Science.gov

Sample records for 40s small ribosomal

  1. Satratoxin G interaction with 40S and 60S ribosomal subunits precedes apoptosis in the macrophage

    SciTech Connect

    Bae, Hee Kyong; Shinozuka, Junko; Islam, Zahidul; Pestka, James J.

    2009-06-01

    Satratoxin G (SG) and other macrocyclic trichothecene mycotoxins are potent inhibitors of eukaryotic translation that are potentially immunosuppressive. The purpose of this research was to test the hypothesis that SG-induced apoptosis in the macrophage correlates with binding of this toxin to the ribosome. Exposure of RAW 264.7 murine macrophages to SG at concentrations of 10 to 80 ng/ml induced DNA fragmentation within 4 h that was indicative of apoptosis. To relate these findings to ribosome binding of SG, RAW cells were exposed to different toxin concentrations for various time intervals, ribosomal fractions isolated by sucrose density gradient ultracentrifugation and resultant fractions analyzed for SG by competitive ELISA. SG was found to specifically interact with 40S and 60S ribosomal subunits as early as 5 min and that, at high concentrations or extended incubation times, the toxin induced polysome disaggregation. While co-incubation with the simple Type B trichothecene DON had no effect on SG uptake into cell cytoplasm, it inhibited SG binding to the ribosome, suggesting that the two toxins bound to identical sites and that SG binding was reversible. Although both SG and DON induced mobilization of p38 and JNK 1/2 to the ribosome, phosphorylation of ribosomal bound MAPKs occurred only after DON treatment. SG association with the 40S and 60S subunits was also observed in the PC-12 neuronal cell model which is similarly susceptible to apoptosis. To summarize, SG rapidly binds small and large ribosomal subunits in a concentration- and time-dependent manner that was consistent with induction of apoptosis.

  2. The unfolded protein response triggers site-specific regulatory ubiquitylation of 40S ribosomal proteins

    PubMed Central

    Rising, Lisa; Mak, Raymond; Webb, Kristofor; Kaiser, Stephen E.; Zuzow, Nathan; Riviere, Paul; Yang, Bing; Fenech, Emma; Tang, Xin; Lindsay, Scott A.; Christianson, John C.; Hampton, Randolph Y.; Wasserman, Steven A.; Bennett, Eric J.

    2015-01-01

    Summary Insults to endoplasmic reticulum (ER) homeostasis activate the unfolded protein response (UPR), which elevates protein folding and degradation capacity and attenuates protein synthesis. While a role for ubiquitin in regulating the degradation of misfolded ER-resident proteins is well described, ubiquitin-dependent regulation of translational reprogramming during the UPR remains uncharacterized. Using global quantitative ubiquitin proteomics, we identify evolutionarily conserved, site-specific regulatory ubiquitylation of 40S ribosomal proteins. We demonstrate that these events occur on assembled cytoplasmic ribosomes and are stimulated by both UPR activation and translation inhibition. We further show that ER stress-stimulated regulatory 40S ribosomal ubiquitylation occurs on a timescale similar to eIF2α phosphorylation, is dependent upon PERK signaling, and is required for optimal cell survival during chronic UPR activation. In total, these results reveal regulatory 40S ribosomal ubiquitylation as a previously uncharacterized and important facet of eukaryotic translational control. PMID:26051182

  3. Sequential domain assembly of ribosomal protein S3 drives 40S subunit maturation

    PubMed Central

    Mitterer, Valentin; Murat, Guillaume; Réty, Stéphane; Blaud, Magali; Delbos, Lila; Stanborough, Tamsyn; Bergler, Helmut; Leulliot, Nicolas; Kressler, Dieter; Pertschy, Brigitte

    2016-01-01

    Eukaryotic ribosomes assemble by association of ribosomal RNA with ribosomal proteins into nuclear precursor particles, which undergo a complex maturation pathway coordinated by non-ribosomal assembly factors. Here, we provide functional insights into how successive structural re-arrangements in ribosomal protein S3 promote maturation of the 40S ribosomal subunit. We show that S3 dimerizes and is imported into the nucleus with its N-domain in a rotated conformation and associated with the chaperone Yar1. Initial assembly of S3 with 40S precursors occurs via its C-domain, while the N-domain protrudes from the 40S surface. Yar1 is replaced by the assembly factor Ltv1, thereby fixing the S3 N-domain in the rotated orientation and preventing its 40S association. Finally, Ltv1 release, triggered by phosphorylation, and flipping of the S3 N-domain into its final position results in the stable integration of S3. Such a stepwise assembly may represent a new paradigm for the incorporation of ribosomal proteins. PMID:26831757

  4. Pre-40S ribosome biogenesis factor Tsr1 is an inactive structural mimic of translational GTPases

    PubMed Central

    McCaughan, Urszula M.; Jayachandran, Uma; Shchepachev, Vadim; Chen, Zhuo Angel; Rappsilber, Juri; Tollervey, David; Cook, Atlanta G.

    2016-01-01

    Budding yeast Tsr1 is a ribosome biogenesis factor with sequence similarity to GTPases, which is essential for cytoplasmic steps in 40S subunit maturation. Here we present the crystal structure of Tsr1 at 3.6 Å. Tsr1 has a similar domain architecture to translational GTPases such as EF-Tu and the selenocysteine incorporation factor SelB. However, active site residues required for GTP binding and hydrolysis are absent, explaining the lack of enzymatic activity in previous analyses. Modelling of Tsr1 into cryo-electron microscopy maps of pre-40S particles shows that a highly acidic surface of Tsr1 is presented on the outside of pre-40S particles, potentially preventing premature binding to 60S subunits. Late pre-40S maturation also requires the GTPase eIF5B and the ATPase Rio1. The location of Tsr1 is predicted to block binding by both factors, strongly indicating that removal of Tsr1 is an essential step during cytoplasmic maturation of 40S ribosomal subunits. PMID:27250689

  5. Pre-40S ribosome biogenesis factor Tsr1 is an inactive structural mimic of translational GTPases.

    PubMed

    McCaughan, Urszula M; Jayachandran, Uma; Shchepachev, Vadim; Chen, Zhuo Angel; Rappsilber, Juri; Tollervey, David; Cook, Atlanta G

    2016-01-01

    Budding yeast Tsr1 is a ribosome biogenesis factor with sequence similarity to GTPases, which is essential for cytoplasmic steps in 40S subunit maturation. Here we present the crystal structure of Tsr1 at 3.6 Å. Tsr1 has a similar domain architecture to translational GTPases such as EF-Tu and the selenocysteine incorporation factor SelB. However, active site residues required for GTP binding and hydrolysis are absent, explaining the lack of enzymatic activity in previous analyses. Modelling of Tsr1 into cryo-electron microscopy maps of pre-40S particles shows that a highly acidic surface of Tsr1 is presented on the outside of pre-40S particles, potentially preventing premature binding to 60S subunits. Late pre-40S maturation also requires the GTPase eIF5B and the ATPase Rio1. The location of Tsr1 is predicted to block binding by both factors, strongly indicating that removal of Tsr1 is an essential step during cytoplasmic maturation of 40S ribosomal subunits. PMID:27250689

  6. Rrp12 and the Exportin Crm1 Participate in Late Assembly Events in the Nucleolus during 40S Ribosomal Subunit Biogenesis

    PubMed Central

    Moriggi, Giulia; Nieto, Blanca; Dosil, Mercedes

    2014-01-01

    During the biogenesis of small ribosomal subunits in eukaryotes, the pre-40S particles formed in the nucleolus are rapidly transported to the cytoplasm. The mechanisms underlying the nuclear export of these particles and its coordination with other biogenesis steps are mostly unknown. Here we show that yeast Rrp12 is required for the exit of pre-40S particles to the cytoplasm and for proper maturation dynamics of upstream 90S pre-ribosomes. Due to this, in vivo elimination of Rrp12 leads to an accumulation of nucleoplasmic 90S to pre-40S transitional particles, abnormal 35S pre-rRNA processing, delayed elimination of processing byproducts, and no export of intermediate pre-40S complexes. The exportin Crm1 is also required for the same pre-ribosome maturation events that involve Rrp12. Thus, in addition to their implication in nuclear export, Rrp12 and Crm1 participate in earlier biosynthetic steps that take place in the nucleolus. Our results indicate that, in the 40S subunit synthesis pathway, the completion of early pre-40S particle assembly, the initiation of byproduct degradation and the priming for nuclear export occur in an integrated manner in late 90S pre-ribosomes. PMID:25474739

  7. Cyclic nucleotide-independent protein kinases from ribosomes and phosphorylation of a single 40S ribosomal subunit protein in zoospores of Blastocladiella emersonii.

    PubMed

    Bonato, M C; da Costa Maia, J C; Juliani, M H

    1983-06-01

    Cyclic nucleotide-independent protein kinase (EC 2.7.1.37) activity was found in the nuclear cap organelle, within which ribosomes of zoospores of Blastocladiella emersonii are sequestered. Two protein kinase activities were resolved from the high-salt wash fraction of zoospore ribosomes by selective adsorption to DEAE-cellulose. Both enzymes phosphorylated in vitro a 32,000 Mr protein of the 40S ribosomal subunit. Phosphorylation of this ribosomal protein, which exhibits electrophoretic properties similar to those of mammalian ribosomal protein S6, was also observed in vivo in 32P-labeled zoospores. PMID:6853450

  8. Eudistomin C, an Antitumor and Antiviral Natural Product, Targets 40S Ribosome and Inhibits Protein Translation.

    PubMed

    Ota, Yu; Chinen, Takumi; Yoshida, Keisuke; Kudo, Shun; Nagumo, Yoko; Shiwa, Yuh; Yamada, Ryosuke; Umihara, Hirotatsu; Iwasaki, Kotaro; Masumoto, Hiroshi; Yokoshima, Satoshi; Yoshikawa, Hirofumi; Fukuyama, Tohru; Kobayashi, Junichi; Usui, Takeo

    2016-09-01

    Eudistomin C (EudiC), a natural product, shows potent antitumor and antiviral activities, but the target molecule and the mechanism of action remain to be revealed. Here, we show that the 40S ribosome is the target in EudiC cytotoxicity. We isolated EudiC-resistant mutants from a multidrug-sensitive yeast strain, and a genetic analysis classified these YER (yeast EudiC resistance) mutants into three complementation groups. A genome-wide study revealed that the YER1-6 mutation is in the uS11 gene (RPS14A). Biotinylated EudiC pulled down Rps14p-containing complexes from 40S and 80S ribosomes, but not from the 60S ribosome. EudiC strongly inhibited translation of the wild-type strain but not of YER1-6 in cells and in vitro. These results indicate that EudiC is a protein synthesis inhibitor targeting the uS11-containing ribosomal subunit, and shows cytotoxicity by inhibiting protein translation. PMID:27304596

  9. The DEAD-box Protein Rok1 Orchestrates 40S and 60S Ribosome Assembly by Promoting the Release of Rrp5 from Pre-40S Ribosomes to Allow for 60S Maturation

    PubMed Central

    Khoshnevis, Sohail; Askenasy, Isabel; Dattolo, Maria D.; Young-Erdos, Crystal L.; Stroupe, M. Elizabeth; Karbstein, Katrin

    2016-01-01

    DEAD-box proteins are ubiquitous regulators of RNA biology. While commonly dubbed “helicases,” their activities also include duplex annealing, adenosine triphosphate (ATP)-dependent RNA binding, and RNA-protein complex remodeling. Rok1, an essential DEAD-box protein, and its cofactor Rrp5 are required for ribosome assembly. Here, we use in vivo and in vitro biochemical analyses to demonstrate that ATP-bound Rok1, but not adenosine diphosphate (ADP)-bound Rok1, stabilizes Rrp5 binding to 40S ribosomes. Interconversion between these two forms by ATP hydrolysis is required for release of Rrp5 from pre-40S ribosomes in vivo, thereby allowing Rrp5 to carry out its role in 60S subunit assembly. Furthermore, our data also strongly suggest that the previously described accumulation of snR30 upon Rok1 inactivation arises because Rrp5 release is blocked and implicate a previously undescribed interaction between Rrp5 and the DEAD-box protein Has1 in mediating snR30 accumulation when Rrp5 release from pre-40S subunits is blocked. PMID:27280440

  10. The DEAD-box Protein Rok1 Orchestrates 40S and 60S Ribosome Assembly by Promoting the Release of Rrp5 from Pre-40S Ribosomes to Allow for 60S Maturation.

    PubMed

    Khoshnevis, Sohail; Askenasy, Isabel; Johnson, Matthew C; Dattolo, Maria D; Young-Erdos, Crystal L; Stroupe, M Elizabeth; Karbstein, Katrin

    2016-06-01

    DEAD-box proteins are ubiquitous regulators of RNA biology. While commonly dubbed "helicases," their activities also include duplex annealing, adenosine triphosphate (ATP)-dependent RNA binding, and RNA-protein complex remodeling. Rok1, an essential DEAD-box protein, and its cofactor Rrp5 are required for ribosome assembly. Here, we use in vivo and in vitro biochemical analyses to demonstrate that ATP-bound Rok1, but not adenosine diphosphate (ADP)-bound Rok1, stabilizes Rrp5 binding to 40S ribosomes. Interconversion between these two forms by ATP hydrolysis is required for release of Rrp5 from pre-40S ribosomes in vivo, thereby allowing Rrp5 to carry out its role in 60S subunit assembly. Furthermore, our data also strongly suggest that the previously described accumulation of snR30 upon Rok1 inactivation arises because Rrp5 release is blocked and implicate a previously undescribed interaction between Rrp5 and the DEAD-box protein Has1 in mediating snR30 accumulation when Rrp5 release from pre-40S subunits is blocked. PMID:27280440

  11. Late-assembly of human ribosomal protein S20 in the cytoplasm is essential for the functioning of the small subunit ribosome

    SciTech Connect

    Tai, Lin-Ru; Chou, Chang-Wei; Wu, Jing-Ying; Kirby, Ralph; Lin, Alan

    2013-11-15

    Using immuno-fluorescent probing and Western blotting analysis, we reveal the exclusive cytoplasm nature of the small subunit ribosomal protein S20. To illustrate the importance of the cellular compartmentation of S20 to the function of small subunit 40S, we created a nuclear resident S20{sub NLS} mutant gene and examined polysome profile of cells that had been transfected with the S20{sub NLS} gene. As a result, we observed the formation of recombinant 40S carried S20{sub NLS} but this recombinant 40S was never found in the polysome, suggesting such a recombinant 40S was translation incompetent. Moreover, by the tactic of the energy depletion and restoration, we were able to restrain the nuclear-resided S20{sub NLS} in the cytoplasm. Yet, along a progressive energy restoration, we observed the presence of recombinant 40S subunits carrying the S20{sub NLS} in the polysome. This proves that S20 needs to be cytoplasmic in order to make a functional 40S subunit. Furthermore, it also implies that the assembly order of ribosomal protein in eukaryote is orderly regulated. - Highlights: • The step of S20 assembled on 40S is happened in the cytoplasm. • A small subunit assembled with a nuclear S20{sub NLS} is translational incompetence. • Using energy depletion and recovery to manipulate the cellular compartment of S20{sub NLS}. • Cytoplasm-retained S20{sub NLS} is crucial for creating a functional small subunit.

  12. Hrr25/CK1δ-directed release of Ltv1 from pre-40S ribosomes is necessary for ribosome assembly and cell growth

    PubMed Central

    Ghalei, Homa; Schaub, Franz X.; Doherty, Joanne R.; Noguchi, Yoshihiko; Roush, William R.; Cleveland, John L.; Stroupe, M. Elizabeth

    2015-01-01

    Casein kinase 1δ/ε (CK1δ/ε) and their yeast homologue Hrr25 are essential for cell growth. Further, CK1δ is overexpressed in several malignancies, and CK1δ inhibitors have shown promise in several preclinical animal studies. However, the substrates of Hrr25 and CK1δ/ε that are necessary for cell growth and survival are unknown. We show that Hrr25 is essential for ribosome assembly, where it phosphorylates the assembly factor Ltv1, which causes its release from nascent 40S subunits and allows subunit maturation. Hrr25 inactivation or expression of a nonphosphorylatable Ltv1 variant blocked Ltv1 release in vitro and in vivo, and prevented entry into the translation-like quality control cycle. Conversely, phosphomimetic Ltv1 variants rescued viability after Hrr25 depletion. Finally, Ltv1 knockdown in human breast cancer cells impaired apoptosis induced by CK1δ/ε inhibitors, establishing that the antiproliferative activity of these inhibitors is due, at least in part, to disruption of ribosome assembly. These findings validate the ribosome assembly pathway as a novel target for the development of anticancer therapeutics. PMID:25778921

  13. The interaction pattern between a homology model of 40S ribosomal S9 protein of Rhizoctonia solani and 1-hydroxyphenaize by docking study.

    PubMed

    Dharni, Seema; Sanchita; Samad, Abdul; Sharma, Ashok; Patra, Dharani Dhar

    2014-01-01

    1-Hydroxyphenazine (1-OH-PHZ), a natural product from Pseudomonas aeruginosa strain SD12, was earlier reported to have potent antifungal activity against Rhizoctonia solani. In the present work, the antifungal activity of 1-OH-PHZ on 40S ribosomal S9 protein was validated by molecular docking approach. 1-OH-PHZ showed interaction with two polar contacts with residues, Arg69 and Phe19, which inhibits the synthesis of fungal protein. Our study reveals that 1-OH-PHZ can be a potent inhibitor of 40S ribosomal S9 protein of R. solani that may be a promising approach for the management of fungal diseases. PMID:24864254

  14. The Interaction Pattern between a Homology Model of 40S Ribosomal S9 Protein of Rhizoctonia solani and 1-Hydroxyphenaize by Docking Study

    PubMed Central

    Dharni, Seema; Sanchita; Sharma, Ashok; Patra, Dharani Dhar

    2014-01-01

    1-Hydroxyphenazine (1-OH-PHZ), a natural product from Pseudomonas aeruginosa strain SD12, was earlier reported to have potent antifungal activity against Rhizoctonia solani. In the present work, the antifungal activity of 1-OH-PHZ on 40S ribosomal S9 protein was validated by molecular docking approach. 1-OH-PHZ showed interaction with two polar contacts with residues, Arg69 and Phe19, which inhibits the synthesis of fungal protein. Our study reveals that 1-OH-PHZ can be a potent inhibitor of 40S ribosomal S9 protein of R. solani that may be a promising approach for the management of fungal diseases. PMID:24864254

  15. Germiston virus transcriptase requires active 40S ribosomal subunits and utilizes capped cellular RNAs.

    PubMed Central

    Vialat, P; Bouloy, M

    1992-01-01

    The transcriptase associated with Germiston virus was assayed in an in vitro reaction in which transcription was coupled to translation by adding reticulocyte lysate under the appropriate salt conditions. When analyzed in polyacrylamide gels, the major transcripts migrated like authentic S mRNAs and possessed 12- to 18-base-long nontemplated 5' extensions similar to the 5' end of viral mRNAs. These transcripts were functional for the synthesis of at least proteins N and NSS. When translation was inhibited by adding protein synthesis inhibitors such as puromycin, cycloheximide, and anisomycin, a drastic inhibitory effect was observed on the synthesis of the complete S mRNA transcripts. However, initiation and part of the elongation process were still active, since short and incomplete RNA molecules with RNA primers at their 5' ends were synthesized. On the other hand, we found that edeine, another inhibitor of protein synthesis, stimulated not only synthesis of S mRNAs but also that of the full-length S cRNAs. Taking into account the mode of action of this antibiotic, we discuss the results, which emphasize the crucial role of active ribosomes during bunyavirus transcription and confirm the observations reported on La Crosse virions. Moreover, we showed that the RNA transcripts synthesized in a transcription-translation reaction were capped and that most of them have acquired the 5' terminal sequences of the alpha- or beta-globin mRNA. Images PMID:1731108

  16. Compilation of small ribosomal subunit RNA structures.

    PubMed Central

    Neefs, J M; Van de Peer, Y; De Rijk, P; Chapelle, S; De Wachter, R

    1993-01-01

    The database on small ribosomal subunit RNA structure contained 1804 nucleotide sequences on April 23, 1993. This number comprises 365 eukaryotic, 65 archaeal, 1260 bacterial, 30 plastidial, and 84 mitochondrial sequences. These are stored in the form of an alignment in order to facilitate the use of the database as input for comparative studies on higher-order structure and for reconstruction of phylogenetic trees. The elements of the postulated secondary structure for each molecule are indicated by special symbols. The database is available on-line directly from the authors by ftp and can also be obtained from the EMBL nucleotide sequence library by electronic mail, ftp, and on CD ROM disk. PMID:8332525

  17. HCV IRES interacts with the 18S rRNA to activate the 40S ribosome for subsequent steps of translation initiation

    PubMed Central

    Malygin, Alexey A.; Kossinova, Olga A.; Shatsky, Ivan N.; Karpova, Galina G.

    2013-01-01

    Previous analyses of complexes of 40S ribosomal subunits with the hepatitis C virus (HCV) internal ribosome entry site (IRES) have revealed contacts made by the IRES with ribosomal proteins. Here, using chemical probing, we show that the HCV IRES also contacts the backbone and bases of the CCC triplet in the 18S ribosomal RNA (rRNA) expansion segment 7. These contacts presumably provide interplay between IRES domain II and the AUG codon close to ribosomal protein S5, which causes a rearrangement of 18S rRNA structure in the vicinity of the universally conserved nucleotide G1639. As a result, G1639 becomes exposed and the corresponding site of the 40S subunit implicated in transfer RNA discrimination can select . These data are the first demonstration at nucleotide resolution of direct IRES–rRNA interactions and how they induce conformational transition in the 40S subunit allowing the HCV IRES to function without AUG recognition initiation factors. PMID:23873958

  18. Hepatitis-C-virus-like internal ribosome entry sites displace eIF3 to gain access to the 40S subunit

    NASA Astrophysics Data System (ADS)

    Hashem, Yaser; Des Georges, Amedee; Dhote, Vidya; Langlois, Robert; Liao, Hstau Y.; Grassucci, Robert A.; Pestova, Tatyana V.; Hellen, Christopher U. T.; Frank, Joachim

    2013-11-01

    Hepatitis C virus (HCV) and classical swine fever virus (CSFV) messenger RNAs contain related (HCV-like) internal ribosome entry sites (IRESs) that promote 5'-end independent initiation of translation, requiring only a subset of the eukaryotic initiation factors (eIFs) needed for canonical initiation on cellular mRNAs. Initiation on HCV-like IRESs relies on their specific interaction with the 40S subunit, which places the initiation codon into the P site, where it directly base-pairs with eIF2-bound initiator methionyl transfer RNA to form a 48S initiation complex. However, all HCV-like IRESs also specifically interact with eIF3 (refs 2, 5, 6, 7, 9, 10, 11, 12), but the role of this interaction in IRES-mediated initiation has remained unknown. During canonical initiation, eIF3 binds to the 40S subunit as a component of the 43S pre-initiation complex, and comparison of the ribosomal positions of eIF3 and the HCV IRES revealed that they overlap, so that their rearrangement would be required for formation of ribosomal complexes containing both components. Here we present a cryo-electron microscopy reconstruction of a 40S ribosomal complex containing eIF3 and the CSFV IRES. Remarkably, although the position and interactions of the CSFV IRES with the 40S subunit in this complex are similar to those of the HCV IRES in the 40S-IRES binary complex, eIF3 is completely displaced from its ribosomal position in the 43S complex, and instead interacts through its ribosome-binding surface exclusively with the apical region of domain III of the IRES. Our results suggest a role for the specific interaction of HCV-like IRESs with eIF3 in preventing ribosomal association of eIF3, which could serve two purposes: relieving the competition between the IRES and eIF3 for a common binding site on the 40S subunit, and reducing formation of 43S complexes, thereby favouring translation of viral mRNAs.

  19. Identification of neighbouring protein pairs in the rat liver 40-S ribosomal subunits cross-linked with dimethyl suberimidate.

    PubMed

    Terao, K; Uchiumi, T; Kobayashi, Y; Ogata, K

    1980-01-24

    (1) The 40-S ribosomal subunits of rat liver were treated with a bifunctional cross-linking reagent, dimethyl suberimidate. Cross-linked protein-protein dimers were separated by two-dimensional acrylamide gel electrophoresis. The stained cross-linked complexes within the gel were radioiodinated without the elution of proteins from the gel and were cloven into the original monomeric protein constituents by ammonolysis. The proteins in each dimer were finally identified by two-dimensional acrylamide gel electrophoresis of the cloven monomeric proteins, followed by radioautography of the stained gel. (2) The molecular weights of cross-linked complexes were determined by SDS-polyacrylamide gel electrophoresis and were compared with those of their constituent proteins. (3) The following dimers were proposed from these results: S3-S12 (S3 or S3a-S11), S4-S12 (S3b-S11, S5-S7 (S4-S6), S5-S22 (S4-S23 or S24), S6-S8 (S5-S7), S8-S16 (S7-S18), S17-S21 (S16--S19) and S22A-S22B (S23-S24), designated according to our numbering system [1]. The designations according to the proposed uniform nomenclature [2] are described in parentheses. PMID:7353033

  20. Position of the CrPV IRES on the 40S subunit and factor dependence of IRES/80S ribosome assembly.

    PubMed

    Pestova, Tatyana V; Lomakin, Ivan B; Hellen, Christopher U T

    2004-09-01

    The cricket paralysis virus intergenic region internal ribosomal entry site (CrPV IGR IRES) can assemble translation initiation complexes by binding to 40S subunits without Met-tRNA(Met)(i) and initiation factors (eIFs) and then by joining directly with 60S subunits, yielding elongation-competent 80S ribosomes. Here, we report that eIF1, eIF1A and eIF3 do not significantly influence IRES/40S subunit binding but strongly inhibit subunit joining and the first elongation cycle. The IRES can avoid their inhibitory effect by its ability to bind directly to 80S ribosomes. The IRES's ability to bind to 40S subunits simultaneously with eIF1 allowed us to use directed hydroxyl radical cleavage to map its position relative to the known position of eIF1. A connecting loop in the IRES's pseudoknot (PK) III domain, part of PK II and the entire domain containing PK I are solvent-exposed and occupy the E site and regions of the P site that are usually occupied by Met-tRNA(Met)(i). PMID:15332113

  1. Re-analysis of cryoEM data on HCV IRES bound to 40S subunit of human ribosome integrated with recent structural information suggests new contact regions between ribosomal proteins and HCV RNA

    PubMed Central

    Joseph, Agnel Praveen; Bhat, Prasanna; Das, Saumitra; Srinivasan, Narayanaswamy

    2014-01-01

    In this study, we combine available high resolution structural information on eukaryotic ribosomes with low resolution cryo-EM data on the Hepatitis C Viral RNA (IRES) human ribosome complex. Aided further by the prediction of RNA-protein interactions and restrained docking studies, we gain insights on their interaction at the residue level. We identified the components involved at the major and minor contact regions, and propose that there are energetically favorable local interactions between 40S ribosomal proteins and IRES domains. Domain II of the IRES interacts with ribosomal proteins S5 and S25 while the pseudoknot and the downstream domain IV region bind to ribosomal proteins S26, S28 and S5. We also provide support using UV cross-linking studies to validate our proposition of interaction between the S5 and IRES domains II and IV. We found that domain IIIe makes contact with the ribosomal protein S3a (S1e). Our model also suggests that the ribosomal protein S27 interacts with domain IIIc while S7 has a weak contact with a single base RNA bulge between junction IIIabc and IIId. The interacting residues are highly conserved among mammalian homologs while IRES RNA bases involved in contact do not show strict conservation. IRES RNA binding sites for S25 and S3a show the best conservation among related viral IRESs. The new contacts identified between ribosomal proteins and RNA are consistent with previous independent studies on RNA-binding properties of ribosomal proteins reported in literature, though information at the residue level is not available in previous studies. PMID:25268799

  2. Small protein domains fold inside the ribosome exit tunnel.

    PubMed

    Marino, Jacopo; von Heijne, Gunnar; Beckmann, Roland

    2016-03-01

    Cotranslational folding of small protein domains within the ribosome exit tunnel may be an important cellular strategy to avoid protein misfolding. However, the pathway of cotranslational folding has so far been described only for a few proteins, and therefore, it is unclear whether folding in the ribosome exit tunnel is a common feature for small protein domains. Here, we have analyzed nine small protein domains and determined at which point during translation their folding generates sufficient force on the nascent chain to release translational arrest by the SecM arrest peptide, both in vitro and in live E. coli cells. We find that all nine protein domains initiate folding while still located well within the ribosome exit tunnel. PMID:26879042

  3. gar2 is a nucleolar protein from Schizosaccharomyces pombe required for 18S rRNA and 40S ribosomal subunit accumulation.

    PubMed Central

    Gulli, M P; Girard, J P; Zabetakis, D; Lapeyre, B; Melese, T; Caizergues-Ferrer, M

    1995-01-01

    Several nucleolar proteins, such as nucleolin, NOP1/fibrillarin, SSB1, NSR1 and GAR1 share a common glycine and arginine rich structural motif called the GAR domain. To identify novel nucleolar proteins from fission yeast we screened Schizosaccharomyces pombe genomic DNA libraries with a probe encompassing the GAR structural motif. Here we report the identification and characterization of a S.pombe gene coding for a novel nucleolar protein, designated gar2. The structure of the fission yeast gar2 is reminiscent of that of nucleolin from vertebrates and NSR1 from Saccharomyces cerevisiae. In addition, like these proteins, gar2 has a nucleolar localisation. The disruption of the gar2+ gene affects normal cell growth, leads to an accumulation of 35S pre-rRNA and a decrease of mature 18S rRNA steady state levels. Moreover, ribosomal profiles of the mutant show an increase of free 60S ribosomal subunits and an absence of free 40S ribosomal subunits. gar2 is able to rescue a S.cerevisiae mutant lacking NSR1, thus establishing gar2 as a functional homolog of NSR1. We propose that gar2 helps the assembly of pre-ribosomal particles containing 18S rRNA. Images PMID:7596817

  4. Essential ribosome assembly factor Fap7 regulates a hierarchy of RNA-protein interactions during small ribosomal subunit biogenesis.

    PubMed

    Hellmich, Ute A; Weis, Benjamin L; Lioutikov, Anatoli; Wurm, Jan Philip; Kaiser, Marco; Christ, Nina A; Hantke, Katharina; Kötter, Peter; Entian, Karl-Dieter; Schleiff, Enrico; Wöhnert, Jens

    2013-09-17

    Factor activating Pos9 (Fap7) is an essential ribosome biogenesis factor important for the assembly of the small ribosomal subunit with an uncommon dual ATPase and adenylate kinase activity. Depletion of Fap7 or mutations in its ATPase motifs lead to defects in small ribosomal subunit rRNA maturation, the absence of ribosomal protein Rps14 from the assembled subunit, and retention of the nascent small subunit in a quality control complex with the large ribosomal subunit. The molecular basis for the role of Fap7 in ribosome biogenesis is, however, not yet understood. Here we show that Fap7 regulates multiple interactions between the precursor rRNA, ribosomal proteins, and ribosome assembly factors in a hierarchical manner. Fap7 binds to Rps14 with a very high affinity. Fap7 binding blocks both rRNA-binding elements of Rps14, suggesting that Fap7 inhibits premature interactions of Rps14 with RNA. The Fap7/Rps14 interaction is modulated by nucleotide binding to Fap7. Rps14 strongly activates the ATPase activity but not the adenylate kinase activity of Fap7, identifying Rps14 as an example of a ribosomal protein functioning as an ATPase-activating factor. In addition, Fap7 inhibits the RNA cleavage activity of Nob1, the endonuclease responsible for the final maturation step of the small subunit rRNA, in a nucleotide independent manner. Thus, Fap7 may regulate small subunit biogenesis at multiple stages. PMID:24003121

  5. Towards a classification of E. coli ribosomal proteins: A hypothetical `small ribosome' as a primitive protein-synthesizing apparatus

    NASA Astrophysics Data System (ADS)

    Ohnishi, Koji

    1984-12-01

    Homologies were searched among the published primary sequences of 51 E. coli ribosomal proteins, partly by ‘eye’ and partly by computer-assisted methods. By employing Moore and Goodman's alignment statistics for evaluating homology levels, 33 out of these 51 ribosomal proteins has been classified into 9 homology groups, some of which being yet tentative and remaining to be further analyzed. Taking it into consideration that most ribosomal protein genes are clustered at str- stc region, rif region and several other regions, these results strongly suggest that most or all of the contemporary ribosomal proteins must have evolved by repeated gene duplications of very few (or only one) primitive ancestral ribosomal protein gene(s). Thus it is most reasonable to propose that a ‘ small ribosome’ consisting of very few (or only one) ribosomal protein(s) must have existed as a primitive protein-synthesizing apparatus.

  6. Dependency Map of Proteins in the Small Ribosomal Subunit

    PubMed Central

    Hamacher, Kay; Trylska, Joanna; McCammon, J. Andrew

    2006-01-01

    The assembly of the ribosome has recently become an interesting target for antibiotics in several bacteria. In this work, we extended an analytical procedure to determine native state fluctuations and contact breaking to investigate the protein stability dependence in the 30S small ribosomal subunit of Thermus thermophilus. We determined the causal influence of the presence and absence of proteins in the 30S complex on the binding free energies of other proteins. The predicted dependencies are in overall agreement with the experimentally determined assembly map for another organism, Escherichia coli. We found that the causal influences result from two distinct mechanisms: one is pure internal energy change, the other originates from the entropy change. We discuss the implications on how to target the ribosomal assembly most effectively by suggesting six proteins as targets for mutations or other hindering of their binding. Our results show that by blocking one out of this set of proteins, the association of other proteins is eventually reduced, thus reducing the translation efficiency even more. We could additionally determine the binding dependency of THX—a peptide not present in the ribosome of E. coli—and suggest its assembly path. PMID:16485038

  7. Database on the structure of small ribosomal subunit RNA.

    PubMed Central

    Van de Peer, Y; Caers, A; De Rijk, P; De Wachter, R

    1998-01-01

    About 8600 complete or nearly complete sequences are now available from the Antwerp database on small ribosomal subunit RNA. All these sequences are aligned with one another on the basis of the adopted secondary structure model, which is corroborated by the observation of compensating substitutions in the alignment. Literature references, accession numbers and detailed taxonomic information are also compiled. The database can be consulted via the World Wide Web at URL http://rrna.uia.ac.be/ssu/ PMID:9399829

  8. Exploring accessibility of structural elements of the mammalian 40S ribosomal mRNA entry channel at various steps of translation initiation.

    PubMed

    Sharifulin, Dmitri E; Bartuli, Yulia S; Meschaninova, Maria I; Ven'yaminova, Aliya G; Graifer, Dmitri M; Karpova, Galina G

    2016-10-01

    In this work, we studied how the accessibility of structural elements of the mammalian 40S ribosomal mRNA entry channel, ribosomal protein (rp) uS3 and helix (h) 16 of the 18S rRNA, changes upon the translation initiation. In particular, we examined the accessibility of rp uS3 for binding of unstructured RNAs and of riboses in h16 towards attack with benzoyl cyanide (BzCN) in complexes assembled in rabbit reticulocyte lysate utilizing synthetic oligoribonucleotides as well as full-length and truncated up to the initiation AUG codon hepatitis C virus IRES as model mRNAs. With both mRNA types, the rp uS3 peptide recognizing single-stranded RNAs was shown to become shielded only in those 48S preinitiation complexes (PICs) that contained eIF3j bound to 40S subunit in the area between the decoding site and the mRNA entry channel. Chemical probing with BzCN revealed that h16 in the 48S PICs containing eIF3j or scanning factor DHX29 is strongly shielded; the effect was observed with all the mRNAs used, and h16 remained protected as well in 80S post-initiation complexes lacking these factors. Altogether, the obtained results allowed us to suggest that eIF3j bound at the 48S PICs makes the rp uS3 inaccessible for binding of RNAs and this factor subunit is responsible for the decrease of h16 conformational flexibility; the latter is manifested as reduced accessibility of h16 to BzCN. Thus, our findings provide new insights into how eIF3j is implicated in ensuring the proper conformation of the mRNA entry channel, thereby facilitating mRNA loading. PMID:27346718

  9. Database on the structure of small ribosomal subunit RNA.

    PubMed Central

    Van de Peer, Y; Jansen, J; De Rijk, P; De Wachter, R

    1997-01-01

    The Antwerp database on small ribosomal subunit RNA now offers more than 6000 nucleotide sequences (August 1996). All these sequences are stored in the form of an alignment based on the adopted secondary structure model, which is corroborated by the observation of compensating substitutions in the alignment. Besides the primary and secondary structure information, literature references, accession numbers and detailed taxonomic information are also compiled. For ease of use, the complete database is made available to the scientific community via World Wide Web at URL http://rrna.uia.ac.be/ssu/ . PMID:9016516

  10. Database on the structure of small ribosomal subunit RNA.

    PubMed Central

    Van de Peer, Y; Van den Broeck, I; De Rijk, P; De Wachter, R

    1994-01-01

    The database on small ribosomal subunit RNA structure contains (June 1994) 2824 nucleotide sequences. All these sequences are stored in the form of an alignment based on the adopted secondary structure model, which in turn is corroborated by the observation of compensating substitutions in the alignment. The complete database is made available to the scientific community through anonymous ftp on our server in Antwerp. A special effort was made to improve electronic retrieval and a program is supplied that allows to create different file formats. The database can also be obtained from the EMBL nucleotide sequence library. PMID:7524022

  11. Database on the structure of small ribosomal subunit RNA.

    PubMed Central

    Van de Peer, Y; Nicolaï, S; De Rijk, P; De Wachter, R

    1996-01-01

    The Antwerp database on small ribosomal subunit RNA offers over 4300 nucleotide sequences (August 1995). All these sequences are stored in the form of an alignment based on the adopted secondary structure model, which in turn is corroborated by the observation of compensating substitutions in the alignment. Besides the primary and secondary structure information, literature references, accession numbers and detailed taxonomic information are also compiled. The complete database is made available to the scientific community through anonymous ftp and World Wide Web(WWW). PMID:8594609

  12. Ribosomal small subunit domains radiate from a central core.

    PubMed

    Gulen, Burak; Petrov, Anton S; Okafor, C Denise; Vander Wood, Drew; O'Neill, Eric B; Hud, Nicholas V; Williams, Loren Dean

    2016-01-01

    The domain architecture of a large RNA can help explain and/or predict folding, function, biogenesis and evolution. We offer a formal and general definition of an RNA domain and use that definition to experimentally characterize the rRNA of the ribosomal small subunit. Here the rRNA comprising a domain is compact, with a self-contained system of molecular interactions. A given rRNA helix or stem-loop must be allocated uniquely to a single domain. Local changes such as mutations can give domain-wide effects. Helices within a domain have interdependent orientations, stabilities and interactions. With these criteria we identify a core domain (domain A) of small subunit rRNA. Domain A acts as a hub, linking the four peripheral domains and imposing orientational and positional restraints on the other domains. Experimental characterization of isolated domain A, and mutations and truncations of it, by methods including selective 2'OH acylation analyzed by primer extension and circular dichroism spectroscopy are consistent with our architectural model. The results support the utility of the concept of an RNA domain. Domain A, which exhibits structural similarity to tRNA, appears to be an essential core of the small ribosomal subunit. PMID:26876483

  13. Ribosomal small subunit domains radiate from a central core

    NASA Astrophysics Data System (ADS)

    Gulen, Burak; Petrov, Anton S.; Okafor, C. Denise; Vander Wood, Drew; O'Neill, Eric B.; Hud, Nicholas V.; Williams, Loren Dean

    2016-02-01

    The domain architecture of a large RNA can help explain and/or predict folding, function, biogenesis and evolution. We offer a formal and general definition of an RNA domain and use that definition to experimentally characterize the rRNA of the ribosomal small subunit. Here the rRNA comprising a domain is compact, with a self-contained system of molecular interactions. A given rRNA helix or stem-loop must be allocated uniquely to a single domain. Local changes such as mutations can give domain-wide effects. Helices within a domain have interdependent orientations, stabilities and interactions. With these criteria we identify a core domain (domain A) of small subunit rRNA. Domain A acts as a hub, linking the four peripheral domains and imposing orientational and positional restraints on the other domains. Experimental characterization of isolated domain A, and mutations and truncations of it, by methods including selective 2‧OH acylation analyzed by primer extension and circular dichroism spectroscopy are consistent with our architectural model. The results support the utility of the concept of an RNA domain. Domain A, which exhibits structural similarity to tRNA, appears to be an essential core of the small ribosomal subunit.

  14. Ribosomal small subunit domains radiate from a central core

    PubMed Central

    Gulen, Burak; Petrov, Anton S.; Okafor, C. Denise; Vander Wood, Drew; O’Neill, Eric B.; Hud, Nicholas V.; Williams, Loren Dean

    2016-01-01

    The domain architecture of a large RNA can help explain and/or predict folding, function, biogenesis and evolution. We offer a formal and general definition of an RNA domain and use that definition to experimentally characterize the rRNA of the ribosomal small subunit. Here the rRNA comprising a domain is compact, with a self-contained system of molecular interactions. A given rRNA helix or stem-loop must be allocated uniquely to a single domain. Local changes such as mutations can give domain-wide effects. Helices within a domain have interdependent orientations, stabilities and interactions. With these criteria we identify a core domain (domain A) of small subunit rRNA. Domain A acts as a hub, linking the four peripheral domains and imposing orientational and positional restraints on the other domains. Experimental characterization of isolated domain A, and mutations and truncations of it, by methods including selective 2′OH acylation analyzed by primer extension and circular dichroism spectroscopy are consistent with our architectural model. The results support the utility of the concept of an RNA domain. Domain A, which exhibits structural similarity to tRNA, appears to be an essential core of the small ribosomal subunit. PMID:26876483

  15. Parkin induces upregulation of 40S ribosomal protein SA and posttranslational modification of cytokeratins 8 and 18 in human cervical cancer cells.

    PubMed

    Song, Dae-Geun; Kim, Yoon Suk; Jung, Byung Chul; Rhee, Ki-Jong; Pan, Cheol-Ho

    2013-12-01

    Parkin was originally identified as a protein associated with Parkinson's disease. Recently, numerous research studies have suggested that parkin acts as a tumor suppressor. In accordance with these studies, we previously reported that overexpression of parkin in HeLa cells induced growth inhibition. To elucidate possible mechanisms by which parkin may inhibit cell growth, HeLa cells were infected with adenoviruses expressing either the parkin gene or adenovirus alone for 72 h and a total proteomic analysis was performed using 2-D gel electrophoresis followed by LC-MS/MS. We identified three proteins whose expression changed between the two groups: the 40S ribosomal protein SA (RPSA) was downregulated in parkin virus-infected cells, and cytokeratins 8 and 18 exhibited an acid shift in pI value without a change in molecular weight, suggesting that these proteins became phosphorylated in parkin virus-infected cells. The changes in these three proteins were first observed at 60 h postinfection and were most dramatic at 72 h postinfection. Because upregulation of RPSA and dephosphorylation of cytokeratins 8/18 have been linked with tumor progression, these data suggest that parkin may inhibit cell growth, at least in part, by decreasing RPSA expression and inducing phosphorylation of cytokeratin 8/18. PMID:23990477

  16. A Single Acetylation of 18 S rRNA Is Essential for Biogenesis of the Small Ribosomal Subunit in Saccharomyces cerevisiae*

    PubMed Central

    Ito, Satoshi; Akamatsu, Yu; Noma, Akiko; Kimura, Satoshi; Miyauchi, Kenjyo; Ikeuchi, Yoshiho; Suzuki, Takeo; Suzuki, Tsutomu

    2014-01-01

    Biogenesis of eukaryotic ribosome is a complex event involving a number of non-ribosomal factors. During assembly of the ribosome, rRNAs are post-transcriptionally modified by 2′-O-methylation, pseudouridylation, and several base-specific modifications, which are collectively involved in fine-tuning translational fidelity and/or modulating ribosome assembly. By mass-spectrometric analysis, we demonstrated that N4-acetylcytidine (ac4C) is present at position 1773 in the 18 S rRNA of Saccharomyces cerevisiae. In addition, we found an essential gene, KRE33 (human homolog, NAT10), that we renamed RRA1 (ribosomal RNA cytidine acetyltransferase 1) encoding an RNA acetyltransferase responsible for ac4C1773 formation. Using recombinant Rra1p, we could successfully reconstitute ac4C1773 in a model rRNA fragment in the presence of both acetyl-CoA and ATP as substrates. Upon depletion of Rra1p, the 23 S precursor of 18 S rRNA was accumulated significantly, which resulted in complete loss of 18 S rRNA and small ribosomal subunit (40 S), suggesting that ac4C1773 formation catalyzed by Rra1p plays a critical role in processing of the 23 S precursor to yield 18 S rRNA. When nuclear acetyl-CoA was depleted by inactivation of acetyl-CoA synthetase 2 (ACS2), we observed temporal accumulation of the 23 S precursor, indicating that Rra1p modulates biogenesis of 40 S subunit by sensing nuclear acetyl-CoA concentration. PMID:25086048

  17. Eukaryote-specific extensions in ribosomal proteins of the small subunit: Structure and function.

    PubMed

    Ghosh, Arnab; Komar, Anton A

    2015-01-01

    High-resolution structures of yeast ribosomes have improved our understanding of the architecture and organization of eukaryotic rRNA and proteins, as well as eukaryote-specific extensions present in some conserved ribosomal proteins. Despite this progress, assignment of specific functions to individual proteins and/or eukaryote-specific protein extensions remains challenging. It has been suggested that eukaryote-specific extensions of conserved proteins from the small ribosomal subunit may facilitate eukaryote-specific reactions in the initiation phase of protein synthesis. This review summarizes emerging data describing the structural and functional significance of eukaryote-specific extensions of conserved small ribosomal subunit proteins, particularly their possible roles in recruitment and spatial organization of eukaryote-specific initiation factors. PMID:26779416

  18. Yeast eIF4B binds to the head of the 40S ribosomal subunit and promotes mRNA recruitment through its N-terminal and internal repeat domains.

    PubMed

    Walker, Sarah E; Zhou, Fujun; Mitchell, Sarah F; Larson, Victoria S; Valasek, Leos; Hinnebusch, Alan G; Lorsch, Jon R

    2013-02-01

    Eukaryotic translation initiation factor (eIF)4B stimulates recruitment of mRNA to the 43S ribosomal pre-initiation complex (PIC). Yeast eIF4B (yeIF4B), shown previously to bind single-stranded (ss) RNA, consists of an N-terminal domain (NTD), predicted to be unstructured in solution; an RNA-recognition motif (RRM); an unusual domain comprised of seven imperfect repeats of 26 amino acids; and a C-terminal domain. Although the mechanism of yeIF4B action has remained obscure, most models have suggested central roles for its RRM and ssRNA-binding activity. We have dissected the functions of yeIF4B's domains and show that the RRM and its ssRNA-binding activity are dispensable in vitro and in vivo. Instead, our data indicate that the 7-repeats and NTD are the most critical domains, which mediate binding of yeIF4B to the head of the 40S ribosomal subunit via interaction with Rps20. This interaction induces structural changes in the ribosome's mRNA entry channel that could facilitate mRNA loading. We also show that yeIF4B strongly promotes productive interaction of eIF4A with the 43S•mRNA PIC in a manner required for efficient mRNA recruitment. PMID:23236192

  19. The quaternary structure of the ribosome from E. coli. A neutron small-angle scattering study

    NASA Astrophysics Data System (ADS)

    Nowotny, V.; Nowotny, P.; Voß, H.; Nierhaus, K. H.; May, R. P.

    1989-01-01

    Ribosomes synthesize proteins in living cells. The E. coli ribosome is composed of a small (30S) and a large subunit (50S). They consist of different proteins (21 or 34, respectively) and of ribosomal RNAs (16S or 23S and 5S). The inter-protein distances within the ribosomal subunits can be measured from scattering experiments with selectively labeled protein pairs from which the quaternary distribution of the proteins is reconstructed. We have developed the strategy of the “glassy ribosome”: the rRNAs and the proteins are deuterated such that they reach the same scattering density and are “invisible” in a corresponding buffer solution. A preliminary quaternary map of the 50S subunit which is the result of our new method for the extraction of the distances from the scattering data as well as shape parameters of proteins in situ will be presented.

  20. Mammalian mitochondrial ribosomal small subunit (MRPS) genes: A putative role in human disease.

    PubMed

    Gopisetty, Gopal; Thangarajan, Rajkumar

    2016-09-01

    Mitochondria are prominently understood as power houses producing ATP the primary energy currency of the cell. However, mitochondria are also known to play an important role in apoptosis and autophagy, and mitochondrial dysregulation can lead to pathological outcomes. Mitochondria are known to contain 1500 proteins of which only 13 are coded by mitochondrial DNA and the rest are coded by nuclear genes. Protein synthesis in mitochondria involves mitochondrial ribosomes which are 55-60S particles and are composed of small 28S and large 39S subunits. A feature of mammalian mitoribosome which differentiate it from bacterial ribosomes is the increased protein content. The human mitochondrial ribosomal protein (MRP) gene family comprises of 30 genes which code for mitochondrial ribosomal small subunit and 50 genes for the large subunit. The present review focuses on the mitochondrial ribosomal small subunit genes (MRPS), presents an overview of the literature and data gleaned from publicly available gene and protein expression databases. The survey revealed aberrations in MRPS gene expression patterns in varied human diseases indicating a putative role in their etiology. PMID:27170550

  1. Genome-wide RNAi Screening Identifies Protein Modules Required for 40S Subunit Synthesis in Human Cells.

    PubMed

    Badertscher, Lukas; Wild, Thomas; Montellese, Christian; Alexander, Leila T; Bammert, Lukas; Sarazova, Marie; Stebler, Michael; Csucs, Gabor; Mayer, Thomas U; Zamboni, Nicola; Zemp, Ivo; Horvath, Peter; Kutay, Ulrike

    2015-12-29

    Ribosome biogenesis is a highly complex process requiring many assisting factors. Studies in yeast have yielded comprehensive knowledge of the cellular machinery involved in this process. However, many aspects of ribosome synthesis are different in higher eukaryotes, and the global set of mammalian ribosome biogenesis factors remains unexplored. We used an imaging-based, genome-wide RNAi screen to find human proteins involved in 40S ribosomal subunit biogenesis. Our analysis identified ∼ 300 factors, many part of essential protein modules such as the small subunit (SSU) processome, the eIF3 and chaperonin complexes, and the ubiquitin-proteasome system. We demonstrate a role for the vertebrate-specific factor RBIS in ribosome synthesis, uncover a requirement for the CRL4 E3 ubiquitin ligase in nucleolar ribosome biogenesis, and reveal that intracellular glutamine synthesis supports 40S subunit production. PMID:26711351

  2. rRNA Suppressor of a Eukaryotic Translation Initiation Factor 5B/Initiation Factor 2 Mutant Reveals a Binding Site for Translational GTPases on the Small Ribosomal Subunit▿

    PubMed Central

    Shin, Byung-Sik; Kim, Joo-Ran; Acker, Michael G.; Maher, Kathryn N.; Lorsch, Jon R.; Dever, Thomas E.

    2009-01-01

    The translational GTPases promote initiation, elongation, and termination of protein synthesis by interacting with the ribosome. Mutations that impair GTP hydrolysis by eukaryotic translation initiation factor 5B/initiation factor 2 (eIF5B/IF2) impair yeast cell growth due to failure to dissociate from the ribosome following subunit joining. A mutation in helix h5 of the 18S rRNA in the 40S ribosomal subunit and intragenic mutations in domain II of eIF5B suppress the toxic effects associated with expression of the eIF5B-H480I GTPase-deficient mutant in yeast by lowering the ribosome binding affinity of eIF5B. Hydroxyl radical mapping experiments reveal that the domain II suppressors interface with the body of the 40S subunit in the vicinity of helix h5. As the helix h5 mutation also impairs elongation factor function, the rRNA and eIF5B suppressor mutations provide in vivo evidence supporting a functionally important docking of domain II of the translational GTPases on the body of the small ribosomal subunit. PMID:19029250

  3. Morphology and Small-Subunit Ribosomal DNA Sequence of Henneguya Adiposa (Myxosporea) From Ictalurus punctatus (Siluriformes)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The original description of Henneguya adiposa, a myxozoan parasitizing channel catfish Ictalurus punctatus, is supplemented with new data on spore morphology, including photomicrographs and line drawings, as well as 18S small-subunit (SSU) ribosomal DNA (rDNA) sequence. Elongate, translucent, linear...

  4. Recruitment of the 40S Ribosome Subunit to the 3′-Untranslated Region (UTR) of a Viral mRNA, via the eIF4 Complex, Facilitates Cap-independent Translation*

    PubMed Central

    Sharma, Sohani Das; Kraft, Jelena J.; Miller, W. Allen; Goss, Dixie J.

    2015-01-01

    Barley yellow dwarf virus mRNA, which lacks both cap and poly(A) tail, has a translation element (3′-BTE) in its 3′-UTR essential for efficient translation initiation at the 5′-proximal AUG. This mechanism requires eukaryotic initiation factor 4G (eIF4G), subunit of heterodimer eIF4F (plant eIF4F lacks eIF4A), and 3′-BTE-5′-UTR interaction. Using fluorescence anisotropy, SHAPE (selective 2′-hydroxyl acylation analyzed by primer extension) analysis, and toeprinting, we found that (i) 40S subunits bind to BTE (Kd = 350 ± 30 nm), (ii) the helicase complex eIF4F-eIF4A-eIF4B-ATP increases 40S subunit binding (Kd = 120 ± 10 nm) to the conserved stem-loop I of the 3′-BTE by exposing more unpaired bases, and (iii) long distance base pairing transfers this complex to the 5′-end of the mRNA, where translation initiates. Although 3′-5′ interactions have been recognized as important in mRNA translation, barley yellow dwarf virus employs a novel mechanism utilizing the 3′-UTR as the primary site of ribosome recruitment. PMID:25792742

  5. Ribosome hijacking: a role for small protein B during trans-translation

    PubMed Central

    Nonin-Lecomte, Sylvie; Germain-Amiot, Noella; Gillet, Reynald; Hallier, Marc; Ponchon, Luc; Dardel, Frédéric; Felden, Brice

    2009-01-01

    Tight recognition of codon–anticodon pairings by the ribosome ensures the accuracy and fidelity of protein synthesis. In eubacteria, translational surveillance and ribosome rescue are performed by the ‘tmRNA–SmpB' system (transfer messenger RNA–small protein B). Remarkably, entry and accommodation of aminoacylated-tmRNA into stalled ribosomes occur without a codon–anticodon interaction but in the presence of SmpB. Here, we show that within a stalled ribosome, SmpB interacts with the three universally conserved bases G530, A1492 and A1493 that form the 30S subunit decoding centre, in which canonical codon–anticodon pairing occurs. The footprints at positions A1492 and A1493 of a small decoding centre, as well as on a set of conserved SmpB amino acids, were identified by nuclear magnetic resonance. Mutants at these residues display the same growth defects as for ΔsmpB strains. The SmpB protein has functional and structural similarities with initiation factor 1, and is proposed to be a functional mimic of the pairing between a codon and an anticodon. PMID:19132006

  6. The Small Ribosomal Subunit RNA Isoforms in Plasmodium Cynomolgi

    PubMed Central

    Corredor, V.; Enea, V.

    1994-01-01

    We report the isolation, characterization and analysis of the small subunit rRNA genes in Plasmodium cynomolgi (Ceylon). As in other Plasmodium species, these genes are present in low copy number, are unlinked and form two types that are distinct in sequence and are expressed stage specifically. The asexually expressed (type A) genes are present in four copies in the Ceylon(-) and in five copies in the Berok(-) strain. Surprisingly, the sexually expressed (type B) gene is present in a single copy. The vast majority of the differences between gene types is confined to the variable regions. The pattern of divergence is different from that observed in Plasmodium berghei or in Plasmodium falciparum. Analysis of the small subunit rRNA sequences of P. cynomolgi, P. berghei and P. falciparum, indicates that the two gene types do not evolve independently but rather interact (through gene conversion or some form of recombination) to such an extent as to erase whatever stage-specific sequence signatures they may have had in the last common ancestor. PMID:8005440

  7. Structural and functional studies of Bud23–Trm112 reveal 18S rRNA N7-G1575 methylation occurs on late 40S precursor ribosomes

    PubMed Central

    Létoquart, Juliette; Huvelle, Emmeline; Wacheul, Ludivine; Bourgeois, Gabrielle; Zorbas, Christiane; Graille, Marc; Heurgué-Hamard, Valérie; Lafontaine, Denis L. J.

    2014-01-01

    The eukaryotic small ribosomal subunit carries only four ribosomal (r) RNA methylated bases, all close to important functional sites. N7-methylguanosine (m7G) introduced at position 1575 on 18S rRNA by Bud23–Trm112 is at a ridge forming a steric block between P- and E-site tRNAs. Here we report atomic resolution structures of Bud23–Trm112 in the apo and S-adenosyl-l-methionine (SAM)-bound forms. Bud23 and Trm112 interact through formation of a β-zipper involving main-chain atoms, burying an important hydrophobic surface and stabilizing the complex. The structures revealed that the coactivator Trm112 undergoes an induced fit to accommodate its methyltransferase (MTase) partner. We report important structural similarity between the active sites of Bud23 and Coffea canephora xanthosine MTase, leading us to propose and validate experimentally a model for G1575 coordination. We identify Bud23 residues important for Bud23–Trm112 complex formation and recruitment to pre-ribosomes. We report that though Bud23–Trm112 binds precursor ribosomes at an early nucleolar stage, m7G methylation occurs at a late step of small subunit biogenesis, implying specifically delayed catalytic activation. Finally, we show that Bud23–Trm112 interacts directly with the box C/D snoRNA U3-associated DEAH RNA helicase Dhr1 supposedly involved in central pseudoknot formation; this suggests that Bud23–Trm112 might also contribute to controlling formation of this irreversible and dramatic structural reorganization essential to overall folding of small subunit rRNA. Our study contributes important new elements to our understanding of key molecular aspects of human ribosomopathy syndromes associated with WBSCR22 (human Bud23) malfunction. PMID:25489090

  8. Stage-specific assembly events of the 6-MDa small-subunit processome initiate eukaryotic ribosome biogenesis.

    PubMed

    Chaker-Margot, Malik; Hunziker, Mirjam; Barandun, Jonas; Dill, Brian D; Klinge, Sebastian

    2015-11-01

    Eukaryotic ribosome biogenesis involves a plethora of ribosome-assembly factors, and their temporal order of association with preribosomal RNA is largely unknown. By using Saccharomyces cerevisiae as a model organism, we developed a system that recapitulates and arrests ribosome assembly at early stages, thus providing in vivo snapshots of nascent preribosomal particles. Here we report the stage-specific order in which 70 ribosome-assembly factors associate with preribosomal RNA domains, thereby forming the 6-MDa small-subunit processome. PMID:26479197

  9. Structural and functional analysis of Escherichia coli ribosomes containing small deletions around position 1760 in the 23S ribosomal RNA.

    PubMed Central

    Zweib, C; Dahlberg, A E

    1984-01-01

    Three different small deletions were produced at a single Pvu 2 restriction site in E. coli 23S rDNA of plasmid pKK 3535 using exonuclease Bal 31. The deletions were located around position 1760 in 23S rRNA and were characterized by DNA sequencing as well as by direct fingerprinting and S1-mapping of the rRNA. Two of the mutant plasmids, Pvu 2-32 and Pvu 2-33, greatly reduced the growth rate of transformed cells while the third mutant, Pvu 2-14 grew as fast as cells containing the wild-type plasmid pKK 3535. All three mutant 23S rRNAs were incorporated into 50S-like particles and were even found in 70S ribosomes and polysomes in vivo. The conformation of mutant 23S rRNA in 50S subunits was probed with a double-strand specific RNase from cobra venom. These analyses revealed changes in the accessibility of cleavage sites near the deletions around position 1760 and in the area around position 800 in all three mutant rRNAs. We suggest, that an altered conformation of the rRNAs at the site of the deletion is responsible for the slow growth of cells containing mutant plasmids Pvu 2-32 and Pvu 2-33. Images PMID:6091057

  10. Substitution rate calibration of small subunit ribosomal RNA identifies chlorarachniophyte endosymbionts as remnants of green algae.

    PubMed Central

    Van de Peer, Y; Rensing, S A; Maier, U G; De Wachter, R

    1996-01-01

    Chlorarachniophytes are amoeboid algae with chlorophyll a and b containing plastids that are surrounded by four membranes instead of two as in plants and green algae. These extra membranes form important support for the hypothesis that chlorarachniophytes have acquired their plastids by the ingestion of another eukaryotic plastid-containing alga. Chlorarachniophytes also contain a small nucleus-like structure called the nucleomorph situated between the two inner and the two outer membranes surrounding the plastid. This nucleomorph is a remnant of the endosymbiont's nucleus and encodes, among other molecules, small subunit ribosomal RNA. Previous phylogenetic analyses on the basis of this molecule provided unexpected and contradictory evidence for the origin of the chlorarachniophyte endosymbiont. We developed a new method for measuring the substitution rates of the individual nucleotides of small subunit ribosomal RNA. From the resulting substitution rate distribution, we derived an equation that gives a more realistic relationship between sequence dissimilarity and evolutionary distance than equations previously available. Phylogenetic trees constructed on the basis of evolutionary distances computed by this new method clearly situate the chlorarachniophyte nucleomorphs among the green algae. Moreover, this relationship is confirmed by transversion analysis of the Chlorarachnion plastid small subunit ribosomal RNA. PMID:8755544

  11. Downregulation of ribosomal protein S6 inhibits the growth of non-small cell lung cancer by inducing cell cycle arrest, rather than apoptosis.

    PubMed

    Chen, Bojiang; Zhang, Wen; Gao, Jun; Chen, Hong; Jiang, Li; Liu, Dan; Cao, Yidan; Zhao, Shuang; Qiu, Zhixin; Zeng, Jing; Zhang, Shangfu; Li, Weimin

    2014-11-28

    Ribosomal protein S6 (rpS6), a component of the small 40S ribosomal subunit, has been found to be associated with multiple physiological and pathophysiological functions. However, its effects and mechanisms in non-small cell lung cancer (NSCLC) still remain unknown. Here, we showed that expressions of total rpS6 and phosphorylation rpS6 (p-rpS6) were both significantly overexpressed in NSCLC. Further survival analysis revealed the shortened overall survival (OS) and relapse-free survival (RFS) in p-rpS6 overexpressed patients and confirmed it as an independent adverse predictor. Stable downregulation of rpS6 in lung adenocarcinoma A549 and squamous cell carcinoma H520 cell lines was then achieved by two specific small hairpin RNA (shRNA) lentiviruses separately. Subsequent experiments showed that downregulation of rpS6 dramatically inhibited cell proliferation in vitro and tumorigenicity in vivo. Moreover, loss of rpS6 promoted cells arrested in G0-G1 phase and reduced in G2-M phase, along with the expression alterations of relative proteins. However, no notable change in apoptosis was observed. Collectively, these results suggested that rpS6 is overactivated in NSCLC and its downregulation suppresses the growth of NSCLC mainly by inducing G0-G1 cell cycle arrest rather than apoptosis. PMID:25199762

  12. Structure of the small ribosomal subunit RNA of the pulmonate snail, Limicolaria kambeul, and phylogenetic analysis of the Metazoa.

    PubMed

    Winnepennickx, B; Backeljau, T; van de Peer, Y; De Wachter, R

    1992-09-01

    The complete nucleotide sequence of the small ribosomal subunit RNA of the gastropod, Limicolaria kambeul, was determined and used to infer a secondary structure model. In order to clarify the phylogenetic position of the Mollusca among the Metazoa, an evolutionary tree was constructed by neighbor-joining, starting from an alignment of small ribosomal subunit RNA sequences. The Mollusca appear to be a monophyletic group, related to Arthropoda and Chordata in an unresolved trichotomy. PMID:1505675

  13. Structural aspects of RbfA action during small ribosomal subunit assembly

    PubMed Central

    Datta, Partha P.; Wilson, Daniel N.; Kawazoe, Masahito; Swami, Neil K.; Kaminishi, Tatsuya; Sharma, Manjuli R.; Booth, Timothy M.; Takemoto, Chie; Fucini, Paola; Yokoyama, Shigeyuki; Agrawal, Rajendra K.

    2007-01-01

    Summary Ribosome binding factor A (RbfA) is a bacterial cold-shock response protein, required for an efficient processing of the 5′end of the 16S ribosomal RNA (rRNA) during assembly of the small (30S) ribosomal subunit. Here we present a crystal structure of Thermus thermophilus RbfA and a three-dimensional cryo-electron microscopic (EM) map of the T. thermophilus 30S·RbfA complex. RbfA binds to the 30S subunit in a position overlapping the binding sites of the A- and P-site tRNAs, and RbfA’s functionally important C-terminus extends toward the 5′ end of the 16S rRNA. In the presence of RbfA, a portion of the 16S rRNA encompassing helix 44, which is known to be directly involved in mRNA decoding and tRNA binding, is displaced. These results shed light on the role played by RbfA during maturation of the 30S subunit, and also indicate how RbfA provides cells with a translational advantage under conditions of cold shock. PMID:17996707

  14. Nucleocytoplasmic transport of ribosomes in a eukaryotic system: Is there a facilitated transport process

    SciTech Connect

    Khanna-Gupta, A.; Ware, V.C. )

    1989-03-01

    The authors have examined the kinetics of the process by which ribosomes are exported from the nucleus to the cytoplasm using Xenopus laevis oocytes microinjected into the germinal vesicle with radiolabeled ribosomes or ribosomal subunits from X. laevis, Tetrahymena thermophila, or Escherichia coli. Microinjected eukaryotic mature ribosomes are redistributed into the oocyte cytoplasm by an apparent carrier-mediated transport process that exhibits saturation kinetics as increasing amounts of ribosomes are injected. T. thermophila ribosomes are competent to traverse the Xenopus nuclear envelope, suggesting that the basic mechanism underlying ribosome transport is evolutionarily conserved. Microinjected E. coli ribosomes are not transported in this system, indicating that prokaryotic ribosomes lack the signals required for transport. Surprisingly, coinjected small (40S) and large (60S) subunits from T. thermophila are transported significantly faster than individual subunits. These observations support a facilitated transport model for the translocation of ribosomal subunits as separate units across the nuclear envelope whereby the transport rate of 60S or 40S subunits is enhanced by the presence of the partner subunit. Although the basic features of the transport mechanism have been preserved through evolution, other aspects of the process may be mediated through species-specific interactions. They hypothesize that a species-specific nuclear 40S-60S subunit association may expedite the transport of individual subunits across the nuclear envelope.

  15. Phylogenetic position of Cryothecomonas inferred from nuclear-encoded small subunit ribosomal RNA.

    PubMed

    Kühn, S; Lange, M; Medlin, L K

    2000-12-01

    The systematic position of the genus Cryothecomonas has been determined from an analysis of the nuclear-encoded small subunit ribosomal RNA gene of Cryothecomonas longipes and two strains of Cryothecomonas aestivalis. Our phylogenetic trees inferred from maximum likelihood, distance and maximum parsimony methods robustly show that the genus Cryothecomonas clusters within the phylum Cercozoa, and is related to the sarcomonad flagellate Heteromita globosa. Morphological data supporting the taxonomic placement of Cryothecomonas near the sarcomonad flagellates has been compiled from the literature. The high number of nucleotide substitutions found between two morphologically indistinguishable strains of Cryothecomonas aestivalis suggests the possibility of cryptic species within Cryothecomonas aestivalis. PMID:11212894

  16. Phylogenetic classification of the frog pathogen Amphibiothecum (Dermosporidium) penneri based on small ribosomal subunit sequencing

    USGS Publications Warehouse

    Feldman, S.H.; Wimsatt, J.H.; Green, D.E.

    2005-01-01

    We determined 1,600 base pairs of DNA sequence in the 18S small ribosomal subunit from two geographically distinct isolates of Dermosporidium penneri. Maximum likelihood and parsimony analysis of these sequences place D. penneri in the order Dermocystida of the class Mesomycetozoea. The 18S rRNA sequences from these two isolates only differ within a single region of 16 contiguous nucleotides. Based on the distant phylogenetic relationship of these organisms to Amphibiocystidium ranae and similarity to Sphaerothecum destruens we propose the organism be renamed Amphibiothecum penneri.

  17. Stepwise and dynamic assembly of the earliest precursors of small ribosomal subunits in yeast.

    PubMed

    Zhang, Liman; Wu, Chen; Cai, Gaihong; Chen, She; Ye, Keqiong

    2016-03-15

    The eukaryotic ribosomal RNA (rRNA) is associated cotranscriptionally with numerous factors into an enormous 90S preribosomal particle that conducts early processing of small ribosomal subunits. The assembly pathway and structure of the 90S particle is poorly understood. Here, we affinity-purified and analyzed the constituents of yeast 90S particles that were assembled on a series of plasmid-encoded 3'-truncated pre-18S RNAs. We determined the assembly point of 65 proteins and the U3, U14, and snR30 small nucleolar RNAs (snoRNAs), revealing a stepwise and dynamic assembly map. The 5' external transcribed spacer (ETS) alone can nucleate a large complex. When the 18S rRNA is nearly complete, the 90S structure undergoes a dramatic reorganization, releasing U14, snR30, and 14 protein factors that bind earlier. We also identified a reference state of 90S that is fully assembled yet has not undergone 5'ETS processing. The assembly map present here provides a new framework to understand small subunit biogenesis. PMID:26980190

  18. Cryo-EM structure of the small subunit of the mammalian mitochondrial ribosome.

    PubMed

    Kaushal, Prem S; Sharma, Manjuli R; Booth, Timothy M; Haque, Emdadul M; Tung, Chang-Shung; Sanbonmatsu, Karissa Y; Spremulli, Linda L; Agrawal, Rajendra K

    2014-05-20

    The mammalian mitochondrial ribosomes (mitoribosomes) are responsible for synthesizing 13 membrane proteins that form essential components of the complexes involved in oxidative phosphorylation or ATP generation for the eukaryotic cell. The mammalian 55S mitoribosome contains significantly smaller rRNAs and a large mass of mitochondrial ribosomal proteins (MRPs), including large mito-specific amino acid extensions and insertions in MRPs that are homologous to bacterial ribosomal proteins and an additional 35 mito-specific MRPs. Here we present the cryo-EM structure analysis of the small (28S) subunit (SSU) of the 55S mitoribosome. We find that the mito-specific extensions in homologous MRPs generally are involved in inter-MRP contacts and in contacts with mito-specific MRPs, suggesting a stepwise evolution of the current architecture of the mitoribosome. Although most of the mito-specific MRPs and extensions of homologous MRPs are situated on the peripheral regions, they also contribute significantly to the formation of linings of the mRNA and tRNA paths, suggesting a tailor-made structural organization of the mito-SSU for the recruitment of mito-specific mRNAs, most of which do not possess a 5' leader sequence. In addition, docking of previously published coordinates of the large (39S) subunit (LSU) into the cryo-EM map of the 55S mitoribosome reveals that mito-specific MRPs of both the SSU and LSU are involved directly in the formation of six of the 15 intersubunit bridges. PMID:24799711

  19. Cryo-EM structure of the small subunit of the mammalian mitochondrial ribosome

    PubMed Central

    Kaushal, Prem S.; Sharma, Manjuli R.; Booth, Timothy M.; Haque, Emdadul M.; Tung, Chang-Shung; Sanbonmatsu, Karissa Y.; Spremulli, Linda L.; Agrawal, Rajendra K.

    2014-01-01

    The mammalian mitochondrial ribosomes (mitoribosomes) are responsible for synthesizing 13 membrane proteins that form essential components of the complexes involved in oxidative phosphorylation or ATP generation for the eukaryotic cell. The mammalian 55S mitoribosome contains significantly smaller rRNAs and a large mass of mitochondrial ribosomal proteins (MRPs), including large mito-specific amino acid extensions and insertions in MRPs that are homologous to bacterial ribosomal proteins and an additional 35 mito-specific MRPs. Here we present the cryo-EM structure analysis of the small (28S) subunit (SSU) of the 55S mitoribosome. We find that the mito-specific extensions in homologous MRPs generally are involved in inter-MRP contacts and in contacts with mito-specific MRPs, suggesting a stepwise evolution of the current architecture of the mitoribosome. Although most of the mito-specific MRPs and extensions of homologous MRPs are situated on the peripheral regions, they also contribute significantly to the formation of linings of the mRNA and tRNA paths, suggesting a tailor-made structural organization of the mito-SSU for the recruitment of mito-specific mRNAs, most of which do not possess a 5′ leader sequence. In addition, docking of previously published coordinates of the large (39S) subunit (LSU) into the cryo-EM map of the 55S mitoribosome reveals that mito-specific MRPs of both the SSU and LSU are involved directly in the formation of six of the 15 intersubunit bridges. PMID:24799711

  20. Integrative structural analysis of the UTPB complex, an early assembly factor for eukaryotic small ribosomal subunits

    PubMed Central

    Zhang, Cheng; Sun, Qi; Chen, Rongchang; Chen, Xining; Lin, Jinzhong; Ye, Keqiong

    2016-01-01

    Ribosome assembly is an essential and conserved cellular process in eukaryotes that requires numerous assembly factors. The six-subunit UTPB complex is an essential component of the 90S precursor of the small ribosomal subunit. Here, we analyzed the molecular architecture of UTPB using an integrative structural biology approach. We mapped the major interactions that associate each of six UTPB proteins. Crystallographic studies showed that Utp1, Utp21, Utp12 and Utp13 are evolutionarily related and form a dimer of dimers (Utp1–Utp21, Utp12–Utp13) through their homologous helical C-terminal domains. Molecular docking with crosslinking restraints showed that the WD domains of Utp12 and Utp13 are associated, as are the WD domains of Utp1, Utp21 and Utp18. Electron microscopy images of the entire UTPB complex revealed that it predominantly adopts elongated conformations and possesses internal flexibility. We also determined crystal structures of the WD domain of Utp18 and the HAT and deviant HAT domains of Utp6. A structural model of UTPB was derived based on these data. PMID:27330138

  1. An overview of pre-ribosomal RNA processing in eukaryotes

    PubMed Central

    Henras, Anthony K; Plisson-Chastang, Célia; O'Donohue, Marie-Françoise; Chakraborty, Anirban; Gleizes, Pierre-Emmanuel

    2015-01-01

    Ribosomal RNAs are the most abundant and universal noncoding RNAs in living organisms. In eukaryotes, three of the four ribosomal RNAs forming the 40S and 60S subunits are borne by a long polycistronic pre-ribosomal RNA. A complex sequence of processing steps is required to gradually release the mature RNAs from this precursor, concomitant with the assembly of the 79 ribosomal proteins. A large set of trans-acting factors chaperone this process, including small nucleolar ribonucleoparticles. While yeast has been the gold standard for studying the molecular basis of this process, recent technical advances have allowed to further define the mechanisms of ribosome biogenesis in animals and plants. This renewed interest for a long-lasting question has been fueled by the association of several genetic diseases with mutations in genes encoding both ribosomal proteins and ribosome biogenesis factors, and by the perspective of new anticancer treatments targeting the mechanisms of ribosome synthesis. A consensus scheme of pre-ribosomal RNA maturation is emerging from studies in various kinds of eukaryotic organisms. However, major differences between mammalian and yeast pre-ribosomal RNA processing have recently come to light. WIREs RNA 2015, 6:225–242. doi: 10.1002/wrna.1269 PMID:25346433

  2. Small-subunit ribosomal RNA gene sequences of Phaeodarea challenge the monophyly of Haeckel's Radiolaria.

    PubMed

    Polet, Stephane; Berney, Cédric; Fahrni, José; Pawlowski, Jan

    2004-03-01

    In his grand monograph of Radiolaria, Ernst Haeckel originally included Phaeodarea together with Acantharea and Polycystinea, all three taxa characterized by the presence of a central capsule and the possession of axopodia. Cytological and ultrastructural studies, however, questioned the monophyly of Radiolaria, suggesting an independent evolutionary origin of the three taxa, and the first molecular data on Acantharea and Polycystinea brought controversial results. To test further the monophyly of Radiolaria, we sequenced the complete small subunit ribosomal RNA gene of three phaeodarians and three polycystines. Our analyses reveal that phaeodarians clearly branch among the recently described phylum Cercozoa, separately from Acantharea and Polycystinea. This result enhances the morphological variability within the phylum Cercozoa, which already contains very heterogeneous groups of protists. Our study also confirms the common origin of Acantharea and Polycystinea, which form a sister-group to the Cercozoa, and allows a phylogenetic reinterpretation of the morphological features of the three radiolarian groups. PMID:15144058

  3. Phylogenetic relationships of the green alga Volvox carteri deduced from small-subunit ribosomal RNA comparisons.

    PubMed

    Rausch, H; Larsen, N; Schmitt, R

    1989-09-01

    The 1788-nucleotide sequence of the small-subunit ribosomal RNA (srRNA) coding region from the chlorophyte Volvox carteri was determined. The secondary structure bears features typical of the universal model of srRNA, including about 40 helices and a division into four domains. Phylogenetic relationships to 17 other eukaryotes, including two other chlorophytes, were explored by comparing srRNA sequences. Similarity values and the inspection of phylogenetic trees derived by distance matrix methods revealed a close relationship between V. carteri and Chlamydomonas reinhardtii. The results are consistent with the view that these Volvocales, and the third green alga, Nanochlorum eucaryotum, are more closely related to higher plants than to any other major eukaryotic group, but constitute a distinct lineage that has long been separated from the line leading to the higher plants. PMID:2506359

  4. A putative precursor for the small ribosomal RNA from mitochondria of Saccharomyces cerevisiae.

    PubMed Central

    Osinga, K A; Evers, R F; Van der Laan, J C; Tabak, H F

    1981-01-01

    We have characterized a putative precursor RNA (15.5S) for the 15S ribosomal RNA in mitochondria of Saccharomyces cerevisiae. Hybrids were formed with mitochondrial RNA and mtDNA fragments terminally labelled at restriction sites located within the gene coding for 15S ribosomal RNA and treated with S1 nuclease (Berk, A.J. and Sharp, J.A. (1977) 12, 721-732). Sites of resistant hybrids were measured by agarose gel electrophoresis and end points of RNAs determined. The 15.5S RNA is approximately 80 nucleotides longer than the 15S ribosomal RNA, with the extra sequences being located at the 5'-end. Both 15S ribosomal RNA and 15.5S RNA are fully localised within a 2000 base pair HapII fragment. This putative precursor and the mature 15S ribosomal RNA are also found in petite mutants which retain the 15S ribosomal RNA gene. The petite mutant with the smallest genetic complexity has its end point of deletion (junction) just outside the HapII site located in the 5' flank of the 15S ribosomal RNA genes as determined by S1 nuclease analysis. This leaves a DNA stretch approximately 300 base pairs long where an initiation signal for mitochondrial transcription may be present. Images PMID:6262728

  5. Small-Molecule Inhibitor Leads of Ribosome-Inactivating Proteins Developed Using the Doorstop Approach

    PubMed Central

    Pang, Yuan-Ping; Park, Jewn Giew; Wang, Shaohua; Vummenthala, Anuradha; Mishra, Rajesh K.; McLaughlin, John E.; Di, Rong; Kahn, Jennifer Nielsen; Tumer, Nilgun E.; Janosi, Laszlo; Davis, Jon; Millard, Charles B.

    2011-01-01

    Ribosome-inactivating proteins (RIPs) are toxic because they bind to 28S rRNA and depurinate a specific adenine residue from the α-sarcin/ricin loop (SRL), thereby inhibiting protein synthesis. Shiga-like toxins (Stx1 and Stx2), produced by Escherichia coli, are RIPs that cause outbreaks of foodborne diseases with significant morbidity and mortality. Ricin, produced by the castor bean plant, is another RIP lethal to mammals. Currently, no US Food and Drug Administration-approved vaccines nor therapeutics exist to protect against ricin, Shiga-like toxins, or other RIPs. Development of effective small-molecule RIP inhibitors as therapeutics is challenging because strong electrostatic interactions at the RIP•SRL interface make drug-like molecules ineffective in competing with the rRNA for binding to RIPs. Herein, we report small molecules that show up to 20% cell protection against ricin or Stx2 at a drug concentration of 300 nM. These molecules were discovered using the doorstop approach, a new approach to protein•polynucleotide inhibitors that identifies small molecules as doorstops to prevent an active-site residue of an RIP (e.g., Tyr80 of ricin or Tyr77 of Stx2) from adopting an active conformation thereby blocking the function of the protein rather than contenders in the competition for binding to the RIP. This work offers promising leads for developing RIP therapeutics. The results suggest that the doorstop approach might also be applicable in the development of other protein•polynucleotide inhibitors as antiviral agents such as inhibitors of the Z-DNA binding proteins in poxviruses. This work also calls for careful chemical and biological characterization of drug leads obtained from chemical screens to avoid the identification of irrelevant chemical structures and to avoid the interference caused by direct interactions between the chemicals being screened and the luciferase reporter used in screening assays. PMID:21455295

  6. One step engineering of the small-subunit ribosomal RNA using CRISPR/Cas9.

    PubMed

    Kannan, Krishna; Tsvetanova, Billyana; Chuang, Ray-Yuan; Noskov, Vladimir N; Assad-Garcia, Nacyra; Ma, Li; Hutchison Iii, Clyde A; Smith, Hamilton O; Glass, John I; Merryman, Chuck; Venter, J Craig; Gibson, Daniel G

    2016-01-01

    Bacteria are indispensable for the study of fundamental molecular biology processes due to their relatively simple gene and genome architecture. The ability to engineer bacterial chromosomes is quintessential for understanding gene functions. Here we demonstrate the engineering of the small-ribosomal subunit (16S) RNA of Mycoplasma mycoides, by combining the CRISPR/Cas9 system and the yeast recombination machinery. We cloned the entire genome of M. mycoides in yeast and used constitutively expressed Cas9 together with in vitro transcribed guide-RNAs to introduce engineered 16S rRNA genes. By testing the function of the engineered 16S rRNA genes through genome transplantation, we observed surprising resilience of this gene to addition of genetic elements or helix substitutions with phylogenetically-distant bacteria. While this system could be further used to study the function of the 16S rRNA, one could envision the "simple" M. mycoides genome being used in this setting to study other genetic structures and functions to answer fundamental questions of life. PMID:27489041

  7. One step engineering of the small-subunit ribosomal RNA using CRISPR/Cas9

    PubMed Central

    Kannan, Krishna; Tsvetanova, Billyana; Chuang, Ray-Yuan; Noskov, Vladimir N.; Assad-Garcia, Nacyra; Ma, Li; Hutchison III, Clyde A.; Smith, Hamilton O.; Glass, John I.; Merryman, Chuck; Venter, J. Craig; Gibson, Daniel G.

    2016-01-01

    Bacteria are indispensable for the study of fundamental molecular biology processes due to their relatively simple gene and genome architecture. The ability to engineer bacterial chromosomes is quintessential for understanding gene functions. Here we demonstrate the engineering of the small-ribosomal subunit (16S) RNA of Mycoplasma mycoides, by combining the CRISPR/Cas9 system and the yeast recombination machinery. We cloned the entire genome of M. mycoides in yeast and used constitutively expressed Cas9 together with in vitro transcribed guide-RNAs to introduce engineered 16S rRNA genes. By testing the function of the engineered 16S rRNA genes through genome transplantation, we observed surprising resilience of this gene to addition of genetic elements or helix substitutions with phylogenetically-distant bacteria. While this system could be further used to study the function of the 16S rRNA, one could envision the “simple” M. mycoides genome being used in this setting to study other genetic structures and functions to answer fundamental questions of life. PMID:27489041

  8. Revealing stable processing products from ribosome-associated small RNAs by deep-sequencing data analysis

    PubMed Central

    Zywicki, Marek; Bakowska-Zywicka, Kamilla; Polacek, Norbert

    2012-01-01

    The exploration of the non-protein-coding RNA (ncRNA) transcriptome is currently focused on profiling of microRNA expression and detection of novel ncRNA transcription units. However, recent studies suggest that RNA processing can be a multi-layer process leading to the generation of ncRNAs of diverse functions from a single primary transcript. Up to date no methodology has been presented to distinguish stable functional RNA species from rapidly degraded side products of nucleases. Thus the correct assessment of widespread RNA processing events is one of the major obstacles in transcriptome research. Here, we present a novel automated computational pipeline, named APART, providing a complete workflow for the reliable detection of RNA processing products from next-generation-sequencing data. The major features include efficient handling of non-unique reads, detection of novel stable ncRNA transcripts and processing products and annotation of known transcripts based on multiple sources of information. To disclose the potential of APART, we have analyzed a cDNA library derived from small ribosome-associated RNAs in Saccharomyces cerevisiae. By employing the APART pipeline, we were able to detect and confirm by independent experimental methods multiple novel stable RNA molecules differentially processed from well known ncRNAs, like rRNAs, tRNAs or snoRNAs, in a stress-dependent manner. PMID:22266655

  9. sORFs.org: a repository of small ORFs identified by ribosome profiling.

    PubMed

    Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben

    2016-01-01

    With the advent of ribosome profiling, a next generation sequencing technique providing a "snap-shot'' of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these 'sORFs', indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. PMID:26527729

  10. sORFs.org: a repository of small ORFs identified by ribosome profiling

    PubMed Central

    Olexiouk, Volodimir; Crappé, Jeroen; Verbruggen, Steven; Verhegen, Kenneth; Martens, Lennart; Menschaert, Gerben

    2016-01-01

    With the advent of ribosome profiling, a next generation sequencing technique providing a “snap-shot’’ of translated mRNA in a cell, many short open reading frames (sORFs) with ribosomal activity were identified. Follow-up studies revealed the existence of functional peptides, so-called micropeptides, translated from these ‘sORFs’, indicating a new class of bio-active peptides. Over the last few years, several micropeptides exhibiting important cellular functions were discovered. However, ribosome occupancy does not necessarily imply an actual function of the translated peptide, leading to the development of various tools assessing the coding potential of sORFs. Here, we introduce sORFs.org (http://www.sorfs.org), a novel database for sORFs identified using ribosome profiling. Starting from ribosome profiling, sORFs.org identifies sORFs, incorporates state-of-the-art tools and metrics and stores results in a public database. Two query interfaces are provided, a default one enabling quick lookup of sORFs and a BioMart interface providing advanced query and export possibilities. At present, sORFs.org harbors 263 354 sORFs that demonstrate ribosome occupancy, originating from three different cell lines: HCT116 (human), E14_mESC (mouse) and S2 (fruit fly). sORFs.org aims to provide an extensive sORFs database accessible to researchers with limited bioinformatics knowledge, thus enabling easy integration into personal projects. PMID:26527729

  11. Identification of Methylated Proteins in the Yeast Small Ribosomal Subunit: A Role for SPOUT Methyltransferases in Protein Arginine Methylation†

    PubMed Central

    Young, Brian D.; Weiss, David I.; Zurita-Lopez, Cecilia I.; Webb, Kristofor J.; Clarke, Steven G.; McBride, Anne E.

    2012-01-01

    We have characterized the posttranslational methylation of Rps2, Rps3, and Rps27a, three small ribosomal subunit proteins in the yeast Saccharomyces cerevisiae, using mass spectrometry and amino acid analysis. We found that Rps2 is substoichiometrically modified at arginine-10 by the Rmt1 methyltransferase. We demonstrated that Rps3 is stoichiometrically modified by ω-monomethylation at arginine-146 by mass spectrometric and site-directed mutagenic analyses. Substitution of alanine for arginine at position 146 is associated with slow cell growth, suggesting that the amino acid identity at this site may influence ribosomal function and/or biogenesis. Analysis of the three-dimensional structure of Rps3 in S. cerevisiae shows that arginine-146 makes contacts with the small subunit rRNA. Screening of deletion mutants encoding potential yeast methyltransferases revealed that the loss of the YOR021C gene results in the absence of methylation on Rps3. We demonstrated that recombinant Yor021c catalyzes ω-monomethylarginine formation when incubated with S-adenosylmethionine and hypomethylated ribosomes prepared from a YOR021C deletion strain. Interestingly, Yor021c belongs to the family of SPOUT methyltransferases that, to date, have only been shown to modify RNA substrates. Our findings suggest a wider role for SPOUT methyltransferases in nature. Finally, we have demonstrated the presence of a stoichiometrically methylated cysteine residue at position 39 of Rps27a in a zinc-cysteine cluster. The discovery of these three novel sites of protein modification within the small ribosomal subunit will now allow for an analysis of their functional roles in translation and possibly other cellular processes. PMID:22650761

  12. Tricks an IRES uses to enslave ribosomes

    PubMed Central

    2012-01-01

    In eukaryotes, mRNAs are primarily translated through a cap-dependent mechanism whereby initiation factors recruit the 40S ribosomal subunit to a cap structure at the 5’ end of the mRNA. However, some viral and cellular messages initiate protein synthesis without a cap. They use a structured RNA element termed an internal ribosome entry site (IRES) to recruit the 40S ribosomal subunit. IRESs were discovered over 20 years ago but only recently have studies using a model IRES from dicistroviruses expanded our understanding of how a three dimensional RNA structure can capture and manipulate the ribosome to initiate translation. PMID:22944245

  13. Phylogenetic Analysis of Myobia musculi (Schranck, 1781) by Using the 18S Small Ribosomal Subunit Sequence

    PubMed Central

    Feldman, Sanford H; Ntenda, Abraham M

    2011-01-01

    We used high-fidelity PCR to amplify 2 overlapping regions of the ribosomal gene complex from the rodent fur mite Myobia musculi. The amplicons encompassed a large portion of the mite's ribosomal gene complex spanning 3128 nucleotides containing the entire 18S rRNA, internal transcribed spacer (ITS) 1, 5.8S rRNA, ITS2, and a portion of the 5′-end of the 28S rRNA. M. musculi’s 179-nucleotide 5.8S rRNA nucleotide sequence was not conserved, so this region was identified by conservation of rRNA secondary structure. Maximum likelihood and Bayesian inference phylogenetic analyses were performed by using multiple sequence alignment consisting of 1524 nucleotides of M. musculi 18S rRNA and homologous sequences from 42 prostigmatid mites and the tick Dermacentor andersoni. The phylograms produced by both methods were in agreement regarding terminal, secondary, and some tertiary phylogenetic relationships among mites. Bayesian inference discriminated most infraordinal relationships between Eleutherengona and Parasitengona mites in the suborder Anystina. Basal relationships between suborders Anystina and Eupodina historically determined by comparing differences in anatomic characteristics were less well-supported by our molecular analysis. Our results recapitulated similar 18S rRNA sequence analyses recently reported. Our study supports M. musculi as belonging to the suborder Anystina, infraorder Eleutherenona, and superfamily Cheyletoidea. PMID:22330574

  14. Paradigms of ribosome synthesis: Lessons learned from ribosomal proteins

    PubMed Central

    Gamalinda, Michael; Woolford, John L

    2015-01-01

    The proteome in all cells is manufactured via the intricate process of translation by multimolecular factories called ribosomes. Nevertheless, these ribonucleoprotein particles, the largest of their kind, also have an elaborate assembly line of their own. Groundbreaking discoveries that bacterial ribosomal subunits can be self-assembled in vitro jumpstarted studies on how ribosomes are constructed. Until recently, ribosome assembly has been investigated almost entirely in vitro with bacterial small subunits under equilibrium conditions. In light of high-resolution ribosome structures and a more sophisticated toolkit, the past decade has been defined by a burst of kinetic studies in vitro and, importantly, also a shift to examining ribosome maturation in living cells, especially in eukaryotes. In this review, we summarize the principles governing ribosome assembly that emerged from studies focusing on ribosomal proteins and their interactions with rRNA. Understanding these paradigms has taken center stage, given the linkage between anomalous ribosome biogenesis and proliferative disorders. PMID:26779413

  15. A three-dimensional model of domain III of the Escherichia coli small ribosomal subunit.

    PubMed

    Elson, D; Spitnik-Elson, P

    1987-09-01

    A three-dimensional model of domain III (nucleotides 920 to 1395) of the 30S ribosomal subunit of E. coli is proposed. The data used as a guide in folding the secondary structure of the RNA into a tertiary structure are four long range RNA-RNA interactions proposed by us on the basis of experiments performed in this laboratory plus two sets of data from other laboratories: protein-RNA cross-linking sites for proteins S1, S3, S7, S10 and S12, and the interprotein distances determined by neutron scattering. The model is consistent with nearly all of the published experimental findings on the structure of domain III. PMID:2450593

  16. GTP hydrolysis by EF-G synchronizes tRNA movement on small and large ribosomal subunits

    PubMed Central

    Holtkamp, Wolf; Cunha, Carlos E; Peske, Frank; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V

    2014-01-01

    Elongation factor G (EF-G) promotes the movement of two tRNAs and the mRNA through the ribosome in each cycle of peptide elongation. During translocation, the tRNAs transiently occupy intermediate positions on both small (30S) and large (50S) ribosomal subunits. How EF-G and GTP hydrolysis control these movements is still unclear. We used fluorescence labels that specifically monitor movements on either 30S or 50S subunits in combination with EF-G mutants and translocation-specific antibiotics to investigate timing and energetics of translocation. We show that EF-G–GTP facilitates synchronous movements of peptidyl-tRNA on the two subunits into an early post-translocation state, which resembles a chimeric state identified by structural studies. EF-G binding without GTP hydrolysis promotes only partial tRNA movement on the 50S subunit. However, rapid 30S translocation and the concomitant completion of 50S translocation require GTP hydrolysis and a functional domain 4 of EF-G. Our results reveal two distinct modes for utilizing the energy of EF-G binding and GTP hydrolysis and suggest that coupling of GTP hydrolysis to translocation is mediated through rearrangements of the 30S subunit. PMID:24614227

  17. GTP hydrolysis by EF-G synchronizes tRNA movement on small and large ribosomal subunits.

    PubMed

    Holtkamp, Wolf; Cunha, Carlos E; Peske, Frank; Konevega, Andrey L; Wintermeyer, Wolfgang; Rodnina, Marina V

    2014-05-01

    Elongation factor G (EF-G) promotes the movement of two tRNAs and the mRNA through the ribosome in each cycle of peptide elongation. During translocation, the tRNAs transiently occupy intermediate positions on both small (30S) and large (50S) ribosomal subunits. How EF-G and GTP hydrolysis control these movements is still unclear. We used fluorescence labels that specifically monitor movements on either 30S or 50S subunits in combination with EF-G mutants and translocation-specific antibiotics to investigate timing and energetics of translocation. We show that EF-G-GTP facilitates synchronous movements of peptidyl-tRNA on the two subunits into an early post-translocation state, which resembles a chimeric state identified by structural studies. EF-G binding without GTP hydrolysis promotes only partial tRNA movement on the 50S subunit. However, rapid 30S translocation and the concomitant completion of 50S translocation require GTP hydrolysis and a functional domain 4 of EF-G. Our results reveal two distinct modes for utilizing the energy of EF-G binding and GTP hydrolysis and suggest that coupling of GTP hydrolysis to translocation is mediated through rearrangements of the 30S subunit. PMID:24614227

  18. Seeing is Believing in Ribosome Assembly.

    PubMed

    Warner, Jonathan R

    2016-07-14

    Many proteins have been implicated genetically and biochemically in the assembly of eukaryotic ribosomes. Now, Kornprobst et al. show us how they are put together with a cryoEM structure of the 90S processome that initiates ribosome assembly, revealing the arrangement of U3 RNA and the several UTP complexes that form a chaperone-like structure around and within the developing 40S ribosomal subunit. PMID:27419867

  19. Zfrp8/PDCD2 Interacts with RpS2 Connecting Ribosome Maturation and Gene-Specific Translation.

    PubMed

    Minakhina, Svetlana; Naryshkina, Tatyana; Changela, Neha; Tan, William; Steward, Ruth

    2016-01-01

    Zfrp8/PDCD2 is a highly conserved protein essential for stem cell maintenance in both flies and mammals. It is also required in fast proliferating cells such as cancer cells. Our previous studies suggested that Zfrp8 functions in the formation of mRNP (mRNA ribonucleoprotein) complexes and also controls RNA of select Transposable Elements (TEs). Here we show that in Zfrp8/PDCD2 knock down (KD) ovaries, specific mRNAs and TE transcripts show increased nuclear accumulation. We also show that Zfrp8/PDCD2 interacts with the (40S) small ribosomal subunit through direct interaction with RpS2 (uS5). By studying the distribution of endogenous and transgenic fluorescently tagged ribosomal proteins we demonstrate that Zfrp8/PDCD2 regulates the cytoplasmic levels of components of the small (40S) ribosomal subunit, but does not control nuclear/nucleolar localization of ribosomal proteins. Our results suggest that Zfrp8/PDCD2 functions at late stages of ribosome assembly and may regulate the binding of specific mRNA-RNPs to the small ribosomal subunit ultimately controlling their cytoplasmic localization and translation. PMID:26807849

  20. Zfrp8/PDCD2 Interacts with RpS2 Connecting Ribosome Maturation and Gene-Specific Translation

    PubMed Central

    Minakhina, Svetlana; Naryshkina, Tatyana; Changela, Neha; Tan, William; Steward, Ruth

    2016-01-01

    Zfrp8/PDCD2 is a highly conserved protein essential for stem cell maintenance in both flies and mammals. It is also required in fast proliferating cells such as cancer cells. Our previous studies suggested that Zfrp8 functions in the formation of mRNP (mRNA ribonucleoprotein) complexes and also controls RNA of select Transposable Elements (TEs). Here we show that in Zfrp8/PDCD2 knock down (KD) ovaries, specific mRNAs and TE transcripts show increased nuclear accumulation. We also show that Zfrp8/PDCD2 interacts with the (40S) small ribosomal subunit through direct interaction with RpS2 (uS5). By studying the distribution of endogenous and transgenic fluorescently tagged ribosomal proteins we demonstrate that Zfrp8/PDCD2 regulates the cytoplasmic levels of components of the small (40S) ribosomal subunit, but does not control nuclear/nucleolar localization of ribosomal proteins. Our results suggest that Zfrp8/PDCD2 functions at late stages of ribosome assembly and may regulate the binding of specific mRNA-RNPs to the small ribosomal subunit ultimately controlling their cytoplasmic localization and translation. PMID:26807849

  1. Ribosomal RNA analysis in the diagnosis of Diamond-Blackfan Anaemia.

    PubMed

    Quarello, Paola; Garelli, Emanuela; Carando, Adriana; Mancini, Cecilia; Foglia, Luiselda; Botto, Carlotta; Farruggia, Piero; De Keersmaecker, Kim; Aspesi, Anna; Ellis, Steve R; Dianzani, Irma; Ramenghi, Ugo

    2016-03-01

    Diamond-Blackfan anaemia (DBA) is an inherited disease characterized by pure erythroid aplasia that has been tagged as a 'ribosomopathy'. We report a multi-centre study focused on the analysis of rRNA processing of 53 Italian DBA patients using capillary electrophoresis analysis of rRNA maturation of the 40S and 60S ribosomal subunits. The ratio of 28S/18S rRNA was higher in patients with mutated ribosomal proteins (RPs) of the small ribosomal subunit. In contrast, patients with mutated RPs of the large ribosomal subunit (RPLs) had a lower 28S/18S ratio. The assay reported here would be amenable for development as a diagnostic tool. PMID:26763766

  2. Proteomic analysis of the mammalian mitochondrial ribosome. Identification of protein components in the 28 S small subunit.

    PubMed

    Suzuki, T; Terasaki, M; Takemoto-Hori, C; Hanada, T; Ueda, T; Wada, A; Watanabe, K

    2001-08-31

    The mammalian mitochondrial ribosome (mitoribosome) has a highly protein-rich composition with a small sedimentation coefficient of 55 S, consisting of 39 S large and 28 S small subunits. In the previous study, we analyzed 39 S large subunit proteins from bovine mitoribosome (Suzuki, T., Terasaki, M., Takemoto-Hori, C., Hanada, T., Ueda, T., Wada, A., and Watanabe, K. (2001) J. Biol. Chem. 276, 21724-21736). The results suggested structural compensation for the rRNA deficit through proteins of increased molecular mass in the mitoribosome. We report here the identification of 28 S small subunit proteins. Each protein was separated by radical-free high-reducing two-dimensional polyacrylamide gel electrophoresis and analyzed by liquid chromatography/mass spectrometry/mass spectrometry using electrospray ionization/ion trap mass spectrometer to identify cDNA sequence by expressed sequence tag data base searches in silico. Twenty one proteins from the small subunit were identified, including 11 new proteins along with their complete cDNA sequences from human and mouse. In addition to these proteins, three new proteins were also identified in the 55 S mitoribosome. We have clearly identified a mitochondrial homologue of S12, which is a key regulatory protein of translation fidelity and a candidate for the autosomal dominant deafness gene, DFNA4. The apoptosis-related protein DAP3 was found to be a component of the small subunit, indicating a new function for the mitoribosome in programmed cell death. In summary, we have mapped a total of 55 proteins from the 55 S mitoribosome on the two-dimensional polyacrylamide gels. PMID:11402041

  3. Ribosome Assembly as Antimicrobial Target

    PubMed Central

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H.

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  4. Ribosome Assembly as Antimicrobial Target.

    PubMed

    Nikolay, Rainer; Schmidt, Sabine; Schlömer, Renate; Deuerling, Elke; Nierhaus, Knud H

    2016-01-01

    Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors. PMID:27240412

  5. Structural characterization of ribosome recruitment and translocation by type IV IRES.

    PubMed

    Murray, Jason; Savva, Christos G; Shin, Byung-Sik; Dever, Thomas E; Ramakrishnan, V; Fernández, Israel S

    2016-01-01

    Viral mRNA sequences with a type IV IRES are able to initiate translation without any host initiation factors. Initial recruitment of the small ribosomal subunit as well as two translocation steps before the first peptidyl transfer are essential for the initiation of translation by these mRNAs. Using electron cryomicroscopy (cryo-EM) we have structurally characterized at high resolution how the Cricket Paralysis Virus Internal Ribosomal Entry Site (CrPV-IRES) binds the small ribosomal subunit (40S) and the translocation intermediate stabilized by elongation factor 2 (eEF2). The CrPV-IRES restricts tvhe otherwise flexible 40S head to a conformation compatible with binding the large ribosomal subunit (60S). Once the 60S is recruited, the binary CrPV-IRES/80S complex oscillates between canonical and rotated states (Fernández et al., 2014; Koh et al., 2014), as seen for pre-translocation complexes with tRNAs. Elongation factor eEF2 with a GTP analog stabilizes the ribosome-IRES complex in a rotated state with an extra ~3 degrees of rotation. Key residues in domain IV of eEF2 interact with pseudoknot I (PKI) of the CrPV-IRES stabilizing it in a conformation reminiscent of a hybrid tRNA state. The structure explains how diphthamide, a eukaryotic and archaeal specific post-translational modification of a histidine residue of eEF2, is involved in translocation. PMID:27159451

  6. Recognition of chimeric small-subunit ribosomal DNAs composed of genes from uncultivated microorganisms

    NASA Technical Reports Server (NTRS)

    Kopczynski, E. D.; Bateson, M. M.; Ward, D. M.

    1994-01-01

    When PCR was used to recover small-subunit (SSU) rRNA genes from a hot spring cyanobacterial mat community, chimeric SSU rRNA sequences which exhibited little or no secondary structural abnormality were recovered. They were revealed as chimeras of SSU rRNA genes of uncultivated species through separate phylogenetic analysis of short sequence domains.

  7. Structural insights into ribosome translocation.

    PubMed

    Ling, Clarence; Ermolenko, Dmitri N

    2016-09-01

    During protein synthesis, tRNA and mRNA are translocated from the A to P to E sites of the ribosome thus enabling the ribosome to translate one codon of mRNA after the other. Ribosome translocation along mRNA is induced by the universally conserved ribosome GTPase, elongation factor G (EF-G) in bacteria and elongation factor 2 (EF-2) in eukaryotes. Recent structural and single-molecule studies revealed that tRNA and mRNA translocation within the ribosome is accompanied by cyclic forward and reverse rotations between the large and small ribosomal subunits parallel to the plane of the intersubunit interface. In addition, during ribosome translocation, the 'head' domain of small ribosomal subunit undergoes forward- and back-swiveling motions relative to the rest of the small ribosomal subunit around the axis that is orthogonal to the axis of intersubunit rotation. tRNA/mRNA translocation is also coupled to the docking of domain IV of EF-G into the A site of the small ribosomal subunit that converts the thermally driven motions of the ribosome and tRNA into the forward translocation of tRNA/mRNA inside the ribosome. Despite recent and enormous progress made in the understanding of the molecular mechanism of ribosome translocation, the sequence of structural rearrangements of the ribosome, EF-G and tRNA during translocation is still not fully established and awaits further investigation. WIREs RNA 2016, 7:620-636. doi: 10.1002/wrna.1354 For further resources related to this article, please visit the WIREs website. PMID:27117863

  8. Gcn1 contacts the small ribosomal protein Rps10, which is required for full activation of the protein kinase Gcn2.

    PubMed

    Lee, Su Jung; Swanson, Mark J; Sattlegger, Evelyn

    2015-03-15

    In eukaryotes, amino acid deprivation leads to the accumulation of uncharged tRNAs that are detected by Gcn2 (general control non-derepressible 2), which in turn phosphorylates eIF2α (α-subunit of eukaryotic translation initiation factor 2), an essential process for overcoming starvation. In Saccharomyces cerevisiae, sensing amino acid shortages requires that Gcn2 binds directly to its effector protein Gcn1 and both must associate with the ribosome. Our hypothesis is that uncharged tRNAs occur in the ribosomal A-site and that Gcn1 is directly involved in transfer of this starvation signal to Gcn2. In the present paper, we provide evidence that Gcn1 directly contacts the small ribosomal protein S10 (Rps10). Gcn1 residues 1060-1777 showed a yeast two-hybrid (Y2H) interaction with Rps10A. In vitro, Rps10A or Rps10B co-precipitated Gcn1[1060-1777] in an RNA-independent manner. rps10AΔ or rps10BΔ strains showed reduced eIF2α phosphorylation under replete conditions and shortly after onset of starvation, suggesting that Gcn1-mediated Gcn2 activation was impaired. Overexpression of GST-tagged Rps10 reduced growth under amino acid starvation and this was exacerbated by the Gcn1-M7A mutation known to impair Gcn1-ribosome interaction and Gcn2 activity. Under amino acid starvation, eEF3 (eukaryotic translation elongation factor 3) overexpression, known to weaken Gcn1 function on the ribosome, exacerbated the growth defect of rps10AΔ or rps10BΔ strains. Taken together, these data support the idea that Gcn1 contacts ribosome-bound Rps10 to efficiently mediate Gcn2 activation. PMID:25437641

  9. Phylogenetic position of the genus Perkinsus (Protista, Apicomplexa) based on small subunit ribosomal RNA.

    PubMed

    Goggin, C L; Barker, S C

    1993-07-01

    Parasites of the genus Perkinsus destroy marine molluscs worldwide. Their phylogenetic position within the kingdom Protista is controversial. Nucleotide sequence data (1792 bp) from the small subunit rRNA gene of Perkinsus sp. from Anadara trapezia (Mollusca: Bivalvia) from Moreton Bay, Queensland, was used to examine the phylogenetic affinities of this enigmatic genus. These data were aligned with nucleotide sequences from 6 apicomplexans, 3 ciliates, 3 flagellates, a dinoflagellate, 3 fungi, maize and human. Phylogenetic trees were constructed after analysis with maximum parsimony and distance matrix methods. Our analyses indicate that Perkinsus is phylogenetically closer to dinoflagellates and to coccidean and piroplasm apicomplexans than to fungi or flagellates. PMID:8366895

  10. Phylogenetics of Bonamia parasites based on small subunit and internal transcribed spacer region ribosomal DNA sequence data.

    PubMed

    Hill, Kristina M; Stokes, Nancy A; Webb, Stephen C; Hine, P Mike; Kroeck, Marina A; Moore, James D; Morley, Margaret S; Reece, Kimberly S; Burreson, Eugene M; Carnegie, Ryan B

    2014-07-24

    The genus Bonamia (Haplosporidia) includes economically significant oyster parasites. Described species were thought to have fairly circumscribed host and geographic ranges: B. ostreae infecting Ostrea edulis in Europe and North America, B. exitiosa infecting O. chilensis in New Zealand, and B. roughleyi infecting Saccostrea glomerata in Australia. The discovery of B. exitiosa-like parasites in new locations and the observation of a novel species, B. perspora, in non-commercial O. stentina altered this perception and prompted our wider evaluation of the global diversity of Bonamia parasites. Samples of 13 oyster species from 21 locations were screened for Bonamia spp. by PCR, and small subunit and internal transcribed spacer regions of Bonamia sp. ribosomal DNA were sequenced from PCR-positive individuals. Infections were confirmed histologically. Phylogenetic analyses using parsimony and Bayesian methods revealed one species, B. exitiosa, to be widely distributed, infecting 7 oyster species from Australia, New Zealand, Argentina, eastern and western USA, and Tunisia. More limited host and geographic distributions of B. ostreae and B. perspora were confirmed, but nothing genetically identifiable as B. roughleyi was found in Australia or elsewhere. Newly discovered diversity included a Bonamia sp. in Dendostrea sandvicensis from Hawaii, USA, that is basal to the other Bonamia species and a Bonamia sp. in O. edulis from Tomales Bay, California, USA, that is closely related to both B. exitiosa and the previously observed Bonamia sp. from O. chilensis in Chile. PMID:25060496

  11. Prevalent Ciliate Symbiosis on Copepods: High Genetic Diversity and Wide Distribution Detected Using Small Subunit Ribosomal RNA Gene

    PubMed Central

    Guo, Zhiling; Liu, Sheng; Hu, Simin; Li, Tao; Huang, Yousong; Liu, Guangxing; Zhang, Huan; Lin, Senjie

    2012-01-01

    Toward understanding the genetic diversity and distribution of copepod-associated symbiotic ciliates and the evolutionary relationships with their hosts in the marine environment, we developed a small subunit ribosomal RNA gene (18S rDNA)-based molecular method and investigated the genetic diversity and genotype distribution of the symbiotic ciliates on copepods. Of the 10 copepod species representing six families collected from six locations of Pacific and Atlantic Oceans, 9 were found to harbor ciliate symbionts. Phylogenetic analysis of the 391 ciliate 18S rDNA sequences obtained revealed seven groups (ribogroups), six (containing 99% of all the sequences) belonging to subclass Apostomatida, the other clustered with peritrich ciliate Vorticella gracilis. Among the Apostomatida groups, Group III were essentially identical to Vampyrophrya pelagica, and the other five groups represented the undocumented ciliates that were close to Vampyrophrya/Gymnodinioides/Hyalophysa. Group VI ciliates were found in all copepod species but one (Calanus sinicus), and were most abundant among all ciliate sequences obtained, indicating that they are the dominant symbiotic ciliates universally associated with copepods. In contrast, some ciliate sequences were found only in some of the copepods examined, suggesting the host selectivity and geographic differentiation of ciliates, which requires further verification by more extensive sampling. Our results reveal the wide occurrence and high genetic diversity of symbiotic ciliates on marine copepods and highlight the need to systematically investigate the host- and geography-based genetic differentiation and ecological roles of these ciliates globally. PMID:23024768

  12. An overview of the secondary structure of the V4 region of eukaryotic small-subunit ribosomal RNA.

    PubMed Central

    Nickrent, D L; Sargent, M L

    1991-01-01

    The V4 region of the small subunit (18S) ribosomal RNA was examined in 72 different sequences representing a broad sample eukaryotic diversity. This domain is the most variable region of the 18S rRNA molecule and ranges in length from ca. 230 to over 500 bases. Based upon comparative analysis, secondary structural models were constructed for all sequences and the resulting generalized model shows that most organisms possess seven helices for this region. The protists and two insects show from one to as many as four helices in addition to the above seven. In this report, we summarize secondary structure information presented elsewhere for the V4 region, describe the general features for helical and apical regions, and identify signature sequences useful in helix identification. Our model generally agrees with other current concepts; however, we propose modifications or alternative structures for the start of the V4 region, the large protist inserts, and the sector that may possibly contain a pseudoknot. PMID:2014163

  13. Ribosomal Protein Rps26 Influences 80S Ribosome Assembly in Saccharomyces cerevisiae

    PubMed Central

    Belyy, Alexander; Levanova, Nadezhda; Tabakova, Irina; Rospert, Sabine

    2016-01-01

    ABSTRACT The eukaryotic ribosome consists of a small (40S) and a large (60S) subunit. Rps26 is one of the essential ribosomal proteins of the 40S subunit and is encoded by two almost identical genes, RPS26a and RPS26b. Previous studies demonstrated that Rps26 interacts with the 5′ untranslated region of mRNA via the eukaryote-specific 62-YXXPKXYXK-70 (Y62–K70) motif. Those observations suggested that this peptide within Rps26 might play an important and specific role during translation initiation. By using alanine-scanning mutagenesis and engineered strains of the yeast Saccharomyces cerevisiae, we found that single amino acid substitutions within the Y62–K70 motif of Rps26 did not affect the in vivo function of the protein. In contrast, complete deletion of the Y62–K70 segment was lethal. The simultaneous replacement of five conserved residues within the Y62–K70 segment by alanines resulted in growth defects under stress conditions and produced distinct changes in polysome profiles that were indicative of the accumulation of free 60S subunits. Human Rps26 (Rps26-Hs), which displays significant homology with yeast Rps26, supported the growth of an S. cerevisiae Δrps26a Δrps26b strain. However, the Δrps26a Δrps26b double deletion strain expressing Rps26-Hs displayed substantial growth defects and an altered ratio of 40S/60S ribosomal subunits. The combined data strongly suggest that the eukaryote-specific motif within Rps26 does not play a specific role in translation initiation. Rather, the data indicate that Rps26 as a whole is necessary for proper assembly of the 40S subunit and the 80S ribosome in yeast. IMPORTANCE Rps26 is an essential protein of the eukaryotic small ribosomal subunit. Previous experiments demonstrated an interaction between the eukaryote-specific Y62–K70 segment of Rps26 and the 5′ untranslated region of mRNA. The data suggested a specific role of the Y62–K70 motif during translation initiation. Here, we report that single

  14. Ribosomal and mitochondrial DNA analysis of Trichuridae nematodes of carnivores and small mammals.

    PubMed

    Guardone, Lisa; Deplazes, Peter; Macchioni, Fabio; Magi, Marta; Mathis, Alexander

    2013-10-18

    Several species of Trichuridae nematodes can infect dogs, cats and wild mammals. The diagnosis of these infections relies on the microscopic identification of eggs which are characterized by a similar "lemon" shape and polar plugs in all Trichuridae. Thus, morphological diagnosis to species level is challenging. The use of biomolecular diagnostic methods is desirable but very little genetic data are known from Trichuridae of carnivores and small mammals. The aim of this work was to genetically characterize several species of Trichuridae that can affect dogs, cats and wild mammals, as a basis to develop molecular diagnostic tests. Specimens (adult worms or eggs) of Eucoleus aerophilus (syn. Capillaria aerophila), Eucoleus boehmi (syn. Capillaria boehmi), Pearsonema plica (syn. Capillaria plica), Aonchotheca putorii (syn. Capillaria putorii), Calodium hepaticum (syn. Capillaria hepatica), Calodium splenaecum (syn. Capillaria splenaeca) and Trichuris vulpis were obtained from carcasses of red foxes, feces of dogs, the liver of a vole and from the spleen of Crocidura sp. Parts of the small subunit rRNA (18S rRNA) gene and of the mitochondrial cytochrome c oxidase subunit I (cox 1 mtDNA) gene were amplified from the above mentioned nematodes, yielding the first 18S rRNA gene sequences of all the capillariid nematodes and the first cox 1 mtDNA sequences of E. boehmi, P. plica, C. hepaticum, A. putorii and T. vulpis. The 18S rRNA gene is highly conserved among the different species and not suitable as a target for specific diagnostic oligonucleotides. However, these sequences contribute to a better understanding of the complex taxonomic relations among Trichuridae. Indeed, a dendrogram based on the 18S rRNA gene locus supports the latest taxonomic revision. Interspecies divergence was much higher at the cox 1 mtDNA gene locus, rendering it suitable for DNA barcoding and particularly valuable in resolving closely related species. Furthermore, the mitochondrial genetic

  15. Conformational changes of the small ribosomal subunit during elongation factor G-dependent tRNA-mRNA translocation.

    PubMed

    Peske, Frank; Savelsbergh, Andreas; Katunin, Vladimir I; Rodnina, Marina V; Wintermeyer, Wolfgang

    2004-11-01

    Translocation, a coordinated movement of two tRNAs together with mRNA on the ribosome, is catalyzed by elongation factor G (EF-G). The reaction is accompanied by conformational rearrangements of the ribosome that are, as yet, not well characterized. Here, we analyze those rearrangements by restricting the conformational flexibility of the ribosome by antibiotics binding to specific sites of the ribosome. Paromomycin (Par), viomycin (Vio), spectinomycin (Spc), and hygromycin B (HygB) inhibited the tRNA-mRNA movement, while the other partial reactions of translocation, including the unlocking rearrangement of the ribosome that precedes tRNA-mRNA movement, were not affected. The functional cycle of EF-G, i.e. binding of EF-G.GTP to the ribosome, GTP hydrolysis, Pi release, and dissociation of EF-G.GDP from the ribosome, was not affected either, indicating that EF-G turnover is not coupled directly to tRNA-mRNA movement. The inhibition of translocation by Par and Vio is attributed to the stabilization of tRNA binding in the A site, whereas Spc and HygB had a direct inhibitory effect on tRNA-mRNA movement. Streptomycin (Str) had essentially no effect on translocation, although it caused a large increase in tRNA affinity to the A site. These results suggest that conformational changes in the vicinity of the decoding region at the binding sites of Spc and HygB are important for tRNA-mRNA movement, whereas Str seems to stabilize a conformation of the ribosome that is prone to rapid translocation, thereby compensating the effect on tRNA affinity. PMID:15491605

  16. Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome.

    PubMed

    Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki

    2015-11-17

    rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general. PMID:26534993

  17. Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome

    PubMed Central

    Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki

    2015-01-01

    rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the “main” chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general. PMID:26534993

  18. The reduction in small ribosomal subunit abundance in ethanol-stressed cells of Bacillus subtilis is mediated by a SigB-dependent antisense RNA.

    PubMed

    Mars, Ruben A T; Mendonça, Karoline; Denham, Emma L; van Dijl, Jan Maarten

    2015-10-01

    One of the best-characterized general stress responses in bacteria is the σB-mediated stress response of the Gram-positive soil bacterium Bacillus subtilis. The σB regulon contains approximately 200 protein-encoding genes and 136 putative regulatory RNAs. One of these σB-dependent RNAs, named S1136-S1134, was recently mapped as being transcribed from the S1136 promoter on the opposite strand of the essential rpsD gene, which encodes the ribosomal primary-binding protein S4. Accordingly, S1136-S1134 transcription results in an rpsD-overlapping antisense RNA (asRNA). Upon exposure of B. subtilis to ethanol, the S1136 promoter was found to be induced, while rpsD transcription was downregulated. By quantitative PCR, we show that the activation of transcription from the S1136 promoter is directly responsible for the downregulation of rpsD upon ethanol exposure. We also show that this downregulation of rpsD leads to a reduced level of the small (30S) ribosomal subunit upon ethanol stress. The activation of the S1136 promoter thus represents the first example of antisense transcription-mediated regulation in the general stress response of B. subtilis and implicates the reduction of ribosomal protein abundance as a new aspect in the σB-dependent stress response. We propose that the observed reduction in the level of the small ribosomal subunit, which contains the ribosome-decoding center, may protect B. subtilis cells against misreading and spurious translation of possibly toxic aberrant peptides under conditions of ethanol stress. PMID:26115952

  19. Human C4orf14 interacts with the mitochondrial nucleoid and is involved in the biogenesis of the small mitochondrial ribosomal subunit

    PubMed Central

    He, J.; Cooper, H. M.; Reyes, A.; Di Re, M.; Kazak, L.; Wood, S. R.; Mao, C. C.; Fearnley, I. M.; Walker, J. E.; Holt, I. J.

    2012-01-01

    The bacterial homologue of C4orf14, YqeH, has been linked to assembly of the small ribosomal subunit. Here, recombinant C4orf14 isolated from human cells, co-purified with the small, 28S subunit of the mitochondrial ribosome and the endogenous protein co-fractionated with the 28S subunit in sucrose gradients. Gene silencing of C4orf14 specifically affected components of the small subunit, leading to decreased protein synthesis in the organelle. The GTPase of C4orf14 was critical to its interaction with the 28S subunit, as was GTP. Therefore, we propose that C4orf14, with bound GTP, binds to components of the 28S subunit facilitating its assembly, and GTP hydrolysis acts as the release mechanism. C4orf14 was also found to be associated with human mitochondrial nucleoids, and C4orf14 gene silencing caused mitochondrial DNA depletion. In vitro C4orf14 is capable of binding to DNA. The association of C4orf14 with mitochondrial translation factors and the mitochondrial nucleoid suggests that the 28S subunit is assembled at the mitochondrial nucleoid, enabling the direct transfer of messenger RNA from the nucleoid to the ribosome in the organelle. PMID:22447445

  20. Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution

    NASA Astrophysics Data System (ADS)

    Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad

    2015-07-01

    Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs.

  1. Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution.

    PubMed

    Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad

    2015-01-01

    Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5'-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome-HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs. PMID:26155016

  2. Depletion of U3 small nucleolar RNA inhibits cleavage in the 5' external transcribed spacer of yeast pre-ribosomal RNA and impairs formation of 18S ribosomal RNA.

    PubMed Central

    Hughes, J M; Ares, M

    1991-01-01

    Multiple processing events are required to convert a single eukaryotic pre-ribosomal RNA (pre-rRNA) into mature 18S (small subunit), 5.8S and 25-28S (large subunit) rRNAs. We have asked whether U3 small nucleolar RNA is required for pre-rRNA processing in vivo by depleting Saccharomyces cerevisiae of U3 by conditional repression of U3 synthesis. The resulting pattern of accumulation and depletion of specific pre-rRNAs indicates that U3 is required for multiple events leading to the maturation of 18S rRNA. These include an initial cleavage within the 5' external transcribed spacer, resembling the U3 dependent initial processing event of mammalian pre-rRNA. Formation of large subunit rRNAs is unaffected by U3 depletion. The similarity between the effects of U3 depletion and depletion of U14 small nucleolar RNA and the nucleolar protein fibrillarin (NOP1) suggests that these could be components of a single highly conserved processing complex. Images PMID:1756730

  3. Ribosomal proteins: functions beyond the ribosome

    PubMed Central

    Zhou, Xiang; Liao, Wen-Juan; Liao, Jun-Ming; Liao, Peng; Lu, Hua

    2015-01-01

    Although ribosomal proteins are known for playing an essential role in ribosome assembly and protein translation, their ribosome-independent functions have also been greatly appreciated. Over the past decade, more than a dozen of ribosomal proteins have been found to activate the tumor suppressor p53 pathway in response to ribosomal stress. In addition, these ribosomal proteins are involved in various physiological and pathological processes. This review is composed to overview the current understanding of how ribosomal stress provokes the accumulation of ribosome-free ribosomal proteins, as well as the ribosome-independent functions of ribosomal proteins in tumorigenesis, immune signaling, and development. We also propose the potential of applying these pieces of knowledge to the development of ribosomal stress-based cancer therapeutics. PMID:25735597

  4. Natural-abundance stable carbon isotopes of small-subunit ribosomal RNA (SSU rRNA) from Guaymas Basin (Mexico)

    NASA Astrophysics Data System (ADS)

    MacGregor, B. J.; Mendlovitz, H.; Albert, D.; Teske, A. P.

    2012-12-01

    Small-subunit ribosomal RNA (SSU rRNA) is a phylogenetically informative molecule found in all species. Because it is poorly preserved in most environments, it is a useful marker for active microbial populations. We are using the natural-abundance stable carbon isotopic composition of specific microbial groups to help identify the carbon substrates contributing to microbial biomass in a variety of marine environments. At Guaymas Basin, hydrothermal fluids interact with abundant sedimentary organic carbon to produce natural gas and petroleum. Where this reaches the sediment surface, it can support dense patches of seafloor life, including Beggiatoa mats. We report here on the stable carbon isotopic composition of SSU rRNA from a Beggiatoa mat transect, a cold background site, a warm site with high oil concentration, and a second Beggiatoa mat. The central part of the transect mat overlay the steepest temperature gradient, and was visually dominated by orange Beggiatoa. This was fringed by white Beggiatoa mat and bare, but still warm, sediment. Methane concentrations were saturating beneath the orange and white mats and at the oily site, lower beneath bare sediment, and below detection at the background site. Our initial hypotheses were that rRNA isotopic composition would be strongly influenced by methane supply, and that archaeal rRNA might be lighter than bacterial due to contributions from methanogens and anaerobic methane oxidizers. We used biotin-labeled oligonucleotides to capture Bacterial and Archaeal SSU rRNA for isotopic determination. Background-site rRNA was isotopically heaviest, and bacterial RNA from below 2 cm at the oily site was lightest, consistent with control by methane. Within the transect mat, however, the pattern was more complicated; at some sediment depths, rRNA from the mat periphery was isotopically lightest. Part of this may be due to the spatially and temporally variable paths followed by hydrothermal fluid, which can include horizontal

  5. Decreased activity of Blastocladiella emersonii zoospore ribosomes: correlation with developmental changes in ribosome-associated proteins.

    PubMed

    Jaworski, A J; Wilson, J B

    1989-10-01

    Ribosomal proteins isolated from dormant zoospores were compared to the ribosomal proteins found in the active growth phase by two-dimensional polyacrylamide gel electrophoresis. Zoospore ribosomes were found to contain a set of five proteins, designated Z1 to Z5, which were not present in growth phase ribosomes. The Z1-Z5 proteins were not removed by high-salt washes using either 1 M KCl or 1 M NH4 Cl. The Z1 protein is found associated with zoospore 60 S subunits while Z2-Z5 are bound to 40 S subunits. Zoospore monoribosomes and polyribosomes contain comparable levels of each of the five proteins. Approximately 60 min. after sporulation is induced, the Z1-Z5 proteins begin to accumulate on the ribosomes with the highest levels of these proteins found associated with ribosomes at the zoospore stage. During germination, the proteins gradually disappear and are not detectable on the ribosomes after 4 hr of germination. The presence of the Z1-Z5 proteins correlates with a decrease in in vitro protein synthetic activity of the fungal ribosomes. The data are consistent with the hypothesis that the proteins regulate translation by completely blocking protein synthesis on a subset of ribosomes while the remainder of the ribosomes function at normal rates. PMID:2776972

  6. Common Pharmacophore of Structurally Distinct Small-Molecule Inhibitors of Intracellular Retrograde Trafficking of Ribosome Inactivating Proteins

    NASA Astrophysics Data System (ADS)

    Yu, Shichao; Park, Jewn Giew; Kahn, Jennifer Nielsen; Tumer, Nilgun E.; Pang, Yuan-Ping

    2013-12-01

    We reported previously (+/-)-2-(5-methylthiophen-2-yl)-3-phenyl-2,3-dihydroquinazolin-4(1H)-one [(+/-)-Retro-2cycl] as the chemical structure of Retro-2 that showed mouse protection against ricin, a notorious ribosome inactivating protein (RIP). Herein we report our chemical resolution of (+/-)-Retro-2cycl, analog synthesis, and cell-based evaluation showing that the two optically pure enantiomers and their achiral analog have nearly the same degree of cell protection against ricin as (+/-)-Retro-2cycl. We also report our computational studies explaining the lack of stereo preference and revealing a common pharmacophore of structurally distinct inhibitors of intracellular retrograde trafficking of RIPs. This pharmacophore comprises a central aromatic ring o-substituted by an aromatic ring and a moiety bearing an O or S atom attached to sp2 C atom(s). These results offer new insights into lead identification and optimization for RIP antidote development to minimize the global health threat caused by ribosome-inactivating proteins.

  7. Crystallography of ribosomal particles

    NASA Astrophysics Data System (ADS)

    Yonath, A.; Frolow, F.; Shoham, M.; Müssig, J.; Makowski, I.; Glotz, C.; Jahn, W.; Weinstein, S.; Wittmann, H. G.

    1988-07-01

    Several forms of three-dimensional crystals and two-dimensional sheets of intact ribosomes and their subunits have been obtained as a result of: (a) an extensive systematic investigation of the parameters involved in crystallization, (b) a development of an experimental procedure for controlling the volumes of the crystallization droplets, (c) a study of the nucleation process, and (d) introducing a delicate seeding procedure coupled with variations in the ratios of mono- and divalent ions in the crystallization medium. In all cases only biologically active particles could be crystallized, and the crystalline material retains its integrity and activity. Crystallographic data have been collected from crystals of 50S ribosomal subunits, using synchrotron radiation at temperatures between + 19 and - 180°C. Although at 4°C the higher resolution reflections decay within minutes in the synchrotron beam, at cryo-temperature there was hardly any radiation damage, and a complete set of data to about 6Åresolution could be collected from a single crystal. Heavy-atom clusters were used for soaking as well as for specific binding to the surface of the ribosomal subunits prior to crystallization. The 50S ribosomal subunits from a mutant of B. stearothermophilus which lacks the ribosomal protein BL11 crystallize isomorphously with in the native ones. Models, aimed to be used for low resolution phasing, have been reconstructed from two-dimensional sheets of 70S ribosomes and 50S subunits at 47 and 30Å, respectively. These models show the overall structure of these particles, the contact areas between the large and small subunits, the space where protein synthesis might take place and a tunnel which may provide the path for the nascent protein chain.

  8. High-throughput, cell-based screens to identify small-molecule inhibitors of ricin toxin and related category b ribosome inactivating proteins (RIPs).

    PubMed

    Wahome, Paul G; Mantis, Nicholas J

    2013-02-01

    Ricin is a member of the ubiquitous ribosome-inactivating protein (RIP) family of toxins. The Centers for Disease Control and Prevention (CDC) classify ricin and related toxins as Category B biothreat agents. There are currently no antidotes or therapeutics to counteract RIPs in humans. The discovery of effective small-molecule inhibitors of RIPs is increasingly possible, however, due to the availability and accessibility of diverse small-molecule chemical libraries coupled with robust robotics and automated screening methodologies. In this article, we describe a cell-based, high-throughput screening strategy and secondary assays that we have successfully used to identify compounds that target ricin toxin's enzymatic activity and intracellular trafficking, as well as stress-activated signaling pathways associated with cell death. The methods described in the protocol are amenable to the other RIPs. PMID:23408195

  9. Genetic Selection of Peptide Aptamers That Interact and Inhibit Both Small Protein B and Alternative Ribosome-Rescue Factor A of Aeromonas veronii C4.

    PubMed

    Liu, Peng; Chen, Yong; Wang, Dan; Tang, Yanqiong; Tang, Hongqian; Song, Haichao; Sun, Qun; Zhang, Yueling; Liu, Zhu

    2016-01-01

    Aeromonas veronii is a pathogenic gram-negative bacterium, which infects a variety of animals and results in mass mortality. The stalled-ribosome rescues are reported to ensure viability and virulence under stress conditions, of which primarily include trans-translation and alternative ribosome-rescue factor A (ArfA) in A. veronii. For identification of specific peptides that interact and inhibit the stalled-ribosome rescues, peptide aptamer library (pTRG-SN-peptides) was constructed using pTRG as vector and Staphylococcus aureus nuclease (SN) as scaffold protein, in which 16 random amino acids were introduced to form an exposed surface loop. In the meantime both Small Protein B (SmpB) which acts as one of the key components in trans-translation, and ArfA were inserted to pBT to constitute pBT-SmpB and pBT-ArfA, respectively. The peptide aptamer PA-2 was selected from pTRG-SN-peptides by bacterial two-hybrid system (B2H) employing pBT-SmpB or pBT-ArfA as baits. The conserved sites G133K134 and D138K139R140 of C-terminal SmpB were identified by interacting with N-terminal SN, and concurrently the residue K62 of ArfA was recognized by interacting with the surface loop of the specific peptide aptamer PA-2. The expression plasmids pN-SN or pN-PA-2, which combined the duplication origin of pRE112 with the neokanamycin promoter expressing SN or PA-2, were created and transformed into A. veronii C4, separately. The engineered A. veronii C4 which endowing SN or PA-2 expression impaired growth capabilities under stress conditions including temperatures, sucrose, glucose, potassium chloride (KCl) and antibiotics, and the stress-related genes rpoS and nhaP were down-regulated significantly by Quantitative Real-time PCR (qRT-PCR) when treating in 2.0% KCl. Thus, the engineered A. veronii C4 conferring PA-2 expression might be potentially attenuated vaccine, and also the peptide aptamer PA-2 could develop as anti-microbial drugs targeted to the ribosome rescued factors in A

  10. Genetic Selection of Peptide Aptamers That Interact and Inhibit Both Small Protein B and Alternative Ribosome-Rescue Factor A of Aeromonas veronii C4

    PubMed Central

    Liu, Peng; Chen, Yong; Wang, Dan; Tang, Yanqiong; Tang, Hongqian; Song, Haichao; Sun, Qun; Zhang, Yueling; Liu, Zhu

    2016-01-01

    Aeromonas veronii is a pathogenic gram-negative bacterium, which infects a variety of animals and results in mass mortality. The stalled-ribosome rescues are reported to ensure viability and virulence under stress conditions, of which primarily include trans-translation and alternative ribosome-rescue factor A (ArfA) in A. veronii. For identification of specific peptides that interact and inhibit the stalled-ribosome rescues, peptide aptamer library (pTRG-SN-peptides) was constructed using pTRG as vector and Staphylococcus aureus nuclease (SN) as scaffold protein, in which 16 random amino acids were introduced to form an exposed surface loop. In the meantime both Small Protein B (SmpB) which acts as one of the key components in trans-translation, and ArfA were inserted to pBT to constitute pBT-SmpB and pBT-ArfA, respectively. The peptide aptamer PA-2 was selected from pTRG-SN-peptides by bacterial two-hybrid system (B2H) employing pBT-SmpB or pBT-ArfA as baits. The conserved sites G133K134 and D138K139R140 of C-terminal SmpB were identified by interacting with N-terminal SN, and concurrently the residue K62 of ArfA was recognized by interacting with the surface loop of the specific peptide aptamer PA-2. The expression plasmids pN-SN or pN-PA-2, which combined the duplication origin of pRE112 with the neokanamycin promoter expressing SN or PA-2, were created and transformed into A. veronii C4, separately. The engineered A. veronii C4 which endowing SN or PA-2 expression impaired growth capabilities under stress conditions including temperatures, sucrose, glucose, potassium chloride (KCl) and antibiotics, and the stress-related genes rpoS and nhaP were down-regulated significantly by Quantitative Real-time PCR (qRT-PCR) when treating in 2.0% KCl. Thus, the engineered A. veronii C4 conferring PA-2 expression might be potentially attenuated vaccine, and also the peptide aptamer PA-2 could develop as anti-microbial drugs targeted to the ribosome rescued factors in A

  11. Structural characterization of ribosome recruitment and translocation by type IV IRES

    PubMed Central

    Murray, Jason; Savva, Christos G; Shin, Byung-Sik; Dever, Thomas E; Ramakrishnan, V; Fernández, Israel S

    2016-01-01

    Viral mRNA sequences with a type IV IRES are able to initiate translation without any host initiation factors. Initial recruitment of the small ribosomal subunit as well as two translocation steps before the first peptidyl transfer are essential for the initiation of translation by these mRNAs. Using electron cryomicroscopy (cryo-EM) we have structurally characterized at high resolution how the Cricket Paralysis Virus Internal Ribosomal Entry Site (CrPV-IRES) binds the small ribosomal subunit (40S) and the translocation intermediate stabilized by elongation factor 2 (eEF2). The CrPV-IRES restricts the otherwise flexible 40S head to a conformation compatible with binding the large ribosomal subunit (60S). Once the 60S is recruited, the binary CrPV-IRES/80S complex oscillates between canonical and rotated states (Fernández et al., 2014; Koh et al., 2014), as seen for pre-translocation complexes with tRNAs. Elongation factor eEF2 with a GTP analog stabilizes the ribosome-IRES complex in a rotated state with an extra ~3 degrees of rotation. Key residues in domain IV of eEF2 interact with pseudoknot I (PKI) of the CrPV-IRES stabilizing it in a conformation reminiscent of a hybrid tRNA state. The structure explains how diphthamide, a eukaryotic and archaeal specific post-translational modification of a histidine residue of eEF2, is involved in translocation. DOI: http://dx.doi.org/10.7554/eLife.13567.001 PMID:27159451

  12. RNA Cytidine Acetyltransferase of Small-Subunit Ribosomal RNA: Identification of Acetylation Sites and the Responsible Acetyltransferase in Fission Yeast, Schizosaccharomyces pombe

    PubMed Central

    Taoka, Masato; Ishikawa, Daisuke; Nobe, Yuko; Ishikawa, Hideaki; Yamauchi, Yoshio; Terukina, Goro; Nakayama, Hiroshi; Hirota, Kouji; Takahashi, Nobuhiro; Isobe, Toshiaki

    2014-01-01

    The eukaryotic small-subunit (SSU) ribosomal RNA (rRNA) has two evolutionarily conserved acetylcytidines. However, the acetylation sites and the acetyltransferase responsible for the acetylation have not been identified. We performed a comprehensive MS-based analysis covering the entire sequence of the fission yeast, Schizosaccharomyces pombe, SSU rRNA and identified two acetylcytidines at positions 1297 and 1815 in the 3′ half of the rRNA. To identify the enzyme responsible for the cytidine acetylation, we searched for an S. pombe gene homologous to TmcA, a bacterial tRNA N-acetyltransferase, and found one potential candidate, Nat10. A temperature-sensitive strain of Nat10 with a mutation in the Walker A type ATP-binding motif abolished the cytidine acetylation in SSU rRNA, and the wild-type Nat10 supplemented to this strain recovered the acetylation, providing evidence that Nat10 is necessary for acetylation of SSU rRNA. The Nat10 mutant strain showed a slow-growth phenotype and was defective in forming the SSU rRNA from the precursor RNA, suggesting that cytidine acetylation is necessary for ribosome assembly. PMID:25402480

  13. Structural Insights Into Ribosome Recycling Factor Interactions with the 70S Ribosome

    PubMed Central

    Pai, Raj D.; Zhang, Wen; Schuwirth, Barbara S.; Hirokawa, Go; Kaji, Hideko; Kaji, Akira; Cate, Jamie H.D.

    2009-01-01

    SUMMARY At the end of translation in bacteria, ribosome recycling factor (RRF) is used together with Elongation Factor G (EF-G) to recycle the 30S and 50S ribosomal subunits for the next round of translation. In x-ray crystal structures of RRF with the Escherichia coli 70S ribosome, RRF binds to the large ribosomal subunit in the cleft that contains the peptidyl transferase center (PTC). Upon binding of either E. coli or T. thermophilus RRF to the E. coli ribosome, the tip of ribosomal RNA helix H69 in the large subunit moves away from the small subunit toward RRF by 8 Å, thereby disrupting a key contact between the small and large ribosomal subunits, termed bridge B2a. In the ribosome crystals, the ability of RRF to destabilize bridge B2a is influenced by crystal packing forces. Movement of H69 involves an ordered to disordered transition upon binding of RRF to the ribosome. The disruption of bridge B2a upon RRF binding to the ribosome seen in the present structures reveals one of the key roles that RRF plays in ribosome recycling, the dissociation of 70S ribosomes into subunits. The structures also reveal contacts between Domain II of RRF and protein S12 in the 30S subunit that may also play a role in ribosome recycling. PMID:18234219

  14. Cryo-EM structure of Hepatitis C virus IRES bound to the human ribosome at 3.9-Å resolution

    PubMed Central

    Quade, Nick; Boehringer, Daniel; Leibundgut, Marc; van den Heuvel, Joop; Ban, Nenad

    2015-01-01

    Hepatitis C virus (HCV), a widespread human pathogen, is dependent on a highly structured 5′-untranslated region of its mRNA, referred to as internal ribosome entry site (IRES), for the translation of all of its proteins. The HCV IRES initiates translation by directly binding to the small ribosomal subunit (40S), circumventing the need for many eukaryotic translation initiation factors required for mRNA scanning. Here we present the cryo-EM structure of the human 40S ribosomal subunit in complex with the HCV IRES at 3.9 Å resolution, determined by focused refinement of an 80S ribosome–HCV IRES complex. The structure reveals the molecular details of the interactions between the IRES and the 40S, showing that expansion segment 7 (ES7) of the 18S rRNA acts as a central anchor point for the HCV IRES. The structural data rationalizes previous biochemical and genetic evidence regarding the initiation mechanism of the HCV and other related IRESs. PMID:26155016

  15. Non-Diamond Blackfan anemia disorders of ribosome function: Shwachman Diamond syndrome and 5q- syndrome.

    PubMed

    Burwick, Nicholas; Shimamura, Akiko; Liu, Johnson M

    2011-04-01

    A number of human disorders, dubbed ribosomopathies, are linked to impaired ribosome biogenesis or function. These include but are not limited to Diamond Blackfan anemia (DBA), Shwachman Diamond syndrome (SDS), and the 5q- myelodysplastic syndrome (MDS). This review focuses on the latter two non-DBA disorders of ribosome function. Both SDS and 5q- syndrome lead to impaired hematopoiesis and a predisposition to leukemia. SDS, due to bi-allelic mutations of the SBDS gene, is a multi-system disorder that also includes bony abnormalities, and pancreatic and neurocognitive dysfunction. SBDS associates with the 60S subunit in human cells and has a role in subunit joining and translational activation in yeast models. In contrast, 5q- syndrome is associated with acquired haplo-insufficiency of RPS14, a component of the small 40S subunit. RPS14 is critical for 40S assembly in yeast models, and depletion of RPS14 in human CD34(+) cells is sufficient to recapitulate the 5q- erythroid defect. Both SDS and the 5q- syndrome represent important models of ribosome function and may inform future treatment strategies for the ribosomopathies. PMID:21435510

  16. Ribosomal Database Project II

    DOE Data Explorer

    The Ribosomal Database Project (RDP) provides ribosome related data and services to the scientific community, including online data analysis and aligned and annotated Bacterial small-subunit 16S rRNA sequences. As of March 2008, RDP Release 10 is available and currently (August 2009) contains 1,074,075 aligned 16S rRNA sequences. Data that can be downloaded include zipped GenBank and FASTA alignment files, a histogram (in Excel) of the number of RDP sequences spanning each base position, data in the Functional Gene Pipeline Repository, and various user submitted data. The RDP-II website also provides numerous analysis tools.[From the RDP-II home page at http://rdp.cme.msu.edu/index.jsp

  17. Sequence variation in nuclear ribosomal small subunit, internal transcribed spacer and large subunit regions of Rhizophagus irregularis and Gigaspora margarita is high and isolate-dependent.

    PubMed

    Thiéry, Odile; Vasar, Martti; Jairus, Teele; Davison, John; Roux, Christophe; Kivistik, Paula-Ann; Metspalu, Andres; Milani, Lili; Saks, Ülle; Moora, Mari; Zobel, Martin; Öpik, Maarja

    2016-06-01

    Arbuscular mycorrhizal (AM) fungi are known to exhibit high intra-organism genetic variation. However, information about intra- vs. interspecific variation among the genes commonly used in diversity surveys is limited. Here, the nuclear small subunit (SSU) rRNA gene, internal transcribed spacer (ITS) region and large subunit (LSU) rRNA gene portions were sequenced from 3 to 5 individual spores from each of two isolates of Rhizophagus irregularis and Gigaspora margarita. A total of 1482 Sanger sequences (0.5 Mb) from 239 clones were obtained, spanning ~4370 bp of the ribosomal operon when concatenated. Intrasporal and intra-isolate sequence variation was high for all three regions even though variant numbers were not exhausted by sequencing 12-40 clones per isolate. Intra-isolate nucleotide variation levels followed the expected order of ITS > LSU > SSU, but the values were strongly dependent on isolate identity. Single nucleotide polymorphism (SNP) densities over 4 SNP/kb in the ribosomal operon were detected in all four isolates. Automated operational taxonomic unit picking within the sequence set of known identity overestimated species richness with almost all cut-off levels, markers and isolates. Average intraspecific sequence similarity values were 99%, 96% and 94% for amplicons in SSU, LSU and ITS, respectively. The suitability of the central part of the SSU as a marker for AM fungal community surveys was further supported by its level of nucleotide variation, which is similar to that of the ITS region; its alignability across the entire phylum; its appropriate length for next-generation sequencing; and its ease of amplification in single-step PCR. PMID:27092961

  18. Megraft: A software package to graft ribosomal small subunit (16S/18S) fragments onto full-length sequences for accurate species richness and sequencing depth analysis in pyrosequencing-length metagenomes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Metagenomic libraries represent subsamples of the total DNA found at a study site and offer unprecedented opportunities to study ecological and functional aspects of microbial communities. To examine the depth of the sequencing effort, rarefaction analysis of the ribosomal small sub-unit (SSU/16S/18...

  19. Neutron scattering in the ribosome structure

    NASA Astrophysics Data System (ADS)

    Serdyuk, Igor N.

    1997-02-01

    Thermal neutron scattering has become a powerful instrument for studying the ribosome and its components. The application of neutron scattering allowed to establish some principal features of the ribosome structure: non-homogeneous distribution of the RNA and protein within ribosomal particles, the RNA role as a framework in the arrangement and maintenance of the structure of ribosomal particles, and the globular character of ribosomal proteins. The use of selective deuteration of separate ribosomal proteins in combination with the triangulation method revealed mutual spatial arrangement (the 3D-map) of all the ribosomal proteins within the small particle and in the most part of the large ribosomal particle. An essential impact has been made in the structural studies of ribosomes with the development of novel experimental approaches: triple isotopic substitution and spin contrast variation. These approaches with direct interpretation of spherical harmonics provide new possibilities for constructing models of ribosomal particles, opening principally new perspectives for joint use of X-ray synchrotron diffraction in crystals and small-angle neutron scattering in solution.

  20. HCV IRES manipulates the ribosome to promote the switch from translation initiation to elongation.

    PubMed

    Filbin, Megan E; Vollmar, Breanna S; Shi, Dan; Gonen, Tamir; Kieft, Jeffrey S

    2013-02-01

    The internal ribosome entry site (IRES) of the hepatitis C virus (HCV) drives noncanonical initiation of protein synthesis necessary for viral replication. Functional studies of the HCV IRES have focused on 80S ribosome formation but have not explored its role after the 80S ribosome is poised at the start codon. Here, we report that mutations of an IRES domain that docks in the 40S subunit's decoding groove cause only a local perturbation in IRES structure and result in conformational changes in the IRES-rabbit 40S subunit complex. Functionally, the mutations decrease IRES activity by inhibiting the first ribosomal translocation event, and modeling results suggest that this effect occurs through an interaction with a single ribosomal protein. The ability of the HCV IRES to manipulate the ribosome provides insight into how the ribosome's structure and function can be altered by bound RNAs, including those derived from cellular invaders. PMID:23262488

  1. A definition of the domains Archaea, Bacteria and Eucarya in terms of small subunit ribosomal RNA characteristics

    NASA Technical Reports Server (NTRS)

    Winker, S.; Woese, C. R.

    1991-01-01

    The number of small subunit rRNA sequences is now great enough that the three domains Archaea, Bacteria and Eucarya (Woese et al., 1990) can be reliably defined in terms of their sequence "signatures". Approximately 50 homologous positions (or nucleotide pairs) in the small subunit rRNA characterize and distinguish among the three. In addition, the three can be recognized by a variety of nonhomologous rRNA characters, either individual positions and/or higher-order structural features. The Crenarchaeota and the Euryarchaeota, the two archaeal kingdoms, can also be defined and distinguished by their characteristic compositions at approximately fifteen positions in the small subunit rRNA molecule.

  2. LOOP IIId of the HCV IRES is essential for the structural rearrangement of the 40S-HCV IRES complex

    PubMed Central

    Angulo, Jenniffer; Ulryck, Nathalie; Deforges, Jules; Chamond, Nathalie; Lopez-Lastra, Marcelo; Masquida, Benoît; Sargueil, Bruno

    2016-01-01

    As obligatory intracellular parasites, viruses rely on cellular machines to complete their life cycle, and most importantly they recruit the host ribosomes to translate their mRNA. The Hepatitis C viral mRNA initiates translation by directly binding the 40S ribosomal subunit in such a way that the initiation codon is correctly positioned in the P site of the ribosome. Such a property is likely to be central for many viruses, therefore the description of host-pathogen interaction at the molecular level is instrumental to provide new therapeutic targets. In this study, we monitored the 40S ribosomal subunit and the viral RNA structural rearrangement induced upon the formation of the binary complex. We further took advantage of an IRES viral mutant mRNA deficient for translation to identify the interactions necessary to promote translation. Using a combination of structure probing in solution and molecular modeling we establish a whole atom model which appears to be very similar to the one obtained recently by cryoEM. Our model brings new information on the complex, and most importantly reveals some structural rearrangement within the ribosome. This study suggests that the formation of a ‘kissing complex’ between the viral RNA and the 18S ribosomal RNA locks the 40S ribosomal subunit in a conformation proficient for translation. PMID:26626152

  3. LOOP IIId of the HCV IRES is essential for the structural rearrangement of the 40S-HCV IRES complex.

    PubMed

    Angulo, Jenniffer; Ulryck, Nathalie; Deforges, Jules; Chamond, Nathalie; Lopez-Lastra, Marcelo; Masquida, Benoît; Sargueil, Bruno

    2016-02-18

    As obligatory intracellular parasites, viruses rely on cellular machines to complete their life cycle, and most importantly they recruit the host ribosomes to translate their mRNA. The Hepatitis C viral mRNA initiates translation by directly binding the 40S ribosomal subunit in such a way that the initiation codon is correctly positioned in the P site of the ribosome. Such a property is likely to be central for many viruses, therefore the description of host-pathogen interaction at the molecular level is instrumental to provide new therapeutic targets. In this study, we monitored the 40S ribosomal subunit and the viral RNA structural rearrangement induced upon the formation of the binary complex. We further took advantage of an IRES viral mutant mRNA deficient for translation to identify the interactions necessary to promote translation. Using a combination of structure probing in solution and molecular modeling we establish a whole atom model which appears to be very similar to the one obtained recently by cryoEM. Our model brings new information on the complex, and most importantly reveals some structural rearrangement within the ribosome. This study suggests that the formation of a 'kissing complex' between the viral RNA and the 18S ribosomal RNA locks the 40S ribosomal subunit in a conformation proficient for translation. PMID:26626152

  4. Ribonucleic acid and ribosomes of Bacillus stearothermophilus.

    PubMed

    Saunders, G F; Campbell, L L

    1966-01-01

    Saunders, Grady F. (University of Illinois, Urbana), and L. Leon Campbell. Ribonucleic acid and ribosomes of Bacillus stearothermophilus. J. Bacteriol. 91:332-339. 1966.-The ability of some thermophilic bacteria to grow at temperatures as high as 76 C emphasizes the remarkable thermal stability of their crucial macromolecules. An investigation of the ribonucleic acid (RNA) and ribosomes of Bacillus stearothermophilus was conducted. Washed log-phase cells were disrupted either by sonic treatment or by alumina grinding in 10(-2)m MgCl(2)-10(-2)m tris-(hydroxymethyl)aminomethane buffer, pH 7.4 (TM buffer). Ultracentrifugal analysis revealed peaks at 72.5S, 101S, and 135S, with the 101S peak being the most prominent. By lowering the Mg(++) concentration to 10(-3)m, the ribosome preparation was dissociated to give 40S, 31S, and 54S peaks. These in turn were reassociated in the presence of 10(-2)m Mg(++) to give the larger 73S and 135S particles. When heated in TM buffer, Escherichia coli ribosomes began a gradual dissociation at 58 C, and at 70 C underwent a large hyperchromic shift with a T(m) at 72.8 C. In contrast, B. stearothermophilus ribosomes did not show a hyperchromic shift below 70 C; they had a T(m) of 77.9 C. The thermal denaturation curves of the 4S, 16S, and 23S RNA from both organisms were virtually identical. The gross amino acid composition of B. stearothermophilus ribosomes showed no marked differences from that reported for E. coli ribosomes. These data suggest that the unusual thermal stability of B. stearothermophilus ribosomes may reflect either an unusual packing arrangement of the protein to the RNA or differences in the primary structure of the ribosomal proteins. PMID:5903099

  5. Ribosome engineering to promote new crystal forms

    SciTech Connect

    Selmer, Maria; Gao, Yong-Gui; Weixlbaumer, Albert; Ramakrishnan, V.

    2012-05-01

    Truncation of ribosomal protein L9 in T. thermophilus allows the generation of new crystal forms and the crystallization of ribosome–GTPase complexes. Crystallographic studies of the ribosome have provided molecular details of protein synthesis. However, the crystallization of functional complexes of ribosomes with GTPase translation factors proved to be elusive for a decade after the first ribosome structures were determined. Analysis of the packing in different 70S ribosome crystal forms revealed that regardless of the species or space group, a contact between ribosomal protein L9 from the large subunit and 16S rRNA in the shoulder of a neighbouring small subunit in the crystal lattice competes with the binding of GTPase elongation factors to this region of 16S rRNA. To prevent the formation of this preferred crystal contact, a mutant strain of Thermus thermophilus, HB8-MRCMSAW1, in which the ribosomal protein L9 gene has been truncated was constructed by homologous recombination. Mutant 70S ribosomes were used to crystallize and solve the structure of the ribosome with EF-G, GDP and fusidic acid in a previously unobserved crystal form. Subsequent work has shown the usefulness of this strain for crystallization of the ribosome with other GTPase factors.

  6. Scattering studies on ribosomes in solution

    NASA Astrophysics Data System (ADS)

    Ramakrishnan, V.

    1986-02-01

    Ribosomes are organelles that play a central role in protein synthesis. They are complexes of protein and nucleic acid, and can be analysed as two-component systems by neutron scattering. Moreover, ribosomes can be biochemically prepared that have specific proteins deuterated. Both these properties have been exploited to study the structure of the ribosome by neutron scattering. This article reviews the studies carried out on the small ribosomal subunit, and describes a recent study that has resolved a conflict between the results of two classes of experiments.

  7. Biogenesis and nuclear export of ribosomal subunits in higher eukaryotes depend on the CRM1 export pathway.

    PubMed

    Thomas, Franziska; Kutay, Ulrike

    2003-06-15

    The production of ribosomes constitutes a major biosynthetic task for cells. Eukaryotic small and large ribosomal subunits are assembled in the nucleolus and independently exported to the cytoplasm. Most nuclear export pathways require RanGTP-binding export receptors. We analyzed the role of CRM1, the export receptor for leucine-rich nuclear export signals (NES), in the biogenesis of ribosomal subunits in vertebrate cells. Inhibition of the CRM1 export pathway led to a defect in nuclear export of both 40S and 60S subunits in HeLa cells. Moreover, the export of newly made ribosomal subunits in Xenopus oocytes was efficiently and specifically competed by BSA-NES conjugates. The CRM1 dependence of 60S subunit export suggested a conserved function for NMD3, a factor proposed to be a 60S subunit export adaptor in yeast. Indeed, we observed that nuclear export of human NMD3 (hNMD3) is sensitive to leptomycin B (LMB), which inactivates CRM1. It had, however, not yet been demonstrated that Nmd3 can interact with CRM1. Using purified recombinant proteins we have shown here that hNMD3 binds to CRM1 directly, in a RanGTP-dependent manner, by way of a C-terminal NES sequence. Our results suggest that the functions of CRM1 and NMD3 in ribosomal subunit export are conserved from yeast to higher eukaryotes. PMID:12724356

  8. Functional Role of Ribosomal Signatures

    PubMed Central

    Chen, Ke; Eargle, John; Sarkar, Krishnarjun; Gruebele, Martin; Luthey-Schulten, Zaida

    2010-01-01

    Although structure and sequence signatures in ribosomal RNA and proteins are defining characteristics of the three domains of life and instrumental in constructing the modern phylogeny, little is known about their functional roles in the ribosome. In this work, the largest coevolving RNA/protein signatures in the bacterial 30S ribosome are investigated both experimentally and computationally through all-atom molecular-dynamics simulations. The complex includes the N-terminal fragment of the ribosomal protein S4, which is a primary binding protein that initiates 30S small subunit assembly from the 5′ domain, and helix 16 (h16), which is part of the five-way junction in 16S rRNA. Our results show that the S4 N-terminus signature is intrinsically disordered in solution, whereas h16 is relatively stable by itself. The dynamic disordered property of the protein is exploited to couple the folding and binding process to the five-way junction, and the results provide insight into the mechanism for the early and fast binding of S4 in the assembly of the ribosomal small subunit. PMID:21156135

  9. Ribosomal protein S6 is highly expressed in non-Hodgkin lymphoma and associates with mRNA containing a 5' terminal oligopyrimidine tract.

    PubMed

    Hagner, P R; Mazan-Mamczarz, K; Dai, B; Balzer, E M; Corl, S; Martin, S S; Zhao, X F; Gartenhaus, R B

    2011-03-31

    The molecular mechanism(s) linking tumorigenesis and morphological alterations in the nucleolus are presently coming into focus. The nucleolus is the cellular organelle in which the formation of ribosomal subunits occurs. Ribosomal biogenesis occurs through the transcription of ribosomal RNA (rRNA), rRNA processing and production of ribosomal proteins. An error in any of these processes may lead to deregulated cellular translation, evident in multiple cancers and 'ribosomopathies'. Deregulated protein synthesis may be achieved through the overexpression of ribosomal proteins as seen in primary leukemic blasts with elevated levels of ribosomal proteins S11 and S14. In this study, we demonstrate that ribosomal protein S6 (RPS6) is highly expressed in primary diffuse large B-cell lymphoma (DLBCL) samples. Genetic modulation of RPS6 protein levels with specifically targeted short hairpin RNA (shRNA) lentiviruses led to a decrease in the actively proliferating population of cells compared with control shRNA. Low-dose rapamycin treatments have been shown to affect the translation of 5' terminal oligopyrimidine (5' TOP) tract mRNA, which encodes the translational machinery, implicating RPS6 in 5' TOP translation. Recently, it was shown that disruption of 40S ribosomal biogenesis through specific small inhibitory RNA knockdown of RPS6 defined RPS6 as a critical regulator of 5' TOP translation. For the first time, we show that RPS6 associates with multiple mRNAs containing a 5' TOP tract. These findings expand our understanding of the mechanism(s) involved in ribosomal biogenesis and deregulated protein synthesis in DLBCL. PMID:21102526

  10. A Method for Studying Protistan Diversity Using Massively Parallel Sequencing of V9 Hypervariable Regions of Small-Subunit Ribosomal RNA Genes

    PubMed Central

    Amaral-Zettler, Linda A.; McCliment, Elizabeth A.; Ducklow, Hugh W.; Huse, Susan M.

    2009-01-01

    Background Massively parallel pyrosequencing of amplicons from the V6 hypervariable regions of small-subunit (SSU) ribosomal RNA (rRNA) genes is commonly used to assess diversity and richness in bacterial and archaeal populations. Recent advances in pyrosequencing technology provide read lengths of up to 240 nucleotides. Amplicon pyrosequencing can now be applied to longer variable regions of the SSU rRNA gene including the V9 region in eukaryotes. Methodology/Principal Findings We present a protocol for the amplicon pyrosequencing of V9 regions for eukaryotic environmental samples for biodiversity inventories and species richness estimation. The International Census of Marine Microbes (ICoMM) and the Microbial Inventory Research Across Diverse Aquatic Long Term Ecological Research Sites (MIRADA-LTERs) projects are already employing this protocol for tag sequencing of eukaryotic samples in a wide diversity of both marine and freshwater environments. Conclusions/Significance Massively parallel pyrosequencing of eukaryotic V9 hypervariable regions of SSU rRNA genes provides a means of estimating species richness from deeply-sampled populations and for discovering novel species from the environment. PMID:19633714

  11. Ultrastructural characteristics and small subunit ribosomal DNA sequence of Vairimorpha cheracis sp. nov., (Microspora: Burenellidae), a parasite of the Australian yabby, Cherax destructor (Decapoda: Parastacidae).

    PubMed

    Moodie, Elizabeth G; Le Jambre, Leo F; Katz, Margaret E

    2003-11-01

    This is the first record of a species of Vairimorpha infecting a crustacean host. Vairimorpha cheracis sp. nov. was found in a highland population of the Australian freshwater crayfish, Cherax destructor. The majority of spores and earlier developmental stages of V. cheracis sp. nov. were found within striated muscle cells of the thorax, abdomen, and appendages of the crayfish. Only octosporoblastic sporogony within sporophorous vesicles (SPVs) was observed. Diplokaryotic sporonts separated into two uninucleate daughter cells, each of which gave rise to four sporoblasts in a rosette-shaped plasmodium, so that eight uninucleate spores were produced within the persistent ovoid SPV. Ultrastructural features of stages in the octosporoblastic sequence were similar to those described for Vairimorpha necatrix, the type species. Mature spores were pyriform in shape and averaged 3.4x1.9 microm in dimensions. The anterior polaroplast was lamellar in structure, and the posterior polaroplast vesicular. The polar filament was coiled 10-12 times, lateral to the posterior vacuole. The small subunit ribosomal DNA (SSU rDNA) of V. cheracis sp. nov. was sequenced and compared with other microsporidia. V. cheracis sp. nov. showed over 97% sequence identity with Vairimorpha imperfecta and five species of Nosema, and only 86% sequence identity with V. necatrix. The need for a taxonomic revision of the Nosema/Vairimorpha group of species is discussed. PMID:14726242

  12. The Large Ribosomal Subunit Protein L9 Enables the Growth of EF-P Deficient Cells and Enhances Small Subunit Maturation

    PubMed Central

    Naganathan, Anusha; Wood, Matthew P.; Moore, Sean D.

    2015-01-01

    The loss of the large ribosomal protein L9 causes a reduction in translation fidelity by an unknown mechanism. To identify pathways affected by L9, we identified mutants of E. coli that require L9 for fitness. In a prior study, we characterized L9-dependent mutations in the essential GTPase Der (EngA). Here, we describe a second class of L9-dependent mutations that either compromise or inactivate elongation factor P (EF-P, eIF5A in eukaryotes). Without L9, Δefp cells are practically inviable. Cell fractionation studies revealed that, in both the Der and EF-P mutant cases, L9's activity reduces immature 16S rRNA in 30S particles and partially restores the abundance of monosomes. Inspired by these findings, we discovered that L9 also enhances 16S maturation in wild-type cells. Surprisingly, although the amount of immature 16S in 30S particles was found to be elevated in ΔrplI cells, the amount in polysomes was low and inversely correlated with the immature 16S abundance. These findings provide an explanation for the observed fitness increases afforded by L9 in these mutants and reveal particular physiological conditions in which L9 becomes critical. Additionally, L9 may affect the partitioning of small subunits containing immature 16S rRNA. PMID:25879934

  13. Prevalence, Genetic Characterization, and 18S Small Subunit Ribosomal RNA Diversity of Trypanosoma rangeli in Triatomine and Mammal Hosts in Endemic Areas for Chagas Disease in Ecuador.

    PubMed

    Ocaña-Mayorga, Sofia; Aguirre-Villacis, Fernanda; Pinto, C Miguel; Vallejo, Gustavo A; Grijalva, Mario J

    2015-12-01

    Trypanosoma rangeli is a nonpathogenic parasite for humans; however, its medical importance relies in its similarity and overlapping distribution with Trypanosoma cruzi, causal agent of Chagas disease in the Americas. The genetic diversity of T. rangeli and its association with host species (triatomines and mammals) has been identified along Central and the South America; however, it has not included data of isolates from Ecuador. This study reports infection with T. rangeli in 18 genera of mammal hosts and five species of triatomines in three environments (domestic, peridomestic, and sylvatic). Higher infection rates were found in the sylvatic environment, in close association with Rhodnius ecuadoriensis. The results of this study extend the range of hosts infected with this parasite and the geographic range of the T. rangeli genotype KP1(-)/lineage C in South America. It was not possible to detect variation on T. rangeli from the central coastal region and southern Ecuador with the analysis of the small subunit ribosomal RNA (SSU-rRNA) gene, even though these areas are ecologically different and a phenotypic subdivision of R. ecuadoriensis has been found. R. ecuadoriensis is considered one of the most important vectors for Chagas disease transmission in Ecuador due to its wide distribution and adaptability to diverse environments. An extensive knowledge of the trypanosomes circulating in this species of triatomine, and associated mammal hosts, is important for delineating transmission dynamics and preventive measures in the endemic areas of Ecuador and Northern Peru. PMID:26645579

  14. Phylogeny of organisms investigated by the base-pair changes in the stem regions of small and large ribosomal subunit RNAs.

    PubMed

    Otsuka, J; Terai, G; Nakano, T

    1999-02-01

    In order to obtain the evolutionary distance data that are as purely additive as possible, we have developed a novel method for evaluating the evolutionary distances from the base-pair changes in stem regions of ribosomal RNAs (rRNAs). The application of this method to small-subunit (SSU) and large-subunit (LSU) rRNAs provides the distance data, with which both the unweighted pair group method of analysis and the neighbor-joining method give almost the same tree topology of most organisms except for some Protoctista, thermophilic bacteria, parasitic organisms, and endosymbionts. Although the evolutionary distances calculated with LSU rRNAs are somewhat longer than those with SSU rRNAs, the difference, probably due to a slight difference in functional constraint, is substantially decreased when the distances are converted into the divergence times of organisms by the measure of the time scale estimated in each type of rRNAs. The divergence times of main branches agree fairly well with the geological record of organisms, at least after the appearance of oxygen-releasing photosynthesis, although the divergence times of Eukaryota, Archaebacteria, and Eubacteria are somewhat overestimated in comparison with the geological record of Earth formation. This result is explained by considering that the mutation rate is determined by the accumulation of misrepairs for DNA damage caused by radiation and that the effect of radiation had been stronger before the oxygen molecules became abundant in the atmosphere of the Earth. PMID:9929391

  15. Ribosome dynamics and the evolutionary history of ribosomes

    NASA Astrophysics Data System (ADS)

    Fox, George E.; Paci, Maxim; Tran, Quyen; Petrov, Anton S.; Williams, Loren D.

    2015-09-01

    The ribosome is a dynamic nanomachine responsible for coded protein synthesis. Its major subsystems were essentially in place at the time of the last universal common ancestor (LUCA). Ribosome evolutionary history thus potentially provides a window into the pre- LUCA world. This history begins with the origins of the peptidyl transferase center where the actual peptide is synthesized and then continues over an extended timeframe as additional functional centers including the GTPase center are added. The large ribosomal RNAs (rRNAs) have grown over time by an accretion process and a model exists that proposes a relative age of each accreted element. We have compared atomic resolution ribosome structures before and after EF-G bound GTP hydrolysis and thereby identified the location of 23 pivot points in the large rRNAs that facilitate ribosome dynamics. Pivots in small subunit helices h28 and h44 appear to be especially central to the process and according to the accretion model significantly older than the other helices containing pivots. Overall, the results suggest that ribosomal dynamics occurred in two phases. In the first phase, an inherently mobile h28/h44 combination provided the flexibility needed to create a dynamic ribosome that was essentially a Brownian machine. This addition likely made coded peptide synthesis possible by facilitating movement of a primitive mRNA. During the second phase, addition of pivoting elements and the creation of a factor binding site allowed the regulation of the inherent motion created by h28/h44. All of these events likely occurred before LUCA.

  16. Cap-dependent translation is mediated by 'RNA looping' rather than 'ribosome scanning'.

    PubMed

    Jang, Sung Key; Paek, Ki Young

    2016-01-01

    The 40S ribosomal subunit cannot directly recognize the start codon of eukaryotic mRNAs. Instead, it recognizes the start codon after its association with the 5'-cap structure via translation initiation factors. Base-by-base inspection of the 5'UTR by a scanning ribosome is the generally accepted hypothesis of start codon selection. As part of an effort to confirm the underlying mechanism of start codon selection by the 40S ribosome, we investigated the role of eIF4G, which participates in the recruitment of 40S ribosomes to various translation enhancers, such as 5'-cap structure, poly(A) tail, and several internal ribosome entry sites. We found that an artificial translation factor composed of recombinant eIF4G fused with MS2 greatly enhanced translation of an upstream reporter gene when it was tethered to the 3'UTR. These data suggest that the 40S ribosome recruited to a translation enhancer can find the start codon by looping of the intervening RNA segment. The 'RNA-looping' hypothesis of translation start codon recognition was further supported by an analysis of the effect of 5'UTR length on translation efficiency and the mathematically predicted probability of RNA-loop-mediated interactions between the start codon and the 40S ribosome associated at the 5'-end. PMID:26515582

  17. Redescription of Rhizodomus tagatzi (Ciliophora: Spirotrichea: Tintinnida), based on morphology and small subunit ribosomal RNA gene sequence.

    PubMed

    Saccà, Alessandro; Strüder-Kypke, Michaela C; Lynn, Denis H

    2012-01-01

    Herein, we redescribe a tintinnid ciliate that is most commonly known as Tintinnopsis corniger Hada, 1964; but it has been described several times with different names, specifically Tintinnopsis nudicauda Paulmier, 1997 and Rhizodomus tagatzi Strelkow & Wirketis, 1950. Neotype material was collected from the water column of the coastal saline Lake Faro, a meromictic basin connected to the Straits of Messina, Central Mediterranean. The Lake Faro population is characterized by a hyaline or sparsely agglomerated lorica, which made it possible to observe in detail the basal layer structure, usually concealed by abundant incrusting particles. Along with an improved description of the lorica, we provide novel information, such as the general zooid morphology, the ciliary pattern, and the small subunit rRNA (SSU rRNA) gene sequence. Our phylogenetic analysis, based on the SSU rRNA, groups this species with Tintinnopsis radix, while the first taxonomic study designated it as R. tagatzi, introducing a new genus due to peculiarities in lorica morphology. We conclude that the species should be known as R. tagatzi, the senior synonym for the species. However, we do not transfer any other species to this genus, despite strong molecular similarities. Although it is obvious that the genus Tintinnopsis is in need of a thorough revision, current molecular and cytological information for this genus is too sparse, and the type species has not yet been redescribed with modern methods. PMID:22452414

  18. The methyltransferase adaptor protein Trm112 is involved in biogenesis of both ribosomal subunits

    PubMed Central

    Sardana, Richa; Johnson, Arlen W.

    2012-01-01

    We previously identified Bud23 as the methyltransferase that methylates G1575 of rRNA in the P-site of the small (40S) ribosomal subunit. In this paper, we show that Bud23 requires the methyltransferase adaptor protein Trm112 for stability in vivo. Deletion of Trm112 results in a bud23Δ-like mutant phenotype. Thus Trm112 is required for efficient small-subunit biogenesis. Genetic analysis suggests the slow growth of a trm112Δ mutant is due primarily to the loss of Bud23. Surprisingly, suppression of the bud23Δ-dependent 40S defect revealed a large (60S) biogenesis defect in a trm112Δ mutant. Using sucrose gradient sedimentation analysis and coimmunoprecipitation, we show that Trm112 is also involved in 60S subunit biogenesis. The 60S defect may be dependent on Nop2 and Rcm1, two additional Trm112 interactors that we identify. Our work extends the known range of Trm112 function from modification of tRNAs and translation factors to both ribosomal subunits, showing that its effects span all aspects of the translation machinery. Although Trm112 is required for Bud23 stability, our results suggest that Trm112 is not maintained in a stable complex with Bud23. We suggest that Trm112 stabilizes its free methyltransferase partners not engaged with substrate and/or helps to deliver its methyltransferase partners to their substrates. PMID:22956767

  19. HCV IRES manipulates the ribosome to promote the switch from translation initiation to elongation

    PubMed Central

    Filbin, Megan E.; Vollmar, Breanna S.; Shi, Dan; Gonen, Tamir; Kieft, Jeffrey S.

    2012-01-01

    The hepatitis C virus (HCV) internal ribosome entry site (IRES) drives non-canonical initiation of protein synthesis necessary for viral replication. HCV IRES functional studies have focused on 80S ribosome formation, but have not explored roles after the 80S ribosome is poised at the start codon. Here, we report that mutations of an IRES domain that docks in the 40S subunit’s decoding groove and cause only a local perturbation in IRES structure result in conformational changes in the IRES-rabbit 40S subunit complex. Functionally, we find the mutation decreases IRES activity by inhibiting the first ribosome translocation event, and modeling suggests that this effect is through an interaction with a single ribosomal protein. The HCV IRES’ ability to manipulate the ribosome provides insight into how the ribosome’s structure and function can be altered by bound RNAs, including those derived from cellular invaders. PMID:23262488

  20. Ribosome biogenesis in the yeast Saccharomyces cerevisiae.

    PubMed

    Woolford, John L; Baserga, Susan J

    2013-11-01

    Ribosomes are highly conserved ribonucleoprotein nanomachines that translate information in the genome to create the proteome in all cells. In yeast these complex particles contain four RNAs (>5400 nucleotides) and 79 different proteins. During the past 25 years, studies in yeast have led the way to understanding how these molecules are assembled into ribosomes in vivo. Assembly begins with transcription of ribosomal RNA in the nucleolus, where the RNA then undergoes complex pathways of folding, coupled with nucleotide modification, removal of spacer sequences, and binding to ribosomal proteins. More than 200 assembly factors and 76 small nucleolar RNAs transiently associate with assembling ribosomes, to enable their accurate and efficient construction. Following export of preribosomes from the nucleus to the cytoplasm, they undergo final stages of maturation before entering the pool of functioning ribosomes. Elaborate mechanisms exist to monitor the formation of correct structural and functional neighborhoods within ribosomes and to destroy preribosomes that fail to assemble properly. Studies of yeast ribosome biogenesis provide useful models for ribosomopathies, diseases in humans that result from failure to properly assemble ribosomes. PMID:24190922

  1. Features of 80S mammalian ribosome and its subunits

    PubMed Central

    Budkevich, Tatyana V.; El'skaya, Anna V.; Nierhaus, Knud H.

    2008-01-01

    It is generally believed that basic features of ribosomal functions are universally valid, but a systematic test still stands out for higher eukaryotic 80S ribosomes. Here we report: (i) differences in tRNA and mRNA binding capabilities of eukaryotic and bacterial ribosomes and their subunits. Eukaryotic 40S subunits bind mRNA exclusively in the presence of cognate tRNA, whereas bacterial 30S do bind mRNA already in the absence of tRNA. 80S ribosomes bind mRNA efficiently in the absence of tRNA. In contrast, bacterial 70S interact with mRNA more productively in the presence rather than in the absence of tRNA. (ii) States of initiation (Pi), pre-translocation (PRE) and post-translocation (POST) of the ribosome were checked and no significant functional differences to the prokaryotic counterpart were observed including the reciprocal linkage between A and E sites. (iii) Eukaryotic ribosomes bind tetracycline with an affinity 15 times lower than that of bacterial ribosomes (Kd 30 μM and 1–2 μM, respectively). The drug does not effect enzymatic A-site occupation of 80S ribosomes in contrast to non-enzymatic tRNA binding to the A-site. Both observations explain the relative resistance of eukaryotic ribosomes to this antibiotic. PMID:18632761

  2. A small RNA regulates multiple ABC transporter mRNAs by targeting C/A-rich elements inside and upstream of ribosome-binding sites

    PubMed Central

    Sharma, Cynthia M.; Darfeuille, Fabien; Plantinga, Titia H.; Vogel, Jörg

    2007-01-01

    The interactions of numerous regulatory small RNAs (sRNAs) with target mRNAs have been characterized, but how sRNAs can regulate multiple, structurally unrelated mRNAs is less understood. Here we show that Salmonella GcvB sRNA directly acts on seven target mRNAs that commonly encode periplasmic substrate-binding proteins of ABC uptake systems for amino acids and peptides. Alignment of GcvB homologs of distantly related bacteria revealed a conserved G/U-rich element that is strictly required for GcvB target recognition. Analysis of target gene fusion regulation in vivo, and in vitro structure probing and translation assays showed that GcvB represses its target mRNAs by binding to extended C/A-rich regions, which may also serve as translational enhancer elements. In some cases (oppA, dppA), GcvB repression can be explained by masking the ribosome-binding site (RBS) to prevent 30S subunit binding. However, GcvB can also effectively repress translation by binding to target mRNAs at upstream sites, outside the RBS. Specifically, GcvB represses gltI mRNA translation at the C/A-rich target site located at positions −57 to −45 relative to the start codon. Taken together, our study suggests highly conserved regions in sRNAs and mRNA regions distant from Shine-Dalgarno sequences as important elements for the identification of sRNA targets. PMID:17974919

  3. Using Small Subunit Ribosomal RNA to Follow Dark Incorporation of 14C-bicarbonate by Bacteria and Archaea in Sandy Sediment

    NASA Astrophysics Data System (ADS)

    MacGregor, B. J.; Musat, N.; Kuypers, M. M.

    2007-12-01

    Small subunit ribosomal RNA (SSU rRNA) and the genes encoding it have become the basis of modern microbial phylogeny, and of numerous methods for characterizing the composition of bacterial, archaeal, and even eukaryotic communities as they occur in nature. A limitation of this approach has been that phylogeny alone is not a reliable guide to physiology, particularly for groups with no close relatives in culture. We have been developing ways of using the SSU rRNA molecule itself to identify and (eventually) quantify the carbon sources incorporated by particular phylogenetic groups. This can be done by taking advantage of natural variations in carbon isotopic composition among growth substrates, or by following incorporation of 13C- or 14C-labeled compounds. 14C has the advantage that natural background levels are negligible. In the present study, our goal is to identify species responsible for non-photosynthetic CO2 incorporation in sandy sediments of the German Wadden Sea. Sediment cores collected from the Janssand sand flats were percolated with 14C-bicarbonate at in situ temperature for 36-38h in the dark, total RNA isolated, and domain-specific oligonucleotide probes used to capture bacterial and archaeal SSU rRNA. Total and/or captured RNA was separated by denaturing polyacrylamide gel electrophoresis, and 14C detected by phosphor imager, autoradiography, or beta imager. Detection was fastest and most sensitive with the beta imager. Both Bacteria and Archaea had incorporated label, suggesting both groups may harbor non-photosynthetic autotrophs. The next step will be to use more specific capture probes. We are currently working to separate the captured domain-specific SSU rRNA on non-denaturing gels, with detection by the high-resolution mode of the beta imager, so that individual species incorporating label can be identified by RT-PCR and sequencing of labeled bands.

  4. The ribosome filter redux.

    PubMed

    Mauro, Vincent P; Edelman, Gerald M

    2007-09-15

    The ribosome filter hypothesis postulates that ribosomes are not simply translation machines but also function as regulatory elements that differentially affect or filter the translation of particular mRNAs. On the basis of new information, we take the opportunity here to review the ribosome filter hypothesis, suggest specific mechanisms of action, and discuss recent examples from the literature that support it. PMID:17890902

  5. Deconstructing ribosome construction

    PubMed Central

    Connolly, Keith; Culver, Gloria

    2013-01-01

    The ribosome is an essential ribonucleoprotein enzyme, and its biogenesis is a fundamental process in all living cells. Recent X-ray crystal structures of the bacterial ribosome and new technologies have allowed a greater interrogation of in vitro ribosome assembly; however, substantially less is known about ribosome biogenesis in vivo. Ongoing investigations are focused on elucidating the cellular processes that facilitate biogenesis of the ribosomal subunits, and many extraribosomal factors, including modification enzymes, remodeling enzymes and GTPases, are being uncovered. Moreover, specific roles for ribosome biogenesis factors in subunit maturation are now being elaborated. Ultimately, such studies will reveal a more complete understanding of processes at work in in vivo ribosome biogenesis. PMID:19376708

  6. Evolution of the ribosome at atomic resolution

    PubMed Central

    Petrov, Anton S.; Bernier, Chad R.; Hsiao, Chiaolong; Norris, Ashlyn M.; Kovacs, Nicholas A.; Waterbury, Chris C.; Stepanov, Victor G.; Harvey, Stephen C.; Fox, George E.; Wartell, Roger M.; Hud, Nicholas V.; Williams, Loren Dean

    2014-01-01

    The origins and evolution of the ribosome, 3–4 billion years ago, remain imprinted in the biochemistry of extant life and in the structure of the ribosome. Processes of ribosomal RNA (rRNA) expansion can be “observed” by comparing 3D rRNA structures of bacteria (small), yeast (medium), and metazoans (large). rRNA size correlates well with species complexity. Differences in ribosomes across species reveal that rRNA expansion segments have been added to rRNAs without perturbing the preexisting core. Here we show that rRNA growth occurs by a limited number of processes that include inserting a branch helix onto a preexisting trunk helix and elongation of a helix. rRNA expansions can leave distinctive atomic resolution fingerprints, which we call “insertion fingerprints.” Observation of insertion fingerprints in the ribosomal common core allows identification of probable ancestral expansion segments. Conceptually reversing these expansions allows extrapolation backward in time to generate models of primordial ribosomes. The approach presented here provides insight to the structure of pre-last universal common ancestor rRNAs and the subsequent expansions that shaped the peptidyl transferase center and the conserved core. We infer distinct phases of ribosomal evolution through which ribosomal particles evolve, acquiring coding and translocation, and extending and elaborating the exit tunnel. PMID:24982194

  7. History of the ribosome and the origin of translation

    PubMed Central

    Petrov, Anton S.; Gulen, Burak; Norris, Ashlyn M.; Kovacs, Nicholas A.; Lanier, Kathryn A.; Fox, George E.; Harvey, Stephen C.; Wartell, Roger M.; Hud, Nicholas V.; Williams, Loren Dean

    2015-01-01

    We present a molecular-level model for the origin and evolution of the translation system, using a 3D comparative method. In this model, the ribosome evolved by accretion, recursively adding expansion segments, iteratively growing, subsuming, and freezing the rRNA. Functions of expansion segments in the ancestral ribosome are assigned by correspondence with their functions in the extant ribosome. The model explains the evolution of the large ribosomal subunit, the small ribosomal subunit, tRNA, and mRNA. Prokaryotic ribosomes evolved in six phases, sequentially acquiring capabilities for RNA folding, catalysis, subunit association, correlated evolution, decoding, energy-driven translocation, and surface proteinization. Two additional phases exclusive to eukaryotes led to tentacle-like rRNA expansions. In this model, ribosomal proteinization was a driving force for the broad adoption of proteins in other biological processes. The exit tunnel was clearly a central theme of all phases of ribosomal evolution and was continuously extended and rigidified. In the primitive noncoding ribosome, proto-mRNA and the small ribosomal subunit acted as cofactors, positioning the activated ends of tRNAs within the peptidyl transferase center. This association linked the evolution of the large and small ribosomal subunits, proto-mRNA, and tRNA. PMID:26621738

  8. History of the ribosome and the origin of translation.

    PubMed

    Petrov, Anton S; Gulen, Burak; Norris, Ashlyn M; Kovacs, Nicholas A; Bernier, Chad R; Lanier, Kathryn A; Fox, George E; Harvey, Stephen C; Wartell, Roger M; Hud, Nicholas V; Williams, Loren Dean

    2015-12-15

    We present a molecular-level model for the origin and evolution of the translation system, using a 3D comparative method. In this model, the ribosome evolved by accretion, recursively adding expansion segments, iteratively growing, subsuming, and freezing the rRNA. Functions of expansion segments in the ancestral ribosome are assigned by correspondence with their functions in the extant ribosome. The model explains the evolution of the large ribosomal subunit, the small ribosomal subunit, tRNA, and mRNA. Prokaryotic ribosomes evolved in six phases, sequentially acquiring capabilities for RNA folding, catalysis, subunit association, correlated evolution, decoding, energy-driven translocation, and surface proteinization. Two additional phases exclusive to eukaryotes led to tentacle-like rRNA expansions. In this model, ribosomal proteinization was a driving force for the broad adoption of proteins in other biological processes. The exit tunnel was clearly a central theme of all phases of ribosomal evolution and was continuously extended and rigidified. In the primitive noncoding ribosome, proto-mRNA and the small ribosomal subunit acted as cofactors, positioning the activated ends of tRNAs within the peptidyl transferase center. This association linked the evolution of the large and small ribosomal subunits, proto-mRNA, and tRNA. PMID:26621738

  9. Assessing the odd secondary structural properties of nuclear small subunit ribosomal RNA sequences (18S) of the twisted-wing parasites (Insecta: Strepsiptera).

    PubMed

    Gillespie, J J; McKenna, C H; Yoder, M J; Gutell, R R; Johnston, J S; Kathirithamby, J; Cognato, A I

    2005-12-01

    We report the entire sequence (2864 nts) and secondary structure of the nuclear small subunit ribosomal RNA (SSU rRNA) gene (18S) from the twisted-wing parasite Caenocholax fenyesi texensis Kathirithamby & Johnston (Strepsiptera: Myrmecolacidae). The majority of the base pairings in this structural model map on to the SSU rRNA secondary and tertiary helices that were previously predicted with comparative analysis. These regions of the core rRNA were unambiguously aligned across all Arthropoda. In contrast, many of the variable regions, as previously characterized in other insect taxa, had very large insertions in C. f. texensis. The helical base pairs in these regions were predicted with a comparative analysis of a multiple sequence alignment (that contains C. f. texensis and 174 published arthropod 18S rRNA sequences, including eleven strepsipterans) and thermodynamic-based algorithms. Analysis of our structural alignment revealed four unusual insertions in the core rRNA structure that are unique to animal 18S rRNA and in general agreement with previously proposed insertion sites for strepsipterans. One curious result is the presence of a large insertion within a hairpin loop of a highly conserved pseudoknot helix in variable region 4. Despite the extraordinary variability in sequence length and composition, this insertion contains the conserved sequences 5'-AUUGGCUUAAA-3' and 5'-GAC-3' that immediately flank a putative helix at the 5'- and 3'-ends, respectively. The longer sequence has the potential to form a nine base pair helix with a sequence in the variable region 2, consistent with a recent study proposing this tertiary interaction. Our analysis of a larger set of arthropod 18S rRNA sequences has revealed possible errors in some of the previously published strepsipteran 18S rRNA sequences. Thus we find no support for the previously recovered heterogeneity in the 18S molecules of strepsipterans. Our findings lend insight to the evolution of RNA structure and

  10. The ribosomal database project.

    PubMed Central

    Larsen, N; Olsen, G J; Maidak, B L; McCaughey, M J; Overbeek, R; Macke, T J; Marsh, T L; Woese, C R

    1993-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome data along with related programs and services. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams and various software packages for handling, analyzing and displaying alignments and trees. The data are available via ftp and electronic mail. Certain analytic services are also provided by the electronic mail server. PMID:8332524

  11. The Ribosomal Database Project.

    PubMed Central

    Maidak, B L; Larsen, N; McCaughey, M J; Overbeek, R; Olsen, G J; Fogel, K; Blandy, J; Woese, C R

    1994-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services, and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (rdp.life.uiuc.edu), electronic mail (server/rdp.life.uiuc.edu) and gopher (rdpgopher.life.uiuc.edu). The electronic mail server also provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for chimeric nature of newly sequenced rRNAs, and automated alignment. PMID:7524021

  12. Direct ribosomal binding by a cellular inhibitor of translation

    PubMed Central

    Colón-Ramos, Daniel A; Shenvi, Christina L; Weitzel, Douglas H; Gan, Eugene C; Matts, Robert; Cate, Jamie; Kornbluth, Sally

    2009-01-01

    During apoptosis and under conditions of cellular stress, several signaling pathways promote inhibition of cap-dependent translation while allowing continued translation of specific messenger RNAs encoding regulatory and stress-response proteins. We report here that the apoptotic regulator Reaper inhibits protein synthesis by binding directly to the 40S ribosomal subunit. This interaction does not affect either ribosomal association of initiation factors or formation of 43S or 48S complexes. Rather, it interferes with late initiation events upstream of 60S subunit joining, apparently modulating start-codon recognition during scanning. CrPV IRES–driven translation, involving direct ribosomal recruitment to the start site, is relatively insensitive to Reaper. Thus, Reaper is the first known cellular ribosomal binding factor with the potential to allow selective translation of mRNAs initiating at alternative start codons or from certain IRES elements. This function of Reaper may modulate gene expression programs to affect cell fate. PMID:16429152

  13. Cap-dependent translation is mediated by ‘RNA looping’ rather than ‘ribosome scanning’

    PubMed Central

    Jang, Sung Key; Paek, Ki Young

    2016-01-01

    Abstract The 40S ribosomal subunit cannot directly recognize the start codon of eukaryotic mRNAs. Instead, it recognizes the start codon after its association with the 5′-cap structure via translation initiation factors. Base-by-base inspection of the 5′UTR by a scanning ribosome is the generally accepted hypothesis of start codon selection. As part of an effort to confirm the underlying mechanism of start codon selection by the 40S ribosome, we investigated the role of eIF4G, which participates in the recruitment of 40S ribosomes to various translation enhancers, such as 5′-cap structure, poly(A) tail, and several internal ribosome entry sites. We found that an artificial translation factor composed of recombinant eIF4G fused with MS2 greatly enhanced translation of an upstream reporter gene when it was tethered to the 3′UTR. These data suggest that the 40S ribosome recruited to a translation enhancer can find the start codon by looping of the intervening RNA segment. The ‘RNA-looping’ hypothesis of translation start codon recognition was further supported by an analysis of the effect of 5′UTR length on translation efficiency and the mathematically predicted probability of RNA-loop–mediated interactions between the start codon and the 40S ribosome associated at the 5′-end. PMID:26515582

  14. The Ribosomal Database Project

    PubMed Central

    Olsen, Gary J.; Overbeek, Ross; Larsen, Niels; Marsh, Terry L.; McCaughey, Michael J.; Maciukenas, Michael A.; Kuan, Wen-Min; Macke, Thomas J.; Xing, Yuqing; Woese, Carl R.

    1992-01-01

    The Ribosomal Database Project (RDP) compiles ribosomal sequences and related data, and redistributes them in aligned and phylogenetically ordered form to its user community. It also offers various software packages for handling, analyzing and displaying sequences. In addition, the RDP offers (or will offer) certain analytic services. At present the project is in an intermediate stage of development. PMID:1598241

  15. HCV IRES domain IIb affects the configuration of coding RNA in the 40S subunit's decoding groove.

    PubMed

    Filbin, Megan E; Kieft, Jeffrey S

    2011-07-01

    Hepatitis C virus (HCV) uses a structured internal ribosome entry site (IRES) RNA to recruit the translation machinery to the viral RNA and begin protein synthesis without the ribosomal scanning process required for canonical translation initiation. Different IRES structural domains are used in this process, which begins with direct binding of the 40S ribosomal subunit to the IRES RNA and involves specific manipulation of the translational machinery. We have found that upon initial 40S subunit binding, the stem-loop domain of the IRES that contains the start codon unwinds and adopts a stable configuration within the subunit's decoding groove. This configuration depends on the sequence and structure of a different stem-loop domain (domain IIb) located far from the start codon in sequence, but spatially proximal in the IRES•40S complex. Mutation of domain IIb results in misconfiguration of the HCV RNA in the decoding groove that includes changes in the placement of the AUG start codon, and a substantial decrease in the ability of the IRES to initiate translation. Our results show that two distal regions of the IRES are structurally communicating at the initial step of 40S subunit binding and suggest that this is an important step in driving protein synthesis. PMID:21606179

  16. Illuminating Parasite Protein Production by Ribosome Profiling.

    PubMed

    Parsons, Marilyn; Myler, Peter J

    2016-06-01

    While technologies for global enumeration of transcript abundance are well-developed, those that assess protein abundance require tailoring to penetrate to low-abundance proteins. Ribosome profiling circumvents this challenge by measuring global protein production via sequencing small mRNA fragments protected by the assembled ribosome. This powerful approach is now being applied to protozoan parasites including trypanosomes and Plasmodium. It has been used to identify new protein-coding sequences (CDSs) and clarify the boundaries of previously annotated CDSs in Trypanosoma brucei. Ribosome profiling has demonstrated that translation efficiencies vary widely between genes and, for trypanosomes at least, for the same gene across stages. The ribosomal proteins are themselves subjected to translational control, suggesting a means of reinforcing global translational regulation. PMID:27061497

  17. Chemical modulators of ribosome biogenesis as biological probes.

    PubMed

    Stokes, Jonathan M; Brown, Eric D

    2015-12-01

    Small-molecule inhibitors of protein biosynthesis have been instrumental in the dissection of the complexities of ribosome structure and function. Ribosome biogenesis, on the other hand, is a complex and largely enigmatic process for which there is a paucity of chemical probes. Indeed, ribosome biogenesis has been studied almost exclusively using genetic and biochemical approaches without the benefit of small-molecule inhibitors of this process. Here, we provide a perspective on the promise of chemical inhibitors of ribosome assembly for future research. We explore key obstacles that complicate the interpretation of studies aimed at perturbing ribosome biogenesis in vivo using genetic methods, and we argue that chemical inhibitors are especially powerful because they can be used to induce perturbations in a manner that obviates these difficulties. Thus, in combination with leading-edge biochemical and structural methods, chemical probes offer unique advantages toward elucidating the molecular events that define the assembly of ribosomes. PMID:26575239

  18. Ribosomal History Reveals Origins of Modern Protein Synthesis

    PubMed Central

    Harish, Ajith; Caetano-Anollés, Gustavo

    2012-01-01

    The origin and evolution of the ribosome is central to our understanding of the cellular world. Most hypotheses posit that the ribosome originated in the peptidyl transferase center of the large ribosomal subunit. However, these proposals do not link protein synthesis to RNA recognition and do not use a phylogenetic comparative framework to study ribosomal evolution. Here we infer evolution of the structural components of the ribosome. Phylogenetic methods widely used in morphometrics are applied directly to RNA structures of thousands of molecules and to a census of protein structures in hundreds of genomes. We find that components of the small subunit involved in ribosomal processivity evolved earlier than the catalytic peptidyl transferase center responsible for protein synthesis. Remarkably, subunit RNA and proteins coevolved, starting with interactions between the oldest proteins (S12 and S17) and the oldest substructure (the ribosomal ratchet) in the small subunit and ending with the rise of a modern multi-subunit ribosome. Ancestral ribonucleoprotein components show similarities to in vitro evolved RNA replicase ribozymes and protein structures in extant replication machinery. Our study therefore provides important clues about the chicken-or-egg dilemma associated with the central dogma of molecular biology by showing that ribosomal history is driven by the gradual structural accretion of protein and RNA structures. Most importantly, results suggest that functionally important and conserved regions of the ribosome were recruited and could be relics of an ancient ribonucleoprotein world. PMID:22427882

  19. Interaction of ribosomal protein L22 with casein kinase 2α: a novel mechanism for understanding the biology of non-small cell lung cancer.

    PubMed

    Yang, Mingxia; Sun, Haibo; He, Ji; Wang, Hong; Yu, Xiaowei; Ma, Lei; Zhu, Changliang

    2014-07-01

    Dysfunction of ribosomal proteins (RPs) may play an important role in molecular tumorigenesis, such as lung cancer, acting in extraribosomal functions. Many protein-protein interaction studies and genetic screens have confirmed the extraribosomal capacity of RPs. As reported, ribosomal protein L22 (RPL22) dysfunction could increase cancer risk. In the present study, we examined RPL22-protein complexes in lung cancer cells. Tandem affinity purification (TAP) was used to screen the RPL22-protein complexes, and GST pull-down experiments and confocal microscopy were used to assess the protein-protein interaction. The experiment of kinase assay was used to study the function of the RPL22-protein complexes. The results showed that several differentially expressed proteins were isolated and identified by LC-MS/MS, which revealed that one of the protein complexes included casein kinase 2α (CK2α). RPL22 and CK2α interact in vitro. RPL22 also inhibited CK2α substrate phosphorylation in vitro. This is the first report of the RPL22-CK2α relationship in lung cancer. Dysregulated CK2 may impact cell proliferation and apoptosis, key features of cancer cell biology. Our results indicate that RPL22 may be a candidate anticancer agent due to its CK2α-binding and -inhibitory functions in human lung cancer. PMID:24840952

  20. When ribosomes go bad: diseases of ribosome biogenesis

    PubMed Central

    Freed, Emily F.; Bleichert, Franziska; Dutca, Laura M.; Baserga, Susan J.

    2010-01-01

    Ribosomes are vital for cell growth and survival. Until recently, it was believed that mutations in ribosomes or ribosome biogenesis factors would be lethal, due to the essential nature of these complexes. However, in the last few decades, a number of diseases of ribosome biogenesis have been discovered. It remains a challenge in the field to elucidate the molecular mechanisms underlying them. PMID:20174677

  1. Hydroxylation of the eukaryotic ribosomal decoding center affects translational accuracy

    PubMed Central

    Loenarz, Christoph; Sekirnik, Rok; Thalhammer, Armin; Ge, Wei; Spivakovsky, Ekaterina; Mackeen, Mukram M.; McDonough, Michael A.; Cockman, Matthew E.; Kessler, Benedikt M.; Ratcliffe, Peter J.; Wolf, Alexander; Schofield, Christopher J.

    2014-01-01

    The mechanisms by which gene expression is regulated by oxygen are of considerable interest from basic science and therapeutic perspectives. Using mass spectrometric analyses of Saccharomyces cerevisiae ribosomes, we found that the amino acid residue in closest proximity to the decoding center, Pro-64 of the 40S subunit ribosomal protein Rps23p (RPS23 Pro-62 in humans) undergoes posttranslational hydroxylation. We identify RPS23 hydroxylases as a highly conserved eukaryotic subfamily of Fe(II) and 2-oxoglutarate dependent oxygenases; their catalytic domain is closely related to transcription factor prolyl trans-4-hydroxylases that act as oxygen sensors in the hypoxic response in animals. The RPS23 hydroxylases in S. cerevisiae (Tpa1p), Schizosaccharomyces pombe and green algae catalyze an unprecedented dihydroxylation modification. This observation contrasts with higher eukaryotes, where RPS23 is monohydroxylated; the human Tpa1p homolog OGFOD1 catalyzes prolyl trans-3-hydroxylation. TPA1 deletion modulates termination efficiency up to ∼10-fold, including of pathophysiologically relevant sequences; we reveal Rps23p hydroxylation as its molecular basis. In contrast to most previously characterized accuracy modulators, including antibiotics and the prion state of the S. cerevisiae translation termination factor eRF3, Rps23p hydroxylation can either increase or decrease translational accuracy in a stop codon context-dependent manner. We identify conditions where Rps23p hydroxylation status determines viability as a consequence of nonsense codon suppression. The results reveal a direct link between oxygenase catalysis and the regulation of gene expression at the translational level. They will also aid in the development of small molecules altering translational accuracy for the treatment of genetic diseases linked to nonsense mutations. PMID:24550462

  2. The ribosomal subunit assembly line

    PubMed Central

    Dlakić, Mensur

    2005-01-01

    Recent proteomic studies in Saccharomyces cerevisiae have identified nearly 200 proteins, other than the structural ribosomal proteins, that participate in the assembly of ribosomal subunits and their transport from the nucleus. In a separate line of research, proteomic studies of mature plant ribosomes have revealed considerable variability in the protein composition of individual ribosomes. PMID:16207363

  3. Frozen spin targets in ribosomal structure research.

    PubMed

    Stuhrmann, H B

    1991-01-01

    Polarized neutron scattering strongly depends on nuclear spin polarisation, particularly on proton spin polarisation. A single proton in a deuterated environment then is as efficient as 10 electrons in X-ray anomalous diffraction. Neutron scattering from the nuclear spin label is controlled by the polarisation of neutron spins and nuclear spins. Pure deuteron spin labels and proton spin labels are created by NMR saturation. We report on results obtained from the large subunit of E. coli ribosomes which have been obtained at the research reactor of GKSS using the polarized target facility developed by CERN. The nuclear spins were oriented with respect to an external field by dynamic nuclear polarisation. Proton spin polarisations of more than 80% were obtained in ribosomes at temperatures below 0.5 K. At T = 130 mK the relaxation time of the polarized target is one month (frozen spin target). Polarized small-angle neutron scattering of the in situ structure of rRNA and the total ribosomal protein (TP) has been determined from the frozen spin targets of the large ribosomal subunit, which has been deuterated in the TP and rRNA respectively. The results agree with those from neutron scattering in H2O/D2O mixtures obtained at room temperature. This is a necessary prerequisite for the planned determination of the in situ structure of individual ribosomal proteins and especially of that of ribosome bound mRNA and tRNAs. PMID:1720669

  4. Molecular architecture of the ribosome-bound Hepatitis C Virus internal ribosomal entry site RNA.

    PubMed

    Yamamoto, Hiroshi; Collier, Marianne; Loerke, Justus; Ismer, Jochen; Schmidt, Andrea; Hilal, Tarek; Sprink, Thiemo; Yamamoto, Kaori; Mielke, Thorsten; Bürger, Jörg; Shaikh, Tanvir R; Dabrowski, Marylena; Hildebrand, Peter W; Scheerer, Patrick; Spahn, Christian M T

    2015-12-14

    Internal ribosomal entry sites (IRESs) are structured cis-acting RNAs that drive an alternative, cap-independent translation initiation pathway. They are used by many viruses to hijack the translational machinery of the host cell. IRESs facilitate translation initiation by recruiting and actively manipulating the eukaryotic ribosome using only a subset of canonical initiation factor and IRES transacting factors. Here we present cryo-EM reconstructions of the ribosome 80S- and 40S-bound Hepatitis C Virus (HCV) IRES. The presence of four subpopulations for the 80S•HCV IRES complex reveals dynamic conformational modes of the complex. At a global resolution of 3.9 Å for the most stable complex, a derived atomic model reveals a complex fold of the IRES RNA and molecular details of its interaction with the ribosome. The comparison of obtained structures explains how a modular architecture facilitates mRNA loading and tRNA binding to the P-site. This information provides the structural foundation for understanding the mechanism of HCV IRES RNA-driven translation initiation. PMID:26604301

  5. The ribosome returned

    PubMed Central

    Moore, Peter B

    2009-01-01

    Since the mid-1990s, insights obtained from electron microscopy and X-ray crystallography have transformed our understanding of how the most important ribozyme in the cell, the ribosome, catalyzes protein synthesis. This review provides a brief account of how this structural revolution came to pass, and the impact it has had on our understanding of how the ribosome decodes messenger RNAs. PMID:19222865

  6. Ribosome-omics of the human ribosome

    PubMed Central

    Gupta, Varun; Warner, Jonathan R.

    2014-01-01

    The torrent of RNA-seq data becoming available not only furnishes an overview of the entire transcriptome but also provides tools to focus on specific areas of interest. Our focus on the synthesis of ribosomes asked whether the abundance of mRNAs encoding ribosomal proteins (RPs) matched the equimolar need for the RPs in the assembly of ribosomes. We were at first surprised to find, in the mapping data of ENCODE and other sources, that there were nearly 100-fold differences in the level of the mRNAs encoding the different RPs. However, after correcting for the mapping ambiguities introduced by the presence of more than 2000 pseudogenes derived from RP mRNAs, we show that for 80%–90% of the RP genes, the molar ratio of mRNAs varies less than threefold, with little tissue specificity. Nevertheless, since the RPs are needed in equimolar amounts, there must be sluggish or regulated translation of the more abundant RP mRNAs and/or substantial turnover of unused RPs. In addition, seven of the RPs have subsidiary genes, three of which are pseudogenes that have been “rescued” by the introduction of promoters and/or upstream introns. Several of these are transcribed in a tissue-specific manner, e.g., RPL10L in testis and RPL3L in muscle, leading to potential variation in ribosome structure from one tissue to another. Of the 376 introns in the RP genes, a single one is alternatively spliced in a tissue-specific manner. PMID:24860015

  7. Analysis of Blastocladiella emersonii ribosomal proteins in four two-dimensional gel electrophoresis systems.

    PubMed

    Bonato, M C; Maia, J C; Juliani, M H

    1985-01-01

    Ribosomal proteins of the aquatic fungus Blastocladiella emersonii were isolated and characterized on four different two-dimensional polyacrylamide gel electrophoresis systems. 40S and 60S ribosomal subunit proteins from zoospores were identified. The position of every protein was determined in each electrophoretic system using the "four-corners" method (Madjar et al., Molecular and General Genetics, 171: 121-134, 1979). Thirty-two and 39 proteins were identified in the 40S and 60S ribosomal subunits, respectively. The molecular weights of individual proteins in the 40S subunit ranged from 10 000 to 37 000, with a number-average molecular weight of 20 000. The molecular weight range for the 60S subunit was 13 000-51 000 with a number-average molecular weight of 21 000. Proteins from ribosomes of different cell types were compared and found to be qualitatively indistinguishable. The only consistent difference in the patterns of proteins was in the S6 protein of the 40S subunit, which is the major phosphoprotein of Blastocladiella ribosomes. PMID:3830281

  8. Alterations in the ribosomal machinery in cancer and hematologic disorders

    PubMed Central

    2012-01-01

    Ribosomes are essential components of the protein translation machinery and are composed of more than 80 unique large and small ribosomal proteins. Recent studies show that in addition to their roles in protein translation, ribosomal proteins are also involved in extra-ribosomal functions of DNA repair, apoptosis and cellular homeostasis. Consequently, alterations in the synthesis or functioning of ribosomal proteins can lead to various hematologic disorders. These include congenital anemias such as Diamond Blackfan anemia and Shwachman Diamond syndrome; both of which are associated with mutations in various ribosomal genes. Acquired uniallelic deletion of RPS14 gene has also been shown to lead to the 5q syndrome, a distinct subset of MDS associated with macrocytic anemia. Recent evidence shows that specific ribosomal proteins are overexpressed in liver, colon, prostate and other tumors. Ribosomal protein overexpression can promote tumorigenesis by interactions with the p53 tumor suppressor pathway and also by direct effects on various oncogenes. These data point to a broad role of ribosome protein alterations in hematologic and oncologic diseases. PMID:22709827

  9. Ribosome hibernation factor promotes Staphylococcal survival and differentially represses translation.

    PubMed

    Basu, Arnab; Yap, Mee-Ngan F

    2016-06-01

    In opportunistic Gram-positive Staphylococcus aureus, a small protein called hibernation-promoting factor (HPFSa) is sufficient to dimerize 2.5-MDa 70S ribosomes into a translationally inactive 100S complex. Although the 100S dimer is observed in only the stationary phase in Gram-negative gammaproteobacteria, it is ubiquitous throughout all growth phases in S. aureus The biological significance of the 100S ribosome is poorly understood. Here, we reveal an important role of HPFSa in preserving ribosome integrity and poising cells for translational restart, a process that has significant clinical implications for relapsed staphylococcal infections. We found that the hpf null strain is severely impaired in long-term viability concomitant with a dramatic loss of intact ribosomes. Genome-wide ribosome profiling shows that eliminating HPFSa drastically increased ribosome occupancy at the 5' end of specific mRNAs under nutrient-limited conditions, suggesting that HPFSa may suppress translation initiation. The protective function of HPFSa on ribosomes resides at the N-terminal conserved basic residues and the extended C-terminal segment, which are critical for dimerization and ribosome binding, respectively. These data provide significant insight into the functional consequences of 100S ribosome loss for protein synthesis and stress adaptation. PMID:27001516

  10. Ribosome hibernation factor promotes Staphylococcal survival and differentially represses translation

    PubMed Central

    Basu, Arnab; Yap, Mee-Ngan F.

    2016-01-01

    In opportunistic Gram-positive Staphylococcus aureus, a small protein called hibernation-promoting factor (HPFSa) is sufficient to dimerize 2.5-MDa 70S ribosomes into a translationally inactive 100S complex. Although the 100S dimer is observed in only the stationary phase in Gram-negative gammaproteobacteria, it is ubiquitous throughout all growth phases in S. aureus. The biological significance of the 100S ribosome is poorly understood. Here, we reveal an important role of HPFSa in preserving ribosome integrity and poising cells for translational restart, a process that has significant clinical implications for relapsed staphylococcal infections. We found that the hpf null strain is severely impaired in long-term viability concomitant with a dramatic loss of intact ribosomes. Genome-wide ribosome profiling shows that eliminating HPFSa drastically increased ribosome occupancy at the 5′ end of specific mRNAs under nutrient-limited conditions, suggesting that HPFSa may suppress translation initiation. The protective function of HPFSa on ribosomes resides at the N-terminal conserved basic residues and the extended C-terminal segment, which are critical for dimerization and ribosome binding, respectively. These data provide significant insight into the functional consequences of 100S ribosome loss for protein synthesis and stress adaptation. PMID:27001516

  11. The Ribosome Comes Alive

    PubMed Central

    2010-01-01

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample (“story in a sample”), providing snapshots of an entire subprocess of translation, such as translocation or decoding. PMID:21072331

  12. The Ribosome Comes Alive.

    PubMed

    Frank, Joachim

    2010-06-18

    This essay is a reflection on the ways the X-ray structures of the ribosome are helping in the interpretation of cryogenic electron microscopy (cryo-EM) density maps showing the translating ribosome in motion. Through advances in classification methods, cryo-EM and single-particle reconstruction methods have recently evolved to the point where they can yield an array of structures from a single sample ("story in a sample"), providing snapshots of an entire subprocess of translation, such as translocation or decoding. PMID:21072331

  13. The N-terminal extension of Escherichia coli ribosomal protein L20 is important for ribosome assembly, but dispensable for translational feedback control

    PubMed Central

    GUILLIER, MAUDE; ALLEMAND, FRÉDÉRIC; GRAFFE, MONIQUE; RAIBAUD, SOPHIE; DARDEL, FRÉDÉRIC; SPRINGER, MATHIAS; CHIARUTTINI, CLAUDE

    2005-01-01

    The Escherichia coli autoregulatory ribosomal protein L20 consists of two structurally distinct domains. The C-terminal domain is globular and sits on the surface of the large ribosomal subunit whereas the N-terminal domain has an extended shape and penetrates deep into the RNA-rich core of the subunit. Many other ribosomal proteins have analogous internal or terminal extensions. However, the biological functions of these extended domains remain obscure. Here we show that the N-terminal tail of L20 is important for ribosome assembly in vivo. Indeed, a truncated version of L20 without its N-terminal tail is unable to complement the deletion of rplT, the gene encoding L20. In addition, this L20 truncation confers a lethal-dominant phenotype, suggesting that the N-terminal domain is essential for cell growth because it could be required for ribosome assembly. Supporting this hypothesis, partial deletions of the N-terminal tail of the protein are shown to cause a slow-growth phenotype due to altered ribosome assembly in vivo as large amounts of intermediate 40S ribosomal particles accumulate. In addition to being a ribosomal protein, L20 also acts as an autogenous repressor. Using L20 truncations, we also show that the N-terminal tail of L20 is dispensable for autogenous control. PMID:15840820

  14. Ribosome-inactivating proteins

    PubMed Central

    Walsh, Matthew J; Dodd, Jennifer E; Hautbergue, Guillaume M

    2013-01-01

    Ribosome-inactivating proteins (RIPs) were first isolated over a century ago and have been shown to be catalytic toxins that irreversibly inactivate protein synthesis. Elucidation of atomic structures and molecular mechanism has revealed these proteins to be a diverse group subdivided into two classes. RIPs have been shown to exhibit RNA N-glycosidase activity and depurinate the 28S rRNA of the eukaryotic 60S ribosomal subunit. In this review, we compare archetypal RIP family members with other potent toxins that abolish protein synthesis: the fungal ribotoxins which directly cleave the 28S rRNA and the newly discovered Burkholderia lethal factor 1 (BLF1). BLF1 presents additional challenges to the current classification system since, like the ribotoxins, it does not possess RNA N-glycosidase activity but does irreversibly inactivate ribosomes. We further discuss whether the RIP classification should be broadened to include toxins achieving irreversible ribosome inactivation with similar turnovers to RIPs, but through different enzymatic mechanisms. PMID:24071927

  15. Recycling of eukaryotic post-termination ribosomal complexes

    PubMed Central

    Pisarev, Andrey V.; Hellen, Christopher U. T.; Pestova, Tatyana V.

    2007-01-01

    SUMMARY After translational termination, mRNA and P site deacylated tRNA remain associated with ribosomes in post-termination complexes (post-TCs), which must therefore be recycled by releasing mRNA and deacylated tRNA and by dissociating ribosomes into subunits. Recycling of bacterial post-TCs requires elongation factor EF-G and a ribosome recycling factor RRF. Eukaryotes do not encode a RRF homologue and their mechanism of ribosomal recycling is unknown. We investigated eukaryotic recycling using post-TCs assembled on a model mRNA encoding a tetrapeptide followed by a UAA stop codon and report that initiation factors eIF3, eIF1, eIF1A and eIF3j, a loosely associated subunit of eIF3, can promote recycling of eukaryotic post-TCs. eIF3 is the principal factor that promotes splitting of post-termination ribosomes into 60S subunits and tRNA- and mRNA-bound 40S subunits. Its activity is enhanced by eIF3j, eIF1 and eIF1A. eIF1 also mediates release of P-site tRNA, whereas eIF3j ensures subsequent dissociation of mRNA. PMID:17956730

  16. Dynamics of ribosome scanning and recycling revealed by translation complex profiling.

    PubMed

    Archer, Stuart K; Shirokikh, Nikolay E; Beilharz, Traude H; Preiss, Thomas

    2016-07-28

    Regulation of messenger RNA translation is central to eukaryotic gene expression control. Regulatory inputs are specified by them RNA untranslated regions (UTRs) and often target translation initiation. Initiation involves binding of the 40S ribosomal small subunit (SSU) and associated eukaryotic initiation factors (eIFs)near the mRNA 5′ cap; the SSU then scans in the 3′ direction until it detects the start codon and is joined by the 60S ribosomal large subunit (LSU) to form the 80S ribosome. Scanning and other dynamic aspects of the initiation model have remained as conjectures because methods to trap early intermediates were lacking. Here we uncover the dynamics of the complete translation cycle in live yeast cells using translation complex profile sequencing (TCP-seq), a method developed from the ribosome profiling approach. We document scanning by observing SSU footprints along 5′ UTRs. Scanning SSU have 5′-extended footprints (up to~75 nucleotides), indicative of additional interactions with mRNA emerging from the exit channel, promoting forward movement. We visualized changes in initiation complex conformation as SSU footprints coalesced into three major sizes at start codons (19, 29 and 37 nucleotides). These share the same 5′ start site but differ at the 3′ end, reflecting successive changes at the entry channel from an open to a closed state following start codon recognition. We also observe SSU 'lingering' at stop codons after LSU departure. Our results underpin mechanistic models of translation initiation and termination, built on decades of biochemical and structural investigation, with direct genome-wide in vivo evidence. Our approach captures ribosomal complexes at all phases of translation and will aid in studying translation dynamics in diverse cellular contexts. Dysregulation of translation is common in disease and, for example, SSU scanning is a target of anti-cancer drug development. TCP-seq will prove useful in discerning differences

  17. Energy landscape of the ribosomal decoding center.

    PubMed

    Sanbonmatsu, K Y

    2006-08-01

    The ribosome decodes the genetic information that resides in nucleic acids. A key component of the decoding mechanism is a conformational switch in the decoding center of the small ribosomal subunit discovered in high-resolution X-ray crystallography studies. It is known that small subunit nucleotides A1492 and A1493 flip out of helix 44 upon transfer RNA (tRNA) binding; however, the operation principles of this switch remain unknown. Replica molecular dynamics simulations reveal a low free energy barrier between flipped-out and flipped-in states, consistent with a switch that can be controlled by shifting the equilibrium between states. The barrier determined by the simulations is sufficiently small for the binding of ligands, such as tRNAs or aminoglycoside antibiotics, to shift the equilibrium. PMID:16905237

  18. Homoiterons and expansion in ribosomal RNAs.

    PubMed

    Parker, Michael S; Sallee, Floyd R; Park, Edwards A; Parker, Steven L

    2015-01-01

    Ribosomal RNAs in both prokaryotes and eukaryotes feature numerous repeats of three or more nucleotides with the same nucleobase (homoiterons). In prokaryotes these repeats are much more frequent in thermophile compared to mesophile or psychrophile species, and have similar frequency in both large RNAs. These features point to use of prokaryotic homoiterons in stabilization of both ribosomal subunits. The two large RNAs of eukaryotic cytoplasmic ribosomes have expanded to a different degree across the evolutionary ladder. The big RNA of the larger subunit (60S LSU) evolved expansion segments of up to 2400 nucleotides, and the smaller subunit (40S SSU) RNA acquired expansion segments of not more than 700 nucleotides. In the examined eukaryotes abundance of rRNA homoiterons generally follows size and nucleotide bias of the expansion segments, and increases with GC content and especially with phylogenetic rank. Both the nucleotide bias and frequency of homoiterons are much larger in metazoan and angiosperm LSU compared to the respective SSU RNAs. This is especially pronounced in the tetrapod vertebrates and seems to culminate in the hominid mammals. The stability of secondary structure in polyribonucleotides would significantly connect to GC content, and should also relate to G and C homoiteron content. RNA modeling points to considerable presence of homoiteron-rich double-stranded segments especially in vertebrate LSU RNAs, and homoiterons with four or more nucleotides in the vertebrate and angiosperm LSU RNAs are largely confined to the expansion segments. These features could mainly relate to protein export function and attachment of LSU to endoplasmic reticulum and other subcellular networks. PMID:26636029

  19. Homoiterons and expansion in ribosomal RNAs

    PubMed Central

    Parker, Michael S.; Sallee, Floyd R.; Park, Edwards A.; Parker, Steven L.

    2015-01-01

    Ribosomal RNAs in both prokaryotes and eukaryotes feature numerous repeats of three or more nucleotides with the same nucleobase (homoiterons). In prokaryotes these repeats are much more frequent in thermophile compared to mesophile or psychrophile species, and have similar frequency in both large RNAs. These features point to use of prokaryotic homoiterons in stabilization of both ribosomal subunits. The two large RNAs of eukaryotic cytoplasmic ribosomes have expanded to a different degree across the evolutionary ladder. The big RNA of the larger subunit (60S LSU) evolved expansion segments of up to 2400 nucleotides, and the smaller subunit (40S SSU) RNA acquired expansion segments of not more than 700 nucleotides. In the examined eukaryotes abundance of rRNA homoiterons generally follows size and nucleotide bias of the expansion segments, and increases with GC content and especially with phylogenetic rank. Both the nucleotide bias and frequency of homoiterons are much larger in metazoan and angiosperm LSU compared to the respective SSU RNAs. This is especially pronounced in the tetrapod vertebrates and seems to culminate in the hominid mammals. The stability of secondary structure in polyribonucleotides would significantly connect to GC content, and should also relate to G and C homoiteron content. RNA modeling points to considerable presence of homoiteron-rich double-stranded segments especially in vertebrate LSU RNAs, and homoiterons with four or more nucleotides in the vertebrate and angiosperm LSU RNAs are largely confined to the expansion segments. These features could mainly relate to protein export function and attachment of LSU to endoplasmic reticulum and other subcellular networks. PMID:26636029

  20. Disruption of ribosome assembly in yeast blocks cotranscriptional pre-rRNA processing and affects the global hierarchy of ribosome biogenesis.

    PubMed

    Talkish, Jason; Biedka, Stephanie; Jakovljevic, Jelena; Zhang, Jingyu; Tang, Lan; Strahler, John R; Andrews, Philip C; Maddock, Janine R; Woolford, John L

    2016-06-01

    In higher eukaryotes, pre-rRNA processing occurs almost exclusively post-transcriptionally. This is not the case in rapidly dividing yeast, as the majority of nascent pre-rRNAs are processed cotranscriptionally, with cleavage at the A2 site first releasing a pre-40S ribosomal subunit followed by release of a pre-60S ribosomal subunit upon transcription termination. Ribosome assembly is driven in part by hierarchical association of assembly factors and r-proteins. Groups of proteins are thought to associate with pre-ribosomes cotranscriptionally during early assembly steps, whereas others associate later, after transcription is completed. Here we describe a previously uncharacterized phenotype observed upon disruption of ribosome assembly, in which normally late-binding proteins associate earlier, with pre-ribosomes containing 35S pre-rRNA. As previously observed by many other groups, we show that disruption of 60S subunit biogenesis results in increased amounts of 35S pre-rRNA, suggesting that a greater fraction of pre-rRNAs are processed post-transcriptionally. Surprisingly, we found that early pre-ribosomes containing 35S pre-rRNA also contain proteins previously thought to only associate with pre-ribosomes after early pre-rRNA processing steps have separated maturation of the two subunits. We believe the shift to post-transcriptional processing is ultimately due to decreased cellular division upon disruption of ribosome assembly. When cells are grown under stress or to high density, a greater fraction of pre-rRNAs are processed post-transcriptionally and follow an alternative processing pathway. Together, these results affirm the principle that ribosome assembly occurs through different, parallel assembly pathways and suggest that there is a kinetic foot-race between the formation of protein binding sites and pre-rRNA processing events. PMID:27036125

  1. Ribosome recycling induces optimal translation rate at low ribosomal availability.

    PubMed

    Marshall, E; Stansfield, I; Romano, M C

    2014-09-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3' end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called 'closed-loop' model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces a substantial increase in ribosome current. Furthermore, for sufficiently large values of the recycling rate, the lattice does not transition directly from low to high ribosome density, as seen in lattice models without recycling. Instead, a maximal current phase becomes accessible for much lower values of the initiation rate, and multiple phase transitions occur over a wide region of the phase plane. Crucially, we show that in the presence of ribosome recycling, mRNAs can exhibit a peak in protein production at low values of the initiation rate, beyond which translation rate decreases. This has important implications for translation of certain mRNAs, suggesting that there is an optimal concentration of ribosomes at which protein synthesis is maximal, and beyond which translational efficiency is impaired. PMID:25008084

  2. Ribosome recycling induces optimal translation rate at low ribosomal availability

    PubMed Central

    Marshall, E.; Stansfield, I.; Romano, M. C.

    2014-01-01

    During eukaryotic cellular protein synthesis, ribosomal translation is made more efficient through interaction between the two ends of the messenger RNA (mRNA). Ribosomes reaching the 3′ end of the mRNA can thus recycle and begin translation again on the same mRNA, the so-called ‘closed-loop’ model. Using a driven diffusion lattice model of translation, we study the effects of ribosome recycling on the dynamics of ribosome flow and density on the mRNA. We show that ribosome recycling induces a substantial increase in ribosome current. Furthermore, for sufficiently large values of the recycling rate, the lattice does not transition directly from low to high ribosome density, as seen in lattice models without recycling. Instead, a maximal current phase becomes accessible for much lower values of the initiation rate, and multiple phase transitions occur over a wide region of the phase plane. Crucially, we show that in the presence of ribosome recycling, mRNAs can exhibit a peak in protein production at low values of the initiation rate, beyond which translation rate decreases. This has important implications for translation of certain mRNAs, suggesting that there is an optimal concentration of ribosomes at which protein synthesis is maximal, and beyond which translational efficiency is impaired. PMID:25008084

  3. Structures of the ribosome in intermediate states of ratcheting

    PubMed Central

    Zhang, Wen; Dunkle, Jack; Cate, Jamie H. D.

    2010-01-01

    Summary Structures of the E. coli 70S ribosome show how the large and small subunits rotate to facilitate protein synthesis. Protein biosynthesis on the ribosome requires repeated cycles of ratcheting, which couples rotation of the two ribosomal subunits with respect to each other and swiveling of the head domain of the small subunit. However, the molecular basis for how the two ribosomal subunits rearrange contacts with each other during ratcheting while remaining stably associated is not known. Here we describe x-ray crystal structures of the intact Escherichia coli ribosome, either in the apo form (3.5 Å resolution) or with one (4.0 Å res) or two (4.0 Å res) anticodon stem-loop tRNA mimics bound, that reveal intermediate states of intersubunit rotation. In the structures, the interface between the small and large ribosomal subunits rearranges in discrete steps along the ratcheting pathway. Positioning of the head domain of the small subunit is controlled by interactions with the large subunit and with the tRNA bound in the peptidyl-tRNA site. The intermediates observed here provide insight into how tRNAs move into the hybrid state of binding that precedes the final steps of mRNA and tRNA translocation. PMID:19696352

  4. Cotranslational protein folding on the ribosome monitored in real time.

    PubMed

    Holtkamp, Wolf; Kokic, Goran; Jäger, Marcus; Mittelstaet, Joerg; Komar, Anton A; Rodnina, Marina V

    2015-11-27

    Protein domains can fold into stable tertiary structures while they are synthesized on the ribosome. We used a high-performance, reconstituted in vitro translation system to investigate the folding of a small five-helix protein domain-the N-terminal domain of Escherichia coli N5-glutamine methyltransferase HemK-in real time. Our observations show that cotranslational folding of the protein, which folds autonomously and rapidly in solution, proceeds through a compact, non-native conformation that forms within the peptide tunnel of the ribosome. The compact state rearranges into a native-like structure immediately after the full domain sequence has emerged from the ribosome. Both folding transitions are rate-limited by translation, allowing for quasi-equilibrium sampling of the conformational space restricted by the ribosome. Cotranslational folding may be typical of small, intrinsically rapidly folding protein domains. PMID:26612953

  5. Cotranslational Protein Folding inside the Ribosome Exit Tunnel.

    PubMed

    Nilsson, Ola B; Hedman, Rickard; Marino, Jacopo; Wickles, Stephan; Bischoff, Lukas; Johansson, Magnus; Müller-Lucks, Annika; Trovato, Fabio; Puglisi, Joseph D; O'Brien, Edward P; Beckmann, Roland; von Heijne, Gunnar

    2015-09-01

    At what point during translation do proteins fold? It is well established that proteins can fold cotranslationally outside the ribosome exit tunnel, whereas studies of folding inside the exit tunnel have so far detected only the formation of helical secondary structure and collapsed or partially structured folding intermediates. Here, using a combination of cotranslational nascent chain force measurements, inter-subunit fluorescence resonance energy transfer studies on single translating ribosomes, molecular dynamics simulations, and cryoelectron microscopy, we show that a small zinc-finger domain protein can fold deep inside the vestibule of the ribosome exit tunnel. Thus, for small protein domains, the ribosome itself can provide the kind of sheltered folding environment that chaperones provide for larger proteins. PMID:26321634

  6. Cotranslational Protein Folding inside the Ribosome Exit Tunnel

    PubMed Central

    Nilsson, Ola B.; Hedman, Rickard; Marino, Jacopo; Wickles, Stephan; Bischoff, Lukas; Johansson, Magnus; Müller-Lucks, Annika; Trovato, Fabio; Puglisi, Joseph D.; O’Brien, Edward P.; Beckmann, Roland; von Heijne, Gunnar

    2015-01-01

    Summary At what point during translation do proteins fold? It is well established that proteins can fold cotranslationally outside the ribosome exit tunnel, whereas studies of folding inside the exit tunnel have so far detected only the formation of helical secondary structure and collapsed or partially structured folding intermediates. Here, using a combination of cotranslational nascent chain force measurements, inter-subunit fluorescence resonance energy transfer studies on single translating ribosomes, molecular dynamics simulations, and cryoelectron microscopy, we show that a small zinc-finger domain protein can fold deep inside the vestibule of the ribosome exit tunnel. Thus, for small protein domains, the ribosome itself can provide the kind of sheltered folding environment that chaperones provide for larger proteins. PMID:26321634

  7. Ribosomal crystallography: peptide bond formation and its inhibition.

    PubMed

    Bashan, Anat; Zarivach, Raz; Schluenzen, Frank; Agmon, Ilana; Harms, Joerg; Auerbach, Tamar; Baram, David; Berisio, Rita; Bartels, Heike; Hansen, Harly A S; Fucini, Paola; Wilson, Daniel; Peretz, Moshe; Kessler, Maggie; Yonath, Ada

    2003-09-01

    Ribosomes, the universal cellular organelles catalyzing the translation of genetic code into proteins, are protein/RNA assemblies, of a molecular weight 2.5 mega Daltons or higher. They are built of two subunits that associate for performing protein biosynthesis. The large subunit creates the peptide bond and provides the path for emerging proteins. The small has key roles in initiating the process and controlling its fidelity. Crystallographic studies on complexes of the small and the large eubacterial ribosomal subunits with substrate analogs, antibiotics, and inhibitors confirmed that the ribosomal RNA governs most of its activities, and indicated that the main catalytic contribution of the ribosome is the precise positioning and alignment of its substrates, the tRNA molecules. A symmetry-related region of a significant size, containing about two hundred nucleotides, was revealed in all known structures of the large ribosomal subunit, despite the asymmetric nature of the ribosome. The symmetry rotation axis, identified in the middle of the peptide-bond formation site, coincides with the bond connecting the tRNA double-helical features with its single-stranded 3' end, which is the moiety carrying the amino acids. This thus implies sovereign movements of tRNA features and suggests that tRNA translocation involves a rotatory motion within the ribosomal active site. This motion is guided and anchored by ribosomal nucleotides belonging to the active site walls, and results in geometry suitable for peptide-bond formation with no significant rearrangements. The sole geometrical requirement for this proposed mechanism is that the initial P-site tRNA adopts the flipped orientation. The rotatory motion is the major component of unified machinery for peptide-bond formation, translocation, and nascent protein progression, since its spiral nature ensures the entrance of the nascent peptide into the ribosomal exit tunnel. This tunnel, assumed to be a passive path for the

  8. Exploring Internal Ribosome Entry Sites as Therapeutic Targets

    PubMed Central

    Komar, Anton A.; Hatzoglou, Maria

    2015-01-01

    Initiation of eukaryotic mRNA translation may proceed via several different routes, each requiring a different subset of factors and relying on different and specific interactions between the mRNA and the ribosome. Two modes predominate: (i) so-called cap-dependent initiation, which requires all canonical initiation factors and is responsible for about 95–97% of all initiation events in eukaryotic cells; and (ii) cap-independent internal initiation, which requires a reduced subset of initiation factors and accounts for up to 5% of the remaining initiation events. Internal initiation relies on the presence of so-called internal ribosome entry site (IRES) elements in the 5′ UTRs of some viral and cellular mRNAs. These elements (often possessing complex secondary and tertiary structures) promote efficient interaction of the mRNA with the 40S ribosome and allow for internal ribosome entry. Internal initiation of translation of specific mRNAs may contribute to development of severe disease and pathological states, such as hepatitis C and cancer. Therefore, this cellular mechanism represents an attractive target for pharmacological modulation. The purpose of this review is to provide insight into current strategies used to target viral and cellular IRESs and discuss the physiological consequences (and potential therapeutic implications) of abrogation/modulation of IRES-mediated translation. PMID:26539410

  9. Visualization of the joining of ribosomal subunits reveals the presence of 80S ribosomes in the nucleus

    PubMed Central

    Al-Jubran, Khalid; Wen, Jikai; Abdullahi, Akilu; Roy Chaudhury, Subhendu; Li, Min; Ramanathan, Preethi; Matina, Annunziata; De, Sandip; Piechocki, Kim; Rugjee, Kushal Nivriti; Brogna, Saverio

    2013-01-01

    In eukaryotes the 40S and 60S ribosomal subunits are assembled in the nucleolus, but there appear to be mechanisms preventing mRNA binding, 80S formation, and initiation of translation in the nucleus. To visualize association between ribosomal subunits, we tagged pairs of Drosophila ribosomal proteins (RPs) located in different subunits with mutually complementing halves of fluorescent proteins. Pairs of tagged RPs expected to interact, or be adjacent in the 80S structure, showed strong fluorescence, while pairs that were not in close proximity did not. Moreover, the complementation signal is found in ribosomal fractions and it was enhanced by translation elongation inhibitors and reduced by initiation inhibitors. Our technique achieved 80S visualization both in cultured cells and in fly tissues in vivo. Notably, while the main 80S signal was in the cytoplasm, clear signals were also seen in the nucleolus and at other nuclear sites. Furthermore, we detected rapid puromycin incorporation in the nucleolus and at transcription sites, providing an independent indication of functional 80S in the nucleolus and 80S association with nascent transcripts. PMID:24129492

  10. Ribosomes in a Stacked Array

    PubMed Central

    Yamashita, Yui; Kadokura, Yoshitomo; Sotta, Naoyuki; Fujiwara, Toru; Takigawa, Ichigaku; Satake, Akiko; Onouchi, Hitoshi; Naito, Satoshi

    2014-01-01

    Expression of CGS1, which codes for an enzyme of methionine biosynthesis, is feedback-regulated by mRNA degradation in response to S-adenosyl-l-methionine (AdoMet). In vitro studies revealed that AdoMet induces translation arrest at Ser-94, upon which several ribosomes stack behind the arrested one, and mRNA degradation occurs at multiple sites that presumably correspond to individual ribosomes in a stacked array. Despite the significant contribution of stacked ribosomes to inducing mRNA degradation, little is known about the ribosomes in the stacked array. Here, we assigned the peptidyl-tRNA species of the stacked second and third ribosomes to their respective codons and showed that they are arranged at nine-codon intervals behind the Ser-94 codon, indicating tight stacking. Puromycin reacts with peptidyl-tRNA in the P-site, releasing the nascent peptide as peptidyl-puromycin. This reaction is used to monitor the activity of the peptidyltransferase center (PTC) in arrested ribosomes. Puromycin reaction of peptidyl-tRNA on the AdoMet-arrested ribosome, which is stalled at the pre-translocation step, was slow. This limited reactivity can be attributed to the peptidyl-tRNA occupying the A-site at this step rather than to suppression of PTC activity. In contrast, puromycin reactions of peptidyl-tRNA with the stacked second and third ribosomes were slow but were not as slow as pre-translocation step ribosomes. We propose that the anticodon end of peptidyl-tRNA resides in the A-site of the stacked ribosomes and that the stacked ribosomes are stalled at an early step of translocation, possibly at the P/E hybrid state. PMID:24652291

  11. Exploring Ribosome Positioning on Translating Transcripts with Ribosome Profiling.

    PubMed

    Spealman, Pieter; Wang, Hao; May, Gemma; Kingsford, Carl; McManus, C Joel

    2016-01-01

    Recent technological advances (e.g., microarrays and massively parallel sequencing) have facilitated genome-wide measurement of many aspects of gene regulation. Ribosome profiling is a high-throughput sequencing method used to measure gene expression at the level of translation. This is accomplished by quantifying both the number of translating ribosomes and their locations on mRNA transcripts. The inventors of this approach have published several methods papers detailing its implementation and addressing the basics of ribosome profiling data analysis. Here we describe our lab's procedure, which differs in some respects from those published previously. In addition, we describe a data analysis pipeline, Ribomap, for ribosome profiling data. Ribomap allocates sequence reads to alternative mRNA isoforms, normalizes sequencing bias along transcripts using RNA-seq data, and outputs count vectors of per-codon ribosome occupancy for each transcript. PMID:26463378

  12. Interplay between trigger factor and other protein biogenesis factors on the ribosome

    NASA Astrophysics Data System (ADS)

    Bornemann, Thomas; Holtkamp, Wolf; Wintermeyer, Wolfgang

    2014-06-01

    Nascent proteins emerging from translating ribosomes in bacteria are screened by a number of ribosome-associated protein biogenesis factors, among them the chaperone trigger factor (TF), the signal recognition particle (SRP) that targets ribosomes synthesizing membrane proteins to the membrane and the modifying enzymes, peptide deformylase (PDF) and methionine aminopeptidase (MAP). Here, we examine the interplay between these factors both kinetically and at equilibrium. TF rapidly scans the ribosomes until it is stabilized on ribosomes presenting TF-specific nascent chains. SRP binding to those complexes is strongly impaired. Thus, TF in effect prevents SRP binding to the majority of ribosomes, except those presenting SRP-specific signal sequences, explaining how the small amount of SRP in the cell can be effective in membrane targeting. PDF and MAP do not interfere with TF or SRP binding to translating ribosomes, indicating that nascent-chain processing can take place before or in parallel with TF or SRP binding.

  13. The identification by affinity chromatography of the rat liver ribosomal proteins that bind to elongator and initiator transfer ribonucleic acids.

    PubMed

    Ulbrich, N; Wool, I G; Ackerman, E; Sigler, P B

    1980-07-25

    Mixed yeast elongator-tRNAs (bulk tRNA lacking fRNAm,fMet), pure isoaccepting species of elongator-tRNAs (tRNAmMet and tRNAPhe), and purified initiator-tRNA (tRNAfMet) were each oxidized with periodate and the 3' terminus was coupled to Sepharose 4B through an adipic acid dihydrazide spacer. The rat liver ribosomal proteins that associated with the tRNAs were isolated by affinity chromatography and identified by electrophoresis in polyacrylamide gels. The rat liver ribosomal proteins that were bound to the elongator-tRNA preparations were L6, L35a, and S15; small amounts of a number of other proteins also associated with the nucleic acid. When initiator-tRNA (tRNAfMet) was immobilized on Sepharose, only L6 and L35a were bound; no 40 S subunit proteins associated with initiator-tRNA. No Escherichia coli proteins formed a complex with either eukaryotic initiator- or elongator-tRNAs. PMID:7391064

  14. Yeast Rrp14p is a nucleolar protein involved in both ribosome biogenesis and cell polarity

    PubMed Central

    Yamada, Hiroko; Horigome, Chihiro; Okada, Takafumi; Shirai, Chiharu; Mizuta, Keiko

    2007-01-01

    We previously cloned RRP14/YKL082c, whose product exhibits two-hybrid interaction with Ebp2p, a regulatory factor of assembly of 60S ribosomal subunits. Depletion of Rrp14p results in shortage of 60S ribosomal subunits and retardation of processing from 27S pre-rRNA to 25S rRNA. Furthermore, 35S pre-rRNA synthesis appears to decline in Rrp14p-depleted cells. Rrp14p interacts with regulatory factors of 60S subunit assembly and also with Utp11p and Faf1p, which are regulatory factors required for assembly of 40S ribosomal subunits. We propose that Rrp14p is involved in ribosome synthesis from the beginning of 35S pre-rRNA synthesis to assembly of the 60S ribosomal subunit. Disruption of RRP14 causes an extremely slow growth rate of the cell, a severe defect in ribosome synthesis, and a depolarized localization of cortical actin patches throughout the cell cycle. These results suggest that Rrp14p has dual functions in ribosome synthesis and polarized cell growth. PMID:17804645

  15. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation

    PubMed Central

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G.; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S. Kundhavai; Klaholz, Bruno P.; Eriani, Gilbert

    2016-01-01

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon. PMID:27554013

  16. Ribosomal 18S rRNA base pairs with mRNA during eukaryotic translation initiation.

    PubMed

    Martin, Franck; Ménétret, Jean-François; Simonetti, Angelita; Myasnikov, Alexander G; Vicens, Quentin; Prongidi-Fix, Lydia; Natchiar, S Kundhavai; Klaholz, Bruno P; Eriani, Gilbert

    2016-01-01

    Eukaryotic mRNAs often contain a Kozak sequence that helps tether the ribosome to the AUG start codon. The mRNA of histone H4 (h4) does not undergo classical ribosome scanning but has evolved a specific tethering mechanism. The cryo-EM structure of the rabbit ribosome complex with mouse h4 shows that the mRNA forms a folded, repressive structure at the mRNA entry site on the 40S subunit next to the tip of helix 16 of 18S ribosomal RNA (rRNA). Toe-printing and mutational assays reveal that an interaction exists between a purine-rich sequence in h4 mRNA and a complementary UUUC sequence of helix h16. Together the present data establish that the h4 mRNA harbours a sequence complementary to an 18S rRNA sequence which tethers the mRNA to the ribosome to promote proper start codon positioning, complementing the interactions of the 40S subunit with the Kozak sequence that flanks the AUG start codon. PMID:27554013

  17. Comprehensive analysis of phosphorylated proteins of Escherichia coli ribosomes.

    PubMed

    Soung, George Y; Miller, Jennifer L; Koc, Hasan; Koc, Emine C

    2009-07-01

    Phosphorylation of bacterial ribosomal proteins has been known for decades; however, there is still very limited information available on specific locations of the phosphorylation sites in ribosomal proteins and the role they might play in protein synthesis. In this study, we have mapped the specific phosphorylation sites in 24 Escherichia coli ribosomal proteins by tandem mass spectrometry. Detection of phosphorylation was achieved by either phosphorylation specific visualization techniques, ProQ staining, and antibodies for phospho-Ser, Thr, and Tyr; or by mass spectrometry equipped with a capability to detect addition and loss of the phosphate moiety. Enrichment by immobilized metal affinity and/or strong cation exchange chromatography was used to improve the success of detection of the low abundance phosphopeptides. We found the small subunit (30S) proteins S3, S4, S5, S7, S11, S12, S13, S18, and S21 and the large subunit (50S) proteins L1, L2, L3, L5, L6, L7/L12, L13, L14, L16, L18, L19, L21, L22, L28, and L31 to be phosphorylated at one or more residues. Potential roles for each specific site in ribosome function were deduced through careful evaluation of the given phosphorylation sites in 3D-crystal structure models of ribosomes and the previous mutational studies of E. coli ribosomal proteins. PMID:19469554

  18. Purification, characterization and crystallization of the human 80S ribosome

    PubMed Central

    Khatter, Heena; Myasnikov, Alexander G.; Mastio, Leslie; Billas, Isabelle M. L.; Birck, Catherine; Stella, Stefano; Klaholz, Bruno P.

    2014-01-01

    Ribosomes are key macromolecular protein synthesis machineries in the cell. Human ribosomes have so far not been studied to atomic resolution because of their particularly complex structure as compared with other eukaryotic or prokaryotic ribosomes, and they are difficult to prepare to high homogeneity, which is a key requisite for high-resolution structural work. We established a purification protocol for human 80S ribosomes isolated from HeLa cells that allows obtaining large quantities of homogenous samples as characterized by biophysical methods using analytical ultracentrifugation and multiangle laser light scattering. Samples prepared under different conditions were characterized by direct single particle imaging using cryo electron microscopy, which helped optimizing the preparation protocol. From a small data set, a 3D reconstruction at subnanometric resolution was obtained showing all prominent structural features of the human ribosome, and revealing a salt concentration dependence of the presence of the exit site tRNA, which we show is critical for obtaining crystals. With these well-characterized samples first human 80S ribosome crystals were obtained from several crystallization conditions in capillaries and sitting drops, which diffract to 26 Å resolution at cryo temperatures and for which the crystallographic parameters were determined, paving the way for future high-resolution work. PMID:24452798

  19. Structures of the Ribosome in Intermediate States of Ratcheting

    SciTech Connect

    Zhang, Wen; Dunkle, Jack A.; Cate, Jamie H.D.

    2009-10-21

    Protein biosynthesis on the ribosome requires repeated cycles of ratcheting, which couples rotation of the two ribosomal subunits with respect to each other, and swiveling of the head domain of the small subunit. However, the molecular basis for how the two ribosomal subunits rearrange contacts with each other during ratcheting while remaining stably associated is not known. Here, we describe x-ray crystal structures of the intact Escherichia coli ribosome, either in the apo-form (3.5 angstrom resolution) or with one (4.0 angstrom resolution) or two (4.0 angstrom resolution) anticodon stem-loop tRNA mimics bound, that reveal intermediate states of intersubunit rotation. In the structures, the interface between the small and large ribosomal subunits rearranges in discrete steps along the ratcheting pathway. Positioning of the head domain of the small subunit is controlled by interactions with the large subunit and with the tRNA bound in the peptidyl-tRNA site. The intermediates observed here provide insight into how tRNAs move into the hybrid state of binding that precedes the final steps of mRNA and tRNA translocation.

  20. The mechanics of ribosomal translocation.

    PubMed

    Achenbach, John; Nierhaus, Knud H

    2015-07-01

    The ribosome translates the sequence of codons of an mRNA into the corresponding sequence of amino acids as it moves along the mRNA with a codon-step width of about 10 Å. The movement of the million-dalton complex ribosome is triggered by the universal elongation factor G (EF2 in archaea and eukaryotes) and is termed translocation. Unraveling the molecular details of translocation is one of the most challenging tasks of current ribosome research. In the last two years, enormous progress has been obtained by highly-resolved X-ray and cryo-electron microscopic structures as well as by sophisticated biochemical approaches concerning the trigger and control of the movement of the tRNA2·mRNA complex inside the ribosome during translocation. This review inspects and surveys these achievements. PMID:25514765

  1. The Ribosomal Database Project (RDP).

    PubMed Central

    Maidak, B L; Olsen, G J; Larsen, N; Overbeek, R; McCaughey, M J; Woese, C R

    1996-01-01

    The Ribosomal Database Project (RDP) is a curated database that offers ribosome-related data, analysis services and associated computer programs. The offerings include phylogenetically ordered alignments of ribosomal RNA (rRNA) sequences, derived phylogenetic trees, rRNA secondary structure diagrams and various software for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (rdp.life.uiuc.edu), electronic mail (server@rdp.life.uiuc.edu), gopher (rdpgopher.life.uiuc.edu) and World Wide Web (WWW)(http://rdpwww.life.uiuc.edu/). The electronic mail and WWW servers provide ribosomal probe checking, screening for possible chimeric rRNA sequences, automated alignment and approximate phylogenetic placement of user-submitted sequences on an existing phylogenetic tree. PMID:8594608

  2. Ribosomal proteins produced in excess are degraded by the ubiquitin-proteasome system.

    PubMed

    Sung, Min-Kyung; Reitsma, Justin M; Sweredoski, Michael J; Hess, Sonja; Deshaies, Raymond J

    2016-09-01

    Ribosome assembly is an essential process that consumes prodigious quantities of cellular resources. Ribosomal proteins cannot be overproduced in Saccharomyces cerevisiae because the excess proteins are rapidly degraded. However, the responsible quality control (QC) mechanisms remain poorly characterized. Here we demonstrate that overexpression of multiple proteins of the small and large yeast ribosomal subunits is suppressed. Rpl26 overexpressed from a plasmid can be detected in the nucleolus and nucleoplasm, but it largely fails to assemble into ribosomes and is rapidly degraded. However, if the endogenous RPL26 loci are deleted, plasmid-encoded Rpl26 assembles into ribosomes and localizes to the cytosol. Chemical and genetic perturbation studies indicate that overexpressed ribosomal proteins are degraded by the ubiquitin-proteasome system and not by autophagy. Inhibition of the proteasome led to accumulation of multiple endogenous ribosomal proteins in insoluble aggregates, consistent with the operation of this QC mechanism in the absence of ribosomal protein overexpression. Our studies reveal that ribosomal proteins that fail to assemble into ribosomes are rapidly distinguished from their assembled counterparts and ubiquitinated and degraded within the nuclear compartment. PMID:27385339

  3. Analysis of the interactome of ribosomal protein S19 mutants.

    PubMed

    Caterino, Marianna; Aspesi, Anna; Pavesi, Elisa; Imperlini, Esther; Pagnozzi, Daniela; Ingenito, Laura; Santoro, Claudio; Dianzani, Irma; Ruoppolo, Margherita

    2014-10-01

    Diamond-Blackfan anemia, characterized by defective erythroid progenitor maturation, is caused in one-fourth of cases by mutations of ribosomal protein S19 (RPS19), which is a component of the ribosomal 40S subunit. Our previous work described proteins interacting with RPS19 with the aim to determine its functions. Here, two RPS19 mutants, R62W and R101H, have been selected to compare their interactomes versus the wild-type protein one, using the same functional proteomic approach that we employed to characterize RPS19 interactome. Mutations R62W and R101H impair RPS19 ability to associate with the ribosome. Results presented in this paper highlight the striking differences between the interactomes of wild-type and mutant RPS19 proteins. In particular, mutations abolish interactions with proteins having splicing, translational and helicase activity, thus confirming the role of RPS19 in RNA processing/metabolism and translational control. The data have been deposited to the ProteomeXchange with identifier PXD000640 (http://proteomecentral.proteomexchange.org/dataset/PXD000640). PMID:25069755

  4. Regulation of the mammalian elongation cycle by subunit rolling: a eukaryotic-specific ribosome rearrangement.

    PubMed

    Budkevich, Tatyana V; Giesebrecht, Jan; Behrmann, Elmar; Loerke, Justus; Ramrath, David J F; Mielke, Thorsten; Ismer, Jochen; Hildebrand, Peter W; Tung, Chang-Shung; Nierhaus, Knud H; Sanbonmatsu, Karissa Y; Spahn, Christian M T

    2014-07-01

    The extent to which bacterial ribosomes and the significantly larger eukaryotic ribosomes share the same mechanisms of ribosomal elongation is unknown. Here, we present subnanometer resolution cryoelectron microscopy maps of the mammalian 80S ribosome in the posttranslocational state and in complex with the eukaryotic eEF1A⋅Val-tRNA⋅GMPPNP ternary complex, revealing significant differences in the elongation mechanism between bacteria and mammals. Surprisingly, and in contrast to bacterial ribosomes, a rotation of the small subunit around its long axis and orthogonal to the well-known intersubunit rotation distinguishes the posttranslocational state from the classical pretranslocational state ribosome. We term this motion "subunit rolling." Correspondingly, a mammalian decoding complex visualized in substates before and after codon recognition reveals structural distinctions from the bacterial system. These findings suggest how codon recognition leads to GTPase activation in the mammalian system and demonstrate that in mammalia subunit rolling occurs during tRNA selection. PMID:24995983

  5. Ensemble cryo-EM uncovers inchworm-like translocation of a viral IRES through the ribosome

    PubMed Central

    Abeyrathne, Priyanka D; Koh, Cha San; Grant, Timothy; Grigorieff, Nikolaus; Korostelev, Andrei A

    2016-01-01

    Internal ribosome entry sites (IRESs) mediate cap-independent translation of viral mRNAs. Using electron cryo-microscopy of a single specimen, we present five ribosome structures formed with the Taura syndrome virus IRES and translocase eEF2•GTP bound with sordarin. The structures suggest a trajectory of IRES translocation, required for translation initiation, and provide an unprecedented view of eEF2 dynamics. The IRES rearranges from extended to bent to extended conformations. This inchworm-like movement is coupled with ribosomal inter-subunit rotation and 40S head swivel. eEF2, attached to the 60S subunit, slides along the rotating 40S subunit to enter the A site. Its diphthamide-bearing tip at domain IV separates the tRNA-mRNA-like pseudoknot I (PKI) of the IRES from the decoding center. This unlocks 40S domains, facilitating head swivel and biasing IRES translocation via hitherto-elusive intermediates with PKI captured between the A and P sites. The structures suggest missing links in our understanding of tRNA translocation. DOI: http://dx.doi.org/10.7554/eLife.14874.001 PMID:27159452

  6. [Ribosomal RNA Evolution

    NASA Technical Reports Server (NTRS)

    1997-01-01

    It is generally believed that an RNA World existed at an early stage in the history of life. During this early period, RNA molecules are seen to be potentially involved in both catalysis and the storage of genetic information. Translation presents several interrelated themes of inquiry for exobiology. First, it is essential, for understanding the very origin of life, how peptides and eventually proteins might have come to be made on the early Earth in a template directed manner. Second, it is necessary to understand how a machinery of similar complexity to that found in the ribosomes of modern organisms came to exist by the time of the last common ancestor (as detected by 16S rRNA sequence studies). Third, the ribosomal RNAs themselves likely had a very early origin and studies of their history may be very informative about the nature of the RNA World. Moreover, studies of these RNAs will contribute to a better understanding of the potential roles of RNA in early evolution.During the past year we have ave conducted a comparative study of four completely sequenced bacterial genoames. We have focused initially on conservation of gene order. The second component of the project continues to build on the model system for studying the validity of variant 5S rRNA sequences in the vicinity of the modern Vibrio proteolyticus 5S rRNA that we established earlier. This system has made it possible to conduct a detailed and extensive analysis of a local portion of the sequence space. These core methods have been used to construct numerous mutants during the last several years. Although it has been a secondary focus, this work has continued over the last year such that we now have in excess of 125 V. proteolyticus derived constructs which have been made and characterized. We have also continued high resolution NMR work on RNA oligomers originally initiated by G. Kenneth Smith who was funded by a NASA Graduate Student Researcher's Fellowship Award until May of 1996. Mr. Smith

  7. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome.

    PubMed

    Poirot, Olivier; Timsit, Youri

    2016-01-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through "molecular synapses", ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the "sensory-proteins" innervate the functional ribosomal sites, while the "inter-proteins" interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  8. Neuron-Like Networks Between Ribosomal Proteins Within the Ribosome

    PubMed Central

    Poirot, Olivier; Timsit, Youri

    2016-01-01

    From brain to the World Wide Web, information-processing networks share common scale invariant properties. Here, we reveal the existence of neural-like networks at a molecular scale within the ribosome. We show that with their extensions, ribosomal proteins form complex assortative interaction networks through which they communicate through tiny interfaces. The analysis of the crystal structures of 50S eubacterial particles reveals that most of these interfaces involve key phylogenetically conserved residues. The systematic observation of interactions between basic and aromatic amino acids at the interfaces and along the extension provides new structural insights that may contribute to decipher the molecular mechanisms of signal transmission within or between the ribosomal proteins. Similar to neurons interacting through “molecular synapses”, ribosomal proteins form a network that suggest an analogy with a simple molecular brain in which the “sensory-proteins” innervate the functional ribosomal sites, while the “inter-proteins” interconnect them into circuits suitable to process the information flow that circulates during protein synthesis. It is likely that these circuits have evolved to coordinate both the complex macromolecular motions and the binding of the multiple factors during translation. This opens new perspectives on nanoscale information transfer and processing. PMID:27225526

  9. WBSCR22/Merm1 is required for late nuclear pre-ribosomal RNA processing and mediates N7-methylation of G1639 in human 18S rRNA

    PubMed Central

    Haag, Sara; Kretschmer, Jens

    2015-01-01

    Ribosomal (r)RNAs are extensively modified during ribosome synthesis and their modification is required for the fidelity and efficiency of translation. Besides numerous small nucleolar RNA-guided 2′-O methylations and pseudouridinylations, a number of individual RNA methyltransferases are involved in rRNA modification. WBSCR22/Merm1, which is affected in Williams–Beuren syndrome and has been implicated in tumorigenesis and metastasis formation, was recently shown to be involved in ribosome synthesis, but its molecular functions have remained elusive. Here we show that depletion of WBSCR22 leads to nuclear accumulation of 3′-extended 18SE pre-rRNA intermediates resulting in impaired 18S rRNA maturation. We map the 3′ ends of the 18SE pre-rRNA intermediates accumulating after depletion of WBSCR22 and in control cells using 3′-RACE and deep sequencing. Furthermore, we demonstrate that WBSCR22 is required for N7-methylation of G1639 in human 18S rRNA in vivo. Interestingly, the catalytic activity of WBSCR22 is not required for 18S pre-rRNA processing, suggesting that the key role of WBSCR22 in 40S subunit biogenesis is independent of its function as an RNA methyltransferase. PMID:25525153

  10. Identification by affinity chromatography of the eukaryotic ribosomal proteins that bind to 5.8 S ribosomal ribonucleic acid.

    PubMed

    Ulbrich, N; Lin, A; Wool, I G

    1979-09-10

    The proteins that bind to rat liver 5.8 S ribosomal ribonucleic acid were identified by affinity chromatography. The nucleic acid was oxidized with periodate and coupled by its 3'-terminus to Sepharose 4B through and adipic acid dihydrazide spacer. The ribosomal proteins that associate with the immobilized 5.8 S rRNA were identified by polyacrylamide gel electrophoresiss: they were L19, L8, and L6 from the 60 S subunit; and S13 and S9 from the small subparticle. Small amounts of L14, L17', L18, L27/L27', and L35', and of S11, S15, S23/S24, and S26 also were bound to the affinity column, but whether they associate directly and specifically with 5.8 S rRNA is not known. Escherichia coli ribosomal proteins did not bind to the rat liver 5.8 S rRNA affinity column. PMID:468846

  11. Chloroplast ribosomes and protein synthesis.

    PubMed Central

    Harris, E H; Boynton, J E; Gillham, N W

    1994-01-01

    Consistent with their postulated origin from endosymbiotic cyanobacteria, chloroplasts of plants and algae have ribosomes whose component RNAs and proteins are strikingly similar to those of eubacteria. Comparison of the secondary structures of 16S rRNAs of chloroplasts and bacteria has been particularly useful in identifying highly conserved regions likely to have essential functions. Comparative analysis of ribosomal protein sequences may likewise prove valuable in determining their roles in protein synthesis. This review is concerned primarily with the RNAs and proteins that constitute the chloroplast ribosome, the genes that encode these components, and their expression. It begins with an overview of chloroplast genome structure in land plants and algae and then presents a brief comparison of chloroplast and prokaryotic protein-synthesizing systems and a more detailed analysis of chloroplast rRNAs and ribosomal proteins. A description of the synthesis and assembly of chloroplast ribosomes follows. The review concludes with discussion of whether chloroplast protein synthesis is essential for cell survival. PMID:7854253

  12. Ribosomal protein uS19 mutants reveal its role in coordinating ribosome structure and function

    PubMed Central

    Bowen, Alicia M; Musalgaonkar, Sharmishtha; Moomau, Christine A; Gulay, Suna P; Mirvis, Mary; Dinman, Jonathan D

    2015-01-01

    Prior studies identified allosteric information pathways connecting functional centers in the large ribosomal subunit to the decoding center in the small subunit through the B1a and B1b/c intersubunit bridges in yeast. In prokaryotes a single SSU protein, uS13, partners with H38 (the A-site finger) and uL5 to form the B1a and B1b/c bridges respectively. In eukaryotes, the SSU component was split into 2 separate proteins during the course of evolution. One, also known as uS13, participates in B1b/c bridge with uL5 in eukaryotes. The other, called uS19 is the SSU partner in the B1a bridge with H38. Here, polyalanine mutants of uS19 involved in the uS19/uS13 and the uS19/H38 interfaces were used to elucidate the important amino acid residues involved in these intersubunit communication pathways. Two key clusters of amino acids were identified: one located at the junction between uS19 and uS13, and a second that appears to interact with the distal tip of H38. Biochemical analyses reveal that these mutations shift the ribosomal rotational equilibrium toward the unrotated state, increasing ribosomal affinity for tRNAs in the P-site and for ternary complex in the A-site, and inhibit binding of the translocase, eEF2. These defects in turn affect specific aspects of translational fidelity. These findings suggest that uS19 plays a critical role as a conduit of information exchange between the large and small ribosomal subunits directly through the B1a, and indirectly through the B1b/c bridges. PMID:26824029

  13. Ribosomal protein uS19 mutants reveal its role in coordinating ribosome structure and function.

    PubMed

    Bowen, Alicia M; Musalgaonkar, Sharmishtha; Moomau, Christine A; Gulay, Suna P; Mirvis, Mary; Dinman, Jonathan D

    2015-01-01

    Prior studies identified allosteric information pathways connecting functional centers in the large ribosomal subunit to the decoding center in the small subunit through the B1a and B1b/c intersubunit bridges in yeast. In prokaryotes a single SSU protein, uS13, partners with H38 (the A-site finger) and uL5 to form the B1a and B1b/c bridges respectively. In eukaryotes, the SSU component was split into 2 separate proteins during the course of evolution. One, also known as uS13, participates in B1b/c bridge with uL5 in eukaryotes. The other, called uS19 is the SSU partner in the B1a bridge with H38. Here, polyalanine mutants of uS19 involved in the uS19/uS13 and the uS19/H38 interfaces were used to elucidate the important amino acid residues involved in these intersubunit communication pathways. Two key clusters of amino acids were identified: one located at the junction between uS19 and uS13, and a second that appears to interact with the distal tip of H38. Biochemical analyses reveal that these mutations shift the ribosomal rotational equilibrium toward the unrotated state, increasing ribosomal affinity for tRNAs in the P-site and for ternary complex in the A-site, and inhibit binding of the translocase, eEF2. These defects in turn affect specific aspects of translational fidelity. These findings suggest that uS19 plays a critical role as a conduit of information exchange between the large and small ribosomal subunits directly through the B1a, and indirectly through the B1b/c bridges. PMID:26824029

  14. An RNA trapping mechanism in Alphavirus mRNA promotes ribosome stalling and translation initiation

    PubMed Central

    Toribio, René; Díaz-López, Irene; Boskovic, Jasminka; Ventoso, Iván

    2016-01-01

    During translation initiation, eukaryotic initiation factor 2 (eIF2) delivers the Met-tRNA to the 40S ribosomal subunit to locate the initiation codon (AUGi) of mRNA during the scanning process. Stress-induced eIF2 phosphorylation leads to a general blockade of translation initiation and represents a key antiviral pathway in mammals. However, some viral mRNAs can initiate translation in the presence of phosphorylated eIF2 via stable RNA stem-loop structures (DLP; Downstream LooP) located in their coding sequence (CDS), which promote 43S preinitiation complex stalling on the initiation codon. We show here that during the scanning process, DLPs of Alphavirus mRNA become trapped in ES6S region (680–914 nt) of 18S rRNA that are projected from the solvent side of 40S subunit. This trapping can lock the progress of the 40S subunit on the mRNA in a way that places the upstream initiator AUGi on the P site of 40S subunit, obviating the participation of eIF2. Notably, the DLP structure is released from 18S rRNA upon 60S ribosomal subunit joining, suggesting conformational changes in ES6Ss during the initiation process. These novel findings illustrate how viral mRNA is threaded into the 40S subunit during the scanning process, exploiting the topology of the 40S subunit solvent side to enhance its translation in vertebrate hosts. PMID:26984530

  15. An RNA trapping mechanism in Alphavirus mRNA promotes ribosome stalling and translation initiation.

    PubMed

    Toribio, René; Díaz-López, Irene; Boskovic, Jasminka; Ventoso, Iván

    2016-05-19

    During translation initiation, eukaryotic initiation factor 2 (eIF2) delivers the Met-tRNA to the 40S ribosomal subunit to locate the initiation codon (AUGi) of mRNA during the scanning process. Stress-induced eIF2 phosphorylation leads to a general blockade of translation initiation and represents a key antiviral pathway in mammals. However, some viral mRNAs can initiate translation in the presence of phosphorylated eIF2 via stable RNA stem-loop structures (DLP; Downstream LooP) located in their coding sequence (CDS), which promote 43S preinitiation complex stalling on the initiation codon. We show here that during the scanning process, DLPs of Alphavirus mRNA become trapped in ES6S region (680-914 nt) of 18S rRNA that are projected from the solvent side of 40S subunit. This trapping can lock the progress of the 40S subunit on the mRNA in a way that places the upstream initiator AUGi on the P site of 40S subunit, obviating the participation of eIF2. Notably, the DLP structure is released from 18S rRNA upon 60S ribosomal subunit joining, suggesting conformational changes in ES6Ss during the initiation process. These novel findings illustrate how viral mRNA is threaded into the 40S subunit during the scanning process, exploiting the topology of the 40S subunit solvent side to enhance its translation in vertebrate hosts. PMID:26984530

  16. Ribosomal RNA sequence suggest microsporidia are extremely ancient eukaryotes

    NASA Technical Reports Server (NTRS)

    Vossbrinck, C. R.; Maddox, J. V.; Friedman, S.; Debrunner-Vossbrinck, B. A.; Woese, C. R.

    1987-01-01

    A comparative sequence analysis of the 18S small subunit ribosomal RNA (rRNA) of the microsporidium Vairimorpha necatrix is presented. The results show that this rRNA sequence is more unlike those of other eukaryotes than any known eukaryote rRNA sequence. It is concluded that the lineage leading to microsporidia branched very early from that leading to other eukaryotes.

  17. Initiation factor 2 stabilizes the ribosome in a semirotated conformation.

    PubMed

    Ling, Clarence; Ermolenko, Dmitri N

    2015-12-29

    Intersubunit rotation and movement of the L1 stalk, a mobile domain of the large ribosomal subunit, have been shown to accompany the elongation cycle of translation. The initiation phase of protein synthesis is crucial for translational control of gene expression; however, in contrast to elongation, little is known about the conformational rearrangements of the ribosome during initiation. Bacterial initiation factors (IFs) 1, 2, and 3 mediate the binding of initiator tRNA and mRNA to the small ribosomal subunit to form the initiation complex, which subsequently associates with the large subunit by a poorly understood mechanism. Here, we use single-molecule FRET to monitor intersubunit rotation and the inward/outward movement of the L1 stalk of the large ribosomal subunit during the subunit-joining step of translation initiation. We show that, on subunit association, the ribosome adopts a distinct conformation in which the ribosomal subunits are in a semirotated orientation and the L1 stalk is positioned in a half-closed state. The formation of the semirotated intermediate requires the presence of an aminoacylated initiator, fMet-tRNA(fMet), and IF2 in the GTP-bound state. GTP hydrolysis by IF2 induces opening of the L1 stalk and the transition to the nonrotated conformation of the ribosome. Our results suggest that positioning subunits in a semirotated orientation facilitates subunit association and support a model in which L1 stalk movement is coupled to intersubunit rotation and/or IF2 binding. PMID:26668356

  18. Profiling of Mycoplasma gallisepticum Ribosomes.

    PubMed

    Fisunov, G Y; Evsyutina, D V; Arzamasov, A A; Butenko, I O; Govorun, V M

    2015-01-01

    The development of high-throughput technologies is increasingly resulting in identification of numerous cases of low correlation between mRNA and the protein level in cells. These controversial observations were made on various bacteria, such as E. coli, Desulfovibrio vulgaris, and Lactococcus lactis. Thus, it is important to develop technologies, including high-throughput techniques, aimed at studying gene expression regulation at the level of translation. In the current study, we performed proteomic profiling of M. gallisepticum ribosomes and identified high abundant noncanonical proteins. We found that binding of mRNAs to ribosomes is mainly determined by two parameters: (1) abundance of mRNA itself and (2) complimentary interactions between the 3' end of 16S rRNA and the ribosome binding site in the 5'-untranslated region of mRNA. PMID:26798497

  19. Profiling of Mycoplasma gallisepticum Ribosomes

    PubMed Central

    Fisunov, G. Y.; Evsyutina, D. V.; Arzamasov, A. A.; Butenko, I. O.; Govorun, V. M.

    2015-01-01

    The development of high-throughput technologies is increasingly resulting in identification of numerous cases of low correlation between mRNA and the protein level in cells. These controversial observations were made on various bacteria, such as E. coli, Desulfovibrio vulgaris, and Lactococcus lactis. Thus, it is important to develop technologies, including high-throughput techniques, aimed at studying gene expression regulation at the level of translation. In the current study, we performed proteomic profiling of M. gallisepticum ribosomes and identified high abundant noncanonical proteins. We found that binding of mRNAs to ribosomes is mainly determined by two parameters: (1) abundance of mRNA itself and (2) complimentary interactions between the 3’ end of 16S rRNA and the ribosome binding site in the 5’-untranslated region of mRNA. PMID:26798497

  20. Ribosome Dwell Times and the Protein Copy Number Distribution

    NASA Astrophysics Data System (ADS)

    Gorissen, Mieke; Vanderzande, Carlo

    2012-09-01

    Translation is the cellular process in which ribosomes make proteins from information encoded on messenger RNA (mRNA). We model translation with an exclusion process taking into account the experimentally determined, non-exponential, waiting time between steps of a ribosome. From numerical simulations using realistic parameter values, we determine the distribution P( E) of the number of proteins E produced by one mRNA. We find that for small E this distribution is not geometric. We present a simplified and analytically solvable model that relates P( E) to the distributions of the times to produce the first E proteins.

  1. Comprehensive Molecular Structure of the Eukaryotic Ribosome

    PubMed Central

    Taylor, Derek J.; Devkota, Batsal; Huang, Andrew D.; Topf, Maya; Narayanan, Eswar; Sali, Andrej; Harvey, Stephen C.; Frank, Joachim

    2009-01-01

    Despite the emergence of a large number of X-ray crystallographic models of the bacterial 70S ribosome over the past decade, an accurate atomic model of the eukaryotic 80S ribosome is still not available. Eukaryotic ribosomes possess more ribosomal proteins and ribosomal RNA than bacterial ribosomes, which are implicated in extra-ribosomal functions in the eukaryotic cells. By combining cryo-EM with RNA and protein homology modeling, we obtained an atomic model of the yeast 80S ribosome complete with all ribosomal RNA expansion segments and all ribosomal proteins for which a structural homolog can be identified. Mutation or deletion of 80S ribosomal proteins can abrogate maturation of the ribosome, leading to several human diseases. We have localized one such protein unique to eukaryotes, rpS19e, whose mutations are associated with Diamond-Blackfan anemia in humans. Additionally, we characterize crucial and novel interactions between the dynamic stalk base of the ribosome with eukaryotic elongation factor 2. PMID:20004163

  2. New ribosomes for new memories?

    PubMed Central

    Hernández, A Iván; Alarcon, Juan M; Allen, Kim D

    2015-01-01

    Widely thought to be a housekeeping process, the regulation and synthesis of rRNA emerges as a potentially central mechanism for the maintenance of synaptic plasticity and memory. We have recently shown that an essential component of late-phase synaptic plasticity is rRNA biosynthesis — the rate-limiting step in the production of new ribosomes. We hypothesize that a particular population of ribosomes is generated upon learning-associated neural activity to alter the rate of synthesis of plasticity factors at tagged synapses that will support the maintenance of synaptic plasticity and memory. PMID:26479998

  3. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  4. 5SRNAdb: an information resource for 5S ribosomal RNAs

    PubMed Central

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A.; Karlowski, Wojciech M.

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA–protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  5. Ribosomal Dynamics: Intrinsic Instability of a Molecular Machine

    NASA Astrophysics Data System (ADS)

    Gao, Haixiao; Le Barron, Jamie; Frank, Joachim

    Ribosomes are molecular machines that translate genetic message into nascent peptides, through a complex dynamics interplay with mRNAs, tRNAs, and various protein factors. A prominent example of ribosomal dynamics is the rotation of small ribosomal subunit with respect to a large subunit, characterized as the "ratchet motion," which is triggered by the binding of several translation factors. Here, we analyze two kinds of ribosomal ratchet motions, induced by the binding of EF-G and RF3, respectively, as previously observed by cryo-electron microscopy. Using the flexible fitting technique (real-space refinement) and an RNA secondary structure display tool (coloRNA), we obtained quasi-atomic models of the ribosome in these ratchet-motion-related functional states and mapped the observed differences onto the highly conserved RNA secondary structure. Comparisons between two sets of ratchet motions revealed that, while the overall patterns of the RNA displacement are very similar, several local regions stand out in their differential behavior, including the highly conserved GAC (GTPase-associated-center) region. We postulate that these regions are important in modulating general ratchet motion and bestowing it with the dynamic characteristics required for the specific function.

  6. Chromatographic Purification of Highly Active Yeast Ribosomes

    PubMed Central

    Meskauskas, Arturas; Leshin, Jonathan A.; Dinman, Jonathan D.

    2011-01-01

    Eukaryotic ribosomes are much more labile as compared to their eubacterial and archael counterparts, thus posing a significant challenge to researchers. Particularly troublesome is the fact that lysis of cells releases a large number of proteases and nucleases which can degrade ribosomes. Thus, it is important to separate ribosomes from these enzymes as quickly as possible. Unfortunately, conventional differential ultracentrifugation methods leaves ribosomes exposed to these enzymes for unacceptably long periods of time, impacting their structural integrity and functionality. To address this problem, we utilize a chromatographic method using a cysteine charged Sulfolink resin. This simple and rapid application significantly reduces co-purifying proteolytic and nucleolytic activities, producing high yields of intact, highly biochemically active yeast ribosomes. We suggest that this method should also be applicable to mammalian ribosomes. The simplicity of the method, and the enhanced purity and activity of chromatographically purified ribosome represents a significant technical advancement for the study of eukaryotic ribosomes. PMID:22042245

  7. Ribosomal crystallography: from crystal growth to initial phasing

    NASA Astrophysics Data System (ADS)

    Thygesen, J.; Krumbholz, S.; Levin, I.; Zaytzev-Bashan, A.; Harms, J.; Bartels, H.; Schlünzen, F.; Hansen, H. A. S.; Bennett, W. S.; Volkmann, N.; Agmon, I.; Eisenstein, M.; Dribin, A.; Maltz, E.; Sagi, I.; Morlang, S.; Fua, M.; Franceschi, F.; Weinstein, S.; Böddeker, N.; Sharon, R.; Anagnostopoulos, K.; Peretz, M.; Geva, M.; Berkovitch-Yellin, Z.; Yonath, A.

    1996-10-01

    Preliminary phases were determined by the application of the isomorphous replacement method at low and intermediate resolution for structure factor amplitudes collected from crystals of large and small ribosomal subunits from halophilic and thermophilic bacteria. Derivatization was performed with dense heavy atom clusters, either by soaking or by specific covalent binding prior to the crystallization. The resulting initial electron density maps contain features comparable in size to those expected for the corresponding particles. The packing arrangements of these maps have been compared with motifs observed by electron microscopy in positively stained thin sections of embedded three-dimensional crystals, as well as with phase sets obtained by ab-initio computations. Aimed at higher resolution phasing, procedures are being developed for multi-site binding of relatively small dense metal clusters at selected locations. Potential sites are being inserted either by mutagenesis or by chemical modifications to facilitate cluster binding to the large halophilic and the small thermophilic ribosomal subunits which yield crystals diffracting to the highest resolution obtained so far for ribosomes, 2.9 and 7.3 Å, respectively. For this purpose the surfaces of these ribosomal particles have been characterized and conditions for quantitative reversible detachment of selected ribosomal proteins have been found. The corresponding genes are being cloned, sequenced, mutated to introduce the reactive side-groups (mainly cysteines) and overexpressed. To assist the interpretation of the anticipated electron density maps, sub-ribosomal stable complexes were isolated from H50S. One of these complexes is composed of two proteins and the other is made of a stretch of the rRNA and a protein. For exploiting the exposed parts of the surface of these complexes for heavy atom binding and for attempting the determination of their three-dimensional structure, their components are being produced

  8. Architecture of the 90S Pre-ribosome: A Structural View on the Birth of the Eukaryotic Ribosome.

    PubMed

    Kornprobst, Markus; Turk, Martin; Kellner, Nikola; Cheng, Jingdong; Flemming, Dirk; Koš-Braun, Isabelle; Koš, Martin; Thoms, Matthias; Berninghausen, Otto; Beckmann, Roland; Hurt, Ed

    2016-07-14

    The 90S pre-ribosome is an early biogenesis intermediate formed during co-transcriptional ribosome formation, composed of ∼70 assembly factors and several small nucleolar RNAs (snoRNAs) that associate with nascent pre-rRNA. We report the cryo-EM structure of the Chaetomium thermophilum 90S pre-ribosome, revealing how a network of biogenesis factors including 19 β-propellers and large α-solenoid proteins engulfs the pre-rRNA. Within the 90S pre-ribosome, we identify the UTP-A, UTP-B, Mpp10-Imp3-Imp4, Bms1-Rcl1, and U3 snoRNP modules, which are organized around 5'-ETS and partially folded 18S rRNA. The U3 snoRNP is strategically positioned at the center of the 90S particle to perform its multiple tasks during pre-rRNA folding and processing. The architecture of the elusive 90S pre-ribosome gives unprecedented structural insight into the early steps of pre-rRNA maturation. Nascent rRNA that is co-transcriptionally folded and given a particular shape by encapsulation within a dedicated mold-like structure is reminiscent of how polypeptides use chaperone chambers for their protein folding. PMID:27419870

  9. AMPLIFICATION OF RIBOSOMAL RNA SEQUENCES

    EPA Science Inventory

    This book chapter offers an overview of the use of ribosomal RNA sequences. A history of the technology traces the evolution of techniques to measure bacterial phylogenetic relationships and recent advances in obtaining rRNA sequence information. The manual also describes procedu...

  10. Studies on Pea Ribosomal Proteins

    PubMed Central

    Lin, Chu-Yung; Chia, Subrina Li-Li; Travis, Robert L.; Key, Joe L.

    1975-01-01

    Ribosomal subunits prepared by NH4Cl dissociation (0.5 m) of the monomeric ribosomes were much less active in in vitro protein synthesis than those prepared by KCl dissociation. The decrease in activity correlated with a detachment of some proteins (L2 and L9 as shown by gel electrophoresis) within the 60S ribosomal subunits. Subunits prepared with 0.3 m NH4Cl retained L2 and L9, but the activity remained low. Incubation of these 60S subunits in TKM buffer (50 mm tris [pH 7.5], 20 mm KCl, and 5 mm MgCl2) for 20 min at 37 C restored the activity almost to the level of those obtained by KCl dissociation. Treatment of the 0.3 m NH4Cl-derived 60S subunits with a protein reagent, Procion brilliant blue, prior to extraction of the ribosomal proteins resulted in the loss of L2 and L9, showing that these proteins were made accessible for dye binding. These observations suggest that a considerable degree of unfolding of the 60S subunit occurs at 0.3 m NH4Cl (this apparently leads to a preferential detachment of L2 and L9 at 0.5 m NH4Cl) and that the activity of the purified subunits depends not only on the presence of L2 and L9 but also on the organization of these proteins within the 60S subunits. Images PMID:16659254

  11. Insertion of the Biogenesis Factor Rei1 Probes the Ribosomal Tunnel during 60S Maturation.

    PubMed

    Greber, Basil Johannes; Gerhardy, Stefan; Leitner, Alexander; Leibundgut, Marc; Salem, Michèle; Boehringer, Daniel; Leulliot, Nicolas; Aebersold, Ruedi; Panse, Vikram Govind; Ban, Nenad

    2016-01-14

    Eukaryotic ribosome biogenesis depends on several hundred assembly factors to produce functional 40S and 60S ribosomal subunits. The final phase of 60S subunit biogenesis is cytoplasmic maturation, which includes the proofreading of functional centers of the 60S subunit and the release of several ribosome biogenesis factors. We report the cryo-electron microscopy (cryo-EM) structure of the yeast 60S subunit in complex with the biogenesis factors Rei1, Arx1, and Alb1 at 3.4 Å resolution. In addition to the network of interactions formed by Alb1, the structure reveals a mechanism for ensuring the integrity of the ribosomal polypeptide exit tunnel. Arx1 probes the entire set of inner-ring proteins surrounding the tunnel exit, and the C terminus of Rei1 is deeply inserted into the ribosomal tunnel, where it forms specific contacts along almost its entire length. We provide genetic and biochemical evidence that failure to insert the C terminus of Rei1 precludes subsequent steps of 60S maturation. PMID:26709046

  12. Phosphorylation of ribosomal proteins induced by auxins in maize embryonic tissues. [Zea mays

    SciTech Connect

    Perez, L.; Aguilar, R.; Mendez, A.P.; de Jimenez, E.S.

    1990-11-01

    The effect of auxin on ribosomal protein phosphorylation of germinating maize (Zea mays) tissues was investigated. Two-dimensional gel electrophoresis and autoradiography of ({sup 32}P) ribosomal protein patterns for natural and synthetic auxin-treated tissues were performed. Both the rate of {sup 32}P incorporation and the electrophoretic patterns were dependent on {sup 32}P pulse length, suggesting that active protein phosphorylation-dephosphorylation occurred in small and large subunit proteins, in control as well as in auxin-treated tissues. The effect of ribosomal protein phosphorylation on in vitro translation was tested. Measurements of poly(U) translation rates as a function of ribosome concentration provided apparent K{sub m} values significantly different for auxin-treated and nontreated tissues. These findings suggest that auxin might exert some kind of translational control by regulating the phosphorylated status of ribosomal proteins.

  13. High Precision Analysis of Translational Pausing by Ribosome Profiling in Bacteria Lacking EFP

    PubMed Central

    Woolstenhulme, Christopher J.; Guydosh, Nicholas R.; Green, Rachel; Buskirk, Allen R.

    2015-01-01

    Summary Ribosome profiling is a powerful method for globally assessing the activity of ribosomes in a cell. Despite its application in many organisms, ribosome profiling studies in bacteria have struggled to obtain the resolution necessary to precisely define translational pauses. Here we report improvements that yield much higher resolution in E. coli profiling data, enabling us to more accurately assess ribosome pausing and refine earlier studies of the impact of polyproline motifs on elongation. We comprehensively characterize pausing at proline-rich motifs in the absence of elongation factor EFP. We find that only a small fraction of genes with strong pausing motifs have reduced ribosome density downstream and identify features that explain this phenomenon. These features allow us to predict which proteins likely have reduced output in the efp knockout strain. PMID:25843707

  14. Characterizing inactive ribosomes in translational profiling.

    PubMed

    Liu, Botao; Qian, Shu-Bing

    2016-01-01

    The broad impact of translational regulation has emerged explosively in the last few years in part due to the technological advance in genome-wide interrogation of gene expression. During mRNA translation, the majority of actively translating ribosomes exist as polysomes in cells with multiple ribosomes loaded on a single transcript. The importance of the monosome, however, has been less appreciated in translational profiling analysis. Here we report that the monosome fraction isolated by sucrose sedimentation contains a large quantity of inactive ribosomes that do not engage on mRNAs to direct translation. We found that the elongation factor eEF2, but not eEF1A, stably resides in these non-translating ribosomes. This unique feature permits direct evaluation of ribosome status under various stress conditions and in the presence of translation inhibitors. Ribosome profiling reveals that the monosome has a similar but not identical pattern of ribosome footprints compared to the polysome. We show that the association of free ribosomal subunits minimally contributes to ribosome occupancy outside of the coding region. Our results not only offer a quantitative method to monitor ribosome availability, but also uncover additional layers of ribosome status needed to be considered in translational profiling analysis. PMID:27335722

  15. Alcoholic Liver Disease and the Mitochondrial Ribosome

    PubMed Central

    Cahill, Alan; Sykora, Peter

    2009-01-01

    Summary Chronic alcohol consumption has been shown to severely compromise mitochondrial protein synthesis. Hepatic mitochondria isolated from alcoholic animals contain decreased levels of respiratory complexes and display depressed respiration rates when compared to pair-fed controls. One underlying mechanism for this involves ethanol-elicited alterations in the structural and functional integrity of the mitochondrial ribosome. Ethanol feeding results in ribosomal changes that include decreased sedimentation rates, larger hydrodynamic volumes, increased levels of unassociated subunits and changes in the levels of specific ribosomal proteins. The methods presented in this chapter detail how to isolate mitochondrial ribosomes, determine ribosomal activity, separate ribosomes into nucleic acid and protein, and perform two-dimensional nonequilibrium pH gradient electrophoretic polyacrylamide gel electrophoresis to separate and subsequently identify mitochondrial ribosomal proteins. PMID:18369931

  16. [About the ribosomal biogenesis in human].

    PubMed

    Tafforeau, Lionel

    2015-01-01

    Ribosomes are cellular ribonucleoprotein particles required for a fundamental mechanism, translation of the genetic information into proteins. Ribosome biogenesis is a highly complex pathway involving many maturation steps: ribosomal RNA (rRNA) synthesis, rRNA processing, pre-rRNA modifications, its assembly with ribosomal proteins in the nuceolus, export of the subunit precursors to the nucleoplasm and the cytoplasm. Ribosome biogenesis has mainly being investigated in yeast during these last 25 years. However, recent works have shown that, despite many similarities between yeast and human ribosome structure and biogenesis, human pre-rRNA processing is far more complex than in yeast. In order to better understand diseases related to a malfunction in ribosome synthesis, the ribosomopathies, research should be conducted directly in human cells and animal models. PMID:26152166

  17. Intersubunit movement is required for ribosomal translocation

    PubMed Central

    Horan, Lucas H.; Noller, Harry F.

    2007-01-01

    Translocation of tRNA and mRNA during protein synthesis is believed to be coupled to structural changes in the ribosome. The “ratchet model,” based on cryo-EM reconstructions of ribosome complexes, invokes relative movement of the 30S and 50S ribosomal subunits in this process; however, evidence that directly demonstrates a requirement for intersubunit movement during translocation is lacking. To address this problem, we created an intersubunit disulfide cross-link to restrict potential movement. The cross-linked ribosomes were unable to carry out polypeptide synthesis; this inhibition was completely reversed upon reduction of the disulfide bridge. In vitro assays showed that the cross-linked ribosomes were specifically blocked in elongation factor G-dependent translocation. These findings show that intersubunit movement is required for ribosomal translocation, accounting for the universal two-subunit architecture of ribosomes. PMID:17360328

  18. Maize reas1 Mutant Stimulates Ribosome Use Efficiency and Triggers Distinct Transcriptional and Translational Responses.

    PubMed

    Qi, Weiwei; Zhu, Jie; Wu, Qiao; Wang, Qun; Li, Xia; Yao, Dongsheng; Jin, Ying; Wang, Gang; Wang, Guifeng; Song, Rentao

    2016-02-01

    Ribosome biogenesis is a fundamental cellular process in all cells. Impaired ribosome biogenesis causes developmental defects; however, its molecular and cellular bases are not fully understood. We cloned a gene responsible for a maize (Zea mays) small seed mutant, dek* (for defective kernel), and found that it encodes Ribosome export associated1 (ZmReas1). Reas1 is an AAA-ATPase that controls 60S ribosome export from the nucleus to the cytoplasm after ribosome maturation. dek* is a weak mutant allele with decreased Reas1 function. In dek* cells, mature 60S ribosome subunits are reduced in the nucleus and cytoplasm, but the proportion of actively translating polyribosomes in cytosol is significantly increased. Reduced phosphorylation of eukaryotic initiation factor 2α and the increased elongation factor 1α level indicate an enhancement of general translational efficiency in dek* cells. The mutation also triggers dramatic changes in differentially transcribed genes and differentially translated RNAs. Discrepancy was observed between differentially transcribed genes and differentially translated RNAs, indicating distinct cellular responses at transcription and translation levels to the stress of defective ribosome processing. DNA replication and nucleosome assembly-related gene expression are selectively suppressed at the translational level, resulting in inhibited cell growth and proliferation in dek* cells. This study provides insight into cellular responses due to impaired ribosome biogenesis. PMID:26645456

  19. Structural studies of E. coli ribosomes by spectroscopic techniques: A specialized review

    NASA Astrophysics Data System (ADS)

    Bonicontro, Adalberto; Risuleo, Gianfranco

    2005-12-01

    We present a review on our interdisciplinary line of research based on strategies of molecular biology and biophysics. These have been applied to the study of the prokaryotic ribosome of the bacterium Escherichia coli. Our investigations on this organelle have continued for more than a decade and we have adopted different spectroscopic biophysical techniques such as: dielectric and fluorescence spectroscopy as well as light scattering (photon correlation spectroscopy). Here we report studies on the whole 70S ribosomes and on the separated subunits 30S and 50S. Our results evidence intrinsic structural features of the subunits: the small shows a more "floppy" structure, while the large one appears to be more rigid. Also, an inner "kernel" formed by the RNA/protein association is found within the ribosome. This kernel is surrounded by a ribonucleoprotein complex more exposed to the solvent. Initial analyses were done on the so called Kaldtschmit-Wittmann ribosome: more recently we have extended the studies to the "tight couple" ribosome known for its better functional performance in vitro. Data evidence a phenomenological correlation between the differential biological activity and the intrinsic structural properties of the two-ribosome species. Finally, investigations were also conducted on particles treated at sub-denaturing temperatures and on ribosomes partially deproteinized by salt treatment (ribosomal cores). Results suggest that the thermal treatment and the selective removal of proteins cause analogous structural alterations.

  20. Hypoxic stress-induced changes in ribosomes of maize seedling roots. [Zea mays L

    SciTech Connect

    Bailey-Serres, J.; Freeling, M. )

    1990-11-01

    The hypoxic stress response of Zea mays L. seedling roots involves regulation of gene expression at transcriptional and posttranscriptional levels. We investigated the effect of hypoxia on the translational machinery of seedling roots. The levels of monoribosomes and ribosomal subunits increased dramatically within 1 hour of stress. Prolonged hypoxia resulted in continued accumulation of nontranslating ribosomes, as well as increased levels of small polyribosomes. The return of seedlings to normal aerobic conditions resulted in recovery of normal polyribosome levels. Comparison of ribosomal proteins from control and hypoxic roots revealed differences in quantity and electrophoretic mobility. In vivo labeling of roots with ({sup 35}S)methionine revealed variations in newly synthesized ribosomal proteins. In vivo labeling of roots with ({sup 32}P)orthophosphate revealed a major reduction in the phosphorylation of a 31 kilodalton ribosomal protein in hypoxic stressed roots. In vitro phosphorylation of ribosomal proteins by endogenous kinases was used to probe for differences in ribosome structure and composition. The patterns of in vitro kinased phosphoproteins of ribosomes from control and hypoxic roots were not identical. Variation in phosphoproteins of polyribosomes from control and hypoxic roots, as well as among polyribosomes from hypoxic roots were observed. These results indicate that modification of the translational machinery occurs in response to hypoxic stress.

  1. Molecular Genetics of Cryptopleurine Resistance in Saccharomyces Cerevisiae: Expression of a Ribosomal Protein Gene Family

    PubMed Central

    Paulovich, A. G.; Thompson, J. R.; Larkin, J. C.; Li, Z.; Woolford-Jr., J. L.

    1993-01-01

    The Saccharomyces cerevisiae CRY1 gene encodes the 40S ribosomal subunit protein rp59 and confers sensitivity to the protein synthesis inhibitor cryptopleurine. A yeast strain containing the cry1-δ1::URA3 null allele is viable, cryptopleurine sensitive (Cry(S)), and expresses rp59 mRNA, suggesting that there is a second functional CRY gene. The CRY2 gene has been isolated from a yeast genomic library cloned in bacteriophage λ, using a CRY1 DNA probe. The DNA sequence of the CRY2 gene contains an open reading frame encoding ribosomal protein 59 that differs at five residues from rp59 encoded by the CRY1 gene. The CRY2 gene was mapped to the left arm of chromosome X, centromere-proximal to cdc6 and immediately adjacent to ribosomal protein genes RPS24A and RPL46. Ribosomal protein 59 is an essential protein; upon sporulation of a diploid doubly heterozygous for cry1-δ2::TRP1 cry2-δ1::LEU2 null alleles, no spore clones containing both null alleles were recovered. Several results indicate that CRY2 is expressed, but at lower levels than CRY1: (1) Introduction of CRY2 on high copy plasmids into Cry(R) yeast of genotype cry1 CRY2 confers a Cry(S) phenotype. Transformation of these Cry(R) yeast with CRY2 on a low copy CEN plasmid does not confer a Cry(S) phenotype. (2) Haploids containing the cry1-δ2::TRP1 null allele have a deficit of 40S ribosomal subunits, but cry2-δ1::LEU2 strains have wild-type amounts of 40S ribosomal subunits. (3) CRY2 mRNA is present at lower levels than CRY1 mRNA. (4) Higher levels of β-galactosidase are expressed from a CRY1-lacZ gene fusion than from a CRY2-lacZ gene fusion. Mutations that alter or eliminate the last amino acid of rp59 encoded by either CRY1 or CRY2 result in resistance to cryptopleurine. Because CRY2 (and cry2) is expressed at lower levels than CRY1 (and cry1), the Cry(R) phenotype of cry2 mutants is only expressed in strains containing a cry1-δ null allele. PMID:8293976

  2. RNA Mimicry by the Fap7 Adenylate Kinase in Ribosome Biogenesis

    PubMed Central

    Réty, Stéphane; Lebaron, Simon; Deschamps, Patrick; Bareille, Joseph; Jombart, Julie; Robert-Paganin, Julien; Delbos, Lila; Chardon, Florian; Zhang, Elodie; Charenton, Clément; Tollervey, David; Leulliot, Nicolas

    2014-01-01

    During biogenesis of the 40S and 60S ribosomal subunits, the pre-40S particles are exported to the cytoplasm prior to final cleavage of the 20S pre-rRNA to mature 18S rRNA. Amongst the factors involved in this maturation step, Fap7 is unusual, as it both interacts with ribosomal protein Rps14 and harbors adenylate kinase activity, a function not usually associated with ribonucleoprotein assembly. Human hFap7 also regulates Cajal body assembly and cell cycle progression via the p53–MDM2 pathway. This work presents the functional and structural characterization of the Fap7–Rps14 complex. We report that Fap7 association blocks the RNA binding surface of Rps14 and, conversely, Rps14 binding inhibits adenylate kinase activity of Fap7. In addition, the affinity of Fap7 for Rps14 is higher with bound ADP, whereas ATP hydrolysis dissociates the complex. These results suggest that Fap7 chaperones Rps14 assembly into pre-40S particles via RNA mimicry in an ATP-dependent manner. Incorporation of Rps14 by Fap7 leads to a structural rearrangement of the platform domain necessary for the pre-rRNA to acquire a cleavage competent conformation. PMID:24823650

  3. PCR Primers for Metazoan Mitochondrial 12S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Kweskin, Matthew; Knowlton, Nancy

    2012-01-01

    Background Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. Methodology/Principal Findings A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. Conclusions/Significance Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans. PMID:22536450

  4. Affinity labeling of the ribosomal P site in Drosophila melanogaster

    SciTech Connect

    North, D.

    1987-01-01

    Several recent studies have probed the peptidyl transferase region of the Drosophila ribosome via the use of reactive site specific analogues (affinity labels). P site proteins adjacent to the 3' end of the amino acid bearing tRNA strand were labeled with modified tRNA fragments. Drugs affecting the binding of these agents were used to further clarify the nature of the region. The nascent peptide region of the P site was not labeled in previous experiments. To label that region radioactive Bromoacetylphenylalanyl-tRNA (BrAcphe-tRNA) was synthesized. The alpha-bromoacetyl group of this analogue is potentially reactive with nucleophiles present in either proteins or RNAs. Charged tRNAs and tRNA analogues bearing a peptide bond on the N-terminus of their amino acid are recognized as having affinity for the ribosomal P site. Specific labeling of the P site by BrAcphe-tRNA was confirmed by its ability to radioactively label proteins indirectly. As many as 8 ribosomal proteins may be labeled under these conditions, however, the majority of the bound label is associated with 3 large subunit proteins and 2 small subunit proteins. Overlaps between the proteins labeled by BrAcphe-tRNA and those labeled by other affinity labels are examined and a model of the peptidyl transferase region of Drosophila ribosomes is presented.

  5. Ribosomal protein L3: Gatekeeper to the A-site

    PubMed Central

    2007-01-01

    Summary Ribosomal protein L3 (L3) is an essential and indispensable component for formation of the peptidyltransferase center. Atomic resolution ribosome structures reveal two extensions of L3 protruding deep into the core of the large subunit. The central extension of L3 in Saccharomyces cerevisiae was investigated using a combination of molecular genetic, biochemical, chemical probing and molecular modeling methods. A reciprocal relationship between ribosomal affinity for eEF-1A stimulated binding of aa-tRNA and for eEF2 suggests that the central extension of L3 may function as an allosteric switch in coordinating binding of the elongation factors. Opening of the aa-tRNA accommodation corridor promoted resistance to the A-site specific translational inhibitor anisomycin, suggesting a competitive model for anisomycin resistance. These changes were also found to inhibit peptidyltransferase activity, stimulating programmed -1 ribosomal frameshifting, and promoting virus propagation defects. These studies provide a basis for deeper insight for rational design of small molecule antiviral therapeutics. PMID:17386264

  6. Two orthogonal cleavages separate subunit RNAs in mouse ribosome biogenesis

    PubMed Central

    Wang, Minshi; Anikin, Leonid; Pestov, Dimitri G.

    2014-01-01

    Ribosome biogenesis is a dynamic multistep process, many features of which are still incompletely documented. Here, we show that changes in this pathway can be captured and annotated by means of a graphic set of pre-rRNA ratios, a technique we call Ratio Analysis of Multiple Precursors (RAMP). We find that knocking down a ribosome synthesis factor produces a characteristic RAMP profile that exhibits consistency across a range of depletion levels. This facilitates the inference of affected steps and simplifies comparative analysis. We applied RAMP to examine how endonucleolytic cleavages of the mouse pre-rRNA transcript in the internal transcribed spacer 1 (ITS1) are affected by depletion of factors required for maturation of the small ribosomal subunit (Rcl1, Fcf1/Utp24, Utp23) and the large subunit (Pes1, Nog1). The data suggest that completion of early maturation in a subunit triggers its release from the common pre-rRNA transcript by stimulating cleavage at the proximal site in ITS1. We also find that splitting of pre-rRNA in the 3′ region of ITS1 is prevalent in adult mouse tissues and quiescent cells, as it is in human cells. We propose a model for subunit separation during mammalian ribosome synthesis and discuss its implications for understanding pre-rRNA processing pathways. PMID:25190460

  7. Synthesis of ribosomes in Saccharomyces cerevisiae.

    PubMed Central

    Warner, J R

    1989-01-01

    The assembly of a eucaryotic ribosome requires the synthesis of four ribosomal ribonucleic acid (RNA) molecules and more than 75 ribosomal proteins. It utilizes all three RNA polymerases; it requires the cooperation of the nucleus and the cytoplasm, the processing of RNA, and the specific interaction of RNA and protein molecules. It is carried out efficiently and is exquisitely sensitive to the needs of the cell. Our current understanding of this process in the genetically tractable yeast Saccharomyces cerevisiae is reviewed. The ribosomal RNA genes are arranged in a tandem array of 100 to 200 copies. This tandem array has led to unique ways of carrying out a number of functions. Replication is asymmetric and does not initiate from every autonomously replicating sequence. Recombination is suppressed. Transcription of the major ribosomal RNA appears to involve coupling between adjacent transcription units, which are separated by the 5S RNA transcription unit. Genes for many ribosomal proteins have been cloned and sequenced. Few are linked; most are duplicated; most have an intron. There is extensive homology between yeast ribosomal proteins and those of other species. Most, but not all, of the ribosomal protein genes have one or two sites that are essential for their transcription and that bind a common transcription factor. This factor binds also to many other places in the genome, including the telomeres. There is coordinated transcription of the ribosomal protein genes under a variety of conditions. However, the cell seems to possess no mechanism for regulating the transcription of individual ribosomal protein genes in response either to a deficiency or an excess of a particular ribosomal protein. A deficiency causes slow growth. Any excess ribosomal protein is degraded very rapidly, with a half-life of 1 to 5 min. Unlike most types of cells, yeast cells appear not to regulate the translation of ribosomal proteins. However, in the case of ribosomal protein L32

  8. Control of ribosome formation in rat heart

    SciTech Connect

    Russo, L.A.

    1987-01-01

    Diabetes of 9 days duration produced a 17% diminution in the rate of total protein synthesis in rat hearts perfused as Langendorff preparations supplied with glucose, plasma levels of amino acids, and 400 ..mu..U/ml insulin. This reduction was attributable to a decrease in efficiency of protein synthesis and total RNA content. Total messenger RNA content decreased in diabetic hearts in proportion to the reduction in total RNA. Diabetes also resulted in diminished ribosome content as reflected by the induction in total RNA. Ribosome production was investigated by monitoring incorporation of (/sup 3/H)phenylalanine into the proteins of cytoplasmic ribosomes. Rates of ribosome formation in diabetic hearts were as fast as control rates in the presence of insulin, and were faster than control rates in the absence of the hormone. These results indicated that ribosome content fell in diabetic hearts despite unchanged or faster rates of ribosome formation.

  9. Multiperspective smFRET reveals rate-determining late intermediates of ribosomal translocation.

    PubMed

    Wasserman, Michael R; Alejo, Jose L; Altman, Roger B; Blanchard, Scott C

    2016-04-01

    Directional translocation of the ribosome through the mRNA open reading frame is a critical determinant of translational fidelity. This process entails a complex interplay of large-scale conformational changes within the actively translating particle, which together coordinate the movement of tRNA and mRNA substrates with respect to the large and small ribosomal subunits. Using pre-steady state, single-molecule fluorescence resonance energy transfer imaging, we tracked the nature and timing of these conformational events within the Escherichia coli ribosome from five structural perspectives. Our investigations revealed direct evidence of structurally and kinetically distinct late intermediates during substrate movement, whose resolution determines the rate of translocation. These steps involve intramolecular events within the EF-G-GDP-bound ribosome, including exaggerated, reversible fluctuations of the small-subunit head domain, which ultimately facilitate peptidyl-tRNA's movement into its final post-translocation position. PMID:26926435

  10. Quantitative studies of mRNA recruitment to the eukaryotic ribosome.

    PubMed

    Fraser, Christopher S

    2015-07-01

    The process of peptide bond synthesis by ribosomes is conserved between species, but the initiation step differs greatly between the three kingdoms of life. This is illustrated by the evolution of roughly an order of magnitude more initiation factor mass found in humans compared with bacteria. Eukaryotic initiation of translation is comprised of a number of sub-steps: (i) recruitment of an mRNA and initiator methionyl-tRNA to the 40S ribosomal subunit; (ii) migration of the 40S subunit along the 5' UTR to locate the initiation codon; and (iii) recruitment of the 60S subunit to form the 80S initiation complex. Although the mechanism and regulation of initiation has been studied for decades, many aspects of the pathway remain unclear. In this review, I will focus discussion on what is known about the mechanism of mRNA selection and its recruitment to the 40S subunit. I will summarize how the 43S preinitiation complex (PIC) is formed and stabilized by interactions between its components. I will discuss what is known about the mechanism of mRNA selection by the eukaryotic initiation factor 4F (eIF4F) complex and how the selected mRNA is recruited to the 43S PIC. The regulation of this process by secondary structure located in the 5' UTR of an mRNA will also be discussed. Finally, I present a possible kinetic model with which to explain the process of mRNA selection and recruitment to the eukaryotic ribosome. PMID:25742741

  11. Initiation of Translation by Cricket Paralysis Virus IRES Requires Its Translocation in the Ribosome

    PubMed Central

    Fernández, Israel S.; Bai, Xiao-Chen; Murshudov, Garib; Scheres, Sjors H.W.; Ramakrishnan, V.

    2014-01-01

    Summary The cricket paralysis virus internal ribosome entry site (CrPV-IRES) is a folded structure in a viral mRNA that allows initiation of translation in the absence of any host initiation factors. By using recent advances in single-particle electron cryomicroscopy, we have solved the structure of CrPV-IRES bound to the ribosome of the yeast Kluyveromyces lactis in both the canonical and rotated states at overall resolutions of 3.7 and 3.8 Å, respectively. In both states, the pseudoknot PKI of the CrPV-IRES mimics a tRNA/mRNA interaction in the decoding center of the A site of the 40S ribosomal subunit. The structure and accompanying factor-binding data show that CrPV-IRES binding mimics a pretranslocation rather than initiation state of the ribosome. Translocation of the IRES by elongation factor 2 (eEF2) is required to bring the first codon of the mRNA into the A site and to allow the start of translation. PMID:24792965

  12. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    PubMed

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation. PMID:26801560

  13. Ribosome Mechanics Informs about Mechanism.

    PubMed

    Zimmermann, Michael T; Jia, Kejue; Jernigan, Robert L

    2016-02-27

    The essential aspects of the ribosome's mechanism can be extracted from coarse-grained simulations, including the ratchet motion, the movement together of critical bases at the decoding center, and movements of the peptide tunnel lining that assist in the expulsion of the synthesized peptide. Because of its large size, coarse graining helps to simplify and to aid in the understanding of its mechanism. Results presented here utilize coarse-grained elastic network modeling to extract the dynamics, and both RNAs and proteins are coarse grained. We review our previous results, showing the well-known ratchet motions and the motions in the peptide tunnel and in the mRNA tunnel. The motions of the lining of the peptide tunnel appear to assist in the expulsion of the growing peptide chain, and clamps at the ends of the mRNA tunnel with three proteins ensure that the mRNA is held tightly during decoding and essential for the helicase activity at the entrance. The entry clamp may also assist in base recognition to ensure proper selection of the incoming tRNA. The overall precision of the ribosome machine-like motions is remarkable. PMID:26687034

  14. Mitomycin C Inhibits Ribosomal RNA

    PubMed Central

    Snodgrass, Ryan G.; Collier, Abby C.; Coon, Amy E.; Pritsos, Chris A.

    2010-01-01

    Mitomycin C (MMC) is a commonly used and extensively studied chemotherapeutic agent requiring biological reduction for activity. Damage to nuclear DNA is thought to be its primary mechanism of cell death. Due to a lack of evidence for significant MMC activation in the nucleus and for in vivo studies demonstrating the formation of MMC-DNA adducts, we chose to investigate alternative nucleic acid targets. Real-time reverse transcription-PCR was used to determine changes in mitochondrial gene expression induced by MMC treatment. Although no consistent effects on mitochondrial mRNA expression were observed, complementary results from reverse transcription-PCR experiments and gel-shift and binding assays demonstrated that MMC rapidly decreased the transcript levels of 18S ribosomal RNA in a concentration-dependent manner. Under hypoxic conditions, transcript levels of 18S rRNA decreased by 1.5-fold compared with untreated controls within 30 min. Recovery to base line required several hours, indicating that de novo synthesis of 18S was necessary. Addition of MMC to an in vitro translation reaction significantly decreased protein production in the cell-free system. Functional assays performed using a luciferase reporter construct in vivo determined that protein translation was inhibited, further confirming this mechanism of toxicity. The interaction of MMC with ribosomal RNA and subsequent inhibition of protein translation is consistent with mechanisms proposed for other natural compounds. PMID:20418373

  15. E. coli metabolic protein aldehyde-alcohol dehydrogenase-E binds to the ribosome: a unique moonlighting action revealed.

    PubMed

    Shasmal, Manidip; Dey, Sandip; Shaikh, Tanvir R; Bhakta, Sayan; Sengupta, Jayati

    2016-01-01

    It is becoming increasingly evident that a high degree of regulation is involved in the protein synthesis machinery entailing more interacting regulatory factors. A multitude of proteins have been identified recently which show regulatory function upon binding to the ribosome. Here, we identify tight association of a metabolic protein aldehyde-alcohol dehydrogenase E (AdhE) with the E. coli 70S ribosome isolated from cell extract under low salt wash conditions. Cryo-EM reconstruction of the ribosome sample allows us to localize its position on the head of the small subunit, near the mRNA entrance. Our study demonstrates substantial RNA unwinding activity of AdhE which can account for the ability of ribosome to translate through downstream of at least certain mRNA helices. Thus far, in E. coli, no ribosome-associated factor has been identified that shows downstream mRNA helicase activity. Additionally, the cryo-EM map reveals interaction of another extracellular protein, outer membrane protein C (OmpC), with the ribosome at the peripheral solvent side of the 50S subunit. Our result also provides important insight into plausible functional role of OmpC upon ribosome binding. Visualization of the ribosome purified directly from the cell lysate unveils for the first time interactions of additional regulatory proteins with the ribosome. PMID:26822933

  16. E. coli metabolic protein aldehyde-alcohol dehydrogenase-E binds to the ribosome: a unique moonlighting action revealed

    PubMed Central

    Shasmal, Manidip; Dey, Sandip; Shaikh, Tanvir R.; Bhakta, Sayan; Sengupta, Jayati

    2016-01-01

    It is becoming increasingly evident that a high degree of regulation is involved in the protein synthesis machinery entailing more interacting regulatory factors. A multitude of proteins have been identified recently which show regulatory function upon binding to the ribosome. Here, we identify tight association of a metabolic protein aldehyde-alcohol dehydrogenase E (AdhE) with the E. coli 70S ribosome isolated from cell extract under low salt wash conditions. Cryo-EM reconstruction of the ribosome sample allows us to localize its position on the head of the small subunit, near the mRNA entrance. Our study demonstrates substantial RNA unwinding activity of AdhE which can account for the ability of ribosome to translate through downstream of at least certain mRNA helices. Thus far, in E. coli, no ribosome-associated factor has been identified that shows downstream mRNA helicase activity. Additionally, the cryo-EM map reveals interaction of another extracellular protein, outer membrane protein C (OmpC), with the ribosome at the peripheral solvent side of the 50S subunit. Our result also provides important insight into plausible functional role of OmpC upon ribosome binding. Visualization of the ribosome purified directly from the cell lysate unveils for the first time interactions of additional regulatory proteins with the ribosome. PMID:26822933

  17. UtpA and UtpB chaperone nascent pre-ribosomal RNA and U3 snoRNA to initiate eukaryotic ribosome assembly

    PubMed Central

    Hunziker, Mirjam; Barandun, Jonas; Petfalski, Elisabeth; Tan, Dongyan; Delan-Forino, Clémentine; Molloy, Kelly R.; Kim, Kelly H.; Dunn-Davies, Hywel; Shi, Yi; Chaker-Margot, Malik; Chait, Brian T.; Walz, Thomas; Tollervey, David; Klinge, Sebastian

    2016-01-01

    Early eukaryotic ribosome biogenesis involves large multi-protein complexes, which co-transcriptionally associate with pre-ribosomal RNA to form the small subunit processome. The precise mechanisms by which two of the largest multi-protein complexes—UtpA and UtpB—interact with nascent pre-ribosomal RNA are poorly understood. Here, we combined biochemical and structural biology approaches with ensembles of RNA–protein cross-linking data to elucidate the essential functions of both complexes. We show that UtpA contains a large composite RNA-binding site and captures the 5′ end of pre-ribosomal RNA. UtpB forms an extended structure that binds early pre-ribosomal intermediates in close proximity to architectural sites such as an RNA duplex formed by the 5′ ETS and U3 snoRNA as well as the 3′ boundary of the 18S rRNA. Both complexes therefore act as vital RNA chaperones to initiate eukaryotic ribosome assembly. PMID:27354316

  18. UtpA and UtpB chaperone nascent pre-ribosomal RNA and U3 snoRNA to initiate eukaryotic ribosome assembly

    NASA Astrophysics Data System (ADS)

    Hunziker, Mirjam; Barandun, Jonas; Petfalski, Elisabeth; Tan, Dongyan; Delan-Forino, Clémentine; Molloy, Kelly R.; Kim, Kelly H.; Dunn-Davies, Hywel; Shi, Yi; Chaker-Margot, Malik; Chait, Brian T.; Walz, Thomas; Tollervey, David; Klinge, Sebastian

    2016-06-01

    Early eukaryotic ribosome biogenesis involves large multi-protein complexes, which co-transcriptionally associate with pre-ribosomal RNA to form the small subunit processome. The precise mechanisms by which two of the largest multi-protein complexes--UtpA and UtpB--interact with nascent pre-ribosomal RNA are poorly understood. Here, we combined biochemical and structural biology approaches with ensembles of RNA-protein cross-linking data to elucidate the essential functions of both complexes. We show that UtpA contains a large composite RNA-binding site and captures the 5' end of pre-ribosomal RNA. UtpB forms an extended structure that binds early pre-ribosomal intermediates in close proximity to architectural sites such as an RNA duplex formed by the 5' ETS and U3 snoRNA as well as the 3' boundary of the 18S rRNA. Both complexes therefore act as vital RNA chaperones to initiate eukaryotic ribosome assembly.

  19. Biochemical characterization of three mycobacterial ribosomal fractions.

    PubMed

    Portelance, V; Beaudet, R

    1983-02-01

    The induction of antituberculous immunity by crude ribosomal fractions isolated from Mycobacterium tuberculosis strain H37Ra, M. bovis strain BCG, and M. smegmatis was studied in CF-1 mice. Levels of antituberculous immunity similar to that induced by live BCG were induced by the BCG and H37Ra ribosomal fractions whereas that isolated from M. smegmatis was found to be inactive. Electrophoresis of the three ribosomal fractions in sodium dodecyl sulfate - polyacylamide gels followed by differential staining showed the two active ribosomal fractions to be similar in their proteins, carbohydrate-containing substances, and lipid profiles. The inactive smegmatis ribosomal fraction differed mainly from the active ones on the basis of its carbohydrate-containing substances profile and by the absence of lipids. The polysaccharides and the ribosomes present in the H37Ra ribosomal fractions were purified by affinity chromatography on concanavalin A - Sepharose 4B. Each purified preparation showed no or only low antituberculous activity when injected separately, but when mixed together a high protection was observed. The formation of complexes between the ribosomes and the polysaccharide fraction was suggested and appears to be necessary for the induction of antituberculous immunity. PMID:6189570

  20. Ribosome flow model with positive feedback

    PubMed Central

    Margaliot, Michael; Tuller, Tamir

    2013-01-01

    Eukaryotic mRNAs usually form a circular structure; thus, ribosomes that terminatae translation at the 3′ end can diffuse with increased probability to the 5′ end of the transcript, initiating another cycle of translation. This phenomenon describes ribosomal flow with positive feedback—an increase in the flow of ribosomes terminating translating the open reading frame increases the ribosomal initiation rate. The aim of this paper is to model and rigorously analyse translation with feedback. We suggest a modified version of the ribosome flow model, called the ribosome flow model with input and output. In this model, the input is the initiation rate and the output is the translation rate. We analyse this model after closing the loop with a positive linear feedback. We show that the closed-loop system admits a unique globally asymptotically stable equilibrium point. From a biophysical point of view, this means that there exists a unique steady state of ribosome distributions along the mRNA, and thus a unique steady-state translation rate. The solution from any initial distribution will converge to this steady state. The steady-state distribution demonstrates a decrease in ribosome density along the coding sequence. For the case of constant elongation rates, we obtain expressions relating the model parameters to the equilibrium point. These results may perhaps be used to re-engineer the biological system in order to obtain a desired translation rate. PMID:23720534

  1. Complementary roles of initiation factor 1 and ribosome recycling factor in 70S ribosome splitting

    PubMed Central

    Pavlov, Michael Y; Antoun, Ayman; Lovmar, Martin; Ehrenberg, Måns

    2008-01-01

    We demonstrate that ribosomes containing a messenger RNA (mRNA) with a strong Shine–Dalgarno sequence are rapidly split into subunits by initiation factors 1 (IF1) and 3 (IF3), but slowly split by ribosome recycling factor (RRF) and elongation factor G (EF-G). Post-termination-like (PTL) ribosomes containing mRNA and a P-site-bound deacylated transfer RNA (tRNA) are split very rapidly by RRF and EF-G, but extremely slowly by IF1 and IF3. Vacant ribosomes are split by RRF/EF-G much more slowly than PTL ribosomes and by IF1/IF3 much more slowly than mRNA-containing ribosomes. These observations reveal complementary splitting of different ribosomal complexes by IF1/IF3 and RRF/EF-G, and suggest the existence of two major pathways for ribosome splitting into subunits in the living cell. We show that the identity of the deacylated tRNA in the PTL ribosome strongly affects the rate by which it is split by RRF/EF-G and that IF3 is involved in the mechanism of ribosome splitting by IF1/IF3 but not by RRF/EF-G. With support from our experimental data, we discuss the principally different mechanisms of ribosome splitting by IF1/IF3 and by RRF/EF-G. PMID:18497739

  2. A novel function for the 90 kDa heat-shock protein (Hsp90): facilitating nuclear export of 60 S ribosomal subunits.

    PubMed Central

    Schlatter, Harald; Langer, Thomas; Rosmus, Susann; Onneken, Marie-Luise; Fasold, Hugo

    2002-01-01

    Ribosomal subunits are assembled in the nucleus, and mature 40 S and 60 S subunits are exported stoichiometrically into the cytoplasm. The nuclear export of ribosomal subunits is a unidirectional, saturable and energy-dependent process. An in vitro assay for the nuclear export of 60 S ribosomal subunits involves the use of resealed nuclear envelopes. The export of ribosomal subunits from resealed nuclear envelopes is enhanced by cytoplasmic proteins. Here we present evidence that the export-promoting activity was due to the cytoplasmic 90 kDa heat-shock protein (Hsp90). Isolated, purified Hsp90 vastly enhanced the export of 60 S ribosomal subunits from resealed nuclear envelopes, while inhibition of Hsp90 function, either with the Hsp90-binding drug geldanamycin or with anti-Hsp90 antibodies, resulted in reduced release of 60 S ribosomal subunits. To confirm these findings under in vivo conditions, corresponding experiments were performed with Xenopus oocytes using microinjection techniques; the results obtained confirmed the findings obtained with resealed nuclear envelopes. These findings suggest that Hsp90 facilitates the nuclear export of 60 S ribosomal subunits, probably by chaperoning protein interactions during the export process. PMID:11879195

  3. The kissing-loop T-shaped structure translational enhancer of Pea enation mosaic virus can bind simultaneously to ribosomes and a 5' proximal hairpin.

    PubMed

    Gao, Feng; Gulay, Suna P; Kasprzak, Wojciech; Dinman, Jonathan D; Shapiro, Bruce A; Simon, Anne E

    2013-11-01

    The Pea enation mosaic virus (PEMV) 3' translational enhancer, known as the kissing-loop T-shaped structure (kl-TSS), binds to 40S subunits, 60S subunits, and 80S ribosomes, whereas the Turnip crinkle virus (TCV) TSS binds only to 60S subunits and 80S ribosomes. Using electrophoretic mobility gel shift assay (EMSA)-based competition assays, the kl-TSS was found to occupy a different site in the ribosome than the P-site-binding TCV TSS, suggesting that these two TSS employ different mechanisms for enhancing translation. The kl-TSS also engages in a stable, long-distance RNA-RNA kissing-loop interaction with a 12-bp 5'-coding-region hairpin that does not alter the structure of the kl-TSS as revealed by molecular dynamics simulations. Addition of the kl-TSS in trans to a luciferase reporter construct containing either wild-type or mutant 5' and 3' PEMV sequences suppressed translation, suggesting that the kl-TSS is required in cis to function, and both ribosome-binding and RNA interaction activities of the kl-TSS contributed to translational inhibition. Addition of the kl-TSS was more detrimental for translation than an adjacent eIF4E-binding 3' translational enhancer known as the PTE, suggesting that the PTE may support the ribosome-binding function of the kl-TSS. Results of in-line RNA structure probing, ribosome filter binding, and high-throughput selective 2'-hydroxyl acylation analyzed by primer extension (hSHAPE) of rRNAs within bound ribosomes suggest that kl-TSS binding to ribosomes and binding to the 5' hairpin are compatible activities. These results suggest a model whereby posttermination ribosomes/ribosomal subunits bind to the kl-TSS and are delivered to the 5' end of the genome via the associated RNA-RNA interaction, which enhances the rate of translation reinitiation. PMID:23986599

  4. Viral IRES RNA structures and ribosome interactions.

    PubMed

    Kieft, Jeffrey S

    2008-06-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide 'cap' on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES-ribosome complexes are revealing the structural basis of viral IRES' 'hijacking' of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  5. Differential Stoichiometry among Core Ribosomal Proteins

    PubMed Central

    Slavov, Nikolai; Semrau, Stefan; Airoldi, Edoardo; Budnik, Bogdan; van Oudenaarden, Alexander

    2015-01-01

    Summary Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs), some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC) and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function. PMID:26565899

  6. Ribosome defects in disorders of erythropoiesis.

    PubMed

    Narla, Anupama; Hurst, Slater N; Ebert, Benjamin L

    2011-02-01

    Over the past decade, genetic lesions that cause ribosome dysfunction have been identified in both congenital and acquired human disorders. These discoveries have established a new category of disorders, known as ribosomopathies, in which the primary pathophysiology is related to impaired ribosome function. The protoptypical disorders are Diamond-Blackfan anemia, a congenital bone marrow failure syndrome, and the 5q- syndrome, a subtype of myelodysplastic syndrome. In both of these disorders, impaired ribosome function causes a severe macrocytic anemia. In this review, we will discuss the evidence that defects in ribosomal biogenesis cause the hematologic phenotype of Diamond-Blackfan anemia and the 5q- syndrome. We will also explore the potential mechanisms by which a ribosomal defect, which would be expected to have widespread consequences, may lead to specific defects in erythropoiesis. PMID:21279816

  7. Viral IRES RNA structures and ribosome interactions

    PubMed Central

    Kieft, Jeffrey S.

    2009-01-01

    In eukaryotes, protein synthesis initiates primarily by a mechanism that requires a modified nucleotide ‘cap’ on the mRNA and also proteins that recruit and position the ribosome. Many pathogenic viruses use an alternative, cap-independent mechanism that substitutes RNA structure for the cap and many proteins. The RNAs driving this process are called internal ribosome-entry sites (IRESs) and some are able to bind the ribosome directly using a specific 3D RNA structure. Recent structures of IRES RNAs and IRES–ribosome complexes are revealing the structural basis of viral IRES’ ‘hijacking’ of the protein-making machinery. It now seems that there are fundamental differences in the 3D structures used by different IRESs, although there are some common features in how they interact with ribosomes. PMID:18468443

  8. Interaction of Chloramphenicol Tripeptide Analogs with Ribosomes.

    PubMed

    Tereshchenkov, A G; Shishkina, A V; Tashlitsky, V N; Korshunova, G A; Bogdanov, A A; Sumbatyan, N V

    2016-04-01

    Chloramphenicol amine peptide derivatives containing tripeptide fragments of regulatory "stop peptides" - MRL, IRA, IWP - were synthesized. The ability of the compounds to form ribosomal complexes was studied by displacement of the fluorescent erythromycin analog from its complex with E. coli ribosomes. It was found that peptide chloramphenicol analogs are able to bind to bacterial ribosomes. The dissociation constants were 4.3-10 µM, which is 100-fold lower than the corresponding values for chloramphenicol amine-ribosome complex. Interaction of the chloramphenicol peptide analogs with ribosomes was simulated by molecular docking, and the most probable contacts of "stop peptide" motifs with the elements of nascent peptide exit tunnel were identified. PMID:27293096

  9. Differential Stoichiometry among Core Ribosomal Proteins.

    PubMed

    Slavov, Nikolai; Semrau, Stefan; Airoldi, Edoardo; Budnik, Bogdan; van Oudenaarden, Alexander

    2015-11-01

    Understanding the regulation and structure of ribosomes is essential to understanding protein synthesis and its dysregulation in disease. While ribosomes are believed to have a fixed stoichiometry among their core ribosomal proteins (RPs), some experiments suggest a more variable composition. Testing such variability requires direct and precise quantification of RPs. We used mass spectrometry to directly quantify RPs across monosomes and polysomes of mouse embryonic stem cells (ESC) and budding yeast. Our data show that the stoichiometry among core RPs in wild-type yeast cells and ESC depends both on the growth conditions and on the number of ribosomes bound per mRNA. Furthermore, we find that the fitness of cells with a deleted RP-gene is inversely proportional to the enrichment of the corresponding RP in polysomes. Together, our findings support the existence of ribosomes with distinct protein composition and physiological function. PMID:26565899

  10. Molecular basis for the ribosome functioning as an L-tryptophan sensor.

    PubMed

    Bischoff, Lukas; Berninghausen, Otto; Beckmann, Roland

    2014-10-23

    Elevated levels of the free amino acid L-tryptophan (L-Trp) trigger expression of the tryptophanase tnaCAB operon in E. coli. Activation depends on tryptophan-dependent ribosomal stalling during translation of the upstream TnaC peptide. Here, we present a cryoelectron microscopy (cryo-EM) reconstruction at 3.8 Å resolution of a ribosome stalled by the TnaC peptide. Unexpectedly, we observe two L-Trp molecules in the ribosomal exit tunnel coordinated within composite hydrophobic pockets formed by the nascent TnaC peptide and the tunnel wall. As a result, the peptidyl transferase center (PTC) adopts a distinct conformation that precludes productive accommodation of release factor 2 (RF2), thereby inducing translational stalling. Collectively, our results demonstrate how the translating ribosome can act as a small molecule sensor for gene regulation. PMID:25310980

  11. Characterization of GE82832, a peptide inhibitor of translocation interacting with bacterial 30S ribosomal subunits

    PubMed Central

    Brandi, Letizia; Fabbretti, Attilio; Stefano, Michele Di; Lazzarini, Ameriga; Abbondi, Monica; Gualerzi, Claudio O.

    2006-01-01

    GE82832, a secondary metabolite produced by Streptosporangium cinnabarinum (strain GE82832), has been identified as a translational inhibitor by in vitro screening of a library of natural products. Secondary functional tests specific for individual steps of the translational pathway demonstrated that translocation is the specific target of GE82832. Chemical probing in situ demonstrated that this antibiotic protects bases A1324 and A1333 and exposes C1336 of 16S rRNA, thereby indicating that its binding site is located on the head of the 30S ribosomal subunit. The ribosomal location of GE82832, near ribosomal protein S13 and G1338, two elements of the small subunit that are part of or close to the B1a intrasubunit bridge, suggests that translocation inhibition results from an altered dynamics of 30S–50S ribosomal subunit interaction. PMID:16699167

  12. Choreography of molecular movements during ribosome progression along mRNA.

    PubMed

    Belardinelli, Riccardo; Sharma, Heena; Caliskan, Neva; Cunha, Carlos E; Peske, Frank; Wintermeyer, Wolfgang; Rodnina, Marina V

    2016-04-01

    During translation elongation, ribosome translocation along an mRNA entails rotations of the ribosomal subunits, swiveling motions of the small subunit (SSU) head and stepwise movements of the tRNAs together with the mRNA. Here, we reconstructed the choreography of the collective motions of the Escherichia coli ribosome during translocation promoted by elongation factor EF-G, by recording the fluorescence signatures of nine different reporters placed on both ribosomal subunits, tRNA and mRNA. We captured an early forward swiveling of the SSU head taking place while the SSU body rotates in the opposite, clockwise direction. Backward swiveling of the SSU head starts upon tRNA translocation and continues until the post-translocation state is reached. This work places structures of translocation intermediates along a time axis and unravels principles of the motions of macromolecular machines. PMID:26999556

  13. MPV17L2 is required for ribosome assembly in mitochondria

    PubMed Central

    Dalla Rosa, Ilaria; Durigon, Romina; Pearce, Sarah F.; Rorbach, Joanna; Hirst, Elizabeth M.A.; Vidoni, Sara; Reyes, Aurelio; Brea-Calvo, Gloria; Minczuk, Michal; Woellhaf, Michael W.; Herrmann, Johannes M.; Huynen, Martijn A.; Holt, Ian J.; Spinazzola, Antonella

    2014-01-01

    MPV17 is a mitochondrial protein of unknown function, and mutations in MPV17 are associated with mitochondrial deoxyribonucleic acid (DNA) maintenance disorders. Here we investigated its most similar relative, MPV17L2, which is also annotated as a mitochondrial protein. Mitochondrial fractionation analyses demonstrate MPV17L2 is an integral inner membrane protein, like MPV17. However, unlike MPV17, MPV17L2 is dependent on mitochondrial DNA, as it is absent from ρ0 cells, and co-sediments on sucrose gradients with the large subunit of the mitochondrial ribosome and the monosome. Gene silencing of MPV17L2 results in marked decreases in the monosome and both subunits of the mitochondrial ribosome, leading to impaired protein synthesis in the mitochondria. Depletion of MPV17L2 also induces mitochondrial DNA aggregation. The DNA and ribosome phenotypes are linked, as in the absence of MPV17L2 proteins of the small subunit of the mitochondrial ribosome are trapped in the enlarged nucleoids, in contrast to a component of the large subunit. These findings suggest MPV17L2 contributes to the biogenesis of the mitochondrial ribosome, uniting the two subunits to create the translationally competent monosome, and provide evidence that assembly of the small subunit of the mitochondrial ribosome occurs at the nucleoid. PMID:24948607

  14. Canonical Initiation Factor Requirements of the Myc Family of Internal Ribosome Entry Segments▿ †

    PubMed Central

    Spriggs, Keith A.; Cobbold, Laura C.; Jopling, Catherine L.; Cooper, Rebecca E.; Wilson, Lindsay A.; Stoneley, Mark; Coldwell, Mark J.; Poncet, Didier; Shen, Ya-Ching; Morley, Simon J.; Bushell, Martin; Willis, Anne E.

    2009-01-01

    Initiation of protein synthesis in eukaryotes requires recruitment of the ribosome to the mRNA and its translocation to the start codon. There are at least two distinct mechanisms by which this process can be achieved; the ribosome can be recruited either to the cap structure at the 5′ end of the message or to an internal ribosome entry segment (IRES), a complex RNA structural element located in the 5′ untranslated region (5′-UTR) of the mRNA. However, it is not well understood how cellular IRESs function to recruit the ribosome or how the 40S ribosomal subunits translocate from the initial recruitment site on the mRNA to the AUG initiation codon. We have investigated the canonical factors that are required by the IRESs found in the 5′-UTRs of c-, L-, and N-myc, using specific inhibitors and a tissue culture-based assay system, and have shown that they differ considerably in their requirements. The L-myc IRES requires the eIF4F complex and the association of PABP and eIF3 with eIF4G for activity. The minimum requirements of the N- and c-myc IRESs are the C-terminal domain of eIF4G to which eIF4A is bound and eIF3, although interestingly this protein does not appear to be recruited to the IRES RNA via eIF4G. Finally, our data show that all three IRESs require a ternary complex, although in contrast to c- and L-myc IRESs, the N-myc IRES has a lesser requirement for a ternary complex. PMID:19124605

  15. Ribosomopathies: human disorders of ribosome dysfunction.

    PubMed

    Narla, Anupama; Ebert, Benjamin L

    2010-04-22

    Ribosomopathies compose a collection of disorders in which genetic abnormalities cause impaired ribosome biogenesis and function, resulting in specific clinical phenotypes. Congenital mutations in RPS19 and other genes encoding ribosomal proteins cause Diamond-Blackfan anemia, a disorder characterized by hypoplastic, macrocytic anemia. Mutations in other genes required for normal ribosome biogenesis have been implicated in other rare congenital syndromes, Schwachman-Diamond syndrome, dyskeratosis congenita, cartilage hair hypoplasia, and Treacher Collins syndrome. In addition, the 5q- syndrome, a subtype of myelodysplastic syndrome, is caused by a somatically acquired deletion of chromosome 5q, which leads to haploinsufficiency of the ribosomal protein RPS14 and an erythroid phenotype highly similar to Diamond-Blackfan anemia. Acquired abnormalities in ribosome function have been implicated more broadly in human malignancies. The p53 pathway provides a surveillance mechanism for protein translation as well as genome integrity and is activated by defects in ribosome biogenesis; this pathway appears to be a critical mediator of many of the clinical features of ribosomopathies. Elucidation of the mechanisms whereby selective abnormalities in ribosome biogenesis cause specific clinical syndromes will hopefully lead to novel therapeutic strategies for these diseases. PMID:20194897

  16. The Functional Role of eL19 and eB12 Intersubunit Bridge in the Eukaryotic Ribosome.

    PubMed

    Kisly, Ivan; Gulay, Suna P; Mäeorg, Uno; Dinman, Jonathan D; Remme, Jaanus; Tamm, Tiina

    2016-05-22

    During translation, the two eukaryotic ribosomal subunits remain associated through 17 intersubunit bridges, five of which are eukaryote specific. These are mainly localized to the peripheral regions and are believed to stabilize the structure of the ribosome. The functional importance of these bridges remains largely unknown. Here, the essentiality of the eukaryote-specific bridge eB12 has been investigated. The main component of this bridge is ribosomal protein eL19 that is composed of an N-terminal globular domain, a middle region, and a long C-terminal α-helix. The analysis of deletion mutants demonstrated that the globular domain and middle region of eL19 are essential for cell viability, most likely functioning in ribosome assembly. The eB12 bridge, formed by contacts between the C-terminal α-helix of eL19 and 18S rRNA in concert with additional stabilizing interactions involving either eS7 or uS17, is dispensable for viability. Nevertheless, eL19 mutants impaired in eB12 bridge formation displayed slow growth phenotypes, altered sensitivity/resistance to translational inhibitors, and enhanced hyperosmotic stress tolerance. Biochemical analyses determined that the eB12 bridge contributes to the stability of ribosome subunit interactions in vitro. 60S subunits containing eL19 variants defective in eB12 bridge formation failed to form 80S ribosomes regardless of Mg(2+) concentration. The reassociation of 40S and mutant 60S subunits was markedly improved in the presence of deacetylated tRNA, emphasizing the importance of tRNAs during the subunit association. We propose that the eB12 bridge plays an important role in subunit joining and in optimizing ribosome functionality. PMID:27038511

  17. A new system for naming ribosomal proteins

    PubMed Central

    Ban, Nenad; Beckmann, Roland; Cate, Jamie HD; Dinman, Jonathan D; Dragon, François; Ellis, Steven R; Lafontaine, Denis LJ; Lindahl, Lasse; Liljas, Anders; Lipton, Jeffrey M; McAlear, Michael A; Moore, Peter B; Noller, Harry F; Ortega, Joaquin; Panse, Vikram Govind; Ramakrishnan, V; Spahn, Christian MT; Steitz, Thomas A; Tchorzewski, Marek; Tollervey, David; Warren, Alan J; Williamson, James R; Wilson, Daniel; Yonath, Ada; Yusupov, Marat

    2015-01-01

    A system for naming ribosomal proteins is described that the authors intend to use in the future. They urge others to adopt it. The objective is to eliminate the confusion caused by the assignment of identical names to ribosomal proteins from different species that are unrelated in structure and function. In the system proposed here, homologous ribosomal proteins are assigned the same name, regardless of species. It is designed so that new names are similar enough to old names to be easily recognized, but are written in a format that unambiguously identifies them as ‘new system’ names. PMID:24524803

  18. The economics of ribosome biosynthesis in yeast.

    PubMed

    Warner, J R

    1999-11-01

    In a rapidly growing yeast cell, 60% of total transcription is devoted to ribosomal RNA, and 50% of RNA polymerase II transcription and 90% of mRNA splicing are devoted to ribosomal proteins (RPs). Coordinate regulation of the approximately 150 rRNA genes and 137 RP genes that make such prodigious use of resources is essential for the economy of the cell. This is entrusted to a number of signal transduction pathways that can abruptly induce or silence the ribosomal genes, leading to major implications for the expression of other genes as well. PMID:10542411

  19. Computational studies of molecular machines: the ribosome.

    PubMed

    Sanbonmatsu, Karissa Y

    2012-04-01

    The past decade has produced an avalanche of experimental data on the structure and dynamics of the ribosome. Groundbreaking studies in structural biology and kinetics have placed important constraints on ribosome structural dynamics. However, a gulf remains between static structures and time dependent data. In particular, X-ray crystallography and cryo-EM studies produce static models of the ribosome in various states, but lack dynamic information. Single molecule studies produce information on the rates of transitions between these states but do not have high-resolution spatial information. Computational studies have aided in bridging this gap by providing atomic resolution simulations of structural fluctuations and transitions between configurations. PMID:22336622

  20. Computational studies of molecular machines: the ribosome

    PubMed Central

    Sanbonmatsu, Karissa Y.

    2013-01-01

    The past decade has produced an avalanche of experimental data on the structure and dynamics of the ribosome. Groundbreaking studies in structural biology and kinetics have placed important constraints on ribosome structural dynamics. However, a gulf remains between static structures and time dependent data. In particular, x-ray crystallography and cryo-EM studies produce static models of the ribosome in various states, but lack dynamic information. Single molecule studies produce information on the rates of transitions between these states but do not have high-resolution spatial information. Computational studies have aided in bridging this gap by providing atomic resolution simulations of structural fluctuations and transitions between configurations. PMID:22336622

  1. Cisplatin Targeting of Bacterial Ribosomal RNA Hairpins

    PubMed Central

    Dedduwa-Mudalige, Gayani N. P.; Chow, Christine S.

    2015-01-01

    Cisplatin is a clinically important chemotherapeutic agent known to target purine bases in nucleic acids. In addition to major deoxyribonucleic acid (DNA) intrastrand cross-links, cisplatin also forms stable adducts with many types of ribonucleic acid (RNA) including siRNA, spliceosomal RNAs, tRNA, and rRNA. All of these RNAs play vital roles in the cell, such as catalysis of protein synthesis by rRNA, and therefore serve as potential drug targets. This work focused on platination of two highly conserved RNA hairpins from E. coli ribosomes, namely pseudouridine-modified helix 69 from 23S rRNA and the 790 loop of helix 24 from 16S rRNA. RNase T1 probing, MALDI mass spectrometry, and dimethyl sulfate mapping revealed platination at GpG sites. Chemical probing results also showed platination-induced RNA structural changes. These findings reveal solvent and structural accessibility of sites within bacterial RNA secondary structures that are functionally significant and therefore viable targets for cisplatin as well as other classes of small molecules. Identifying target preferences at the nucleotide level, as well as determining cisplatin-induced RNA conformational changes, is important for the design of more potent drug molecules. Furthermore, the knowledge gained through studies of RNA-targeting by cisplatin is applicable to a broad range of organisms from bacteria to human. PMID:26370969

  2. A new version of the RDP (Ribosomal Database Project)

    NASA Technical Reports Server (NTRS)

    Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.; Pramanik, S.; Schmidt, T. M.; Tiedje, J. M.; Woese, C. R.

    1999-01-01

    The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [ Nucleic Acids Res. (1997), 25, 109-111], is now hosted by the Center for Microbial Ecology at Michigan State University. RDP-II is a curated database that offers ribosomal RNA (rRNA) nucleotide sequence data in aligned and unaligned forms, analysis services, and associated computer programs. During the past two years, data alignments have been updated and now include >9700 small subunit rRNA sequences. The recent development of an ObjectStore database will provide more rapid updating of data, better data accuracy and increased user access. RDP-II includes phylogenetically ordered alignments of rRNA sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software programs for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (ftp.cme.msu. edu) and WWW (http://www.cme.msu.edu/RDP). The WWW server provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree. Additional utilities also exist at RDP-II, including distance matrix, T-RFLP, and a Java-based viewer of the phylogenetic trees that can be used to create subtrees.

  3. Introns regulate the production of ribosomal proteins by modulating splicing of duplicated ribosomal protein genes.

    PubMed

    Petibon, Cyrielle; Parenteau, Julie; Catala, Mathieu; Elela, Sherif Abou

    2016-05-01

    Most budding yeast introns exist in the many duplicated ribosomal protein genes (RPGs) and it has been posited that they remain there to modulate the expression of RPGs and cell growth in response to stress. However, the mechanism by which introns regulate the expression of RPGs and their impact on the synthesis of ribosomal proteins remain unclear. In this study, we show that introns determine the ratio of ribosomal protein isoforms through asymmetric paralog-specific regulation of splicing. Exchanging the introns and 3' untranslated regions of the duplicated RPS9 genes altered the splicing efficiency and changed the ratio of the ribosomal protein isoforms. Mutational analysis of the RPS9 genes indicated that splicing is regulated by variations in the intron structure and the 3' untranslated region. Together these data suggest that preferential splicing of duplicated RPGs provides a means for adjusting the ratio of different ribosomal protein isoforms, while maintaining the overall expression level of each ribosomal protein. PMID:26945043

  4. Effects of induction of rRNA overproduction on ribosomal protein synthesis and ribosome subunit assembly in Escherichia coli.

    PubMed Central

    Yamagishi, M; Nomura, M

    1988-01-01

    Overproduction of rRNA was artificially induced in Escherichia coli cells to test whether the synthesis of ribosomal protein (r-protein) is normally repressed by feedback regulation. When rRNA was overproduced more than twofold from a hybrid plasmid carrying the rrnB operon fused to the lambda pL promoter (pL-rrnB), synthesis of individual r-proteins increased by an average of about 60%. This demonstrates that the synthesis of r-proteins is repressed under normal conditions. The increase of r-protein production, however, for unknown reasons, was not as great as the increase in rRNA synthesis and resulted in an imbalance between the amounts of rRNA and r-protein synthesis. Therefore, only a small (less than 20%) increase in the synthesis of complete 30S and 50S ribosome subunits was detected, and a considerable fraction of the excess rRNA was degraded. Lack of complete cooperativity in the assembly of ribosome subunits in vivo is discussed as a possible explanation for the absence of a large stimulation of ribosome synthesis observed under these conditions. In addition to the induction of intact rRNA overproduction from the pL-rrnB operon, the effects of unbalanced overproduction of each of the two large rRNAs, 16S rRNA and 23S rRNA, on r-protein synthesis were examined using pL-rrnB derivatives carrying a large deletion in either the 23S rRNA gene or the 16S rRNA gene. Operon-specific derepression after 23S or 16S rRNA overproduction correlated with the overproduction of rRNA containing the target site for the operon-specific repressor r-protein. These results are discussed to explain the apparent coupling of the assembly of one ribosomal subunit with that of the other which was observed in earlier studies on conditionally lethal mutants with defects in ribosome assembly. PMID:3053641

  5. Key intermolecular interactions in the E. coli 70S ribosome revealed by coarse-grained analysis.

    PubMed

    Zhang, Zhiyong; Sanbonmatsu, Karissa Y; Voth, Gregory A

    2011-10-26

    The ribosome is a very large complex that consists of many RNA and protein molecules and plays a central role in protein biosynthesis in all organisms. Extensive interactions between different molecules are critical to ribosomal functional dynamics. In this work, intermolecular interactions in the Escherichia coli 70S ribosome are investigated by coarse-grained (CG) analysis. CG models are defined to preserve dynamic domains in RNAs and proteins and to capture functional motions in the ribosome, and then the CG sites are connected by harmonic springs, and spring constants are obtained by matching the computed fluctuations to those of an all-atom molecular dynamics (MD) simulation. Those spring constants indicate how strong the interactions are between the ribosomal components, and they are in good agreement with various experimental data. Nearly all the bridges between the small and large ribosomal subunits are indicated by CG interactions with large spring constants. The head of the small subunit is very mobile because it has minimal CG interactions with the rest of the subunit; however, a large number of small subunit proteins bind to maintain the internal structure of the head. The results show a clear connection between the intermolecular interactions and the structural and functional properties of the ribosome because of the reduced complexity in domain-based CG models. The present approach also provides a useful strategy to map interactions between molecules within large biomolecular complexes since it is not straightforward to investigate these by either atomistic MD simulations or residue-based elastic network models. PMID:21910449

  6. Maize reas1 Mutant Stimulates Ribosome Use Efficiency and Triggers Distinct Transcriptional and Translational Responses1[OPEN

    PubMed Central

    Qi, Weiwei; Zhu, Jie; Wu, Qiao; Wang, Qun; Li, Xia; Yao, Dongsheng; Jin, Ying; Wang, Gang; Wang, Guifeng

    2016-01-01

    Ribosome biogenesis is a fundamental cellular process in all cells. Impaired ribosome biogenesis causes developmental defects; however, its molecular and cellular bases are not fully understood. We cloned a gene responsible for a maize (Zea mays) small seed mutant, dek* (for defective kernel), and found that it encodes Ribosome export associated1 (ZmReas1). Reas1 is an AAA-ATPase that controls 60S ribosome export from the nucleus to the cytoplasm after ribosome maturation. dek* is a weak mutant allele with decreased Reas1 function. In dek* cells, mature 60S ribosome subunits are reduced in the nucleus and cytoplasm, but the proportion of actively translating polyribosomes in cytosol is significantly increased. Reduced phosphorylation of eukaryotic initiation factor 2α and the increased elongation factor 1α level indicate an enhancement of general translational efficiency in dek* cells. The mutation also triggers dramatic changes in differentially transcribed genes and differentially translated RNAs. Discrepancy was observed between differentially transcribed genes and differentially translated RNAs, indicating distinct cellular responses at transcription and translation levels to the stress of defective ribosome processing. DNA replication and nucleosome assembly-related gene expression are selectively suppressed at the translational level, resulting in inhibited cell growth and proliferation in dek* cells. This study provides insight into cellular responses due to impaired ribosome biogenesis. PMID:26645456

  7. A tRNA methyltransferase paralog is important for ribosome stability and cell division in Trypanosoma brucei.

    PubMed

    Fleming, Ian M C; Paris, Zdeněk; Gaston, Kirk W; Balakrishnan, R; Fredrick, Kurt; Rubio, Mary Anne T; Alfonzo, Juan D

    2016-01-01

    Most eukaryotic ribosomes contain 26/28S, 5S, and 5.8S large subunit ribosomal RNAs (LSU rRNAs) in addition to the 18S rRNA of the small subunit (SSU rRNA). However, in kinetoplastids, a group of organisms that include medically important members of the genus Trypanosoma and Leishmania, the 26/28S large subunit ribosomal RNA is uniquely composed of 6 rRNA fragments. In addition, recent studies have shown the presence of expansion segments in the large ribosomal subunit (60S) of Trypanosoma brucei. Given these differences in structure, processing and assembly, T. brucei ribosomes may require biogenesis factors not found in other organisms. Here, we show that one of two putative 3-methylcytidine methyltransferases, TbMTase37 (a homolog of human methyltransferase-like 6, METTL6), is important for ribosome stability in T. brucei. TbMTase37 localizes to the nucleolus and depletion of the protein results in accumulation of ribosomal particles lacking srRNA 4 and reduced levels of polysome associated ribosomes. We also find that TbMTase37 plays a role in cytokinesis, as loss of the protein leads to multi-flagellated and multi-nucleated cells. PMID:26888608

  8. A tRNA methyltransferase paralog is important for ribosome stability and cell division in Trypanosoma brucei

    PubMed Central

    Fleming, Ian M. C.; Paris, Zdeněk; Gaston, Kirk W.; Balakrishnan, R.; Fredrick, Kurt; Rubio, Mary Anne T.; Alfonzo, Juan D.

    2016-01-01

    Most eukaryotic ribosomes contain 26/28S, 5S, and 5.8S large subunit ribosomal RNAs (LSU rRNAs) in addition to the 18S rRNA of the small subunit (SSU rRNA). However, in kinetoplastids, a group of organisms that include medically important members of the genus Trypanosoma and Leishmania, the 26/28S large subunit ribosomal RNA is uniquely composed of 6 rRNA fragments. In addition, recent studies have shown the presence of expansion segments in the large ribosomal subunit (60S) of Trypanosoma brucei. Given these differences in structure, processing and assembly, T. brucei ribosomes may require biogenesis factors not found in other organisms. Here, we show that one of two putative 3-methylcytidine methyltransferases, TbMTase37 (a homolog of human methyltransferase-like 6, METTL6), is important for ribosome stability in T. brucei. TbMTase37 localizes to the nucleolus and depletion of the protein results in accumulation of ribosomal particles lacking srRNA 4 and reduced levels of polysome associated ribosomes. We also find that TbMTase37 plays a role in cytokinesis, as loss of the protein leads to multi-flagellated and multi-nucleated cells. PMID:26888608

  9. The tails of ubiquitin precursors are ribosomal proteins whose fusion to ubiquitin facilitates ribosome biogenesis

    NASA Astrophysics Data System (ADS)

    Finley, Daniel; Bartel, Bonnie; Varshavsky, Alexander

    1989-03-01

    Three of the four yeast ubiquitin genes encode hybrid proteins which are cleaved to yield ubiquitin and previously unidentified ribosomal proteins. The transient association between ubiquitin and these proteins promotes their incorporation into nascent ribosomes and is required for efficient ribosome biogenesis. These results suggest a novel 'chaperone' function for ubiquitin, in which its covalent association with other proteins promotes the formation of specific cellular structures.

  10. Discovery of peptidylarginine deiminase-4 substrates by protein array: antagonistic citrullination and methylation of human ribosomal protein S2.

    PubMed

    Guo, Qin; Bedford, Mark T; Fast, Walter

    2011-07-01

    Peptidylarginine deiminase (PAD) catalyzes the posttranslational citrullination of selected proteins in a calcium dependent manner. The PAD4 isoform has been implicated in multiple sclerosis, rheumatoid arthritis, some types of cancer, and plays a role in gene regulation. However, the substrate selectivity of PAD4 is not well defined, nor is the impact of citrullination on many other pathways. Here, a high-density protein array is used as a primary screen to identify 40 previously unreported PAD4 substrates, 10 of which are selected and verified in a cell lysate-based secondary assay. One of the most prominent hits, human 40S ribosomal protein S2 (RPS2), is characterized in detail. PAD4 citrullinates the Arg-Gly repeat region of RPS2, which is also an established site for Arg methylation by protein arginine methyltransferase 3 (PRMT3). As in other systems, crosstalk is observed; citrullination and methylation modifications are found to be antagonistic to each other, suggesting a conserved posttranslational regulatory strategy. Both PAD4 and PRMT3 are found to co-sediment with the free 40S ribosomal subunit fraction from cell extracts. These findings are consistent with participation of citrullination in the regulation of RPS2 and ribosome assembly. This application of protein arrays to reveal new PAD4 substrates suggests a role for citrullination in a number of different cellular pathways. PMID:21584310

  11. Identification of antituberculosis agents that target ribosomal protein interactions using a yeast two-hybrid system

    PubMed Central

    Lin, Yuan; Li, Yan; Zhu, Yuanjun; Zhang, Jing; Li, Yongzhen; Liu, Xiao; Jiang, Wei; Yu, Shishan; You, Xue-Fu; Xiao, Chunling; Hong, Bin; Wang, Yanchang; Jiang, Jian-Dong; Si, Shuyi

    2012-01-01

    Mycobacterium tuberculosis kills about 2 million people annually and antibiotic resistance is a cause of increased mortality. Therefore, development of new antituberculosis drugs is urgent for the control of widespread tuberculosis infections. For this purpose, we performed an innovative screen to identify new agents that disrupt the function of ribosomes in M. tuberculosis. Two bacterial ribosomal proteins L12 and L10 interact with each other and constitute the stalk of the 50S ribosomal subunit, which recruits initiation and elongation factors (EFs) during translation. Therefore, the L12–L10 interaction should be essential for ribosomal function and protein synthesis. We established a yeast two-hybrid system to identify small molecules that block the interaction between L12 and L10 proteins from M. tuberculosis. Using this system, we identified two compounds T766 and T054 that show strong bactericidal activity against tuberculosis but with low toxicity to mice and other bacterial strains. Moreover, using surface plasmon resonance (SPR) assay, we have demonstrated that these compounds bind specifically to L12 to disrupt L12–L10 interaction. Overproduction of L12 protein, but not L10, lowers the antibacterial activity of T766 and T054, indicating that the ribosome is likely the cellular target. Therefore, our data demonstrate that this yeast two-hybrid system is a useful tool to identify unique antituberculosis agents targeting the ribosomal protein L12–L10 interaction. PMID:23045703

  12. Recognition of the 70S ribosome and polysome by the RNA degradosome in Escherichia coli

    PubMed Central

    Tsai, Yi-Chun; Du, Dijun; Domínguez-Malfavón, Lilianha; Dimastrogiovanni, Daniela; Cross, Jonathan; Callaghan, Anastasia J.; García-Mena, Jaime; Luisi, Ben F.

    2012-01-01

    The RNA degradosome is a multi-enzyme assembly that contributes to key processes of RNA metabolism, and it engages numerous partners in serving its varied functional roles. Small domains within the assembly recognize collectively a diverse range of macromolecules, including the core protein components, the cytoplasmic lipid membrane, mRNAs, non-coding regulatory RNAs and precursors of structured RNAs. We present evidence that the degradosome can form a stable complex with the 70S ribosome and polysomes, and we demonstrate the proximity in vivo of ribosomal proteins and the scaffold of the degradosome, RNase E. The principal interactions are mapped to two, independent, RNA-binding domains from RNase E. RhlB, the RNA helicase component of the degradosome, also contributes to ribosome binding, and this is favoured through an activating interaction with RNase E. The catalytic activity of RNase E for processing 9S RNA (the ribosomal 5S RNA precursor) is repressed in the presence of the ribosome, whereas there is little affect on the cleavage of single-stranded substrates mediated by non-coding RNA, suggestings that the enzyme retains capacity to cleave unstructured substrates when associated with the ribosome. We propose that polysomes may act as antennae that enhance the rates of capture of the limited number of degradosomes, so that they become recruited to sites of active translation to act on mRNAs as they become exposed or tagged for degradation. PMID:22923520

  13. Regulation of the mammalian elongation cycle by subunit rolling: a eukaryotic-specific ribosome rearrangement

    PubMed Central

    Budkevich, Tatyana V.; Giesebrecht, Jan; Behrmann, Elmar; Loerke, Justus; Ramrath, David J.F.; Mielke, Thorsten; Ismer, Jochen; Hildebrand, Peter W.; Tung, Chang-Shung; Nierhaus, Knud H.; Sanbonmatsu, Karissa Y.; Spahn, Christian M.T.

    2014-01-01

    SUMMARY The extent to which bacterial ribosomes and the significantly larger eukaryotic ribosomes share the same mechanisms of ribosomal elongation is unknown. Here, we present sub-nanometer resolution cryo-electron microscopy maps of the mammalian 80S ribosome in the post-translocational state and in complex with the eukaryotic eEF1A•Val-tRNA•GMPPNP ternary complex, revealing significant differences in the elongation mechanism between bacteria and mammals. Surprisingly, and in contrast to bacterial ribosomes, a rotation of the small subunit around its long axis and orthogonal to the well-known intersubunit rotation distinguishes the post-translocational state from the classical pre-translocational state ribosome. We term this motion “subunit rolling”. Correspondingly, a mammalian decoding complex visualized in sub-states before and after codon recognition reveals structural distinctions from the bacterial system. These findings suggest how codon recognition leads to GTPase activation in the mammalian system and demonstrate that in mammalia subunit rolling occurs during tRNA selection. PMID:24995983

  14. Marrow failure: a window into ribosome biology.

    PubMed

    Ruggero, Davide; Shimamura, Akiko

    2014-10-30

    Diamond-Blackfan anemia, Shwachman-Diamond syndrome, and dyskeratosis congenita are inherited syndromes characterized by marrow failure, congenital anomalies, and cancer predisposition. Genetic and molecular studies have uncovered distinct abnormalities in ribosome biogenesis underlying each of these 3 disorders. How defects in ribosomes, the essential organelles required for protein biosynthesis in all cells, cause tissue-specific abnormalities in human disease remains a question of fundamental scientific and medical importance. Here we review the overlapping and distinct clinical features of these 3 syndromes and discuss current knowledge regarding the ribosomal pathways disrupted in each of these disorders. We also explore the increasing complexity of ribosome biology and how this informs our understanding of developmental biology and human disease. PMID:25237201

  15. Marrow failure: a window into ribosome biology

    PubMed Central

    Ruggero, Davide

    2014-01-01

    Diamond-Blackfan anemia, Shwachman-Diamond syndrome, and dyskeratosis congenita are inherited syndromes characterized by marrow failure, congenital anomalies, and cancer predisposition. Genetic and molecular studies have uncovered distinct abnormalities in ribosome biogenesis underlying each of these 3 disorders. How defects in ribosomes, the essential organelles required for protein biosynthesis in all cells, cause tissue-specific abnormalities in human disease remains a question of fundamental scientific and medical importance. Here we review the overlapping and distinct clinical features of these 3 syndromes and discuss current knowledge regarding the ribosomal pathways disrupted in each of these disorders. We also explore the increasing complexity of ribosome biology and how this informs our understanding of developmental biology and human disease. PMID:25237201

  16. The immunological properties of Brucella ribosomal preparations.

    PubMed

    Corbel, M J

    1976-01-01

    Ribosomes were isolated from Brucella abortus strains 19 and 45/20 by disruption of the cells followed by differential ultracentrifugation. The ribosome preparations contained 2-3 components reacting in immunodiffusion tests but were free of detectable lipopolysaccharide-protein agglutinogen. They crossreacted with antisera to Br. abortus, Br. melitensis, Br. suis and Br. ovis and elicited intradermal delayed hypersensitivity reactions in animals infected with Br. abortus, Br. melitensis or Br. suis. The ribosomes were antigenic in rabbits, guinea pigs and mice. Those from Br. abortus S19 induced agglutinins reaction with smooth brucella strains whereas those from Br. abortus 45/20 induced agglutinins reacting with rough brucella strains. Cattle vaccinated with S19 or 45/20 vaccines or infected with Br. abortus developed pricipitins to ribosomal components at an early stage in the immune response. PMID:816681

  17. Ribosome Inactivating Proteins from Rosaceae.

    PubMed

    Shang, Chenjing; Rougé, Pierre; Van Damme, Els J M

    2016-01-01

    Ribosome-inactivating proteins (RIPs) are widespread among higher plants of different taxonomic orders. In this study, we report on the RIP sequences found in the genome/transcriptome of several important Rosaceae species, including many economically important edible fruits such as apple, pear, peach, apricot, and strawberry. All RIP domains from Rosaceae share high sequence similarity with conserved residues in the catalytic site and the carbohydrate binding sites. The genomes of Malus domestica and Pyrus communis contain both type 1 and type 2 RIP sequences, whereas for Prunus mume, Prunus persica, Pyrus bretschneideri, and Pyrus communis a complex set of type 1 RIP sequences was retrieved. Heterologous expression and purification of the type 1 as well as the type 2 RIP from apple allowed to characterize the biological activity of the proteins. Both RIPs from Malus domestica can inhibit protein synthesis. Furthermore, molecular modelling suggests that RIPs from Rosaceae possess three-dimensional structures that are highly similar to the model proteins and can bind to RIP substrates. Screening of the recombinant type 2 RIP from apple on a glycan array revealed that this type 2 RIP interacts with terminal sialic acid residues. Our data suggest that the RIPs from Rosaceae are biologically active proteins. PMID:27556443

  18. A preformed compact ribosome-binding domain in the cricket paralysis-like virus IRES RNAs

    PubMed Central

    COSTANTINO, DAVID; KIEFT, JEFFREY S.

    2005-01-01

    The internal ribosome site RNA of the cricket paralysis-like viruses (CrPV-like) binds directly to the ribosome, assembling the translation machinery without initiation factors. This mechanism does not require initiator tRNA, and translation starts from a non-AUG codon. A wealth of biochemical data has yielded a working model for this process, but the three-dimensional structure and biophysical characteristics of the unbound CrPV-like IRES RNAs are largely unexplored. Here, we demonstrate that the CrPV-like IRESes prefold into a two-part structure in the presence of magnesium ions. The largest part is a prefolded compact RNA domain that shares folding and structural characteristics with other compactly folded RNAs such as group I intron RNAs and RNase P RNA. Chemical probing reveals that the CrPV-like IRES’ compact domain contains RNA helices that are packed tightly enough to exclude solvent, and analytical ultracentrifugation indicates a large change in the shape of the IRES upon folding. Formation of this compact domain is necessary for binding of the 40S subunit, and the structural organization of the unbound IRES RNA is consistent with the hypothesis that the IRES is functionally and structurally preorganized before ribosome binding. PMID:15701733

  19. Crystal structures of complexes containing domains from two viral internal ribosome entry site (IRES) RNAs bound to the 70S ribosome

    SciTech Connect

    Zhu, Jianyu; Korostelev, Andrei; Costantino, David A.; Donohue, John P.; Noller, Harry F.; Kieft, Jeffrey S.

    2011-08-24

    Internal ribosome entry site (IRES) RNAs are elements of viral or cellular mRNAs that bypass steps of canonical eukaryotic cap-dependent translation initiation. Understanding of the structural basis of IRES mechanisms is limited, partially due to a lack of high-resolution structures of IRES RNAs bound to their cellular targets. Prompted by the universal phylogenetic conservation of the ribosomal P site, we solved the crystal structures of proposed P site binding domains from two intergenic region IRES RNAs bound to bacterial 70S ribosomes. The structures show that these IRES domains nearly perfectly mimic a tRNA-mRNA interaction. However, there are clear differences in the global shape and position of this IRES domain in the intersubunit space compared to those of tRNA, supporting a mechanism for IRES action that invokes hybrid state mimicry to drive a noncanonical mode of translocation. These structures suggest how relatively small structured RNAs can manipulate complex biological machines.

  20. Dosage Sensitivity of RPL9 and Concerted Evolution of Ribosomal Protein Genes in Plants

    PubMed Central

    Devis, Deborah; Firth, Sue M.; Liang, Zhe; Byrne, Mary E.

    2015-01-01

    The ribosome in higher eukaryotes is a large macromolecular complex composed of four rRNAs and eighty different ribosomal proteins. In plants, each ribosomal protein is encoded by multiple genes. Duplicate genes within a family are often necessary to provide a threshold dose of a ribosomal protein but in some instances appear to have non-redundant functions. Here, we addressed whether divergent members of the RPL9 gene family are dosage sensitive or whether these genes have non-overlapping functions. The RPL9 family in Arabidopsis thaliana comprises two nearly identical members, RPL9B and RPL9C, and a more divergent member, RPL9D. Mutations in RPL9C and RPL9D genes lead to delayed growth early in development, and loss of both genes is embryo lethal, indicating that these are dosage-sensitive and redundant genes. Phylogenetic analysis of RPL9 as well as RPL4, RPL5, RPL27a, RPL36a, and RPS6 family genes in the Brassicaceae indicated that multicopy ribosomal protein genes have been largely retained following whole genome duplication. However, these gene families also show instances of tandem duplication, small scale deletion, and evidence of gene conversion. Furthermore, phylogenetic analysis of RPL9 genes in angiosperm species showed that genes within a species are more closely related to each other than to RPL9 genes in other species, suggesting ribosomal protein genes undergo convergent evolution. Our analysis indicates that ribosomal protein gene retention following whole genome duplication contributes to the number of genes in a family. However, small scale rearrangements influence copy number and likely drive concerted evolution of these dosage-sensitive genes. PMID:26734020

  1. Phylogenetic relationships of Cryptosporidium determined by ribosomal RNA sequence comparison.

    PubMed

    Johnson, A M; Fielke, R; Lumb, R; Baverstock, P R

    1990-04-01

    Reverse transcription of total cellular RNA was used to obtain a partial sequence of the small subunit ribosomal RNA of Cryptosporidium, a protist currently placed in the phylum Apicomplexa. The semi-conserved regions were aligned with homologous sequences in a range of other eukaryotes, and the evolutionary relationships of Cryptosporidium were determined by two different methods of phylogenetic analysis. The prokaryotes Escherichia coli and Halobacterium cuti were included as outgroups. The results do not show an especially close relationship of Cryptosporidium to other members of the phylum Apicomplexa. PMID:2332273

  2. Structure of psoralen-crosslinked ribosomal RNA from Drosophila melanogaster.

    PubMed Central

    Wollenzien, P L; Youvan, D C; Hearst, J E

    1978-01-01

    Ribosomal RNA from Drosophila melanogaster photoreacted with hydroxymethyltrioxsalen has been examined by electron microscopy. Reproducible patterns of hairpins were found in both the 26S and 18S RNA. The frequency of these hairpins and the amount of incorporated drug were dependent upon the conditions under which the crosslinking was performed. A prominent central hairpin occurs in the 26S RNA and the break that interrupts the continuity of the RNA chain is located within it. In addition to several small hairpins, the crosslinked 18S RNA contains a large open loop. Images PMID:417342

  3. G3BP-Caprin1-USP10 complexes mediate stress granule condensation and associate with 40S subunits.

    PubMed

    Kedersha, Nancy; Panas, Marc D; Achorn, Christopher A; Lyons, Shawn; Tisdale, Sarah; Hickman, Tyler; Thomas, Marshall; Lieberman, Judy; McInerney, Gerald M; Ivanov, Pavel; Anderson, Paul

    2016-03-28

    Mammalian stress granules (SGs) contain stalled translation preinitiation complexes that are assembled into discrete granules by specific RNA-binding proteins such as G3BP. We now show that cells lacking both G3BP1 and G3BP2 cannot form SGs in response to eukaryotic initiation factor 2α phosphorylation or eIF4A inhibition, but are still SG-competent when challenged with severe heat or osmotic stress. Rescue experiments using G3BP1 mutants show that phosphomimetic G3BP1-S149E fails to rescue SG formation, whereas G3BP1-F33W, a mutant unable to bind G3BP partner proteins Caprin1 or USP10, rescues SG formation. Caprin1/USP10 binding to G3BP is mutually exclusive: Caprin binding promotes, but USP10 binding inhibits, SG formation. G3BP interacts with 40S ribosomal subunits through its RGG motif, which is also required for G3BP-mediated SG formation. We propose that G3BP mediates the condensation of SGs by shifting between two different states that are controlled by the phosphorylation of S149 and by binding to Caprin1 or USP10. PMID:27022092

  4. A Neurospora crassa ribosomal protein gene, homologous to yeast CRY1, contains sequences potentially coordinating its transcription with rRNA genes.

    PubMed Central

    Tyler, B M; Harrison, K

    1990-01-01

    We have isolated and sequenced a Neurospora crassa ribosomal protein gene (designated crp-2) strongly homologous to the rp59 gene (CRY1) of yeast and the S14 ribosomal protein gene of mammals. The inferred sequence of the crp-2 protein is more homologous (83%) to the mammalian S14 sequence than to the yeast rp59 sequence (69%). The gene has three intervening sequences (IVSs) two of which are offset 7 bp from the position of IVSs in the mammalian genes. None correspond to the position of the IVS in the yeast gene. Crp-2 was mapped by RFLP analysis to the right arm of linkage group III. The 5' region of the gene contains three copies of a sequence, the Ribo box, previously shown to be required for transcription of both 5S and 40S rRNA genes. We speculate that the Ribo box may coordinate ribosomal protein and rRNA gene transcription. Images PMID:1977135

  5. Ribosome-associated pentatricopeptide repeat proteins function as translational activators in mitochondria of trypanosomes.

    PubMed

    Aphasizheva, Inna; Maslov, Dmitri A; Qian, Yu; Huang, Lan; Wang, Qi; Costello, Catherine E; Aphasizhev, Ruslan

    2016-03-01

    Mitochondrial ribosomes of Trypanosoma brucei are composed of 9S and 12S rRNAs, eubacterial-type ribosomal proteins, polypeptides lacking discernible motifs and approximately 20 pentatricopeptide repeat (PPR) RNA binding proteins. Several PPRs also populate the polyadenylation complex; among these, KPAF1 and KPAF2 function as general mRNA 3' adenylation/uridylation factors. The A/U-tail enables mRNA binding to the small ribosomal subunit and is essential for translation. The presence of A/U-tail also correlates with requirement for translation of certain mRNAs in mammalian and insect parasite stages. Here, we inquired whether additional PPRs activate translation of individual mRNAs. Proteomic analysis identified KRIPP1 and KRIPP8 as components of the small ribosomal subunit in mammalian and insect forms, but also revealed their association with the polyadenylation complex in the latter. RNAi knockdowns demonstrated essential functions of KRIPP1 and KRIPP8 in the actively respiring insect stage, but not in the mammalian stage. In the KRIPP1 knockdown, A/U-tailed mRNA encoding cytochrome c oxidase subunit 1 declined concomitantly with the de novo synthesis of this subunit whereas polyadenylation and translation of cyb mRNA were unaffected. In contrast, the KRIPP8 knockdown inhibited A/U-tailing and translation of both CO1 and cyb mRNAs. Our findings indicate that ribosome-associated PPRs may selectively activate mRNAs for translation. PMID:26713541

  6. Ribosome-associated pentatricopeptide repeat proteins function as translational activators in mitochondria of trypanosomes

    PubMed Central

    Aphasizheva, Inna; Maslov, Dmitri A.; Qian, Yu; Huang, Lan; Wang, Qi; Costello, Catherine E.; Aphasizhev, Ruslan

    2016-01-01

    Summary Mitochondrial ribosomes of Trypanosoma brucei are composed of 9S and 12S rRNAs, eubacterial-type ribosomal proteins, polypeptides lacking discernible motifs and approximately 20 pentatricopeptide repeat (PPR) RNA binding proteins. Several PPRs also populate the polyadenylation complex; among these, KPAF1 and KPAF2 function as general mRNA 3′ adenylation/uridylation factors. The A/U-tail enables mRNA binding to the small ribosomal subunit and is essential for translation. The presence of A/U-tail also correlates with requirement for translation of certain mRNAs in mammalian and insect parasite stages. Here, we inquired whether additional PPRs activate translation of individual mRNAs. Proteomic analysis identified KRIPP1 and KRIPP8 as components of the small ribosomal subunit in mammalian and insect forms, but also revealed their association with the polyadenylation complex in the latter. RNAi knockdowns demonstrated essential functions of KRIPP1 and KRIPP8 in the actively respiring insect stage, but not in the mammalian stage. In the KRIPP1 knockdown, A/U-tailed mRNA encoding cytochrome c oxidase subunit 1 declined concomitantly with the de novo synthesis of this subunit whereas polyadenylation and translation of cyb mRNA were unaffected. In contrast, the KRIPP8 knockdown inhibited A/U-tailing and translation of both CO1 and cyb mRNAs. Our findings indicate that ribosome-associated PPRs may selectively activate mRNAs for translation. PMID:26713541

  7. The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

    SciTech Connect

    Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen; Bashan, Anat; Belousoff, Matthew; Wekselman, Itai; Zimmerman, Ella; Xiong, Liqun; Klepacki, Dorota; Arakawa, Kenji; Kinashi, Haruyasu; Mankin, Alexander S.; Yonath, Ada

    2010-04-26

    Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, the streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.

  8. High-resolution structure of the Escherichia coli ribosome

    PubMed Central

    Noeske, Jonas; Wasserman, Michael R.; Terry, Daniel S.; Altman, Roger B.; Blanchard, Scott C.; Cate, Jamie H. D.

    2015-01-01

    Protein synthesis by the ribosome is highly dependent on the ionic conditions in the cellular environment, but the roles of ribosome solvation remain poorly understood. Moreover, the function of modifications to ribosomal RNA and ribosomal proteins are unclear. Here we present the structure of the Escherichia coli 70S ribosome to 2.4 Å resolution. The structure reveals details of the ribosomal subunit interface that are conserved in all domains of life, and suggest how solvation contributes to ribosome integrity and function. The structure also suggests how the conformation of ribosomal protein uS12 likely impacts its contribution to messenger RNA decoding. This structure helps to explain the phylogenetic conservation of key elements of the ribosome, including posttranscriptional and posttranslational modifications and should serve as a basis for future antibiotic development. PMID:25775265

  9. Analysis of interactions between ribosomal proteins and RNA structural motifs

    PubMed Central

    2010-01-01

    Background One important goal of structural bioinformatics is to recognize and predict the interactions between protein binding sites and RNA. Recently, a comprehensive analysis of ribosomal proteins and their interactions with rRNA has been done. Interesting results emerged from the comparison of r-proteins within the small subunit in T. thermophilus and E. coli, supporting the idea of a core made by both RNA and proteins, conserved by evolution. Recent work showed also that ribosomal RNA is modularly composed. Motifs are generally single-stranded sequences of consecutive nucleotides (ssRNA) with characteristic folding. The role of these motifs in protein-RNA interactions has been so far only sparsely investigated. Results This work explores the role of RNA structural motifs in the interaction of proteins with ribosomal RNA (rRNA). We analyze composition, local geometries and conformation of interface regions involving motifs such as tetraloops, kink turns and single extruded nucleotides. We construct an interaction map of protein binding sites that allows us to identify the common types of shared 3-D physicochemical binding patterns for tetraloops. Furthermore, we investigate the protein binding pockets that accommodate single extruded nucleotides either involved in kink-turns or in arbitrary RNA strands. This analysis reveals a new structural motif, called tripod. It corresponds to small pockets consisting of three aminoacids arranged at the vertices of an almost equilateral triangle. We developed a search procedure for the recognition of tripods, based on an empirical tripod fingerprint. Conclusion A comparative analysis with the overall RNA surface and interfaces shows that contact surfaces involving RNA motifs have distinctive features that may be useful for the recognition and prediction of interactions. PMID:20122215

  10. Mitochondrial ribosomal proteins (MRPs) of yeast.

    PubMed Central

    Graack, H R; Wittmann-Liebold, B

    1998-01-01

    Mitochondrial ribosomal proteins (MRPs) are the counterparts in that organelle of the cytoplasmic ribosomal proteins in the host. Although the MRPs fulfil similar functions in protein biosynthesis, they are distinct in number, features and primary structures from the latter. Most progress in the eludication of the properties of individual MRPs, and in the characterization of the corresponding genes, has been made in baker's yeast (Saccharomyces cerevisiae). To date, 50 different MRPs have been determined, although biochemical data and mutational analysis propose a total number which is substantially higher. Surprisingly, only a minority of the MRPs that have been characterized show significant sequence similarities to known ribosomal proteins from other sources, thus limiting the deduction of their functions by simple comparison of amino acid sequences. Further, individual MRPs have been characterized functionally by mutational studies, and the regulation of expression of MRP genes has been described. The interaction of the mitochondrial ribosomes with transcription factors specific for individual mitochondrial mRNAs, and the communication between mitochondria and the nucleus for the co-ordinated expression of ribosomal constituents, are other aspects of current MRP research. Although the mitochondrial translational system is still far from being described completely, the yeast MRP system serves as a model for other organisms, including that of humans. PMID:9445368

  11. Attachment of ribosomal complexes and retrograde scanning during initiation on the Halastavi árva virus IRES.

    PubMed

    Abaeva, Irina S; Pestova, Tatyana V; Hellen, Christopher U T

    2016-03-18

    Halastavi árva virus (HalV) has a positive-sense RNA genome, with an 827 nt-long 5' UTR and an intergenic region separating two open reading frames. Whereas the encoded proteins are most homologous to Dicistrovirus polyproteins, its 5' UTR is distinct. Here, we report that the HalV 5' UTR comprises small stem-loop domains separated by long single-stranded areas and a large A-rich unstructured region surrounding the initiation codon AUG828, and possesses cross-kingdom internal ribosome entry site (IRES) activity. In contrast to most viral IRESs, it does not depend on structural integrity and specific interaction of a structured element with a translational component, and is instead determined by the unstructured region flanking AUG828. eIF2, eIF3, eIF1 and eIF1A promote efficient 48S initiation complex formation at AUG828, which is reduced ∼5-fold on omission of eIF1 and eIF1A. Initiation involves direct attachment of 43S preinitiation complexes within a short window at or immediately downstream of AUG828. 40S and eIF3 are sufficient for initial binding. After attachment, 43S complexes undergo retrograde scanning, strongly dependent on eIF1 and eIF1A. eIF4A/eIF4G stimulated initiation only at low temperatures or on mutants, in which areas surrounding AUG828 had been replaced by heterologous sequences. However, they strongly promoted initiation at AUG872, yielding a proline-rich oligopeptide. PMID:26783202

  12. Attachment of ribosomal complexes and retrograde scanning during initiation on the Halastavi árva virus IRES

    PubMed Central

    Abaeva, Irina S.; Pestova, Tatyana V.; Hellen, Christopher U.T.

    2016-01-01

    Halastavi árva virus (HalV) has a positive-sense RNA genome, with an 827 nt-long 5′ UTR and an intergenic region separating two open reading frames. Whereas the encoded proteins are most homologous to Dicistrovirus polyproteins, its 5′ UTR is distinct. Here, we report that the HalV 5′ UTR comprises small stem-loop domains separated by long single-stranded areas and a large A-rich unstructured region surrounding the initiation codon AUG828, and possesses cross-kingdom internal ribosome entry site (IRES) activity. In contrast to most viral IRESs, it does not depend on structural integrity and specific interaction of a structured element with a translational component, and is instead determined by the unstructured region flanking AUG828. eIF2, eIF3, eIF1 and eIF1A promote efficient 48S initiation complex formation at AUG828, which is reduced ∼5-fold on omission of eIF1 and eIF1A. Initiation involves direct attachment of 43S preinitiation complexes within a short window at or immediately downstream of AUG828. 40S and eIF3 are sufficient for initial binding. After attachment, 43S complexes undergo retrograde scanning, strongly dependent on eIF1 and eIF1A. eIF4A/eIF4G stimulated initiation only at low temperatures or on mutants, in which areas surrounding AUG828 had been replaced by heterologous sequences. However, they strongly promoted initiation at AUG872, yielding a proline-rich oligopeptide. PMID:26783202

  13. Large-scale isolation of mitochondrial ribosomes from mammalian tissues.

    PubMed

    Spremulli, Linda L

    2007-01-01

    The preparation of mammalian mitochondrial ribosomes in sufficient quantities for biochemical studies is best done beginning with whole tissue rather than from cells in culture. This issue arises because of the low abundance of these ribosomes in cells, making their isolation a challenge. Crude mitochondrial preparations are made by differential centrifugation and are treated with digitonin to remove the outer membrane. This treatment also effectively removes most contamination by cytoplasmic ribosomes. Purification of mammalian mitochondrial ribosomes requires treatment with detergents to release the ribosomes from their association with the membrane. Sucrose density gradient centrifugation is used to separate the ribosomes from other large oligomeric complexes from this organelle. PMID:18314732

  14. Protein L5 is crucial for in vivo assembly of the bacterial 50S ribosomal subunit central protuberance

    PubMed Central

    Korepanov, Alexey P.; Korobeinikova, Anna V.; Shestakov, Sergey A.; Garber, Maria B.; Gongadze, George M.

    2012-01-01

    In the present work, ribosomes assembled in bacterial cells in the absence of essential ribosomal protein L5 were obtained. After arresting L5 synthesis, Escherichia coli cells divide a limited number of times. During this time, accumulation of defective large ribosomal subunits occurs. These 45S particles lack most of the central protuberance (CP) components (5S rRNA and proteins L5, L16, L18, L25, L27, L31, L33 and L35) and are not able to associate with the small ribosomal subunit. At the same time, 5S rRNA is found in the cytoplasm in complex with ribosomal proteins L18 and L25 at quantities equal to the amount of ribosomes. Thus, it is the first demonstration that protein L5 plays a key role in formation of the CP during assembly of the large ribosomal subunit in the bacterial cell. A possible model for the CP assembly in vivo is discussed in view of the data obtained. PMID:22821559

  15. The prolyl isomerase, FKBP25, interacts with RNA-engaged nucleolin and the pre-60S ribosomal subunit.

    PubMed

    Gudavicius, Geoff; Dilworth, David; Serpa, Jason J; Sessler, Nicole; Petrotchenko, Evgeniy V; Borchers, Christoph H; Nelson, Christopher J

    2014-07-01

    Peptidyl-proline isomerases of the FK506-binding protein (FKBP) family belong to a class of enzymes that catalyze the cis-trans isomerization of prolyl-peptide bonds in proteins. A handful of FKBPs are found in the nucleus, implying that the isomerization of proline in nuclear proteins is enzymatically controlled. FKBP25 is a nuclear protein that has been shown to associate with chromatin modifiers and transcription factors. In this study, we performed the first proteomic characterization of FKBP25 and found that it interacts with numerous ribosomal proteins, ribosomal processing factors, and a small selection of chromatin modifiers. In agreement with previous reports, we found that nucleolin is a major FKBP25-interacting protein and demonstrated that this interaction is dependent on rRNA. FKBP25 interacts with the immature large ribosomal subunit in nuclear extract but does not associate with mature ribosomes, implicating this FKBP's action in ribosome biogenesis. Despite engaging nascent 60S ribosomes, FKBP25 does not affect steady-state levels of rRNAs or its pre-rRNA intermediates. We conclude that FKBP25 is likely recruited to preribosomes to chaperone one of the protein components of the ribosome large subunit. PMID:24840943

  16. Single-Molecule Observations of Ribosome Function

    PubMed Central

    Blanchard, Scott C.

    2009-01-01

    Summary of Recent Advances Single-molecule investigations promise to greatly advance our understanding of basic and regulated ribosome functions during the process of translation. Here, recent progress towards directly imaging the elemental translation elongation steps using fluorescence resonance energy transfer (FRET)-based imaging methods is discussed, which provide striking evidence of the highly dynamic nature of the ribosome. In this view, global rates and fidelities of protein synthesis reactions may be regulated by interactions of the ribosome with mRNA, tRNA, translation factors, and potentially many other cellular ligands, that modify intrinsic conformational equilibria in the translating particle. Future investigations probing this model must aim to visualize translation processes from multiple structural and kinetic perspectives simultaneously, to provide direct correlations between factor binding and conformational events. PMID:19223173

  17. Genome Mining for Ribosomally Synthesized Natural Products

    PubMed Central

    Velásquez, Juan E.; van der Donk, Wilfred

    2011-01-01

    In recent years, the number of known peptide natural products that are synthesized via the ribosomal pathway has rapidly grown. Taking advantage of sequence homology among genes encoding precursor peptides or biosynthetic proteins, in silico mining of genomes combined with molecular biology approaches has guided the discovery of a large number of new ribosomal natural products, including lantipeptides, cyanobactins, linear thiazole/oxazole-containing peptides, microviridins, lasso peptides, amatoxins, cyclotides, and conopeptides. In this review, we describe the strategies used for the identification of these ribosomally-synthesized and posttranslationally modified peptides (RiPPs) and the structures of newly identified compounds. The increasing number of chemical entities and their remarkable structural and functional diversity may lead to novel pharmaceutical applications. PMID:21095156

  18. Human nucleolar protein Nop52 (RRP1/NNP-1) is involved in site 2 cleavage in internal transcribed spacer 1 of pre-rRNAs at early stages of ribosome biogenesis

    PubMed Central

    Yoshikawa, Harunori; Ishikawa, Hideaki; Izumikawa, Keiichi; Miura, Yutaka; Hayano, Toshiya; Isobe, Toshiaki; Simpson, Richard J.; Takahashi, Nobuhiro

    2015-01-01

    During the early steps of ribosome biogenesis in mammals, the two ribosomal subunits 40S and 60S are produced via splitting of the large 90S pre-ribosomal particle (90S) into pre-40S and pre-60S pre-ribosomal particles (pre-40S and pre-60S). We previously proposed that replacement of fibrillarin by Nop52 (RRP1/NNP-1) for the binding to p32 (C1QBP) is a key event that drives this splitting process. However, how the replacement by RRP1 is coupled with the endo- and/or exo-ribonucleolytic cleavage of pre-rRNA remains unknown. In this study, we demonstrate that RRP1 deficiency suppressed site 2 cleavage on ITS1 of 47S/45S, 41S and 36S pre-rRNAs in human cells. RRP1 was also present in 90S and was localized in the dense fibrillar component of the nucleolus dependently on active RNA polymerase I transcription. In addition, double knockdown of XRN2 and RRP1 revealed that RRP1 accelerated the site 2 cleavage of 47S, 45S and 41S pre-rRNAs. These data suggest that RRP1 is involved not only in competitive binding with fibrillarin to C1QBP on 90S but also in site 2 cleavage in ITS1 of pre-rRNAs at early stages of human ribosome biogenesis; thus, it is likely that RRP1 integrates the cleavage of site 2 with the physical split of 90S into pre-40S and pre-60S. PMID:25969445

  19. Human nucleolar protein Nop52 (RRP1/NNP-1) is involved in site 2 cleavage in internal transcribed spacer 1 of pre-rRNAs at early stages of ribosome biogenesis.

    PubMed

    Yoshikawa, Harunori; Ishikawa, Hideaki; Izumikawa, Keiichi; Miura, Yutaka; Hayano, Toshiya; Isobe, Toshiaki; Simpson, Richard J; Takahashi, Nobuhiro

    2015-06-23

    During the early steps of ribosome biogenesis in mammals, the two ribosomal subunits 40S and 60S are produced via splitting of the large 90S pre-ribosomal particle (90S) into pre-40S and pre-60S pre-ribosomal particles (pre-40S and pre-60S). We previously proposed that replacement of fibrillarin by Nop52 (RRP1/NNP-1) for the binding to p32 (C1QBP) is a key event that drives this splitting process. However, how the replacement by RRP1 is coupled with the endo- and/or exo-ribonucleolytic cleavage of pre-rRNA remains unknown. In this study, we demonstrate that RRP1 deficiency suppressed site 2 cleavage on ITS1 of 47S/45S, 41S and 36S pre-rRNAs in human cells. RRP1 was also present in 90S and was localized in the dense fibrillar component of the nucleolus dependently on active RNA polymerase I transcription. In addition, double knockdown of XRN2 and RRP1 revealed that RRP1 accelerated the site 2 cleavage of 47S, 45S and 41S pre-rRNAs. These data suggest that RRP1 is involved not only in competitive binding with fibrillarin to C1QBP on 90S but also in site 2 cleavage in ITS1 of pre-rRNAs at early stages of human ribosome biogenesis; thus, it is likely that RRP1 integrates the cleavage of site 2 with the physical split of 90S into pre-40S and pre-60S. PMID:25969445

  20. Ribosome-dependent activation of stringent control.

    PubMed

    Brown, Alan; Fernández, Israel S; Gordiyenko, Yuliya; Ramakrishnan, V

    2016-06-01

    In order to survive, bacteria continually sense, and respond to, environmental fluctuations. Stringent control represents a key bacterial stress response to nutrient starvation that leads to rapid and comprehensive reprogramming of metabolic and transcriptional patterns. In general, transcription of genes for growth and proliferation is downregulated, while those important for survival and virulence are upregulated. Amino acid starvation is sensed by depletion of the aminoacylated tRNA pools, and this results in accumulation of ribosomes stalled with non-aminoacylated (uncharged) tRNA in the ribosomal A site. RelA is recruited to stalled ribosomes and activated to synthesize a hyperphosphorylated guanosine analogue, (p)ppGpp, which acts as a pleiotropic secondary messenger. However, structural information about how RelA recognizes stalled ribosomes and discriminates against aminoacylated tRNAs is missing. Here we present the cryo-electron microscopy structure of RelA bound to the bacterial ribosome stalled with uncharged tRNA. The structure reveals that RelA utilizes a distinct binding site compared to the translational factors, with a multi-domain architecture that wraps around a highly distorted A-site tRNA. The TGS (ThrRS, GTPase and SpoT) domain of RelA binds the CCA tail to orient the free 3' hydroxyl group of the terminal adenosine towards a β-strand, such that an aminoacylated tRNA at this position would be sterically precluded. The structure supports a model in which association of RelA with the ribosome suppresses auto-inhibition to activate synthesis of (p)ppGpp and initiate the stringent response. Since stringent control is responsible for the survival of pathogenic bacteria under stress conditions, and contributes to chronic infections and antibiotic tolerance, RelA represents a good target for the development of novel antibacterial therapeutics. PMID:27279228

  1. Functions of ribosomal proteins in assembly of eukaryotic ribosomes in vivo.

    PubMed

    de la Cruz, Jesús; Karbstein, Katrin; Woolford, John L

    2015-01-01

    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79-80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type-specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

  2. Functions of Ribosomal Proteins in Assembly of Eukaryotic Ribosomes In Vivo

    PubMed Central

    2016-01-01

    The proteome of cells is synthesized by ribosomes, complex ribonucleoproteins that in eukaryotes contain 79–80 proteins and four ribosomal RNAs (rRNAs) more than 5,400 nucleotides long. How these molecules assemble together and how their assembly is regulated in concert with the growth and proliferation of cells remain important unanswered questions. Here, we review recently emerging principles to understand how eukaryotic ribosomal proteins drive ribosome assembly in vivo. Most ribosomal proteins assemble with rRNA cotranscriptionally; their association with nascent particles is strengthened as assembly proceeds. Each subunit is assembled hierarchically by sequential stabilization of their subdomains. The active sites of both subunits are constructed last, perhaps to prevent premature engagement of immature ribosomes with active subunits. Late-assembly intermediates undergo quality-control checks for proper function. Mutations in ribosomal proteins that affect mostly late steps lead to ribosomopathies, diseases that include a spectrum of cell type–specific disorders that often transition from hypoproliferative to hyperproliferative growth. PMID:25706898

  3. Modular domains of the Dicistroviridae intergenic internal ribosome entry site

    PubMed Central

    Jang, Christopher J.; Jan, Eric

    2010-01-01

    The intergenic region internal ribosome entry site (IGR IRES) of the Dicistroviridae viral family can directly assemble 80S ribosomes and initiate translation at a non-AUG codon from the ribosomal A-site. These functions are directed by two independently folded domains of the IGR IRES. One domain, composed of overlapping pseudoknots II and III (PKII/III), mediates ribosome recruitment. The second domain, composed of PKI, mimics a tRNA anticodon–codon interaction to position the ribosome at the ribosomal A-site. Although adopting a common secondary structure, the dicistrovirus IGR IRESs can be grouped into two classes based on distinct features within each domain. In this study, we report on the modularity of the IGR IRESs and show that the ribosome-binding domain and the tRNA anticodon mimicry domain are functionally interchangeable between the Type I and the Type II IGR IRESs. Using structural probing, ribosome-binding assays, and ribosome positioning analysis by toeprinting assays, we show that the chimeric IRESs fold properly, assemble 80S ribosomes, and can mediate IRES translation in rabbit reticulocyte lysates. We also demonstrate that the chimeric IRESs can stimulate the ribosome-dependent GTPase activity of eEF2, which suggests that the ribosome is primed for a step downstream from IRES binding. Overall, the results demonstrate that the dicistrovirus IGR IRESs are composed of two modular domains that work in concert to manipulate the ribosome and direct translation initiation. PMID:20423979

  4. The Fragmented Mitochondrial Ribosomal RNAs of Plasmodium falciparum

    PubMed Central

    Feagin, Jean E.; Harrell, Maria Isabel; Lee, Jung C.; Coe, Kevin J.; Sands, Bryan H.; Cannone, Jamie J.; Tami, Germaine; Schnare, Murray N.; Gutell, Robin R.

    2012-01-01

    Background The mitochondrial genome in the human malaria parasite Plasmodium falciparum is most unusual. Over half the genome is composed of the genes for three classic mitochondrial proteins: cytochrome oxidase subunits I and III and apocytochrome b. The remainder encodes numerous small RNAs, ranging in size from 23 to 190 nt. Previous analysis revealed that some of these transcripts have significant sequence identity with highly conserved regions of large and small subunit rRNAs, and can form the expected secondary structures. However, these rRNA fragments are not encoded in linear order; instead, they are intermixed with one another and the protein coding genes, and are coded on both strands of the genome. This unorthodox arrangement hindered the identification of transcripts corresponding to other regions of rRNA that are highly conserved and/or are known to participate directly in protein synthesis. Principal Findings The identification of 14 additional small mitochondrial transcripts from P. falcipaurm and the assignment of 27 small RNAs (12 SSU RNAs totaling 804 nt, 15 LSU RNAs totaling 1233 nt) to specific regions of rRNA are supported by multiple lines of evidence. The regions now represented are highly similar to those of the small but contiguous mitochondrial rRNAs of Caenorhabditis elegans. The P. falciparum rRNA fragments cluster on the interfaces of the two ribosomal subunits in the three-dimensional structure of the ribosome. Significance All of the rRNA fragments are now presumed to have been identified with experimental methods, and nearly all of these have been mapped onto the SSU and LSU rRNAs. Conversely, all regions of the rRNAs that are known to be directly associated with protein synthesis have been identified in the P. falciparum mitochondrial genome and RNA transcripts. The fragmentation of the rRNA in the P. falciparum mitochondrion is the most extreme example of any rRNA fragmentation discovered. PMID:22761677

  5. Both endonucleolytic and exonucleolytic cleavage mediate ITS1 removal during human ribosomal RNA processing.

    PubMed

    Sloan, Katherine E; Mattijssen, Sandy; Lebaron, Simon; Tollervey, David; Pruijn, Ger J M; Watkins, Nicholas J

    2013-03-01

    Human ribosome production is up-regulated during tumorogenesis and is defective in many genetic diseases (ribosomopathies). We have undertaken a detailed analysis of human precursor ribosomal RNA (pre-rRNA) processing because surprisingly little is known about this important pathway. Processing in internal transcribed spacer 1 (ITS1) is a key step that separates the rRNA components of the large and small ribosomal subunits. We report that this was initiated by endonuclease cleavage, which required large subunit biogenesis factors. This was followed by 3' to 5' exonucleolytic processing by RRP6 and the exosome, an enzyme complex not previously linked to ITS1 removal. In contrast, RNA interference-mediated knockdown of the endoribonuclease MRP did not result in a clear defect in ITS1 processing. Despite the apparently high evolutionary conservation of the pre-rRNA processing pathway and ribosome synthesis factors, each of these features of human ITS1 processing is distinct from those in budding yeast. These results also provide significant insight into the links between ribosomopathies and ribosome production in human cells. PMID:23439679

  6. Detecting ricin: sensitive luminescent assay for ricin A-chain ribosome depurination kinetics.

    PubMed

    Sturm, Matthew B; Schramm, Vern L

    2009-04-15

    Ricin is a family member of the lethal ribosome-inactivating proteins (RIP) found in plants. Ricin toxin A-chain (RTA) from castor beans catalyzes the hydrolytic depurination of a single base from a GAGA tetraloop of eukaryotic rRNA to release a single adenine from the sarcin-ricin loop (SRL). Protein synthesis is inhibited by loss of the elongation factor binding site resulting in cell death. We report a sensitive coupled assay for the measurement of adenine released from ribosomes or small stem-loop RNAs by RTA catalysis. Adenine phosphoribosyl transferase (APRTase) and pyruvate orthophosphate dikinase (PPDK) convert adenine to ATP for quantitation by firefly luciferase. The resulting AMP is cycled to ATP to give sustained luminescence proportional to adenine concentration. Subpicomole adenine quantitation permits the action of RTA on eukaryotic ribosomes to be followed in continuous, high-throughput assays. Facile analysis of RIP catalytic activity will have applications in plant toxin detection, inhibitor screens, mechanistic analysis of depurinating agents on oligonucleotides and intact ribosomes, and in cancer immunochemotherapy. Kinetic analysis of the catalytic action of RTA on rabbit reticulocyte 80S ribosomes establishes a catalytic efficiency of 2.6 x 10(8) M(-1) s(-1), a diffusion limited reaction indicating catalytic perfection even with large reactants. PMID:19364139

  7. Structures of the human and Drosophila 80S ribosome.

    PubMed

    Anger, Andreas M; Armache, Jean-Paul; Berninghausen, Otto; Habeck, Michael; Subklewe, Marion; Wilson, Daniel N; Beckmann, Roland

    2013-05-01

    Protein synthesis in all cells is carried out by macromolecular machines called ribosomes. Although the structures of prokaryotic, yeast and protist ribosomes have been determined, the more complex molecular architecture of metazoan 80S ribosomes has so far remained elusive. Here we present structures of Drosophila melanogaster and Homo sapiens 80S ribosomes in complex with the translation factor eEF2, E-site transfer RNA and Stm1-like proteins, based on high-resolution cryo-electron-microscopy density maps. These structures not only illustrate the co-evolution of metazoan-specific ribosomal RNA with ribosomal proteins but also reveal the presence of two additional structural layers in metazoan ribosomes, a well-ordered inner layer covered by a flexible RNA outer layer. The human and Drosophila ribosome structures will provide the basis for more detailed structural, biochemical and genetic experiments. PMID:23636399

  8. Mutational analysis of S12 protein and implications for the accuracy of decoding by the ribosome

    PubMed Central

    Sharma, Divya; Cukras, Anthony R.; Rogers, Elizabeth J.; Southworth, Daniel R.; Green, Rachel

    2007-01-01

    The fidelity of aminoacyl-tRNA selection by the ribosome depends on a conformational switch in the decoding center of the small ribosomal subunit induced by cognate but not by near-cognate aminoacyl tRNA. The aminoglycosides paromomycin and streptomycin bind to the decoding center and induce related structural rearrangements that explain their observed effects on miscoding. Structural and biochemical studies have identified ribosomal protein S12 (as well as specific nucleotides in 16S rRNA) as a critical molecular contributor in distinguishing between cognate and near-cognate tRNA species as well as in promoting more global rearrangements in the small subunit referred to as “closure”. Here we use a mutational approach to define contributions made by two highly conserved loops in S12 to the process of tRNA selection. Most S12 variant ribosomes tested display increased levels of fidelity (a “restrictive” phenotype). Interestingly, several variants, K42A and R53A, were substantially resistant to the miscoding effects of paromomycin. Further characterization of the compromised paromomycin response identified a probable second, fidelity modulating binding site for paromomycin in the 16S rRNA that facilitates closure of the small subunit and compensates for defects associated with the S12 mutations. PMID:17967466

  9. The structures of the anti-tuberculosis antibiotics viomycin and capreomycin bound to the 70S ribosome

    SciTech Connect

    Stanley, Robin E.; Blaha, Gregor; Grodzicki, Robert L.; Strickler, Michael D.; Steitz, Thomas A.

    2010-05-03

    Viomycin and capreomycin belong to the tuberactinomycin family of antibiotics, which are among the most effective antibiotics against multidrug-resistant tuberculosis. Here we present two crystal structures of the 70S ribosome in complex with three tRNAs and bound to either viomycin or capreomycin at 3.3- and 3.5-{angstrom} resolution, respectively. Both antibiotics bind to the same site on the ribosome, which lies at the interface between helix 44 of the small ribosomal subunit and helix 69 of the large ribosomal subunit. The structures of these complexes suggest that the tuberactinomycins inhibit translocation by stabilizing the tRNA in the A site in the pretranslocation state. In addition, these structures show that the tuberactinomycins bind adjacent to the binding sites for the paromomycin and hygromycin B antibiotics, which may enable the development of new derivatives of tuberactinomycins that are effective against drug-resistant strains.

  10. The Structure of the Anti-tuberculosis Antibiotics Viomycin and Capreomycin Bound to the 70S Ribosome

    SciTech Connect

    Stanley, R.; Blaha, G; Grodzicki, R; Strickler, M; Steitz, T

    2010-01-01

    Viomycin and capreomycin belong to the tuberactinomycin family of antibiotics, which are among the most effective antibiotics against multidrug-resistant tuberculosis. Here we present two crystal structures of the 70S ribosome in complex with three tRNAs and bound to either viomycin or capreomycin at 3.3- and 3.5-{angstrom} resolution, respectively. Both antibiotics bind to the same site on the ribosome, which lies at the interface between helix 44 of the small ribosomal subunit and helix 69 of the large ribosomal subunit. The structures of these complexes suggest that the tuberactinomycins inhibit translocation by stabilizing the tRNA in the A site in the pretranslocation state. In addition, these structures show that the tuberactinomycins bind adjacent to the binding sites for the paromomycin and hygromycin B antibiotics, which may enable the development of new derivatives of tuberactinomycins that are effective against drug-resistant strains.

  11. Inferring the Ancient History of the Translation Machinery and Genetic Code via Recapitulation of Ribosomal Subunit Assembly Orders

    PubMed Central

    Fournier, Gregory P.; Neumann, Justin E.; Gogarten, J. Peter

    2010-01-01

    Universally conserved positions in ribosomal proteins have significant biases in amino acid usage, likely indicating the expansion of the genetic code at the time leading up to the most recent common ancestor(s) (MRCA). Here, we apply this principle to the evolutionary history of the ribosome before the MRCA. It has been proposed that the experimentally determined order of assembly for ribosomal subunits recapitulates their evolutionary chronology. Given this model, we produce a probabilistic evolutionary ordering of the universally conserved small subunit (SSU) and large subunit (LSU) ribosomal proteins. Optimizing the relative ordering of SSU and LSU evolutionary chronologies with respect to minimizing differences in amino acid usage bias, we find strong compositional evidence for a more ancient origin for early LSU proteins. Furthermore, we find that this ordering produces several trends in specific amino acid usages compatible with models of genetic code evolution. PMID:20208990

  12. Two thraustochytrid 5S ribosomal RNAs.

    PubMed Central

    MacKay, R M; Doolittle, W F

    1982-01-01

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  13. Two thraustochytrid 5S ribosomal RNAs.

    PubMed

    MacKay, R M; Doolittle, W F

    1982-12-20

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  14. Release of Nonstop Ribosomes Is Essential

    PubMed Central

    Feaga, Heather A.; Viollier, Patrick H.

    2014-01-01

    ABSTRACT Bacterial ribosomes frequently translate to the 3′ end of an mRNA without terminating at a stop codon. Almost all bacteria use the transfer-messenger RNA (tmRNA)-based trans-translation pathway to release these “nonstop” ribosomes and maintain protein synthesis capacity. trans-translation is essential in some species, but in others, such as Caulobacter crescentus, trans-translation can be inactivated. To determine why trans-translation is dispensable in C. crescentus, a Tn-seq screen was used to identify genes that specifically alter growth in cells lacking ssrA, the gene encoding tmRNA. One of these genes, CC1214, was essential in ΔssrA cells. Purified CC1214 protein could release nonstop ribosomes in vitro. CC1214 is a homolog of the Escherichia coli ArfB protein, and using the CC1214 sequence, ArfB homologs were identified in the majority of bacterial phyla. Most species in which ssrA has been deleted contain an ArfB homolog, suggesting that release of nonstop ribosomes may be essential in most or all bacteria. PMID:25389176

  15. Modeling Interactions of Erythromycin Derivatives with Ribosomes.

    PubMed

    Shishkina, A V; Makarova, T M; Tereshchenkov, A G; Makarov, G I; Korshunova, G A; Bogdanov, A A

    2015-11-01

    Using a method of static simulation, a series of erythromycin A analogs was designed with aldehyde functions introduced instead of one of the methyl substituents in the 3'-N-position of the antibiotic that was potentially capable of forming a covalent bond with an amino group of one of the nucleotide residues of the 23S rRNA in the ribosomal exit tunnel. Similar interaction is observed for antibiotics of the tylosin series, which bind tightly to the large ribosomal subunit and demonstrate high antibacterial activity. Binding of novel erythromycin derivatives with the bacterial ribosome was investigated with the method of fluorescence polarization. It was found that the erythromycin analog containing a 1-methyl-3-oxopropyl group in the 3'-N-position demonstrates the best binding. Based on the ability to inhibit protein biosynthesis, it is on the same level as erythromycin, and it is significantly better than desmethyl-erythromycin. Molecular dynamic modeling of complexes of the derivatives with ribosomes was conducted to explain the observed effects. PMID:26615442

  16. Promoter architectures in the yeast ribosomal expression program

    PubMed Central

    Bosio, Maria Cristina; Negri, Rodolfo

    2011-01-01

    Ribosome biogenesis begins with the orchestrated expression of hundreds of genes, including the three large classes of ribosomal protein, ribosome biogenesis and snoRNA genes. Current knowledge about the corresponding promoters suggests the existence of novel class-specific transcriptional strategies and crosstalk between telomere length and cell growth control. PMID:21468232

  17. Taura syndrome virus IRES initiates translation by binding its tRNA-mRNA–like structural element in the ribosomal decoding center

    PubMed Central

    Koh, Cha San; Brilot, Axel F.; Grigorieff, Nikolaus; Korostelev, Andrei A.

    2014-01-01

    In cap-dependent translation initiation, the open reading frame (ORF) of mRNA is established by the placement of the AUG start codon and initiator tRNA in the ribosomal peptidyl (P) site. Internal ribosome entry sites (IRESs) promote translation of mRNAs in a cap-independent manner. We report two structures of the ribosome-bound Taura syndrome virus (TSV) IRES belonging to the family of Dicistroviridae intergenic IRESs. Intersubunit rotational states differ in these structures, suggesting that ribosome dynamics play a role in IRES translocation. Pseudoknot I of the IRES occupies the ribosomal decoding center at the aminoacyl (A) site in a manner resembling that of the tRNA anticodon-mRNA codon. The structures reveal that the TSV IRES initiates translation by a previously unseen mechanism, which is conceptually distinct from initiator tRNA-dependent mechanisms. Specifically, the ORF of the IRES-driven mRNA is established by the placement of the preceding tRNA-mRNA–like structure in the A site, whereas the 40S P site remains unoccupied during this initial step. PMID:24927574

  18. Ribosomal Protein S6 Phosphorylation in the Nervous System: From Regulation to Function

    PubMed Central

    Biever, Anne; Valjent, Emmanuel; Puighermanal, Emma

    2015-01-01

    Since the discovery of the phosphorylation of the 40S ribosomal protein S6 (rpS6) about four decades ago, much effort has been made to uncover the molecular mechanisms underlying the regulation of this post-translational modification. In the field of neuroscience, rpS6 phosphorylation is commonly used as a readout of the mammalian target of rapamycin complex 1 signaling activation or as a marker for neuronal activity. Nevertheless, its biological role in neurons still remains puzzling. Here we review the pharmacological and physiological stimuli regulating this modification in the nervous system as well as the pathways that transduce these signals into rpS6 phosphorylation. Altered rpS6 phosphorylation observed in various genetic and pathophysiological mouse models is also discussed. Finally, we examine the current state of knowledge on the physiological role of this post-translational modification and highlight the questions that remain to be addressed. PMID:26733799

  19. Introns regulate the production of ribosomal proteins by modulating splicing of duplicated ribosomal protein genes

    PubMed Central

    Petibon, Cyrielle; Parenteau, Julie; Catala, Mathieu; Elela, Sherif Abou

    2016-01-01

    Most budding yeast introns exist in the many duplicated ribosomal protein genes (RPGs) and it has been posited that they remain there to modulate the expression of RPGs and cell growth in response to stress. However, the mechanism by which introns regulate the expression of RPGs and their impact on the synthesis of ribosomal proteins remain unclear. In this study, we show that introns determine the ratio of ribosomal protein isoforms through asymmetric paralog-specific regulation of splicing. Exchanging the introns and 3′ untranslated regions of the duplicated RPS9 genes altered the splicing efficiency and changed the ratio of the ribosomal protein isoforms. Mutational analysis of the RPS9 genes indicated that splicing is regulated by variations in the intron structure and the 3′ untranslated region. Together these data suggest that preferential splicing of duplicated RPGs provides a means for adjusting the ratio of different ribosomal protein isoforms, while maintaining the overall expression level of each ribosomal protein. PMID:26945043

  20. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly.

    PubMed

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G

    2014-01-01

    Within a single generation time a growing yeast cell imports ∼14 million ribosomal proteins (r-proteins) into the nucleus for ribosome production. After import, it is unclear how these intrinsically unstable and aggregation-prone proteins are targeted to the ribosome assembly site in the nucleolus. Here, we report the discovery of a conserved nuclear carrier Tsr2 that coordinates transfer of the r-protein eS26 to the earliest assembling pre-ribosome, the 90S. In vitro studies revealed that Tsr2 efficiently dissociates importin:eS26 complexes via an atypical RanGTP-independent mechanism that terminates the import process. Subsequently, Tsr2 binds the released eS26, shields it from proteolysis, and ensures its safe delivery to the 90S pre-ribosome. We anticipate similar carriers-termed here escortins-to securely connect the nuclear import machinery with pathways that deposit r-proteins onto developing pre-ribosomal particles. PMID:25144938

  1. A RanGTP-independent mechanism allows ribosomal protein nuclear import for ribosome assembly

    PubMed Central

    Schütz, Sabina; Fischer, Ute; Altvater, Martin; Nerurkar, Purnima; Peña, Cohue; Gerber, Michaela; Chang, Yiming; Caesar, Stefanie; Schubert, Olga T; Schlenstedt, Gabriel; Panse, Vikram G

    2014-01-01

    Within a single generation time a growing yeast cell imports ∼14 million ribosomal proteins (r-proteins) into the nucleus for ribosome production. After import, it is unclear how these intrinsically unstable and aggregation-prone proteins are targeted to the ribosome assembly site in the nucleolus. Here, we report the discovery of a conserved nuclear carrier Tsr2 that coordinates transfer of the r-protein eS26 to the earliest assembling pre-ribosome, the 90S. In vitro studies revealed that Tsr2 efficiently dissociates importin:eS26 complexes via an atypical RanGTP-independent mechanism that terminates the import process. Subsequently, Tsr2 binds the released eS26, shields it from proteolysis, and ensures its safe delivery to the 90S pre-ribosome. We anticipate similar carriers—termed here escortins—to securely connect the nuclear import machinery with pathways that deposit r-proteins onto developing pre-ribosomal particles. DOI: http://dx.doi.org/10.7554/eLife.03473.001 PMID:25144938

  2. Arabidopsis protein arginine methyltransferase 3 is required for ribosome biogenesis by affecting precursor ribosomal RNA processing

    PubMed Central

    Hang, Runlai; Liu, Chunyan; Ahmad, Ayaz; Zhang, Yong; Lu, Falong; Cao, Xiaofeng

    2014-01-01

    Ribosome biogenesis is a fundamental and tightly regulated cellular process, including synthesis, processing, and assembly of rRNAs with ribosomal proteins. Protein arginine methyltransferases (PRMTs) have been implicated in many important biological processes, such as ribosome biogenesis. Two alternative precursor rRNA (pre-rRNA) processing pathways coexist in yeast and mammals; however, how PRMT affects ribosome biogenesis remains largely unknown. Here we show that Arabidopsis PRMT3 (AtPRMT3) is required for ribosome biogenesis by affecting pre-rRNA processing. Disruption of AtPRMT3 results in pleiotropic developmental defects, imbalanced polyribosome profiles, and aberrant pre-rRNA processing. We further identify an alternative pre-rRNA processing pathway in Arabidopsis and demonstrate that AtPRMT3 is required for the balance of these two pathways to promote normal growth and development. Our work uncovers a previously unidentified function of PRMT in posttranscriptional regulation of rRNA, revealing an extra layer of complexity in the regulation of ribosome biogenesis. PMID:25352672

  3. Immature large ribosomal subunits containing the 7S pre-rRNA can engage in translation in Saccharomyces cerevisiae.

    PubMed

    Rodríguez-Galán, Olga; García-Gómez, Juan J; Kressler, Dieter; de la Cruz, Jesús

    2015-01-01

    Evolution has provided eukaryotes with mechanisms that impede immature and/or aberrant ribosomes to engage in translation. These mechanisms basically either prevent the nucleo-cytoplasmic export of these particles or, once in the cytoplasm, the release of associated assembly factors, which interfere with the binding of translation initiation factors and/or the ribosomal subunit joining. We have previously shown that aberrant yeast 40S ribosomal subunits containing the 20S pre-rRNA can engage in translation. In this study, we describe that cells harbouring the dob1-1 allele, encoding a mutated version of the exosome-assisting RNA helicase Mtr4, accumulate otherwise nuclear pre-60S ribosomal particles containing the 7S pre-rRNA in the cytoplasm. Polysome fractionation analyses revealed that these particles are competent for translation and do not induce elongation stalls. This phenomenon is rather specific since most mutations in other exosome components or co-factors, impairing the 3' end processing of the mature 5.8S rRNA, accumulate 7S pre-rRNAs in the nucleus. In addition, we confirm that pre-60S ribosomal particles containing either 5.8S + 30 or 5.8S + 5 pre-rRNAs also engage in translation elongation. We propose that 7S pre-rRNA processing is not strictly required for pre-60S r-particle export and that, upon arrival in the cytoplasm, there is no specific mechanism to prevent translation by premature pre-60S r-particles containing 3' extended forms of mature 5.8S rRNA. PMID:26151772

  4. TORC1 and TORC2 work together to regulate ribosomal protein S6 phosphorylation in Saccharomyces cerevisiae.

    PubMed

    Yerlikaya, Seda; Meusburger, Madeleine; Kumari, Romika; Huber, Alexandre; Anrather, Dorothea; Costanzo, Michael; Boone, Charles; Ammerer, Gustav; Baranov, Pavel V; Loewith, Robbie

    2016-01-15

    Nutrient-sensitive phosphorylation of the S6 protein of the 40S subunit of the eukaryote ribosome is highly conserved. However, despite four decades of research, the functional consequences of this modification remain unknown. Revisiting this enigma in Saccharomyces cerevisiae, we found that the regulation of Rps6 phosphorylation on Ser-232 and Ser-233 is mediated by both TOR complex 1 (TORC1) and TORC2. TORC1 regulates phosphorylation of both sites via the poorly characterized AGC-family kinase Ypk3 and the PP1 phosphatase Glc7, whereas TORC2 regulates phosphorylation of only the N-terminal phosphosite via Ypk1. Cells expressing a nonphosphorylatable variant of Rps6 display a reduced growth rate and a 40S biogenesis defect, but these phenotypes are not observed in cells in which Rps6 kinase activity is compromised. Furthermore, using polysome profiling and ribosome profiling, we failed to uncover a role of Rps6 phosphorylation in either global translation or translation of individual mRNAs. Taking the results together, this work depicts the signaling cascades orchestrating Rps6 phosphorylation in budding yeast, challenges the notion that Rps6 phosphorylation plays a role in translation, and demonstrates that observations made with Rps6 knock-ins must be interpreted cautiously. PMID:26582391

  5. The linkage between ribosomal crystallography, metal ions, heteropolytungstates and functional flexibility

    NASA Astrophysics Data System (ADS)

    Bashan, Anat; Yonath, Ada

    2008-11-01

    Crystallography of ribosomes, the universal cell nucleoprotein assemblies facilitating the translation of the genetic-code into proteins, met with severe problems owing to the large size, complex structure, inherent flexibility and high conformational variability of the ribosome. For the case of the small ribosomal subunit, which caused extreme difficulties, post-crystallization treatment by minute amounts of a heteropolytungstate cluster allowed structure determination at atomic resolution. This cluster played a dual role: providing anomalous phasing power and dramatically increased the resolution, by stabilization of a selected functional conformation. Thus, four out of the fourteen clusters that bind to each of the crystallized small subunits are attached to a specific ribosomal protein in a fashion that may control a significant component of the subunit internal flexibility, by "gluing" symmetrical related subunits. Here, we highlight basic issues in the relationship between metal ions and macromolecules and present common traits controlling in the interactions between polymetalates and various macromolecules, which may be extended towards the exploitation of polymetalates for therapeutical treatment.

  6. Inhibitors of Ribosome Rescue Arrest Growth of Francisella tularensis at All Stages of Intracellular Replication.

    PubMed

    Goralski, Tyler D P; Dewan, Kalyan K; Alumasa, John N; Avanzato, Victoria; Place, David E; Markley, Rachel L; Katkere, Bhuvana; Rabadi, Seham M; Bakshi, Chandra Shekhar; Keiler, Kenneth C; Kirimanjeswara, Girish S

    2016-06-01

    Bacteria require at least one pathway to rescue ribosomes stalled at the ends of mRNAs. The primary pathway for ribosome rescue is trans-translation, which is conserved in >99% of sequenced bacterial genomes. Some species also have backup systems, such as ArfA or ArfB, which can rescue ribosomes in the absence of sufficient trans-translation activity. Small-molecule inhibitors of ribosome rescue have broad-spectrum antimicrobial activity against bacteria grown in liquid culture. These compounds were tested against the tier 1 select agent Francisella tularensis to determine if they can limit bacterial proliferation during infection of eukaryotic cells. The inhibitors KKL-10 and KKL-40 exhibited exceptional antimicrobial activity against both attenuated and fully virulent strains of F. tularensis in vitro and during ex vivo infection. Addition of KKL-10 or KKL-40 to macrophages or liver cells at any time after infection by F. tularensis prevented further bacterial proliferation. When macrophages were stimulated with the proinflammatory cytokine gamma interferon before being infected by F. tularensis, addition of KKL-10 or KKL-40 reduced intracellular bacteria by >99%, indicating that the combination of cytokine-induced stress and a nonfunctional ribosome rescue pathway is fatal to F. tularensis Neither KKL-10 nor KKL-40 was cytotoxic to eukaryotic cells in culture. These results demonstrate that ribosome rescue is required for F. tularensis growth at all stages of its infection cycle and suggest that KKL-10 and KKL-40 are good lead compounds for antibiotic development. PMID:26953190

  7. The Genes for Cytoplasmic Ribosomal Ribonucleic Acid in Higher Plants

    PubMed Central

    Scott, N. Steele; Ingle, J.

    1973-01-01

    The genes for cytoplasmic ribosomal RNA are partially resolved from the bulk of the DNA by CsCl equilibrium centrifugation. Although in some plants the buoyant density of the ribosomal RNA genes is as expected from the base composition of ribosomal RNA, others show a large discrepancy which cannot be due to the presence of low G-C spacer-DNA. The cross-hybridization observed with 1.3 and 0.7 × 106 molecular weight ribosomal RNAs and DNA, which varies greatly with different plant species, is not due to contamination of the ribosomal RNAs, and is specific for the ribosomal DNA of each species, probably largely restricted to those sequences coding for the two stable ribosomal RNAs. The double reciprocal plot may be used for the extrapolation of saturation values only with caution, because in these cases such plots are not linear over the whole of the hybridization reaction. PMID:16658392

  8. BUD22 Affects Ty1 Retrotransposition and Ribosome Biogenesis in Saccharomyces cerevisiae

    PubMed Central

    Dakshinamurthy, Arun; Nyswaner, Katherine M.; Farabaugh, Philip J.; Garfinkel, David J.

    2010-01-01

    A variety of cellular factors affect the movement of the retrovirus-like transposon Ty1. To identify genes involved in Ty1 virus-like particle (VLP) function, the level of the major capsid protein (Gag-p45) and its proteolytic precursor (Gag-p49p) was monitored in a subset of Ty1 cofactor mutants. Twenty-nine of 87 mutants contained alterations in the level of Gag; however, only bud22Δ showed a striking defect in Gag processing. BUD22 affected the +1 translational frameshifting event required to express the Pol proteins protease, integrase, and reverse transcriptase. Therefore, it is possible that the bud22Δ mutant may not produce enough functional Ty1 protease to completely process Gag-p49 to p45. Furthermore, BUD22 is required for 18S rRNA processing and 40S subunit biogenesis and influences polysome density. Together our results suggest that BUD22 is involved in a step in ribosome biogenesis that not only affects general translation, but also may alter the frameshifting efficiency of ribosomes, an event central to Ty1 retrotransposition. PMID:20498295

  9. Phosphorylation of ribosomal protein S6 in the aquatic fungus Blastocladiella emersonii.

    PubMed

    Bonato, M C; da Silva, A M; Maia, J C; Juliani, M H

    1984-11-01

    The changes in the degree of phosphorylation of ribosomal protein S6 during the life cycle of the aquatic fungus Blastocladiella emersonii were analyzed by two-dimensional gel electrophoresis. Three phosphorylated derivatives of S6 are present throughout the entire life cycle. However, under certain germination conditions, more highly phosphorylated derivatives of S6 appear. Nonetheless, the resumption of protein synthesis that occurs during germination is not dependent on those highly phosphorylated derivatives of S6. The pattern and sites of phosphorylation of S6 labelled in vivo with [32P]orthophosphate have been compared with those of 40S ribosomal subunit labelled in vitro by partially purified protein kinases. Three major phosphopeptides were found in S6 isolated from the zoospore, while six phosphopeptides were found after zoospore germination (in germling cells). The phosphopeptide patterns of S6 phosphorylated by the cAMP-dependent protein kinase and by casein kinases I and II were completely distinct. Only the cAMP-dependent protein kinase gives rise to a phosphopeptide found in 32P-labelled cells, indicating that one of sites phosphorylated in vivo is also phosphorylated in vitro by the cAMP-dependent protein kinase. PMID:6092077

  10. Key Inter-molecular Interactions in the E. Coli 70S Ribosome Revealed by Coarse-Grained Analysis

    PubMed Central

    Zhang, Zhiyong; Sanbonmatsu, Karissa Y.; Voth, Gregory A.

    2011-01-01

    The ribosome is a very large complex, which consists of many RNA and protein molecules and plays a central role in protein biosynthesis in all organisms. Extensive interactions between different molecules are critical to ribosomal functional dynamics. In this work, inter-molecular interactions in the E. coli 70S ribosome are investigated by coarse-grained (CG) analysis. CG models are defined to preserve dynamic domains in RNAs and proteins, and capture functional motions in the ribosome, then the CG sites are connected by harmonic springs and spring constants are obtained by matching the computed fluctuations to those of an all-atom molecular dynamics (MD) simulation. Those spring constants indicate how strong the interactions are between the ribosomal components, which are in good agreement with various experimental data. Nearly all of bridges between the small and large ribosomal subunits are indicated by CG interactions with large spring constants. The head of the small subunit is very mobile because it has the minimal CG interactions with the rest of the subunit; However, a large number of small subunit proteins bind to maintain the internal structure of the head. The results show a clear connection between the inter-molecular interactions and the structural and functional properties of the ribosome because of the reduced complexity in domain-based CG models. The present approach also provides a useful strategy to map interactions between molecules within large biomolecular complexes since it is not straightforward to investigate these by either atomistic MD simulations or residue-based elastic network models. PMID:21910449

  11. Cooling-induced SUMOylation of EXOSC10 down-regulates ribosome biogenesis.

    PubMed

    Knight, John R P; Bastide, Amandine; Peretti, Diego; Roobol, Anne; Roobol, Jo; Mallucci, Giovanna R; Smales, C Mark; Willis, Anne E

    2016-04-01

    The RNA exosome is essential for 3' processing of functional RNA species and degradation of aberrant RNAs in eukaryotic cells. Recent reports have defined the substrates of the exosome catalytic domains and solved the multimeric structure of the exosome complex. However, regulation of exosome activity remains poorly characterized, especially in response to physiological stress. Following the observation that cooling of mammalian cells results in a reduction in 40S:60S ribosomal subunit ratio, we uncover regulation of the nuclear exosome as a result of reduced temperature. Using human cells and an in vivo model system allowing whole-body cooling, we observe reduced EXOSC10 (hRrp6, Pm/Scl-100) expression in the cold. In parallel, both models of cooling increase global SUMOylation, leading to the identification of specific conjugation of SUMO1 to EXOSC10, a process that is increased by cooling. Furthermore, we define the major SUMOylation sites in EXOSC10 by mutagenesis and show that overexpression of SUMO1 alone is sufficient to suppress EXOSC10 abundance. Reducing EXOSC10 expression by RNAi in human cells correlates with the 3' preribosomal RNA processing defects seen in the cold as well as reducing the 40S:60S ratio, a previously uncharacterized consequence of EXOSC10 suppression. Together, this work illustrates that EXOSC10 can be modified by SUMOylation and identifies a physiological stress where this regulation is prevalent both in vitro and in vivo. PMID:26857222

  12. Cooling-induced SUMOylation of EXOSC10 down-regulates ribosome biogenesis

    PubMed Central

    Bastide, Amandine; Peretti, Diego; Roobol, Anne; Roobol, Jo; Mallucci, Giovanna R.; Smales, C. Mark; Willis, Anne E.

    2016-01-01

    The RNA exosome is essential for 3′ processing of functional RNA species and degradation of aberrant RNAs in eukaryotic cells. Recent reports have defined the substrates of the exosome catalytic domains and solved the multimeric structure of the exosome complex. However, regulation of exosome activity remains poorly characterized, especially in response to physiological stress. Following the observation that cooling of mammalian cells results in a reduction in 40S:60S ribosomal subunit ratio, we uncover regulation of the nuclear exosome as a result of reduced temperature. Using human cells and an in vivo model system allowing whole-body cooling, we observe reduced EXOSC10 (hRrp6, Pm/Scl-100) expression in the cold. In parallel, both models of cooling increase global SUMOylation, leading to the identification of specific conjugation of SUMO1 to EXOSC10, a process that is increased by cooling. Furthermore, we define the major SUMOylation sites in EXOSC10 by mutagenesis and show that overexpression of SUMO1 alone is sufficient to suppress EXOSC10 abundance. Reducing EXOSC10 expression by RNAi in human cells correlates with the 3′ preribosomal RNA processing defects seen in the cold as well as reducing the 40S:60S ratio, a previously uncharacterized consequence of EXOSC10 suppression. Together, this work illustrates that EXOSC10 can be modified by SUMOylation and identifies a physiological stress where this regulation is prevalent both in vitro and in vivo. PMID:26857222

  13. Global shape mimicry of tRNA within a viral internal ribosome entry site mediates translational reading frame selection

    PubMed Central

    Au, Hilda H.; Cornilescu, Gabriel; Mouzakis, Kathryn D.; Ren, Qian; Burke, Jordan E.; Lee, Seonghoon; Butcher, Samuel E.; Jan, Eric

    2015-01-01

    The dicistrovirus intergenic region internal ribosome entry site (IRES) adopts a triple-pseudoknotted RNA structure and occupies the core ribosomal E, P, and A sites to directly recruit the ribosome and initiate translation at a non-AUG codon. A subset of dicistrovirus IRESs directs translation in the 0 and +1 frames to produce the viral structural proteins and a +1 overlapping open reading frame called ORFx, respectively. Here we show that specific mutations of two unpaired adenosines located at the core of the three-helical junction of the honey bee dicistrovirus Israeli acute paralysis virus (IAPV) IRES PKI domain can uncouple 0 and +1 frame translation, suggesting that the structure adopts distinct conformations that contribute to 0 or +1 frame translation. Using a reconstituted translation system, we show that ribosomes assembled on mutant IRESs that direct exclusive 0 or +1 frame translation lack reading frame fidelity. Finally, a nuclear magnetic resonance/small-angle X-ray scattering hybrid approach reveals that the PKI domain of the IAPV IRES adopts an RNA structure that resembles a complete tRNA. The tRNA shape-mimicry enables the viral IRES to gain access to the ribosome tRNA-binding sites and form intermolecular contacts with the ribosome that are necessary for initiating IRES translation in a specific reading frame. PMID:26554019

  14. Structure of trigger factor binding domain in biologically homologous complex with eubacterial ribosome reveals its chaperone action

    SciTech Connect

    Baram, David; Pyetan, Erez; Sittner, Assa; Auerbach-Nevo, Tamar; Bashan, Anat; Yonath, Ada

    2010-07-13

    Trigger factor (TF), the first chaperone in eubacteria to encounter the emerging nascent chain, binds to the large ribosomal subunit in the vicinity of the protein exit tunnel opening and forms a sheltered folding space. Here, we present the 3.5-{angstrom} crystal structure of the physiological complex of the large ribosomal subunit from the eubacterium Deinococcus radiodurans with the N-terminal domain of TF (TFa) from the same organism. For anchoring, TFa exploits a small ribosomal surface area in the vicinity of proteins L23 and L29, by using its 'signature motif' as well as additional structural elements. The molecular details of TFa interactions reveal that L23 is essential for the association of TF with the ribosome and may serve as a channel of communication with the nascent chain progressing in the tunnel. L29 appears to induce a conformational change in TFa, which results in the exposure of TFa hydrophobic patches to the opening of the ribosomal exit tunnel, thus increasing its affinity for hydrophobic segments of the emerging nascent polypeptide. This observation implies that, in addition to creating a protected folding space for the emerging nascent chain, TF association with the ribosome prevents aggregation by providing a competing hydrophobic environment and may be critical for attaining the functional conformation necessary for chaperone activity.

  15. Global shape mimicry of tRNA within a viral internal ribosome entry site mediates translational reading frame selection.

    PubMed

    Au, Hilda H; Cornilescu, Gabriel; Mouzakis, Kathryn D; Ren, Qian; Burke, Jordan E; Lee, Seonghoon; Butcher, Samuel E; Jan, Eric

    2015-11-24

    The dicistrovirus intergenic region internal ribosome entry site (IRES) adopts a triple-pseudoknotted RNA structure and occupies the core ribosomal E, P, and A sites to directly recruit the ribosome and initiate translation at a non-AUG codon. A subset of dicistrovirus IRESs directs translation in the 0 and +1 frames to produce the viral structural proteins and a +1 overlapping open reading frame called ORFx, respectively. Here we show that specific mutations of two unpaired adenosines located at the core of the three-helical junction of the honey bee dicistrovirus Israeli acute paralysis virus (IAPV) IRES PKI domain can uncouple 0 and +1 frame translation, suggesting that the structure adopts distinct conformations that contribute to 0 or +1 frame translation. Using a reconstituted translation system, we show that ribosomes assembled on mutant IRESs that direct exclusive 0 or +1 frame translation lack reading frame fidelity. Finally, a nuclear magnetic resonance/small-angle X-ray scattering hybrid approach reveals that the PKI domain of the IAPV IRES adopts an RNA structure that resembles a complete tRNA. The tRNA shape-mimicry enables the viral IRES to gain access to the ribosome tRNA-binding sites and form intermolecular contacts with the ribosome that are necessary for initiating IRES translation in a specific reading frame. PMID:26554019

  16. The Kissing-Loop T-Shaped Structure Translational Enhancer of Pea Enation Mosaic Virus Can Bind Simultaneously to Ribosomes and a 5′ Proximal Hairpin

    PubMed Central

    Gao, Feng; Gulay, Suna P.; Kasprzak, Wojciech; Dinman, Jonathan D.

    2013-01-01

    The Pea Enation Mosaic Virus (PEMV) 3′ translational enhancer, known as the kissing-loop T-shaped structure (kl-TSS), binds to 40S subunits, 60S subunits, and 80S ribosomes, whereas the Turnip crinkle virus (TCV) TSS binds only to 60S subunits and 80S ribosomes. Using electrophoretic mobility gel shift assay (EMSA)-based competition assays, the kl-TSS was found to occupy a different site in the ribosome than the P-site-binding TCV TSS, suggesting that these two TSS employ different mechanisms for enhancing translation. The kl-TSS also engages in a stable, long-distance RNA-RNA kissing-loop interaction with a 12-bp 5′-coding-region hairpin that does not alter the structure of the kl-TSS as revealed by molecular dynamics simulations. Addition of the kl-TSS in trans to a luciferase reporter construct containing either wild-type or mutant 5′ and 3′ PEMV sequences suppressed translation, suggesting that the kl-TSS is required in cis to function, and both ribosome-binding and RNA interaction activities of the kl-TSS contributed to translational inhibition. Addition of the kl-TSS was more detrimental for translation than an adjacent eIF4E-binding 3′ translational enhancer known as the PTE, suggesting that the PTE may support the ribosome-binding function of the kl-TSS. Results of in-line RNA structure probing, ribosome filter binding, and high-throughput selective 2′-hydroxyl acylation analyzed by primer extension (hSHAPE) of rRNAs within bound ribosomes suggest that kl-TSS binding to ribosomes and binding to the 5′ hairpin are compatible activities. These results suggest a model whereby posttermination ribosomes/ribosomal subunits bind to the kl-TSS and are delivered to the 5′ end of the genome via the associated RNA-RNA interaction, which enhances the rate of translation reinitiation. PMID:23986599

  17. Ribosomal Mutations in Streptococcus pneumoniae Clinical Isolates

    PubMed Central

    Pihlajamäki, Marja; Kataja, Janne; Seppälä, Helena; Elliot, John; Leinonen, Maija; Huovinen, Pentti; Jalava, Jari

    2002-01-01

    Eleven clinical isolates of Streptococcus pneumoniae, isolated in Finland during 1996 to 2000, had an unusual macrolide resistance phenotype. They were resistant to macrolides and streptogramin B but susceptible, intermediate, or low-level resistant to lincosamides. No acquired macrolide resistance genes were detected from the strains. The isolates were found to have mutations in domain V of the 23S rRNA or ribosomal protein L4. Seven isolates had an A2059C mutation in two to four out of the four alleles encoding the 23S rRNA, two isolates had an A2059G mutation in two alleles, one isolate had a C2611G mutation in all four alleles, and one isolate had a 69GTG71-to-69TPS71 substitution in ribosomal protein L4. PMID:11850244

  18. Navigating the ribosome's metastable energy landscape.

    PubMed

    Munro, James B; Sanbonmatsu, Kevin Y; Spahn, Christian M T; Blanchard, Scott C

    2009-08-01

    The molecular mechanisms by which tRNA molecules enter and transit the ribosome during mRNA translation remains elusive. However, recent genetic, biochemical and structural studies offer important new findings into the ordered sequence of events underpinning the translocation process that help place the molecular mechanism within reach. In particular, new structural and kinetic insights have been obtained regarding tRNA movements through 'hybrid state' configurations. These dynamic views reveal that the macromolecular ribosome particle, like many smaller proteins, has an intrinsic capacity to reversibly sample an ensemble of similarly stable native states. Such perspectives suggest that substrates, factors and environmental cues contribute to translation regulation by helping the dynamic system navigate through a highly complex and metastable energy landscape. PMID:19647434

  19. Disassembly of yeast 80S ribosomes into subunits is a concerted action of ribosome-assisted folding of denatured protein.

    PubMed

    Chakraborty, Biprashekhar; Bhakta, Sayan; Sengupta, Jayati

    2016-01-22

    It has been shown by several groups that ribosome can assist folding of denatured protein in vitro and the process is conserved across the species. Domain V of large ribosomal rRNA which occupies the intersubunit side of the large subunit was identified as the key player responsible for chaperoning the folding process. Thus, it is conceivable that denatured protein needs to access the intersubunit space of the ribosome in order to get folded. In this study, we have investigated the mechanism of release of the protein from the eukaryotic ribosome following reactivation. We have observed significant splitting of yeast 80S ribosome when incubated with the denatured BCAII protein. Energy-free disassembly mechanism functions in low Mg(+2) ion concentration for prokaryotic ribosomes. Eukaryotic ribosomes do not show significant splitting even at low Mg(+2) ion concentration. In this respect, denatured protein-induced disassembly of eukaryotic ribosome without the involvement of any external energy source is intriguing. For prokaryotic ribosomes, it was reported that the denatured protein induces ribosome splitting into subunits in order to access domain V-rRNA. In contrast, our results suggest an alternative mechanism for eukaryotic ribosomal rRNA-mediated protein folding and subsequent separation of the subunits by which release of the activated-protein occurs. PMID:26723252

  20. Conserved functional domains and a novel tertiary interaction near the pseudoknot drive translational activity of hepatitis C virus and hepatitis C virus-like internal ribosome entry sites

    PubMed Central

    Easton, Laura E.; Locker, Nicolas; Lukavsky, Peter J.

    2009-01-01

    The translational activity of the hepatitis C virus (HCV) internal ribosome entry site (IRES) and other HCV-like IRES RNAs depends on structured RNA elements in domains II and III, which serve to recruit the ribosomal 40S subunit, eukaryotic initiation factor (eIF) 3 and the ternary eIF2/Met-tRNAiMet/GTP complex and subsequently domain II assists subunit joining. Porcine teschovirus-1 talfan (PTV-1) is a member of the Picornaviridae family, with a predicted HCV-like secondary structure, but only stem-loops IIId and IIIe in the 40S-binding domain display significant sequence conservation with the HCV IRES. Here, we use chemical probing to show that interaction sites with the 40S subunit and eIF3 are conserved between HCV and HCV-like IRESs. In addition, we reveal the functional role of a strictly conserved co-variation between a purine–purine mismatch near the pseudoknot (A–A/G) and the loop sequence of domain IIIe (GAU/CA). These nucleotides are involved in a tertiary interaction, which serves to stabilize the pseudoknot structure and correlates with translational efficiency in both the PTV-1 and HCV IRES. Our data demonstrate conservation of functional domains in HCV and HCV-like IRESs including a more complex structure surrounding the pseudoknot than previously assumed. PMID:19596815

  1. Structure and Function of the Mitochondrial Ribosome.

    PubMed

    Greber, Basil J; Ban, Nenad

    2016-06-01

    Mitochondrial ribosomes (mitoribosomes) perform protein synthesis inside mitochondria, the organelles responsible for energy conversion and adenosine triphosphate production in eukaryotic cells. Throughout evolution, mitoribosomes have become functionally specialized for synthesizing mitochondrial membrane proteins, and this has been accompanied by large changes to their structure and composition. We review recent high-resolution structural data that have provided unprecedented insight into the structure and function of mitoribosomes in mammals and fungi. PMID:27023846

  2. Structural snapshots of actively translating human ribosomes.

    PubMed

    Behrmann, Elmar; Loerke, Justus; Budkevich, Tatyana V; Yamamoto, Kaori; Schmidt, Andrea; Penczek, Pawel A; Vos, Matthijn R; Bürger, Jörg; Mielke, Thorsten; Scheerer, Patrick; Spahn, Christian M T

    2015-05-01

    Macromolecular machines, such as the ribosome, undergo large-scale conformational changes during their functional cycles. Although their mode of action is often compared to that of mechanical machines, a crucial difference is that, at the molecular dimension, thermodynamic effects dominate functional cycles, with proteins fluctuating stochastically between functional states defined by energetic minima on an energy landscape. Here, we have used cryo-electron microscopy to image ex-vivo-derived human polysomes as a source of actively translating ribosomes. Multiparticle refinement and 3D variability analysis allowed us to visualize a variety of native translation intermediates. Significantly populated states include not only elongation cycle intermediates in pre- and post-translocational states, but also eEF1A-containing decoding and termination/recycling complexes. Focusing on the post-translocational state, we extended this assessment to the single-residue level, uncovering striking details of ribosome-ligand interactions and identifying both static and functionally important dynamic elements. PMID:25957688

  3. Structural snapshots of actively translating human ribosomes

    PubMed Central

    Behrmann, Elmar; Loerke, Justus; Budkevich, Tatyana V.; Yamamoto, Kaori; Schmidt, Andrea; Penczek, Pawel A.; Vos, Matthijn R.; Bürger, Jörg; Mielke, Thorsten; Scheerer, Patrick; Spahn, Christian M.T.

    2015-01-01

    Summary Macromolecular machines, such as the ribosome, undergo large-scale conformational changes during their functional cycles. While their mode of action is often compared to that of mechanical machines, a crucial difference is that at the molecular dimension, thermodynamic effects dominate functional cycles, with proteins fluctuating stochastically between functional states defined by energetic minima on an energy landscape. Here, we have used cryo-electron microscopy to image ex vivo-derived human polysomes as a source of actively translating ribosomes. Multiparticle refinement and three-dimensional variability analysis allowed us to visualize a variety of native translation intermediates. Significantly populated states include not only elongation cycle intermediates in pre- and post-translocational states, but also eEF1A-containing decoding and termination/recycling complexes. Focusing on the post-translocational state, we extended this assessment to the single-residue level, uncovering striking details of ribosome-ligand interactions and identifying both static and functionally important dynamic elements. PMID:25957688

  4. Stochastic gating and drug-ribosome interactions.

    PubMed

    Vaiana, Andrea C; Sanbonmatsu, Kevin Y

    2009-02-27

    Gentamicin is a potent antibiotic that is used in combination therapy for inhalation anthrax disease. The drug is also often used in therapy for methicillin-resistant Staphylococcusaureus. Gentamicin works by flipping a conformational switch on the ribosome, disrupting the reading head (i.e., 16S ribosomal decoding bases 1492-1493) used for decoding messenger RNA. We use explicit solvent all-atom molecular simulation to study the thermodynamics of the ribosomal decoding site and its interaction with gentamicin. The replica exchange molecular dynamics simulations used an aggregate sampling of 15 mus when summed over all replicas, allowing us to explicitly calculate the free-energy landscape, including a rigorous treatment of enthalpic and entropic effects. Here, we show that the decoding bases flip on a timescale faster than that of gentamicin binding, supporting a stochastic gating mechanism for antibiotic binding, rather than an induced-fit model where the bases only flip in the presence of a ligand. The study also allows us to explore the nonspecific binding landscape near the binding site and reveals that, rather than a two-state bound/unbound scenario, drug dissociation entails shuttling between many metastable local minima in the free-energy landscape. Special care is dedicated to validation of the obtained results, both by direct comparison to experiment and by estimation of simulation convergence. PMID:19146858

  5. Mitochondrial ribosome assembly in health and disease

    PubMed Central

    De Silva, Dasmanthie; Tu, Ya-Ting; Amunts, Alexey; Fontanesi, Flavia; Barrientos, Antoni

    2015-01-01

    The ribosome is a structurally and functionally conserved macromolecular machine universally responsible for catalyzing protein synthesis. Within eukaryotic cells, mitochondria contain their own ribosomes (mitoribosomes), which synthesize a handful of proteins, all essential for the biogenesis of the oxidative phosphorylation system. High-resolution cryo-EM structures of the yeast, porcine and human mitoribosomal subunits and of the entire human mitoribosome have uncovered a wealth of new information to illustrate their evolutionary divergence from their bacterial ancestors and their adaptation to synthesis of highly hydrophobic membrane proteins. With such structural data becoming available, one of the most important remaining questions is that of the mitoribosome assembly pathway and factors involved. The regulation of mitoribosome biogenesis is paramount to mitochondrial respiration, and thus to cell viability, growth and differentiation. Moreover, mutations affecting the rRNA and protein components produce severe human mitochondrial disorders. Despite its biological and biomedical significance, knowledge on mitoribosome biogenesis and its deviations from the much-studied bacterial ribosome assembly processes is scarce, especially the order of rRNA processing and assembly events and the regulatory factors required to achieve fully functional particles. This article focuses on summarizing the current available information on mitoribosome assembly pathway, factors that form the mitoribosome assembly machinery, and the effect of defective mitoribosome assembly on human health. PMID:26030272

  6. Polar bears, antibiotics, and the evolving ribosome (Nobel Lecture).

    PubMed

    Yonath, Ada

    2010-06-14

    High-resolution structures of ribosomes, the cellular machines that translate the genetic code into proteins, revealed the decoding mechanism, detected the mRNA path, identified the sites of the tRNA molecules in the ribosome, elucidated the position and the nature of the nascent proteins exit tunnel, illuminated the interactions of the ribosome with non-ribosomal factors, such as the initiation, release and recycling factors, and provided valuable information on ribosomal antibiotics, their binding sites, modes of action, principles of selectivity and the mechanisms leading to their resistance. Notably, these structures proved that the ribosome is a ribozyme whose active site, namely where the peptide bonds are being formed, is situated within a universal symmetrical region that is embedded in the otherwise asymmetric ribosome structure. As this symmetrical region is highly conserved and provides the machinery required for peptide bond formation and for ribosome polymerase activity, it may be the remnant of the proto-ribosome, a dimeric prebiotic machine that formed peptide bonds and non-coded polypeptide chains. Structures of complexes of ribosomes with antibiotics targeting them revealed the principles allowing for their clinical use, identified resistance mechanisms and showed the structural bases for discriminating pathogenic bacteria from hosts, hence providing valuable structural information for antibiotics improvement and for the design of novel compounds that can serve as antibiotics. PMID:20535730

  7. Structure of a mitochondrial ribosome with minimal RNA.

    PubMed

    Sharma, Manjuli R; Booth, Timothy M; Simpson, Larry; Maslov, Dmitri A; Agrawal, Rajendra K

    2009-06-16

    The Leishmania tarentolae mitochondrial ribosome (Lmr) is a minimal ribosomal RNA (rRNA)-containing ribosome. We have obtained a cryo-EM map of the Lmr. The map reveals several features that have not been seen in previously-determined structures of eubacterial or eukaryotic (cytoplasmic or organellar) ribosomes to our knowledge. Comparisons of the Lmr map with X-ray crystallographic and cryo-EM maps of the eubacterial ribosomes and a cryo-EM map of the mammalian mitochondrial ribosome show that (i) the overall structure of the Lmr is considerably more porous, (ii) the topology of the intersubunit space is significantly different, with fewer intersubunit bridges, but more tunnels, and (iii) several of the functionally-important rRNA regions, including the alpha-sarcin-ricin loop, have different relative positions within the structure. Furthermore, the major portions of the mRNA channel, the tRNA passage, and the nascent polypeptide exit tunnel contain Lmr-specific proteins, suggesting that the mechanisms for mRNA recruitment, tRNA interaction, and exiting of the nascent polypeptide in Lmr must differ markedly from the mechanisms deduced for ribosomes in other organisms. Our study identifies certain structural features that are characteristic solely of mitochondrial ribosomes and other features that are characteristic of both mitochondrial and chloroplast ribosomes (i.e., organellar ribosomes). PMID:19497863

  8. Protein synthesis. Rqc2p and 60S ribosomal subunits mediate mRNA-independent elongation of nascent chains.

    PubMed

    Shen, Peter S; Park, Joseph; Qin, Yidan; Li, Xueming; Parsawar, Krishna; Larson, Matthew H; Cox, James; Cheng, Yifan; Lambowitz, Alan M; Weissman, Jonathan S; Brandman, Onn; Frost, Adam

    2015-01-01

    In Eukarya, stalled translation induces 40S dissociation and recruitment of the ribosome quality control complex (RQC) to the 60S subunit, which mediates nascent chain degradation. Here we report cryo-electron microscopy structures revealing that the RQC components Rqc2p (YPL009C/Tae2) and Ltn1p (YMR247C/Rkr1) bind to the 60S subunit at sites exposed after 40S dissociation, placing the Ltn1p RING (Really Interesting New Gene) domain near the exit channel and Rqc2p over the P-site transfer RNA (tRNA). We further demonstrate that Rqc2p recruits alanine- and threonine-charged tRNA to the A site and directs the elongation of nascent chains independently of mRNA or 40S subunits. Our work uncovers an unexpected mechanism of protein synthesis, in which a protein--not an mRNA--determines tRNA recruitment and the tagging of nascent chains with carboxy-terminal Ala and Thr extensions ("CAT tails"). PMID:25554787

  9. Modification of ribosomal RNA by ribosome-inactivating proteins from plants.

    PubMed Central

    Stirpe, F; Bailey, S; Miller, S P; Bodley, J W

    1988-01-01

    We have surveyed 14 different toxic and nontoxic ribosome-inactivating proteins from plants for the ability to act on the RNA of the eucaryotic 60 S ribosomal subunit. All of these proteins act to introduce a specific modification into 26-28 S RNA which renders the RNA sensitive to cleavage by aniline. Sequence analysis of the 5'-termini of the fragments produced by ricin and saporin following aniline cleavage indicate that both proteins possess identical specificity. Our observations support the conclusion of Endo and Tsurugi (J. Biol. Chem. 262, 8128-8130, 1987) that ricin is a specific N-glycosidase and we have located the site of this cleavage by direct sequence analysis. Our results further suggest that all plant ribosome-inactivating proteins function as specific N-glycosidases with the same specificity. Images PMID:3347493

  10. Runx1 deficiency decreases ribosome biogenesis and confers stress resistance to hematopoietic stem and progenitor cells

    PubMed Central

    Cai, Xiongwei; Gao, Long; Teng, Li; Ge, Jingping; Oo, Zaw Min; Kumar, Ashish R.; Gilliland, D. Gary; Mason, Philip J.; Tan, Kai; Speck, Nancy A.

    2015-01-01

    Summary The transcription factor RUNX1 is frequently mutated in myelodysplastic syndrome and leukemia. RUNX1 mutations can be early events, creating pre-leukemic stem cells that expand in the bone marrow. Here we show, counter-intuitively, that Runx1 deficient hematopoietic stem and progenitor cells (HSPCs) have a slow growth, low biosynthetic, small cell phenotype and markedly reduced ribosome biogenesis (Ribi). The reduced Ribi involved decreased levels of rRNA and many mRNAs encoding ribosome proteins. Runx1 appears to directly regulate Ribi; Runx1 is enriched on the promoters of genes encoding ribosome proteins, and binds the ribosomal DNA repeats. Runx1 deficient HSPCs have lower p53 levels, reduced apoptosis, an attenuated unfolded protein response, and accordingly are resistant to genotoxic and endoplasmic reticulum stress. The low biosynthetic activity and corresponding stress resistance provides a selective advantage to Runx1 deficient HSPCs, allowing them to expand in the bone marrow and outcompete normal HSPCs. PMID:26165925

  11. Sequence of steps in ribosome recycling as defined by kinetic analysis.

    PubMed

    Peske, Frank; Rodnina, Marina V; Wintermeyer, Wolfgang

    2005-05-13

    After termination of protein synthesis in bacteria, ribosomes are recycled from posttermination complexes by the combined action of elongation factor G (EF-G), ribosome recycling factor (RRF), and initiation factor 3 (IF3). The functions of the factors and the sequence in which ribosomal subunits, tRNA, and mRNA are released from posttermination complexes are unclear and, in part, controversial. Here, we study the reaction by rapid kinetics monitoring fluorescence. We show that RRF and EF-G with GTP, but not with GDPNP, promote the dissociation of 50S subunits from the posttermination complex without involving translocation or a translocation-like event. IF3 does not affect subunit dissociation but prevents reassociation, thereby masking the dissociating effect of EF-G-RRF under certain experimental conditions. IF3 is required for the subsequent ejection of tRNA and mRNA from the small subunit. The latter step is slower than subunit dissociation and constitutes the rate-limiting step of ribosome recycling. PMID:15893724

  12. An unexpected type of ribosomes induced by kasugamycin: A look into ancestral times of protein synthesis?

    PubMed Central

    Kaberdina, Anna Chao; Szaflarski, Witold; Nierhaus, Knud H.; Moll, Isabella

    2010-01-01

    SUMMARY Translation of leaderless mRNAs, lacking ribosomal recruitment signals other than the 5′-terminal AUG-initiating codon, occurs in all three domains of life. Contemporary leaderless mRNAs may therefore be viewed as molecular fossils resembling ancestral mRNAs. Here, we analyzed the phenomenon of sustained translation of a leaderless mRNA in the presence of the antibiotic kasugamycin. Unexpected from the known in vitro effects of the drug, kasugamycin induced the formation of stable ~61S ribosomes in vivo, which were proficient in selectively translating leaderless mRNA. 61S particles are devoid of more than six proteins of the small subunit including the functionally important proteins S1 and S12. The lack of these proteins could be reconciled with structural changes in the 16S rRNA. These studies provide in vivo evidence for the functionality of ribosomes devoid of multiple proteins, and shed light on the evolutionary history of ribosomes. PMID:19187763

  13. X-ray Analyses of the Ribosomal A-Site Molecular Switches

    NASA Astrophysics Data System (ADS)

    Kondo, Jiro

    The aminoacyl-tRNA decoding site (A-site) on the small ribosomal subunit is an RNA molecular switch guaranteeing high translation fidelity. Due to the similarity of the secondary structure of the A-site, it has long been believed that the functional characteristics and tertiary structure of the A-site molecular switch are basically conserved in three main cell types, bacteria, mitochondria and eukaryotic cytoplasm. However, these three cell types are noticeably different in their biological properties such as life cycle, genome size, structural component of ribosome and number of tRNA species. In our structural studies, we have shown how a small difference of nucleotide sequences affects the dynamics of the A-site molecular switches underlying the decoding mechanism adapted to their biological properties and environments. The observed structural insights into the decoding process allowed us to understand molecular mechanisms of non-syndromic hearing loss and toxicity mechanism of aminoglycoside antibiotics.

  14. Overexpression, purification, molecular characterization and pharmacological evaluation for anticancer activity of ribosomal protein S23 from the giant panda (Ailuropoda melanoleuca).

    PubMed

    Wang, Ting; Hou, Yiling; Ding, Xiang; Song, Bo; Wang, Fang; Hou, Wanru

    2013-06-01

    Ribosomal protein S23 (RPS23) is a component of the 40S small ribosomal subunit encoded by the RPS23 gene, which is specific to eukaryotes. The cDNA and genomic sequence of RPS23 were cloned from Ailuropoda melanoleuca (A. melanoleuca) using reverse transcription‑polymerase chain reaction (RT-PCR) technology and touchdown PCR, respectively. The two sequences were analyzed preliminarily and the cDNA of the RPS23 gene was overexpressed in Escherichia coli (E. coli) BL21. The cDNA of RPS23 cloned from giant panda was 472 bp, and it contained an open reading frame (ORF) of 432 bp encoding 142 amino acids. The nucleotide sequence of the coding sequence showed a high degree of homology to some mammals as determined by BLAST analysis, similar to the amino acid sequence. The genomic sequence was 2,105 bp in length, with 4 exons and 3 introns. The primary structure analysis revealed that the molecular weight of the putative RPS23 protein was 15.80 kDa with a theoretical isoelectric point (pI) of 11.23. The molecular weight of the recombinant protein RPS23 was 21.5 kDa with a theoretical pI of 10.57. Topology prediction showed that there are seven different patterns of functional sites in the RPS23 protein of giant panda. RPS23 was successfully expressed in E. coli and its protein fused with the N‑terminal His‑tagged protein triggered the accumulation of an expected 21.5‑kDa polypeptide. The inhibitory rate of tumor growth in mice treated with 0.1 µg/ml RPS23 protein was 49.45%, the highest in the three doses used, which may be comparable to mannatide treatment. Histology of immune organs showed that the tissues were characterized by a regular and tight arrangement, while tumor tissues of the mice in the RPS23 group exhibited a loose arrangement compared to the control group. However, there was no obvious damage to other organs, such as the heart, lung and kidney. Investigations are currently being conducted to determine the bioactive principles of the recombinant

  15. Protein interaction mapping with ribosome-displayed using PLATO ORF libraries

    PubMed Central

    Zhu, Jian; Larman, H. Benjamin; Gao, Geng; Somwar, Romel; Zhang, Zijuan; Laserson, Uri; Ciccia, Alberto; Pavlova, Natalya; Church, George; Zhang, Wei; Kesari, Santosh; Elledge, Stephen J.

    2013-01-01

    Identifying physical interactions between proteins and other molecules is a critical aspect of biological analysis. Here we describe PLATO, an in vitro method for mapping such interactions by affinity enrichment of a library of full-length open reading frames displayed on ribosomes, followed by massively parallel analysis using DNA sequencing. We demonstrate the broad utility of the method by identifying known and new interacting partners of LYN kinase, patient autoantibodies and the small molecules gefitinib and dasatinib. PMID:24336473

  16. Concentric-flow electrokinetic injector enables serial crystallography of ribosome and photosystem II.

    PubMed

    Sierra, Raymond G; Gati, Cornelius; Laksmono, Hartawan; Dao, E Han; Gul, Sheraz; Fuller, Franklin; Kern, Jan; Chatterjee, Ruchira; Ibrahim, Mohamed; Brewster, Aaron S; Young, Iris D; Michels-Clark, Tara; Aquila, Andrew; Liang, Mengning; Hunter, Mark S; Koglin, Jason E; Boutet, Sébastien; Junco, Elia A; Hayes, Brandon; Bogan, Michael J; Hampton, Christina Y; Puglisi, Elisabetta V; Sauter, Nicholas K; Stan, Claudiu A; Zouni, Athina; Yano, Junko; Yachandra, Vittal K; Soltis, S Michael; Puglisi, Joseph D; DeMirci, Hasan

    2016-01-01

    We describe a concentric-flow electrokinetic injector for efficiently delivering microcrystals for serial femtosecond X-ray crystallography analysis that enables studies of challenging biological systems in their unadulterated mother liquor. We used the injector to analyze microcrystals of Geobacillus stearothermophilus thermolysin (2.2-Å structure), Thermosynechococcus elongatus photosystem II (<3-Å diffraction) and Thermus thermophilus small ribosomal subunit bound to the antibiotic paromomycin at ambient temperature (3.4-Å structure). PMID:26619013

  17. Backbone and side chain NMR assignments for the ribosome assembly factor Nop6 from Saccharomyces cerevisiae.

    PubMed

    Wurm, Jan Philip; Lioutikov, Anatoli; Kötter, Peter; Entian, Karl-Dieter; Wöhnert, Jens

    2014-10-01

    The Saccharomyces cerevisiae Nop6 protein is involved in the maturation of the small ribosomal subunit. It contains a central RNA binding domain and a predicted C-terminal coiled-coil domain. Here we report the almost complete (>90%) (1)H,(13)C,(15)N backbone and side chain NMR assignment of a 15 kDa Nop6 construct comprising the RNA binding and coiled-coil domains. PMID:23921755

  18. Dynamic Behavior of Trigger Factor on the Ribosome.

    PubMed

    Deeng, J; Chan, K Y; van der Sluis, E O; Berninghausen, O; Han, W; Gumbart, J; Schulten, K; Beatrix, B; Beckmann, R

    2016-09-11

    Trigger factor (TF) is the only ribosome-associated chaperone in bacteria. It interacts with hydrophobic segments in nascent chain (NCs) as they emerge from the ribosome. TF binds via its N-terminal ribosome-binding domain (RBD) mainly to ribosomal protein uL23 at the tunnel exit on the large ribosomal subunit. Whereas earlier structural data suggested that TF binds as a rigid molecule to the ribosome, recent comparisons of structural data on substrate-bound, ribosome-bound, and TF in solution from different species suggest that this chaperone is a rather flexible molecule. Here, we present two cryo-electron microscopy structures of TF bound to ribosomes translating an mRNA coding for a known TF substrate from Escherichia coli of a different length. The structures reveal distinct degrees of flexibility for the different TF domains, a conformational rearrangement of the RBD upon ribosome binding, and an increase in rigidity within TF when the NC is extended. Molecular dynamics simulations agree with these data and offer a molecular basis for these observations. PMID:27320387

  19. -1 Programmed Ribosomal Frameshifting as a Force-Dependent Process.

    PubMed

    Visscher, Koen

    2016-01-01

    -1 Programmed ribosomal frameshifting is a translational recoding event in which ribosomes slip backward along messenger RNA presumably due to increased tension disrupting the codon-anticodon interaction at the ribosome's coding site. Single-molecule physical methods and recent experiments characterizing the physical properties of mRNA's slippery sequence as well as the mechanical stability of downstream mRNA structure motifs that give rise to frameshifting are discussed. Progress in technology, experimental assays, and data analysis methods hold promise for accurate physical modeling and quantitative understanding of -1 programmed ribosomal frameshifting. PMID:26970190

  20. Dissociability of free and peptidyl-tRNA bound ribosomes.

    PubMed

    Surguchov, A P; Fominykch, E S; Lyzlova, L V

    1978-06-16

    The influence of peptidyl-tRNA on the dissociation of yeast 80 S ribosomes into subunits was studied. For this purpose temperature-sensitive (ts) suppressor strain of yeast Saccharomyces cervisiae carrying a defect in peptide chain termination was used. It was found that peptidyl-tRNA did not influence the dissociation of ribosomes either at high salt concentration or in the presence of dissociation factor (DF) from yeast. After dissociation of yeast ribosomes in 0.5 M KCl, peptidyl-tRNA remains bound to the 60 S subunit. Some characteristics of the termination process and release of nascent polypeptides from yeast ribosomes are discussed. PMID:355860

  1. Commandeering the Ribosome: Lessons Learned from Dicistroviruses about Translation.

    PubMed

    Kerr, Craig H; Jan, Eric

    2016-06-15

    To replicate, all viruses depend entirely on the enslavement of host cell ribosomes for their own advantage. To this end, viruses have evolved a multitude of translational strategies to usurp the ribosome. RNA-based structures known as internal ribosome entry sites (IRESs) are among the most notable mechanisms employed by viruses to seize host ribosomes. In this article, we spotlight the intergenic region IRES from the Dicistroviridae family of viruses and its importance as a model for IRES-dependent translation and in understanding fundamental properties of translation. PMID:27053555

  2. Replication of ribosomal DNA in Xenopus laevis.

    PubMed

    Bozzoni, I; Baldari, C T; Amaldi, F; Buongiorno-Nardelli, M

    1981-09-01

    The study of the localization of the replication origins of rDNA in Xenopus laevis has been approached by two different methods. 1. The DNA of X. laevis larvae was fractionated by CsCl gradient centrifugation in bulk and ribosomal DNA and examined in the electron microscope. In bulk DNA, clusters of microbubbles, which are related with the origins of replication, appear to be spaced along the DNA molecules at intervals comparable with the size of the 'average' replicon of X. laevis. In ribosomal DNA, the distance between adjacent clusters is much shorter and corresponds to the size of the rDNA repeating unit. When ribosomal DNA was submitted to digestion with restriction enzymes (Eco RI and HindIII) the microbubbles are observed in the non-transcribed spacer-containing fragment. 2. Cultured cells of X. laevis were synchronized by mitotic selection and incubated with 5-fluoro-2-deoxyuridine for a time longer than the G1 phase. This treatment synchronizes the replicons and allows them to start replicating very slowly. It was thus possible to obtain a preferential labelling of the regions containing the origins. The analysis by gel electrophoresis of the Eco Ri-digested rDNA showed that the radioactivity was preferentially incorporated in the fragments which contain the non-transcribed spacer. The results of these two approaches indicate that the rRNA gene cluster consists of multiple units of replication, possibly one per gene unit. Furthermore they show that the origins of replication are localized into the non-transcribed spacer. PMID:7297565

  3. Major centers of motion in the large ribosomal RNAs

    PubMed Central

    Paci, Maxim; Fox, George E.

    2015-01-01

    Major centers of motion in the rRNAs of Thermus thermophilus are identified by alignment of crystal structures of EF-G bound and EF-G unbound ribosomal subunits. Small rigid helices upstream of these ‘pivots’ are aligned, thereby decoupling their motion from global rearrangements. Of the 21 pivots found, six are observed in the large subunit rRNA and 15 in the small subunit rRNA. Although the magnitudes of motion differ, with only minor exceptions equivalent pivots are seen in comparisons of Escherichia coli structures and one Saccharomyces cerevisiae structure pair. The pivoting positions are typically associated with structurally weak motifs such as non-canonical, primarily U-G pairs, bulge loops and three-way junctions. Each pivot is typically in direct physical contact with at least one other in the set and often several others. Moving helixes include rRNA segments in contact with the tRNA, intersubunit bridges and helices 28, 32 and 34 of the small subunit. These helices are envisioned to form a network. EF-G rearrangement would then provide directional control of this network propagating motion from the tRNA to the intersubunit bridges to the head swivel or along the same path backward. PMID:25870411

  4. Direct Activation of Ribosome-Associated Double-Stranded RNA-Dependent Protein Kinase (PKR) by Deoxynivalenol, Anisomycin and Ricin: A New Model for Ribotoxic Stress Response Induction

    PubMed Central

    Zhou, Hui-Ren; He, Kaiyu; Landgraf, Jeff; Pan, Xiao; Pestka, James J.

    2014-01-01

    Double-stranded RNA (dsRNA)-activated protein kinase (PKR) is a critical upstream mediator of the ribotoxic stress response (RSR) to the trichothecene deoxynivalenol (DON) and other translational inhibitors. Here, we employed HeLa cell lysates to: (1) characterize PKR’s interactions with the ribosome and ribosomal RNA (rRNA); (2) demonstrate cell-free activation of ribosomal-associated PKR and (3) integrate these findings in a unified model for RSR. Robust PKR-dependent RSR was initially confirmed in intact cells. PKR basally associated with 40S, 60S, 80S and polysome fractions at molar ratios of 7, 2, 23 and 3, respectively. Treatment of ATP-containing HeLa lysates with DON or the ribotoxins anisomycin and ricin concentration-dependently elicited phosphorylation of PKR and its substrate eIF2α. These phosphorylations could be blocked by PKR inhibitors. rRNA immunoprecipitation (RNA-IP) of HeLa lysates with PKR-specific antibody and sequencing revealed that in the presence of DON or not, the kinase associated with numerous discrete sites on both the 18S and 28S rRNA molecules, a number of which contained double-stranded hairpins. These findings are consistent with a sentinel model whereby multiple PKR molecules basally associate with the ribosome positioning them to respond to ribotoxin-induced alterations in rRNA structure by dimerizing, autoactivating and, ultimately, evoking RSR. PMID:25521494

  5. Mutations in Ribosomal Proteins, RPL4 and RACK1, Suppress the Phenotype of a Thermospermine-Deficient Mutant of Arabidopsis thaliana

    PubMed Central

    Kakehi, Jun-Ichi; Kawano, Eri; Yoshimoto, Kaori; Cai, Qingqing; Imai, Akihiro; Takahashi, Taku

    2015-01-01

    Thermospermine acts in negative regulation of xylem differentiation and its deficient mutant of Arabidopsis thaliana, acaulis5 (acl5), shows excessive xylem formation and severe dwarfism. Studies of two dominant suppressors of acl5, sac51-d and sac52-d, have revealed that SAC51 and SAC52 encode a transcription factor and a ribosomal protein L10 (RPL10), respectively, and these mutations enhance translation of the SAC51 mRNA, which contains conserved upstream open reading frames in the 5’ leader. Here we report identification of SAC53 and SAC56 responsible for additional suppressors of acl5. sac53-d is a semi-dominant allele of the gene encoding a receptor for activated C kinase 1 (RACK1) homolog, a component of the 40S ribosomal subunit. sac56-d represents a semi-dominant allele of the gene for RPL4. We show that the GUS reporter activity driven by the CaMV 35S promoter plus the SAC51 5’ leader is reduced in acl5 and restored by sac52-d, sac53-d, and sac56-d as well as thermospermine. Furthermore, the SAC51 mRNA, which may be a target of nonsense-mediated mRNA decay, was found to be stabilized in these ribosomal mutants and by thermospermine. These ribosomal proteins are suggested to act in the control of uORF-mediated translation repression of SAC51, which is derepressed by thermospermine. PMID:25625317

  6. Ribosomal RNA: a key to phylogeny

    NASA Technical Reports Server (NTRS)

    Olsen, G. J.; Woese, C. R.

    1993-01-01

    As molecular phylogeny increasingly shapes our understanding of organismal relationships, no molecule has been applied to more questions than have ribosomal RNAs. We review this role of the rRNAs and some of the insights that have been gained from them. We also offer some of the practical considerations in extracting the phylogenetic information from the sequences. Finally, we stress the importance of comparing results from multiple molecules, both as a method for testing the overall reliability of the organismal phylogeny and as a method for more broadly exploring the history of the genome.

  7. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi.

    PubMed

    Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen

    2012-04-17

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups. PMID:22454494

  8. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

    PubMed Central

    Schoch, Conrad L.; Seifert, Keith A.; Huhndorf, Sabine; Robert, Vincent; Spouge, John L.; Levesque, C. André; Chen, Wen; Bolchacova, Elena; Voigt, Kerstin; Crous, Pedro W.; Miller, Andrew N.; Wingfield, Michael J.; Aime, M. Catherine; An, Kwang-Deuk; Bai, Feng-Yan; Barreto, Robert W.; Begerow, Dominik; Bergeron, Marie-Josée; Blackwell, Meredith; Boekhout, Teun; Bogale, Mesfin; Boonyuen, Nattawut; Burgaz, Ana R.; Buyck, Bart; Cai, Lei; Cai, Qing; Cardinali, G.; Chaverri, Priscila; Coppins, Brian J.; Crespo, Ana; Cubas, Paloma; Cummings, Craig; Damm, Ulrike; de Beer, Z. Wilhelm; de Hoog, G. Sybren; Del-Prado, Ruth; Dentinger, Bryn; Diéguez-Uribeondo, Javier; Divakar, Pradeep K.; Douglas, Brian; Dueñas, Margarita; Duong, Tuan A.; Eberhardt, Ursula; Edwards, Joan E.; Elshahed, Mostafa S.; Fliegerova, Katerina; Furtado, Manohar; García, Miguel A.; Ge, Zai-Wei; Griffith, Gareth W.; Griffiths, K.; Groenewald, Johannes Z.; Groenewald, Marizeth; Grube, Martin; Gryzenhout, Marieka; Guo, Liang-Dong; Hagen, Ferry; Hambleton, Sarah; Hamelin, Richard C.; Hansen, Karen; Harrold, Paul; Heller, Gregory; Herrera, Cesar; Hirayama, Kazuyuki; Hirooka, Yuuri; Ho, Hsiao-Man; Hoffmann, Kerstin; Hofstetter, Valérie; Högnabba, Filip; Hollingsworth, Peter M.; Hong, Seung-Beom; Hosaka, Kentaro; Houbraken, Jos; Hughes, Karen; Huhtinen, Seppo; Hyde, Kevin D.; James, Timothy; Johnson, Eric M.; Johnson, Joan E.; Johnston, Peter R.; Jones, E.B. Gareth; Kelly, Laura J.; Kirk, Paul M.; Knapp, Dániel G.; Kõljalg, Urmas; Kovács, Gábor M.; Kurtzman, Cletus P.; Landvik, Sara; Leavitt, Steven D.; Liggenstoffer, Audra S.; Liimatainen, Kare; Lombard, Lorenzo; Luangsa-ard, J. Jennifer; Lumbsch, H. Thorsten; Maganti, Harinad; Maharachchikumbura, Sajeewa S. N.; Martin, María P.; May, Tom W.; McTaggart, Alistair R.; Methven, Andrew S.; Meyer, Wieland; Moncalvo, Jean-Marc; Mongkolsamrit, Suchada; Nagy, László G.; Nilsson, R. Henrik; Niskanen, Tuula; Nyilasi, Ildikó; Okada, Gen; Okane, Izumi; Olariaga, Ibai; Otte, Jürgen; Papp, Tamás; Park, Duckchul; Petkovits, Tamás; Pino-Bodas, Raquel; Quaedvlieg, William; Raja, Huzefa A.; Redecker, Dirk; Rintoul, Tara L.; Ruibal, Constantino; Sarmiento-Ramírez, Jullie M.; Schmitt, Imke; Schüßler, Arthur; Shearer, Carol; Sotome, Kozue; Stefani, Franck O.P.; Stenroos, Soili; Stielow, Benjamin; Stockinger, Herbert; Suetrong, Satinee; Suh, Sung-Oui; Sung, Gi-Ho; Suzuki, Motofumi; Tanaka, Kazuaki; Tedersoo, Leho; Telleria, M. Teresa; Tretter, Eric; Untereiner, Wendy A.; Urbina, Hector; Vágvölgyi, Csaba; Vialle, Agathe; Vu, Thuy Duong; Walther, Grit; Wang, Qi-Ming; Wang, Yan; Weir, Bevan S.; Weiß, Michael; White, Merlin M.; Xu, Jianping; Yahr, Rebecca; Yang, Zhu L.; Yurkov, Andrey; Zamora, Juan-Carlos; Zhang, Ning; Zhuang, Wen-Ying; Schindel, David

    2012-01-01

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups. PMID:22454494

  9. Toward the mechanism of eIF4F-mediated ribosomal attachment to mammalian capped mRNAs.

    PubMed

    Kumar, Parimal; Hellen, Christopher U T; Pestova, Tatyana V

    2016-07-01

    Ribosomal attachment to mammalian capped mRNAs is achieved through the cap-eukaryotic initiation factor 4E (eIF4E)-eIF4G-eIF3-40S chain of interactions, but the mechanism by which mRNA enters the mRNA-binding channel of the 40S subunit remains unknown. To investigate this process, we recapitulated initiation on capped mRNAs in vitro using a reconstituted translation system. Formation of initiation complexes at 5'-terminal AUGs was stimulated by the eIF4E-cap interaction and followed "the first AUG" rule, indicating that it did not occur by backward scanning. Initiation complexes formed even at the very 5' end of mRNA, implying that Met-tRNAi (Met) inspects mRNA from the first nucleotide and that initiation does not have a "blind spot." In assembled initiation complexes, the cap was no longer associated with eIF4E. Omission of eIF4A or disruption of eIF4E-eIF4G-eIF3 interactions converted eIF4E into a specific inhibitor of initiation on capped mRNAs. Taken together, these results are consistent with the model in which eIF4E-eIF4G-eIF3-40S interactions place eIF4E at the leading edge of the 40S subunit, and mRNA is threaded into the mRNA-binding channel such that Met-tRNAi (Met) can inspect it from the first nucleotide. Before entering, eIF4E likely dissociates from the cap to overcome steric hindrance. We also found that the m(7)G cap specifically interacts with eIF3l. PMID:27401559

  10. The effect of trichloroethylene and acrylonitrile on RNA and ribosome synthesis and ribosome content in Saccharomyces cells.

    PubMed

    Lochmann, E R; Ehrlich, W; Mangir, M

    1984-04-01

    The effects of trichloroethylene (TCE) and acrylonitrile (ACN) on growth, RNA synthesis, ribosome synthesis, and ribosome content were tested in yeast cells. TCE causes a delay of the growth of a cell culture (prolongation of the lag phase), but does not cause inhibition. Cells exposed to increasing concentrations of ACN show increasing damage, so that, at a certain point of the growth curve, cell division stops altogether. Similar results were obtained when RNA synthesis was investigated: After treatment with TCE, the maximum RNA synthesis of the cell culture was retarded, but subsequently reached the same level as the untreated control cells. In the presence of ACN, however, the rate of RNA synthesis was lowered with increasing ACN concentrations. The same effect was observed upon investigation of ribosome synthesis: Whereas TCE produces only a slight effect, treatment with increasing concentrations of ACN leads to a substantial decrease in ribosome synthesis, and finally to total inhibition. Parallel to this, the content of free and membrane-bound ribosomes is diminished. Obviously, the decrease in ribosome content is caused not only by an inhibition of ribosome synthesis, but also by a degradation of existing ribosomes, as well as by induction of a ribosome-associated RNase. PMID:6714140

  11. Studies on membrane proteins involved in ribosome binding on the rough endoplasmic reticulum. Ribophorins have no ribosome-binding activity.

    PubMed Central

    Yoshida, H; Tondokoro, N; Asano, Y; Mizusawa, K; Yamagishi, R; Horigome, T; Sugano, H

    1987-01-01

    A membrane protein fraction showing affinity for ribosomes was isolated from rat liver microsomes (microsomal fractions) in association with ribosomes by treatment of the microsomes with Emulgen 913 and then solubilized from the ribosomes with sodium deoxycholate. This protein fraction was separated into two fractions, glycoproteins, including ribophorins I and II, and non-glycoproteins, virtually free from ribophorins I and II, on concanavalin A-Sepharose columns. The two fractions were each reconstituted into liposomes to determine their ribosome-binding activities. The specific binding activity of the non-glycoprotein fraction was approx. 2.3-fold higher than that of the glycoprotein fraction. The recovery of ribosome-binding capacity of the two fractions was about 85% of the total binding capacity of the material applied to a concanavalin A-Sepharose column, and about 90% of it was found in the non-glycoprotein fraction. The affinity constants of the ribosomes for the reconstituted liposomes were somewhat higher than those for stripped rough microsomes. The mode of ribosome binding to the reconstituted liposomes was very similar to that to the stripped rough microsomes, in its sensitivity to proteolytic enzymes and its strong inhibition by increasing KCl concentration. These results support the idea that ribosome binding to rat liver microsomes is not directly mediated by ribophorins I and II, but that another unidentified membrane protein(s) plays a role in ribosome binding. Images Fig. 1. Fig. 3. Fig. 5. PMID:3663192

  12. Biphasic character of ribosomal translocation and non-Michaelis-Menten kinetics of translation

    NASA Astrophysics Data System (ADS)

    Xie, Ping

    2014-12-01

    We study theoretically the kinetics of mRNA translocation in the wild-type (WT) Escherichia coli ribosome, which is composed of a small 30 S and large 50 S subunit, and the ribosomes with mutations to some intersubunit bridges such as B1a, B4, B7a, and B8. The theoretical results reproduce well the available in vitro experimental data on the biphasic kinetics of the forward mRNA translocation catalyzed by elongation factor G (EF-G) hydrolyzing GTP, which can be best fit by the sum of two exponentials, and the monophasic kinetics of the spontaneous reverse mRNA translocation in the absence of the elongation factor, which can be best fit by a single-exponential function, in both the WT and mutant ribosomes. We show that both the mutation-induced increase in the maximal rate of the slow phase for the forward mRNA translocation and that in the rate of the spontaneous reverse mRNA translocation result from a reduction in the intrinsic energy barrier to resist the rotational movements between the two subunits, giving the same degree of increase in the two rates. The mutation-induced increase in the maximal rate of the fast phase for the forward mRNA translocation results mainly from the increase in the rate of the ribosomal unlocking, a conformational change in the ribosome that widens the mRNA channel for the mRNA translocation to take place, which could be partly due to the effect of the mutation on the intrasubunit 30S head rotation. Moreover, we study the translation rate of the WT and mutant ribosomes. It is shown that the translation rate versus the concentration of EF-G-GTP does not follow the Michaelis-Menten (MM) kinetics, which is in sharp contrast to the general property of other enzymes that the rate of the enzymatic reaction versus the concentration of a substrate follows the MM kinetics. The physical origin of this non-MM kinetics for the ribosome is revealed.

  13. Crystal structures of complexes containing domains from two viral internal ribosome entry site (IRES) RNAs bound to the 70S ribosome.

    PubMed

    Zhu, Jianyu; Korostelev, Andrei; Costantino, David A; Donohue, John P; Noller, Harry F; Kieft, Jeffrey S

    2011-02-01

    Internal ribosome entry site (IRES) RNAs are elements of viral or cellular mRNAs that bypass steps of canonical eukaryotic cap-dependent translation initiation. Understanding of the structural basis of IRES mechanisms is limited, partially due to a lack of high-resolution structures of IRES RNAs bound to their cellular targets. Prompted by the universal phylogenetic conservation of the ribosomal P site, we solved the crystal structures of proposed P site binding domains from two intergenic region IRES RNAs bound to bacterial 70S ribosomes. The structures show that these IRES domains nearly perfectly mimic a tRNA • mRNA interaction. However, there are clear differences in the global shape and position of this IRES domain in the intersubunit space compared to those of tRNA, supporting a mechanism for IRES action that invokes hybrid state mimicry to drive a noncanonical mode of translocation. These structures suggest how relatively small structured RNAs can manipulate complex biological machines. PMID:21245352

  14. Autophagy induction is a Tor- and Tp53-independent cell survival response in a zebrafish model of disrupted ribosome biogenesis.

    PubMed

    Boglev, Yeliz; Badrock, Andrew P; Trotter, Andrew J; Du, Qian; Richardson, Elsbeth J; Parslow, Adam C; Markmiller, Sebastian J; Hall, Nathan E; de Jong-Curtain, Tanya A; Ng, Annie Y; Verkade, Heather; Ober, Elke A; Field, Holly A; Shin, Donghun; Shin, Chong H; Hannan, Katherine M; Hannan, Ross D; Pearson, Richard B; Kim, Seok-Hyung; Ess, Kevin C; Lieschke, Graham J; Stainier, Didier Y R; Heath, Joan K

    2013-01-01

    Ribosome biogenesis underpins cell growth and division. Disruptions in ribosome biogenesis and translation initiation are deleterious to development and underlie a spectrum of diseases known collectively as ribosomopathies. Here, we describe a novel zebrafish mutant, titania (tti(s450)), which harbours a recessive lethal mutation in pwp2h, a gene encoding a protein component of the small subunit processome. The biochemical impacts of this lesion are decreased production of mature 18S rRNA molecules, activation of Tp53, and impaired ribosome biogenesis. In tti(s450), the growth of the endodermal organs, eyes, brain, and craniofacial structures is severely arrested and autophagy is up-regulated, allowing intestinal epithelial cells to evade cell death. Inhibiting autophagy in tti(s450) larvae markedly reduces their lifespan. Somewhat surprisingly, autophagy induction in tti(s450) larvae is independent of the state of the Tor pathway and proceeds unabated in Tp53-mutant larvae. These data demonstrate that autophagy is a survival mechanism invoked in response to ribosomal stress. This response may be of relevance to therapeutic strategies aimed at killing cancer cells by targeting ribosome biogenesis. In certain contexts, these treatments may promote autophagy and contribute to cancer cells evading cell death. PMID:23408911

  15. Role of ribosomal protein mutations in tumor development (Review).

    PubMed

    Goudarzi, Kaveh M; Lindström, Mikael S

    2016-04-01

    Ribosomes are cellular machines essential for protein synthesis. The biogenesis of ribosomes is a highly complex and energy consuming process that initiates in the nucleolus. Recently, a series of studies applying whole-exome or whole-genome sequencing techniques have led to the discovery of ribosomal protein gene mutations in different cancer types. Mutations in ribosomal protein genes have for example been found in endometrial cancer (RPL22), T-cell acute lymphoblastic leukemia (RPL10, RPL5 and RPL11), chronic lymphocytic leukemia (RPS15), colorectal cancer (RPS20), and glioma (RPL5). Moreover, patients suffering from Diamond-Blackfan anemia, a bone marrow failure syndrome caused by mutant ribosomal proteins are also at higher risk for developing leukemia, or solid tumors. Different experimental models indicate potential mechanisms whereby ribosomal proteins may initiate cancer development. In particular, deregulation of the p53 tumor suppressor network and altered mRNA translation are mechanisms likely to be involved. We envisage that changes in expression and the occurrence of ribosomal protein gene mutations play important roles in cancer development. Ribosome biology constitutes a re-emerging vital area of basic and translational cancer research. PMID:26892688

  16. Role of ribosomal protein mutations in tumor development (Review)

    PubMed Central

    GOUDARZI, KAVEH M.; LINDSTRÖM, MIKAEL S.

    2016-01-01

    Ribosomes are cellular machines essential for protein synthesis. The biogenesis of ribosomes is a highly complex and energy consuming process that initiates in the nucleolus. Recently, a series of studies applying whole-exome or whole-genome sequencing techniques have led to the discovery of ribosomal protein gene mutations in different cancer types. Mutations in ribosomal protein genes have for example been found in endometrial cancer (RPL22), T-cell acute lymphoblastic leukemia (RPL10, RPL5 and RPL11), chronic lymphocytic leukemia (RPS15), colorectal cancer (RPS20), and glioma (RPL5). Moreover, patients suffering from Diamond-Blackfan anemia, a bone marrow failure syndrome caused by mutant ribosomal proteins are also at higher risk for developing leukemia, or solid tumors. Different experimental models indicate potential mechanisms whereby ribosomal proteins may initiate cancer development. In particular, deregulation of the p53 tumor suppressor network and altered mRNA translation are mechanisms likely to be involved. We envisage that changes in expression and the occurrence of ribosomal protein gene mutations play important roles in cancer development. Ribosome biology constitutes a re-emerging vital area of basic and translational cancer research. PMID:26892688

  17. Motion of individual ribosomes along mRNA

    NASA Astrophysics Data System (ADS)

    Visscher, Koen

    2004-11-01

    Ribosomes move along messenger RNA to translate a sequence of ribonucleotides into a corresponding sequence of amino acids that make up a protein. Efficient motion of ribosomes along the mRNA requires hydrolysis of GTP, converting chemical energy into mechanical work, like better known molecular motors such as kinesin. However, motion is just one of the many tasks of the ribosome, whereas for kinesin, motion itself is the main goal. In keeping with these functional differences, the ribosome is also much larger consisting of more than 50 proteins and with half of its mass made up of ribosomal RNA. Such structural complexity enables indirect ways of coupling GTP hydrolysis to directed motion. In order to elucidate the mechanochemical coupling in ribosomes we have developed a single-molecule assay based on using optical tweezers to record the motion of individual ribosomes along mRNA. Translation rates of 2-4 codons/s have been observed. However, when increasing the force opposing motion, we observe backward slippage of ribosomes along homopolymeric poly(U) messages. Currently, it is not clear if the motor operates in reverse or if backward motion has become completely uncoupled from GTP hydrolysis. Interestingly, force-induced backward motion is of biological relevance because of its possible role in -1 frameshifting, a mechanism used by viruses to regulate gene expression at the level of translation.

  18. Proteopedia Entry: The Large Ribosomal Subunit of "Haloarcula Marismortui"

    ERIC Educational Resources Information Center

    Decatur, Wayne A.

    2010-01-01

    This article presents a "Proteopedia" page that shows the refined version of the structure of the "Haloarcula" large ribosomal subunit as solved by the laboratories of Thomas Steitz and Peter Moore. The landmark structure is of great impact as it is the first atomic-resolution structure of the highly conserved ribosomal subunit which harbors…

  19. Kinetics of paused ribosome recycling in Escherichia coli

    PubMed Central

    Janssen, Brian D.; Hayes, Christopher S.

    2009-01-01

    Summary The bacterial tmRNA•SmpB system recycles stalled translation complexes in a process termed ‘ribosome rescue’. tmRNA•SmpB specifically recognizes ribosomes that are paused at or near the 3′ end of truncated mRNA, and therefore nucleolytic mRNA processing is required before paused ribosomes can be rescued from full-length transcripts. Here, we examine the recycling of ribosomes paused on both full-length and truncated mRNAs. Peptidyl-tRNAs corresponding to each paused translation complex were identified, and their turnover kinetics used to estimate the half-lives of paused ribosomes in vivo. Ribosomes were paused at stop codons on full-length mRNA using a nascent peptide motif that interferes with translation termination and elicits tmRNA•SmpB activity. Peptidyl-tRNA turnover from these termination-paused ribosomes was slightly more rapid in tmRNA+ cells (T1/2 = 22 ± 2.2 s), compared to ΔtmRNA cells (T1/2 = 32 ± 1.6 s). Overexpression of release factor-1 (RF-1) greatly accelerated peptidyl-tRNA turnover from termination-paused ribosomes in both tmRNA+ and ΔtmRNA cells, whereas other termination factors had little or no effect on recycling. In contrast to inefficient translation termination, ribosome recycling from truncated transcripts lacking in-frame stop codons was dramatically accelerated by tmRNA•SmpB. However, peptidyl-tRNA still turned over from nonstop-paused ribosomes at a significant rate (t1/2 = 61 ± 7.3 s) in ΔtmRNA cells. Overexpression of RF-1, RF-3, and ribosome recycling factor (RRF) in ΔtmRNA cells failed to accelerate ribosome recycling from nonstop mRNA. These results indicate that tmRNA•SmpB activity is rate-limited by mRNA cleavage, and that RF-3 and RRF do not constitute a tmRNA-independent rescue pathway as previously suggested. Peptidyl-tRNA turnover from nonstop-paused ribosomes in ΔtmRNA cells suggests the existence of another uncharacterized ribosome rescue pathway. PMID:19761774

  20. Accommodation of tmRNA-SmpB into stalled ribosomes: a cryo-EM study.

    PubMed

    Weis, Felix; Bron, Patrick; Rolland, Jean-Paul; Thomas, Daniel; Felden, Brice; Gillet, Reynald

    2010-02-01

    In eubacteria, translation of defective messenger RNAs (mRNAs) produces truncated polypeptides that stall on the ribosome. A quality control mechanism referred to as trans-translation is performed by transfer-messenger RNA (tmRNA), a specialized RNA acting as both a tRNA and an mRNA, associated with small protein B (SmpB). So far, a clear view of the structural movements of both the protein and RNA necessary to perform accommodation is still lacking. By using a construct containing the tRNA-like domain as well as the extended helix H2 of tmRNA, we present a cryo-electron microscopy study of the process of accommodation. The structure suggests how tmRNA and SmpB move into the ribosome decoding site after the release of EF-Tu.GDP. While two SmpB molecules are bound per ribosome in a preaccommodated state, our results show that during accommodation the SmpB protein interacting with the small subunit decoding site stays in place while the one interacting with the large subunit moves away. Relative to canonical translation, an additional movement is observed due to the rotation of H2. This suggests that the larger movement required to resume translation on a tmRNA internal open reading frame starts during accommodation. PMID:20038631

  1. Probing the mechanisms underlying human diseases in making ribosomes.

    PubMed

    Farley, Katherine I; Baserga, Susan J

    2016-08-15

    Ribosomes are essential, highly complex machines responsible for protein synthesis in all growing cells. Because of their importance, the process of building these machines is intricately regulated. Although the proteins involved in regulating ribosome biogenesis are just beginning to be understood, especially in human cells, the consequences for dysregulating this process have been even less studied. Such interruptions in ribosome synthesis result in a collection of human disorders known as ribosomopathies. Ribosomopathies, which occur due to mutations in proteins involved in the global process of ribosome biogenesis, result in tissue-specific defects. The questions posed by this dichotomy and the steps taken to address these questions are therefore the focus of this review: How can tissue-specific disorders result from alterations in global processes? Could ribosome specialization account for this difference? PMID:27528749

  2. DExD/H-box RNA helicases in ribosome biogenesis

    PubMed Central

    Martin, Roman; Straub, Annika U.; Doebele, Carmen; Bohnsack, Markus T.

    2013-01-01

    Ribosome synthesis requires a multitude of cofactors, among them DExD/H-box RNA helicases. Bacterial RNA helicases involved in ribosome assembly are not essential, while eukaryotes strictly require multiple DExD/H-box proteins that are involved in the much more complex ribosome biogenesis pathway. Here, RNA helicases are thought to act in structural remodeling of the RNPs including the modulation of protein binding, and they are required for allowing access or the release of specific snoRNPs from pre-ribosomes. Interestingly, helicase action is modulated by specific cofactors that can regulate recruitment and enzymatic activity. This review summarizes the current knowledge and focuses on recent findings and open questions on RNA helicase function and regulation in ribosome synthesis. PMID:22922795

  3. Prediction of ribosome footprint profile shapes from transcript sequences

    PubMed Central

    Liu, Tzu-Yu; Song, Yun S.

    2016-01-01

    Motivation: Ribosome profiling is a useful technique for studying translational dynamics and quantifying protein synthesis. Applications of this technique have shown that ribosomes are not uniformly distributed along mRNA transcripts. Understanding how each transcript-specific distribution arises is important for unraveling the translation mechanism. Results: Here, we apply kernel smoothing to construct predictive features and build a sparse model to predict the shape of ribosome footprint profiles from transcript sequences alone. Our results on Saccharomyces cerevisiae data show that the marginal ribosome densities can be predicted with high accuracy. The proposed novel method has a wide range of applications, including inferring isoform-specific ribosome footprints, designing transcripts with fast translation speeds and discovering unknown modulation during translation. Availability and implementation: A software package called riboShape is freely available at https://sourceforge.net/projects/riboshape Contact: yss@berkeley.edu PMID:27307616

  4. Structures of Eukaryotic Ribosomal Stalk Proteins and Its Complex with Trichosanthin, and Their Implications in Recruiting Ribosome-Inactivating Proteins to the Ribosomes

    PubMed Central

    Choi, Andrew K. H.; Wong, Eddie C. K.; Lee, Ka-Ming; Wong, Kam-Bo

    2015-01-01

    Ribosome-inactivating proteins (RIP) are RNA N-glycosidases that inactivate ribosomes by specifically depurinating a conserved adenine residue at the α-sarcin/ricin loop of 28S rRNA. Recent studies have pointed to the involvement of the C-terminal domain of the eukaryotic stalk proteins in facilitating the toxic action of RIPs. This review highlights how structural studies of eukaryotic stalk proteins provide insights into the recruitment of RIPs to the ribosomes. Since the C-terminal domain of eukaryotic stalk proteins is involved in specific recognition of elongation factors and some eukaryote-specific RIPs (e.g., trichosanthin and ricin), we postulate that these RIPs may have evolved to hijack the translation-factor-recruiting function of ribosomal stalk in reaching their target site of rRNA. PMID:25723321

  5. mRNA Translocation Occurs During the Second Step of Ribosomal Intersubunit Rotation

    PubMed Central

    Ermolenko, Dmitri N.; Noller, Harry F.

    2010-01-01

    During protein synthesis, mRNA and tRNA undergo coupled translocation through the ribosome in a process that is catalyzed by elongation factor EF-G. Based on cryo-EM reconstructions, counterclockwise and clockwise rotational movements between the large and small ribosomal subunits have been implicated in a proposed ratcheting mechanism to drive the unidirectional movement of translocation. We have used a combination of two fluorescence-based approaches to study the timing of these events: Intersubunit FRET measurements to observe relative rotational movement of the subunits and a fluorescence quenching assay to monitor translocation of mRNA. Binding of EF-G·GTP first induces rapid counterclockwise intersubunit rotation, followed by a slower, clockwise reversal of the rotational movement. Comparison of the rates of these movements reveals that mRNA translocation occurs during the second, clockwise rotation event, corresponding to the transition from the hybrid state to the classical state. PMID:21399643

  6. Regulation of ribosomal DNA amplification by the TOR pathway

    PubMed Central

    Jack, Carmen V.; Cruz, Cristina; Hull, Ryan M.; Keller, Markus A.; Ralser, Markus; Houseley, Jonathan

    2015-01-01

    Repeated regions are widespread in eukaryotic genomes, and key functional elements such as the ribosomal DNA tend to be formed of high copy repeated sequences organized in tandem arrays. In general, high copy repeats are remarkably stable, but a number of organisms display rapid ribosomal DNA amplification at specific times or under specific conditions. Here we demonstrate that target of rapamycin (TOR) signaling stimulates ribosomal DNA amplification in budding yeast, linking external nutrient availability to ribosomal DNA copy number. We show that ribosomal DNA amplification is regulated by three histone deacetylases: Sir2, Hst3, and Hst4. These enzymes control homologous recombination-dependent and nonhomologous recombination-dependent amplification pathways that act in concert to mediate rapid, directional ribosomal DNA copy number change. Amplification is completely repressed by rapamycin, an inhibitor of the nutrient-responsive TOR pathway; this effect is separable from growth rate and is mediated directly through Sir2, Hst3, and Hst4. Caloric restriction is known to up-regulate expression of nicotinamidase Pnc1, an enzyme that enhances Sir2, Hst3, and Hst4 activity. In contrast, normal glucose concentrations stretch the ribosome synthesis capacity of cells with low ribosomal DNA copy number, and we find that these cells show a previously unrecognized transcriptional response to caloric excess by reducing PNC1 expression. PNC1 down-regulation forms a key element in the control of ribosomal DNA amplification as overexpression of PNC1 substantially reduces ribosomal DNA amplification rate. Our results reveal how a signaling pathway can orchestrate specific genome changes and demonstrate that the copy number of repetitive DNA can be altered to suit environmental conditions. PMID:26195783

  7. Regulation of ribosome biogenesis in maize embryonic axes during germination.

    PubMed

    Villa-Hernández, J M; Dinkova, T D; Aguilar-Caballero, R; Rivera-Cabrera, F; Sánchez de Jiménez, E; Pérez-Flores, L J

    2013-10-01

    Ribosome biogenesis is a pre-requisite for cell growth and proliferation; it is however, a highly regulated process that consumes a great quantity of energy. It requires the coordinated production of rRNA, ribosomal proteins and non-ribosomal factors which participate in the processing and mobilization of the new ribosomes. Ribosome biogenesis has been studied in yeast and animals; however, there is little information about this process in plants. The objective of the present work was to study ribosome biogenesis in maize seeds during germination, a stage characterized for its fast growth, and the effect of insulin in this process. Insulin has been reported to accelerate germination and to induce seedling growth. It was observed that among the first events reactivated just after 3 h of imbibition are the rDNA transcription and the pre-rRNA processing and that insulin stimulates both of them (40-230%). The transcript of nucleolin, a protein which regulates rDNA transcription and pre-rRNA processing, is among the messages stored in quiescent dry seeds and it is mobilized into the polysomal fraction during the first hours of imbibition (6 h). In contrast, de novo ribosomal protein synthesis was low during the first hours of imbibition (3 and 6 h) increasing by 60 times in later stages (24 h). Insulin increased this synthesis (75%) at 24 h of imbibition; however, not all ribosomal proteins were similarly regulated. In this regard, an increase in RPS6 and RPL7 protein levels was observed, whereas RPL3 protein levels did not change even though its transcription was induced. Results show that ribosome biogenesis in the first stages of imbibition is carried out with newly synthesized rRNA and ribosomal proteins translated from stored mRNA. PMID:23806421

  8. Crystal Structures of the uL3 Mutant Ribosome: Illustration of the Importance of Ribosomal Proteins for Translation Efficiency.

    PubMed

    Mailliot, Justine; Garreau de Loubresse, Nicolas; Yusupova, Gulnara; Meskauskas, Arturas; Dinman, Jonathan D; Yusupov, Marat

    2016-05-22

    The ribosome has been described as a ribozyme in which ribosomal RNA is responsible for peptidyl-transferase reaction catalysis. The W255C mutation of the universally conserved ribosomal protein uL3 has diverse effects on ribosome function (e.g., increased affinities for transfer RNAs, decreased rates of peptidyl-transfer), and cells harboring this mutation are resistant to peptidyl-transferase inhibitors (e.g., anisomycin). These observations beg the question of how a single amino acid mutation may have such wide ranging consequences. Here, we report the structure of the vacant yeast uL3 W255C mutant ribosome by X-ray crystallography, showing a disruption of the A-site side of the peptidyl-transferase center (PTC). An additional X-ray crystallographic structure of the anisomycin-containing mutant ribosome shows that high concentrations of this inhibitor restore a "WT-like" configuration to this region of the PTC, providing insight into the resistance mechanism of the mutant. Globally, our data demonstrate that ribosomal protein uL3 is structurally essential to ensure an optimal and catalytically efficient organization of the PTC, highlighting the importance of proteins in the RNA-centered ribosome. PMID:26906928

  9. PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Knowlton, Nancy

    2012-01-01

    Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets

  10. Modifying the maker: Oxygenases target ribosome biology.

    PubMed

    Zhuang, Qinqin; Feng, Tianshu; Coleman, Mathew L

    2015-01-01

    The complexity of the eukaryotic protein synthesis machinery is partly driven by extensive and diverse modifications to associated proteins and RNAs. These modifications can have important roles in regulating translation factor activity and ribosome biogenesis and function. Further investigation of 'translational modifications' is warranted considering the growing evidence implicating protein synthesis as a critical point of gene expression control that is commonly deregulated in disease. New evidence suggests that translation is a major new target for oxidative modifications, specifically hydroxylations and demethylations, which generally are catalyzed by a family of emerging oxygenase enzymes that act at the interface of nutrient availability and metabolism. This review summarizes what is currently known about the role or these enzymes in targeting rRNA synthesis, protein translation and associated cellular processes. PMID:26779412

  11. Ribosome-Inactivating and Related Proteins

    PubMed Central

    Schrot, Joachim; Weng, Alexander; Melzig, Matthias F.

    2015-01-01

    Ribosome-inactivating proteins (RIPs) are toxins that act as N-glycosidases (EC 3.2.2.22). They are mainly produced by plants and classified as type 1 RIPs and type 2 RIPs. There are also RIPs and RIP related proteins that cannot be grouped into the classical type 1 and type 2 RIPs because of their different sizes, structures or functions. In addition, there is still not a uniform nomenclature or classification existing for RIPs. In this review, we give the current status of all known plant RIPs and we make a suggestion about how to unify those RIPs and RIP related proteins that cannot be classified as type 1 or type 2 RIPs. PMID:26008228

  12. Modifying the maker: Oxygenases target ribosome biology

    PubMed Central

    Zhuang, Qinqin; Feng, Tianshu; Coleman, Mathew L

    2015-01-01

    The complexity of the eukaryotic protein synthesis machinery is partly driven by extensive and diverse modifications to associated proteins and RNAs. These modifications can have important roles in regulating translation factor activity and ribosome biogenesis and function. Further investigation of ‘translational modifications’ is warranted considering the growing evidence implicating protein synthesis as a critical point of gene expression control that is commonly deregulated in disease. New evidence suggests that translation is a major new target for oxidative modifications, specifically hydroxylations and demethylations, which generally are catalyzed by a family of emerging oxygenase enzymes that act at the interface of nutrient availability and metabolism. This review summarizes what is currently known about the role or these enzymes in targeting rRNA synthesis, protein translation and associated cellular processes. PMID:26779412

  13. Altering the ribosomal subunit ratio in yeast maximizes recombinant protein yield

    PubMed Central

    Bonander, Nicklas; Darby, Richard AJ; Grgic, Ljuban; Bora, Nagamani; Wen, Jikai; Brogna, Saverio; Poyner, David R; O'Neill, Michael AA; Bill, Roslyn M

    2009-01-01

    Background The production of high yields of recombinant proteins is an enduring bottleneck in the post-genomic sciences that has yet to be addressed in a truly rational manner. Typically eukaryotic protein production experiments have relied on varying expression construct cassettes such as promoters and tags, or culture process parameters such as pH, temperature and aeration to enhance yields. These approaches require repeated rounds of trial-and-error optimization and cannot provide a mechanistic insight into the biology of recombinant protein production. We published an early transcriptome analysis that identified genes implicated in successful membrane protein production experiments in yeast. While there has been a subsequent explosion in such analyses in a range of production organisms, no one has yet exploited the genes identified. The aim of this study was to use the results of our previous comparative transcriptome analysis to engineer improved yeast strains and thereby gain an understanding of the mechanisms involved in high-yielding protein production hosts. Results We show that tuning BMS1 transcript levels in a doxycycline-dependent manner resulted in optimized yields of functional membrane and soluble protein targets. Online flow microcalorimetry demonstrated that there had been a substantial metabolic change to cells cultured under high-yielding conditions, and in particular that high yielding cells were more metabolically efficient. Polysome profiling showed that the key molecular event contributing to this metabolically efficient, high-yielding phenotype is a perturbation of the ratio of 60S to 40S ribosomal subunits from approximately 1:1 to 2:1, and correspondingly of 25S:18S ratios from 2:1 to 3:1. This result is consistent with the role of the gene product of BMS1 in ribosome biogenesis. Conclusion This work demonstrates the power of a rational approach to recombinant protein production by using the results of transcriptome analysis to engineer

  14. Yeast Ribosomal Protein L40 Assembles Late into Precursor 60 S Ribosomes and Is Required for Their Cytoplasmic Maturation*

    PubMed Central

    Fernández-Pevida, Antonio; Rodríguez-Galán, Olga; Díaz-Quintana, Antonio; Kressler, Dieter; de la Cruz, Jesús

    2012-01-01

    Most ribosomal proteins play important roles in ribosome biogenesis and function. Here, we have examined the contribution of the essential ribosomal protein L40 in these processes in the yeast Saccharomyces cerevisiae. Deletion of either the RPL40A or RPL40B gene and in vivo depletion of L40 impair 60 S ribosomal subunit biogenesis. Polysome profile analyses reveal the accumulation of half-mers and a moderate reduction in free 60 S ribosomal subunits. Pulse-chase, Northern blotting, and primer extension analyses in the L40-depleted strain clearly indicate that L40 is not strictly required for the precursor rRNA (pre-rRNA) processing reactions but contributes to optimal 27 SB pre-rRNA maturation. Moreover, depletion of L40 hinders the nucleo-cytoplasmic export of pre-60 S ribosomal particles. Importantly, all these defects most likely appear as the direct consequence of impaired Nmd3 and Rlp24 release from cytoplasmic pre-60 S ribosomal subunits and their inefficient recycling back into the nucle(ol)us. In agreement, we show that hemagglutinin epitope-tagged L40A assembles in the cytoplasm into almost mature pre-60 S ribosomal particles. Finally, we have identified that the hemagglutinin epitope-tagged L40A confers resistance to sordarin, a translation inhibitor that impairs the function of eukaryotic elongation factor 2, whereas the rpl40a and rpl40b null mutants are hypersensitive to this antibiotic. We conclude that L40 is assembled at a very late stage into pre-60 S ribosomal subunits and that its incorporation into 60 S ribosomal subunits is a prerequisite for subunit joining and may ensure proper functioning of the translocation process. PMID:22995916

  15. Bmi1 promotes erythroid development through regulating ribosome biogenesis

    PubMed Central

    Gao, Rui; Chen, Sisi; Kobayashi, Michihiro; Yu, Hao; Zhang, Yingchi; Wan, Yang; Young, Sara K.; Soltis, Anthony; Yu, Ming; Vemula, Sasidhar; Fraenkel, Ernest; Cantor, Alan; Antipin, Yevgeniy; Xu, Yang; Yoder, Mervin C.; Wek, Ronald C.; Ellis, Steven R.; Kapur, Reuben; Zhu, Xiaofan; Liu, Yan

    2015-01-01

    While Polycomb group protein Bmi1 is important for stem cell maintenance, its role in lineage commitment is largely unknown. We have identified Bmi1 as a novel regulator of erythroid development. Bmi1 is highly expressed in mouse erythroid progenitor cells and its deficiency impairs erythroid differentiation. BMI1 is also important for human erythroid development. Furthermore, we discovered that loss of Bmi1 in erythroid progenitor cells results in down-regulation of transcription of multiple ribosomal protein genes and impaired ribosome biogenesis. Bmi1 deficiency stabilizes p53 protein, leading to upregulation of p21 expression and subsequent G0/G1 cell cycle arrest. Genetic inhibition of p53 activity rescues the erythroid defects seen in the Bmi1 null mice, demonstrating that a p53-dependent mechanism underlies the pathophysiology of the anemia. Mechanistically, Bmi1 is associated with multiple ribosomal protein genes and may positively regulate their expression in erythroid progenitor cells. Thus, Bmi1 promotes erythroid development, at least in part through regulating ribosome biogenesis. Ribosomopathies are human disorders of ribosome dysfunction, including diamond blackfan anemia (DBA) and 5q- syndrome, in which genetic abnormalities cause impaired ribosome biogenesis, resulting in specific clinical phenotypes. We observed that BMI1 expression in human hematopoietic stem and progenitor cells (HSPCs) from patients with DBA is correlated with the expression of some ribosomal protein genes, suggesting that BMI1 deficiency may play a pathological role in DBA and other ribosomopathies. PMID:25385494

  16. Bmi1 promotes erythroid development through regulating ribosome biogenesis.

    PubMed

    Gao, Rui; Chen, Sisi; Kobayashi, Michihiro; Yu, Hao; Zhang, Yingchi; Wan, Yang; Young, Sara K; Soltis, Anthony; Yu, Ming; Vemula, Sasidhar; Fraenkel, Ernest; Cantor, Alan; Antipin, Yevgeniy; Xu, Yang; Yoder, Mervin C; Wek, Ronald C; Ellis, Steven R; Kapur, Reuben; Zhu, Xiaofan; Liu, Yan

    2015-03-01

    While Polycomb group protein Bmi1 is important for stem cell maintenance, its role in lineage commitment is largely unknown. We have identified Bmi1 as a novel regulator of erythroid development. Bmi1 is highly expressed in mouse erythroid progenitor cells and its deficiency impairs erythroid differentiation. BMI1 is also important for human erythroid development. Furthermore, we discovered that loss of Bmi1 in erythroid progenitor cells results in decreased transcription of multiple ribosomal protein genes and impaired ribosome biogenesis. Bmi1 deficiency stabilizes p53 protein, leading to upregulation of p21 expression and subsequent G0/G1 cell cycle arrest. Genetic inhibition of p53 activity rescues the erythroid defects seen in the Bmi1 null mice, demonstrating that a p53-dependent mechanism underlies the pathophysiology of the anemia. Mechanistically, Bmi1 is associated with multiple ribosomal protein genes and may positively regulate their expression in erythroid progenitor cells. Thus, Bmi1 promotes erythroid development, at least in part through regulating ribosome biogenesis. Ribosomopathies are human disorders of ribosome dysfunction, including Diamond-Blackfan anemia (DBA) and 5q- syndrome, in which genetic abnormalities cause impaired ribosome biogenesis, resulting in specific clinical phenotypes. We observed that BMI1 expression in human hematopoietic stem and progenitor cells from patients with DBA is correlated with the expression of some ribosomal protein genes, suggesting that BMI1 deficiency may play a pathological role in DBA and other ribosomopathies. PMID:25385494

  17. Sharing of mitotic pre-ribosomal particles between daughter cells.

    PubMed

    Sirri, Valentina; Jourdan, Nathalie; Hernandez-Verdun, Danièle; Roussel, Pascal

    2016-04-15

    Ribosome biogenesis is a fundamental multistep process initiated by the synthesis of 90S pre-ribosomal particles in the nucleoli of higher eukaryotes. Even though synthesis of ribosomes stops during mitosis while nucleoli disappear, mitotic pre-ribosomal particles persist as observed in pre-nucleolar bodies (PNBs) during telophase. To further understand the relationship between the nucleolus and the PNBs, the presence and the fate of the mitotic pre-ribosomal particles during cell division were investigated. We demonstrate that the recently synthesized 45S precursor ribosomal RNAs (pre-rRNAs) as well as the 32S and 30S pre-rRNAs are maintained during mitosis and associated with the chromosome periphery together with pre-rRNA processing factors. Maturation of the mitotic pre-ribosomal particles, as assessed by the stability of the mitotic pre-rRNAs, is transiently arrested during mitosis by a cyclin-dependent kinase (CDK)1-cyclin-B-dependent mechanism and can be restored by CDK inhibitor treatments. At the M-G1 transition, the resumption of mitotic pre-rRNA processing in PNBs does not induce the disappearance of PNBs; this only occurs when functional nucleoli reform. Strikingly, during their maturation process, mitotic pre-rRNAs localize in reforming nucleoli. PMID:26929073

  18. Stochastic kinetics of ribosomes: Single motor properties and collective behavior

    NASA Astrophysics Data System (ADS)

    Garai, Ashok; Chowdhury, Debanjan; Chowdhury, Debashish; Ramakrishnan, T. V.

    2009-07-01

    Syntheses of protein molecules in a cell are carried out by ribosomes. A ribosome can be regarded as a molecular motor which utilizes the input chemical energy to move on a messenger RNA (mRNA) track that also serves as a template for the polymerization of the corresponding protein. The forward movement, however, is characterized by an alternating sequence of translocation and pause. Using a quantitative model, which captures the mechanochemical cycle of an individual ribosome, we derive an exact analytical expression for the distribution of its dwell times at the successive positions on the mRNA track. Inverse of the average dwell time satisfies a “Michaelis-Menten-type” equation and is consistent with the general formula for the average velocity of a molecular motor with an unbranched mechanochemical cycle. Extending this formula appropriately, we also derive the exact force-velocity relation for a ribosome. Often many ribosomes simultaneously move on the same mRNA track, while each synthesizes a copy of the same protein. We extend the model of a single ribosome by incorporating steric exclusion of different individuals on the same track. We draw the phase diagram of this model of ribosome traffic in three-dimensional spaces spanned by experimentally controllable parameters. We suggest new experimental tests of our theoretical predictions.

  19. Functional interaction of yeast elongation factor 3 with yeast ribosomes.

    PubMed

    Chakraburtty, K

    1999-01-01

    Elongation factor 3 (EF-3) is a unique and essential requirement of the fungal translational apparatus. EF-3 is a monomeric protein with a molecular mass of 116,000. EF-3 is required by yeast ribosomes for in vitro translation and for in vivo growth. The protein stimulates the binding of EF-1 alpha :GTP:aa-tRNA ternary complex to the ribosomal A-site by facilitating release of deacylated-tRNA from the E-site. The reaction requires ATP hydrolysis. EF-3 contains two ATP-binding sequence motifs (NBS). NBSI is sufficient for the intrinsic ATPase function. NBSII is essential for ribosome-stimulated activity. By limited proteolysis, EF-3 was divided into two distinct functional domains. The N-terminal domain lacking the highly charged lysine blocks failed to bind ribosomes and was inactive in the ribosome-stimulated ATPase activity. The C-terminally derived lysine-rich fragment showed strong binding to yeast ribosomes. The purported S5 homology region of EF-3 at the N-terminal end has been reported to interact with 18S ribosomal RNA. We postulate that EF-3 contacts rRNA and/or protein(s) through the C-terminal end. Removal of these residues severely weakens its interaction mediated possibly through the N-terminal domain of the protein. PMID:10216951

  20. Evidence that Yih1 resides in a complex with ribosomes.

    PubMed

    Waller, Tracey; Lee, Su Jung; Sattlegger, Evelyn

    2012-05-01

    Adjusting protein synthesis by phosphorylating eukaryotic translation initiation factor 2 (eIF2α) is a major mechanism by which eukaryotes adapt to and overcome stress. The eIF2α kinase Gcn2 is essential for overcoming amino acid starvation in all eukaryotes. We have shown that to sense starvation, the Gcn2 RWD domain must directly contact its effector protein, Gcn1, and both must bind to the ribosome, suggesting that starvation is sensed within a Gcn1-Gcn2-ribosome complex. The mammalian protein IMPACT, highly expressed in neurons, and its yeast orthologue yeast IMPACT homologue (Yih1) harbour an RWD domain with Gcn1-binding activity. We have shown that Yih1 downregulates Gcn2 by competing with Gcn2 for Gcn1-binding. Here, we provide evidence that Yih1 forms a complex with ribosomes. In velocity sedimentation assays, overexpressed glutathione S-transferase (GST)-tagged Yih1 cosedimented with polyribosomes independently of Gcn1. Reduction of polyribosomes to monosomes concomitantly decreased GST-Yih1 sedimentation in the heavy fractions where polyribosomes are normally found. Furthermore, GST-Yih1 coprecipitated large ribosomal protein Rpl39 independently of Gcn1. GST-Yih1 overexpression did not significantly affect Gcn1-ribosome or Gcn2-ribosome cosedimentation. myc-tagged Yih1 expressed from its own promoter cosedimented with polyribosomes independently of Gcn1, indicating that Yih1-ribosome interaction occurs under physiological conditions. GST-IMPACT cosedimented with yeast ribosomes and coprecipitated Rpl39 in a Gcn1-independent fashion, suggesting that Yih1/IMPACT-ribosome association is evolutionarily conserved. Moreover, GST-IMPACT coprecipitated actin as found for GST-Yih1. Taken together, our findings strongly suggest that IMPACT/Yih1 associates with ribosomes and that these ribosomes may simultaneously carry Gcn1 and Gcn2. Close physical proximity of Yih1 to the Gcn1-Gcn2-ribosome complex would allow cells to quickly inhibit Gcn2 whenever or wherever

  1. Quantitative assessment of ribosome drop-off in E. coli.

    PubMed

    Sin, Celine; Chiarugi, Davide; Valleriani, Angelo

    2016-04-01

    Premature ribosome drop-off is one of the major errors in translation of mRNA by ribosomes. However, repeated analyses of Ribo-seq data failed to quantify its strength inE. coli Relying on a novel highly sensitive data analysis method we show that a significant rate of ribosome drop-off is measurable and can be quantified also when cells are cultured under non-stressing conditions. Moreover, we find that the drop-off rate is highly variable, depending on multiple factors. In particular, under environmental stress such as amino acid starvation or ethanol intoxication, the drop-off rate markedly increases. PMID:26935582

  2. Whither Ribosome Structure and Dynamics Research? (A Perspective).

    PubMed

    Frank, Joachim

    2016-09-11

    As high-resolution cryogenic electron microscopy (cryo-EM) structures of ribosomes proliferate, at resolutions that allow atomic interactions to be visualized, this article attempts to give a perspective on the way research on ribosome structure and dynamics may be headed, and particularly the new opportunities we have gained through recent advances in cryo-EM. It is pointed out that single-molecule FRET and cryo-EM form natural complements in the characterization of ribosome dynamics and transitions among equilibrating states of in vitro translational systems. PMID:27178840

  3. Quantitative assessment of ribosome drop-off in E. coli

    PubMed Central

    Sin, Celine; Chiarugi, Davide; Valleriani, Angelo

    2016-01-01

    Premature ribosome drop-off is one of the major errors in translation of mRNA by ribosomes. However, repeated analyses of Ribo-seq data failed to quantify its strength in E. coli. Relying on a novel highly sensitive data analysis method we show that a significant rate of ribosome drop-off is measurable and can be quantified also when cells are cultured under non-stressing conditions. Moreover, we find that the drop-off rate is highly variable, depending on multiple factors. In particular, under environmental stress such as amino acid starvation or ethanol intoxication, the drop-off rate markedly increases. PMID:26935582

  4. Synchronous tRNA movements during translocation on the ribosome are orchestrated by elongation factor G and GTP hydrolysis.

    PubMed

    Holtkamp, Wolf; Wintermeyer, Wolfgang; Rodnina, Marina V

    2014-10-01

    The translocation of tRNAs through the ribosome proceeds through numerous small steps in which tRNAs gradually shift their positions on the small and large ribosomal subunits. The most urgent questions are: (i) whether these intermediates are important; (ii) how the ribosomal translocase, the GTPase elongation factor G (EF-G), promotes directed movement; and (iii) how the energy of GTP hydrolysis is coupled to movement. In the light of recent advances in biophysical and structural studies, we argue that intermediate states of translocation are snapshots of dynamic fluctuations that guide the movement. In contrast to current models of stepwise translocation, kinetic evidence shows that the tRNAs move synchronously on the two ribosomal subunits in a rapid reaction orchestrated by EF-G and GTP hydrolysis. EF-G combines the energy regimes of a GTPase and a motor protein and facilitates tRNA movement by a combination of directed Brownian ratchet and power stroke mechanisms. PMID:25118068

  5. Folding and escape of nascent proteins at ribosomal exit tunnel

    NASA Astrophysics Data System (ADS)

    Bui, Phuong Thuy; Hoang, Trinh Xuan

    2016-03-01

    We investigate the interplay between post-translational folding and escape of two small single-domain proteins at the ribosomal exit tunnel by using Langevin dynamics with coarse-grained models. It is shown that at temperatures lower or near the temperature of the fastest folding, folding proceeds concomitantly with the escape process, resulting in vectorial folding and enhancement of foldability of nascent proteins. The concomitance between the two processes, however, deteriorates as temperature increases. Our folding simulations as well as free energy calculation by using umbrella sampling show that, at low temperatures, folding at the tunnel follows one or two specific pathways without kinetic traps. It is shown that the escape time can be mapped to a one-dimensional diffusion model with two different regimes for temperatures above and below the folding transition temperature. Attractive interactions between amino acids and attractive sites on the tunnel wall lead to a free energy barrier along the escape route of the protein. It is suggested that this barrier slows down the escape process and consequently promotes correct folding of the released nascent protein.

  6. Folding and escape of nascent proteins at ribosomal exit tunnel.

    PubMed

    Bui, Phuong Thuy; Hoang, Trinh Xuan

    2016-03-01

    We investigate the interplay between post-translational folding and escape of two small single-domain proteins at the ribosomal exit tunnel by using Langevin dynamics with coarse-grained models. It is shown that at temperatures lower or near the temperature of the fastest folding, folding proceeds concomitantly with the escape process, resulting in vectorial folding and enhancement of foldability of nascent proteins. The concomitance between the two processes, however, deteriorates as temperature increases. Our folding simulations as well as free energy calculation by using umbrella sampling show that, at low temperatures, folding at the tunnel follows one or two specific pathways without kinetic traps. It is shown that the escape time can be mapped to a one-dimensional diffusion model with two different regimes for temperatures above and below the folding transition temperature. Attractive interactions between amino acids and attractive sites on the tunnel wall lead to a free energy barrier along the escape route of the protein. It is suggested that this barrier slows down the escape process and consequently promotes correct folding of the released nascent protein. PMID:26957181

  7. Effect of alpha-sarcin and ribosome-inactivating proteins on the interaction of elongation factors with ribosomes.

    PubMed

    Brigotti, M; Rambelli, F; Zamboni, M; Montanaro, L; Sperti, S

    1989-02-01

    alpha-Sarcin from Aspergillus giganteus and the ribosome-inactivating proteins (RIPs) from higher plants inactivate the 60 S ribosomal subunit. The former is an RNAase, whereas RIPs are N-glycosidases. The site of cleavage of RNA and that of N-glycosidic depurinization are at one nucleotide distance in 28 S rRNA [Endo & Tsurugi (1987) J. Biol. Chem. 262, 8128-8130]. The effect of alpha-sarcin and that of RIPs on the interaction of elongation factors with Artemia salina (brine shrimp) ribosomes have been investigated. alpha-Sarcin inhibits both the EF1 (elongation factor 1)-dependent binding of aminoacyl-tRNA and the GTP-dependent binding of EF2 (elongation factor 2) to ribosomes, whereas two of the RIPs tested, ricin from Ricinus communis (castor bean) and volkensin from Adenia volkensii (kilyambiti), inhibit only the latter reaction. EF2 protects ribosomes from inactivation by both alpha-sarcin and ricin. The EF1-binding site is affected only by alpha-sarcin. The sensitivity of this site to alpha-sarcin is increased by pretreatment of ribosomes with ricin. A. salina ribosomes were highly resistant to the third RIP tested, namely gelonin from Gelonium multiflorum. All four proteins tested have, however, a comparable activity on the rabbit reticulocyte-lysate system. PMID:2930482

  8. 40S recruitment in the absence of eIF4G/4A by EMCV IRES refines the model for translation initiation on the archetype of Type II IRESs

    PubMed Central

    Chamond, Nathalie; Deforges, Jules; Ulryck, Nathalie; Sargueil, Bruno

    2014-01-01

    Initiation of translation on Type II IRESs, such as those of EMCV and FMDV viruses, has been well documented in the recent years. For EMCV, the current model argues for a mechanism in which the key interaction necessary for the pre-initiation complex recruitment is eIF4G binding to the central J-K domains of EMCV-IRES. Here we demonstrate that, in contrast with the current model, the molecular mechanism of EMCV-IRES involves direct recruitment of the 40S subunit. Importantly, we identified a specific structural element that prevents the correct positioning of the initiation codon in the close vicinity of the ribosomal P site. This work clarifies how this interaction could not be anticipated by earlier studies and allows us to propose a new model for initiation complex assembly on EMCV-IRES. The role attributed to eIF4G/4A can thus be refined as stabilizing/promoting the conformational changes that are necessary for IRES function, thus resembling the role conventionally assigned to ITAFs. This raises the interesting possibility that IRESs are primarily ribosome binders, some of which having partly lost the ability to fold into the active structure without the help of proteins. PMID:25159618

  9. Systematics of Chaetognatha under the light of molecular data, using duplicated ribosomal 18S DNA sequences.

    PubMed

    Papillon, Daniel; Perez, Yvan; Caubit, Xavier; Le Parco, Yannick

    2006-03-01

    While the phylogenetic position of Chaetognatha has became central to the question of early bilaterian evolution, the internal systematics of the phylum are still not clear. The phylogenetic relationships of the chaetognaths were investigated using newly obtained small subunit ribosomal RNA nuclear 18S (SSU rRNA) sequences from 16 species together with 3 sequences available in GenBank. As previously shown with the large subunit ribosomal RNA 28S gene, two classes of Chaetognatha SSU rRNA gene can be identified, suggesting a duplication of the whole ribosomal cluster; allowing the rooting of one class of genes by another in phylogenetic analyses. Maximum Parsimony, Maximum Likelihood and Bayesian analyses of the molecular data, and statistical tests showed (1) that there are three main monophyletic groups: Sagittidae/Krohnittidae, Spadellidae/Pterosagittidae, and Eukrohniidae/Heterokrohniidae, (2) that the group of Aphragmophora without Pterosagittidae (Sagittidae/Krohnittidae) is monophyletic, (3) the Spadellidae/Pterosagittidae and Eukrohniidae/Heterokrohniidae families are very likely clustered, (4) the Krohnittidae and Pterosagittidae groups should no longer be considered as families as they are included in other groups designated as families, (5) suborder Ctenodontina is not monophyletic and the Flabellodontina should no longer be considered as a suborder, and (6) the Syngonata/Chorismogonata and the Monophragmophora/Biphragmophora hypotheses are rejected. Such conclusions are considered in the light of morphological characters, several of which are shown to be prone to homoplasy. PMID:16434216

  10. Complete nuclear ribosomal DNA sequence amplification and molecular analyses of Bangia (Bangiales, Rhodophyta) from China

    NASA Astrophysics Data System (ADS)

    Xu, Jiajie; Jiang, Bo; Chai, Sanming; He, Yuan; Zhu, Jianyi; Shen, Zonggen; Shen, Songdong

    2016-01-01

    Filamentous Bangia, which are distributed extensively throughout the world, have simple and similar morphological characteristics. Scientists can classify these organisms using molecular markers in combination with morphology. We successfully sequenced the complete nuclear ribosomal DNA, approximately 13 kb in length, from a marine Bangia population. We further analyzed the small subunit ribosomal DNA gene (nrSSU) and the internal transcribed spacer (ITS) sequence regions along with nine other marine, and two freshwater Bangia samples from China. Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences (00.003; 0-0.006, respectively) from each other, but high divergences (0.123-0.126; 0.198, respectively) from freshwater samples. An exception is the marine sample collected from Weihai, which shows high divergence from both other marine samples (0.063-0.065; 0.129, respectively) and the freshwater samples (0.097; 0.120, respectively). A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades, with the two marine sample clades containing Bangia spp. from North America, Europe, Asia, and Australia; and one freshwater clade, containing Bangia atropurpurea from North America and China.

  11. Complete nuclear ribosomal DNA sequence amplification and molecular analyses of Bangia (Bangiales, Rhodophyta) from China

    NASA Astrophysics Data System (ADS)

    Xu, Jiajie; Jiang, Bo; Chai, Sanming; He, Yuan; Zhu, Jianyi; Shen, Zonggen; Shen, Songdong

    2016-09-01

    Filamentous Bangia, which are distributed extensively throughout the world, have simple and similar morphological characteristics. Scientists can classify these organisms using molecular markers in combination with morphology. We successfully sequenced the complete nuclear ribosomal DNA, approximately 13 kb in length, from a marine Bangia population. We further analyzed the small subunit ribosomal DNA gene (nrSSU) and the internal transcribed spacer (ITS) sequence regions along with nine other marine, and two freshwater Bangia samples from China. Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences (00.003; 0-0.006, respectively) from each other, but high divergences (0.123-0.126; 0.198, respectively) from freshwater samples. An exception is the marine sample collected from Weihai, which shows high divergence from both other marine samples (0.063-0.065; 0.129, respectively) and the freshwater samples (0.097; 0.120, respectively). A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades, with the two marine sample clades containing Bangia spp. from North America, Europe, Asia, and Australia; and one freshwater clade, containing Bangia atropurpurea from North America and China.

  12. Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome

    PubMed Central

    Long, Katherine S.

    2012-01-01

    Linezolid is an oxazolidinone antibiotic in clinical use for the treatment of serious infections of resistant Gram-positive bacteria. It inhibits protein synthesis by binding to the peptidyl transferase center on the ribosome. Almost all known resistance mechanisms involve small alterations to the linezolid binding site, so this review will therefore focus on the various changes that can adversely affect drug binding and confer resistance. High-resolution structures of linezolid bound to the 50S ribosomal subunit show that it binds in a deep cleft that is surrounded by 23S rRNA nucleotides. Mutation of 23S rRNA has for some time been established as a linezolid resistance mechanism. Although ribosomal proteins L3 and L4 are located further away from the bound drug, mutations in specific regions of these proteins are increasingly being associated with linezolid resistance. However, very little evidence has been presented to confirm this. Furthermore, recent findings on the Cfr methyltransferase underscore the modification of 23S rRNA as a highly effective and transferable form of linezolid resistance. On a positive note, detailed knowledge of the linezolid binding site has facilitated the design of a new generation of oxazolidinones that show improved properties against the known resistance mechanisms. PMID:22143525

  13. The Stability of Ribosome Biogenesis Factor WBSCR22 Is Regulated by Interaction with TRMT112 via Ubiquitin-Proteasome Pathway

    PubMed Central

    Õunap, Kadri; Leetsi, Lilian; Matsoo, Maarja; Kurg, Reet

    2015-01-01

    The human WBSCR22 protein is a 18S rRNA methyltransferase involved in pre-rRNA processing and ribosome 40S subunit biogenesis. Recent studies have shown that the protein function in ribosome synthesis is independent of its enzymatic activity. In this work, we have studied the WBSCR22 protein interaction partners by SILAC-coupled co-immunoprecipitation assay and identified TRMT112 as the interaction partner of WBSCR22. Knock-down of TRMT112 expression decreased the WBSCR22 protein level in mammalian cells, suggesting that the stability of WBSCR22 is regulated through the interaction with TRMT112. The localization of the TRMT112 protein is determined by WBSCR22, and the WBSCR22-TRMT112 complex is localized in the cell nucleus. We provide evidence that the interaction between WBSCR22/Bud23 and TRMT112/Trm112 is conserved between mammals and yeast, suggesting that the function of TRMT112 as a co-activator of methyltransferases is evolutionarily conserved. Finally, we show that the transiently expressed WBSCR22 protein is ubiquitinated and degraded through the proteasome pathway, revealing the tight control of the WBSCR22 protein level in the cells. PMID:26214185

  14. Precursor ribosomal ribonucleic acid and ribosome accumulation in vivo during the recovery of Salmonella typhimurium from thermal injury.

    PubMed

    Tomlins, R I; Ordal, Z J

    1971-07-01

    When cells of S. typhimurium were heated at 48 C for 30 min in phosphate buffer (pH 6.0), they became sensitive to Levine Eosin Methylene Blue Agar containing 2% NaCl (EMB-NaCl). The inoculation of injured cells into fresh growth medium supported the return of their normal tolerance to EMB-NaCl within 6 hr. The fractionation of ribosomal ribonucleic acid (rRNA) from unheated and heat-injured cells by polyacrylamide gel electrophoresis demonstrated that after injury the 16S RNA species was totally degraded and the 23S RNA was partially degraded. Sucrose gradient analysis demonstrated that after injury the 30S ribosomal subunit was totally destroyed and the sedimentation coefficient of the 50S particle was decreased to 47S. During the recovery of cells from thermal injury, four species of rRNA accumulated which were demonstrated to have the following sedimentation coefficients: 16, 17, 23, and 24S. Under identical recovery conditions, 22, 26, and 28S precursors of the 30S ribosomal subunit and 31 and 48S precursors of the 50S ribosomal subunit accumulated along with both the 30 and 50S mature particles. The addition of chloramphenicol to the recovery medium inhibited both the maturation of 17S RNA and the production of mature 30S ribosomal subunits, but permitted the accumulation of a single 22S precursor particle. Chloramphenicol did not affect either the maturation of 24S RNA or the mechanism of formation of 50S ribosomal subunits during recovery. Very little old ribosomal protein was associated with the new rRNA synthesized during recovery. New ribosomal proteins were synthesized during recovery and they were found associated with the new rRNA in ribosomal particles. The rate-limiting step in the recovery of S. typhimurium from thermal injury was in the maturation of the newly synthesized rRNA. PMID:4935315

  15. Ribosomes containing mutants of L4 ribosomal protein from Thermus thermophilus display multiple defects in ribosomal functions and sensitivity against erythromycin

    PubMed Central

    TSAGKALIA, AIKATERINI; LEONTIADOU, FOTINI; XAPLANTERI, MARIA A.; PAPADOPOULOS, GEORGIOS; KALPAXIS, DIMITRIOS L.; CHOLI-PAPADOPOULOU, THEODORA

    2005-01-01

    Protein L4 from Thermus thermophilus (TthL4) was heterologously overproduced in Escherichia coli cells. To study the implication of the extended loop of TthL4 in the exit-tunnel and peptidyltransferase functions, the highly conserved E56 was replaced by D or Q, while the semiconserved G55 was changed to E or S. Moreover, the sequence -G55E56- was inverted to -E55G56-. When we incorporated these mutants into E. coli ribosomes and investigated their impact on poly(Phe) synthesis, high variations in the synthetic activity and response to erythromycin of the resulting ribosomes were observed. In the absence of erythromycin, ribosomes harboring mutations G55E and E56D in TthL4 protein were characterized by low activity in synthesizing poly(Phe) and decreased capability in binding tRNA at the A site. On the other hand, ribosomes possessing mutations G55E, G55S, G55E-E56G, or E56Q in TthL4 protein were unexpectedly more sensitive to erythromycin. Evidence in support of these findings was drawn by in vivo experiments, assessing the erythromycin sensitivity of E. coli cells expressing wild-type or mutant TthL4 proteins. Our results emphasize the role of the extended loop of L4 ribosomal protein in the exit-tunnel and peptidyltransferase center functions. PMID:16244130

  16. Ribosome heterogeneity in tumorigenesis: the rRNA point of view

    PubMed Central

    Marcel, Virginie; Catez, Frédéric; Diaz, Jean-Jacques

    2015-01-01

    The "specialized ribosome" concept proposes that ribosome variants are produced and differentially regulate translation. Examples supporting this notion demonstrated heterogeneity of ribosomal protein composition. However, ribosome translational activity is carried out by rRNA. We, and others, recently showed that rRNA heterogeneity regulates translation to generate distinct translatomes promoting tumorigenesis. PMID:27305893

  17. Cryo-EM structure of the tetracycline resistance protein TetM in complex with a translating ribosome at 3.9-Å resolution.

    PubMed

    Arenz, Stefan; Nguyen, Fabian; Beckmann, Roland; Wilson, Daniel N

    2015-04-28

    Ribosome protection proteins (RPPs) confer resistance to tetracycline by binding to the ribosome and chasing the drug from its binding site. Current models for RPP action are derived from 7.2- to 16-Å resolution structures of RPPs bound to vacant or nontranslating ribosomes. Here we present a cryo-electron microscopy reconstruction of the RPP TetM in complex with a translating ribosome at 3.9-Å resolution. The structure reveals the contacts of TetM with the ribosome, including interaction between the conserved and functionally critical C-terminal extension of TetM with a unique splayed conformation of nucleotides A1492 and A1493 at the decoding center of the small subunit. The resolution enables us to unambiguously model the side chains of the amino acid residues comprising loop III in domain IV of TetM, revealing that the tyrosine residues Y506 and Y507 are not responsible for drug-release as suggested previously but rather for intrafactor contacts that appear to stabilize the conformation of loop III. Instead, Pro509 at the tip of loop III is located directly within the tetracycline binding site where it interacts with nucleotide C1054 of the 16S rRNA, such that RPP action uses Pro509, rather than Y506/Y507, to directly dislodge and release tetracycline from the ribosome. PMID:25870267

  18. Metabolic Labeling in the Study of Mammalian Ribosomal RNA Synthesis.

    PubMed

    Stefanovsky, Victor Y; Moss, Tom

    2016-01-01

    RNA metabolic labeling is a method of choice in the study of dynamic changes in the rate of gene transcription and RNA processing. It is particularly applicable to transcription of the ribosomal RNA genes and their processing products due to the very high levels of ribosomal RNA synthesis. Metabolic labeling can detect changes in ribosomal RNA transcription that occur within a few minutes as opposed to the still widely used RT-PCR or Northern blot procedures that measure RNA pool sizes and at best are able to detect changes occurring over several hours or several days. Here, we describe a metabolic labeling technique applicable to the measurement of ribosomal RNA synthesis and processing rates, as well as to the determination of RNA Polymerase I transcription elongation rates. PMID:27576716

  19. Database on the structure of large ribosomal subunit RNA.

    PubMed Central

    De Rijk, P; Van de Peer, Y; Chapelle, S; De Wachter, R

    1994-01-01

    A database on large ribosomal subunit RNA is made available. It contains 258 sequences. It provides sequence, alignment and secondary structure information in computer-readable formats. Files can be obtained using ftp. PMID:7524023

  20. A process yields large quantities of pure ribosome subunits

    NASA Technical Reports Server (NTRS)

    Friedman, M.; Lu, P.; Rich, A.

    1972-01-01

    Development of process for in-vitro protein synthesis from living cells followed by dissociation of ribosomes into subunits is discussed. Process depends on dialysis or use of chelating agents. Operation of process and advantages over previous methods are outlined.

  1. The ribosomal gene spacer region in archaebacteria

    NASA Technical Reports Server (NTRS)

    Achenbach-Richter, L.; Woese, C. R.

    1988-01-01

    Sequences for the spacer regions that separate the 16S and 23S ribosomal RNA genes have been determined for four more (strategically placed) archaebacteria. These confirm the general rule that methanogens and extreme halophiles have spacers that contain a single tRNAala gene, while tRNA genes are not found in the spacer region of the true extreme thermophiles. The present study also shows that the spacer regions from the sulfate reducing Archaeglobus and the extreme thermophile Thermococcus (both of which cluster phylogenetically with the methanogens and extreme halophiles) contain each a tRNAala gene. Thus, not only all methanogens and extreme halophiles show this characteristic, but all organisms on the "methanogen branch" of the archaebacterial tree appear to do so. The finding of a tRNA gene in the spacer region of the extreme thermophile Thermococcus celer is the first known phenotypic property that links this organism with its phylogenetic counterparts, the methanogens, rather than with its phenotypic counterparts, the sulfur-dependent extreme thermophiles.

  2. Nonenzymatic microorganism identification based on ribosomal RNA

    NASA Astrophysics Data System (ADS)

    Ives, Jeffrey T.; Pierini, Alicia M.; Stokes, Jeffrey A.; Wahlund, Thomas M.; Read, Betsy; Bechtel, James H.; Bronk, Burt V.

    1999-11-01

    Effective defense against biological warfare (BW) agents requires rapid, fieldable and accurate systems. For micro- organisms like bacteria and viruses, ribosomal RNA (rRNA) provides a valuable target with multiple advantages of species specificity and intrinsic target amplification. Vegetative and spore forms of bacteria contain approximately 104 copies of rRNA. Direct detection of rRNA copies can eliminate some of the interference and preparation difficulties involved in enzymatic amplification methods. In order to apply the advantages of rRNA to BW defense, we are developing a fieldable system based on 16S rRNA, physical disruption of the micro-organism, solid phase hybridization, and fluorescence detection. Our goals include species-specific identification, complete operation from raw sample to identification in 15 minutes or less, and compact, fieldable instrumentation. Initial work on this project has investigated the lysis and hybridization steps, the species-specificity of oligonucleotides probes, and the development of a novel electromagnetic method to physically disrupt the micro- organisms. Target bacteria have been Escherichia coli (E. coli) and Bacillus subtilis (B. subtilis). Continuing work includes further development of methods to rapidly disrupt the micro-organisms and release the rRNA, improved integration and processing, and extension to bacterial and mammalian viruses like MS2 and vesicular stomatitis virus.

  3. Molecular mechanisms of ribosomal protein gene coregulation.

    PubMed

    Reja, Rohit; Vinayachandran, Vinesh; Ghosh, Sujana; Pugh, B Franklin

    2015-09-15

    The 137 ribosomal protein genes (RPGs) of Saccharomyces provide a model for gene coregulation. We examined the positional and functional organization of their regulators (Rap1 [repressor activator protein 1], Fhl1, Ifh1, Sfp1, and Hmo1), the transcription machinery (TFIIB, TFIID, and RNA polymerase II), and chromatin at near-base-pair resolution using ChIP-exo, as RPGs are coordinately reprogrammed. Where Hmo1 is enriched, Fhl1, Ifh1, Sfp1, and Hmo1 cross-linked broadly to promoter DNA in an RPG-specific manner and demarcated by general minor groove widening. Importantly, Hmo1 extended 20-50 base pairs (bp) downstream from Fhl1. Upon RPG repression, Fhl1 remained in place. Hmo1 dissociated, which was coupled to an upstream shift of the +1 nucleosome, as reflected by the Hmo1 extension and core promoter region. Fhl1 and Hmo1 may create two regulatable and positionally distinct barriers, against which chromatin remodelers position the +1 nucleosome into either an activating or a repressive state. Consistent with in vitro studies, we found that specific TFIID subunits, in addition to cross-linking at the core promoter, made precise cross-links at Rap1 sites, which we interpret to reflect native Rap1-TFIID interactions. Our findings suggest how sequence-specific DNA binding regulates nucleosome positioning and transcription complex assembly >300 bp away and how coregulation coevolved with coding sequences. PMID:26385964

  4. Alveolate phylogeny inferred using concatenated ribosomal proteins.

    PubMed

    Bachvaroff, Tsvetan R; Handy, Sara M; Place, Allen R; Delwiche, Charles F

    2011-01-01

    Dinoflagellates and apicomplexans are a strongly supported monophyletic group in rDNA phylogenies, although this phylogeny is not without controversy, particularly between the two groups. Here we use concatenated protein-coding genes from expressed sequence tags or genomic data to construct phylogenies including "typical" dinophycean dinoflagellates, a parasitic syndinian dinoflagellate, Amoebophrya sp., and two related species, Oxyrrhis marina, and Perkinsus marinus. Seventeen genes encoding proteins associated with the ribosome were selected for phylogenetic analysis. The dataset was limited for the most part by data availability from the dinoflagellates. Forty-five taxa from four major lineages were used: the heterokont outgroup, ciliates, dinoflagellates, and apicomplexans. Amoebophrya sp. was included in this phylogeny as a sole representative of the enigmatic marine alveolate or syndinian lineage. The atypical dinoflagellate O. marina, usually excluded from rDNA analyses due to long branches, was also included. The resulting phylogenies were well supported in concatenated analyses with only a few unstable or weakly supported branches; most features were consistent when different lineages were pruned from the tree or different genes were concatenated. The least stable branches involved the placement of Cryptosporidium spp. within the Apicomplexa and the relationships between P. marinus, Amoebophrya sp., and O. marina. Both bootstrap and approximately unbiased test results confirmed that P. marinus, Amoebophrya sp., O. marina, and the remaining dinoflagellates form a monophyletic lineage to the exclusion of Apicomplexa. PMID:21518081

  5. The 16S ribosomal RNA mutation database (16SMDB).

    PubMed Central

    Triman, K L

    1996-01-01

    The 16S ribosomal RNA mutation database (16SMDB) provides a list of mutated positions in 16S ribosomal RNA from Escherichia coli and the identity of each alteration. Information provided for each mutation includes: (i) a brief description of the phenotype(s) associated with each mutation; (ii) whether a mutant phenotype has been detected by in vivo or in vitro methods; (iii) relevant literature citations. The database is available via ftp and on the World Wide Web. PMID:8594570

  6. Human acidic ribosomal phosphoproteins P0, P1, and P2: Analysis of cDNA clones, in vitro synthesis, and assembly

    SciTech Connect

    Rich, B.E.; Steitz, J.A.

    1987-11-01

    cDNA clones encoding three antigenically related human ribosomal phosophoproteins (P-proteins) P0, P1, and P2 were isolated and sequenced. P1 and P2 are analogous to Escherichia coli ribosomal protein L7/L12, and P0 is likely to be an analog of L10. The three proteins have a nearly identical carboxy-terminal 17-amino-acid sequence (KEESEESD(D/E)DMGFGLFD-COOH) that is the basis of their immunological cross-reactivity. The identifies of the P1 and P2 cDNAs were confirmed by the strong similarities of their encoded amino acid sequences to published primary structures of the homologous rat, brine shrimp, and Saccharomyces cerevisiae proteins. The P0 cDNA was initially identified by translation of hybrid-selected mRNA and immunoprecipitation of the products. To demonstrate that the coding sequences are full length, the P0, P1, and P2 cDNAs were transcribed in vitro by bacteriophage T7 RNA polymerase and the resulting mRNAs were translated in vitro. The synthetic P0, P1, and P2 proteins were serologically and electrophoretically identical to P-proteins extracted from HeLa cells. These synthetic P-proteins were incorporated into 60S but not 40S ribosomes and also assembled into a complex similar to that described for E. coli L7/L12 and L10.

  7. GTPases mechanisms and functions of translation factors on the ribosome.

    PubMed

    Rodnina, M V; Stark, H; Savelsbergh, A; Wieden, H J; Mohr, D; Matassova, N B; Peske, F; Daviter, T; Gualerzi, C O; Wintermeyer, W

    2000-01-01

    The elongation factors (EF) Tu and G and initiation factor 2 (IF2) from bacteria are multidomain GTPases with essential functions in the elongation and initiation phases of translation. They bind to the same site on the ribosome where their low intrinsic GTPase activities are strongly stimulated. The factors differ fundamentally from each other, and from the majority of GTPases, in the mechanisms of GTPase control, the timing of Pi release, and the functional role of GTP hydrolysis. EF-Tu x GTP forms a ternary complex with aminoacyl-tRNA, which binds to the ribosome. Only when a matching codon is recognized, the GTPase of EF-Tu is stimulated, rapid GTP hydrolysis and Pi release take place, EF-Tu rearranges to the GDP form, and aminoacyl-tRNA is released into the peptidyltransferase center. In contrast, EF-G hydrolyzes GTP immediately upon binding to the ribosome, stimulated by ribosomal protein L7/12. Subsequent translocation is driven by the slow dissociation of Pi, suggesting a mechano-chemical function of EF-G. Accordingly, different conformations of EF-G on the ribosome are revealed by cryo-electron microscopy. GTP hydrolysis by IF2 is triggered upon formation of the 70S initiation complex, and the dissociation of Pi and/or IF2 follows a rearrangement of the ribosome into the elongation-competent state. PMID:10937868

  8. Targeted cancer therapy with ribosome biogenesis inhibitors: a real possibility?

    PubMed Central

    Brighenti, Elisa; Treré, Davide; Derenzini, Massimo

    2015-01-01

    The effects of many chemotherapeutic drugs on ribosome biogenesis have been underestimated for a long time. Indeed, many drugs currently used for cancer treatment – and which are known to either damage DNA or hinder DNA synthesis – have been shown to exert their toxic action mainly by inhibiting rRNA synthesis or maturation. Moreover, there are new drugs that have been proposed recently for cancer chemotherapy, which only hinder ribosome biogenesis without any genotoxic activity. Even though ribosome biogenesis occurs in both normal and cancer cells, whether resting or proliferating, there is evidence that the selective inhibition of ribosome biogenesis may, in some instances, result in a selective damage to neoplastic cells. The higher sensitivity of cancer cells to inhibitors of rRNA synthesis appears to be the consequence of either the loss of the mechanisms controlling the cell cycle progression or the acquisition of activating oncogene and inactivating tumor suppressor gene mutations that up-regulate the ribosome biogenesis rate. This article reviews those cancer cell characteristics on which the selective cancer cell cytotoxicity induced by the inhibitors of ribosome biogenesis is based. PMID:26415219

  9. On the expansion of ribosomal proteins and RNAs in eukaryotes.

    PubMed

    Parker, Michael S; Sah, Renu; Balasubramaniam, Ambikaipakan; Sallee, Floyd R; Park, Edwards A; Parker, Steven L

    2014-07-01

    While the ribosome constitution is similar in all biota, there is a considerable increase in size of both ribosomal proteins (RPs) and RNAs in eukaryotes as compared to archaea and bacteria. This is pronounced in the large (60S) ribosomal subunit (LSU). In addition to enlargement (apparently maximized already in lower eukarya), the RP changes include increases in fraction, segregation and clustering of basic residues, and decrease in hydrophobicity. The acidic fraction is lower in eukaryote as compared to prokaryote RPs. In all eukaryote groups tested, the LSU RPs have significantly higher content of basic residues and homobasic segments than the SSU RPs. The vertebrate LSU RPs have much higher sequestration of basic residues than those of bacteria, archaea and even of the lower eukarya. The basic clusters are highly aligned in the vertebrate, but less in the lower eukarya, and only within families in archaea and bacteria. Increase in the basicity of RPs, besides helping transport to the nucleus, should promote stability of the assembled ribosome as well as the association with translocons and other intracellular matrix proteins. The size and GC nucleotide bias of the expansion segments of large LSU rRNAs also culminate in the vertebrate, and should support ribosome association with the endoplasmic reticulum and other intracellular networks. However, the expansion and nucleotide bias of eukaryote LSU rRNAs do not clearly correlate with changes in ionic parameters of LSU ribosomal proteins. PMID:24633358

  10. Increased ribosome density associated to positively charged residues is evident in ribosome profiling experiments performed in the absence of translation inhibitors.

    PubMed

    Requião, Rodrigo D; de Souza, Henrique José Araujo; Rossetto, Silvana; Domitrovic, Tatiana; Palhano, Fernando L

    2016-06-01

    It has been proposed that polybasic peptides cause slower movement of ribosomes through an electrostatic interaction with the highly negative ribosome exit tunnel. Ribosome profiling data-the sequencing of short ribosome-bound fragments of mRNA-is a powerful tool for the analysis of mRNA translation. Using the yeast Saccharomyces cerevisiae as a model, we showed that reduced translation efficiency associated with polybasic protein sequences could be inferred from ribosome profiling. However, an increase in ribosome density at polybasic sequences was evident only when the commonly used translational inhibitors cycloheximide and anisomycin were omitted during mRNA isolation. Since ribosome profiling performed without inhibitors agrees with experimental evidence obtained by other methods, we conclude that cycloheximide and anisomycin must be avoided in ribosome profiling experiments. PMID:27064519

  11. Development and Evaluation of a Quality-Controlled Ribosomal Sequence Database for 16S Ribosomal DNA-Based Identification of Staphylococcus Species

    PubMed Central

    Becker, Karsten; Harmsen, Dag; Mellmann, Alexander; Meier, Christian; Schumann, Peter; Peters, Georg; von Eiff, Christof

    2004-01-01

    To establish an improved ribosomal gene sequence database as part of the Ribosomal Differentiation of Microorganisms (RIDOM) project and to overcome the drawbacks of phenotypic identification systems and publicly accessible sequence databases, both strands of the 5′ end of the 16S ribosomal DNA (rDNA) of 81 type and reference strains comprising all validly described staphylococcal (sub)species were sequenced. Assuming a normal distribution for pairwise distances of all unique staphylococcal sequences and choosing a reporting criterion of ≥98.7% similarity for a “distinct species,” a statistical error probability of 1.0% was calculated. To evaluate this database, a 16S rDNA fragment (corresponding to Escherichia coli positions 54 to 510) of 55 clinical Staphylococcus isolates (including those of the small-colony variant phenotype) were sequenced and analyzed by the RIDOM approach. Of these isolates, 54 (98.2%) had a similarity score above the proposed threshold using RIDOM; 48 (87.3%) of the sequences gave a perfect match, whereas 83.6% were found by searching National Center for Biotechnology Information (NCBI) database entries. In contrast to RIDOM, which showed four ambiguities at the species level (mainly concerning Staphylococcus intermedius versus Staphylococcus delphini), the NCBI database search yielded 18 taxon-related ambiguities and showed numerous matches exhibiting redundant or unspecified entries. Comparing molecular results with those of biochemical procedures, ID 32 Staph (bioMérieux, Marcy I'Etoile, France) and VITEK 2 (bioMérieux) failed to identify 13 (23.6%) and 19 (34.5%) isolates, respectively, due to incorrect identification and/or categorization below acceptable values. In contrast to phenotypic methods and the NCBI database, the novel high-quality RIDOM sequence database provides excellent identification of staphylococci, including rarely isolated species and phenotypic variants. PMID:15528685

  12. Concentric-Flow Electrokinetic Injector Enables Serial Crystallography of Ribosome and Photosystem-II

    PubMed Central

    Sierra, Raymond G.; Gati, Cornelius; Laksmono, Hartawan; Dao, E. Han; Gul, Sheraz; Fuller, Franklin; Kern, Jan; Chatterjee, Ruchira; Ibrahim, Mohamed; Brewster, Aaron S.; Young, Iris D.; Michels-Clark, Tara; Aquila, Andrew; Liang, Mengning; Hunter, Mark S.; Koglin, Jason E.; Boutet, Sébastien; Junco, Elia A.; Hayes, Brandon; Bogan, Michael J.; Hampton, Christina Y.; Puglisi, Elisabetta V.; Sauter, Nicholas K.; Stan, Claudiu A.; Zouni, Athina; Yano, Junko; Yachandra, Vittal K.; Soltis, S. Michael; Puglisi, Joseph D.; DeMirci, Hasan

    2016-01-01

    In this work, a concentric-flow electrokinetic injector delivered microcrystals of Geobacillus stearothermophilus thermolysin (2.2 Å structure), Thermosynechococcus elongatus photosystem II (< 3 Å diffraction) and Thermus thermophilus small ribosomal subunit (3.4 Å structure). The first ambient-temperature X-ray crystal structure of the 30S subunit bound to the antibiotic paromomycin was obtained in its native mother liquor. Compared to previous cryo-cooled structures, this new structure showed that paromomycin binds to the decoding center in a different conformation. PMID:26619013

  13. Chemical probing of the tRNA--ribosome complex.

    PubMed Central

    Peattie, D A; Herr, W

    1981-01-01

    We probed the (Escherichia coli) tRNAPhe--ribosome interaction with the chemical reagents dimethyl sulfate and diethyl pyrocarbonate. This monitored the higher-order structure of the tRNA in this biological complex and identified critical sites in the tRNA molecule involved in binding to the ribosome. The methylation of the N-7 position of guanosine and the N-3 position of cytidine as well as diethyl pyrocarbonate attack on adenosines are sensitive to secondary and tertiary interactions. Here we identify specific bases in E. coli Phe-tRNAPhe affected by the interaction with the ribosome. The 70S ribosome protects the N-3 position of cytidine-74 and 75 in the 3'-terminal C-C-A, suggesting a strong, possibly base pairing, interaction between the ribosome and that universal sequence. The ribosome also induces strong reactivities at the N-7 positions of G-24 and G-46 in the central region of the tRNA molecule near the variable-loop domain as well as less significant reactivities at 11 other guanosines. Two of these, G-10 and G-44, are close to G-24 and G-46 in the center of the molecule; the others (guanosines 1, 5, 6, 18, 19, 63, 65, 69, and 71) are in the coaxial acceptor stem-T stem helix. All of the effects are ribosome induced and occur in the presence or absence of the messenger poly(U). Prior chemical modification of the anticodon bases as well as the two adjacent 3' purines and, less effectively, four purines in the anticodon stem prevent stable poly(U)-directed ribosome binding. Thus, we identify the 3' terminal C-C-A sequence, near the peptidyl transferase site, and the anticodon stem and loop of tRNAPhe as forming critical contacts with the ribosome. Other regions of the molecule become reactive on ribosome binding, but these do not suggest a significant conformational change being more likely due to a change of environment. Images PMID:6166006

  14. Ribosome Shut-Down by 16S rRNA Fragmentation in Stationary-Phase Escherichia coli.

    PubMed

    Luidalepp, Hannes; Berger, Stefan; Joss, Oliver; Tenson, Tanel; Polacek, Norbert

    2016-05-22

    Stationary-phase bacterial cells are characterized by vastly reduced metabolic activities yielding a dormant-like phenotype. Several hibernation programs ensure the establishment and maintenance of this resting growth state. Some of the stationary phase-specific modulations affect the ribosome and its translational activity directly. In stationary-phase Escherichia coli, we observed the appearance of a 16S rRNA fragmentation event at the tip of helix 6 within the small ribosomal subunit (30S). Stationary-phase 30S subunits showed markedly reduced activities in protein biosynthesis. On the other hand, the functional performance of stationary-phase large ribosomal subunits (50S) was indistinguishable from particles isolated from exponentially growing cells. Introduction of the 16S rRNA cut in vitro at helix 6 of exponential phase 30S subunits renders them less efficient in protein biosynthesis. This indicates that the helix 6 fragmentation is necessary and sufficient to attenuate translational activities of 30S ribosomal subunits. These results suggest that stationary phase-specific cleavage of 16S rRNA within the 30S subunit is an efficient means to reduce global translation activities under non-proliferating growth conditions. PMID:27067112

  15. Suppression of a temperature-sensitive cdc33 mutation of yeast by a multicopy plasmid expressing a Drosophila ribosomal protein.

    PubMed

    Lavoie, C; Tam, R; Clark, M; Lee, H; Sonenberg, N; Lasko, P

    1994-05-20

    The Saccharomyces cerevisiae cdc33ts4-2 mutant produces a temperature-sensitive allele of the cap-binding subunit of eukaryotic initiation factor-4F (also termed eIF-4E). From a Drosophila cDNA library constructed in a multicopy yeast shuttle vector, a clone was isolated which restored the ability to grow at elevated temperature to cdc33ts4-2 cells. The rescuing Drosophila clone encodes a small ribosomal subunit protein, which we name S15a based on its molecular weight and similarity with the Brassica napus S15a ribosomal protein. Transcription of the Drosophila gene, RpS15a, occurs at all developmental stages and is enhanced during oogenesis. The ribosomal protein gene is capable of suppressing other alleles of cdc33 but not an inactivation mutation, suggesting that suppression is dependent upon the presence of the temperature-sensitive eIF-4E protein. Supporting this, Western blot analysis shows that far more eIF-4E protein is present in cdc33 yeast cells expressing the RpS15a gene than lacking it. Levels of other unrelated proteins are unaffected. We propose therefore that the expression of high levels of the Drosophila S15a ribosomal protein in the cdc33 yeast cells leads to a selective stabilization of the temperature-sensitive eIF-4E protein, which accounts for the suppression phenomenon. PMID:8182070

  16. The role of GTP in transient splitting of 70S ribosomes by RRF (ribosome recycling factor) and EF-G (elongation factor G)

    PubMed Central

    Hirokawa, Go; Iwakura, Nobuhiro; Kaji, Akira; Kaji, Hideko

    2008-01-01

    Ribosome recycling factor (RRF), elongation factor G (EF-G) and GTP split 70S ribosomes into subunits. Here, we demonstrated that the splitting was transient and the exhaustion of GTP resulted in re-association of the split subunits into 70S ribosomes unless IF3 (initiation factor 3) was present. However, the splitting was observed with sucrose density gradient centrifugation (SDGC) without IF3 if RRF, EF-G and GTP were present in the SDGC buffer. The splitting of 70S ribosomes causes the decrease of light scattering by ribosomes. Kinetic constants obtained from the light scattering studies are sufficient to account for the splitting of 70S ribosomes by RRF and EF-G/GTP during the lag phase for activation of ribosomes for the log phase. As the amount of 70S ribosomes increased, more RRF, EF-G and GTP were necessary to split 70S ribosomes. In the presence of a physiological amount of polyamines, GTP and factors, even 0.6 μM 70S ribosomes (12 times higher than the 70S ribosomes for routine assay) were split. Spermidine (2 mM) completely inhibited anti-association activity of IF3, and the RRF/EF-G/GTP-dependent splitting of 70S ribosomes. PMID:18948280

  17. The conserved interaction of C7orf30 with MRPL14 promotes biogenesis of the mitochondrial large ribosomal subunit and mitochondrial translation

    PubMed Central

    Fung, Stephen; Nishimura, Tamiko; Sasarman, Florin; Shoubridge, Eric A.

    2013-01-01

    Mammalian mitochondria harbor a dedicated translation apparatus that is required for the synthesis of 13 mitochondrial DNA (mtDNA)-encoded polypeptides, all of which are essential components of the oxidative phosphorylation (OXPHOS) complexes. Little is known about the mechanism of assembly of the mitoribosomes that catalyze this process. Here we show that C7orf30, a member of the large family of DUF143 proteins, associates with the mitochondrial large ribosomal subunit (mt-LSU). Knockdown of C7orf30 by short hairpin RNA (shRNA) does not alter the sedimentation profile of the mt-LSU, but results in the depletion of several mt-LSU proteins and decreased monosome formation. This leads to a mitochondrial translation defect, involving the majority of mitochondrial polypeptides, and a severe OXPHOS assembly defect. Immunoprecipitation and mass spectrometry analyses identified mitochondrial ribosomal protein (MRP)L14 as the specific interacting protein partner of C7orf30 in the mt-LSU. Reciprocal experiments in which MRPL14 was depleted by small interfering RNA (siRNA) phenocopied the C7orf30 knockdown. Members of the DUF143 family have been suggested to be universally conserved ribosomal silencing factors, acting by sterically inhibiting the association of the small and large ribosomal subunits. Our results demonstrate that, although the interaction between C7orf30 and MRPL14 has been evolutionarily conserved, human C7orf30 is, on the contrary, essential for mitochondrial ribosome biogenesis and mitochondrial translation. PMID:23171548

  18. gamma-ray spectroscopy of neutron-rich {sup 40}S

    SciTech Connect

    Wang, Z. M.; Chapman, R.; Liang, X.; Burns, M.; Hodsdon, A.; Keyes, K.; Kumar, V.; Papenberg, A.; Smith, J. F.; Spohr, K. M.; Haas, F.; Caurier, E.; Curien, D.; Nowacki, F.; Azaiez, F.; Ibrahim, F.; Verney, D.; Behera, B. R.; Corradi, L.; Fioretto, E.

    2010-05-15

    Yrast states up to (6{sup +}) in the neutron-rich {sup 40}S nucleus have been studied using binary grazing reactions produced by the interaction of a 215 MeV beam of {sup 36}S ions with a thin {sup 208}Pb target. The novel experimental setup that combines the large acceptance magnetic spectrometer, PRISMA, and the high-efficiency gamma-ray detection array, CLARA, was used. A new gamma-ray transition at an energy of 1572 keV was observed and tentatively assigned to the (6{sup +})->(4{sup +}) transition. A comparison of experimental observations and the results of large-scale 0(Planck constant/2pi)omega sd-pf shell-model calculations indicates that one- and two-proton excitations from the 2s{sub 1/2} to the 1d{sub 3/2} orbitals play an important role in reproducing the {sup 40}S yrast level structure and the published B(E2;0{sub g.s.}{sup +}->2{sub 1}{sup +}) value. The structure of the yrast states of the even-A isotopes of sulfur is interpreted in terms of the configurations of valence protons and neutrons within the context of large-scale 0(Planck constant/2pi)omega sd-pf shell-model calculations.

  19. A Ribosome-Binding, 3′ Translational Enhancer Has a T-Shaped Structure and Engages in a Long-Distance RNA-RNA Interaction

    PubMed Central

    Gao, Feng; Kasprzak, Wojciech; Stupina, Vera A.

    2012-01-01

    Many plant RNA viruses contain elements in their 3′ untranslated regions (3′ UTRs) that enhance translation. The PTE (Panicum mosaic virus-like translational enhancer) of Pea enation mosaic virus (PEMV) binds to eukaryotic initiation factor 4E (eIF4E), but how this affects translation from the 5′ end is unknown. We have discovered a three-way branched element just upstream of the PEMV PTE that engages in a long-distance kissing-loop interaction with a coding sequence hairpin that is critical for the translation of a reporter construct and the accumulation of the viral genome in vivo. Loss of the long-distance interaction was more detrimental than elimination of the adjacent PTE, indicating that the RNA-RNA interaction supports additional translation functions besides relocating the PTE to the 5′ end. The branched element is predicted by molecular modeling and molecular dynamics to form a T-shaped structure (TSS) similar to the ribosome-binding TSS of Turnip crinkle virus (TCV). The PEMV element binds to plant 80S ribosomes with a Kd (dissociation constant) of 0.52 μM and to 60S subunits with a Kd of 0.30 μM. Unlike the TCV TSS, the PEMV element also binds 40S subunits (Kd, 0.36 μM). Mutations in the element that suppressed translation reduced either ribosome binding or the RNA-RNA interaction, suggesting that ribosome binding is important for function. This novel, multifunctional element is designated a kl-TSS (kissing-loop T-shaped structure) to distinguish it from the TCV TSS. The kl-TSS has sequence and structural features conserved with the upper portion of most PTE-type elements, which, with the exception of the PEMV PTE, can engage in similar long-distance RNA-RNA interactions. PMID:22761367

  20. The immunogenic activity of ribosomal fractions derived from Brucella abortus.

    PubMed Central

    Corbel, M. J.

    1976-01-01

    The immunizing activity of ribosome preparations derived from Brucella abortus strain 19 cells was examined in guinea-pigs and mice. After subcutaneous injections of Br. abortus ribosomes in Freund's incomplete adjuvant, both mice and guinea-pigs developed immunity to challenge by virulent Br. abortus 544 organisms which was at least as effective as the protection conferred by live strain 19 vaccine. Both mice and guinea-pigs also developed agglutinating and complement-fixing antibodies and delayed hypersensitivity to Br. Abortus antigens. Conversely, ribosome preparations elicited delayed hypersensitivity reactions on intracutaneous injection into guinea-pigs chronically infected with Br. abortus or Br. melitensis. On injection into rabbits, Br. abortus ribosomes incorporated in incomplete adjuvant induced high titres of agglutinins, complement fxing antibodies and precipitins for Br. abortus antigens. On immunochemical examination, the ribosome preparations were not grossly contaminated with antigens derived from the cell surface. They were chemically complex, however, and in addition to RNA contained numerous protein components identified by disk electrophoresis. The nature of the components responsible for conferring protection against Br. abortus was not determined. Images Fig. 1 Fig. 2 Fig. 1 Fig. 2 Fig. 1 Fig. 2 Fig. 1 Fig. 2 PMID:812900

  1. Aminoglycoside activity observed on single pre-translocation ribosome complexes

    PubMed Central

    Feldman, Michael B; Terry, Daniel S; Altman, Roger B; Blanchard, Scott C

    2010-01-01

    Aminoglycoside-class antibiotics bind directly to ribosomal RNA, imparting pleiotropic effects on ribosome function. Despite in-depth structural investigations of aminoglycoside–RNA oligonucleotide and aminoglycoside-ribosome interactions, mechanisms explaining the unique ribosome inhibition profiles of chemically similar aminoglycosides remain elusive. Here, using single-molecule fluorescence resonance energy transfer (smFRET) methods, we show that high-affinity aminoglycoside binding to the conserved decoding site region of the functional pre-translocation ribosome complex specifically remodels the nature of intrinsic dynamic processes within the particle. The extents of these effects, which are distinct for each member of the aminoglycoside class, strongly correlate with their inhibition of EF-G–catalyzed translocation. Neomycin, a 4,5-linked amino-glycoside, binds with lower affinity to one or more secondary binding sites, mediating distinct structural and dynamic perturbations that further enhance translocation inhibition. These new insights help explain why closely related aminoglycosides elicit pleiotropic translation activities and demonstrate the potential utility of smFRET as a tool for dissecting the mechanisms of antibiotic action. PMID:19946275

  2. Amino acid incorporation by ribosomes and polyribosomes from wheat chloroplasts.

    PubMed

    Hadziyev, D; Zalik, S

    1970-01-01

    Sucrose-gradient and analytical ultracentrifugation showed that chloroplast polyribosomes from 4-day-old seedlings had mono-, di-, tri-, tetra- and traces of penta-ribosomes, in contrast with those from 7-day-old seedlings in which only the mono-, di- and traces of tri-ribosomes were present. Without Mg(2+) the polyribosomes dissociated into ribosomal subunits. The rate of l-[U-(14)C]phenylalanine incorporation was threefold greater for preparations from 4- than from 7-day-old seedlings. Incorporation by the latter was stimulated by polyuridylic acid. The rates of incorporation were similar whether the reaction mixture contained chloroplast or wheat-germ transfer RNA and amino acid synthetases purified on methylated albumin-on-kieselguhr and Sephadex G-75 columns respectively. The cofactor requirement was the same as for isolated intact chloroplasts. Osmotic rupture of chloroplasts with and without Triton X-100 revealed the presence of free and bound ribosomes. Free single ribosomes isolated by osmotic shrinkage or prepared by pancreatic ribonuclease digestion of chloroplast polyribosomes had negligible incorporation activity. This activity was increased by washing or by polyuridylic acid, but was still only a fraction of that given by polyribosomes. A comparison of incorporation activity of chloroplast polyribosomes with those from the surrounding cytoplasm showed the former to be 20 times more active. PMID:5411422

  3. Cinnamomin: a multifunctional type II ribosome-inactivating protein.

    PubMed

    He, Wen-Jun; Liu, Wang-Yi

    2003-07-01

    Plant ribosome-inactivating proteins (RIPs) are a group of toxic proteins that can irreversibly inactivate ribosomes by specifically removing the conserved adenine base from the "Sarcin/Ricin domain" of the 28S RNA in ribosome. Cinnamomin is a novel type II RIP isolated in our laboratory from the mature seeds of camphor tree. Besides site-specific deadenylation of the A4324 in the Sarcin/Ricin domain of rat ribosome, this protein could also release the adenine base from DNA molecules at multiple sites and from AMP, ADP, dAMP and adenosine. Furthermore, cinnamomin displays cytotoxicity to carcinoma cells and insect larvae by modifying their ribosomal RNA. These functions possessed by cinnamomin shed a new light on the possible application of cinnamomin in the field of immunotoxin design and transgenic reagents. In this review, we introduce the major recent results on cinnamomin obtained in our laboratory, including purification of this protein, characterization of its enzymatic mechanism, structure and function, gene pattern, physiological role and its biological implications in cytotoxicity. PMID:12672471

  4. Assessing the translational landscape of myogenic differentiation by ribosome profiling

    PubMed Central

    de Klerk, Eleonora; Fokkema, Ivo F.A.C.; Thiadens, Klaske A.M.H.; Goeman, Jelle J.; Palmblad, Magnus; den Dunnen, Johan T.; von Lindern, Marieke; ‘t Hoen, Peter A.C.

    2015-01-01

    The formation of skeletal muscles is associated with drastic changes in protein requirements known to be safeguarded by tight control of gene transcription and mRNA processing. The contribution of regulation of mRNA translation during myogenesis has not been studied so far. We monitored translation during myogenic differentiation of C2C12 myoblasts, using a simplified protocol for ribosome footprint profiling. Comparison of ribosome footprints to total RNA showed that gene expression is mostly regulated at the transcriptional level. However, a subset of transcripts, enriched for mRNAs encoding for ribosomal proteins, was regulated at the level of translation. Enrichment was also found for specific pathways known to regulate muscle biology. We developed a dedicated pipeline to identify translation initiation sites (TISs) and discovered 5333 unannotated TISs, providing a catalog of upstream and alternative open reading frames used during myogenesis. We identified 298 transcripts with a significant switch in TIS usage during myogenesis, which was not explained by alternative promoter usage, as profiled by DeepCAGE. Also these transcripts were enriched for ribosomal protein genes. This study demonstrates that differential mRNA translation controls protein expression of specific subsets of genes during myogenesis. Experimental protocols, analytical workflows, tools and data are available through public repositories (http://lumc.github.io/ribosome-profiling-analysis-framework/). PMID:25873627

  5. Role of ribosomes in Semliki Forest virus nucleocapsid uncoating.

    PubMed Central

    Singh, I; Helenius, A

    1992-01-01

    The mechanism by which Semliki Forest virus nucleocapsids are uncoated was analyzed in living cells and in vitro. In BHK-21 cells, uncoating occurred with virtually complete efficiency within 1 to 2 min after the nucleocapsids entered the cytoplasm. It was inhibited by monensin, which blocks nucleocapsid penetration from endosomes. As previously shown for Sindbis virus (G. Wengler and G. Wengler, Virology 134:435-442, 1984), the capsid proteins from incoming nucleocapsids became associated with ribosomes. The ribosome-bound capsid proteins were distributed throughout the cytoplasm, while the viral RNA remained associated with vacuolar membranes. Using purified nucleocapsids and ribosomes in vitro, we established that ribosomes alone were sufficient for uncoating. Their role was to release the capsid proteins from nucleocapsids and irreversibly sequester them, in a process independent of energy and translation. The process was stoichiometric rather than catalytic, with a maximum of three to six capsid proteins bound to each ribosome. More than 80% of the capsid proteins could thus be removed from the viral RNA, resulting in the formation of nucleocapsid remnants whose sedimentation coefficients progressively decreased from 140S to 80S as uncoating proceeded. Images PMID:1433506

  6. ABC-F Proteins Mediate Antibiotic Resistance through Ribosomal Protection

    PubMed Central

    Sharkey, Liam K. R.; Edwards, Thomas A.

    2016-01-01

    ABSTRACT Members of the ABC-F subfamily of ATP-binding cassette proteins mediate resistance to a broad array of clinically important antibiotic classes that target the ribosome of Gram-positive pathogens. The mechanism by which these proteins act has been a subject of long-standing controversy, with two competing hypotheses each having gained considerable support: antibiotic efflux versus ribosomal protection. Here, we report on studies employing a combination of bacteriological and biochemical techniques to unravel the mechanism of resistance of these proteins, and provide several lines of evidence that together offer clear support to the ribosomal protection hypothesis. Of particular note, we show that addition of purified ABC-F proteins to an in vitro translation assay prompts dose-dependent rescue of translation, and demonstrate that such proteins are capable of displacing antibiotic from the ribosome in vitro. To our knowledge, these experiments constitute the first direct evidence that ABC-F proteins mediate antibiotic resistance through ribosomal protection. PMID:27006457

  7. Ribosome. The complete structure of the 55S mammalian mitochondrial ribosome.

    PubMed

    Greber, Basil J; Bieri, Philipp; Leibundgut, Marc; Leitner, Alexander; Aebersold, Ruedi; Boehringer, Daniel; Ban, Nenad

    2015-04-17

    Mammalian mitochondrial ribosomes (mitoribosomes) synthesize mitochondrially encoded membrane proteins that are critical for mitochondrial function. Here we present the complete atomic structure of the porcine 55S mitoribosome at 3.8 angstrom resolution by cryo-electron microscopy and chemical cross-linking/mass spectrometry. The structure of the 28S subunit in the complex was resolved at 3.6 angstrom resolution by focused alignment, which allowed building of a detailed atomic structure including all of its 15 mitoribosomal-specific proteins. The structure reveals the intersubunit contacts in the 55S mitoribosome, the molecular architecture of the mitoribosomal messenger RNA (mRNA) binding channel and its interaction with transfer RNAs, and provides insight into the highly specialized mechanism of mRNA recruitment to the 28S subunit. Furthermore, the structure contributes to a mechanistic understanding of aminoglycoside ototoxicity. PMID:25837512

  8. Stability of the inner structure constituting a 'kernel' in ribosomal cores probed by dielectric spectroscopy

    NASA Astrophysics Data System (ADS)

    Blasi, M.; Bonincontro, A.; Calandrini, V.; Onori, G.; Risuleo, G.

    2001-05-01

    In this communication we present an investigation on ribosomal cores, i.e. ribosomes deprived of a select group of ribosomal proteins by LiCl treatment. This study was conducted by dielectric spectroscopy technique. The aim was to elucidate the role of ribosomal proteins in the stabilization of a very stable structural nucleus previously observed within the ribosome. The results show that this structure withstands relatively high concentrations of LiCl and is demolished within a limited range of salt concentration. The data discussed here corroborate the idea that this structure constitutes the ribosomal kernel.

  9. RNA structures regulating ribosomal protein biosynthesis in bacilli.

    PubMed

    Deiorio-Haggar, Kaila; Anthony, Jon; Meyer, Michelle M

    2013-07-01

    In Bacilli, there are three experimentally validated ribosomal-protein autogenous regulatory RNAs that are not shared with E. coli. Each of these RNAs forms a unique secondary structure that interacts with a ribosomal protein encoded by a downstream gene, namely S4, S15, and L20. Only one of these RNAs that interacts with L20 is currently found in the RNA Families Database. We created, or modified, existing structural alignments for these three RNAs and used them to perform homology searches. We have determined that each structure exhibits a narrow phylogenetic distribution, mostly relegated to the Firmicute class Bacilli. This work, in conjunction with other similar work, demonstrates that there are most likely many non-homologous RNA regulatory elements regulating ribosomal protein biosynthesis that still await discovery and characterization in other bacterial species. PMID:23611891

  10. Identification of Two Distinct Hybrid State Intermediates On the Ribosome

    PubMed Central

    Munro, James B.; Altman, Roger B.; O’Connor, Nathan; Blanchard, Scott C.

    2007-01-01

    SUMMARY High-spatial and –time resolution single-molecule fluorescence resonance energy transfer measurements have been used to probe the structural and kinetic parameters of transfer RNA (tRNA) movements within the aminoacyl (A) and peptidyl (P) sites of the ribosome. Our investigation of tRNA motions, quantified on wild-type, mutant, and L1-depleted ribosome complexes, reveals a dynamic exchange between three metastable tRNA configurations, one of which is a previously unidentified hybrid state in which only deacylated-tRNA adopts its hybrid (P/E) configuration. These new dynamic information suggests a framework in which the formation of intermediate states in the translocation process is achieved through global conformational rearrangements of the ribosome particle. PMID:17317624

  11. [Mechanism of tRNA translocation on the ribosome].

    PubMed

    Rodnina, M V; Semenkov, Iu P; Savelsbergh, A; Katunin, V I; Peske, F; Wilden, B; Wintermeyer, W

    2001-01-01

    During the translocation step of the elongation cycle of peptide synthesis two tRNAs together with the mRNA move synchronously and rapidly on the ribosome. Translocation is catalyzed by the elongation factor G (EF-G) and requires GTP hydrolysis. The fundamental biochemical features of the process were worked out in the 1970-80s, to a large part by A.S. Spirin and his colleagues. Recent results from pre-steady-state kinetic analysis and cryoelectron microscopy suggest that translocation is a multistep dynamic process that entails large-scale structural rearrangements of both ribosome and EF-G. Kinetic and thermodynamic data, together with the structural information on the conformational changes of the ribosome and of EF-G, provide a detailed mechanistic model of translocation and suggest a mechanism of translocation catalysis by EF-G. PMID:11524952

  12. RNA structures regulating ribosomal protein biosynthesis in bacilli

    PubMed Central

    Deiorio-Haggar, Kaila; Anthony, Jon; Meyer, Michelle M.

    2013-01-01

    In Bacilli, there are three experimentally validated ribosomal-protein autogenous regulatory RNAs that are not shared with E. coli. Each of these RNAs forms a unique secondary structure that interacts with a ribosomal protein encoded by a downstream gene, namely S4, S15, and L20. Only one of these RNAs that interacts with L20 is currently found in the RNA Families Database. We created, or modified, existing structural alignments for these three RNAs and used them to perform homology searches. We have determined that each structure exhibits a narrow phylogenetic distribution, mostly relegated to the Firmicute class Bacilli. This work, in conjunction with other similar work, demonstrates that there are most likely many non-homologous RNA regulatory elements regulating ribosomal protein biosynthesis that still await discovery and characterization in other bacterial species. PMID:23611891

  13. The bacterial translocon SecYEG opens upon ribosome binding.

    PubMed

    Knyazev, Denis G; Lents, Alexander; Krause, Eberhard; Ollinger, Nicole; Siligan, Christine; Papinski, Daniel; Winter, Lukas; Horner, Andreas; Pohl, Peter

    2013-06-21

    In co-translational translocation, the ribosome funnel and the channel of the protein translocation complex SecYEG are aligned. For the nascent chain to enter the channel immediately after synthesis, a yet unidentified signal triggers displacement of the SecYEG sealing plug from the pore. Here, we show that ribosome binding to the resting SecYEG channel triggers this conformational transition. The purified and reconstituted SecYEG channel opens to form a large ion-conducting channel, which has the conductivity of the plug deletion mutant. The number of ion-conducting channels inserted into the planar bilayer per fusion event roughly equals the number of SecYEG channels counted by fluorescence correlation spectroscopy in a single proteoliposome. Thus, the open probability of the channel must be close to unity. To prevent the otherwise lethal proton leak, a closed post-translational conformation of the SecYEG complex bound to a ribosome must exist. PMID:23645666

  14. A Ribosome Flow Model for Analyzing Translation Elongation

    NASA Astrophysics Data System (ADS)

    Reuveni, Shlomi; Meilijson, Isaac; Kupiec, Martin; Ruppin, Eytan; Tuller, Tamir

    We describe the first genome wide analysis of translation based on a model aimed at capturing the physical and dynamical aspects of this process. The Ribosomal Flow Model (RFM) is a computationally efficient approximation of the Totally Asymmetric Exclusion Process (TASEP) model (e.g. see [1]). The RFM is sensitive to the order of codons in the coding sequence, the tRNA pool of the organism, interactions between ribosomes and their size (see Figure [1]). The RFM predicts fundamental outcomes of the translation process, including translation rates, protein abundance and ribosomal densities [2] and the relation between all these variables, better than alternative ('non-physical') approaches (e.g. see [3,4]). In addition, we show that the RFM model can be used for accurate inference of initiation rates, the effect of codon order on protein abundance and the cost of translation. All these variables could not be inferred by previous predictors.

  15. Imprints of the genetic code in the ribosome

    PubMed Central

    Johnson, David B. F.; Wang, Lei

    2010-01-01

    The establishment of the genetic code remains elusive nearly five decades after the code was elucidated. The stereochemical hypothesis postulates that the code developed from interactions between nucleotides and amino acids, yet supporting evidence in a biological context is lacking. We show here that anticodons are selectively enriched near their respective amino acids in the ribosome, and that such enrichment is significantly correlated with the canonical code over random codes. Ribosomal anticodon-amino acid enrichment further reveals that specific codons were reassigned during code evolution, and that the code evolved through a two-stage transition from ancient amino acids without anticodon interaction to newer additions with anticodon interaction. The ribosome thus serves as a molecular fossil, preserving biological evidence that anticodon-amino acid interactions shaped the evolution of the genetic code. PMID:20385807

  16. Molecular profiling of activated neurons by phosphorylated ribosome capture.

    PubMed

    Knight, Zachary A; Tan, Keith; Birsoy, Kivanc; Schmidt, Sarah; Garrison, Jennifer L; Wysocki, Robert W; Emiliano, Ana; Ekstrand, Mats I; Friedman, Jeffrey M

    2012-11-21

    The mammalian brain is composed of thousands of interacting neural cell types. Systematic approaches to establish the molecular identity of functional populations of neurons would advance our understanding of neural mechanisms controlling behavior. Here, we show that ribosomal protein S6, a structural component of the ribosome, becomes phosphorylated in neurons activated by a wide range of stimuli. We show that these phosphorylated ribosomes can be captured from mouse brain homogenates, thereby enriching directly for the mRNAs expressed in discrete subpopulations of activated cells. We use this approach to identify neurons in the hypothalamus regulated by changes in salt balance or food availability. We show that galanin neurons are activated by fasting and that prodynorphin neurons restrain food intake during scheduled feeding. These studies identify elements of the neural circuit that controls food intake and illustrate how the activity-dependent capture of cell-type-specific transcripts can elucidate the functional organization of a complex tissue. PMID:23178128

  17. The Bacterial Translocon SecYEG Opens upon Ribosome Binding*

    PubMed Central

    Knyazev, Denis G.; Lents, Alexander; Krause, Eberhard; Ollinger, Nicole; Siligan, Christine; Papinski, Daniel; Winter, Lukas; Horner, Andreas; Pohl, Peter

    2013-01-01

    In co-translational translocation, the ribosome funnel and the channel of the protein translocation complex SecYEG are aligned. For the nascent chain to enter the channel immediately after synthesis, a yet unidentified signal triggers displacement of the SecYEG sealing plug from the pore. Here, we show that ribosome binding to the resting SecYEG channel triggers this conformational transition. The purified and reconstituted SecYEG channel opens to form a large ion-conducting channel, which has the conductivity of the plug deletion mutant. The number of ion-conducting channels inserted into the planar bilayer per fusion event roughly equals the number of SecYEG channels counted by fluorescence correlation spectroscopy in a single proteoliposome. Thus, the open probability of the channel must be close to unity. To prevent the otherwise lethal proton leak, a closed post-translational conformation of the SecYEG complex bound to a ribosome must exist. PMID:23645666

  18. Ribosomal RNAs in translation termination: facts and hypotheses.

    PubMed

    Arkov, A L; Murgola, E J

    1999-12-01

    It is now well established that ribosomal RNAs (rRNAs) play an active role in every aspect of translation. This review focuses on recent evidence for the involvement of rRNAs from both subunits of the ribosome in translation termination. This evidence comprises data obtained with rRNA mutants both in vivo and in vitro. In particular, mutations in specific regions of rRNAs caused readthrough of nonsense codons in vivo. Consistent with their in vivo characteristics, the mutations decreased the productive association of the ribosome with release factor 2 (RF2) and the efficiency of catalysis of peptidyl-tRNA hydrolysis in the presence of RF2 in realistic in vitro termination systems. It is now evident that genetic selections for termination-defective mutants in vivo and their characterization in realistic in vitro termination assays will rapidly advance our understanding of the mechanism of termination. PMID:10648958

  19. Structural Basis for the Rescue of Stalled Ribosomes: Structure of YaeJ Bound to the Ribosome

    SciTech Connect

    Gagnon, Matthieu G.; Seetharaman, Sai V.; Bulkley, David; Steitz, Thomas A.

    2012-06-19

    In bacteria, the hybrid transfer-messenger RNA (tmRNA) rescues ribosomes stalled on defective messenger RNAs (mRNAs). However, certain gram-negative bacteria have evolved proteins that are capable of rescuing stalled ribosomes in a tmRNA-independent manner. Here, we report a 3.2 angstrom-resolution crystal structure of the rescue factor YaeJ bound to the Thermus thermophilus 70S ribosome in complex with the initiator tRNA{sub i}{sup fMet} and a short mRNA. The structure reveals that the C-terminal tail of YaeJ functions as a sensor to discriminate between stalled and actively translating ribosomes by binding in the mRNA entry channel downstream of the A site between the head and shoulder of the 30S subunit. This allows the N-terminal globular domain to sample different conformations, so that its conserved GGQ motif is optimally positioned to catalyze the hydrolysis of peptidyl-tRNA. This structure gives insights into the mechanism of YaeJ function and provides a basis for understanding how it rescues stalled ribosomes.

  20. Time-resolved binding of azithromycin to Escherichia coli ribosomes.

    PubMed

    Petropoulos, Alexandros D; Kouvela, Ekaterini C; Starosta, Agata L; Wilson, Daniel N; Dinos, George P; Kalpaxis, Dimitrios L

    2009-01-30

    Azithromycin is a semisynthetic derivative of erythromycin that inhibits bacterial protein synthesis by binding within the peptide exit tunnel of the 50S ribosomal subunit. Nevertheless, there is still debate over what localization is primarily responsible for azithromycin binding and as to how many molecules of the drug actually bind per ribosome. In the present study, kinetic methods and footprinting analysis are coupled together to provide time-resolved details of the azithromycin binding process. It is shown that azithromycin binds to Escherichia coli ribosomes in a two-step process: The first-step involves recognition of azithromycin by the ribosomal machinery and places the drug in a low-affinity site located in the upper part of the exit tunnel. The second step corresponds to the slow formation of a final complex that is both much tighter and more potent in hindering the progression of the nascent peptide through the exit tunnel. Substitution of uracil by cytosine at nucleoside 2609 of 23S rRNA, a base implicated in the high-affinity site, facilitates the shift of azithromycin to this site. In contrast, mutation U754A hardly affects the binding process. Binding of azithromycin to both sites is hindered by high concentrations of Mg(2+) ions. Unlike Mg(2+) ions, polyamines do not significantly affect drug binding to the low-affinity site but attenuate the formation of the final complex. The low- and high-affinity sites of azithromycin binding are mutually exclusive, which means that one molecule of the drug binds per E. coli ribosome at a time. In contrast, kinetic and binding data indicate that in Deinococcus radiodurans, two molecules of azithromycin bind cooperatively to the ribosome. This finding confirms previous crystallographic results and supports the notion that species-specific structural differences may primarily account for the apparent discrepancies between the antibiotic binding modes obtained for different organisms. PMID:19071138

  1. Synthesis of Amplified DNA That Codes for Ribosomal RNA

    PubMed Central

    Crippa, Marco; Tocchini-Valentini, Glauco P.

    1971-01-01

    During the amplification stage in ovaries, the complete repetitive unit of the DNA that codes for ribosomal RNA in Xenopus appears to be transcribed. This large RNA transcript is found in a complex with DNA. Substitution experiments with 5-bromodeoxyuridine do not show any evidence that a complete amplified cistron is used as a template for further amplification. A derivative of rifampicin, 2′,5′-dimethyl-N(4′)benzyl-N(4′)[desmethyl] rifampicin, preferentially inhibits the DNA synthesis responsible for ribosomal gene amplification. These results are consistent with the hypothesis that RNA-dependent DNA synthesis is involved in gene amplification. PMID:5288254

  2. Ribosomal Translocation: One Step Closer to the Molecular Mechanism

    PubMed Central

    Shoji, Shinichiro; Walker, Sarah E.; Fredrick, Kurt

    2010-01-01

    Protein synthesis occurs in ribosomes, the targets of numerous antibiotics. How these large and complex machines read and move along mRNA have proven to be challenging questions. In this Review, we focus on translocation, the last step of the elongation cycle in which movement of tRNA and mRNA is catalyzed by elongation factor G. Translocation entails large-scale movements of the tRNAs and conformational changes in the ribosome that require numerous tertiary contacts to be disrupted and reformed. We highlight recent progress toward elucidating the molecular basis of translocation and how various antibiotics influence tRNA–mRNA movement. PMID:19173642

  3. Eukaryotic ribosomes that lack a 5.8S RNA

    NASA Technical Reports Server (NTRS)

    Vossbrinck, C. R.; Woese, C. R.

    1986-01-01

    The 5.8S ribosomal RNA is believed to be a universal eukaryotic characteristic. It has no (size) counterpart among the prokaryotes, although its sequence is homologous with the first 150 or so nucleotides of the prokaryotic large subunit (23S) ribosomal RNA. An exception to this rule is reported here. The microsporidian Vairimorpha necatrix is a eukaryote that has no 5.8S rRNA. As in the prokaryotes, it has a single large subunit rRNA, whose 5-prime region corresponds to the 5.8S rRNA.

  4. Differential scanning calorimetry of whole Escherichia coli treated with the antimicrobial peptide MSI-78 indicate a multi-hit mechanism with ribosomes as a novel target

    PubMed Central

    Brannan, Alexander M.; Whelan, William A.; Cole, Emma

    2015-01-01

    Differential Scanning Calorimetry (DSC) of intact Escherichia coli (E. coli) was used to identify non-lipidic targets of the antimicrobial peptide (AMP) MSI-78. The DSC thermograms revealed that, in addition to its known lytic properties, MSI-78 also has a striking effect on ribosomes. MSI-78’s effect on DSC scans of bacteria was similar to that of kanamycin, an antibiotic drug known to target the 30S small ribosomal subunit. An in vitro transcription/translation assay helped confirm MSI-78’s targeting of ribosomes. The scrambled version of MSI-78 also affected the ribosome peak of the DSC scans, but required greater amounts of peptide to cause a similar effect to the unscrambled peptide. Furthermore, the effect of the scrambled peptide was not specific to the ribosomes; other regions of the DSC thermogram were also affected. These results suggest that MSI-78’s effects on E. coli are at least somewhat dependent on its particular structural features, rather than a sole function of its overall charge and hydrophobicity. When considered along with earlier work detailing MSI-78’s membrane lytic properties, it appears that MSI-78 operates via a multi-hit mechanism with multiple targets. PMID:26713257

  5. Modeling the Overproduction of Ribosomes when Antibacterial Drugs Act on Cells.

    PubMed

    Maitra, Arijit; Dill, Ken A

    2016-02-01

    Bacteria that are subjected to ribosome-inhibiting antibiotic drugs show an interesting behavior: Although the drug slows down cell growth, it also paradoxically increases the cell's concentration of ribosomes. We combine our earlier nonlinear model of the energy-biomass balance in undrugged Escherichia coli cells with Michaelis-Menten binding of drugs that inactivate ribosomes. Predictions are in good agreement with experiments on ribosomal concentrations and synthesis rates versus drug concentrations and growth rates. The model indicates that the added drug drives the cell to overproduce ribosomes, keeping roughly constant the level of ribosomes producing ribosomal proteins, an important quantity for cell growth. The model also predicts that ribosomal production rates should increase and then decrease with added drug. This model gives insights into the driving forces in cells and suggests new experiments. PMID:26840738

  6. Decrease in Ribosomal RNA in Candida albicans Induced by Serum Exposure

    PubMed Central

    Fleischmann, Jacob; Rocha, Miguel A.

    2015-01-01

    Candida albicans is an important polymorphic human pathogen. It can switch from a unicellular yeast form to germinating hypha, which may play a role in making it the successful pathogen it is. This hyphal transformation can be triggered by various extracellular stimuli, the most potent one being serum from any source. We have previously reported that Candida albicans transiently polyadenylates portions of both the large and small subunits of ribosomal RNA, shortly after serum exposure. Northern blots at the same time suggested that serum might induce a decrease in total ribosomal RNA. We have carried out a number of experiments to carefully assess this possibility and now report that serum significantly reduces ribosomal RNA in Candida albicans. Fluorometric measurements, Northern blotting and quantitative RT-PCR, have all confirmed this decrease. Timed experiments show that serum induces this decrease rapidly, as it was seen in as early as five minutes. Cell mass is not decreased as total cellular protein content remains the same and metabolic activity does not appear to slow, as assessed by XTT assay, and by the observation that cells form hyphal structures robustly. Another hyphal inducer, N-acetylglucosamine, also caused RNA decrease, but to a lesser extent. We also observed it in non-germinating yeast, such as Candida glabrata. The reason for this decrease is unknown and overall our data suggests that decrease in rRNA does not play a causal role in hyphal transformation. Rapid and significant decrease in a molecule so central to the yeast’s biology is of some importance, and further studies, such as its effect on protein metabolism, will be required to better understand its purpose. PMID:25946110

  7. Complete sequence and gene organization of the Nosema heliothidis ribosomal RNA gene region.

    PubMed

    Dong, Shinan; Shen, Zhongyuan; Zhu, Feng; Tang, Xudong; Xu, Li

    2011-01-01

    By sequencing the entire ribosomal RNA (rRNA) gene region of Nosema heliothidis isolated from cotton bollworm (Helicoverpa armigera), we showed that its gene organization is similar to the type species, Nosema bombycis: the 5'-large subunit rRNA (2,490 bp)-internal transcribed spacer (192 bp)-small subunit rRNA (1,232 bp)-intergenic spacer (274 bp)-5S rRNA (115 bp)-3'. We constructed two phylogenetic trees, analyzed phylogenetic relationships, examined rRNA organization of microsporidia, and compared the secondary structure of small subunit rRNA with closely related microsporidia. The latter two features may provide important information for the classification and phylogenetic analysis of microsporidia. PMID:21895841

  8. Does Blood of Healthy Subjects Contain Bacterial Ribosomal DNA?

    PubMed Central

    Nikkari, Simo; McLaughlin, Ian J.; Bi, Wanli; Dodge, Deborah E.; Relman, David A.

    2001-01-01

    Real-time PCR methods with primers and a probe targeting conserved regions of the bacterial 16S ribosomal DNA (rDNA) revealed a larger amount of rDNA in blood specimens from healthy individuals than in matched reagent controls. However, the origins and identities of these blood-associated bacterial rDNA sequences remain obscure. PMID:11326021

  9. Mutations in ribosomal proteins: Apoptosis, cell competition, and cancer.

    PubMed

    Baker, Nicholas E; Kale, Abhijit

    2016-01-01

    Mutations affecting multiple ribosomal proteins are implicated in cancer. Using genetic mosaics in the fruit fly Drosophila, we describe 3 apoptotic mechanisms that affect Rp/Rp homozygous mutant cells, Rp/+ heterozygous cells, or Rp/+ heterozygous cells in competition with nearby wild type cells, and discuss how apoptosis might be related to cancer predisposition. PMID:27308545

  10. The ABC of Ribosome-Related Antibiotic Resistance

    PubMed Central

    Wilson, Daniel N.

    2016-01-01

    ABSTRACT The increase in multidrug-resistant pathogenic bacteria is limiting the utility of our current arsenal of antimicrobial agents. Mechanistically understanding how bacteria obtain antibiotic resistance is a critical first step to the development of improved inhibitors. One common mechanism for bacteria to obtain antibiotic resistance is by employing ATP-binding cassette (ABC) transporters to actively pump the drug from the cell. The ABC-F family includes proteins conferring resistance to a variety of clinically important ribosome-targeting antibiotics; however, controversy remains as to whether resistance is conferred via efflux like other ABC transporters or whether another mechanism, such as ribosome protection, is at play. A recent study by Sharkey and coworkers (L. K. Sharkey, T. A. Edwards, and A. J. O’Neill, mBio 7:e01975-15, 2016, http://dx.doi.org/10.1128/mBio.01975-15) provides strong evidence that ABC-F proteins conferring antibiotic resistance utilize ribosome protection mechanisms, namely, by interacting with the ribosome and displacing the drug from its binding site, thus revealing a novel role for ABC-F proteins in antibiotic resistance. PMID:27143393

  11. Protein folding on the ribosome studied using NMR spectroscopy

    PubMed Central

    Waudby, Christopher A.; Launay, Hélène; Cabrita, Lisa D.; Christodoulou, John

    2013-01-01

    NMR spectroscopy is a powerful tool for the investigation of protein folding and misfolding, providing a characterization of molecular structure, dynamics and exchange processes, across a very wide range of timescales and with near atomic resolution. In recent years NMR methods have also been developed to study protein folding as it might occur within the cell, in a de novo manner, by observing the folding of nascent polypeptides in the process of emerging from the ribosome during synthesis. Despite the 2.3 MDa molecular weight of the bacterial 70S ribosome, many nascent polypeptides, and some ribosomal proteins, have sufficient local flexibility that sharp resonances may be observed in solution-state NMR spectra. In providing information on dynamic regions of the structure, NMR spectroscopy is therefore highly complementary to alternative methods such as X-ray crystallography and cryo-electron microscopy, which have successfully characterized the rigid core of the ribosome particle. However, the low working concentrations and limited sample stability associated with ribosome–nascent chain complexes means that such studies still present significant technical challenges to the NMR spectroscopist. This review will discuss the progress that has been made in this area, surveying all NMR studies that have been published to date, and with a particular focus on strategies for improving experimental sensitivity. PMID:24083462

  12. Differential expression of ribosomal proteins in myelodysplastic syndromes.

    PubMed

    Rinker, Elizabeth B; Dueber, Julie C; Qualtieri, Julianne; Tedesco, Jason; Erdogan, Begum; Bosompem, Amma; Kim, Annette S

    2016-02-01

    Aberrations of ribosomal biogenesis have been implicated in several congenital bone marrow failure syndromes, such as Diamond-Blackfan anaemia, Shwachman-Diamond syndrome and Dyskeratosis Congenita. Recent studies have identified haploinsufficiency of RPS14 in the acquired bone marrow disease isolated 5q minus syndrome, a subtype of myelodysplastic syndromes (MDS). However, the expression of various proteins comprising the ribosomal subunits and other proteins enzymatically involved in the synthesis of the ribosome has not been explored in non-5q minus MDS. Furthermore, differences in the effects of these expression alterations among myeloid, erythroid and megakaryocyte lineages have not been well elucidated. We examined the expression of several proteins related to ribosomal biogenesis in bone marrow biopsy specimens from patients with MDS (5q minus patients excluded) and controls with no known myeloid disease. Specifically, we found that there is overexpression of RPS24, DKC1 and SBDS in MDS. This overexpression is in contrast to the haploinsufficiency identified in the congenital bone marrow failure syndromes and in acquired 5q minus MDS. Potential mechanisms for these differences and aetiology for these findings in MDS are discussed. PMID:26408650

  13. Conformation of the signal recognition particle in ribosomal targeting complexes

    PubMed Central

    Buskiewicz, Iwona A.; Jöckel, Johannes; Rodnina, Marina V.; Wintermeyer, Wolfgang

    2009-01-01

    The bacterial signal recognition particle (SRP) binds to ribosomes synthesizing inner membrane proteins and, by interaction with the SRP receptor, FtsY, targets them to the translocon at the membrane. Here we probe the conformation of SRP and SRP protein, Ffh, at different stages of targeting by measuring fluorescence resonance energy transfer (FRET) between fluorophores placed at various positions within SRP. Distances derived from FRET indicate that SRP binding to nontranslating ribosomes triggers a global conformational change of SRP that facilitates binding of the SRP receptor, FtsY. Binding of SRP to a signal-anchor sequence exposed on a ribosome-nascent chain complex (RNC) causes a further change of the SRP conformation, involving the flexible part of the Ffh(M) domain, which increases the affinity for FtsY of ribosome-bound SRP up to the affinity exhibited by the isolated NG domain of Ffh. This indicates that in the RNC–SRP complex the Ffh(NG) domain is fully exposed for binding FtsY to form the targeting complex. Binding of FtsY to the RNC–SRP complex results in a limited conformational change of SRP, which may initiate subsequent targeting steps. PMID:19029307

  14. Ribosomal proteins of the Asian citrus psyllid, Diaphornia citri

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We developed and sequenced 88 ribosomal protein sequences for their use as genetic markers to monitor and identify current and exotic introductions of psyllids into the U.S.A. The sequences were produced and submitted as a psyllid specific dataset into the National Center for Biotechnology Informati...

  15. The toxin GraT inhibits ribosome biogenesis.

    PubMed

    Ainelo, Andres; Tamman, Hedvig; Leppik, Margus; Remme, Jaanus; Hõrak, Rita

    2016-05-01

    Most bacteria encode numerous chromosomal toxin-antitoxin (TA) systems that are proposed to contribute to stress tolerance, as they are able to shift the cells to a dormant state. Toxins act on a variety of targets with the majority attacking the translational apparatus. Intriguingly, the toxicity mechanisms of even closely related toxins may differ essentially. Here, we report on a new type of TA toxin that inhibits ribosome biogenesis. GraT of the GraTA system has previously been described in Pseudomonas putida as an unusually moderate toxin at optimal growth temperatures. However, GraT causes a severe growth defect at lower temperatures. Here, we demonstrate that GraT causes the accumulation of free ribosomal subunits. Mapping the rRNA 5' ends reveals incomplete processing of the free subunits and quantification of modified nucleosides shows an underrepresentation of late subunit assembly specific modifications. This indicates that GraT inhibits ribosome subunit assembly. Interestingly, GraT effects can be alleviated by modification of the chaperone DnaK, a known facilitator of late stages in ribosome biogenesis. We show that GraT directly interacts with DnaK and suggest two possible models for the role of this interaction in GraT toxicity. PMID:26833678

  16. Protein-guided RNA dynamics during early ribosome assembly

    NASA Astrophysics Data System (ADS)

    Kim, Hajin; Abeysirigunawarden, Sanjaya C.; Chen, Ke; Mayerle, Megan; Ragunathan, Kaushik; Luthey-Schulten, Zaida; Ha, Taekjip; Woodson, Sarah A.

    2014-02-01

    The assembly of 30S ribosomes requires the precise addition of 20 proteins to the 16S ribosomal RNA. How early binding proteins change the ribosomal RNA structure so that later proteins may join the complex is poorly understood. Here we use single-molecule fluorescence resonance energy transfer (FRET) to observe real-time encounters between Escherichia coli ribosomal protein S4 and the 16S 5' domain RNA at an early stage of 30S assembly. Dynamic initial S4-RNA complexes pass through a stable non-native intermediate before converting to the native complex, showing that non-native structures can offer a low free-energy path to protein-RNA recognition. Three-colour FRET and molecular dynamics simulations reveal how S4 changes the frequency and direction of RNA helix motions, guiding a conformational switch that enforces the hierarchy of protein addition. These protein-guided dynamics offer an alternative explanation for induced fit in RNA-protein complexes.

  17. The Structure of LepA, the Ribosomal Back Translocase

    SciTech Connect

    Evans,R.; Blaha, G.; Bailey, S.; Steitz, T.

    2008-01-01

    LepA is a highly conserved elongation factor that promotes the back translocation of tRNAs on the ribosome during the elongation cycle. We have determined the crystal structure of LepA from Escherichia coli at 2.8- Angstroms resolution. The high degree of sequence identity between LepA and EF-G is reflected in the structural similarity between the individual homologous domains of LepA and EF-G. However, the orientation of domains III and V in LepA differs from their orientations in EF-G. LepA also contains a C-terminal domain (CTD) not found in EF-G that has a previously unobserved protein fold. The high structural similarity between LepA and EF-G enabled us to derive a homology model for LepA bound to the ribosome using a 7.3- Angstroms cryo-EM structure of a complex between EF-G and the 70S ribosome. In this model, the very electrostatically positive CTD of LepA is placed in the direct vicinity of the A site of the large ribosomal subunit, suggesting a possible interaction between the CTD and the back translocated tRNA or 23S rRNA.

  18. Mutations in ribosomal proteins: Apoptosis, cell competition, and cancer

    PubMed Central

    Baker, Nicholas E.; Kale, Abhijit

    2016-01-01

    Mutations affecting multiple ribosomal proteins are implicated in cancer. Using genetic mosaics in the fruit fly Drosophila, we describe 3 apoptotic mechanisms that affect Rp/Rp homozygous mutant cells, Rp/+ heterozygous cells, or Rp/+ heterozygous cells in competition with nearby wild type cells, and discuss how apoptosis might be related to cancer predisposition. PMID:27308545

  19. N-terminal sequence of some ribosome-inactivating proteins.

    PubMed

    Montecucchi, P C; Lazzarini, A M; Barbieri, L; Stirpe, F; Soria, M; Lappi, D

    1989-04-01

    The N-terminal portion of some type 1 ribosome-inactivating proteins (RIPs) isolated from the seeds of Gelonium multiflorum, Momordica charantia, Bryonia dioica, Saponaria officinalis and from the leaves of Saponaria officinalis are reported in the present paper. Their relationship with other RIPs is discussed. PMID:2753596

  20. Reverse Translocation of tRNA in the Ribosome

    PubMed Central

    Shoji, Shinichiro; Walker, Sarah E.; Fredrick, Kurt

    2009-01-01

    Summary A widely held view is that directional movement of tRNA in the ribosome is determined by an intrinsic mechanism and driven thermodynamically by transpeptidation. Here, we show that, in certain ribosomal complexes, the pretranslocation (PRE) state is thermodynamically favored over the posttranslocation (POST) state. Spontaneous and efficient conversion from the POST to PRE state is observed when EF-G is depleted from ribosomes in the POST state or when tRNA is added to the E site of ribosomes containing P-site tRNA. In the latter assay, the rate of tRNA movement is increased by streptomycin and neomycin, decreased by tetracycline, and not affected by the acylation state of the tRNA. In one case, we provide evidence that complex conversion occurs by reverse translocation (i.e., direct movement of the tRNAs from the E and P sites to the P and A sites, respectively). These findings have important implications for the energetics of translocation. PMID:17189194