifications to the microorganisms increase production of such organic acids as 3-hydroxypropionic acid, lactate, and others. Methods of producing such organic acids as 3-hydroxypropionic acid, lactate, and others with the modified microorganisms are provided. Methods of using acsA or homologs thereof as counter-selectable markers are also provided.

  15. Acid-Base Homeostasis.

    PubMed

    Hamm, L Lee; Nakhoul, Nazih; Hering-Smith, Kathleen S

    2015-12-01

    Acid-base homeostasis and pH regulation are critical for both normal physiology and cell metabolism and function. The importance of this regulation is evidenced by a variety of physiologic derangements that occur when plasma pH is either high or low. The kidneys have the predominant role in regulating the systemic bicarbonate concentration and hence, the metabolic component of acid-base balance. This function of the kidneys has two components: reabsorption of virtually all of the filtered HCO3(-) and production of new bicarbonate to replace that consumed by normal or pathologic acids. This production or generation of new HCO3(-) is done by net acid excretion. Under normal conditions, approximately one-third to one-half of net acid excretion by the kidneys is in the form of titratable acid. The other one-half to two-thirds is the excretion of ammonium. The capacity to excrete ammonium under conditions of acid loads is quantitatively much greater than the capacity to increase titratable acid. Multiple, often redundant pathways and processes exist to regulate these renal functions. Derangements in acid-base homeostasis, however, are common in clinical medicine and can often be related to the systems involved in acid-base transport in the kidneys.

  16. Citric Acid Alternative to Nitric Acid Passivation

    NASA Technical Reports Server (NTRS)

    Lewis, Pattie L. (Compiler)

    2013-01-01

    The Ground Systems Development and Operations GSDO) Program at NASA John F. Kennedy Space Center (KSC) has the primary objective of modernizing and transforming the launch and range complex at KSC to benefit current and future NASA programs along with other emerging users. Described as the launch support and infrastructure modernization program in the NASA Authorization Act of 2010, the GSDO Program will develop and implement shared infrastructure and process improvements to provide more flexible, affordable, and responsive capabilities to a multi-user community. In support of the GSDO Program, the purpose of this project is to demonstratevalidate citric acid as a passivation agent for stainless steel. Successful completion of this project will result in citric acid being qualified for use as an environmentally preferable alternative to nitric acid for passivation of stainless steel alloys in NASA and DoD applications.

  17. Enzymatic gallic acid esterification.

    PubMed

    Weetal, H H

    1985-02-01

    Gallic acid esters of n-propyl and amyl alcohols have been produced by enzymatic synthesis in organic solvents using immobilized tannase. Studies indicate that maximum esterification of gallic acid occurs with amyl alcohol. The enzyme shows broad alcohol specificity. However, the enzyme exhibits absolute specificity for the acid portion of the ester. Studies were carried out on K(m), V(max), pH, and temperature optima.

  18. Amino acids and proteins.

    PubMed

    van Goudoever, Johannes B; Vlaardingerbroek, Hester; van den Akker, Chris H; de Groof, Femke; van der Schoor, Sophie R D

    2014-01-01

    Amino acids and protein are key factors for growth. The neonatal period requires the highest intake in life to meet the demands. Those demands include amino acids for growth, but proteins and amino acids also function as signalling molecules and function as neurotransmitters. Often the nutritional requirements are not met, resulting in a postnatal growth restriction. However, current knowledge on adequate levels of both amino acid as well as protein intake can avoid under nutrition in the direct postnatal phase, avoid the need for subsequent catch-up growth and improve later outcome.

  19. USGS Tracks Acid Rain

    USGS Publications Warehouse

    Gordon, John D.; Nilles, Mark A.; Schroder, LeRoy J.

    1995-01-01

    The U.S. Geological Survey (USGS) has been actively studying acid rain for the past 15 years. When scientists learned that acid rain could harm fish, fear of damage to our natural environment from acid rain concerned the American public. Research by USGS scientists and other groups began to show that the processes resulting in acid rain are very complex. Scientists were puzzled by the fact that in some cases it was difficult to demonstrate that the pollution from automobiles and factories was causing streams or lakes to become more acidic. Further experiments showed how the natural ability of many soils to neutralize acids would reduce the effects of acid rain in some locations--at least as long as the neutralizing ability lasted (Young, 1991). The USGS has played a key role in establishing and maintaining the only nationwide network of acid rain monitoring stations. This program is called the National Atmospheric Deposition Program/National Trends Network (NADP/NTN). Each week, at approximately 220 NADP/NTN sites across the country, rain and snow samples are collected for analysis. NADP/NTN site in Montana. The USGS supports about 72 of these sites. The information gained from monitoring the chemistry of our nation's rain and snow is important for testing the results of pollution control laws on acid rain.

  20. Recovery of organic acids

    DOEpatents

    Verser, Dan W.; Eggeman, Timothy J.

    2011-11-01

    A method is disclosed for the recovery of an organic acid from a dilute salt solution in which the cation of the salt forms an insoluble carbonate salt. A tertiary amine and CO.sub.2 are introduced to the solution to form the insoluble carbonate salt and a complex between the acid and an amine. A water immiscible solvent, such as an alcohol, is added to extract the acid/amine complex from the dilute salt solution to a reaction phase. The reaction phase is continuously dried and a product between the acid and the solvent, such as an ester, is formed.

  1. Recovery of organic acids

    DOEpatents

    Verser, Dan W.; Eggeman, Timothy J.

    2009-10-13

    A method is disclosed for the recovery of an organic acid from a dilute salt solution in which the cation of the salt forms an insoluble carbonate salt. A tertiary amine and CO.sub.2 are introduced to the solution to form the insoluble carbonate salt and a complex between the acid and an amine. A water immiscible solvent, such as an alcohol, is added to extract the acid/amine complex from the dilute salt solution to a reaction phase. The reaction phase is continuously dried and a product between the acid and the solvent, such as an ester, is formed.

  2. Discovery of a new type of scaffold for the creation of novel tyrosinase inhibitors.

    PubMed

    Oyama, Takahiro; Takahashi, Satoshi; Yoshimori, Atsushi; Yamamoto, Tetsuya; Sato, Akira; Kamiya, Takanori; Abe, Hideaki; Abe, Takehiko; Tanuma, Sei-Ichi

    2016-09-15

    Tyrosinase is known as the key enzyme for melanin biosynthesis, which is effective in preventing skin injury by ultra violet (UV). In past decades, tyrosinase has been well studied in the field of cosmetics, medicine, agriculture and environmental sciences, and a lot of tyrosinase inhibitors have been developed for their needs. Here, we searched for new types of tyrosinase inhibitors and found phenylbenzoic acid (PBA) as a unique scaffold. Among three isomers of PBA, 3-phenylbenzoic acid (3-PBA) was revealed to be the most potent inhibitor against mushroom tyrosinase (IC50=6.97μM, monophenolase activity; IC50=36.3μM, diphenolase activity). The kinetic studies suggested that the apparent inhibition modes for the monophenolase and diphenolase activities were noncompetitive and mixed type inhibition, respectively. Analyses by in silico docking studies using the crystallographic structure of mushroom tyrosinase indicated that the carboxylic acid group of the 3-PBA could adequately bind to two cupric ions in the tyrosinase. To prove this hypothesis, we examined the effect of modification of the carboxylic acid group of the 3-PBA on its inhibitory activity. As expected, the esterification abrogated the inhibitory activity. These observations suggest that 3-PBA is a useful lead compound for the generation of novel tyrosinase inhibitors and provides a new insight into the molecular basis of tyrosinase catalytic mechanisms.

  3. Discovery of a new type of scaffold for the creation of novel tyrosinase inhibitors.

    PubMed

    Oyama, Takahiro; Takahashi, Satoshi; Yoshimori, Atsushi; Yamamoto, Tetsuya; Sato, Akira; Kamiya, Takanori; Abe, Hideaki; Abe, Takehiko; Tanuma, Sei-Ichi

    2016-09-15

    Tyrosinase is known as the key enzyme for melanin biosynthesis, which is effective in preventing skin injury by ultra violet (UV). In past decades, tyrosinase has been well studied in the field of cosmetics, medicine, agriculture and environmental sciences, and a lot of tyrosinase inhibitors have been developed for their needs. Here, we searched for new types of tyrosinase inhibitors and found phenylbenzoic acid (PBA) as a unique scaffold. Among three isomers of PBA, 3-phenylbenzoic acid (3-PBA) was revealed to be the most potent inhibitor against mushroom tyrosinase (IC50=6.97μM, monophenolase activity; IC50=36.3μM, diphenolase activity). The kinetic studies suggested that the apparent inhibition modes for the monophenolase and diphenolase activities were noncompetitive and mixed type inhibition, respectively. Analyses by in silico docking studies using the crystallographic structure of mushroom tyrosinase indicated that the carboxylic acid group of the 3-PBA could adequately bind to two cupric ions in the tyrosinase. To prove this hypothesis, we examined the effect of modification of the carboxylic acid group of the 3-PBA on its inhibitory activity. As expected, the esterification abrogated the inhibitory activity. These observations suggest that 3-PBA is a useful lead compound for the generation of novel tyrosinase inhibitors and provides a new insight into the molecular basis of tyrosinase catalytic mechanisms. PMID:27507110

  4. Biological monitoring of pyrethroid exposure of pest control workers in Japan.

    PubMed

    Wang, Dong; Kamijima, Michihiro; Imai, Ryota; Suzuki, Takayoshi; Kameda, Yohei; Asai, Kazumi; Okamura, Ai; Naito, Hisao; Ueyama, Jun; Saito, Isao; Nakajima, Tamie; Goto, Masahiro; Shibata, Eiji; Kondo, Takaaki; Takagi, Kenji; Takagi, Kenzo; Wakusawa, Shinya

    2007-11-01

    Synthetic pyrethroids such as cypermethrin, deltamethrin and permethrin, which are usually used in pest control operations, are metabolized to 3-phenoxybenzoic acid (3-PBA) and excreted in urine. Though 3-PBA can be used to assess exposure to pyrethroids, there are few reports describing urinary 3-PBA levels in Japan. This study aimed to investigate the seasonal variation of the exposure levels of pyrethroids and the concentration of urinary 3-PBA among pest control operators (PCOs) in Japan. The study subjects were 78 and 66 PCOs who underwent a health examination in December 2004 and in August 2005, respectively. 3-PBA was determined using gas chromatography-mass spectrometry. The geometric mean concentration of urinary 3-PBA in winter (3.9 microg/g creatinine) was significantly lower than in summer (12.2 microg/g creatinine) (p<0.05). Geometric mean concentrations of urinary 3-PBA in the spraying workers and the not-spraying workers within 2 d before the survey were 5.4 microg/g creatinine and 0.9 microg/g creatinine for winter with a significant difference between the groups (p<0.05), and 12.3 microg/g creatinine and 8.7 microg/g creatinine for summer (p>0.05), respectively. A significant association of 3-PBA levels and pyrethroid spraying was thus observed only in winter. In conclusion, the results of the present study show that the exposure level of pyrethroids among PCOs in Japan assessed by monitoring urinary 3-PBA was higher than that reported in the UK but comparable to that in Germany. Further research should be accumulated to establish an occupational reference value in Japan.

  5. Mutant fatty acid desaturase

    DOEpatents

    Shanklin, John; Cahoon, Edgar B.

    2004-02-03

    The present invention relates to a method for producing mutants of a fatty acid desaturase having a substantially increased activity towards fatty acid substrates with chains containing fewer than 18 carbons relative to an unmutagenized precursor desaturase having an 18 carbon atom chain length substrate specificity. The method involves inducing one or more mutations in the nucleic acid sequence encoding the precursor desaturase, transforming the mutated sequence into an unsaturated fatty acid auxotroph cell such as MH13 E. coli, culturing the cells in the absence of supplemental unsaturated fatty acids, thereby selecting for recipient cells which have received and which express a mutant fatty acid desaturase with an elevated specificity for fatty acid substrates having chain lengths of less than 18 carbon atoms. A variety of mutants having 16 or fewer carbon atom chain length substrate specificities are produced by this method. Mutant desaturases produced by this method can be introduced via expression vectors into prokaryotic and eukaryotic cells and can also be used in the production of transgenic plants which may be used to produce specific fatty acid products.

  6. Amino Acid Crossword Puzzle

    ERIC Educational Resources Information Center

    Sims, Paul A.

    2011-01-01

    Learning the 20 standard amino acids is an essential component of an introductory course in biochemistry. Later in the course, the students study metabolism and learn about various catabolic and anabolic pathways involving amino acids. Learning new material or concepts often is easier if one can connect the new material to what one already knows;…

  7. Toxicology of Perfluoroalkyl acids

    EPA Science Inventory

    The Perfluoroalkyl acids(PFAAs) area a family of organic chemicals consisting of a perflurinated carbon backbone (4-12in length) and a acidic functional moiety (Carboxylate or sulfonate). These compounds have excellent surface-tension reducing properties and have numerous industr...

  8. Uric acid - blood

    MedlinePlus

    ... High levels of uric acid can sometimes cause gout or kidney disease. You may have this test if you have had or are about to have certain types of chemotherapy. Rapid weight loss, which may occur with such treatments, can increase the amount of uric acid in ...

  9. Bile acid transporters

    PubMed Central

    Dawson, Paul A.; Lan, Tian; Rao, Anuradha

    2009-01-01

    In liver and intestine, transporters play a critical role in maintaining the enterohepatic circulation and bile acid homeostasis. Over the past two decades, there has been significant progress toward identifying the individual membrane transporters and unraveling their complex regulation. In the liver, bile acids are efficiently transported across the sinusoidal membrane by the Na+ taurocholate cotransporting polypeptide with assistance by members of the organic anion transporting polypeptide family. The bile acids are then secreted in an ATP-dependent fashion across the canalicular membrane by the bile salt export pump. Following their movement with bile into the lumen of the small intestine, bile acids are almost quantitatively reclaimed in the ileum by the apical sodium-dependent bile acid transporter. The bile acids are shuttled across the enterocyte to the basolateral membrane and effluxed into the portal circulation by the recently indentified heteromeric organic solute transporter, OSTα-OSTβ. In addition to the hepatocyte and enterocyte, subgroups of these bile acid transporters are expressed by the biliary, renal, and colonic epithelium where they contribute to maintaining bile acid homeostasis and play important cytoprotective roles. This article will review our current understanding of the physiological role and regulation of these important carriers. PMID:19498215

  10. Analysis of Organic Acids.

    ERIC Educational Resources Information Center

    Griswold, John R.; Rauner, Richard A.

    1990-01-01

    Presented are the procedures and a discussion of the results for an experiment in which students select unknown carboxylic acids, determine their melting points, and investigate their solubility behavior in water and ethanol. A table of selected carboxylic acids is included. (CW)

  11. Omega-3 Fatty Acids

    MedlinePlus

    Omega-3 fatty acids are used together with lifestyle changes (diet, weight-loss, exercise) to reduce the amount of triglycerides (a fat-like ... people with very high triglycerides. Omega-3 fatty acids are in a class of medications called antilipemic ...

  12. Toxicology of Perfluoroalkyl Acids*

    EPA Science Inventory

    The perfluoroalkyl acids (PFAAs) are a family of organic chemicals consisting of a perfluorinated carbon backbone (4-12 in length) and an acidic functional moiety (carboxylate or sulfonate). These compounds are chemically stable, have excellent surface-tension reducing properties...

  13. Salicylic Acid Topical

    MedlinePlus

    ... skin blemishes in people who have acne. Topical salicylic acid is also used to treat skin conditions that involve scaling or overgrowth of skin ... water for 15 minutes.Do not apply topical salicylic acid to skin that is broken, red, swollen, irritated, or infected. ...

  14. Uric acid and hypertension.

    PubMed

    Feig, Daniel I

    2011-09-01

    A link between serum uric acid and the development of hypertension was first hypothesized in the 1870s. Although numerous epidemiologic studies in the 1980s and 1990s suggested an association, relatively little attention was paid to it until recently. Animal models have suggested a two-step pathogenesis by which uric acid initially activates the renin angiotensin system and suppresses nitric oxide, leading to uric acid-dependent increase in systemic vascular resistance, followed by a uric acid-mediated vasculopathy, involving renal afferent arterioles, resulting in a late sodium-sensitive hypertension. Initial clinical trials in young patients have supported these mechanisms in young patients but do not yet support pharmacologic reduction of serum uric acid as first-line therapy for hypertension.

  15. Biosynthesis of pulcherriminic acid

    PubMed Central

    MacDonald, J. C.

    1965-01-01

    1. Candida pulcherrima was grown on a complex medium to which various compounds had been added to determine their effect on the biosynthesis of pulcherriminic acid. Most of the pulcherriminic acid synthesized by C. pulcherrima PRL2019 was derived from the l-[1-14C]leucine added to the medium. 2. The cyclic dipeptide of l-leucine (cyclo-l-leucyl-l-leucyl) was shown, by trapping experiments involving cycloleucyl-leucyl isomers, to be synthesized by strain PRL2019. Cyclo-l-leucyl-l-leucyl was derived from l-leucine and was converted into pulcherriminic acid. Cyclo-l-leucyl-l-leucyl was a precursor of pulcherriminic acid in strain PRL2007 also. 3. The results supported the hypothesis that pulcherriminic acid is derived from l-leucine and that cyclo-l-leucyl-l-leucyl is an intermediate in the biosynthesis. PMID:5837792

  16. Total syntheses of cis-cyclopropane fatty acids: dihydromalvalic acid, dihydrosterculic acid, lactobacillic acid, and 9,10-methylenehexadecanoic acid.

    PubMed

    Shah, Sayali; White, Jonathan M; Williams, Spencer J

    2014-12-14

    cis-Cyclopropane fatty acids (cis-CFAs) are widespread constituents of the seed oils of subtropical plants, membrane components of bacteria and protozoa, and the fats and phospholipids of animals. We describe a systematic approach to the synthesis of enantiomeric pairs of four cis-CFAs: cis-9,10-methylenehexadecanoic acid, lactobacillic acid, dihydromalvalic acid, and dihydrosterculic acid. The approach commences with Rh2(OAc)4-catalyzed cyclopropenation of 1-octyne and 1-decyne, and hinges on the preparative scale chromatographic resolution of racemic 2-alkylcycloprop-2-ene-1-carboxylic acids using a homochiral Evan's auxiliary. Saturation of the individual diastereomeric N-cycloprop-2-ene-1-carbonylacyloxazolidines, followed by elaboration to alkylcyclopropylmethylsulfones, allowed Julia-Kocienski olefination with various ω-aldehyde-esters. Finally, saponification and diimide reduction afforded the individual cis-CFA enantiomers. PMID:25321346

  17. Gluconic acid production.

    PubMed

    Anastassiadis, Savas; Morgunov, Igor G

    2007-01-01

    Gluconic acid, the oxidation product of glucose, is a mild neither caustic nor corrosive, non toxic and readily biodegradable organic acid of great interest for many applications. As a multifunctional carbonic acid belonging to the bulk chemicals and due to its physiological and chemical characteristics, gluconic acid itself, its salts (e.g. alkali metal salts, in especially sodium gluconate) and the gluconolactone form have found extensively versatile uses in the chemical, pharmaceutical, food, construction and other industries. Present review article presents the comprehensive information of patent bibliography for the production of gluconic acid and compares the advantages and disadvantages of known processes. Numerous manufacturing processes are described in the international bibliography and patent literature of the last 100 years for the production of gluconic acid from glucose, including chemical and electrochemical catalysis, enzymatic biocatalysis by free or immobilized enzymes in specialized enzyme bioreactors as well as discontinuous and continuous fermentation processes using free growing or immobilized cells of various microorganisms, including bacteria, yeast-like fungi and fungi. Alternatively, new superior fermentation processes have been developed and extensively described for the continuous and discontinuous production of gluconic acid by isolated strains of yeast-like mold Aureobasidium pullulans, offering numerous advantages over the traditional discontinuous fungi processes.

  18. Trans Fatty Acids

    NASA Astrophysics Data System (ADS)

    Doyle, Ellin

    1997-09-01

    Fats and their various fatty acid components seem to be a perennial concern of nutritionists and persons concerned with healthful diets. Advice on the consumption of saturated, polyunsaturated, monounsaturated, and total fat bombards us from magazines and newspapers. One of the newer players in this field is the group of trans fatty acids found predominantly in partially hydrogenated fats such as margarines and cooking fats. The controversy concerning dietary trans fatty acids was recently addressed in an American Heart Association (AHA) science advisory (1) and in a position paper from the American Society of Clinical Nutrition/American Institute of Nutrition (ASCN/AIN) (2). Both reports emphasize that the best preventive strategy for reducing risk for cardiovascular disease and some types of cancer is a reduction in total and saturated fats in the diet, but a reduction in the intake of trans fatty acids was also recommended. Although the actual health effects of trans fatty acids remain uncertain, experimental evidence indicates that consumption of trans fatty acids adversely affects serum lipid levels. Since elevated levels of serum cholesterol and triacylglycerols are associated with increased risk of cardiovascular disease, it follows that intake of trans fatty acids should be minimized.

  19. Sulfuric Acid on Europa

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Frozen sulfuric acid on Jupiter's moon Europa is depicted in this image produced from data gathered by NASA's Galileo spacecraft. The brightest areas, where the yellow is most intense, represent regions of high frozen sulfuric acid concentration. Sulfuric acid is found in battery acid and in Earth's acid rain.

    This image is based on data gathered by Galileo's near infrared mapping spectrometer.

    Europa's leading hemisphere is toward the bottom right, and there are enhanced concentrations of sulfuric acid in the trailing side of Europa (the upper left side of the image). This is the face of Europa that is struck by sulfur ions coming from Jupiter's innermost moon, Io. The long, narrow features that crisscross Europa also show sulfuric acid that may be from sulfurous material extruded in cracks.

    Galileo, launched in 1989, has been orbiting Jupiter and its moons since December 1995. JPL manages the Galileo mission for NASA's Office of Space Science, Washington DC. JPL is a division of the California Institute of Technology, Pasadena, CA.

  20. Strongly Acidic Auxin Indole-3-Methanesulfonic Acid

    PubMed Central

    Cohen, Jerry D.; Baldi, Bruce G.; Bialek, Krystyna

    1985-01-01

    A radiochemical synthesis is described for [14C]indole-3-methanesulfonic acid (IMS), a strongly acidic auxin analog. Techniques were developed for fractionation and purification of IMS using normal and reverse phase chromatography. In addition, the utility of both Fourier transform infrared spectrometry and fast atom bombardment mass spectrometry for analysis of IMS has been demonstrated. IMS was shown to be an active auxin, stimulating soybean hypocotyl elongation, bean first internode curvature, and ethylene production. IMS uptake by thin sections of soybean hypocotyl was essentially independent of solution pH and, when applied at a 100 micromolar concentration, IMS exhibited a basipetal polarity in its transport in both corn coleoptile and soybean hypocotyl sections. [14C]IMS should, therefore, be a useful compound to study fundamental processes related to the movement of auxins in plant tissues and organelles. PMID:16664007

  1. Understanding acid rain

    SciTech Connect

    Budiansky, S.

    1981-06-01

    The complexities of the phenomenon of acid rain are described. Many factors, including meteorology, geology, chemistry, and biology, all play parts. Varying weather, varying soils, the presence of other pollutants and species differences all act to blur the connections between industrial emissions, acid rain, and environmental damage. Some experts believe that the greatest pH shock to lakes occurs during snow melt and runoff in the spring; others believe that much of the plant damage ascribed to acid rain is actually due to the effects of ozone. Much work needs to be done in the area of sampling. Historical data are lacking and sampling methods are not sufficiently accurate. (JMT)

  2. Understanding Acid Base Disorders.

    PubMed

    Gomez, Hernando; Kellum, John A

    2015-10-01

    The concentration of hydrogen ions is regulated in biologic solutions. There are currently 3 recognized approaches to assess changes in acid base status. First is the traditional Henderson-Hasselbalch approach, also called the physiologic approach, which uses the relationship between HCO3(-) and Pco2; the second is the standard base excess approach based on the Van Slyke equation. The third approach is the quantitative or Stewart approach, which uses the strong ion difference and the total weak acids. This article explores the origins of the current concepts framing the existing methods to analyze acid base balance.

  3. Acid rain and soil.

    PubMed

    vanLoon, G W

    1984-08-01

    A summary of important chemical properties of soil is given and the way in which acid rain may affect these properties is discussed. Acid rain may suppress microbiological decomposition and nitrification processes, thus influencing the nutrient status of soils. It has also been found that soil organic matter is less soluble in more acid solutions. Changed nutrient availability patterns are predicted in a low pH environment and enhanced leaching of essential elements from the soil exchange complex has been observed. Increased solubility of potentially toxic elements such as aluminium may also occur from soils which have been exposed to acidified rainfall.

  4. Disorders of Amino Acid Metabolism

    MedlinePlus

    ... Aspiration Syndrome Additional Content Medical News Disorders of Amino Acid Metabolism By Lee M. Sanders, MD, MPH NOTE: ... Metabolic Disorders Disorders of Carbohydrate Metabolism Disorders of Amino Acid Metabolism Disorders of Lipid Metabolism Amino acids are ...

  5. Pantothenic acid and biotin

    MedlinePlus

    ... well as other nutrients, are provided in the Dietary Reference Intakes (DRIs) developed by the Food and Nutrition Board ... level that is thought to ensure enough nutrition. Dietary Reference Intakes for pantothenic acid: Age 0 to 6 months: ...

  6. Amino Acid Metabolism Disorders

    MedlinePlus

    Metabolism is the process your body uses to make energy from the food you eat. Food is ... One group of these disorders is amino acid metabolism disorders. They include phenylketonuria (PKU) and maple syrup ...

  7. [Hydrofluoric acid burns].

    PubMed

    Holla, Robin; Gorter, Ramon R; Tenhagen, Mark; Vloemans, A F P M Jos; Breederveld, Roelf S

    2016-01-01

    Hydrofluoric acid is increasingly used as a rust remover and detergent. Dermal contact with hydrofluoric acid results in a chemical burn characterized by severe pain and deep tissue necrosis. It may cause electrolyte imbalances with lethal consequences. It is important to identify high-risk patients. 'High risk' is defined as a total affected body area > 3% or exposure to hydrofluoric acid in a concentration > 50%. We present the cases of three male patients (26, 31, and 39 years old) with hydrofluoric acid burns of varying severity and describe the subsequent treatments. The application of calcium gluconate 2.5% gel to the skin is the cornerstone of the treatment, reducing pain as well as improving wound healing. Nails should be thoroughly inspected and possibly removed if the nail is involved, to ensure proper healing. In high-risk patients, plasma calcium levels should be evaluated and cardiac monitoring is indicated.

  8. Folic acid - test

    MedlinePlus

    ... folic acid before and during pregnancy helps prevent neural tube defects, such as spina bifida. Women who ... take more if they have a history of neural tube defects in earlier pregnancies. Ask your provider ...

  9. Nitric acid poisoning

    MedlinePlus

    Symptoms from swallowing nitric acid may include: Abdominal pain - severe Burns to skin or mouth Drooling Fever Mouth pain - severe Rapid drop in blood pressure (shock) Throat swelling, which leads to breathing difficulty ...

  10. [Hydrofluoric acid burns].

    PubMed

    Holla, Robin; Gorter, Ramon R; Tenhagen, Mark; Vloemans, A F P M Jos; Breederveld, Roelf S

    2016-01-01

    Hydrofluoric acid is increasingly used as a rust remover and detergent. Dermal contact with hydrofluoric acid results in a chemical burn characterized by severe pain and deep tissue necrosis. It may cause electrolyte imbalances with lethal consequences. It is important to identify high-risk patients. 'High risk' is defined as a total affected body area > 3% or exposure to hydrofluoric acid in a concentration > 50%. We present the cases of three male patients (26, 31, and 39 years old) with hydrofluoric acid burns of varying severity and describe the subsequent treatments. The application of calcium gluconate 2.5% gel to the skin is the cornerstone of the treatment, reducing pain as well as improving wound healing. Nails should be thoroughly inspected and possibly removed if the nail is involved, to ensure proper healing. In high-risk patients, plasma calcium levels should be evaluated and cardiac monitoring is indicated. PMID:27189091

  11. Difficult Decisions: Acid Rain.

    ERIC Educational Resources Information Center

    Miller, John A.; Slesnick, Irwin L.

    1989-01-01

    Discusses some of the contributing factors and chemical reactions involved in the production of acid rain, its effects, and political issues pertaining to who should pay for the clean up. Supplies questions for consideration and discussion. (RT)

  12. Hyaluronic acid fillers.

    PubMed

    Monheit, Gary D; Coleman, Kyle M

    2006-01-01

    Although hyaluronic acids are a relatively new treatment for facial lines and wrinkles, they have provided numerous advances in the area of cosmetic surgery. This article discusses the inherent properties of hyaluronic acid fillers that make them ideal for treatment of facial lines. It encompasses a review of the current literature on U.S. Food and Drug Administration-approved hyaluronic acid fillers and the role that each of these fillers currently has in facial cosmetics. This article also discusses the potential pitfalls and adverse effects that can be associated with using hyaluronic acids for filling facial lines. Finally, it serves as an overview of current techniques for clinical assessment of patients as well as administration and treatment of facial lines and wrinkles.

  13. Boric acid poisoning

    MedlinePlus

    Borax poisoning ... The main symptoms of boric acid poisoning are blue-green vomit, diarrhea, and a bright red rash on the skin. Other symptoms may include: Blisters Collapse Coma Convulsions Drowsiness ...

  14. Stomach acid test

    MedlinePlus

    Gastric acid secretion test ... The test is done after you have not eaten for a while so fluid is all that remains in ... injected into your body. This is done to test the ability of the cells in the stomach ...

  15. Aminolevulinic Acid Topical

    MedlinePlus

    ... under the skin that result from exposure to sunlight and can develop into skin cancer) of the ... acid will make your skin very sensitive to sunlight (likely to get sunburn). Avoid exposure of treated ...

  16. Amino Acids and Chirality

    NASA Technical Reports Server (NTRS)

    Cook, Jamie E.

    2012-01-01

    Amino acids are among the most heavily studied organic compound class in carbonaceous chondrites. The abundance, distributions, enantiomeric compositions, and stable isotopic ratios of amino acids have been determined in carbonaceous chondrites fi'om a range of classes and petrographic types, with interesting correlations observed between these properties and the class and typc of the chondritcs. In particular, isomeric distributions appear to correlate with parent bodies (chondrite class). In addition, certain chiral amino acids are found in enantiomeric excess in some chondrites. The delivery of these enantiomeric excesses to the early Earth may have contributed to the origin of the homochirality that is central to life on Earth today. This talk will explore the amino acids in carbonaceous chondritcs and their relevance to the origin of life.

  17. (Acid rain workshop)

    SciTech Connect

    Turner, R.S.

    1990-12-05

    The traveler presented a paper entitled Susceptibility of Asian Ecosystems to Soil-Mediated Acid Rain Damage'' at the Second Workshop on Acid Rain in Asia. The workshop was organized by the Asian Institute of Technology (Bangkok, Thailand), Argonne National Laboratory (Argonne, Illinois), and Resource Management Associates (Madison, Wisconsin) and was sponsored by the US Department of Energy, the United Nations Environment Program, the United Nations Economic and Social Commission for Asia and the Pacific, and the World Bank. Papers presented on the first day discussed how the experience gained with acid rain in North America and Europe might be applied to the Asian situation. Papers describing energy use projections, sulfur emissions, and effects of acid rain in several Asian countries were presented on the second day. The remaining time was allotted to discussion, planning, and writing plans for a future research program.

  18. Folic acid in diet

    MedlinePlus

    ... a regular supply of the vitamin in the foods you eat. ... vitamins have been added to the food. Many foods are now fortified with folic acid. Some of these are enriched breads, cereals, flours, ...

  19. Valproic Acid and Pregnancy

    MedlinePlus

    ... in the treatment of epilepsy, and to treat bipolar disorder and migraines. I have been taking valproic acid ... that women with seizure disorders and women with bipolar disorder might have menstrual problems and difficulty getting pregnant. ...

  20. Citric acid urine test

    MedlinePlus

    ... The test is used to diagnose renal tubular acidosis and evaluate kidney stone disease. Normal Results The ... level of citric acid may mean renal tubular acidosis and a tendency to form calcium kidney stones. ...

  1. Folic Acid Quiz

    MedlinePlus

    ... more easily than natural food folate. Close × Answer: D CORRECT: Folic acid reduces the risk for spina ... g., orange juice and green vegetables). Close × Answer: D CORRECT: Spina bifida and anencephaly are neural tube ...

  2. Hydrofluoric acid poisoning

    MedlinePlus

    ... your skin or eyes, you may have: Blisters Burns Pain Vision loss Hydrofluoric acid poisoning can have ... urine tests Camera down the throat to see burns in the esophagus and the stomach (endoscopy) Fluids ...

  3. Portable nucleic acid thermocyclers.

    PubMed

    Almassian, David R; Cockrell, Lisa M; Nelson, William M

    2013-11-21

    A nucleic acid thermal cycler is considered to be portable if it is under ten pounds, easily carried by one individual, and battery powered. Nucleic acid amplification includes both polymerase chain reaction (e.g. PCR, RT-PCR) and isothermal amplification (e.g. RPA, HDA, LAMP, NASBA, RCA, ICAN, SMART, SDA). There are valuable applications for portable nucleic acid thermocyclers in fields that include clinical diagnostics, biothreat detection, and veterinary testing. A system that is portable allows for the distributed detection of targets at the point of care and a reduction of the time from sample to answer. The designer of a portable nucleic acid thermocycler must carefully consider both thermal control and the detection of amplification. In addition to thermal control and detection, the designer may consider the integration of a sample preparation subsystem with the nucleic acid thermocycler. There are a variety of technologies that can achieve accurate thermal control and the detection of nucleic acid amplification. Important evaluation criteria for each technology include maturity, power requirements, cost, sensitivity, speed, and manufacturability. Ultimately the needs of a particular market will lead to user requirements that drive the decision between available technologies.

  4. Neutron Nucleic Acid Crystallography.

    PubMed

    Chatake, Toshiyuki

    2016-01-01

    The hydration shells surrounding nucleic acids and hydrogen-bonding networks involving water molecules and nucleic acids are essential interactions for the structural stability and function of nucleic acids. Water molecules in the hydration shells influence various conformations of DNA and RNA by specific hydrogen-bonding networks, which often contribute to the chemical reactivity and molecular recognition of nucleic acids. However, X-ray crystallography could not provide a complete description of structural information with respect to hydrogen bonds. Indeed, X-ray crystallography is a powerful tool for determining the locations of water molecules, i.e., the location of the oxygen atom of H2O; however, it is very difficult to determine the orientation of the water molecules, i.e., the orientation of the two hydrogen atoms of H2O, because X-ray scattering from the hydrogen atom is very small.Neutron crystallography is a specialized tool for determining the positions of hydrogen atoms. Neutrons are not diffracted by electrons, but are diffracted by atomic nuclei; accordingly, neutron scattering lengths of hydrogen and its isotopes are comparable to those of non-hydrogen atoms. Therefore, neutron crystallography can determine both of the locations and orientations of water molecules. This chapter describes the current status of neutron nucleic acid crystallographic research as well as the basic principles of neutron diffraction experiments performed on nucleic acid crystals: materials, crystallization, diffraction experiments, and structure determination. PMID:26227050

  5. Neutron Nucleic Acid Crystallography.

    PubMed

    Chatake, Toshiyuki

    2016-01-01

    The hydration shells surrounding nucleic acids and hydrogen-bonding networks involving water molecules and nucleic acids are essential interactions for the structural stability and function of nucleic acids. Water molecules in the hydration shells influence various conformations of DNA and RNA by specific hydrogen-bonding networks, which often contribute to the chemical reactivity and molecular recognition of nucleic acids. However, X-ray crystallography could not provide a complete description of structural information with respect to hydrogen bonds. Indeed, X-ray crystallography is a powerful tool for determining the locations of water molecules, i.e., the location of the oxygen atom of H2O; however, it is very difficult to determine the orientation of the water molecules, i.e., the orientation of the two hydrogen atoms of H2O, because X-ray scattering from the hydrogen atom is very small.Neutron crystallography is a specialized tool for determining the positions of hydrogen atoms. Neutrons are not diffracted by electrons, but are diffracted by atomic nuclei; accordingly, neutron scattering lengths of hydrogen and its isotopes are comparable to those of non-hydrogen atoms. Therefore, neutron crystallography can determine both of the locations and orientations of water molecules. This chapter describes the current status of neutron nucleic acid crystallographic research as well as the basic principles of neutron diffraction experiments performed on nucleic acid crystals: materials, crystallization, diffraction experiments, and structure determination.

  6. Utilization of acid tars

    SciTech Connect

    Frolov, A.F.; Denisova, T.L.; Aminov, A.N.

    1987-01-01

    Freshly produced acid tar (FPAT), obtained as refinery waste in treating petroleum oils with sulfuric acid and oleum, contains 80% or more sulfuric acid. Of such tars, pond acid tars, which contain up to 80% neutral petroleum products and sulfonated resins, are more stable, and have found applications in the production of binders for paving materials. In this article the authors are presenting results obtained in a study of the composition and reactivity of FPAT and its stability in storage in blends with asphalts obtained in deasphalting operations, and the possibility of using the FPAT in road construction has been examined. In this work, wastes were used which were obtained in treating the oils T-750, KhF-12, I-8A, and MS-14. Data on the change in group chemical composition of FPAT are shown, and the acidity, viscosity, needle penetration, and softening point of acid tars obtained from different grades of oils are plotted as functions of the storage time. It is also shown that the fresh and hardened FPATs differ in their solubilities in various solvents.

  7. LC/ESI/MS method development for the analysis of hepatotoxic cyclic peptide microcystins in animal tissues.

    PubMed

    Ott, Jennifer L; Carmichael, Wayne W

    2006-06-01

    Microcystins (MCYSTs) are a family of related cyclic heptapeptides produced by several genera and species of blue-green algae (cyanobacteria). MCYSTs are potent and specific inhibitors of the serine threonine family of protein phosphatases, especially PP1 and PP2A. MCYSTs inhibit a liver's protein phosphatase by forming a covalent linkage between MCYSTs' Mdha residue and the phosphatase's cysteine residue. Due to the covalent linkage, analysis of MCYSTs in animal tissues has been limited to determination of unbound MCYST concentration. The MMPB (2-methyl-3-methoxy-4-phenylbutyric acid) oxidation procedure allows for the detection of total MCYST burden by releasing the carboxylic acid MMPB from MCYST's Adda amino acid. An internal standard 4-phenylbutyric acid (4PB) accounts for losses during the method. LC/MS conditions were developed using a ThermoFinnigan LCQDuo ion trap in negative electrospray ionization (ESI). Since both compounds produce the [M-H](-) ion, analysis occurs in selected ion monitoring (SIM) mode for both MMPB (m/z 207.1) and 4PB (m/z 163.1). Complete oxidation of MCYST-LR in liver tissues occurs in 3h. A solid phase extraction (SPE) cartridge removes MMPB and 4PB from the oxidant solution. The process efficiency for the SPE procedure is only 51.3%; however, suppression experiments indicate a 41.8% loss in signal strength due to matrix interferences. Therefore, the extraction efficiency for the SDB-XC cartridge procedure is 93.1%. This research has been successful in developing an LC/MS method for the analysis of total MCYST burden in animal tissues.

  8. Method for isolating nucleic acids

    SciTech Connect

    Hurt, Jr., Richard Ashley; Elias, Dwayne A.

    2015-09-29

    The current disclosure provides methods and kits for isolating nucleic acid from an environmental sample. The current methods and compositions further provide methods for isolating nucleic acids by reducing adsorption of nucleic acids by charged ions and particles within an environmental sample. The methods of the current disclosure provide methods for isolating nucleic acids by releasing adsorbed nucleic acids from charged particles during the nucleic acid isolation process. The current disclosure facilitates the isolation of nucleic acids of sufficient quality and quantity to enable one of ordinary skill in the art to utilize or analyze the isolated nucleic acids for a wide variety of applications including, sequencing or species population analysis.

  9. Acidification and Acid Rain

    NASA Astrophysics Data System (ADS)

    Norton, S. A.; Veselã½, J.

    2003-12-01

    Air pollution by acids has been known as a problem for centuries (Ducros, 1845; Smith, 1872; Camuffo, 1992; Brimblecombe, 1992). Only in the mid-1900s did it become clear that it was a problem for more than just industrially developed areas, and that precipitation quality can affect aquatic resources ( Gorham, 1955). The last three decades of the twentieth century saw tremendous progress in the documentation of the chemistry of the atmosphere, precipitation, and the systems impacted by acid atmospheric deposition. Chronic acidification of ecosystems results in chemical changes to soil and to surface waters and groundwater as a result of reduction of base cation supply or an increase in acid (H+) supply, or both. The most fundamental changes during chronic acidification are an increase in exchangeable H+ or Al3+ (aluminum) in soils, an increase in H+ activity (˜concentration) in water in contact with soil, and a decrease in alkalinity in waters draining watersheds. Water draining from the soil is acidified and has a lower pH (=-log [H+]). As systems acidify, their biotic community changes.Acidic surface waters occur in many parts of the world as a consequence of natural processes and also due to atmospheric deposition of strong acid (e.g., Canada, Jeffries et al. (1986); the United Kingdom, Evans and Monteith (2001); Sweden, Swedish Environmental Protection Board (1986); Finland, Forsius et al. (1990); Norway, Henriksen et al. (1988a); and the United States (USA), Brakke et al. (1988)). Concern over acidification in the temperate regions of the northern hemisphere has been driven by the potential for accelerating natural acidification by pollution of the atmosphere with acidic or acidifying compounds. Atmospheric pollution ( Figure 1) has resulted in an increased flux of acid to and through ecosystems. Depending on the ability of an ecosystem to neutralize the increased flux of acidity, acidification may increase only imperceptibly or be accelerated at a rate that

  10. Discovery of essential fatty acids

    PubMed Central

    Spector, Arthur A.; Kim, Hee-Yong

    2015-01-01

    Dietary fat was recognized as a good source of energy and fat-soluble vitamins by the first part of the 20th century, but fatty acids were not considered to be essential nutrients because they could be synthesized from dietary carbohydrate. This well-established view was challenged in 1929 by George and Mildred Burr who reported that dietary fatty acid was required to prevent a deficiency disease that occurred in rats fed a fat-free diet. They concluded that fatty acids were essential nutrients and showed that linoleic acid prevented the disease and is an essential fatty acid. The Burrs surmised that other unsaturated fatty acids were essential and subsequently demonstrated that linolenic acid, the omega-3 fatty acid analog of linoleic acid, is also an essential fatty acid. The discovery of essential fatty acids was a paradigm-changing finding, and it is now considered to be one of the landmark discoveries in lipid research. PMID:25339684

  11. Boric acid catalyzed chemoselective esterification of alpha-hydroxycarboxylic acids.

    PubMed

    Houston, Todd A; Wilkinson, Brendan L; Blanchfield, Joanne T

    2004-03-01

    Boric acid catalyzes the selective esterification of alpha-hydroxycarboxylic acids without causing significant esterification to occur with other carboxylic acids. The procedure is simple, high-yielding, and applicable to the esterification of alpha-hydroxy carboxylates in the presence of other carboxylic acids including beta-hydroxyacids within the same molecule. [reaction: see text

  12. Acid Rain, pH & Acidity: A Common Misinterpretation.

    ERIC Educational Resources Information Center

    Clark, David B.; Thompson, Ronald E.

    1989-01-01

    Illustrates the basis for misleading statements about the relationship between pH and acid content in acid rain. Explains why pH cannot be used as a measure of acidity for rain or any other solution. Suggests that teachers present acidity and pH as two separate and distinct concepts. (RT)

  13. Amino-acid contamination of aqueous hydrochloric acid.

    NASA Technical Reports Server (NTRS)

    Wolman, Y.; Miller, S. L.

    1971-01-01

    Considerable amino-acid contamination in commercially available analytical grade hydrochloric acid (37% HCl) was found. One bottle contained 8,300 nmol of amino-acids per liter. A bottle from another supplier contained 6,700 nmol per liter. The contaminants were mostly protein amino-acids and several unknowns. Data on the volatility of the amino-acids during HCl distillation were also obtained.

  14. Analysis of Bile Acids

    NASA Astrophysics Data System (ADS)

    Sjövall, Jan; Griffiths, William J.; Setchell, Kenneth D. R.; Mano, Nariyasu; Goto, Junichi

    Bile acids constitute a large family of steroids in vertebrates, normally formed from cholesterol and carrying a carboxyl group in a side-chain of variable length. Bile alcohols, also formed from cholesterol, have similar structures as bile acids, except for the absence of a carboxyl group in the steroid skeleton. The conversion of cholesterol to bile acids and/or bile alcohols is of major importance for maintenance of cholesterol homeostasis, both from quantitative and regulatory points of view (Chiang, 2004; Kalaany and Mangelsdorf, 2006; Moore, Kato, Xie, et al., 2006; Scotti, Gilardi, Godio, et al., 2007). Appropriately conjugated bile acids and bile alcohols (also referred to as bile salts) are secreted in bile and serve vital functions in the absorption of lipids and lipid-soluble compounds (Hofmann, 2007). Reliable analytical methods are required for studies of the functions and pathophysiological importance of the variety of bile acids and bile alcohols present in living organisms. When combined with genetic and proteomic studies, analysis of these small molecules (in today's terminology: metabolomics, steroidomics, sterolomics, cholanoidomics, etc.) will lead to a deeper understanding of the integrated metabolic processes in lipid metabolism.

  15. Optical high acidity sensor

    DOEpatents

    Jorgensen, B.S.; Nekimken, H.L.; Carey, W.P.; O`Rourke, P.E.

    1997-07-22

    An apparatus and method for determining acid concentrations in solutions having acid concentrations of from about 0.1 Molar to about 16 Molar is disclosed. The apparatus includes a chamber for interrogation of the sample solution, a fiber optic light source for passing light transversely through the chamber, a fiber optic collector for receiving the collimated light after transmission through the chamber, a coating of an acid resistant polymeric composition upon at least one fiber end or lens, the polymeric composition in contact with the sample solution within the chamber and having a detectable response to acid concentrations within the range of from about 0.1 Molar to about 16 Molar, a measurer for the response of the polymeric composition in contact with the sample solution, and a comparer of the measured response to predetermined standards whereby the acid molarity of the sample solution within the chamber can be determined. Preferably, a first lens is attached to the end of the fiber optic light source, the first lens adapted to collimate light from the fiber optic light source, and a second lens is attached to the end of the fiber optic collector for focusing the collimated light after transmission through the chamber. 10 figs.

  16. Optical high acidity sensor

    DOEpatents

    Jorgensen, Betty S.; Nekimken, Howard L.; Carey, W. Patrick; O'Rourke, Patrick E.

    1997-01-01

    An apparatus and method for determining acid concentrations in solutions having acid concentrations of from about 0.1 Molar to about 16 Molar is disclosed. The apparatus includes a chamber for interrogation of the sample solution, a fiber optic light source for passing light transversely through the chamber, a fiber optic collector for receiving the collimated light after transmission through the chamber, a coating of an acid resistant polymeric composition upon at least one fiber end or lens, the polymeric composition in contact with the sample solution within the chamber and having a detectable response to acid concentrations within the range of from about 0.1 Molar to about 16 Molar, a measurer for the response of the polymeric composition in contact with the sample solution, and, a comparer of the measured response to predetermined standards whereby the acid molarity of the sample solution within the chamber can be determined. Preferably, a first lens is attached to the end of the fiber optic light source, the first lens adapted to collimate light from the fiber optic light source, and a second lens is attached to the end of the fiber optic collector for focusing the collimated light after transmission through the chamber.

  17. Acid sludge utilization

    SciTech Connect

    Suarez, M.

    1980-09-01

    The Peak Oil Company of Tampa, Florida, in cooperation with the United States Department of Energy, has completed an initial study for the incorporation of acid-sludge derived from the rerefining of used lubricating oil into a useful and salable building material. Both bricks and paving materials have been produced using a formulation developed by Peak. Equipment has been designed and constructed for the specific purpose of preparing emulsions containing the acid-sludge, which is a vital ingredient in the final formulation. Testing of products obtained from these initial efforts shows that the acid in the sludge has been effectively neutralized and that heavy metals are not leached from the bricks or paving material in normal testing. While some properties of the building materials that incorporate the acid-sludge by-product are below standards for clay and shale brick, uses are defined for the product as is, and there is some promise of eventual production of building materials that meet all specifications for competitive materials. Initial cost estimations are encouraging, indicating that a profit can be derived by converting a hazardous and noxious by-product of rerefining to a construction material. Acid-sludge has presented a complex and costly disposal problem to the industry resulting in a serious depletion in the capacity for rerefining used lubricating oil.

  18. Domoic acid epileptic disease.

    PubMed

    Ramsdell, John S; Gulland, Frances M

    2014-03-01

    Domoic acid epileptic disease is characterized by spontaneous recurrent seizures weeks to months after domoic acid exposure. The potential for this disease was first recognized in a human case study of temporal lobe epilepsy after the 1987 amnesic shellfish-poisoning event in Quebec, and was characterized as a chronic epileptic syndrome in California sea lions through investigation of a series of domoic acid poisoning cases between 1998 and 2006. The sea lion study provided a breadth of insight into clinical presentations, unusual behaviors, brain pathology, and epidemiology. A rat model that replicates key observations of the chronic epileptic syndrome in sea lions has been applied to identify the progression of the epileptic disease state, its relationship to behavioral manifestations, and to define the neural systems involved in these behavioral disorders. Here, we present the concept of domoic acid epileptic disease as a delayed manifestation of domoic acid poisoning and review the state of knowledge for this disease state in affected humans and sea lions. We discuss causative mechanisms and neural underpinnings of disease maturation revealed by the rat model to present the concept for olfactory origin of an epileptic disease; triggered in dendodendritic synapases of the olfactory bulb and maturing in the olfactory cortex. We conclude with updated information on populations at risk, medical diagnosis, treatment, and prognosis. PMID:24663110

  19. Domoic Acid Epileptic Disease

    PubMed Central

    Ramsdell, John S.; Gulland, Frances M.

    2014-01-01

    Domoic acid epileptic disease is characterized by spontaneous recurrent seizures weeks to months after domoic acid exposure. The potential for this disease was first recognized in a human case study of temporal lobe epilepsy after the 1987 amnesic shellfish-poisoning event in Quebec, and was characterized as a chronic epileptic syndrome in California sea lions through investigation of a series of domoic acid poisoning cases between 1998 and 2006. The sea lion study provided a breadth of insight into clinical presentations, unusual behaviors, brain pathology, and epidemiology. A rat model that replicates key observations of the chronic epileptic syndrome in sea lions has been applied to identify the progression of the epileptic disease state, its relationship to behavioral manifestations, and to define the neural systems involved in these behavioral disorders. Here, we present the concept of domoic acid epileptic disease as a delayed manifestation of domoic acid poisoning and review the state of knowledge for this disease state in affected humans and sea lions. We discuss causative mechanisms and neural underpinnings of disease maturation revealed by the rat model to present the concept for olfactory origin of an epileptic disease; triggered in dendodendritic synapases of the olfactory bulb and maturing in the olfactory cortex. We conclude with updated information on populations at risk, medical diagnosis, treatment, and prognosis. PMID:24663110

  20. A Demonstration of Acid Rain

    ERIC Educational Resources Information Center

    Fong, Man Wai

    2004-01-01

    A demonstration showing acid rain formation is described. Oxides of sulfur and nitrogen that result from the burning of fossil fuels are the major pollutants of acid rain. In this demonstration, SO[subscript 2] gas is produced by the burning of matches. An acid-base indicator will show that the dissolved gas turns an aqueous solution acidic.

  1. DOCOSAHEXAENOIC ACID AND ARACHIDONIC ACID PREVENT ESSENTIAL FATTY ACID DEFICIENCY AND HEPATIC STEATOSIS

    PubMed Central

    Le, Hau D.; Meisel, Jonathan A.; de Meijer, Vincent E.; Fallon, Erica M.; Gura, Kathleen M.; Nose, Vania; Bistrian, Bruce R.; Puder, Mark

    2012-01-01

    Objectives Essential fatty acids are important for growth, development, and physiologic function. Alpha-linolenic acid and linoleic acid are the precursors of docosahexaenoic and arachidonic acid, respectively, and have traditionally been considered the essential fatty acids. However, we hypothesized that docosahexaenoic acid and arachidonic acid can function as the essential fatty acids. Methods Using a murine model of essential fatty acid deficiency and consequent hepatic steatosis, we provided mice with varying amounts of docosahexaenoic and arachidonic acids to determine whether exclusive supplementation of docosahexaenoic and arachidonic acids could prevent essential fatty acid deficiency and inhibit or attenuate hepatic steatosis. Results Mice supplemented with docosahexaenoic and arachidonic acids at 2.1% or 4.2% of their calories for 19 days had normal liver histology and no biochemical evidence of essential fatty acid deficiency, which persisted when observed after 9 weeks. Conclusion Supplementation of sufficient amounts of docosahexaenoic and arachidonic acids alone without alpha-linolenic and linoleic acids meets essential fatty acid requirements and prevents hepatic steatosis in a murine model. PMID:22038210

  2. Biodegradation of cyanuric acid.

    PubMed

    Saldick, J

    1974-12-01

    Cyanuric acid biodegrades readily under a wide variety of natural conditions, and particularly well in systems of either low or zero dissolved-oxygen level, such as anaerobic activated sludge and sewage, soils, muds, and muddy streams and river waters, as well as ordinary aerated activated sludge systems with typically low (1 to 3 ppm) dissolved-oxygen levels. Degradation also proceeds in 3.5% sodium chloride solution. Consequently, there are degradation pathways widely available for breaking down cyanuric acid discharged in domestic effluents. The overall degradation reaction is merely a hydrolysis; CO(2) and ammonia are the initial hydrolytic breakdown products. Since no net oxidation occurs during this breakdown, biodegradation of cyanuric acid exerts no primary biological oxygen demand. However, eventual nitrification of the ammonia released will exert its usual biological oxygen demand.

  3. Exposures to acidic aerosols.

    PubMed

    Spengler, J D; Keeler, G J; Koutrakis, P; Ryan, P B; Raizenne, M; Franklin, C A

    1989-02-01

    Ambient monitoring of acid aerosols in four U.S. cities and in a rural region of southern Ontario clearly show distinct periods of strong acidity. Measurements made in Kingston, TN, and Steubenville, OH, resulted in 24-hr H+ ion concentrations exceeding 100 nmole/m3 more than 10 times during summer months. Periods of elevated acidic aerosols occur less frequently in winter months. The H+ determined during episodic conditions in southern Ontario indicates that respiratory tract deposition can exceed the effects level reported in clinical studies. Observed 12-hr H+ concentrations exceeded 550 nmole/m3 (approximately 27 micrograms/m3 H2SO4). The maximum estimated 1-hr concentration exceeded 1500 nmole/m3 for H+ ions. At these concentrations, an active child might receive more than 2000 nmole of H+ ion in 12 hr and in excess of 900 nmole during the hour when H2SO4 exceeded 50 micrograms/m3.

  4. Biodegradation of Cyanuric Acid

    PubMed Central

    Saldick, Jerome

    1974-01-01

    Cyanuric acid biodegrades readily under a wide variety of natural conditions, and particularly well in systems of either low or zero dissolved-oxygen level, such as anaerobic activated sludge and sewage, soils, muds, and muddy streams and river waters, as well as ordinary aerated activated sludge systems with typically low (1 to 3 ppm) dissolved-oxygen levels. Degradation also proceeds in 3.5% sodium chloride solution. Consequently, there are degradation pathways widely available for breaking down cyanuric acid discharged in domestic effluents. The overall degradation reaction is merely a hydrolysis; CO2 and ammonia are the initial hydrolytic breakdown products. Since no net oxidation occurs during this breakdown, biodegradation of cyanuric acid exerts no primary biological oxygen demand. However, eventual nitrification of the ammonia released will exert its usual biological oxygen demand. PMID:4451360

  5. Calorimetry of Nucleic Acids.

    PubMed

    Rozners, Eriks; Pilch, Daniel S; Egli, Martin

    2015-12-01

    This unit describes the application of calorimetry to characterize the thermodynamics of nucleic acids, specifically, the two major calorimetric methodologies that are currently employed: differential scanning (DSC) and isothermal titration calorimetry (ITC). DSC is used to study thermally induced order-disorder transitions in nucleic acids. A DSC instrument measures, as a function of temperature (T), the excess heat capacity (C(p)(ex)) of a nucleic acid solution relative to the same amount of buffer solution. From a single curve of C(p)(ex) versus T, one can derive the following information: the transition enthalpy (ΔH), entropy (ΔS), free energy (ΔG), and heat capacity (ΔCp); the state of the transition (two-state versus multistate); and the average size of the molecule that melts as a single thermodynamic entity (e.g., the duplex). ITC is used to study the hybridization of nucleic acid molecules at constant temperature. In an ITC experiment, small aliquots of a titrant nucleic acid solution (strand 1) are added to an analyte nucleic acid solution (strand 2), and the released heat is monitored. ITC yields the stoichiometry of the association reaction (n), the enthalpy of association (ΔH), the equilibrium association constant (K), and thus the free energy of association (ΔG). Once ΔH and ΔG are known, ΔS can also be derived. Repetition of the ITC experiment at a number of different temperatures yields the ΔCp for the association reaction from the temperature dependence of ΔH.

  6. Acid rain in Asia

    NASA Astrophysics Data System (ADS)

    Bhatti, Neeloo; Streets, David G.; Foell, Wesley K.

    1992-07-01

    Acid rain has been an issue of great concern in North America and Europe during the past several decades. However, due to the passage of a number of recent regulations, most notably the Clean Air Act in the United States in 1990, there is an emerging perception that the problem in these Western nations is nearing solution. The situation in the developing world, particularly in Asia, is much bleaker. Given the policies of many Asian nations to achieve levels of development comparable with the industrialized world—which necessitate a significant expansion of energy consumption (most derived from indigenous coal reserves)—the potential for the formation of, and damage from, acid deposition in these developing countries is very high. This article delineates and assesses the emissions patterns, meteorology, physical geology, and biological and cultural resources present in various Asian nations. Based on this analysis and the risk factors to acidification, it is concluded that a number of areas in Asia are currently vulnerable to acid rain. These regions include Japan, North and South Korea, southern China, and the mountainous portions of Southeast Asia and southwestern India. Furthermore, with accelerated development (and its attendant increase in energy use and production of emissions of acid deposition precursors) in many nations of Asia, it is likely that other regions will also be affected by acidification in the near future. Based on the results of this overview, it is clear that acid deposition has significant potential to impact the Asian region. However, empirical evidence is urgently needed to confirm this and to provide early warning of increases in the magnitude and spread of acid deposition and its effects throughout this part of the world.

  7. Acid Precipitation; (USA)

    SciTech Connect

    Rushing, J.W.; Hicks, S.C.

    1991-01-01

    This publication, Acid Precipitation (APC) announces on a monthly basis the current worldwide information on acid precipitation and closely related subjects, including wet and dry deposition, long-range transport, environmental effects, modeling, and socioeconomic factors. Information on the following subjects is included within the scope of this publication, but all subjects may not appear in each issue: Pollution sources and pollution control technology; atmospheric transport and chemistry; terrestrial transport and chemistry; aquatic transport and chemistry; biological effects; corrosive effects; and socioeconomics, policy, and legislation.

  8. Whither acid rain?

    PubMed

    Brimblecombe, P

    2001-04-01

    Acid rain, the environmental cause célèbre of the 1980s seems to have vanished from popular conscience. By contrast, scientific research, despite funding difficulties, has continued to produce hundreds of research papers each year. Studies of acid rain taught much about precipitation chemistry, the behaviour of snow packs, long-range transport of pollutants and new issues in the biology of fish and forested ecosystems. There is now evidence of a shift away from research in precipitation and sulfur chemistry, but an impressive theoretical base remains as a legacy.

  9. NITRIC ACID PICKLING PROCESS

    DOEpatents

    Boller, E.R.; Eubank, L.D.

    1958-08-19

    An improved process is described for the treatment of metallic uranium surfaces preparatory to being given hot dip coatings. The process consists in first pickling the uraniunn surInce with aqueous 50% to 70% nitric acid, at 60 to 70 deg C, for about 5 minutes, rinsing the acid solution from the uranium article, promptly drying and then passing it through a molten alkali-metal halide flux consisting of 42% LiCl, 53% KCla and 5% NaCl into a molten metal bath consisting of 85 parts by weight of zinc and 15 parts by weight of aluminum

  10. Fatty acids of Thiobacillus thiooxidans.

    PubMed

    Levin, R A

    1971-12-01

    Fatty acid spectra were made on Thiobacillus thiooxidans cultures both in the presence and absence of organic compounds. Small additions of glucose or acetate had no significant effect either on growth or fatty acid content. The addition of biotin had no stimulatory effect but did result in slight quantitative changes in the fatty acid spectrum. The predominant fatty acid was a C(19) cyclopropane acid.

  11. Fatty Acids of Thiobacillus thiooxidans

    PubMed Central

    Levin, Richard A.

    1971-01-01

    Fatty acid spectra were made on Thiobacillus thiooxidans cultures both in the presence and absence of organic compounds. Small additions of glucose or acetate had no significant effect either on growth or fatty acid content. The addition of biotin had no stimulatory effect but did result in slight quantitative changes in the fatty acid spectrum. The predominant fatty acid was a C19 cyclopropane acid. PMID:4945206

  12. Detection of free and covalently bound microcystins in animal tissues by liquid chromatography-tandem mass spectrometry.

    PubMed

    Neffling, Milla-Riina; Lance, Emilie; Meriluoto, Jussi

    2010-03-01

    Microcystins are cyanobacterial hepatotoxins capable of accumulation into animal tissues. The toxins act by inhibiting specific protein phosphatases and both non-covalent and covalent interactions occur. The 2-methyl-3-methoxy-4-phenylbutyric acid (MMPB) method determines the total, i.e. the sum of free and protein-bound microcystin in tissues. The aim of the method development in this paper was to tackle the problems with the MMPB methodology: the rather laborious workflow and the loss of material during different steps of the method. In the optimised workflow the oxidation recovery was of acceptable level (29-40%), the extraction efficiency good (62-97%), but the signal suppression effect from the matrix remained severe in our system (16-37% signal left). The extraction efficiency for the determination of the free, extractable microcystins, was found to be good, 52-100%, depending on the sample and the toxin variant and concentration.

  13. The Acid-Base Titration of a Very Weak Acid: Boric Acid

    ERIC Educational Resources Information Center

    Celeste, M.; Azevedo, C.; Cavaleiro, Ana M. V.

    2012-01-01

    A laboratory experiment based on the titration of boric acid with strong base in the presence of d-mannitol is described. Boric acid is a very weak acid and direct titration with NaOH is not possible. An auxiliary reagent that contributes to the release of protons in a known stoichiometry facilitates the acid-base titration. Students obtain the…

  14. Lactic acid bacterial cell factories for gamma-aminobutyric acid.

    PubMed

    Li, Haixing; Cao, Yusheng

    2010-11-01

    Gamma-aminobutyric acid is a non-protein amino acid that is widely present in organisms. Several important physiological functions of gamma-aminobutyric acid have been characterized, such as neurotransmission, induction of hypotension, diuretic effects, and tranquilizer effects. Many microorganisms can produce gamma-aminobutyric acid including bacteria, fungi and yeasts. Among them, gamma-aminobutyric acid-producing lactic acid bacteria have been a focus of research in recent years, because lactic acid bacteria possess special physiological activities and are generally regarded as safe. They have been extensively used in food industry. The production of lactic acid bacterial gamma-aminobutyric acid is safe and eco-friendly, and this provides the possibility of production of new naturally fermented health-oriented products enriched in gamma-aminobutyric acid. The gamma-aminobutyric acid-producing species of lactic acid bacteria and their isolation sources, the methods for screening of the strains and increasing their production, the enzymatic properties of glutamate decarboxylases and the relative fundamental research are reviewed in this article. And the potential applications of gamma-aminobutyric acid-producing lactic acid bacteria were also referred to.

  15. Comparison of Buffer Effect of Different Acids During Sandstone Acidizing

    NASA Astrophysics Data System (ADS)

    Umer Shafiq, Mian; Khaled Ben Mahmud, Hisham; Hamid, Mohamed Ali

    2015-04-01

    The most important concern of sandstone matrix acidizing is to increase the formation permeability by removing the silica particles. To accomplish this, the mud acid (HF: HCl) has been utilized successfully for many years to stimulate the sandstone formations, but still it has many complexities. This paper presents the results of laboratory investigations of different acid combinations (HF: HCl, HF: H3PO4 and HF: HCOOH). Hydrofluoric acid and fluoboric acid are used to dissolve clays and feldspar. Phosphoric and formic acids are added as a buffer to maintain the pH of the solution; also it allows the maximum penetration of acid into the core sample. Different tests have been performed on the core samples before and after the acidizing to do the comparative study on the buffer effect of these acids. The analysis consists of permeability, porosity, color change and pH value tests. There is more increase in permeability and porosity while less change in pH when phosphoric and formic acids were used compared to mud acid. From these results it has been found that the buffer effect of phosphoric acid and formic acid is better than hydrochloric acid.

  16. [Studies on interaction of acid-treated nanotube titanic acid and amino acids].

    PubMed

    Zhang, Huqin; Chen, Xuemei; Jin, Zhensheng; Liao, Guangxi; Wu, Xiaoming; Du, Jianqiang; Cao, Xiang

    2010-06-01

    Nanotube titanic acid (NTA) has distinct optical and electrical character, and has photocatalysis character. In accordance with these qualities, NTA was treated with acid so as to enhance its surface activity. Surface structures and surface groups of acid-treated NTA were characterized and analyzed by Transmission Electron Microscope (TEM) and Fourier Transform Infrared Spectrometry (FT-IR). The interaction between acid-treated NTA and amino acids was investigated. Analysis results showed that the lengths of acid-treated NTA became obviously shorter. The diameters of nanotube bundles did not change obviously with acid-treating. Meanwhile, the surface of acid-treated NTA was cross-linked with carboxyl or esterfunction. In addition, acid-treated NTA can catch amino acid residues easily, and then form close combination.

  17. Docosahexaenoic acid and lactation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Docosahexaenoic acid (DHA) is an important component of membrane phospholipids in the retina, and brain, and accumulates rapidly in these tissues during early infancy. DHA is present in human milk, but the amount varies considerably and is largely dependent on maternal diet. This article reviews dat...

  18. Orphenadrinium picrate picric acid

    PubMed Central

    Fun, Hoong-Kun; Hemamalini, Madhukar; Siddaraju, B. P.; Yathirajan, H. S.; Narayana, B.

    2010-01-01

    The asymmetric unit of the title compound N,N-dimethyl-2-[(2-methyl­phen­yl)phenyl­meth­oxy]ethanaminium picrate picric acid, C18H24NO+·C6H2N3O7 −·C6H3N3O7, contains one orphenadrinium cation, one picrate anion and one picric acid mol­ecule. In the orphenadrine cation, the two aromatic rings form a dihedral angle of 70.30 (7)°. There is an intra­molecular O—H⋯O hydrogen bond in the picric acid mol­ecule, which generates an S(6) ring motif. In the crystal structure, the orphenadrine cations, picrate anions and picric acid mol­ecules are connected by strong inter­molecular N—H⋯O hydrogen bonds, π⋯π inter­actions between the benzene rings of cations and anions [centroid–centroid distance = 3.5603 (9) Å] and weak C—H⋯O hydrogen bonds, forming a three-dimensional network. PMID:21580426

  19. Acid Rain Investigations.

    ERIC Educational Resources Information Center

    Hugo, John C.

    1992-01-01

    Presents an activity in which students investigate the formation of solid ammonium chloride aerosol particles to help students better understand the concept of acid rain. Provides activity objectives, procedures, sample data, clean-up instructions, and questions and answers to help interpret the data. (MDH)

  20. The Acid Rain Debate.

    ERIC Educational Resources Information Center

    Oates-Bockenstedt, Catherine

    1997-01-01

    Details an activity designed to motivate students by incorporating science-related issues into a classroom debate. Includes "The Acid Rain Bill" and "Position Guides" for student roles as committee members, consumers, governors, industry owners, tourism professionals, senators, and debate directors. (DKM)

  1. Acid rain bibliography

    SciTech Connect

    Sayers, C.S.

    1983-09-01

    This bibliography identifies 900 citations on various aspects of Acid Rain, covering published bibliographies, books, reports, conference and symposium proceedings, audio visual materials, pamphlets and newsletters. It includes five sections: citations index (complete record of author, title, source, order number); KWIC index; title index; author index; and source index. 900 references.

  2. Acid Rain Classroom Projects.

    ERIC Educational Resources Information Center

    Demchik, Michael J.

    2000-01-01

    Describes a curriculum plan in which students learn about acid rain through instructional media, research and class presentations, lab activities, simulations, design, and design implementation. Describes the simulation activity in detail and includes materials, procedures, instructions, examples, results, and discussion sections. (SAH)

  3. The Acid Rain Debate.

    ERIC Educational Resources Information Center

    Bybee, Rodger; And Others

    1984-01-01

    Describes an activity which provides opportunities for role-playing as industrialists, ecologists, and government officials. The activity involves forming an international commission on acid rain, taking testimony, and, based on the testimony, making recommendations to governments on specific ways to solve the problem. Includes suggestions for…

  4. The Acid Rain Game.

    ERIC Educational Resources Information Center

    Rakow, Steven J.; Glenn, Allen

    1982-01-01

    Provides rationale for and description of an acid rain game (designed for two players), a problem-solving model for elementary students. Although complete instructions are provided, including a copy of the game board, the game is also available for Apple II microcomputers. Information for the computer program is available from the author.…

  5. Targeting tumor acidity

    NASA Astrophysics Data System (ADS)

    Reshetnyak, Yana K.; Engelman, Donald M.; Andreev, Oleg A.

    2012-02-01

    One of the main features of solid tumors is extracellular acidity, which correlates with tumor aggressiveness and metastatic potential. We introduced novel approach in targeting of acidic tumors, and translocation of cell-impermeable cargo molecules across cellular membrane. Our approach is based on main principle of insertion and folding of a polypeptide in lipid bilayer of membrane. We have identified family of pH Low Insertion Peptides (pHLIPs), which are capable spontaneous insertion and folding in membrane at mild acidic conditions. The affinity of peptides of pHLIP family to membrane at low pH is several times higher than at neutral pH. The process of peptides folding occurs within milliseconds. The energy released in a result of folding (about 2 kcal/mol) could be used to move polar cargo across a membrane, which is a novel concept in drug delivery. pHLIP peptides could be considered as a pH-sensitive single peptide molecular transporters and conjugated with imaging probes for fluorescence, MR, PET and SPECT imaging, they represent a novel in vivo marker of acidity. The work is supported by NIH grants CA133890 and GM073857 to OAA, DME, YRK.

  6. Spermatotoxicity of dichloroacetic acid

    EPA Science Inventory

    The testicular toxicity of dichloroacetic acid (DCA), a disinfection byproduct of drinking water, was evaluated in adult male rats given both single and multiple (up to 14 d) oral doses. Delayed spermiation and altered resorption of residual bodies were observed in rats given sin...

  7. Plant fatty acid hydroxylase

    DOEpatents

    Somerville, Chris; van de Loo, Frank

    2000-01-01

    The present invention relates to the identification of nucleic acid sequences and constructs, and methods related thereto, and the use of these sequences and constructs to produce genetically modified plants for the purpose of altering the composition of plant oils, waxes and related compounds.

  8. Alkyl phosphonic acids and sulfonic acids in the Murchison meteorite

    NASA Technical Reports Server (NTRS)

    Cooper, George W.; Onwo, Wilfred M.; Cronin, John R.

    1992-01-01

    Homologous series of alkyl phosphonic acids and alkyl sulfonic acids, along with inorganic orthophosphate and sulfate, are identified in water extracts of the Murchison meteorite after conversion to their t-butyl dimethylsilyl derivatives. The methyl, ethyl, propyl, and butyl compounds are observed in both series. Five of the eight possible alkyl phosphonic acids and seven of the eight possible alkyl sulfonic acids through C4 are identified. Abundances decrease with increasing carbon number as observed of other homologous series indigenous to Murchison. Concentrations range downward from approximately 380 nmol/gram in the alkyl sulfonic acid series, and from 9 nmol/gram in the alkyl phosphonic acid series.

  9. A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid-Mediated Deoxygenation of the Glucose-Derived Materials Quinic Acid and Shikimic Acid

    SciTech Connect

    Arceo, Elena; Ellman, Jonathan; Bergman, Robert

    2010-05-03

    An alternative biomass-based route to benzoic acid from the renewable starting materials quinic acid and shikimic acid is described. Benzoic acid is obtained selectively using a highly efficient, one-step formic acid-mediated deoxygenation method.

  10. 49 CFR 173.158 - Nitric acid.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... material. (b) Nitric acid in any concentration which does not contain sulfuric acid or hydrochloric acid as... sulfuric acid or hydrochloric acid as impurities, when offered for transportation or transported by...

  11. 49 CFR 173.158 - Nitric acid.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... material. (b) Nitric acid in any concentration which does not contain sulfuric acid or hydrochloric acid as... sulfuric acid or hydrochloric acid as impurities, when offered for transportation or transported by...

  12. 49 CFR 173.158 - Nitric acid.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... material. (b) Nitric acid in any concentration which does not contain sulfuric acid or hydrochloric acid as... sulfuric acid or hydrochloric acid as impurities, when offered for transportation or transported by...

  13. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  14. Photostabilization of ascorbic acid with citric acid, tartaric acid and boric acid in cream formulations.

    PubMed

    Ahmad, I; Ali Sheraz, M; Ahmed, S; Shad, Z; Vaid, F H M

    2012-06-01

    This study involves the evaluation of the effect of certain stabilizers, that is, citric acid (CT), tartaric acid (TA) and boric acid (BA) on the degradation of ascorbic acid (AH(2) ) in oil-in-water cream formulations exposed to the UV light and stored in the dark. The apparent first-order rate constants (0.34-0.95 × 10(-3) min(-1) in light, 0.38-1.24 × 10(-2) day(-1) in dark) for the degradation reactions in the presence of the stabilizers have been determined. These rate constants have been used to derive the second-order rate constants (0.26-1.45 × 10(-2) M(-1) min(-1) in light, 3.75-8.50 × 10(-3) M(-1) day(-1) in dark) for the interaction of AH(2) and the individual stabilizers. These stabilizers are effective in causing the inhibition of the rate of degradation of AH(2) both in the light and in the dark. The inhibitory effect of the stabilizers is in the order of CT > TA > BA. The rate of degradation of AH(2) in the presence of these stabilizers in the light is about 120 times higher than that in the dark. This could be explained on the basis of the deactivation of AH(2) -excited triplet state by CT and TA and by the inhibition of AH(2) degradation through complex formation with BA. AH(2) leads to the formation of dehydroascorbic acid (A) by chemical and photooxidation in cream formulations.

  15. Total microcystins analysis in water using laser diode thermal desorption-atmospheric pressure chemical ionization-tandem mass spectrometry.

    PubMed

    Roy-Lachapelle, Audrey; Fayad, Paul B; Sinotte, Marc; Deblois, Christian; Sauvé, Sébastien

    2014-04-11

    A new approach for the analysis of the cyanobacterial microcystins (MCs) in environmental water matrices has been developed. It offers a cost efficient alternative method for the fast quantification of total MCs using mass spectrometry. This approach permits the quantification of total MCs concentrations without requiring any derivatization or the use of a suite of MCs standards. The oxidation product 2-methyl-3-methoxy-4-phenylbutyric acid (MMPB) was formed through a Lemieux oxidation and represented the total concentration of free and bound MCs in water samples. MMPB was analyzed using laser diode thermal desorption-atmospheric pressure chemical ionization coupled to tandem mass spectrometry (LDTD-APCI-MS/MS). LDTD is a robust and reliable sample introduction method with ultra-fast analysis time (<15 s sample(-1)). Several oxidation and LDTD parameters were optimized to improve recoveries and signal intensity. MCs oxidation recovery yield was 103%, showing a complete reaction. Internal calibration with standard addition was achieved with the use of 4-phenylbutyric acid (4-PB) as internal standard and showed good linearity (R(2)>0.999). Limits of detection and quantification were 0.2 and 0.9 μg L(-1), respectively. These values are comparable with the WHO (World Health Organization) guideline of 1 μg L(-1) for total microcystin-LR congener in drinking water. Accuracy and interday/intraday variation coefficients were below 15%. Matrix effect was determined with a recovery of 91%, showing no significant signal suppression. This work demonstrates the use of the LDTD-APCI-MS/MS interface for the screening, detection and quantification of total MCs in complex environmental matrices.

  16. Fatty acid-producing hosts

    DOEpatents

    Pfleger, Brian F; Lennen, Rebecca M

    2013-12-31

    Described are hosts for overproducing a fatty acid product such as a fatty acid. The hosts include an exogenous nucleic acid encoding a thioesterase and, optionally, an exogenous nucleic acid encoding an acetyl-CoA carboxylase, wherein an acyl-CoA synthetase in the hosts are functionally delected. The hosts prefereably include the nucleic acid encoding the thioesterase at an intermediate copy number. The hosts are preferably recominantly stable and growth-competent at 37.degree. C. Methods of producing a fatty acid product comprising culturing such hosts at 37.degree. C. are also described.

  17. Acid diffusion through polyaniline membranes

    SciTech Connect

    Su, T.M.; Huang, S.C.; Conklin, J.A.

    1995-12-01

    Polyaniline membranes in the undoped (base) and doped (acid) forms are studied for their utility as pervaporation membranes. The separation of water from mixtures of propionic acid, acetic acid and formic acid have been demonstrated from various feed compositions. Doped polyaniline displays an enhanced selectivity of water over these organic acids as compared with undoped polyaniline. For as-cast polyaniline membranes a diffusion coefficient (D) on the order of 10{sup -9} cm{sup 2}/sec has been determined for the flux of protons through the membranes using hydrochloric acid.

  18. Exposure of flight attendants to pyrethroid insecticides on commercial flights: urinary metabolite levels and implications.

    PubMed

    Wei, Binnian; Mohan, Krishnan R; Weisel, Clifford P

    2012-07-01

    Pyrethroid insecticides have been used for disinsection of commercial aircrafts. However, little is known about the pyrethroids exposure of flight attendants. The objective of the study was to assess pyrethroids exposure of flight attendants working on commercial aircrafts through monitoring the urinary pyrethroids metabolite levels. Eighty four urine samples were collected from 28 flight attendants, 18-65 years of age, with seventeen working on planes that were non-disinsected, and eleven working on planes that had been disinsected. Five urinary metabolites of pyrethroids were measured using gas chromatographic-mass spectrometric method: 3-phenoxybenzoic acid (3-PBA), cis-/trans-3-(2,2-Dichlorovinyl)-2,2-dimethylcyclo-propane carboxylic acid (cis-/trans-Cl2CA), cis-3-(2,2-dibromovinyl)-2,2-dimethylcyclo-propane-1-carboxylic acid (cis-Br2CA) and 4-fluoro-3-phenoxybenzoic acid (4F-3-PBA). Flight attendants working on disinsected planes had significantly higher urinary levels of 3-PBA, cis- and trans-Cl2CA in pre, post- and 24-h-post flight samples than those on planes which did not report having been disinsected. Urinary levels of cis-Br2CA and 4F-3-PBA did not show significant differences between the two groups. Flight attendants working on international flights connected to Australia had higher urinary levels of 3-PBA, cis- and trans-Cl2CA than those on either domestic and other international flights flying among Asia, Europe and North America. Post-disinsection duration (number of days from disinsection date to flight date) was the most significant factor affecting the urinary pyrethroid metabolites levels of 3-PBA, cis- and trans-Cl2CA of the group flying on disinsected aircraft. It was concluded that working on commercial aircraft disinsected by pyrethroids resulted in elevated body burdens of 3-PBA, cis- and trans-Cl2CA.

  19. Characterization of a novel β-cypermethrin-degrading Aspergillus niger YAT strain and the biochemical degradation pathway of β-cypermethrin.

    PubMed

    Deng, Weiqin; Lin, Derong; Yao, Kai; Yuan, Huaiyu; Wang, Zhilong; Li, Jianlong; Zou, Likou; Han, Xinfeng; Zhou, Kang; He, Li; Hu, Xinjie; Liu, Shuliang

    2015-10-01

    Aspergillus niger YAT strain was obtained from Chinese brick tea (Collection number: CGMCC 10,568) and identified on the basis of morphological characteristics and internal transcribed spacer (ITS) sequence. The strain could degrade 54.83 % of β-cypermethrin (β-CY; 50 mg L(-1)) in 7 days and 100 % of 3-phenoxybenzoic acid (3-PBA; 100 mg L(-1)) in 22 h. The half-lives of β-CY and 3-PBA range from 3.573 to 11.748 days and from 5.635 to 12.160 h, respectively. The degradation of β-CY and 3-PBA was further described using first-order kinetic models. The pathway and mechanism of β-CY degraded by YAT were investigated by analyzing the degraded metabolites through high-performance liquid chromatography (HPLC) and liquid chromatography-mass spectrometry (LC-MS). Relevant enzymatic activities and substrate utilization were also investigated. β-CY degradation products were analyzed. Results indicated that YAT strain transformed β-CY into 3-PBA. 3-PBA was then gradually transformed into permethric acid, protocatechuic acid, 3-hydroxy-5-phenoxy benzoic acid, gallic acid, and phenol gradually. The YAT strain can also effectively degrade these metabolites. The results indicated that YAT strain has potential applications in bioremediation of pyrethroid insecticide (PI)-contaminated environments and fermented food. PMID:26022858

  20. Characterization of a novel β-cypermethrin-degrading Aspergillus niger YAT strain and the biochemical degradation pathway of β-cypermethrin.

    PubMed

    Deng, Weiqin; Lin, Derong; Yao, Kai; Yuan, Huaiyu; Wang, Zhilong; Li, Jianlong; Zou, Likou; Han, Xinfeng; Zhou, Kang; He, Li; Hu, Xinjie; Liu, Shuliang

    2015-10-01

    Aspergillus niger YAT strain was obtained from Chinese brick tea (Collection number: CGMCC 10,568) and identified on the basis of morphological characteristics and internal transcribed spacer (ITS) sequence. The strain could degrade 54.83 % of β-cypermethrin (β-CY; 50 mg L(-1)) in 7 days and 100 % of 3-phenoxybenzoic acid (3-PBA; 100 mg L(-1)) in 22 h. The half-lives of β-CY and 3-PBA range from 3.573 to 11.748 days and from 5.635 to 12.160 h, respectively. The degradation of β-CY and 3-PBA was further described using first-order kinetic models. The pathway and mechanism of β-CY degraded by YAT were investigated by analyzing the degraded metabolites through high-performance liquid chromatography (HPLC) and liquid chromatography-mass spectrometry (LC-MS). Relevant enzymatic activities and substrate utilization were also investigated. β-CY degradation products were analyzed. Results indicated that YAT strain transformed β-CY into 3-PBA. 3-PBA was then gradually transformed into permethric acid, protocatechuic acid, 3-hydroxy-5-phenoxy benzoic acid, gallic acid, and phenol gradually. The YAT strain can also effectively degrade these metabolites. The results indicated that YAT strain has potential applications in bioremediation of pyrethroid insecticide (PI)-contaminated environments and fermented food.

  1. Treatment of Bile Acid Amidation Defects with Glycocholic Acid

    PubMed Central

    Heubi, James E.; Setchell, Kenneth D.R.; Jha, Pinky; Buckley, Donna; Zhang, Wujuan; Rosenthal, Philip; Potter, Carol; Horslen, Simon; Suskind, David

    2014-01-01

    Bile acid amidation defects were predicted to present with fat/fat soluble vitamin malabsorption with minimal cholestasis. We identified and treated 5 patients (1 male/4 females) from 4 families with defective bile acid amidation due to a genetically confirmed deficiency in bile acid CoA:amino acid N-acyl transferase (BAAT) with the conjugated bile acid, glycocholic acid (GCA). Fast atom bombardment-mass spectrometry analysis of urine and bile at baseline revealed predominantly unconjugated cholic acid and absence of the usual glycine and taurine conjugated primary bile acids. Treatment with 15 mg/kg GCA resulted in total duodenal bile acid concentrations of 23.3 ± 19.1 mmol/L (mean ± SD) and 63.5 ± 4.0% of the bile acids were secreted in bile in the conjugated form of which GCA represented 59.6 ± 9.3% of the total biliary bile acids. Unconjugated cholic acid continued to be present in high concentrations in bile because of partial intestinal deconjugation of orally administered GCA. Serum total bile acid concentrations did not significantly differ between pretreatment and post-treatment samples and serum contained predominantly unconjugated cholic acid. These findings confirmed efficient intestinal absorption, hepatic extraction and biliary secretion of the administered GCA. Oral tolerance tests for vitamin D2 (1000 IU vitamin D2/kg) and tocopherol (100 IU/kg tocopherol acetate) demonstrated improvement in fat-soluble vitamin absorption after GCA treatment. Growth improved in 3/3 growth-delayed prepubertal patients. Conclusions: Oral glycocholic acid therapy is safe and effective in improving growth and fat-soluble vitamin absorption in children and adolescents with inborn errors of bile acid metabolism due to amidation defects. PMID:25163551

  2. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis. PMID:27349116

  3. NAPAP (National Acid Precipitation Assessment Program) results on acid rain

    SciTech Connect

    Not Available

    1990-06-01

    The National Acid Precipitation Assessment Program (NAPAP) was mandated by Congress in 1980 to study the effects of acid rain. The results of 10 years of research on the effect of acid deposition and ozone on forests, particularly high elevation spruce and fir, southern pines, eastern hardwoods and western conifers, will be published this year.

  4. Acid Earth--The Global Threat of Acid Pollution.

    ERIC Educational Resources Information Center

    McCormick, John

    Acid pollution is a major international problem, but the debate it has elicited has often clouded the distinction between myth and facts. This publication attempts to concerning the acid pollution situation. This publication attempts to identify available facts. It is the first global review of the problem of acid pollution and the first to…

  5. Usnic acid controls the acidity tolerance of lichens.

    PubMed

    Hauck, Markus; Jürgens, Sascha-René

    2008-11-01

    The hypotheses were tested that, firstly, lichens producing the dibenzofuran usnic acid colonize substrates characterized by specific pH ranges, secondly, this preferred pH is in a range where soluble usnic acid and its corresponding anion occur in similar concentrations, and thirdly, usnic acid makes lichens vulnerable to acidity. Lichens with usnic acid prefer an ambient pH range between 3.5 and 5.5 with an optimum between 4.0 and 4.5. This optimum is close to the pK(a1) value of usnic acid of 4.4. Below this optimum pH, dissolved SO(2) reduces the chlorophyll fluorescence yield more in lichens with than without their natural content of usnic acid. This suggests that usnic acid influences the acidity tolerance of lichens. The putative mechanism of the limited acidity tolerance of usnic acid-containing lichens is the acidification of the cytosol by molecules of protonated usnic acid shuttling protons through the plasma membrane at an apoplastic pH

  6. College Chemistry Students' Mental Models of Acids and Acid Strength

    ERIC Educational Resources Information Center

    McClary, LaKeisha; Talanquer, Vicente

    2011-01-01

    The central goal of this study was to characterize the mental models of acids and acid strength expressed by advanced college chemistry students when engaged in prediction, explanation, and justification tasks that asked them to rank chemical compounds based on their relative acid strength. For that purpose we completed a qualitative research…

  7. Acid hydrolysis of cellulose

    SciTech Connect

    Salazar, H.

    1980-12-01

    One of the alternatives to increase world production of etha nol is by the hydrolysis of cellulose content of agricultural residues. Studies have been made on the types of hydrolysis: enzimatic and acid. Data obtained from the sulphuric acid hydrolysis of cellulose showed that this process proceed in two steps, with a yield of approximately 95% glucose. Because of increases in cost of alternatives resources, the high demand of the product and the more economic production of ethanol from cellulose materials, it is certain that this technology will be implemented in the future. At the same time further studies on the disposal and reuse of the by-products of this production must be undertaken.

  8. [Progress in glucaric acid].

    PubMed

    Qiu, Yuying; Fang, Fang; Du, Guocheng; Chen, Jian

    2015-04-01

    Glucaric acid (GA) is derived from glucose and commonly used in chemical industry. It is also considered as one of the "Top value-added chemicals from biomass" as carbohydrate monomers to produce various synthetic polymers and bioenergy. The demand for GA in food manufacture is increasing. GA has also attracted public attentions due to its therapeutic uses such as regulating hormones, increasing the immune function and reducing the risks of cancers. Currently GA is produced by chemical oxidation. Research on production of GA via microbial synthesis is still at preliminary stage. We reviewed the advances of glucaric acid applications, preparation and quantification methods. The prospects on production of GA by microbial fermentation were also discussed. PMID:26380405

  9. Eucomic acid methanol monosolvate

    PubMed Central

    Li, Guo-Qiang; Li, Yao-Lan; Wang, Guo-Cai; Liang, Zhi-Hong; Jiang, Ren-Wang

    2011-01-01

    In the crystal structure of the title compound [systematic name: 2-hy­droxy-2-(4-hy­droxy­benz­yl)butane­dioic acid methanol monosolvate], C11H12O6·CH3OH, the dihedral angles between the planes of the carboxyl groups and the benzene ring are 51.23 (9) and 87.97 (9)°. Inter­molecular O—H⋯O hydrogen-bonding inter­actions involving the hy­droxy and carb­oxy­lic acid groups and the methanol solvent mol­ecule give a three-dimensional structure. PMID:22091200

  10. Industrial ecotoxicology "acid rain".

    PubMed

    Astolfi, E; Gotelli, C; Higa, J

    1986-01-01

    The acid rain phenomenon was studied in the province of Cordoba, Argentina. This study, based on a previously outlined framework, determined the anthropogenic origin of the low pH due to the presence of industrial hydrochloric acid wastage. This industrial ecotoxicological phenomenon seriously affected the forest wealth, causing a great defoliation of trees and shrubs, with a lower effect on crops. A survey on its effects on human beings has not been carried out, but considering the corrosion caused to different metals and its denouncing biocide effect on plants and animals, we should expect to find some kind of harm to the health of the workers involved or others engaged in farming, and even to those who are far away from the polluting agent. PMID:3758667

  11. Industrial ecotoxicology "acid rain".

    PubMed

    Astolfi, E; Gotelli, C; Higa, J

    1986-01-01

    The acid rain phenomenon was studied in the province of Cordoba, Argentina. This study, based on a previously outlined framework, determined the anthropogenic origin of the low pH due to the presence of industrial hydrochloric acid wastage. This industrial ecotoxicological phenomenon seriously affected the forest wealth, causing a great defoliation of trees and shrubs, with a lower effect on crops. A survey on its effects on human beings has not been carried out, but considering the corrosion caused to different metals and its denouncing biocide effect on plants and animals, we should expect to find some kind of harm to the health of the workers involved or others engaged in farming, and even to those who are far away from the polluting agent.

  12. (Radioiodinated free fatty acids)

    SciTech Connect

    Knapp, Jr., F. F.

    1987-12-11

    The traveler participated in the Second International Workshop on Radioiodinated Free Fatty Acids in Amsterdam, The Netherlands where he presented an invited paper describing the pioneering work at the Oak Ridge National Laboratory (ORNL) involving the design, development and testing of new radioiodinated methyl-branched fatty acids for evaluation of heart disease. He also chaired a technical session on the testing of new agents in various in vitro and in vivo systems. He also visited the Institute for Clinical and Experimental Nuclear Medicine in Bonn, West Germany, to review, discuss, plan and coordinate collaborative investigations with that institution. In addition, he visited the Cyclotron Research Center in Liege, Belgium, to discuss continuing collaborative studies with the Osmium-191/Iridium-191m radionuclide generator system, and to complete manuscripts and plan future studies.

  13. Lipid peroxidation end product 4-hydroxy-trans-2-nonenal triggers unfolded protein response and heme oxygenase-1 expression in PC12 cells: Roles of ROS and MAPK pathways.

    PubMed

    Lin, Meng-Han; Yen, Jui-Hung; Weng, Ching-Yi; Wang, Lisu; Ha, Choi-Lan; Wu, Ming-Jiuan

    2014-01-01

    This study investigates the roles of ROS overproduction and MAPK signaling pathways in the induction of unfolded protein response (UPR) and the expression of Phase II enzymes in response to 4-hydroxy-trans-2-nonenal (4-HNE) in a neuronal-like catecholaminergic PC12 cells. Our results showed that 4-HNE triggered three canonical pathways of UPR, namely IRE1-XBP1, PERK-eIF2α-ATF4 and ATF6, and induced the expression of UPR-targeted genes, GRP78, CHOP, TRB3, PUMA, and GADD34, as well as Phase II enzymes, HO-1 and GCLC. 4-HNE also induced apoptosis, intracellular calcium accumulation, caspase-3 activation, and G0/G1 cell cycle arrest, which was correlated with the increased expression of GADD45α. The addition of tiron, a cellular permeable superoxide scavenger, scavenged 4-HNE-mediated ROS formation, but did not alleviate cytotoxicity, or the expression of UPR-targeted genes or Phase II enzymes, indicating that ROS overproduction per se did not play a major role in 4-HNE-caused deleterious effects. HO-1 expression was attenuated by Nrf2 siRNA and chemical chaperone 4-phenylbutyrate (4-PBA), suggesting HO-1 expression was regulated by Nrf2-ARE, which may work downstream of ER stress. 4-HNE treatment promptly induced ERK, JNK and p38 MAPK activation. Addition of p38 MAPK specific inhibitor SB203580 attenuated HO-1 upregulation, but enhanced expression of CHOP, PUMA and TRB3, and cytotoxicity. These results indicate that 4-HNE-induced transient p38 MAPK activation may serve as an upstream negative regulator of ER stress and confer adaptive cytoprotection against 4-HNE-mediated cell injury.

  14. Prolonged ER Stressed-Hepatocytes drives an Alternative Macrophage Polarization

    PubMed Central

    Xiu, Fangming; Catapano, Michael; Diao, Li; Stanojcic, Mile; Jeschke, Marc G.

    2015-01-01

    Relatively little is known about the effects of hepatocytes on hepatic macrophages, particularly under the situation of endoplasmic reticulum (ER) stress. We examined the effects of hepatocytes conditioned media (CM) from HepG2 treated with ER stress inducers, Tunicamycin (TM) or Thapsigargin (TG), on the secretion of cytokines, expression of ER stress markers and polarization of PMA activated THP-1 cells (pTHP-1). We found that CM decreased the production of the pro-inflammatory cytokines including tumor necrosis factor-α (TNF-α), interleukin (IL)-6 and interleukin (IL)-1β as well as other cytokines and chemokines from pTHP-1 cells. These effects are mediated by the inhibition of TLR4 expression and NF-κB signaling pathway. In addition, hepatocytes CM increased the expression of binding immunoglobulin protein (BiP) and the transcription factor C/EBP homologous protein (CHOP) in pTHP-1 cells. Preconditioning with ER stress inhibitor, small molecular chaperone 4-phenylbutyrate (PBA) before addition of ER stressors, attenuated the ER stress in macrophages, the property of hepatocytes CM to alter TNF-α production and NF-κB expression by macrophages. Remarkably, treatment of macrophage with these CM leads to an alternative activation of macrophages mediated by peroxisome proliferator-activated receptor-γ (PPAR-γ) signaling pathway, which might be resulted from the secretion of IL-10 and IL-4 as well as releasing apoptotic bodies from hepatocytes under ER stress. Our results highlight a mechanism of ER stress transmission from hepatocytes to macrophage that drives an alternative activation of macrophages, which depends on the exposure of hepatocytes to severe and prolonged ER stress. PMID:25944791

  15. Simvastatin inhibits ox-LDL-induced inflammatory adipokines secretion via amelioration of ER stress in 3T3-L1 adipocyte.

    PubMed

    Wu, Zhi-hong; Chen, Ya-qin; Zhao, Shui-ping

    2013-03-01

    Adipocytes behave as a rich source of pro-inflammatory cytokines including tumor necrosis factor-α (TNF-α) and monocyte chemoattractant protein 1 (MCP-1). Endoplasmic reticulum (ER) stress in adipocytes can alter adipokines secretion and induce inflammation. The aim of this study is to evaluate the effect of simvastatin on the ox-LDL-induced ER stress and expression and secretion of TNF-α and MCP-1 in 3T3-L1 adipocytes. Differentiated adipocytes were treated with various concentrations of ox-LDL (0-100 μg/ml) for 24h with or without simvastatin pre-treatment. The protein expressions of ER stress markers, glucose-regulated protein 78 (GRP78) and C/EBP homology protein (CHOP), were determined by Western blot analysis. The mRNA expressions of TNF-α and MCP-1 were measured by real-time PCR. The protein release of TNF-α and MCP-1 in culture medium were evaluated by ELISA. Ox-LDL treatment led to significant up-regulation of GRP78 and CHOP in dose-dependent manner. The expressions of TNF-α and MCP-1 were dose-dependently increased at mRNA and protein levels after ox-LDL intervention. The effects of ox-LDL on adipocytes were abolished by pre-treatment with 4-phenylbutyrate (4-PBA), a chemical chaperone known to ameliorate ER stress. Simvastatin could inhibit ox-LDL-induced ER stress and reduce the expression of TNF-α and MCP-1 at mRNA and protien level in dose dependent manner. In conclusion, ox-LDL can stimulate the expression and secretion of TNF-α and MCP-1 through its activation of ER stress in adipocytes. Simvastatin might exert direct anti-inflammatory effects in adipocytes through amelioration of ER stress.

  16. Involvement of endoplasmic reticulum stress in the necroptosis of microglia/macrophages after spinal cord injury.

    PubMed

    Fan, H; Tang, H-B; Kang, J; Shan, L; Song, H; Zhu, K; Wang, J; Ju, G; Wang, Y-Z

    2015-12-17

    Microglia/macrophages play a crucial role in inflammation after spinal cord injury (SCI). Although extensive studies have been performed on the mechanisms of microglia/macrophage activation and recruitment, how microglia/macrophages are eliminated remains unclear. In the present study, we observed a high-level expression of mixed lineage kinase domain-like protein (MLKL), a key molecule in the execution of necroptosis, in microglia/macrophages after SCI in mice. In vivo PI-labeling and Necrostatin-1 treatment confirmed the necroptosis of microglia/macrophages. Interestingly, our electronic microscopic (EM) study revealed that MLKL localized not only at the membrane but also on the endoplasmic reticulum (ER) of necroptotic microglia/macrophages. Furthermore, receptor-interacting protein 3 (RIP3), another necrosome component, was also found on the ER of necroptotic microglia/macrophages. And Glucose-regulated protein 78 (GRP78), an ER stress sensor, was up-regulated in MLKL-positive microglia/macrophages after SCI, suggesting a possible link between necroptosis and ER stress. In vitro, oxygen-glucose deprivation (OGD) stress induced ER stress and necroptosis in microglia. Inhibiting ER stress by 4-phenylbutyrate (4-PBA) significantly blocked the OGD-induced necroptosis of microglia. In the end, our data showed that, GRP78 and phosphorylated MLKL were co-expressed by the microglia/macrophages in the injured human spinal cord. Taken together, these results suggested that microglia/macrophages undergo an ER-stress involved necroptosis after SCI, implying that ER stress and necroptosis could be manipulated for modulating inflammation post-SCI.

  17. Immunomodulatory spherical nucleic acids.

    PubMed

    Radovic-Moreno, Aleksandar F; Chernyak, Natalia; Mader, Christopher C; Nallagatla, Subbarao; Kang, Richard S; Hao, Liangliang; Walker, David A; Halo, Tiffany L; Merkel, Timothy J; Rische, Clayton H; Anantatmula, Sagar; Burkhart, Merideth; Mirkin, Chad A; Gryaznov, Sergei M

    2015-03-31

    Immunomodulatory nucleic acids have extraordinary promise for treating disease, yet clinical progress has been limited by a lack of tools to safely increase activity in patients. Immunomodulatory nucleic acids act by agonizing or antagonizing endosomal toll-like receptors (TLR3, TLR7/8, and TLR9), proteins involved in innate immune signaling. Immunomodulatory spherical nucleic acids (SNAs) that stimulate (immunostimulatory, IS-SNA) or regulate (immunoregulatory, IR-SNA) immunity by engaging TLRs have been designed, synthesized, and characterized. Compared with free oligonucleotides, IS-SNAs exhibit up to 80-fold increases in potency, 700-fold higher antibody titers, 400-fold higher cellular responses to a model antigen, and improved treatment of mice with lymphomas. IR-SNAs exhibit up to eightfold increases in potency and 30% greater reduction in fibrosis score in mice with nonalcoholic steatohepatitis (NASH). Given the clinical potential of SNAs due to their potency, defined chemical nature, and good tolerability, SNAs are attractive new modalities for developing immunotherapies.

  18. Acid rain in Asia

    SciTech Connect

    Bhatti, N.; Streets, D.G. ); Foell, W.K. )

    1991-01-01

    Acid rain has been an issue of widespread concern in North America and Europe for more than fifteen years. However, there is an emerging feeling that the problem in Europe and North America is nearing solution, largely as a result of existing and newly enacted legislation, decreased energy use due to conservation and efficiency improvements, and/or trends in energy policy away from fossil fuels. The situation in Asia appears much bleaker. Fossil fuels are already used in large quantities, such that local air pollution is becoming a serious problem and high deposition levels are being measured. Emission regulations in most countries (with the notable exception of Japan) are not very stringent. Energy plans in many countries (particularly PRC, India, Thailand, and South Korea) call for very large increases in coal combustion in the future. Finally, there is not presently a strong scientific or public constituency for action to mitigate the potential effects of acid deposition. These factors imply potentially serious problems in the future for long-range transport and deposition of sulfur and nitrogen species and consequent damage to ecosystems and materials. The political ramifications of transboundary environmental pollution in this region are also potentially serious. The purpose of this paper is to provide background information on the acid deposition situation in Asia, with the intention of laying the foundation for the development of a possible research program for this region. 36 refs., 8 figs., 8 tabs.

  19. Immunomodulatory spherical nucleic acids

    PubMed Central

    Radovic-Moreno, Aleksandar F.; Chernyak, Natalia; Mader, Christopher C.; Nallagatla, Subbarao; Kang, Richard S.; Hao, Liangliang; Walker, David A.; Halo, Tiffany L.; Merkel, Timothy J.; Rische, Clayton H.; Anantatmula, Sagar; Burkhart, Merideth; Mirkin, Chad A.; Gryaznov, Sergei M.

    2015-01-01

    Immunomodulatory nucleic acids have extraordinary promise for treating disease, yet clinical progress has been limited by a lack of tools to safely increase activity in patients. Immunomodulatory nucleic acids act by agonizing or antagonizing endosomal toll-like receptors (TLR3, TLR7/8, and TLR9), proteins involved in innate immune signaling. Immunomodulatory spherical nucleic acids (SNAs) that stimulate (immunostimulatory, IS-SNA) or regulate (immunoregulatory, IR-SNA) immunity by engaging TLRs have been designed, synthesized, and characterized. Compared with free oligonucleotides, IS-SNAs exhibit up to 80-fold increases in potency, 700-fold higher antibody titers, 400-fold higher cellular responses to a model antigen, and improved treatment of mice with lymphomas. IR-SNAs exhibit up to eightfold increases in potency and 30% greater reduction in fibrosis score in mice with nonalcoholic steatohepatitis (NASH). Given the clinical potential of SNAs due to their potency, defined chemical nature, and good tolerability, SNAs are attractive new modalities for developing immunotherapies. PMID:25775582

  20. Perfluorooctanoic acid and environmental risks

    EPA Science Inventory

    Perfluorooctanoic acid (PFOA) is a member of the perfluoroalkyl acids (PFAA) family of chemicals, which consist of a carbon backbone typically four to fourteen carbons in length and a charged functional moiety.

  1. Folic Acid Questions and Answers

    MedlinePlus

    ... swallow large pills. How can I take a vitamin with folic acid? A : These days, multivitamins with folic acid come in chewable chocolate or fruit flavors, liquids, and large oval or smaller round ...

  2. Omega-3 fatty acids (image)

    MedlinePlus

    Omega-3 fatty acids are a form of polyunsaturated fat that the body derives from food. Omega-3s (and omega-6s) are known as essential fatty acids (EFAs) because they are important for good health. ...

  3. Acid rain: Reign of controversy

    SciTech Connect

    Kahan, A.M.

    1986-01-01

    Acid Rain is a primer on the science and politics of acid rain. Several introductory chapters describe in simple terms the relevant principles of water chemistry, soil chemistry, and plant physiology and discuss the demonstrated or postulated effects of acid rain on fresh waters and forests as well as on statuary and other exposed objects. There follow discussions on the economic and social implications of acid rain (for example, possible health effects) and on the sources, transport, and distribution of air pollutants.

  4. Sedimentation of sulfuric acid in acid tars from current production

    SciTech Connect

    Denisova, T.L.; Frolov, A.F.; Aminov, A.N.; Novosel'tsev, S.P.

    1987-09-01

    Acid tars obtained in treating T-750, KhF-12, and I-8A oils were investigated for purposes of recovering sulfuric acid and asphalt binders from the compositions and of determining the effects of storage time on the recovery. The consumption and sedimentation levels of sulfuric acid during storage for different periods and at different temperatures were assessed. The characteristics of an asphalt binder obtained by neutralizing acid tar with a paste consisting of asphalts from deasphalting operations and slaked lime, followed by oxidation of the mixture with atmospheric air, were determined. The sulfuric acid recovered in the settling process could be burned in order to purify it of organic contaminants.

  5. Sequential injection redox or acid-base titration for determination of ascorbic acid or acetic acid.

    PubMed

    Lenghor, Narong; Jakmunee, Jaroon; Vilen, Michael; Sara, Rolf; Christian, Gary D; Grudpan, Kate

    2002-12-01

    Two sequential injection titration systems with spectrophotometric detection have been developed. The first system for determination of ascorbic acid was based on redox reaction between ascorbic acid and permanganate in an acidic medium and lead to a decrease in color intensity of permanganate, monitored at 525 nm. A linear dependence of peak area obtained with ascorbic acid concentration up to 1200 mg l(-1) was achieved. The relative standard deviation for 11 replicate determinations of 400 mg l(-1) ascorbic acid was 2.9%. The second system, for acetic acid determination, was based on acid-base titration of acetic acid with sodium hydroxide using phenolphthalein as an indicator. The decrease in color intensity of the indicator was proportional to the acid content. A linear calibration graph in the range of 2-8% w v(-1) of acetic acid with a relative standard deviation of 4.8% (5.0% w v(-1) acetic acid, n=11) was obtained. Sample throughputs of 60 h(-1) were achieved for both systems. The systems were successfully applied for the assays of ascorbic acid in vitamin C tablets and acetic acid content in vinegars, respectively.

  6. Nervonic acid and demyelinating disease.

    PubMed

    Sargent, J R; Coupland, K; Wilson, R

    1994-04-01

    Demyelination in adrenoleukodystrophy (ALD) is associated with an accumulation of very long chain saturated fatty acids such as 26:0 stemming from a genetic defect in the peroxisomal beta oxidation system responsible for the chain shortening of these fatty acids. Long chain monoenoic acids such as erucic acid, 22:1(n-9), can normalise elevated serum levels of 26:0 in ALD by depressing their biosynthesis from shorter chain saturated fatty acids. Sphingolipids from post mortem ALD brain have decreased levels of nervonic acid, 24:1(n-9), and increased levels of stearic acid, 18:0. Increased levels of 26:0 are accompanied by decreased nervonic acid biosynthesis in skin fibroblasts from ALD patients. Sphingolipids from post mortem MS brain have the same decreased 24:1(n-9) and increased 18:0 seen in post mortem ALD brain. The 24:1(n-9) content of sphingomyelin is depressed in erythrocytes from multiple sclerosis (MS) patients. Defects in the microsomal biosynthesis of very long chain fatty acids including 24:1(n-9) in 'jumpy' and 'quaking' mice are accompanied by impaired myelination. An impairment in the provision of nervonic acid in demyelinating diseases is indicated, suggesting that dietary therapy with oils rich in very long chain monenoic acid fatty acids may be beneficial in such conditions.

  7. Pantothenic acid biosynthesis in zymomonas

    SciTech Connect

    Tao, Luan; Tomb, Jean-Francois; Viitanen, Paul V.

    2014-07-01

    Zymomonas is unable to synthesize pantothenic acid and requires this essential vitamin in growth medium. Zymomonas strains transformed with an operon for expression of 2-dehydropantoate reductase and aspartate 1-decarboxylase were able to grow in medium lacking pantothenic acid. These strains may be used for ethanol production without pantothenic acid supplementation in seed culture and fermentation media.

  8. An Umbrella for Acid Rain.

    ERIC Educational Resources Information Center

    Randal, Judith

    1979-01-01

    The Environmental Protection Agency has awarded several grants to study effects of and possible solutions to the problem of "acid rain"; pollution from atmospheric nitric and sulfuric acids. The research program is administered through North Carolina State University at Raleigh and will focus on biological effects of acid rain. (JMF)

  9. Carboxylic acid sorption regeneration process

    DOEpatents

    King, C.J.; Poole, L.J.

    1995-05-02

    Carboxylic acids are sorbed from aqueous feedstocks into an organic liquid phase or onto a solid adsorbent. The acids are freed from the sorbent phase by treating it with aqueous alkylamine thus forming an alkylammonium carboxylate which is dewatered and decomposed to the desired carboxylic acid and the alkylamine. 10 figs.

  10. Carboxylic acid sorption regeneration process

    DOEpatents

    King, C. Judson; Poole, Loree J.

    1995-01-01

    Carboxylic acids are sorbed from aqueous feedstocks into an organic liquid phase or onto a solid adsorbent. The acids are freed from the sorbent phase by treating it with aqueous alkylamine thus forming an alkylammonium carboxylate which is dewatered and decomposed to the desired carboxylic acid and the alkylamine.

  11. Heterogeneous uptake of amines by citric acid and humic acid.

    PubMed

    Liu, Yongchun; Ma, Qingxin; He, Hong

    2012-10-16

    Heterogeneous uptake of methylamine (MA), dimethylamine (DMA), and trimethylamine (TMA) onto citric acid and humic acid was investigated using a Knudsen cell reactor coupled to a quadrupole mass spectrometer at 298 K. Acid-base reactions between amines and carboxylic acids were confirmed. The observed uptake coefficients of MA, DMA, and TMA on citric acid at 298 K were measured to be 7.31 ± 1.13 × 10(-3), 6.65 ± 0.49 × 10(-3), and 5.82 ± 0.68 × 10(-3), respectively, and showed independence of sample mass. The observed uptake coefficients of MA, DMA, and TMA on humic acid at 298 K increased linearly with sample mass, and the true uptake coefficients of MA, DMA, and TMA were measured to be 1.26 ± 0.07 × 10(-5), 7.33 ± 0.40 × 10(-6), and 4.75 ± 0.15 × 10(-6), respectively. Citric acid, having stronger acidity, showed a higher reactivity than humic acid for a given amine; while the steric effect of amines was found to govern the reactivity between amines and citric acid or humic acid.

  12. Composition for nucleic acid sequencing

    SciTech Connect

    Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

    2008-08-26

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  13. Evolution of rosmarinic acid biosynthesis.

    PubMed

    Petersen, Maike; Abdullah, Yana; Benner, Johannes; Eberle, David; Gehlen, Katja; Hücherig, Stephanie; Janiak, Verena; Kim, Kyung Hee; Sander, Marion; Weitzel, Corinna; Wolters, Stefan

    2009-01-01

    Rosmarinic acid and chlorogenic acid are caffeic acid esters widely found in the plant kingdom and presumably accumulated as defense compounds. In a survey, more than 240 plant species have been screened for the presence of rosmarinic and chlorogenic acids. Several rosmarinic acid-containing species have been detected. The rosmarinic acid accumulation in species of the Marantaceae has not been known before. Rosmarinic acid is found in hornworts, in the fern family Blechnaceae and in species of several orders of mono- and dicotyledonous angiosperms. The biosyntheses of caffeoylshikimate, chlorogenic acid and rosmarinic acid use 4-coumaroyl-CoA from the general phenylpropanoid pathway as hydroxycinnamoyl donor. The hydroxycinnamoyl acceptor substrate comes from the shikimate pathway: shikimic acid, quinic acid and hydroxyphenyllactic acid derived from l-tyrosine. Similar steps are involved in the biosyntheses of rosmarinic, chlorogenic and caffeoylshikimic acids: the transfer of the 4-coumaroyl moiety to an acceptor molecule by a hydroxycinnamoyltransferase from the BAHD acyltransferase family and the meta-hydroxylation of the 4-coumaroyl moiety in the ester by a cytochrome P450 monooxygenase from the CYP98A family. The hydroxycinnamoyltransferases as well as the meta-hydroxylases show high sequence similarities and thus seem to be closely related. The hydroxycinnamoyltransferase and CYP98A14 from Coleus blumei (Lamiaceae) are nevertheless specific for substrates involved in RA biosynthesis showing an evolutionary diversification in phenolic ester metabolism. Our current view is that only a few enzymes had to be "invented" for rosmarinic acid biosynthesis probably on the basis of genes needed for the formation of chlorogenic and caffeoylshikimic acid while further biosynthetic steps might have been recruited from phenylpropanoid metabolism, tocopherol/plastoquinone biosynthesis and photorespiration. PMID:19560175

  14. Evolution of rosmarinic acid biosynthesis.

    PubMed

    Petersen, Maike; Abdullah, Yana; Benner, Johannes; Eberle, David; Gehlen, Katja; Hücherig, Stephanie; Janiak, Verena; Kim, Kyung Hee; Sander, Marion; Weitzel, Corinna; Wolters, Stefan

    2009-01-01

    Rosmarinic acid and chlorogenic acid are caffeic acid esters widely found in the plant kingdom and presumably accumulated as defense compounds. In a survey, more than 240 plant species have been screened for the presence of rosmarinic and chlorogenic acids. Several rosmarinic acid-containing species have been detected. The rosmarinic acid accumulation in species of the Marantaceae has not been known before. Rosmarinic acid is found in hornworts, in the fern family Blechnaceae and in species of several orders of mono- and dicotyledonous angiosperms. The biosyntheses of caffeoylshikimate, chlorogenic acid and rosmarinic acid use 4-coumaroyl-CoA from the general phenylpropanoid pathway as hydroxycinnamoyl donor. The hydroxycinnamoyl acceptor substrate comes from the shikimate pathway: shikimic acid, quinic acid and hydroxyphenyllactic acid derived from l-tyrosine. Similar steps are involved in the biosyntheses of rosmarinic, chlorogenic and caffeoylshikimic acids: the transfer of the 4-coumaroyl moiety to an acceptor molecule by a hydroxycinnamoyltransferase from the BAHD acyltransferase family and the meta-hydroxylation of the 4-coumaroyl moiety in the ester by a cytochrome P450 monooxygenase from the CYP98A family. The hydroxycinnamoyltransferases as well as the meta-hydroxylases show high sequence similarities and thus seem to be closely related. The hydroxycinnamoyltransferase and CYP98A14 from Coleus blumei (Lamiaceae) are nevertheless specific for substrates involved in RA biosynthesis showing an evolutionary diversification in phenolic ester metabolism. Our current view is that only a few enzymes had to be "invented" for rosmarinic acid biosynthesis probably on the basis of genes needed for the formation of chlorogenic and caffeoylshikimic acid while further biosynthetic steps might have been recruited from phenylpropanoid metabolism, tocopherol/plastoquinone biosynthesis and photorespiration.

  15. Efficient Activation of Pathogenic ΔPhe501 Mutation in Monocarboxylate Transporter 8 by Chemical and Pharmacological Chaperones.

    PubMed

    Braun, Doreen; Schweizer, Ulrich

    2015-12-01

    Monocarboxylate transporter 8 (MCT8) is a thyroid hormone transmembrane transporter expressed in many cell types, including neurons. Mutations that inactivate transport activity of MCT8 cause severe X-linked psychomotor retardation in male patients, a syndrome originally described as the Allan-Herndon-Dudley syndrome. Treatment options currently explored the focus on finding thyroid hormone-like compounds that bypass MCT8 and enter cells through different transporters. Because MCT8 is a multipass transmembrane protein, some pathogenic mutations affect membrane trafficking while potentially retaining some transporter activity. We explore here the effects of chemical and pharmacological chaperones on the expression and transport activity of the MCT8 mutant ΔPhe501. Dimethylsulfoxide, 4-phenylbutyric acid as well as its sodium salt, and the isoflavone genistein increase T3 uptake into MDCK1 cells stably transfected with mutant MCT8-ΔPhe501. We show that ΔPhe501 represents a temperature-sensitive mutant protein that is stabilized by the proteasome inhibitor MG132. 4-Phenylbutyrate has been used to stabilize ΔPhe508 mutant cystic fibrosis transmembrane conductance regulator protein and is in clinical use in patients with urea cycle defects. Genistein is enriched in soy and available as a nutritional supplement. It is effective in stabilizing MCT8-ΔPhe501 at 100 nM concentration. Expression of the L471P mutant is increased in response to phenylbutyrate, but T3 uptake activity is not induced, supporting the notion that the chaperone specifically increases membrane expression. Our findings suggest that certain pathogenic MCT8 mutants may be responsive to (co-)treatment with readily available compounds, which increase endogenous protein function. PMID:26368820

  16. Activation of autophagy by unfolded proteins during endoplasmic reticulum stress.

    PubMed

    Yang, Xiaochen; Srivastava, Renu; Howell, Stephen H; Bassham, Diane C

    2016-01-01

    Endoplasmic reticulum stress is defined as the accumulation of unfolded proteins in the endoplasmic reticulum, and is caused by conditions such as heat or agents that cause endoplasmic reticulum stress, including tunicamycin and dithiothreitol. Autophagy, a major pathway for degradation of macromolecules in the vacuole, is activated by these stress agents in a manner dependent on inositol-requiring enzyme 1b (IRE1b), and delivers endoplasmic reticulum fragments to the vacuole for degradation. In this study, we examined the mechanism for activation of autophagy during endoplasmic reticulum stress in Arabidopsis thaliana. The chemical chaperones sodium 4-phenylbutyrate and tauroursodeoxycholic acid were found to reduce tunicamycin- or dithiothreitol-induced autophagy, but not autophagy caused by unrelated stresses. Similarly, over-expression of BINDING IMMUNOGLOBULIN PROTEIN (BIP), encoding a heat shock protein 70 (HSP70) molecular chaperone, reduced autophagy. Autophagy activated by heat stress was also found to be partially dependent on IRE1b and to be inhibited by sodium 4-phenylbutyrate, suggesting that heat-induced autophagy is due to accumulation of unfolded proteins in the endoplasmic reticulum. Expression in Arabidopsis of the misfolded protein mimics zeolin or a mutated form of carboxypeptidase Y (CPY*) also induced autophagy in an IRE1b-dependent manner. Moreover, zeolin and CPY* partially co-localized with the autophagic body marker GFP-ATG8e, indicating delivery to the vacuole by autophagy. We conclude that accumulation of unfolded proteins in the endoplasmic reticulum is a trigger for autophagy under conditions that cause endoplasmic reticulum stress. PMID:26616142

  17. Microbial transformations of isocupressic acid.

    PubMed

    Lin, S J; Rosazza, J P

    1998-07-01

    Microbial transformations of the labdane-diterpene isocupressic acid (1) with different microorganisms yielded several oxygenated metabolites that were isolated and characterized by MS and NMR spectroscopic analyses. Nocardia aurantia (ATCC 12674) catalyzed the cleavage of the 13,14-double bond to yield a new nor-labdane metabolite, 2. Cunninghamella elegans (-) (NRRL 1393) gave 7beta-hydroxyisocupressic acid (3) and labda-7,13(E)-diene-6beta,15, 17-triol-19-oic acid (4), and Mucor mucedo (ATCC 20094) gave 2alpha-hydroxyisocupressic acid (5) and labda-8(17),14-diene-2alpha, 13-diol-19-oic acid (6).

  18. Invasive cleavage of nucleic acids

    DOEpatents

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann D.; Dahlberg, James E.

    2002-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  19. Invasive cleavage of nucleic acids

    DOEpatents

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann D.; Dahlberg, James E.

    1999-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  20. The politics of acid rain

    SciTech Connect

    Wilcher, M.E. )

    1989-01-01

    This work examines and compares the acid rain policies through the different political systems of Canada, Great Britain and the United States. Because the flow of acid rain can transcend national boundaries, acid rain has become a crucial international problem. According to the author, because of differences in governmental institutions and structure, the extent of governmental intervention in the industrial economy, the degree of reliance on coal for power generation, and the extent of acid rain damage, national responses to the acid rain problem have varied.

  1. [A catalogue of fatty acids].

    PubMed

    Canalejo, E; Martín Peña, G; Gómez Molero, L; Ruiz Galiana, J

    1996-01-01

    Fatty acids structure and function is an area of renewed interest because of its effects on plasma lipids, biosynthesis of prostaglandins, leucotrienes and thromboxanes, and the obligatory demands of some fatty acids, especially for the newborn. Fatty acids are identified in three different ways: by the classical nomenclature, by its trivial name, and by the new methods also known as the omega system. These three different methods have created some confusion. The aim of this article is to revise fatty acids chemical structure and to compile a list of nutritional important fatty acids with the three different terminologies.

  2. Tested Demonstrations: Color Oscillations in the Formic Acid-Nitric Acid-Sulfuric Acid System.

    ERIC Educational Resources Information Center

    Raw, C. J. G.; And Others

    1983-01-01

    Presented are procedures for demonstrating the production of color oscillations when nitric acid is added to a formic acid/concentrated sulfuric acid mixture. Because of safety considerations, "Super-8" home movie of the color changes was found to be satisfactory for demonstration purposes. (JN)

  3. Twinning of dodecanedicarboxylic acid

    NASA Technical Reports Server (NTRS)

    Sen, R.; Wilcox, W. R.

    1986-01-01

    Twinning of 1,10-dodecanedicarboxyl acid (DDA) was observed in 0.1 mm thick films with a polarizing microscope. Twins originated from polycrystalline regions which tended to nucleate on twin faces, and terminated by intersection gone another. Twinning increased dramatically with addition of organic compounds with a similar molecular size and shape. Increasing the freezing rate, increasing the temperature gradient, and addition of silica particles increased twinning. It is proposed that twins nucleate with polycrystals and sometimes anneal out before they become observable. The impurities may enhance twinning either by lowering the twin energy or by adsorbing on growing faces.

  4. Mycophenolic Acid in Silage

    PubMed Central

    Schneweis, Isabell; Meyer, Karsten; Hörmansdorfer, Stefan; Bauer, Johann

    2000-01-01

    We examined 233 silage samples and found that molds were present in 206 samples with counts between 1 × 103 and 8.9 × 107 (mean, 4.7 × 106) CFU/g. Mycophenolic acid, a metabolite of Penicillium roqueforti, was detected by liquid chromatography-mass spectrometry in 74 (32%) of these samples at levels ranging from 20 to 35,000 (mean, 1,400) μg/kg. This compound has well-known immunosuppressive properties, so feeding with contaminated silage may promote the development of infectious diseases in livestock. PMID:10919834

  5. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  6. Beyond acid rain

    SciTech Connect

    Gaffney, J.S.; Streit, G.E.; Spall, W.D.; Hall, J.H.

    1987-06-01

    This paper discussed the effects of the interactions of soluble oxidants and organic toxins with sulfur dioxide and nitrogen dioxide. It suggested that these chemical reactions in the atmosphere produced a more potent acid rain which was harmful not only because it had a low pH but because it contained oxidants and organic toxins which were harmful to surface vegetation and the organisms found in surface waters. It was stressed that air pollution is a global problem and that is is necessary to develop a better fundamental understanding of how air pollution is causing damage to the streams and forests of the world. 50 references.

  7. Interstellar isothiocyanic acid

    NASA Technical Reports Server (NTRS)

    Frerking, M. A.; Linke, R. A.; Thaddeus, P.

    1979-01-01

    Isothiocyanic acid (HNCS) has been identified in Sgr B2 from millimeter-wave spectral line observations. We have definitely detected three rotational lines, and have probably detected two others. The rotational temperature of HNCS in Sgr B2 is 14 plus or minus 5 K, its column density is 2.5 plus or minus 1.0 x 10 to the 13th per sq cm, and its abundance relative to HNCO is consistent with the cosmic S/O ratio, 1/42.

  8. 20-hydroxyeicosatetraenoic acid and epoxyeicosatrienoic acids and blood pressure.

    PubMed

    McGiff, J C; Quilley, J

    2001-03-01

    The properties of 20-hydroxyeicosatetraenoic acid and epoxyeicosatrienoic acids, vasoactivity and modulation of ion transport and mediation/modulation of the effects of vasoactive hormones, such as angiotensin II and endothelin, underscore their importance to renal vascular mechanisms and electrolyte excretion. 20-Hydroxyeicosatetraenoic acid is an integral component of renal autoregulation and tubuloglomerular feedback as well as cerebral autoregulation, eliciting vasoconstriction by the inhibition of potassium channels. Nitric oxide inhibits 20-hydroxyeicosatetraenoic acid formation, the removal of which contributes to the vasodilator effect of nitric oxide. In contrast, epoxyeicosatrienoic acids are generally vasodilatory by activating potassium channels and have been proposed as endothelium-derived hyperpolarizing factors. 20-Hydroxyeicosatetraenoic acid modulates ion transport in key nephron segments by influencing the activities of sodium--potassium-ATPase and the sodium--potassium--chloride co-transporter; however, the primacy of the various arachidonate oxygenases that generate products affecting these activities changes with age. The range and diversity of activity of 20-hydroxyeicosatetraenoic acid is influenced by its metabolism by cyclooxygenase to products affecting vasomotion and salt/water excretion. 20-Hydroxyeicosatetraenoic acid is the principal renal eicosanoid that interacts with several hormonal systems that are central to blood pressure regulation. This article reviews the most recent studies that address 20-hydroxyeicosatetraenoic acid and epoxyeicosatrienoic acids in vascular and renal tubular function and hypertension.

  9. Vibrational structure of the polyunsaturated fatty acids eicosapentaenoic acid and arachidonic acid studied by infrared spectroscopy

    NASA Astrophysics Data System (ADS)

    Kiefer, Johannes; Noack, Kristina; Bartelmess, Juergen; Walter, Christian; Dörnenburg, Heike; Leipertz, Alfred

    2010-02-01

    The spectroscopic discrimination of the two structurally similar polyunsaturated C 20 fatty acids (PUFAs) 5,8,11,14,17-eicosapentaenoic acid and 5,8,11,14-eicosatetraenoic acid (arachidonic acid) is shown. For this purpose their vibrational structures are studied by means of attenuated total reflection (ATR) Fourier-transform infrared (FT-IR) spectroscopy. The fingerprint regions of the recorded spectra are found to be almost identical, while the C-H stretching mode regions around 3000 cm -1 show such significant differences as results of electronic and molecular structure alterations based on the different degree of saturation that both fatty acids can be clearly distinguished from each other.

  10. Nucleic acid detection methods

    DOEpatents

    Smith, C.L.; Yaar, R.; Szafranski, P.; Cantor, C.R.

    1998-05-19

    The invention relates to methods for rapidly determining the sequence and/or length a target sequence. The target sequence may be a series of known or unknown repeat sequences which are hybridized to an array of probes. The hybridized array is digested with a single-strand nuclease and free 3{prime}-hydroxyl groups extended with a nucleic acid polymerase. Nuclease cleaved heteroduplexes can be easily distinguish from nuclease uncleaved heteroduplexes by differential labeling. Probes and target can be differentially labeled with detectable labels. Matched target can be detected by cleaving resulting loops from the hybridized target and creating free 3-hydroxyl groups. These groups are recognized and extended by polymerases added into the reaction system which also adds or releases one label into solution. Analysis of the resulting products using either solid phase or solution. These methods can be used to detect characteristic nucleic acid sequences, to determine target sequence and to screen for genetic defects and disorders. Assays can be conducted on solid surfaces allowing for multiple reactions to be conducted in parallel and, if desired, automated. 18 figs.

  11. Nucleic Acid Detection Methods

    DOEpatents

    Smith, Cassandra L.; Yaar, Ron; Szafranski, Przemyslaw; Cantor, Charles R.

    1998-05-19

    The invention relates to methods for rapidly determining the sequence and/or length a target sequence. The target sequence may be a series of known or unknown repeat sequences which are hybridized to an array of probes. The hybridized array is digested with a single-strand nuclease and free 3'-hydroxyl groups extended with a nucleic acid polymerase. Nuclease cleaved heteroduplexes can be easily distinguish from nuclease uncleaved heteroduplexes by differential labeling. Probes and target can be differentially labeled with detectable labels. Matched target can be detected by cleaving resulting loops from the hybridized target and creating free 3-hydroxyl groups. These groups are recognized and extended by polymerases added into the reaction system which also adds or releases one label into solution. Analysis of the resulting products using either solid phase or solution. These methods can be used to detect characteristic nucleic acid sequences, to determine target sequence and to screen for genetic defects and disorders. Assays can be conducted on solid surfaces allowing for multiple reactions to be conducted in parallel and, if desired, automated.

  12. Cryoprotection from lipoteichoic acid

    NASA Astrophysics Data System (ADS)

    Rice, Charles V.; Middaugh, Amy; Wickham, Jason R.; Friedline, Anthony; Thomas, Kieth J.; Johnson, Karen; Zachariah, Malcolm; Garimella, Ravindranth

    2012-10-01

    Numerous chemical additives lower the freezing point of water, but life at sub-zero temperatures is sustained by a limited number of biological cryoprotectants. Antifreeze proteins in fish, plants, and insects provide protection to a few degrees below freezing. Microbes have been found to survive at even lower temperatures, and with a few exceptions, antifreeze proteins are missing. Survival has been attributed to external factors, such as the high salt concentration of brine veins and adhesion to particulates or ice crystal defects. We have discovered an endogenous cryoprotectant in the cell wall of bacteria, lipoteichoic acid biopolymers. Adding 1% LTA to bacteria cultures immediately prior to freezing provides 50% survival rate, similar to the results obtained with 1% glycerol. In the absence of an additive, bacterial survival is negligible as measured with the resazurin cell viability assay. The mode of action for LTA cryoprotection is unknown. With a molecular weight of 3-5 kDa, it is unlikely to enter the cell cytoplasm. Our observations suggest that teichoic acids could provide a shell of liquid water around biofilms and planktonic bacteria, removing the need for brine veins to prevent bacterial freezing.

  13. Bicyclic glutamic acid derivatives.

    PubMed

    Meyer, Udo; Bisel, Philippe; Weckert, Edgar; Frahm, August Wilhelm

    2006-05-15

    For the second-generation asymmetric synthesis of the trans-tris(homoglutamic) acids via Strecker reaction of chiral ketimines, the cyanide addition as the key stereodifferentiating step produces mixtures of diastereomeric alpha-amino nitrile esters the composition of which is independent of the reaction temperature and the type of the solvent, respectively. The subsequent hydrolysis is exclusively achieved with concentrated H(2)SO(4) yielding diastereomeric mixtures of three secondary alpha-amino alpha-carbamoyl-gamma-esters and two diastereomeric cis-fused angular alpha-carbamoyl gamma-lactams as bicyclic glutamic acid derivatives, gained from in situ stereomer differentiating cyclisation of the secondary cis-alpha-amino alpha-carbamoyl-gamma-esters. Separation was achieved by CC. The pure secondary trans-alpha-amino alpha-carbamoyl-gamma-esters cyclise on heating and treatment with concentrated H(2)SO(4), respectively, to diastereomeric cis-fused angular secondary alpha-amino imides. Their hydrogenolysis led to the enantiomeric cis-fused angular primary alpha-amino imides. The configuration of all compounds was completely established by NMR methods, CD-spectra, and by X-ray analyses of the (alphaR,1R,5R)-1-carbamoyl-2-(1-phenylethyl)-2-azabicyclo[3.3.0]octan-3-one and of the trans-alphaS,1S,2R-2-ethoxycarbonylmethyl-1-(1-phenylethylamino)cyclopentanecarboxamide. PMID:16596563

  14. Ribonucleic acid purification.

    PubMed

    Martins, R; Queiroz, J A; Sousa, F

    2014-08-15

    Research on RNA has led to many important biological discoveries and improvement of therapeutic technologies. From basic to applied research, many procedures employ pure and intact RNA molecules; however their isolation and purification are critical steps because of the easy degradability of RNA, which can impair chemical stability and biological functionality. The current techniques to isolate and purify RNA molecules still have several limitations and the requirement for new methods able to improve RNA quality to meet regulatory demands is growing. In fact, as basic research improves the understanding of biological roles of RNAs, the biopharmaceutical industry starts to focus on them as a biotherapeutic tools. Chromatographic bioseparation is a high selective unit operation and is the major option in the purification of biological compounds, requiring high purity degree. In addition, its application in biopharmaceutical manufacturing is well established. This paper discusses the importance and the progress of RNA isolation and purification, considering RNA applicability both in research and clinical fields. In particular and in view of the high specificity, affinity chromatography has been recently applied to RNA purification processes. Accordingly, recent chromatographic investigations based on biorecognition phenomena occurring between RNA and amino acids are focused. Histidine and arginine have been used as amino acid ligands, and their ability to isolate different RNA species demonstrated a multipurpose applicability in molecular biology analysis and RNA therapeutics preparation, highlighting the potential contribution of these methods to overcome the challenges of RNA purification. PMID:24951289

  15. Titration of phosphonic acid derivatives in mixtures.

    PubMed

    Wittmann, Z

    1980-01-01

    An analytical procedure is described for the determination of the weak acids phosphonomethyliminodiacetic acid and phosphonomethyliminoacetic acid in their mixtures, and the dissociation constants of phosphonomethyliminoacetic acid are reported.

  16. Growth of nitric acid hydrates on thin sulfuric acid films

    NASA Technical Reports Server (NTRS)

    Iraci, Laura T.; Middlebrook, Ann M.; Wilson, Margaret A.; Tolbert, Margaret A.

    1994-01-01

    Type I polar stratospheric clouds (PSCs) are thought to nucleate and grow on stratospheric sulfate aerosols (SSAs). To model this system, thin sulfuric acid films were exposed to water and nitric acid vapors (1-3 x 10(exp -4) Torr H2O and 1-2.5 x 10(exp -6) Torr HNO3) and subjected to cooling and heating cycles. Fourier Transform Infrared (FTIR) spectroscopy was used to probe the phase of the sulfuric acid and to identify the HNO3/H2O films that condensed. Nitric acid trihydrate (NAT) was observed to grow on crystalline sulfuric acid tetrahydrate (SAT) films. NAT also condensed in/on supercooled H2SO4 films without causing crystallization of the sulfuric acid. This growth is consistent with NAT nucleation from ternary solutions as the first step in PSC formation.

  17. Determination of benzoic acid, chlorobenzoic acids and chlorendic acid in water

    SciTech Connect

    Dietz, E.A.; Cortellucci, N.J.; Singley, K.F. )

    1993-01-01

    To characterize and conduct treatment studies of a landfill leachate an analysis procedure was required to determine concentrations of benzoic acid, the three isomers of chlorobenzoic acid and chlorendic acid. The title compounds were isolated from acidified (pH 1) water by extraction with methyl t-butyl ether. Analytes were concentrated by back-extracting the ether with 0.1 N sodium hydroxide which was separated and acidified. This solution was analyzed by C[sub 18] reversed-phase HPLC with water/acetonitrile/acetic acid eluent and UV detection at 222 nm. The method has detection limits of 200 [mu]g/L for chlorendic acid and 100 [mu]g/L for benzoic acid and each isomer of chlorobenzoic acid. Validation studies with water which was fortified with the analytes at concentrations ranging from one to ten times detection limits resulted in average recoveries of >95%.

  18. Acid rain: Rhetoric and reality

    SciTech Connect

    Park, C.C.

    1987-01-01

    Acid rain is now one of the most serious environmental problems in developed countries. Emissions and fallout were previously extremely localized, but since the introduction of tall stacks policies in both Britain and the US - pardoxically to disperse particulate pollutants and hence reduce local damage - emissions are now lifted into the upper air currents and carried long distances downwind. The acid rain debate now embraces many western countries - including Canada, the US, England, Scotland, Wales, Sweden, Norway, Denmark, West Germany, the Netherlands, Austria, Switzerland - and a growing number of eastern countries - including the Soviet Union, Poland, East Germany, and Czechoslovakia. The problem of acid rain arises, strictly speaking, not so much from the rainfall itself as from its effects on the environment. Runoff affects surface water and groundwater, as well as soils and vegetation. Consequently changes in rainfall acidity can trigger off a range of impacts on the chemistry and ecology of lakes and rivers, soil chemistry and processes, the health and productivity of plants, and building materials, and metallic structures. The most suitable solutions to the problems of acid rain require prevention rather than cure, and there is broad agreement in both the political scientific communities on the need to reduce emissions of sulfur and nitrogen oxides to the atmosphere. Book divisions discuss: the problem of acid rain, the science of acid rain, the technology of acid rain, and the politics of acid rain, in an effort to evaluate this growing global problem of acid rain.

  19. Therapeutic targeting of bile acids

    PubMed Central

    Gores, Gregory J.

    2015-01-01

    The first objectives of this article are to review the structure, chemistry, and physiology of bile acids and the types of bile acid malabsorption observed in clinical practice. The second major theme addresses the classical or known properties of bile acids, such as the role of bile acid sequestration in the treatment of hyperlipidemia; the use of ursodeoxycholic acid in therapeutics, from traditional oriental medicine to being, until recently, the drug of choice in cholestatic liver diseases; and the potential for normalizing diverse bowel dysfunctions in irritable bowel syndrome, either by sequestering intraluminal bile acids for diarrhea or by delivering more bile acids to the colon to relieve constipation. The final objective addresses novel concepts and therapeutic opportunities such as the interaction of bile acids and the microbiome to control colonic infections, as in Clostridium difficile-associated colitis, and bile acid targeting of the farnesoid X receptor and G protein-coupled bile acid receptor 1 with consequent effects on energy expenditure, fat metabolism, and glycemic control. PMID:26138466

  20. Bile Acid Metabolism and Signaling

    PubMed Central

    Chiang, John Y. L.

    2015-01-01

    Bile acids are important physiological agents for intestinal nutrient absorption and biliary secretion of lipids, toxic metabolites, and xenobiotics. Bile acids also are signaling molecules and metabolic regulators that activate nuclear receptors and G protein-coupled receptor (GPCR) signaling to regulate hepatic lipid, glucose, and energy homeostasis and maintain metabolic homeostasis. Conversion of cholesterol to bile acids is critical for maintaining cholesterol homeostasis and preventing accumulation of cholesterol, triglycerides, and toxic metabolites, and injury in the liver and other organs. Enterohepatic circulation of bile acids from the liver to intestine and back to the liver plays a central role in nutrient absorption and distribution, and metabolic regulation and homeostasis. This physiological process is regulated by a complex membrane transport system in the liver and intestine regulated by nuclear receptors. Toxic bile acids may cause inflammation, apoptosis, and cell death. On the other hand, bile acid-activated nuclear and GPCR signaling protects against inflammation in liver, intestine, and macrophages. Disorders in bile acid metabolism cause cholestatic liver diseases, dyslipidemia, fatty liver diseases, cardiovascular diseases, and diabetes. Bile acids, bile acid derivatives, and bile acid sequestrants are therapeutic agents for treating chronic liver diseases, obesity, and diabetes in humans. PMID:23897684

  1. Bile acid interactions with cholangiocytes.

    PubMed

    Xia, Xuefeng; Francis, Heather; Glaser, Shannon; Alpini, Gianfranco; LeSage, Gene

    2006-06-14

    Cholangiocytes are exposed to high concentrations of bile acids at their apical membrane. A selective transporter for bile acids, the Apical Sodium Bile Acid Cotransporter (ASBT) (also referred to as Ibat; gene name Slc10a2) is localized on the cholangiocyte apical membrane. On the basolateral membrane, four transport systems have been identified (t-ASBT, multidrug resistance (MDR)3, an unidentified anion exchanger system and organic solute transporter (Ost) heteromeric transporter, Ostalpha-Ostbeta. Together, these transporters unidirectionally move bile acids from ductal bile to the circulation. Bile acids absorbed by cholangiocytes recycle via the peribiliary plexus back to hepatocytes for re-secretion into bile. This recycling of bile acids between hepatocytes and cholangiocytes is referred to as the cholehepatic shunt pathway. Recent studies suggest that the cholehepatic shunt pathway may contribute in overall hepatobiliary transport of bile acids and to the adaptation to chronic cholestasis due to extrahepatic obstruction. ASBT is acutely regulated by an adenosine 3', 5'-monophosphate (cAMP)-dependent translocation to the apical membrane and by phosphorylation-dependent ubiquitination and proteasome degradation. ASBT is chronically regulated by changes in gene expression in response to biliary bile acid concentration and inflammatory cytokines. Another potential function of cholangiocyte ASBT is to allow cholangiocytes to sample biliary bile acids in order to activate intracellular signaling pathways. Bile acids trigger changes in intracellular calcium, protein kinase C (PKC), phosphoinositide 3-kinase (PI3K), mitogen-activated protein (MAP) kinase and extracellular signal-regulated protein kinase (ERK) intracellular signals. Bile acids significantly alter cholangiocyte secretion, proliferation and survival. Different bile acids have differential effects on cholangiocyte intracellular signals, and in some instances trigger opposing effects on cholangiocyte

  2. Citric acid production patent review.

    PubMed

    Anastassiadis, Savas; Morgunov, Igor G; Kamzolova, Svetlana V; Finogenova, Tatiana V

    2008-01-01

    Current Review article summarizes the developments in citric acid production technologies in East and West last 100 years. Citric acid is commercially produced by large scale fermentation mostly using selected fungal or yeast strains in aerobe bioreactors and still remains one of the runners in industrial production of biotechnological bulk metabolites obtained by microbial fermentation since about 100 years, reflecting the historical development of modern biotechnology and fermentation process technology in East and West. Citric acid fermentation was first found as a fungal product in cultures of Penicillium glaucum on sugar medium by Wehmer in 1893. Citric acid is an important multifunctional organic acid with a broad range of versatile uses in household and industrial applications that has been produced industrially since the beginning of 20(th) century. There is a great worldwide demand for citric acid consumption due to its low toxicity, mainly being used as acidulant in pharmaceutical and food industries. Global citric acid production has reached 1.4 million tones, increasing annually at 3.5-4.0% in demand and consumption. Citric acid production by fungal submerged fermentation is still dominating, however new perspectives like solid-state processes or continuous yeast processes can be attractive for producers to stand in today's strong competition in industry. Further perspectives aiming in the improvement of citric acid production are the improvement of citric acid producing strains by classical and modern mutagenesis and selection as well as downstream processes. Many inexpensive by-products and residues of the agro-industry (e.g. molasses, glycerin etc.) can be economically utilized as substrates in the production of citric acid, especially in solid-state fermentation, enormously reducing production costs and minimizing environmental problems. Alternatively, continuous processes utilizing yeasts which reach 200-250 g/l citric acid can stand in today

  3. Bile acid interactions with cholangiocytes

    PubMed Central

    Xia, Xuefeng; Francis, Heather; Glaser, Shannon; Alpini, Gianfranco; LeSage, Gene

    2006-01-01

    Cholangiocytes are exposed to high concentrations of bile acids at their apical membrane. A selective transporter for bile acids, the Apical Sodium Bile Acid Cotransporter (ASBT) (also referred to as Ibat; gene name Slc10a2) is localized on the cholangiocyte apical membrane. On the basolateral membrane, four transport systems have been identified (t-ASBT, multidrug resistance (MDR)3, an unidentified anion exchanger system and organic solute transporter (Ost) heteromeric transporter, Ostα-Ostβ. Together, these transporters unidirectionally move bile acids from ductal bile to the circulation. Bile acids absorbed by cholangiocytes recycle via the peribiliary plexus back to hepatocytes for re-secretion into bile. This recycling of bile acids between hepatocytes and cholangiocytes is referred to as the cholehepatic shunt pathway. Recent studies suggest that the cholehepatic shunt pathway may contribute in overall hepatobiliary transport of bile acids and to the adaptation to chronic cholestasis due to extrahepatic obstruction. ASBT is acutely regulated by an adenosine 3', 5’-monophosphate (cAMP)-dependent translocation to the apical membrane and by phosphorylation-dependent ubiquitination and proteasome degradation. ASBT is chronically regulated by changes in gene expression in response to biliary bile acid concentration and inflammatory cytokines. Another potential function of cholangiocyte ASBT is to allow cholangiocytes to sample biliary bile acids in order to activate intracellular signaling pathways. Bile acids trigger changes in intracellular calcium, protein kinase C (PKC), phosphoinositide 3-kinase (PI3K), mitogen-activated protein (MAP) kinase and extracellular signal-regulated protein kinase (ERK) intracellular signals. Bile acids significantly alter cholangiocyte secretion, proliferation and survival. Different bile acids have differential effects on cholangiocyte intracellular signals, and in some instances trigger opposing effects on cholangiocyte

  4. Interactions of amino acids, carboxylic acids, and mineral acids with different quinoline derivatives

    NASA Astrophysics Data System (ADS)

    Kalita, Dipjyoti; Deka, Himangshu; Samanta, Shyam Sundar; Guchait, Subrata; Baruah, Jubaraj B.

    2011-03-01

    A series of quinoline containing receptors having amide and ester bonds are synthesized and characterised. The relative binding abilities of these receptors with various amino acids, carboxylic acids and mineral acids are determined by monitoring the changes in fluorescence intensity. Among the receptors bis(2-(quinolin-8-yloxy)ethyl) isophthalate shows fluorescence enhancement on addition of amino acids whereas the other receptors shows fluorescence quenching on addition of amino acids. The receptor N-(quinolin-8-yl)-2-(quinolin-8-yloxy) propanamide has higher binding affinity for amino acids. However, the receptor N-(quinolin-8-yl)-2-(quinolin-8-yloxy)acetamide having similar structure do not bind to amino acids. This is attributed to the concave structure of the former which is favoured due to the presence of methyl substituent. The receptor bis(2-(quinolin-8-yloxy)ethyl) isophthalate do not bind to hydroxy carboxylic acids, but is a good receptor for dicarboxylic acids. The crystal structure of bromide and perchlorate salts of receptor 2-bromo-N-(quinolin-8-yl)-propanamide are determined. In both the cases the amide groups are not in the plane of quinoline ring. The structure of N-(quinolin-8-yl)-2-(quinolin-8-yloxy)acetamide, N-(2-methoxyphenethyl)-2-(quinolin-8-yloxy)acetamide and their salts with maleic acid as well as fumaric acid are determined. It is observed that the solid state structures are governed by the double bond geometry of these two acid. Maleic acid forms salt in both the cases, whereas fumaric acid forms either salt or co-crystals.

  5. Acidity of Strong Acids in Water and Dimethyl Sulfoxide.

    PubMed

    Trummal, Aleksander; Lipping, Lauri; Kaljurand, Ivari; Koppel, Ilmar A; Leito, Ivo

    2016-05-26

    Careful analysis and comparison of the available acidity data of HCl, HBr, HI, HClO4, and CF3SO3H in water, dimethyl sulfoxide (DMSO), and gas-phase has been carried out. The data include experimental and computational pKa and gas-phase acidity data from the literature, as well as high-level computations using different approaches (including the W1 theory) carried out in this work. As a result of the analysis, for every acid in every medium, a recommended acidity value is presented. In some cases, the currently accepted pKa values were revised by more than 10 orders of magnitude. PMID:27115918

  6. Esterification by the Plasma Acidic Water: Novel Application of Plasma Acid

    NASA Astrophysics Data System (ADS)

    Gu, Ling

    2014-03-01

    This work explores the possibility of plasma acid as acid catalyst in organic reactions. Plasma acidic water was prepared by dielectric barrier discharge and used to catalyze esterification of n-heptanioc acid with ethanol. It is found that the plasma acidic water has a stable and better performance than sulfuric acid, meaning that it is an excellent acid catalyst. The plasma acidic water would be a promising alternative for classic mineral acid as a more environment friendly acid.

  7. 49 CFR 173.158 - Nitric acid.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 2 2012-10-01 2012-10-01 false Nitric acid. 173.158 Section 173.158... Nitric acid. (a) Nitric acid exceeding 40 percent concentration may not be packaged with any other material. (b) Nitric acid in any concentration which does not contain sulfuric acid or hydrochloric acid...

  8. Acid rain degradation of nylon

    SciTech Connect

    Kyllo, K.E.

    1984-01-01

    Acid rain, precipitation with a pH less than 5.6, is known to damage lakes, vegetation and buildings. Degradation of outdoor textiles by acid rain is strongly suspected but not well documented. This study reports the effects of sunlight, aqueous acid, heat and humidity (acid rain conditions) on spun delustered nylon 6,6 fabric. Untreated nylon and nylon treated with sulfuric acid of pH 2.0, 3.0, and 4.4 were exposed to light in an Atlas Xenon-arc fadeometer at 63/sup 0/C and 65% R.H. for up to 640 AATCC Fading Units. The untreated and acid treated nylon fabrics were also exposed to similar temperature and humidity condition without light. Nylon degradation was determined by changes in breaking strength, elongation, molecular weight, color, amino end group concentration (NH/sub 2/) and /sup 13/C NMR spectra. Physical damage was assessed using SEM.

  9. A Simpler Nucleic Acid

    NASA Technical Reports Server (NTRS)

    Orgel, Leslie

    2000-01-01

    It has been supposed that for a nucleic acid analog to pair with RNA it must, like RNA, have a backbone with at least a sixatom repeat; a shorter backbone presumably would not stretch far enough to bind RNA properly. The Eschenmoser group has shown, however, that this first impression is incorrect.As they report in their new paper, Eschenmoser and co-workers ( I ) have now synthesized a substantial number of these polymers, which are called (L)-a-threofuranosyl oligonucleotides or TNAs. They are composed of bases linked to a threose sugar-phosphate backbone, with phosphodiester bonds connecting the nucleotides. The investigators discovered that pairs of complementary TNAs do indeed form stable Watson-Crick double helices and, perhaps more importantly, that TNAs form stable double helices with complementary RNAs and DNAs.

  10. [Hydrofluoric acid poisoning: case report].

    PubMed

    Cortina, Tatiana Judith; Ferrero, Hilario Andrés

    2013-01-01

    Hydrofluoric acid is a highly dangerous substance with industrial and domestically appliances. Clinical manifestations of poisoning depend on exposure mechanism, acid concentration and exposed tissue penetrability. Gastrointestinal tract symptoms do not correlate with injury severity. Patients with history of hydrofluoric acid ingestion should undergo an endoscopy of the upper gastrointestinal tract. Intoxication requires immediate intervention because systemic toxicity can take place. We present a 5 year old girl who accidentally swallowed 5 ml of 20% hydrofluoric acid. We performed gastrointestinal tract endoscopy post ingestion, which revealed erythematous esophagus and stomach with erosive lesions. Two months later, same study was performed and revealed esophagus and stomach normal mucous membrane.

  11. Preparation and characterization Al3+-bentonite Turen Malang for esterification fatty acid (palmitic acid, oleic acid and linoleic acid)

    NASA Astrophysics Data System (ADS)

    Abdulloh, Abdulloh; Aminah, Nanik Siti; Triyono, Mudasir, Trisunaryanti, Wega

    2016-03-01

    Catalyst preparation and characterization of Al3+-bentonite for esterification of palmitic acid, oleic acid and linoleic acid has been done. Al3+-bentonite catalyst was prepared from natural bentonite of Turen Malang through cation exchange reaction using AlCl3 solution. The catalysts obtained were characterized by XRD, XRF, pyridine-FTIR and surface area analyser using the BET method. Catalyst activity test of Al3+-bentonite for esterification reaction was done at 65°C using molar ratio of metanol-fatty acid of 30:1 and 0.25 g of Al3+-bentonite catalyst for the period of ½, 1, 2, 3, 4 and 5 hours. Based on the characterization results, the Al3+-bentonite Turen Malang catalyst has a d-spacing of 15.63 Ǻ, acid sites of Brönsted and Lewis respectively of 230.79 µmol/g and 99.39 µmol/g, surface area of 507.3 m2/g and the average of radius pore of 20.09 Å. GC-MS analysis results of the oil phase after esterification reaction showed the formation of biodiesel (FAME: Fatty acid methyl ester), namely methyl palmitate, methyl oleate and methyl linoleate. The number of conversions resulted in esterification reaction using Al3+-bentonite Turen Malang catalyst was 74.61%, 37.75%, and 20, 93% for the esterification of palmitic acid, oleic acid and linoleic acid respectively.

  12. Acidic gas capture by diamines

    SciTech Connect

    Rochelle, Gary; Hilliard, Marcus

    2011-05-10

    Compositions and methods related to the removal of acidic gas. In particular, the present disclosure relates to a composition and method for the removal of acidic gas from a gas mixture using a solvent comprising a diamine (e.g., piperazine) and carbon dioxide. One example of a method may involve a method for removing acidic gas comprising contacting a gas mixture having an acidic gas with a solvent, wherein the solvent comprises piperazine in an amount of from about 4 to about 20 moles/kg of water, and carbon dioxide in an amount of from about 0.3 to about 0.9 moles per mole of piperazine.

  13. Molecular structural studies of lichen substances II: atranorin, gyrophoric acid, fumarprotocetraric acid, rhizocarpic acid, calycin, pulvinic dilactone and usnic acid

    NASA Astrophysics Data System (ADS)

    Edwards, Howell G. M.; Newton, Emma M.; Wynn-Williams, David D.

    2003-06-01

    The FT-Raman and infrared vibrational spectra of some important lichen compounds from two metabolic pathways are characterised. Key biomolecular marker bands have been suggested for the spectroscopic identification of atranorin, gyrophoric acid, fumarprotocetraric acid rhizocarpic acid, calycin, pulvinic dilactone and usnic acid. A spectroscopic protocol has been defined for the detection of these molecules in organisms subjected to environmental stresses such as UV-radiation exposure, desiccation and low temperatures. Use of the protocol will be made for the assessment of survival strategies used by stress-tolerant lichens in Antarctic cold deserts.

  14. Cryoprotection from bacterial teichoic acid

    NASA Astrophysics Data System (ADS)

    Rice, Charles V.; Harrison, William; Kirkpatrick, Karl; Brown, Eric D.

    2009-08-01

    Recent studies from our lab demonstrated that teichoic acid is surrounded by liquid water at -40 °C. The size and shape of the liquid water pockets has been visualized with fluorescence microscopy images of aqueous Rhodamine- B solutions. The long, thin channels surround ice crystals with a size of 5-20 microns. Subsequent studies show that B. subtilis Gram-positive bacteria are sequestered into large pockets without added teichoic acid. Here, the ice crystals are orders of manitude larger. When bacteria are mixed with teichoic acid solutions, the distribution of bacteria changes dramatically. The smaller ice crystals allow the bacteria to align in the thin channels of liquid water seen with teichoic acid only. The role of teichoic acid in the freeze tolerance was examined with live/dead fluorescence assays of bacteria mixed with teichoic acid. These quantitative assays were used to determine if teichoic acid acts in a synergetic fashion to enhance the survivability of E. coli, a gram-negative species which lacks teichoic acid. Additionally, we have obtained B. subtilis mutants lacking wall-associated teichoic acids to evaluate cryoprotection compared to the wild-type strain.

  15. Sulfuric acid as autocatalyst in the formation of sulfuric acid.

    PubMed

    Torrent-Sucarrat, Miquel; Francisco, Joseph S; Anglada, Josep M

    2012-12-26

    Sulfuric acid can act as a catalyst of its own formation. We have carried out a computational investigation on the gas-phase formation of H(2)SO(4) by hydrolysis of SO(3) involving one and two water molecules, and also in the presence of sulfuric acid and its complexes with one and two water molecules. The hydrolysis of SO(3) requires the concurrence of two water molecules, one of them acting as a catalyzer, and our results predict an important catalytic effect, ranging between 3 and 11 kcal·mol(-1) when the catalytic water molecule is substituted by a sulfuric acid molecule or one of its hydrates. In these cases, the reaction products are either bare sulfuric acid dimer or sulfuric acid dimer complexed with a water molecule. There are broad implications from these new findings. The results of the present investigation show that the catalytic effect of sulfuric acid in the SO(3) hydrolysis can be important in the Earth's stratosphere, in the heterogeneous formation of sulfuric acid and in the formation of aerosols, in H(2)SO(4) formation by aircraft engines, and also in understanding the formation of sulfuric acid in the atmosphere of Venus.

  16. Hydrazides of carboxylic acids as inhibitors of steel acidic corrosion

    SciTech Connect

    Aitov, R.G.; Shein, A.B.; Lesnov, A.E.

    1994-09-01

    Hydrazides of carboxylic acids (HCA) inhibit the corrosion of ferrous materials in acids and netral solutions such as stratum and waste waters of oil deposits. In this work, the authors try to explain the above-mentioned difference and to consider HCA as inhibitors of steel hydrogenation.

  17. Fatty Acid Desaturases, Polyunsaturated Fatty Acid Regulation, and Biotechnological Advances

    PubMed Central

    Lee, Je Min; Lee, Hyungjae; Kang, SeokBeom; Park, Woo Jung

    2016-01-01

    Polyunsaturated fatty acids (PUFAs) are considered to be critical nutrients to regulate human health and development, and numerous fatty acid desaturases play key roles in synthesizing PUFAs. Given the lack of delta-12 and -15 desaturases and the low levels of conversion to PUFAs, humans must consume some omega-3 and omega-6 fatty acids in their diet. Many studies on fatty acid desaturases as well as PUFAs have shown that fatty acid desaturase genes are closely related to different human physiological conditions. Since the first front-end desaturases from cyanobacteria were cloned, numerous desaturase genes have been identified and animals and plants have been genetically engineered to produce PUFAs such as eicosapentaenoic acid and docosahexaenoic acid. Recently, a biotechnological approach has been used to develop clinical treatments for human physiological conditions, including cancers and neurogenetic disorders. Thus, understanding the functions and regulation of PUFAs associated with human health and development by using biotechnology may facilitate the engineering of more advanced PUFA production and provide new insights into the complexity of fatty acid metabolism. PMID:26742061

  18. A comparison of chromic acid and sulfuric acid anodizing

    NASA Technical Reports Server (NTRS)

    Danford, M. D.

    1992-01-01

    Because of federal and state mandates restricting the use of hexavalent chromium, it was deemed worthwhile to compare the corrosion protection afforded 2219-T87 aluminum alloy by both Type I chromic acid and Type II sulfuric acid anodizing per MIL-A-8625. Corrosion measurements were made on large, flat 2219-T87 aluminum alloy sheet material with an area of 1 cm(exp 2) exposed to a corrosive medium of 3.5-percent sodium chloride at pH 5.5. Both ac electrochemical impedance spectroscopy and the dc polarization resistance techniques were employed. The results clearly indicate that the corrosion protection obtained by Type II sulfuric acid anodizing is superior, and no problems should result by substituting Type II sulfuric acid anodizing for Type I chromic acid anodizing.

  19. Acid rain on Acid soil: a new perspective.

    PubMed

    Krug, E C; Frink, C R

    1983-08-01

    Acid rain is widely believed to be responsible for acidifying soil and water in areas of North America and northern Europe. However, factors commonly considered to make landscapes susceptible to acidification by acid rain are the same factors long known to strongly acidify soils through the natural processes of soil formation. Recovery from extreme and widespread careless land use has also occurred in regions undergoing acidification. There is evidence that acidification by acid rain is superimposed on long-term acidification induced by changes in land use and consequent vegetative succession. Thus, the interactions of acid rain, acid soil, and vegetation need to be carefully examined on a watershed basis in assessing benefits expected from proposed reductions in emissions of oxides of sulfur and nitrogen.

  20. Carbonic Acid Retreatment of Biomass

    SciTech Connect

    Baylor university

    2003-06-01

    This project sought to address six objectives, outlined below. The objectives were met through the completion of ten tasks. (1) Solidify the theoretical understanding of the binary CO{sub 2}/H{sub 2}O system at reaction temperatures and pressures. The thermodynamics of pH prediction have been improved to include a more rigorous treatment of non-ideal gas phases. However it was found that experimental attempts to confirm theoretical pH predictions were still off by a factor of about 1.8 pH units. Arrhenius experiments were carried out and the activation energy for carbonic acid appears to be substantially similar to sulfuric acid. Titration experiments have not yet confirmed or quantified the buffering or acid suppression effects of carbonic acid on biomass. (2) Modify the carbonic acid pretreatment severity function to include the effect of endogenous acid formation and carbonate buffering, if necessary. It was found that the existing severity functions serve adequately to account for endogenous acid production and carbonate effects. (3) Quantify the production of soluble carbohydrates at different reaction conditions and severity. Results show that carbonic acid has little effect on increasing soluble carbohydrate concentrations for pretreated aspen wood, compared to pretreatment with water alone. This appears to be connected to the release of endogenous acids by the substrate. A less acidic substrate such as corn stover would derive benefit from the use of carbonic acid. (4) Quantify the production of microbial inhibitors at selected reaction conditions and severity. It was found that the release of inhibitors was correlated to reaction severity and that carbonic acid did not appear to increase or decrease inhibition compared to pretreatment with water alone. (5) Assess the reactivity to enzymatic hydrolysis of material pretreated at selected reaction conditions and severity. Enzymatic hydrolysis rates increased with severity, but no advantage was detected for

  1. Carbonic Acid Pretreatment of Biomass

    SciTech Connect

    G. Peter van Walsum; Kemantha Jayawardhana; Damon Yourchisin; Robert McWilliams; Vanessa Castleberry

    2003-05-31

    This project sought to address six objectives, outlined below. The objectives were met through the completion of ten tasks. 1) Solidify the theoretical understanding of the binary CO2/H2O system at reaction temperatures and pressures. The thermodynamics of pH prediction have been improved to include a more rigorous treatment of non-ideal gas phases. However it was found that experimental attempts to confirm theoretical pH predictions were still off by a factor of about 1.8 pH units. Arrhenius experiments were carried out and the activation energy for carbonic acid appears to be substantially similar to sulfuric acid. Titration experiments have not yet confirmed or quantified the buffering or acid suppression effects of carbonic acid on biomass. 2) Modify the carbonic acid pretreatment severity function to include the effect of endogenous acid formation and carbonate buffering, if necessary. It was found that the existing severity functions serve adequately to account for endogenous acid production and carbonate effects. 3) Quantify the production of soluble carbohydrates at different reaction conditions and severity. Results show that carbonic acid has little effect on increasing soluble carbohydrate concentrations for pretreated aspen wood, compared to pretreatment with water alone. This appears to be connected to the release of endogenous acids by the substrate. A less acidic substrate such as corn stover would derive benefit from the use of carbonic acid. 4) Quantify the production of microbial inhibitors at selected reaction conditions and severity. It was found that the release of inhibitors was correlated to reaction severity and that carbonic acid did not appear to increase or decrease inhibition compared to pretreatment with water alone. 5) Assess the reactivity to enzymatic hydrolysis of material pretreated at selected reaction conditions and severity. Enzymatic hydrolysis rates increased with severity, but no advantage was detected for the use of carbonic

  2. Anacardic Acid, Salicylic Acid, and Oleic Acid Differentially Alter Cellular Bioenergetic Function in Breast Cancer Cells.

    PubMed

    Radde, Brandie N; Alizadeh-Rad, Negin; Price, Stephanie M; Schultz, David J; Klinge, Carolyn M

    2016-11-01

    Anacardic acid is a dietary and medicinal phytochemical that inhibits breast cancer cell proliferation and uncouples oxidative phosphorylation (OXPHOS) in isolated rat liver mitochondria. Since mitochondrial-targeted anticancer therapy (mitocans) may be useful in breast cancer, we examined the effect of anacardic acid on cellular bioenergetics and OXPHOS pathway proteins in breast cancer cells modeling progression to endocrine-independence: MCF-7 estrogen receptor α (ERα)+ endocrine-sensitive; LCC9 and LY2 ERα+, endocrine-resistant, and MDA-MB-231 triple negative breast cancer (TNBC) cells. At concentrations similar to cell proliferation IC50 s, anacardic acid reduced ATP-linked oxygen consumption rate (OCR), mitochondrial reserve capacity, and coupling efficiency while increasing proton leak, reflecting mitochondrial toxicity which was greater in MCF-7 compared to endocrine-resistant and TNBC cells. These results suggest tolerance in endocrine-resistant and TNBC cells to mitochondrial stress induced by anacardic acid. Since anacardic acid is an alkylated 2-hydroxybenzoic acid, the effects of salicylic acid (SA, 2-hydroxybenzoic acid moiety) and oleic acid (OA, monounsaturated alkyl moiety) were tested. SA inhibited whereas OA stimulated cell viability. In contrast to stimulation of basal OCR by anacardic acid (uncoupling effect), neither SA nor OA altered basal OCR- except OA inhibited basal and ATP-linked OCR, and increased ECAR, in MDA-MB-231 cells. Changes in OXPHOS proteins correlated with changes in OCR. Overall, neither the 2-hydroxybenzoic acid moiety nor the monounsaturated alky moiety of anacardic acid is solely responsible for the observed mitochondria-targeted anticancer activity in breast cancer cells and hence both moieties are required in the same molecule for the observed effects. J. Cell. Biochem. 117: 2521-2532, 2016. © 2016 Wiley Periodicals, Inc. PMID:26990649

  3. Production of Succinic Acid from Citric Acid and Related Acids by Lactobacillus Strains

    PubMed Central

    Kaneuchi, Choji; Seki, Masako; Komagata, Kazuo

    1988-01-01

    A number of Lactobacillus strains produced succinic acid in de Man-Rogosa-Sharpe broth to various extents. Among 86 fresh isolates from fermented cane molasses in Thailand, 30 strains (35%) produced succinic acid; namely, 23 of 39 Lactobacillus reuteri strains, 6 of 18 L. cellobiosus strains, and 1 of 6 unidentified strains. All of 10 L. casei subsp. casei strains, 5 L. casei subsp. rhamnosus strains, 6 L. mali strains, and 2 L. buchneri strains did not produce succinic acid. Among 58 known strains including 48 type strains of different Lactobacillus species, the strains of L. acidophilus, L. crispatus, L. jensenii, and L. parvus produced succinic acid to the same extent as the most active fresh isolates, and those of L. alimentarius, L. collinoides, L. farciminis, L. fructivorans (1 of 2 strains tested), L. malefermentans, and L. reuteri were also positive, to lesser extents. Diammonium citrate in de Man-Rogosa-Sharpe broth was determined as a precursor of the succinic acid produced. Production rates were about 70% on a molar basis with two fresh strains tested. Succinic acid was also produced from fumaric and malic acids but not from dl-isocitric, α-ketoglutaric, and pyruvic acids. The present study is considered to provide the first evidence on the production of succinic acid, an important flavoring substance in dairy products and fermented beverages, from citrate by lactobacilli. PMID:16347795

  4. Acid rain: a background report

    SciTech Connect

    Glustrom, L.; Stolzenberg, J.

    1982-07-08

    This Staff Brief was prepared for the Wisconsin Legislative Council's Special Committee on Acid Rain to provide an introduction to the issue of acid rain. It is divided into four parts. Part I provides an overview on the controversies surrounding the measurement, formation and effects of acid rain. As described in Part I, the term acid rain is used to describe the deposition of acidic components through both wet deposition (e.g., rain or snow) and dry deposition (e.g., direct contact between atmospheric constituents and the land, water or vegetation of the earth). Part II presents background information on state agency activities relating to acid rain in Wisconsin, describes what is known about the occurrence of, susceptibility to and effects of acid rain in Wisconsin, and provides information related to man-made sources of sulfur and nitrogen oxides in Wisconsin. Part III describes major policies and regulations relating to acid rain which have been or are being developed jointly by the United States and Canadian governments, by the United States government and by the State of Wisconsin. Part IV briefly discusses possible areas for Committee action.

  5. Acid Rain: An Educational Opportunity?

    ERIC Educational Resources Information Center

    Marion, James I.

    1984-01-01

    Deals with how educators can handle the subject of acid rain; illustrates suggestions with experiences of grade nine students visiting Frost Valley Environmental Education Center (Oliverea, New York) to learn scientific concepts through observation of outdoor phenomena, including a stream; and discusses acid rain, pH levels, and pollution control…

  6. Acid rain & electric utilities II

    SciTech Connect

    1997-12-31

    This document presents reports which were presented at the Acid Rain and Electric Utilities Conference. Topics include environmental issues and electric utilities; acid rain program overview; global climate change and carbon dioxide; emissions data management; compliance; emissions control; allowance and trading; nitrogen oxides; and assessment. Individual reports have been processed separately for the United States Department of Energy databases.

  7. Acid Rain: The Scientific Challenge.

    ERIC Educational Resources Information Center

    Godfrey, Paul J.

    1991-01-01

    Documents the workings and findings of the Massachusetts Acid Rain Monitoring Project, which has pooled the volunteer efforts of more than 1,000 amateur and professional scientists since 1983. Reports on the origins of air pollution, the prediction of acid rain, and its effects on both water life and land resources. (JJK)

  8. Acid Precipitation: Causes and Consequences.

    ERIC Educational Resources Information Center

    Babich, Harvey; And Others

    1980-01-01

    This article is the first of three articles in a series on the acid rain problem in recent years. Discussed are the causes of acid precipitation and its consequences for the abiotic and biotic components of the terrestrial and aquatic ecosystems, and for man-made materials. (Author/SA)

  9. Acid Rain: What's the Forecast?

    ERIC Educational Resources Information Center

    Bybee, Rodger

    1984-01-01

    Discusses various types of acid rain, considered to be a century-old problem. Topics include: wet and dry deposition, effects on a variety of environments, ecosystems subject to detrimental effects, and possible solutions to the problem. A list of recommended resources on acid rain is provided. (BC)

  10. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  11. Getting Back to Basics (& Acidics)

    ERIC Educational Resources Information Center

    Rhodes, Sam

    2006-01-01

    This article describes a few novel acid-base experiments intended to introduce students to the basic concepts of acid-base chemistry and provide practical examples that apply directly to the study of biology and the human body. Important concepts such as the reaction between carbon dioxide and water, buffers and protein denaturation, are covered.…

  12. Acid Tests and Basic Fun.

    ERIC Educational Resources Information Center

    McBride, John W.

    1995-01-01

    Explores acids and bases using different indicators, such as turmeric, purple grape juice, and lichens. Because some of these indicators are not as sensitive as cabbage juice or litmus paper, determining to which acids and bases each indicator is sensitive presents an enjoyable, problem-solving challenge for students. Presents directions for…

  13. Acid rain and environmental policy

    SciTech Connect

    Jacobson, J.S.

    1981-10-01

    Various seemingly paradoxical scientific questions are posed which relate to the problem of acid rain and its effect on the environment and environmental policy. The first paradox discussed concerns the supposed increase in fossil fuel usage over the last several decades, with the resultant increases in emissions of pollutants from the combustion of fuels which cause acid rain. Despite these increases, experts do not agree on whether acidity of rain has increased in eastern North America. The second paradox concerns the effect of acid rain on vegetation. If the rain is supposedly harmful, why have some reports shown increases and others, decreases in the growth of crops and trees with the application of simulated acid rain. The third paradox concerns the effect of acid rains on fish life in lakes. If acid rain falls throughout eastern North America, why have some lakes become acid and lost fish populations while others have not. Since unequivocal answers to these scientific questions are not available, a systematic approach is needed for developing policy which can be useful for solving the problem. It appears that traditional cost-benefit analysis can not be the sole basis for decision-making, but that it will be helpful. Research needs must be identified, and the upper and lower limits for alternative strategies must be determined. 14 references, 1 table.

  14. Impacts of acid rain legislation

    SciTech Connect

    Addison, E.L.

    1983-01-01

    The author warns against hasty acid rain legislation that would involve billions of dollars and affect thousands of jobs. He recommends further study into the causes of high acidity in lakes and streams. He states that there are too many uncertainties of whether the problem would be solved by reducing sulfur dioxide emissions from coal-fired power plants. (DMC)

  15. Acid rain: effects on fish and wildlife

    SciTech Connect

    Mayer, K.S.; Multer, E.P.; Schreiber, R.K.

    1984-01-01

    The following questions concerning acid rain are discussed: what is acid rain; what causes acid rain; where do sulfur and nitrogen oxides originate; what areas in the U.S. are susceptible to acid rain; are there early warning signals of acidification to aquatic resources; how does acid rain affect fishery resources; does acid rain affect wildlife; and how can effects of acid rain be reduced.

  16. Lead-acid battery

    SciTech Connect

    Rowlette, J.J.

    1983-09-20

    A light weight lead-acid battery is disclosed having a positive terminal and a negative terminal and including one or more cells or grid stacks having a plurality of vertically stacked conductive monoplates with positive active material and negative active material deposited on alternating plates in the cell or grid stack. Electrolyte layers positioned between each monoplate are included to provide a battery cell having four sides which is capable of being electrically charged and discharged. Two vertical positive bus bars are provided on opposite sides of the battery cell for connecting the monoplates with positive active material together in parallel current conducting relation. In addition, two negative bus bars on opposite sides of the battery cell each being adjacent the positive bus bars are provided for connecting the monoplates with negative active material together in parallel current conducting relation. The positive and negative bus bars not only provide a low resistance method for connecting the plurality of conductive monoplates of their respective battery terminals but also provides support and structural strength to the battery cell structure. In addition, horizontal orientation of monoplates is provided in a vertical stacking arrangement to reduce electrolyte stratification and short circuiting due to flaking of positive and negative active materials from the monoplates.

  17. Lead-acid battery

    NASA Technical Reports Server (NTRS)

    Rowlette, John J. (Inventor)

    1983-01-01

    A light weight lead-acid battery (30) having a positive terminal (36) and a negative terminal (34) and including one or more cells or grid stacks having a plurality of vertically stacked conductive monoplates (10, 20) with positive active material and negative active material deposited on alternating plates in the cell or grid stack. Electrolyte layers (26, 28) positioned between each monoplate are included to provide a battery cell having four sides which is capable of being electrically charged and discharged. Two vertical positive bus bars (42, 43) are provided on opposite sides of the battery cell for connecting the monoplates (10) with positive active material together in parallel current conducting relation. In addition, two negative bus bars (38, 39) on opposite sides of the battery cell each being adjacent the positive bus bars are provided for connecting the monoplates (20) with negative active material together in parallel current conducting relation. The positive (42, 43) and negative (38, 39) bus bars not only provide a low resistance method for connecting the plurality of conductive monoplates of their respective battery terminals (36, 34) but also provides support and structural strength to the battery cell structure. In addition, horizontal orientation of monoplates (10, 20) is provided in a vertical stacking arrangement to reduce electrolyte stratification and short circuiting due to flaking of positive and negative active materials from the monoplates.

  18. Synthesis of higher monocarboxylic acids

    SciTech Connect

    Taikov, B.F.; Novakovskii, E.M.; Zhelkovskaya, V.P.; Shadrova, V.N.; Shcherbik, P.K.

    1981-01-01

    Brown-coal and peat waxes contain higher monocarboxylic acids, alcohols and esters of them as their main components. In view of this, considerable interest is presented by the preparation of individual compounds among those mentioned above, which is particularly important in the study of the composition and development of the optimum variants of the chemical processing of the waxes. In laboratory practice, to obtain higher monocarboxylic acids use is generally made of electrosynthesis according to Kolbe which permits unbranched higher aliphatic acids with given lengths of the hydrocarbon chain to be obtained. The aim of the present work was to synthesize higher monocarboxylic acids: arachidic, behenic, lignoceric, pentacosanoic, erotic, heptacosanoic, montanic, nonacosanoic, melissic, dotriacontanoic and tetratriacontanoic, which are present in waxes. Characteristics of synthesized acids are tabulated. 20 refs.

  19. Atmospheric dust and acid rain

    SciTech Connect

    Hedin, L.O.; Likens, G.E.

    1996-12-01

    Why is acid rain still an environmental problem in Europe and North America despite antipollution reforms? The answer really is blowing in the wind: atmospheric dust. These airborne particles can help neutralize the acids falling on forests, but dust levels are unusually low these days. In the air dust particles can neutralize acid rain. What can we do about acid rain and atmospheric dust? Suggestions range from the improbable to the feasible. One reasonable suggestion is to reduce emissions of acidic pollutants to levels that can be buffered by natural quantities of basic compounds in the atmosphere; such a goal would mean continued reductions in sulfur dioxide and nitrogen oxides, perhaps even greater than those prescribed in the 1990 Amendments to the Clean Air Act in the U.S. 5 figs.

  20. Amino acid management in cancer

    PubMed Central

    Tsun, Zhi-Yang; Possemato, Richard

    2016-01-01

    Amino acids have a dual role in cellular metabolism, as they are both the building blocks for protein synthesis and intermediate metabolites which fuel other biosynthetic reactions. Recent work has demonstrated that deregulation of both arms of amino acid management are common alterations seen in cancer. Among the most highly consumed nutrients by cancer cells are the amino acids glutamine and serine, and the biosynthetic pathways that metabolize them are required in various cancer subtypes and the object of current efforts to target cancer metabolism. Also altered in cancer are components of the machinery which sense amino acid sufficiency, nucleated by the mechanistic target of rapamycin (mTOR), a key regulator of cell growth via modulation of key processes including protein synthesis and autophagy. The precise ways in which altered amino acid management supports cellular transformation remain mostly elusive, and a fuller mechanistic understanding of these processes will be important for efforts to exploit such alterations for cancer therapy. PMID:26277542

  1. Fumaric acid production by fermentation

    PubMed Central

    Roa Engel, Carol A.; Zijlmans, Tiemen W.; van Gulik, Walter M.; van der Wielen, Luuk A. M.

    2008-01-01

    The potential of fumaric acid as a raw material in the polymer industry and the increment of cost of petroleum-based fumaric acid raises interest in fermentation processes for production of this compound from renewable resources. Although the chemical process yields 112% w/w fumaric acid from maleic anhydride and the fermentation process yields only 85% w/w from glucose, the latter raw material is three times cheaper. Besides, the fermentation fixes CO2. Production of fumaric acid by Rhizopus species and the involved metabolic pathways are reviewed. Submerged fermentation systems coupled with product recovery techniques seem to have achieved economically attractive yields and productivities. Future prospects for improvement of fumaric acid production include metabolic engineering approaches to achieve low pH fermentations. PMID:18214471

  2. Formation of acrylic acid from lactic acid in supercritical water

    SciTech Connect

    Mok, W.S.L.; Antal, M.J. Jr. ); Jones, M. Jr. )

    1989-09-15

    Supercritical (SC) water is an unusual medium in which fast and specific heterolytic reactions can be conducted at temperatures as high as 400{degree}C. In supercritical water, lactic acid decomposes into gaseous and liquid products via three primary reaction pathways. Products of the acid-catalyzed heterolytic decarbonylation pathway are carbon monoxide, water, and acetaldehyde. Products of the homolytic, decarboxylation pathway are carbon dioxide, hydrogen, and acetaldehyde. Products of the heterolytic, dehydration pathway are acrylic acid and water. The intramolecular nucleophilic displacement of the {alpha}-hydroxyl by the carbonyl group of lactic acid, producing {alpha}-propiolactone as an unstable intermediate which subsequently rearranges to become the unsaturated acid, is a likely mechanism for acrylic acid formation, although an intramolecular E2 elimination initiated by attack of the carbonyl oxygen on a methyl hydrogen cannot be ruled out. Support for the former mechanism comes in part from the observed 100% relative yield of acrylic acid from {beta}-propiolactone in SC water.

  3. Synthesis of l-(+)-Tartaric Acid from l-Ascorbic Acid via 5-Keto-d-Gluconic Acid in Grapes

    PubMed Central

    Saito, Kazumi; Kasai, Zenzaburo

    1984-01-01

    5-Keto-l-idionic acid (≡5-keto-d-gluconic acid, d-xylo-5-hexulosonic acid) was found as a metabolic product of l-ascorbic acid in slices of immature grapes, Vitis labrusca L. cv `Delaware'. Specifically labeled compounds, recognized as metabolic products of l-ascorbic acid in grapes, were fed to young grape tissues to investigate the metabolic pathway from l-ascorbic acid to l-(+)-tartaric acid. Label from dehydro-l-[1-14C]ascorbic acid, 2-keto-l-[1-14C]idonic acid (l-xylo-2-hexulosonic acid), l-[1-14C]idonic acid, or 5-keto-l-[1-14C] idonic acid was incorporated into l-(+)-tartaric acid in high yields as it was in the l-[1-14C]ascorbic acid experiment. In a double label experiment involving a mixture of l-[1-14C]idonic acid and l-[2-3H]idonic acid, the 3H/14C ratios of 5-keto-l-idonic acid and l-(+)-tartaric acid synthesized in young grape leaves were almost the same as the value of the l-idonic acid fed. Label from 5-keto-l-[6-14C]idonic acid was incorporated into sugars and insoluble residue in the same way as l-[6-14C]ascorbic acid was metabolized in grapes. These results provide strong evidence that in grapes l-(+)-tartaric acid is synthesized from the C4 fragment that corresponds to the C1 to C4 group of the 5-keto-l-idonic acid derived from l-ascorbic acid via 2-keto-l-idonic acid and l-idonic acid. PMID:16663792

  4. Molten fatty acid based microemulsions.

    PubMed

    Noirjean, Cecile; Testard, Fabienne; Dejugnat, Christophe; Jestin, Jacques; Carriere, David

    2016-06-21

    We show that ternary mixtures of water (polar phase), myristic acid (MA, apolar phase) and cetyltrimethylammonium bromide (CTAB, cationic surfactant) studied above the melting point of myristic acid allow the preparation of microemulsions without adding a salt or a co-surfactant. The combination of SANS, SAXS/WAXS, DSC, and phase diagram determination allows a complete characterization of the structures and interactions between components in the molten fatty acid based microemulsions. For the different structures characterized (microemulsion, lamellar or hexagonal phases), a similar thermal behaviour is observed for all ternary MA/CTAB/water monophasic samples and for binary MA/CTAB mixtures without water: crystalline myristic acid melts at 52 °C, and a thermal transition at 70 °C is assigned to the breaking of hydrogen bounds inside the mixed myristic acid/CTAB complex (being the surfactant film in the ternary system). Water determines the film curvature, hence the structures observed at high temperature, but does not influence the thermal behaviour of the ternary system. Myristic acid is partitioned in two "species" that behave independently: pure myristic acid and myristic acid associated with CTAB to form an equimolar complex that plays the role of the surfactant film. We therefore show that myristic acid plays the role of a solvent (oil) and a co-surfactant allowing the fine tuning of the structure of oil and water mixtures. This solvosurfactant behaviour of long chain fatty acid opens the way for new formulations with a complex structure without the addition of any extra compound. PMID:27241163

  5. Pentadecanoic and Heptadecanoic Acids: Multifaceted Odd-Chain Fatty Acids.

    PubMed

    Pfeuffer, Maria; Jaudszus, Anke

    2016-07-01

    The odd-chain fatty acids (OCFAs) pentadecanoic acid (15:0) and heptadecanoic acid (17:0), which account for only a small proportion of total saturated fatty acids in milk fat and ruminant meat, are accepted biomarkers of dairy fat intake. However, they can also be synthesized endogenously, for example, from gut-derived propionic acid (3:0). A number of studies have shown an inverse association between OCFA concentrations in human plasma phospholipids or RBCs and risk of type 2 diabetes and cardiovascular disease. We propose a possible involvement in metabolic regulation from the assumption that there is a link between 15:0 and 17:0 and the metabolism of other short-chain, medium-chain, and longer-chain OCFAs. The OCFAs 15:0 and 17:0 can be elongated to very-long-chain FAs (VLCFAs) such as tricosanoic acid (23:0) and pentacosanoic acid (25:0) in glycosphingolipids, particularly found in brain tissue, or can be derived from these VLCFAs. Their chains can be shortened, yielding propionyl-coenzyme A (CoA). Propionyl-CoA, by succinyl-CoA, can replenish the citric acid cycle (CAC) with anaplerotic intermediates and, thus, improve mitochondrial energy metabolism. Mitochondrial function is compromised in a number of disorders and may be impaired with increasing age. Optimizing anaplerotic intermediate availability for the CAC may help to cope with demands in times of increased metabolic stress and with aging. OCFAs may serve as substrates for synthesis of both odd-numbered VLCFAs and propionyl-CoA or store away excess propionic acid. PMID:27422507

  6. Pentadecanoic and Heptadecanoic Acids: Multifaceted Odd-Chain Fatty Acids.

    PubMed

    Pfeuffer, Maria; Jaudszus, Anke

    2016-07-01

    The odd-chain fatty acids (OCFAs) pentadecanoic acid (15:0) and heptadecanoic acid (17:0), which account for only a small proportion of total saturated fatty acids in milk fat and ruminant meat, are accepted biomarkers of dairy fat intake. However, they can also be synthesized endogenously, for example, from gut-derived propionic acid (3:0). A number of studies have shown an inverse association between OCFA concentrations in human plasma phospholipids or RBCs and risk of type 2 diabetes and cardiovascular disease. We propose a possible involvement in metabolic regulation from the assumption that there is a link between 15:0 and 17:0 and the metabolism of other short-chain, medium-chain, and longer-chain OCFAs. The OCFAs 15:0 and 17:0 can be elongated to very-long-chain FAs (VLCFAs) such as tricosanoic acid (23:0) and pentacosanoic acid (25:0) in glycosphingolipids, particularly found in brain tissue, or can be derived from these VLCFAs. Their chains can be shortened, yielding propionyl-coenzyme A (CoA). Propionyl-CoA, by succinyl-CoA, can replenish the citric acid cycle (CAC) with anaplerotic intermediates and, thus, improve mitochondrial energy metabolism. Mitochondrial function is compromised in a number of disorders and may be impaired with increasing age. Optimizing anaplerotic intermediate availability for the CAC may help to cope with demands in times of increased metabolic stress and with aging. OCFAs may serve as substrates for synthesis of both odd-numbered VLCFAs and propionyl-CoA or store away excess propionic acid.

  7. Acid soil and acid rain, 2nd edition

    SciTech Connect

    Kennedy, I.R.

    1992-01-01

    This book examines the basic chemical processes involved in acidification in order to better assess their long-term effects on the status of soils, the health of plants and other living species that depend on them. It also discusses acidity, pH and protons their significance in bioenergetics and the consequent role of autotrophic organisms in acidifying ecosystems. This edition incorporates and integrates recent findings that render more explanations of the causes of the environmental impacts of acidity, especially in forests and lakes. Also explores current research into acid rain and soil in order to devise appropriate measures for their amelioration.

  8. Functional nucleic acid probes and uses thereof

    DOEpatents

    Nilsen-Hamilton, Marit

    2006-10-03

    The present invention provides functional nucleic acid probes, and methods of using functional nucleic acid probes, for binding a target to carry out a desired function. The probes have at least one functional nucleic acid, at least one regulating nucleic acid, and at least one attenuator. The functional nucleic acid is maintained in an inactive state by the attenuator and activated by the regulating nucleic acid only in the presence of a regulating nucleic acid target. In its activated state the functional nucleic acid can bind to its target to carry out a desired function, such as generating a signal, cleaving a nucleic acid, or catalyzing a reaction.

  9. 21 CFR 184.1021 - Benzoic acid.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Benzoic acid. 184.1021 Section 184.1021 Food and... Substances Affirmed as GRAS § 184.1021 Benzoic acid. (a) Benzoic acid is the chemical benzenecarboxylic acid (C7H6O2), occurring in nature in free and combined forms. Among the foods in which benzoic acid...

  10. 21 CFR 184.1021 - Benzoic acid.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Benzoic acid. 184.1021 Section 184.1021 Food and... Substances Affirmed as GRAS § 184.1021 Benzoic acid. (a) Benzoic acid is the chemical benzenecarboxylic acid (C7H6O2), occurring in nature in free and combined forms. Among the foods in which benzoic acid...

  11. 21 CFR 184.1021 - Benzoic acid.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Benzoic acid. 184.1021 Section 184.1021 Food and... Substances Affirmed as GRAS § 184.1021 Benzoic acid. (a) Benzoic acid is the chemical benzenecarboxylic acid (C7H6O2), occurring in nature in free and combined forms. Among the foods in which benzoic acid...

  12. 21 CFR 184.1021 - Benzoic acid.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Benzoic acid. 184.1021 Section 184.1021 Food and....1021 Benzoic acid. (a) Benzoic acid is the chemical benzenecarboxylic acid (C7H6O2), occurring in nature in free and combined forms. Among the foods in which benzoic acid occurs naturally are...

  13. 21 CFR 189.155 - Monochloroacetic acid.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Monochloroacetic acid. 189.155 Section 189.155... Human Food § 189.155 Monochloroacetic acid. (a) Monochloroacetic acid is the chemical chloroacetic acid... in alcoholic and nonalcoholic beverages. Monochloroacetic acid is permitted in food package...

  14. Diabetes and Alpha Lipoic Acid

    PubMed Central

    Golbidi, Saeid; Badran, Mohammad; Laher, Ismail

    2011-01-01

    Diabetes mellitus is a multi-faceted metabolic disorder where there is increased oxidative stress that contributes to the pathogenesis of this debilitating disease. This has prompted several investigations into the use of antioxidants as a complementary therapeutic approach. Alpha lipoic acid, a naturally occurring dithiol compound which plays an essential role in mitochondrial bioenergetic reactions, has gained considerable attention as an antioxidant for use in managing diabetic complications. Lipoic acid quenches reactive oxygen species, chelates metal ions, and reduces the oxidized forms of other antioxidants such as vitamin C, vitamin E, and glutathione. It also boosts antioxidant defense system through Nrf-2-mediated antioxidant gene expression and by modulation of peroxisome proliferator activated receptors-regulated genes. ALA inhibits nuclear factor kappa B and activates AMPK in skeletal muscles, which in turn have a plethora of metabolic consequences. These diverse actions suggest that lipoic acid acts by multiple mechanisms, many of which have only been uncovered recently. In this review we briefly summarize the known biochemical properties of lipoic acid and then discussed the oxidative mechanisms implicated in diabetic complications and the mechanisms by which lipoic acid may ameliorate these reactions. The findings of some of the clinical trials in which lipoic acid administration has been tested in diabetic patients during the last 10 years are summarized. It appears that the clearest benefit of lipoic acid supplementation is in patients with diabetic neuropathy. PMID:22125537

  15. Cycloadditions for Studying Nucleic Acids.

    PubMed

    Kath-Schorr, Stephanie

    2016-02-01

    Cycloaddition reactions for site-specific or global modification of nucleic acids have enabled the preparation of a plethora of previously inaccessible DNA and RNA constructs for structural and functional studies on naturally occurring nucleic acids, the assembly of nucleic acid nanostructures, therapeutic applications, and recently, the development of novel aptamers. In this chapter, recent progress in nucleic acid functionalization via a range of different cycloaddition (click) chemistries is presented. At first, cycloaddition/click chemistries already used for modifying nucleic acids are summarized, ranging from the well-established copper(I)-catalyzed alkyne-azide cycloaddition reaction to copper free methods, such as the strain-promoted azide-alkyne cycloaddition, tetrazole-based photoclick chemistry and the inverse electron demand Diels-Alder cycloaddition reaction between strained alkenes and tetrazine derivatives. The subsequent sections contain selected applications of nucleic acid functionalization via click chemistry; in particular, site-specific enzymatic labeling in vitro, either via DNA and RNA recognizing enzymes or by introducing unnatural base pairs modified for click reactions. Further sections report recent progress in metabolic labeling and fluorescent detection of DNA and RNA synthesis in vivo, click nucleic acid ligation, click chemistry in nanostructure assembly and click-SELEX as a novel method for the selection of aptamers. PMID:27572987

  16. Phytic acid in green leaves.

    PubMed

    Hadi Alkarawi, H; Zotz, G

    2014-07-01

    Phytic acid or phytate, the free-acid form of myo-inositolhexakiphosphate, is abundant in many seeds and fruits, where it represents the major storage form of phosphorus. Although also known from other plant tissues, available reports on the occurrence of phytic acid, e.g. in leaves, have never been compiled, nor have they been critically reviewed. We found 45 published studies with information on phytic acid content in leaves. Phytic acid was almost always detected when studies specifically tried to detect it, and accounted for up to 98% of total P. However, we argue that such extreme values, which rival findings from storage organs, are dubious and probably result from measurement errors. Excluding these high values from further quantitative analysis, foliar phytic acid-P averaged 2.3 mg·g(-1) , and represented, on average, 7.6% of total P. Remarkably, the ratio of phytic acid-P to total P did not increase with total P, we even detected a negative correlation of the two variables within one species, Manihot esculenta. This enigmatic finding warrants further attention.

  17. Cycloadditions for Studying Nucleic Acids.

    PubMed

    Kath-Schorr, Stephanie

    2016-02-01

    Cycloaddition reactions for site-specific or global modification of nucleic acids have enabled the preparation of a plethora of previously inaccessible DNA and RNA constructs for structural and functional studies on naturally occurring nucleic acids, the assembly of nucleic acid nanostructures, therapeutic applications, and recently, the development of novel aptamers. In this chapter, recent progress in nucleic acid functionalization via a range of different cycloaddition (click) chemistries is presented. At first, cycloaddition/click chemistries already used for modifying nucleic acids are summarized, ranging from the well-established copper(I)-catalyzed alkyne-azide cycloaddition reaction to copper free methods, such as the strain-promoted azide-alkyne cycloaddition, tetrazole-based photoclick chemistry and the inverse electron demand Diels-Alder cycloaddition reaction between strained alkenes and tetrazine derivatives. The subsequent sections contain selected applications of nucleic acid functionalization via click chemistry; in particular, site-specific enzymatic labeling in vitro, either via DNA and RNA recognizing enzymes or by introducing unnatural base pairs modified for click reactions. Further sections report recent progress in metabolic labeling and fluorescent detection of DNA and RNA synthesis in vivo, click nucleic acid ligation, click chemistry in nanostructure assembly and click-SELEX as a novel method for the selection of aptamers.

  18. Terahertz spectrum of gallic acid

    NASA Astrophysics Data System (ADS)

    Wu, Meng; Zhao, Guozhong; Wang, Haiyan; Liang, Chengshen

    2009-11-01

    Gallic acid is natural polyphenol compound found in many green plants. More and more experiments have demonstrated that the gallic acid has comprehensive applications. In the field of medicine, the gallic acid plays an important role in antianaphylaxis, antineoplastic, antimycotic, anti-inflammatory, antivirotic, antiasthmatic and inhibiting the degradation of insulin. It also has a lot of applications in chemical industry, food industry and light industry. So it is important to study the terahertz time-domain spectroscopy of gallic acid. Terahertz time-domain spectroscopy (THz-TDS) is a new coherent spectral technology based on the femtosecond laser. In this work, the spectral characteristics of gallic acid in the range of 0.4 THz to 2.6 THz have been measured by THz-TDS. We obtained its absorption and refraction spectra at room temperature. The vibration absorption spectrum of the single molecule between 0.4 THz and 2.6 THz is simulated based on the Density Functional Theory (DFT). It is found that the gallic acid has the spectral response to THz wave in this frequency range. The results show the abnormal dispersion at 1.51 THz and 2.05 THz. These results can be used in the qualitative analysis of gallic acid and the medicine and food inspection.

  19. Determination of polyfluoroalkyl phosphoric acid diesters, perfluoroalkyl phosphonic acids, perfluoroalkyl phosphinic acids, perfluoroalkyl carboxylic acids, and perfluoroalkane sulfonic acids in lake trout from the Great Lakes region.

    PubMed

    Guo, Rui; Reiner, Eric J; Bhavsar, Satyendra P; Helm, Paul A; Mabury, Scott A; Braekevelt, Eric; Tittlemier, Sheryl A

    2012-11-01

    A comprehensive method to extract perfluoroalkyl carboxylic acids, perfluoroalkane sulfonic acids, perfluoroalkyl phosphonic acids, perfluoroalkyl phosphinic acids, and polyfluoroalkyl phosphoric acid diesters simultaneously from fish samples has been developed. The recoveries of target compounds ranged from 78 % to 121 %. The new method was used to analyze lake trout (Salvelinus namaycush) from the Great Lakes region. The results showed that the total perfluoroalkane sulfonate concentrations ranged from 0.1 to 145 ng/g (wet weight) with perfluorooctane sulfonate (PFOS) as the dominant contaminant. Concentrations in fish between lakes were in the order of Lakes Ontario ≈ Erie > Huron > Superior ≈ Nipigon. The total perfluoroalkyl carboxylic acid concentrations ranged from 0.2 to 18.2 ng/g wet weight. The aggregate mean perfluorooctanoic acid (PFOA) concentration in fish across all lakes was 0.045 ± 0.023 ng/g. Mean concentrations of PFOA were not significantly different (p > 0.1) among the five lakes. Perfluoroalkyl phosphinic acids were detected in lake trout from Lake Ontario, Lake Erie, and Lake Huron with concentration ranging from non-detect (ND) to 0.032 ng/g. Polyfluoroalkyl phosphoric acid diesters were detected only in lake trout from Lake Huron, at levels similar to perfluorooctanoic acid.

  20. Tropospheric cycle of nitrous acid

    NASA Astrophysics Data System (ADS)

    Harrison, Roy M.; Peak, John D.; Collins, Gareth M.

    1996-06-01

    Measurements of the land surface exchange of nitrous acid over grass and sugar beet surfaces reveal both upward and downward fluxes with flux reversal occurring at an ambient concentration of nitrogen dioxide of about 10 ppb. This confirms earlier preliminary findings and strengthens the hypothesis that substantial production of nitrous acid can occur on land surfaces from reaction of nitrogen dioxide and water vapor. Detailed measurements of nitrous acid have been made in central urban, suburban, and rural environments. These measurements, in conjunction with a simple box model, indicate that the atmospheric concentrations of nitrous acid are explicable in terms of a small number of basic processes in which the most important are the surface production of nitrous acid from nitrogen dioxide, atmospheric production from the NO-OH reaction and loss of nitrous acid by photolysis and dry deposition. In the suburban atmosphere, concentrations of nitrous acid are strongly correlated with nitrogen dioxide. In the rural atmosphere a different behavior is seen, with much higher nitrous acid to nitrogen dioxide ratios occurring in more polluted air with nitrogen dioxide concentrations in excess of 10 ppb. At lower nitrogen dioxide concentrations, net deposition of nitrous acid at the ground leads to very low concentrations in advected air. The model study indicates that during daytime in the suburban atmosphere, production of HONO from the NO-OH reaction can compete with photolysis giving a HONO concentration of a few tenths of a part per billion. At the highest observed daytime concentrations of HONO, production of OH radical from its photolysis can proceed at a rate more than 10 times faster than from photolysis of ozone.

  1. Gamma linolenic acid: an antiinflammatory omega-6 fatty acid.

    PubMed

    Kapoor, Rakesh; Huang, Yung-Sheng

    2006-12-01

    Inflammation plays an important role in health and disease. Most of the chronic diseases of modern society, including cancer, diabetes, heart disease, arthritis, Alzheimer's disease, etc. have inflammatory component. At the same time, the link between diet and disease is also being recognized. Amongst dietary constituents, fat has gained most recognition in affecting health. Saturated and trans fatty acids have been implicated in obesity, heart disease, diabetes and cancer while polyunsaturated fatty acids (PUFAs) generally have a positive effect on health. The PUFAs of omega-3 and omega-6 series play a significant role in health and disease by generating potent modulatory molecules for inflammatory responses, including eicosanoids (prostaglandins, and leukotrienes), and cytokines (interleukins) and affecting the gene expression of various bioactive molecules. Gamma linolenic acid (GLA, all cis 6, 9, 12-Octadecatrienoic acid, C18:3, n-6), is produced in the body from linoleic acid (all cis 6,9-octadecadienoic acid), an essential fatty acid of omega-6 series by the enzyme delta-6-desaturase. Preformed GLA is present in trace amounts in green leafy vegetables and in nuts. The most significant source of GLA for infants is breast milk. GLA is further metabolized to dihomogamma linlenic acid (DGLA) which undergoes oxidative metabolism by cyclooxygenases and lipoxygenases to produce anti-inflammatory eicosanoids (prostaglandins of series 1 and leukotrienes of series 3). GLA and its metabolites also affect expression of various genes where by regulating the levels of gene products including matrix proteins. These gene products play a significant role in immune functions and also in cell death (apoptosis). The present review will emphasize the role of GLA in modulating inflammatory response, and hence its potential applications as an anti-inflammatory nutrient or adjuvant.

  2. Solid acids for green chemistry.

    PubMed

    Clark, James H

    2002-09-01

    Solid acids and especially those based on micelle-templated silicas and other mesoporous high surface area support materials are beginning to play a significant role in the greening of fine and specialty chemicals manufacturing processes. A wide range of important organic reactions can be efficiently catalyzed by these materials, which can be designed to provide different types of acidity as well as high degrees of reaction selectivity. The solid acids generally have high turnover numbers and can be easily separated from the organic components. The combination of this chemistry with innovative reaction engineering offers exciting opportunities for innovative green chemical manufacturing in the future. PMID:12234209

  3. Arsanilic acid toxicity in rabbits.

    PubMed

    Confer, A W; Ward, B C; Hines, F A

    1980-04-01

    Rations from several rabbitries experiencing increased mortality, weight loss and diminished reproduction were analyzed for arsanilic acid. Levels of less than 56 ppm of arsanilic acid were found. A 30 day trial was conducted where arsanilic acid was given in doses of 1.6-16.2 mg/day in water to weanling and adult rabbits. The higher doses induced diarrhea, terminal convulsions and death. Weight loss or reduced weight gains occurred in six of seven treated groups. No significant gross or microscopic lesions were observed. Chemical analysis demonstrated the presence of increased total hepatic arsenic levels in treated compared to control rabbits.

  4. Chemiluminescent measurement of atmospheric acid

    NASA Technical Reports Server (NTRS)

    Stedman, D. H.; Kok, G. L.

    1974-01-01

    The design and construction of a gas phase acid sensitive analyzer are reported. These studies showed that the chemical system was a practical analytical method. A complete instrument was developed and prepared for field testing. A Titan 3-C rocket was scheduled for launching on February 11, 1974. Through preparations made by NASA Langley the instrument was set up to monitor the acid concentration in the rocket exhaust. Due to adverse wind conditions no acid was detected. This entire trip is described in detail.

  5. Be an acid rain detective

    SciTech Connect

    Atwill, L.

    1982-07-01

    Acid rain is discussed in a question and answer format. The article is aimed at educating sport fishermen on the subject, and also to encourage them to write their congressmen, senators, and the President about the acid rain problem. The article also announces the availability of an acid rain test kit available through the magazine, ''Sports Afield.'' The kit consists of pH-test paper that turns different shades of pink and blue according to the pH of the water tested. The color of the test paper is then compared to a color chart furnished in the kit and an approximate pH can be determined.

  6. Decarboxylative functionalization of cinnamic acids.

    PubMed

    Borah, Arun Jyoti; Yan, Guobing

    2015-08-14

    Decarboxylative functionalization of α,β-unsaturated carboxylic acids is an emerging area that has been developed significantly in recent years. This critical review focuses on the different decarboxylative functionalization reactions of cinnamic acids leading to the formation of various C-C and C-heteroatom bonds. Apart from metal carboxylates, decarboxylation in cinnamic acids has been achieved efficiently under metal-free conditions, particularly via the use of hypervalent iodine reagents. We believe this review will encourage organic chemists to develop vinylic decarboxylation in a more appealing way with an understanding of new mechanistic insight.

  7. PRODUCTION OF TRIFLUOROACETIC ACID COMPOUNDS

    DOEpatents

    Haworth, W.N.; Stacey, M.

    1949-08-30

    A process is described for the preparation of trifluoroacetic acid. Acetone vapor diluted wlth nitrogen and fluorine also diluted with nltrogen are fed separately at a temperature of about 210 deg C into a reaction vessel containing a catalyst mass selected from-the group consisting of silver and gold. The temperature in the reaction vessel is maintained in the range of 200 deg to 250 deg C. The reaction product, trifluoroacetyl fluoride, is absorbed in aqueous alkali solution. Trifluoroacetic acid is recovered from the solution by acidification wlth an acid such as sulfuric followed by steam distillation.

  8. Acid rain: chemistry and transport.

    PubMed

    Irwin, J G; Williams, M L

    1988-01-01

    This review describes the more important features of the emission, chemistry, transport and deposition of pollutants involved in acid deposition. Global emissions, both natural and man-made, of sulphur and nitrogen oxides are discussed and examples of spatial distributions and trends over the last century presented. The more significant chemical and physical processes involved in the transformation of the primary emissions into their acidic end products are described, including a summary of the approximate timescales of the processes involved. Measurements and modelled calculations of spatial and temporal patterns in the deposition of acidic pollutants by both wet and dry pathways are presented.

  9. Free acidity measurement - a review.

    PubMed

    Srinivasan, T G; Vasudeva Rao, P R

    2014-01-01

    Free acidity is an important parameter especially in the presence of hydrolysable ions. Several methods have been developed for the determination of free acidity, attributing due importance to the accuracy and the precision of the measurement with the aim of the easiness of the methodology as well as post-measurement recovery in mind. This review covers important methods for the determination of free acidity with emphasis on actinide containing solutions, reported in the literature over the past several decades classifying them into different categories.

  10. Amino Acids from a Comet

    NASA Technical Reports Server (NTRS)

    Cook, Jamie Elisla

    2009-01-01

    NASA's Stardust spacecraft returned samples from comet 81P/Wild 2 to Earth in January 2006. Examinations of the organic compounds in cometary samples can reveal information about the prebiotic organic inventory present on the early Earth and within the early Solar System, which may have contributed to the origin of life. Preliminary studies of Stardust material revealed the presence of a suite of organic compounds including several amines and amino acids, but the origin of these compounds (cometary- vs. terrestrial contamination) could not be identified. We have recently measured the carbon isotopic ratios of these amino acids to determine their origin, leading to the first detection of a coetary amino acid.

  11. Can crops tolerate acid rain

    SciTech Connect

    Kaplan, J.K.

    1989-11-01

    This brief article describes work by scientists at the ARS Air Quality-Plant Growth and Development Laboratory in Raleigh, North Carolina, that indicates little damage to crops as a result of acid rain. In studies with simulated acid rain and 216 exposed varieties of 18 crops, there were no significant injuries nor was there reduced growth in most species. Results of chronic and acute exposures were correlated in sensitive tomato and soybean plants and in tolerant winter wheat and lettuce plants. These results suggest that 1-hour exposures could be used in the future to screen varieties for sensitivity to acid rain.

  12. 40 CFR 721.10679 - Carboxylic acid, substituted alkylstannylene ester, reaction products with inorganic acid tetra...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... alkylstannylene ester, reaction products with inorganic acid tetra alkyl ester (generic). 721.10679 Section 721... Carboxylic acid, substituted alkylstannylene ester, reaction products with inorganic acid tetra alkyl ester... identified generically as carboxylic acid, substituted alkylstannylene ester, reaction products...

  13. Treatment of Amino Acid Metabolism Disorders

    MedlinePlus

    ... Treatment of amino acid metabolism disorders Treatment of amino acid metabolism disorders E-mail to a friend Please ... this page It's been added to your dashboard . Amino acid metabolism disorders are rare health conditions that affect ...

  14. Acid preservation systems for food products

    SciTech Connect

    Tiberio, J. E.; Cirigiano, M. C.

    1984-10-16

    Fumaric acid is used in combination with critical amounts of acetic acid to preserve acid containing food products from microbiological spoilage in the absence of or at reduced levels of chemical preservative.

  15. Genetics Home Reference: sialic acid storage disease

    MedlinePlus

    ... Home Health Conditions sialic acid storage disease sialic acid storage disease Enable Javascript to view the expand/ ... Download PDF Open All Close All Description Sialic acid storage disease is an inherited disorder that primarily ...

  16. Treatment of Fatty Acid Oxidation Disorders

    MedlinePlus

    ... of fatty acid oxidation disorders Treatment of fatty acid oxidation disorders E-mail to a friend Please ... page It's been added to your dashboard . Fatty acid oxidation disorders are rare health conditions that affect ...

  17. Molar extinction coefficients of some fatty acids

    NASA Astrophysics Data System (ADS)

    Sandhu, G. K.; Singh, Kulwant; Lark, B. S.; Gerward, L.

    2002-10-01

    The attenuation of gamma rays in some fatty acids, viz. formic acid (CH 2O 2), acetic acid (C 2H 4O 2), propionic acid (C 3H 6O 2), butyric acid (C 4H 8O 2), n-hexanoic acid (C 6H 12O 2), n-caprylic acid (C 8H 16O 2), lauric acid (C 12H 24O 2), myristic acid (C 14H 28O 2), palmitic acid (C 16H 32O 2), oleic acid (C 18H 34O 2) and stearic acid (C 18H 36O 2), has been measured at the photon energies 81, 356, 511, 662, 1173 and 1332 keV. Experimental values for the molar extinction coefficient, the effective atomic number and the electron density have been derived and compared with theoretical calculations. There is good agreement between experiment and theory.

  18. Biotechnological production of citric acid

    PubMed Central

    Max, Belén; Salgado, José Manuel; Rodríguez, Noelia; Cortés, Sandra; Converti, Attilio; Domínguez, José Manuel

    2010-01-01

    This work provides a review about the biotechnological production of citric acid starting from the physicochemical properties and industrial applications, mainly in the food and pharmaceutical sectors. Several factors affecting citric acid fermentation are discussed, including carbon source, nitrogen and phosphate limitations, pH of culture medium, aeration, trace elements and morphology of the fungus. Special attention is paid to the fundamentals of biochemistry and accumulation of citric acid. Technologies employed at industrial scale such as surface or submerged cultures, mainly employing Aspergillus niger, and processes carried out with Yarrowia lipolytica, as well as the technology for recovering the product are also described. Finally, this review summarizes the use of orange peels and other by-products as feedstocks for the bioproduction of citric acid. PMID:24031566

  19. Simulated acid rain on crops

    SciTech Connect

    Plocher, M.D.; Perrigan, S.C.; Hevel, R.J.; Cooper, R.M.; Moss, D.N.

    1985-10-01

    In 1981, simulated H/sub 2/SO/sub 4/ acid rain was applied to alfalfa and tall fescue and a 2:1 ratio of H/sub 2/SO/sub 4/:HNO/sub 3/ acid rain was applied to alfalfa, tall fescue, barley, wheat, potato, tomato, radish, and corn crops growing in the open field at Corvallis, Oregon. Careful attention was given to effects of the acid rain on the appearance of the foliage, and the effects on yield were measured. Because the effect of pH 4.0 rain on corn yield was the only significant effect noted in the 1981 studies, in 1982, more-extensive studies of the effect of simulated H/sub 2/SO/sub 4//HNO/sub 3/ rain on corn were conducted. No significant effects of acid rain were found on foliage appearance, or on yield of grain or stover in the 1982 studies.

  20. Low acid producing solid propellants

    NASA Technical Reports Server (NTRS)

    Bennett, Robert R.

    1995-01-01

    The potential environmental effects of the exhaust products of conventional rocket propellants have been assessed by various groups. Areas of concern have included stratospheric ozone, acid rain, toxicity, air quality and global warming. Some of the studies which have been performed on this subject have concluded that while the impacts of rocket use are extremely small, there are propellant development options which have the potential to reduce those impacts even further. This paper discusses the various solid propellant options which have been proposed as being more environmentally benign than current systems by reducing HCI emissions. These options include acid neutralized, acid scavenged, and nonchlorine propellants. An assessment of the acid reducing potential and the viability of each of these options is made, based on current information. Such an assessment is needed in order to judge whether the potential improvements justify the expenditures of developing the new propellant systems.

  1. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  2. Biopreservation by lactic acid bacteria.

    PubMed

    Stiles, M E

    1996-10-01

    Biopreservation refers to extended storage life and enhanced safety of foods using the natural microflora and (or) their antibacterial products. Lactic acid bacteria have a major potential for use in biopreservation because they are safe to consume and during storage they naturally dominate the microflora of many foods. In milk, brined vegetables, many cereal products and meats with added carbohydrate, the growth of lactic acid bacteria produces a new food product. In raw meats and fish that are chill stored under vacuum or in an environment with elevated carbon dioxide concentration, the lactic acid bacteria become the dominant population and preserve the meat with a "hidden' fermentation. The same applies to processed meats provided that the lactic acid bacteria survive the heat treatment or they are inoculated onto the product after heat treatment. This paper reviews the current status and potential for controlled biopreservation of foods. PMID:8879414

  3. Phosphonic acid based exchange resins

    DOEpatents

    Horwitz, E.P.; Alexandratos, S.D.; Gatrone, R.C.; Chiarizia, R.

    1995-09-12

    An ion exchange resin is described for extracting metal ions from a liquid waste stream. An ion exchange resin is prepared by copolymerizing a vinylidene diphosphonic acid with styrene, acrylonitrile and divinylbenzene. 10 figs.

  4. Lead/acid battery myths

    NASA Astrophysics Data System (ADS)

    Moseley, P. T.

    The lead/acid battery deserves a more positive image than has been traditional heretofore—particularly with respect to a number of aspects that relate to its utility as a power source for electric vehicles. Recent results from a large internationally coordinated research programme indicate that: (i) with proper attention to construction, valve-regulated lead/acid batteries can be deep-discharged many times without capacity loss; (ii) lead/acid batteries can be recharged extremely rapidly so that long journeys of electric vehicles become a realistic possibility; (iii) ranges of over 150 km between charges are achievable, and (iv) the introduction of significant numbers of lead/acid-powered electric vehicles does offer a beneficial environmental impact.

  5. Making cents of acid recovery

    SciTech Connect

    Ondrey, G.; Shanley, A.

    1993-04-01

    Acid recovery may be expensive, but rising transportation and landfill costs may soon make it the only alternative. Traditionally, acids used in processes from titanium dioxide production to gasoline alkylation and metal pickling were neutralized and discharged into waterways or injected into deep wells. Today, however, discharge permits are being phased out in many countries, and deep well injection is coming under closer scrutiny. An even cheaper option was selling spent acid to fertilizer producers, who used it to dissolve phosphate ores. Health concerns, a depressed fertilizer market and tightening disposal regulations for gypsum byproduct have dried up this option. The paper discusses the processes and costs involved in spent acid regeneration, gypsum-free gas treatments, and problems with explosive contaminants.

  6. Glucaric acids from Leonurus japonicus.

    PubMed

    Jiang, Jianshuang; Li, Yixiu; Feng, Ziming; Yang, Yanan; Zhang, Peicheng

    2015-12-01

    Three new glucaric acids, namely 2-feruloyl-4-syringoyl or 5-feruloyl-3-syringoyl glucaric acid (1), 2-syringoyl-4-feruloyl or 5-syringoyl-3-feruloyl glucaric acid (2), and 3-feruloyl-4-syringoyl or 4-feruloyl-3-syringoyl glucaric acid (3), were isolated from Leonurus japonicus Houtt. Their structures were elucidated by detailed spectroscopic means including UV, IR, HR-ESI-MS, 1D and 2D NMR data spectra. The bioactive assays of compounds 1-3 against hepatoprotection activity were determined. The result suggested that compound 2 exhibited a moderate hepatoprotection activity and the cell survival rate was 74% (10(-5)mol/L), using bicyclol (survival rate: 66%, 10(-5)mol/L) as a positive control. Furthermore, compounds 1-3 were evaluated cytotoxic activities in vitro using HCT-8, Bel-7402, BGC-823, A-549, and A2780 model and the results exhibited no obvious cytotoxicity activity.

  7. Biopreservation by lactic acid bacteria.

    PubMed

    Stiles, M E

    1996-10-01

    Biopreservation refers to extended storage life and enhanced safety of foods using the natural microflora and (or) their antibacterial products. Lactic acid bacteria have a major potential for use in biopreservation because they are safe to consume and during storage they naturally dominate the microflora of many foods. In milk, brined vegetables, many cereal products and meats with added carbohydrate, the growth of lactic acid bacteria produces a new food product. In raw meats and fish that are chill stored under vacuum or in an environment with elevated carbon dioxide concentration, the lactic acid bacteria become the dominant population and preserve the meat with a "hidden' fermentation. The same applies to processed meats provided that the lactic acid bacteria survive the heat treatment or they are inoculated onto the product after heat treatment. This paper reviews the current status and potential for controlled biopreservation of foods.

  8. Microbial production of lactic acid.

    PubMed

    Eiteman, Mark A; Ramalingam, Subramanian

    2015-05-01

    Lactic acid is an important commodity chemical having a wide range of applications. Microbial production effectively competes with chemical synthesis methods because biochemical synthesis permits the generation of either one of the two enantiomers with high optical purity at high yield and titer, a result which is particularly beneficial for the production of poly(lactic acid) polymers having specific properties. The commercial viability of microbial lactic acid production relies on utilization of inexpensive carbon substrates derived from agricultural or waste resources. Therefore, optimal lactic acid formation requires an understanding and engineering of both the competing pathways involved in carbohydrate metabolism, as well as pathways leading to potential by-products which both affect product yield. Recent research leverages those biochemical pathways, while researchers also continue to seek strains with improved tolerance and ability to perform under desirable industrial conditions, for example, of pH and temperature.

  9. Phosphonic acid based exchange resins

    DOEpatents

    Horwitz, E. Philip; Alexandratos, Spiro D.; Gatrone, Ralph C.; Chiarizia, Ronato

    1995-01-01

    An ion exchange resin for extracting metal ions from a liquid waste stream. An ion exchange resin is prepared by copolymerizing a vinylidene diphosphonic acid with styrene, acrylonitrile and divinylbenzene.

  10. 21 CFR 184.1009 - Adipic acid.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Adipic acid. 184.1009 Section 184.1009 Food and... Substances Affirmed as GRAS § 184.1009 Adipic acid. (a) Adipic acid (C6H10O4, CAS Reg. No. 00124-04-9) is also known as 1,4-butanedicarboxylic acid or hexane-dioic acid. It is prepared by nitric acid...

  11. 21 CFR 184.1009 - Adipic acid.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Adipic acid. 184.1009 Section 184.1009 Food and... Substances Affirmed as GRAS § 184.1009 Adipic acid. (a) Adipic acid (C6H10O4, CAS Reg. No. 00124-04-9) is also known as 1,4-butanedicarboxylic acid or hexane-dioic acid. It is prepared by nitric acid...

  12. 21 CFR 184.1091 - Succinic acid.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Succinic acid. 184.1091 Section 184.1091 Food and... Substances Affirmed as GRAS § 184.1091 Succinic acid. (a) Succinic acid (C4H6O4, CAS Reg. No. 110-15-6), also referred to as amber acid and ethylenesuccinic acid, is the chemical 1,4-butanedioic acid. It...

  13. 21 CFR 184.1091 - Succinic acid.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Succinic acid. 184.1091 Section 184.1091 Food and....1091 Succinic acid. (a) Succinic acid (C4H6O4, CAS Reg. No. 110-15-6), also referred to as amber acid and ethylenesuccinic acid, is the chemical 1,4-butanedioic acid. It is commercially prepared...

  14. 21 CFR 184.1009 - Adipic acid.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Adipic acid. 184.1009 Section 184.1009 Food and... Substances Affirmed as GRAS § 184.1009 Adipic acid. (a) Adipic acid (C6H10O4, CAS Reg. No. 00124-04-9) is also known as 1,4-butanedicarboxylic acid or hexane-dioic acid. It is prepared by nitric acid...

  15. 21 CFR 184.1091 - Succinic acid.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Succinic acid. 184.1091 Section 184.1091 Food and... Substances Affirmed as GRAS § 184.1091 Succinic acid. (a) Succinic acid (C4H6O4, CAS Reg. No. 110-15-6), also referred to as amber acid and ethylenesuccinic acid, is the chemical 1,4-butanedioic acid. It...

  16. 21 CFR 184.1009 - Adipic acid.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Adipic acid. 184.1009 Section 184.1009 Food and... Substances Affirmed as GRAS § 184.1009 Adipic acid. (a) Adipic acid (C6H10O4, CAS Reg. No. 00124-04-9) is also known as 1,4-butanedicarboxylic acid or hexane-dioic acid. It is prepared by nitric acid...

  17. 21 CFR 184.1091 - Succinic acid.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Succinic acid. 184.1091 Section 184.1091 Food and... Substances Affirmed as GRAS § 184.1091 Succinic acid. (a) Succinic acid (C4H6O4, CAS Reg. No. 110-15-6), also referred to as amber acid and ethylenesuccinic acid, is the chemical 1,4-butanedioic acid. It...

  18. 21 CFR 184.1091 - Succinic acid.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Succinic acid. 184.1091 Section 184.1091 Food and... Substances Affirmed as GRAS § 184.1091 Succinic acid. (a) Succinic acid (C4H6O4, CAS Reg. No. 110-15-6), also referred to as amber acid and ethylenesuccinic acid, is the chemical 1,4-butanedioic acid. It...

  19. 21 CFR 184.1009 - Adipic acid.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Adipic acid. 184.1009 Section 184.1009 Food and....1009 Adipic acid. (a) Adipic acid (C6H10O4, CAS Reg. No. 00124-04-9) is also known as 1,4-butanedicarboxylic acid or hexane-dioic acid. It is prepared by nitric acid oxidation of cyclohexanol...

  20. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.