Science.gov

Sample records for 5 aminolevulinic acid

  1. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  2. Photodynamic therapy with 5-aminolevulinic acid: basic principles and applications

    NASA Astrophysics Data System (ADS)

    Pottier, Roy H.; Kennedy, James C.

    1996-01-01

    Numerous photosensitizing pigments that absorb visible light and are selectively retained in neoplastic tissue are being investigated as potential photochemotherapeutic agents. While much emphasis is being placed on the synthesis of new, far-red absorbing photosensitizers, an alternative approach has been to stimulate the human body to produce its own natural photosensitizer, namely protoporphyrin IX (PpIX). Exogenous 5-aminolevulinic acid (ALA) is rapidly bioconverted into PP by mitochondria, the process being particularly efficient in tumor cells. Since PpIX has a natural and rapid clearing mechanism (via the capture of iron in the process of being converted into heme), ALA-PDT does not suffer from lingering skin phototoxicity. ALA may be introduced orally, intravenously, or topically, and ALA-PDT has been shown to be effective in the treatment of both malignant and non-malignant lesions.

  3. Therapeutic effects of topical 5-aminolevulinic acid photodynamic therapy

    PubMed Central

    Hu, Yin-E; Dai, Shu-Fang; Wang, Bin; Qu, Wei; Gao, Jun-Ling

    2016-01-01

    Objective: To evaluate the therapeutic effects of combined 5-aminolevulinic acid (ALA) and photodynamic therapy (PDT) on genital warts and the safety. Methods: One hundred ten patients with genital warts who were treated in our hospital from June 2013 to October 2014 were selected. The warts and affected parts were disinfected with benzalkonium bromide solution, and the warts were covered with absorbent cotton that had already been added freshly prepared 20% ALA solution, packaged and fixed. Then they were wet-dressed in dark, into which ALA solution was added according to the proportion of 5:3:2 every 30 minutes for three consecutive hours. Afterwards, the warts were illuminated by using photodynamic laser apparatus. The clinical outcomes, adverse reactions and recurrence rates were observed. Results: Genital warts were relieved in 107 out of the 110 cases (cure rate: 97.3%). Male patients had significantly better treatment outcomes at the urethral orifice than those in other affected parts. In the 107 patients, the cure rate of male patients was 98.8%, and they were cured after being treated four times. In contrast, female patients, who were cured after 5 times of treatment, had the cure rate of 91.7%. Their cure rates were similar (χ2=0, P>0.05), but the males were cured after significantly fewer times of treatment than the females (t=-7.432, P<0.05). Five patients suffered from mild tingling or burning sensation upon dressing at the urethral orifice, and the others were all free from systemic adverse reactions. After illumination, a small portion of the patients had mildly red, swelling, painful affected parts, with mild edema that almost disappeared within three days. Three patients relapsed at the urethral orifice and were then cured after further treatment. Conclusion: ALA-PDT can treat genital warts safely with high cure rate and low recurrence rate, particularly working for those of males at the urethral orifice. PMID:27648048

  4. Therapeutic effects of topical 5-aminolevulinic acid photodynamic therapy

    PubMed Central

    Hu, Yin-E; Dai, Shu-Fang; Wang, Bin; Qu, Wei; Gao, Jun-Ling

    2016-01-01

    Objective: To evaluate the therapeutic effects of combined 5-aminolevulinic acid (ALA) and photodynamic therapy (PDT) on genital warts and the safety. Methods: One hundred ten patients with genital warts who were treated in our hospital from June 2013 to October 2014 were selected. The warts and affected parts were disinfected with benzalkonium bromide solution, and the warts were covered with absorbent cotton that had already been added freshly prepared 20% ALA solution, packaged and fixed. Then they were wet-dressed in dark, into which ALA solution was added according to the proportion of 5:3:2 every 30 minutes for three consecutive hours. Afterwards, the warts were illuminated by using photodynamic laser apparatus. The clinical outcomes, adverse reactions and recurrence rates were observed. Results: Genital warts were relieved in 107 out of the 110 cases (cure rate: 97.3%). Male patients had significantly better treatment outcomes at the urethral orifice than those in other affected parts. In the 107 patients, the cure rate of male patients was 98.8%, and they were cured after being treated four times. In contrast, female patients, who were cured after 5 times of treatment, had the cure rate of 91.7%. Their cure rates were similar (χ2=0, P>0.05), but the males were cured after significantly fewer times of treatment than the females (t=-7.432, P<0.05). Five patients suffered from mild tingling or burning sensation upon dressing at the urethral orifice, and the others were all free from systemic adverse reactions. After illumination, a small portion of the patients had mildly red, swelling, painful affected parts, with mild edema that almost disappeared within three days. Three patients relapsed at the urethral orifice and were then cured after further treatment. Conclusion: ALA-PDT can treat genital warts safely with high cure rate and low recurrence rate, particularly working for those of males at the urethral orifice.

  5. Photofrin and 5-aminolevulinic acid permeation through oral mucosa in vitro

    NASA Astrophysics Data System (ADS)

    Flock, Stephen T.; Alleman, Anthony; Lehman, Paul; Blevins, Steve; Stone, Angie; Fink, Louis; Dinehart, Scott; Stern, Scott J.

    1994-07-01

    Photofrin and 5-aminolevulinic acid are photosensitizers that show promise in the photodynamic treatment of cancer, port-wine stains, atherosclerosis and viral lesions. Photofrin is a mixture of porphyrins which, upon the absorption of light, become temporarily cytotoxic. One side-effect associated with the use of Photofrin is long-term cutaneous photosensitivity. It is possible that topical application of this photosensitizing dye will ameliorate such a side-effect. Another way to avoid the cutaneous photosensitivity in photodynamic therapy is to use 5- aminolevulinic acid, which is a porphyrin precursor that causes an increase in the synthesis and concentration of the photosensitizer protoporphyrin IX. 5-aminolevulinic acid is usually applied topically, and so minimizes cutaneous photosensitivity while maximizing the local protoporphyrin concentration. There are a host of disorders in oral mucosa that are potentially treatable by photodynamic therapy. However, since stratum corneum presents an impermeable barrier to many pharmaceuticals, it is not clear that topical application of the photosensitizer will result in a clinically relevant tissue concentration. We have therefore studied the permeation behavior of Photofrin and 5-aminolevulinic acid by applying them to the surface of ex vivo oral mucosa tissue positioned by a Franz diffusion cell. In order to increase the permeability of the photosensitizer across the stratum corneum, we studied the effects of four different drug carriers: phosphate buffered saline, dimethylsulfoxide, ethanol and Azone with isopropyl alcohol.

  6. Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    1999-01-01

    A process of preparing an acid addition salt of delta-aminolevulinic acid comprising: dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures thereof to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing said alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

  7. Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, L.

    1999-05-25

    A process is disclosed for preparing an acid addition salt of delta-aminolevulinic acid comprising. The process involves dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing the alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

  8. A New Strategy for Production of 5-Aminolevulinic Acid in Recombinant Corynebacterium glutamicum with High Yield

    PubMed Central

    Yang, Peng; Liu, Wenjing; Cheng, Xuelian; Wang, Jing; Qi, Qingsheng

    2016-01-01

    ABSTRACT 5-Aminolevulinic acid (ALA), a nonprotein amino acid involved in tetrapyrrole synthesis, has been widely applied in agriculture, medicine, and food production. Many engineered metabolic pathways have been constructed; however, the production yields are still low. In this study, several 5-aminolevulinic acid synthases (ALASs) from different sources were evaluated and compared with respect to their ALA production capacities in an engineered Corynebacterium glutamicum CgS1 strain that can accumulate succinyl-coenzyme A (CoA). A codon-optimized ALAS from Rhodobacter capsulatus SB1003 displayed the best potential. Recombinant strain CgS1/pEC-SB produced 7.6 g/liter ALA using a mineral salt medium in a fed-batch fermentation mode. Employing two-stage fermentation, 12.46 g/liter ALA was produced within 17 h, with a productivity of 0.73 g/liter/h, in recombinant C. glutamicum. Through overexpression of the heterologous nonspecific ALA exporter RhtA from Escherichia coli, the titer was further increased to 14.7 g/liter. This indicated that strain CgS1/pEC-SB-rhtA holds attractive industrial application potential for the future. IMPORTANCE In this study, a two-stage fermentation strategy was used for production of the value-added nonprotein amino acid 5-aminolevulinic acid from glucose and glycine in a generally recognized as safe (GRAS) host, Corynebacterium glutamicum. The ALA titer represented the highest in the literature, to our knowledge. This high production capacity, combined with the potential easy downstream processes, made the recombinant strain an attractive candidate for industrial use in the future. PMID:26921424

  9. Evidence that isolated developing chloroplasts are capable of synthesizing chlorophyll b from 5-aminolevulinic acid

    SciTech Connect

    Huang, Laiqiang; Hoffman, N.E. )

    1990-09-01

    Developing chloroplasts isolated from cucumber (Cucumis sativus L. var Beit Alpha) cotyledons are capable of incorporating ({sup 14}C)5-aminolevulinic acid into chlorophyll (Chl) b and Chl a when incubated under photosynthetic illumination. Thin layer chromatography and high pressure liquid chromatography were employed to analyze the pigments. The specific radioactivity in Chl a was over three times higher than that found in Chl b. Both Chl a and b synthesizing activities in organello decayed rapidly at approximately the same rate. We conclude that concomitant synthesis of Chl a/b-binding apoprotein is not required for Chl b synthesis.

  10. Production of 5-aminolevulinic acid by cell free multi-enzyme catalysis.

    PubMed

    Meng, Qinglong; Zhang, Yanfei; Ju, Xiaozhi; Ma, Chunling; Ma, Hongwu; Chen, Jiuzhou; Zheng, Ping; Sun, Jibin; Zhu, Jun; Ma, Yanhe; Zhao, Xueming; Chen, Tao

    2016-05-20

    5-Aminolevulinic acid (ALA) is the precursor for the biosynthesis of tetrapyrroles and has broad agricultural and medical applications. Currently ALA is mainly produced by chemical synthesis and microbial fermentation. Cell free multi-enzyme catalysis is a promising method for producing high value chemicals. Here we reported our work on developing a cell free process for ALA production using thermostable enzymes. Cheap substrates (succinate and glycine) were used for ALA synthesis by two enzymes: 5-aminolevulinic acid synthase (ALAS) from Laceyella sacchari (LS-ALAS) and succinyl-CoA synthase (Suc) from Escherichia coli. ATP was regenerated by polyphosphate kinase (Ppk) using polyphosphate as the substrate. Succinate was added into the reaction system in a fed-batch mode to avoid its inhibition effect on Suc. After reaction for 160min, ALA concentration was increased to 5.4mM. This is the first reported work on developing the cell free process for ALA production. Through further process and enzyme optimization the cell free process could be an effective and economic way for ALA production.

  11. Enhanced 5-aminolevulinic acid-gold nanoparticle conjugate-based photodynamic therapy using pulse laser

    NASA Astrophysics Data System (ADS)

    Xu, Hao; Yao, Cuiping; Wang, Jing; Chang, Zhennan; Zhang, Zhenxi

    2016-02-01

    The low bioavailability is a crucial limitation for the application of 5-aminolevulinic acid (ALA) in theranostics. In this research, 5-aminolevulinic acid and gold nanoparticle conjugates (ALA-GNPs) were synthesized to improve the bioavailability of ALA and to investigate the impact of ALA photodynamic therapy (ALA-PDT) in Hela cells. A 532 nm pulse laser and light-emitting diode (central wavelengths 502 nm) were jointly used as light sources in PDT research. The results show a 532 nm pulse laser can control ALA release from ALA-GNPs by adjusting the pulse laser dose. This laser control release may be attributed to the heat generation from GNPs under pulse laser irradiation, which indicates accurately adjusting the pulse laser dose to control the drug release in the cell interior can be considered as a new cellular surgery modality. Furthermore, the PDT results in Hela cells indicate the enhancement of ALA release by pulse laser before PDT can promote the efficacy of cell eradication in the light-emitting diode PDT (LED-PDT). This laser mediated drug release system can provide a new online therapy approach in PDT and it can be utilized in the optical monitor technologies based individual theranostics.

  12. Effectiveness of 5-aminolevulinic acid photodynamic therapy in the treatment of hidradenitis suppurativa: a report of 5 cases.

    PubMed

    Andino Navarrete, R; Hasson Nisis, A; Parra Cares, J

    2014-01-01

    Hidradenitis suppurativa has been described as a chronic, recurrent, and disabling inflammatory disease involving the entire hair follicle. Several treatments, including photodynamic therapy, have been used, but the results have been inconsistent and recurrence is high. In this prospective study, we evaluated disease severity, quality of life, and treatment tolerance in 5 patients with moderate to severe hidradenitis suppurativa treated with photodynamic therapy using 5-aminolevulinic acid and a 635-nm light source. Treatment effectiveness was evaluated using the Sartorius severity score, the Dermatology Life Quality Index, and a visual analog scale for pain and disease activity. Significant improvements were observed with all 3 instruments and the effects remained visible at 8 weeks. Our results suggest that photodynamic therapy with 5-aminolevulinic acid and a light wavelength of 635 nm could reduce disease severity and improve quality of life in patients with difficult-to-treat hidradenitis suppurativa.

  13. Clinical utility of 5-aminolevulinic acid HCl to better visualize and more completely remove gliomas

    PubMed Central

    Halani, Sameer H; Adamson, D Cory

    2016-01-01

    Surgical resection is typically the first line of treatment for gliomas. However, the neurosurgeon faces a major challenge in achieving maximal resection in high-grade gliomas as these infiltrative tumors make it difficult to discern tumor margins from normal brain with conventional white-light microscopy alone. To aid in resection of these infiltrative tumors, fluorescence-guided surgery has gained much popularity in intraoperative visualization of malignant gliomas, with 5-aminolevulinic acid (5-ALA) leading the way. First introduced in an article in Neurosurgery, 5-ALA has since become a safe, effective, and inexpensive method to visualize and improve resection of gliomas. This has undoubtedly led to improvements in the clinical course of patients as demonstrated by the increased overall and progression-free survival in patients with such devastating disease. This literature review aims to discuss the major studies and trials demonstrating the clinical utility of 5-ALA and its ability to aid in complete resection of malignant gliomas.

  14. 5-aminolevulinic acid guidance during awake craniotomy to maximise extent of safe resection of glioblastoma multiforme.

    PubMed

    Corns, Robert; Mukherjee, Soumya; Johansen, Anja; Sivakumar, Gnanamurthy

    2015-01-01

    Overall survival for patients with glioblastoma multiforme (GBM) has been consistently shown to improve when the surgeon achieves a gross total resection of the tumour. It has also been demonstrated that surgical adjuncts such as 5-aminolevulinic acid (5-ALA) fluorescence--which delineates malignant tumour tissue--normal brain tissue margin seen using violet-blue excitation under an operating microscope--helps achieve this. We describe the case of a patient with recurrent left frontal GBM encroaching on Broca's area (eloquent brain). Gross total resection of the tumour was achieved by combining two techniques, awake resection to prevent damage to eloquent brain and 5-ALA fluorescence guidance to maximise the extent of tumour resection.This technique led to gross total resection of all T1-enhancing tumour with the avoidance of neurological deficit. The authors recommend this technique in patients when awake surgery can be tolerated and gross total resection is the aim of surgery. PMID:26177997

  15. Physiological and Metabolic Effects of 5-Aminolevulinic Acid for Mitigating Salinity Stress in Creeping Bentgrass

    PubMed Central

    Yang, Zhimin; Chang, Zuoliang; Sun, Lihong; Yu, Jingjin; Huang, Bingru

    2014-01-01

    The objectives of this study were to determine whether foliar application of a chlorophyll precursor, 5-aminolevulinic acid (ALA), could mitigate salinity stress damages in perennial grass species by regulating photosynthetic activities, ion content, antioxidant metabolism, or metabolite accumulation. A salinity-sensitive perennial grass species, creeping bentgrass (Agrostis stolonifera), was irrigated daily with 200 mM NaCl for 28 d, which were foliar sprayed with water or ALA (0.5 mg L−1) weekly during the experiment in growth chamber. Foliar application of ALA was effective in mitigating physiological damage resulting from salinity stress, as manifested by increased turf quality, shoot growth rate, leaf relative water content, chlorophyll content, net photosynthetic rate, stomatal conductance and transpiration rate. Foliar application of ALA also alleviated membrane damages, as shown by lower membrane electrolyte leakage and lipid peroxidation, which was associated with increases in the activities of antioxidant enzymes. Leaf content of Na+ was reduced and the ratio of K+/Na+ was increased with ALA application under salinity stress. The positive effects of ALA for salinity tolerance were also associated with the accumulation of organic acids (α-ketoglutaric acid, succinic acid, and malic acid), amino acids (alanine, 5-oxoproline, aspartic acid, and γ -aminobutyric acid), and sugars (glucose, fructose, galactose, lyxose, allose, xylose, sucrose, and maltose). ALA-mitigation of physiological damages by salinity could be due to suppression of Na+ accumulation and enhanced physiological and metabolic activities related to photosynthesis, respiration, osmotic regulation, and antioxidant defense. PMID:25551443

  16. Physiological and metabolic effects of 5-aminolevulinic acid for mitigating salinity stress in creeping bentgrass.

    PubMed

    Yang, Zhimin; Chang, Zuoliang; Sun, Lihong; Yu, Jingjin; Huang, Bingru

    2014-01-01

    The objectives of this study were to determine whether foliar application of a chlorophyll precursor, 5-aminolevulinic acid (ALA), could mitigate salinity stress damages in perennial grass species by regulating photosynthetic activities, ion content, antioxidant metabolism, or metabolite accumulation. A salinity-sensitive perennial grass species, creeping bentgrass (Agrostis stolonifera), was irrigated daily with 200 mM NaCl for 28 d, which were foliar sprayed with water or ALA (0.5 mg L-1) weekly during the experiment in growth chamber. Foliar application of ALA was effective in mitigating physiological damage resulting from salinity stress, as manifested by increased turf quality, shoot growth rate, leaf relative water content, chlorophyll content, net photosynthetic rate, stomatal conductance and transpiration rate. Foliar application of ALA also alleviated membrane damages, as shown by lower membrane electrolyte leakage and lipid peroxidation, which was associated with increases in the activities of antioxidant enzymes. Leaf content of Na+ was reduced and the ratio of K+/Na+ was increased with ALA application under salinity stress. The positive effects of ALA for salinity tolerance were also associated with the accumulation of organic acids (α-ketoglutaric acid, succinic acid, and malic acid), amino acids (alanine, 5-oxoproline, aspartic acid, and γ -aminobutyric acid), and sugars (glucose, fructose, galactose, lyxose, allose, xylose, sucrose, and maltose). ALA-mitigation of physiological damages by salinity could be due to suppression of Na+ accumulation and enhanced physiological and metabolic activities related to photosynthesis, respiration, osmotic regulation, and antioxidant defense.

  17. Utilization of 5-aminolevulinic acid in the photodynamic therapy of tumors: biochemical and photobiological aspects

    NASA Astrophysics Data System (ADS)

    Pottier, Roy H.; Kennedy, James C.

    1994-03-01

    Inherent in both plants and animals is the natural porphyrin, Protoporphyrin IX (Pp). Although Pp does not appear to have any intrinsic biological activity, it is a potent natural photosensitizer. When activated with ultraviolet or visible light, this photosensitizer can induce significant photodynamic effects on tissues, cells, subcellular elements, and macromolecules via the production of singlet oxygen. The biosynthesis of endogenous Pp is under strict enzymatic control. It is possible to bypass a rate controlling step and induce large, transient concentrations of Pp by the addition of exogenous 5-aminolevulinic acid (ALA). ALA may be administered systemically or topically. Much larger amounts of Pp are produced in certain types of tumor tissue than in adjacent normal tissue. Topically applied ALA can be used to treat a variety of skin lesions, including actinic keratosis, basal cell carcinomas and psoriasis.

  18. Fluorescence-guided resections and photodynamic therapy for malignant gliomas using 5-aminolevulinic acid

    NASA Astrophysics Data System (ADS)

    Stepp, Herbert G.; Beck, Tobias; Beyer, Wolfgang; Pongratz, Thomas; Sroka, Ronald; Baumgartner, Reinhold; Stummer, Walter; Olzowy, Bernhard; Mehrkens, Jan H.; Tonn, Joerg C.; Reulen, Hans J.

    2005-04-01

    Oral application of 20 mg/kg bw of 5-aminolevulinic acid results in a highly specific accumulation of fluorescent and phototoxic Protoporphyrin IX in malignant glioma tissue. Surgical removal with fluorescence guidance is studied in a phase III clinical trial, adjuvant Photodynamic Therapy (PDT) to the surgical cavity is in phase II and for interstitial PDT of recurrent gliomas, a phase I/II study has started. Fluorescence guided resections have been shown to be safe and effective in augmenting neurosurgical removal of malignant gliomas in 52 consecutive patients. Intra-operative fluorescence spectroscopy showed statistically significant higher sensitizer accumulation in vital brain tumor versus the infiltration zone and in the infiltration zone versus adjacent normal brain, which contained very little PPIX. This is promisingly exploited for PDT - both to the surgical cavity by surface irradiation and for stereotactically guided interstitial irradiation.

  19. Review of dermatology use of 5-aminolevulinic acid photodynamic therapy in China from 1997 to 2013

    NASA Astrophysics Data System (ADS)

    Wang, Peiru; Zhang, Guolong; Wang, Xiuli

    2015-07-01

    The prodrug 5-aminolevulinic acid (ALA) and its ester derivatives have been used in photodynamic therapy (PDT) in dermatology worldwide. In China, ALA-PDT was first used to treat urethral condylomata acuminata and non-melanoma skin cancers in 1997. A powder formulation of ALA hydrochloride was approved by the Chinese Food and Drug Administration for the treatment of condylomata acuminata in 2007. Large successful experience of treating condylomatas was accumulated compared with Western countries. Meanwhile, numerous clinical studies as well as off-label use of ALAPDT have been carried out in China. To reflect the progress of ALA-PDT in China, several major Chinese and English databases were searched and published data were reviewed in this article.

  20. Homology modeling of human γ-butyric acid transporters and the binding of pro-drugs 5-aminolevulinic acid and methyl aminolevulinic acid used in photodynamic therapy.

    PubMed

    Baglo, Yan; Gabrielsen, Mari; Sylte, Ingebrigt; Gederaas, Odrun A

    2013-01-01

    Photodynamic therapy (PDT) is a safe and effective method currently used in the treatment of skin cancer. In ALA-based PDT, 5-aminolevulinic acid (ALA), or ALA esters, are used as pro-drugs to induce the formation of the potent photosensitizer protoporphyrin IX (PpIX). Activation of PpIX by light causes the formation of reactive oxygen species (ROS) and toxic responses. Studies have indicated that ALA and its methyl ester (MAL) are taken up into the cells via γ-butyric acid (GABA) transporters (GATs). Uptake via GATs into peripheral sensory nerve endings may also account for one of the few adverse side effects of ALA-based PDT, namely pain. In the present study, homology models of the four human GAT subtypes were constructed using three x-ray crystal structures of the homologous leucine transporter (LeuT) as templates. Binding of the native substrate GABA and the possible substrates ALA and MAL was investigated by molecular docking of the ligands into the central putative substrate binding sites in the outward-occluded GAT models. Electrostatic potentials (ESPs) of the putative substrate translocation pathway of each subtype were calculated using the outward-open and inward-open homology models. Our results suggested that ALA is a substrate of all four GATs and that MAL is a substrate of GAT-2, GAT-3 and BGT-1. The ESP calculations indicated that differences likely exist in the entry pathway of the transporters (i.e. in outward-open conformations). Such differences may be exploited for development of inhibitors that selectively target specific GAT subtypes and the homology models may hence provide tools for design of therapeutic inhibitors that can be used to reduce ALA-induced pain. PMID:23762315

  1. Mechanism for enhanced 5-aminolevulinic acid fluorescence in isocitrate dehydrogenase 1 mutant malignant gliomas

    PubMed Central

    Kim, Ji Young; Kim, Sung Kwon; Kim, Seung-Ki; Park, Sung-Hye; Kim, Hyeonjin; Lee, Se-Hoon; Choi, Seung Hong; Park, Sunghyouk; Park, Chul-Kee

    2015-01-01

    Fluorescence-guided surgery using 5-aminolevulinic acid (5-ALA) has become the main treatment modality in malignant gliomas. However unlike glioblastomas, there are inconsistent result about fluorescence status in WHO grade III gliomas. Here, we show that mutational status of IDH1 is linked to 5-ALA fluorescence. Using genetically engineered malignant glioma cells harboring wild type (U87MG-IDH1WT) or mutant (U87MG-IDH1R132H) IDH1, we demonstrated a lag in 5-ALA metabolism and accumulation of protoporphyrin IX (PpIX) in U87MG-IDH1R132H cells. Next, we used liquid chromatography–mass spectrometry (LC-MS) to screen for tricarboxylic acid (TCA) cycle-related metabolite changes caused by 5-ALA exposure. We observed low baseline levels of NADPH, an essential cofactor for the rate-limiting step of heme degradation, in U87MG-IDH1R132H cells. High levels of NADPH are required to metabolize excessive 5-ALA, giving a plausible reason for the temporarily enhanced 5-ALA fluorescence in mutant IDH1 cells. This hypothesis was supported by the results of metabolic screening in human malignant glioma samples. In conclusion, we have discovered a relationship between enhanced 5-ALA fluorescence and IDH1 mutations in WHO grade III gliomas. Low levels of NADPH in tumors with mutated IDH1 is responsible for the enhanced fluorescence. PMID:26008980

  2. Binding of /sup 14/C-5-aminolevulinic acid to a stromal protein from developing pea chloroplasts

    SciTech Connect

    Thayer, S.S.; Castelfranco, P.A.; Wilkinson, J.; Benson, G.

    1987-04-01

    /sup 14/-5-Aminolevulinic acid (/sup 14/C-ALA) binds to a stromal protein with an apparent molecular weight of 42-43 KD on LDS and non-denaturing gels. The reaction is rapid. Binding is inhibited by sulfhydryl reagents, mM concentrations of levulinic, dihydroxy heptanoic acids and gabaculine, 10 ..mu..M N-methylprotoporphyrin. Dicarboxilic acids, such as deltaKG, Glu, OAA, do not inhibit. Chloramphenicol, ATP, protoporphyrin, anoxia, light, darkness have no effect. The product, once formed, is stable to treatment with 5% conc. HCl in cold acetone. It can be chased in a second incubation with unlabeled ALA, but not with levulinic acid. No activity was detected in the subplastidic membrane fractions. Western blot analysis failed to reveal any homology between the labeled protein and either cytochrome for ALA dehydratase. This ALA-binding protein was not formed in chloroplasts isolated from fully expanded pea leaves. Therefore, it is deemed likely to participate in ALA metabolism during chloroplast development.

  3. Sonodynamic therapy using 5-aminolevulinic acid enhances the efficacy of bleomycin.

    PubMed

    Osaki, Tomohiro; Ono, Misato; Uto, Yoshihiro; Ishizuka, Masahiro; Tanaka, Tohru; Yamanaka, Nobuyasu; Kurahashi, Tsukasa; Azuma, Kazuo; Murahata, Yusuke; Tsuka, Takeshi; Ito, Norihiko; Imagawa, Tomohiro; Okamoto, Yoshiharu

    2016-04-01

    Sonodynamic therapy (SDT) kills tumor cells through the synergistic effects of ultrasound and a sonosensitizer agent. We examined whether 5-aminolevulinic acid (5-ALA)-based SDT at 1 or 3 MHz could enhance the cytotoxicity of bleomycin (BLM) toward mouse mammary tumor cells both in vitro and in vivo. At 1 MHz, cell viability in the 5-ALA-based SDT group at 1, 2, and 3 W/cm(2) was 34.30%, 50.90%, and 60.16%, respectively. Cell viability in the 5-ALA-based SDT+BLM group at 1, 2, and 3 W/cm(2) was 0.09%, 0.32%, and 0.17%, respectively. In contrast, at 3 MHz, 5-ALA-based SDT+BLM did not show pronounced cytotoxicity. In the in vivo study, 5-ALA-based SDT+BLM was significantly more cytotoxic than 5-ALA-based SDT at 1 MHz and 3 MHz. These findings suggest that the mechanism of tumor shrinkage induced by 5-ALA-based SDT+BLM might involve not only direct cell killing, but also vascular shutdown. Thus, we show here that 5-ALA-based SDT enhances the efficacy of BLM both in vitro and in vivo. PMID:26799128

  4. Effects of 5-aminolevulinic acid on a murine model of diet-induced obesity

    PubMed Central

    Koganei, Megumi; Saitou, Yuri; Tsuchiya, Kyoko; Abe, Fuminori; Tanaka, Toru; Horinouchi, Izumi; Izumi, Yoshiya; Yamaji, Taketo; Takahashi, Takeshi

    2015-01-01

    The effects of 5-aminolevulinic acid (5-ALA) on obesity were investigated using a murine model (diet-induced obese mice). Diet-induced obese mice were divided into 4 groups: a control group (C group), which was fed a high-fat diet; a low-5-ALA dose (10 mg/kg/day) group (10A group); a moderate-5-ALA dose (30 mg/kg/day) group (30A group); and a high-5-ALA dose (100 mg/kg/day) group (100A group). 5-ALA was administered by mixing the high fat diet for 8 weeks. Body weight increases in the 30A and 100A groups were significantly smaller compared with those of the C group. Body fat measurements by X-ray computed tomography indicated that the 100A group showed a tendency toward low visceral fat quantities during the final week of the study. Visceral fat weights in the 30A and 100A groups were slightly low. The levels of serum alanine aminotransferase (ALT) and total cholesterol (TC) in the 10A group was slightly low, whereas the 30A and 100A groups showed significantly lower ALT and TC values. Liver lipid concentration showed a dose-dependent decrease with ALA. Thus, in this diet-induced obese murine model, administration of 5-ALA had a significantly beneficial impact on the visceral fat, serum ALT and TC, and liver lipid concentration. PMID:26388673

  5. Regulation of the hemA gene during 5-aminolevulinic acid formation in Pseudomonas aeruginosa.

    PubMed Central

    Hungerer, C; Troup, B; Römling, U; Jahn, D

    1995-01-01

    The general tetrapyrrole precursor 5-aminolevulinic acid is formed in bacteria via two different biosynthetic pathways. Members of the alpha group of the proteobacteria use 5-aminolevulinic acid synthase for the condensation of succinyl-coenzyme A and glycine, while other bacteria utilize a two-step pathway from aminoacylated tRNA(Glu). The tRNA-dependent pathway, involving the enzymes glutamyl-tRNA reductase (encoded by hemA) and glutamate-1-semialdehyde-2,1-aminomutase (encoded by hemL), was demonstrated to be used by Pseudomonas aeruginosa, Pseudomonas putida, Pseudomonas stutzeri, Comamonas testosteroni, Azotobacter vinelandii, and Acinetobacter calcoaceticus. To study the regulation of the pathway, the glutamyl-tRNA reductase gene (hemA) from P. aeruginosa was cloned by complementation of an Escherichia coli hemA mutant. The hemA gene was mapped to the SpeI A fragment and the DpnIL fragment of the P. aeruginosa chromosome corresponding to min 24.1 to 26.8. The cloned hemA gene, coding for a protein of 423 amino acids with a calculated molecular mass of 46,234 Da, forms an operon with the gene for protein release factor 1 (prf1). This translational factor mediates the termination of the protein chain at the ribosome at amber and ochre codons. Since the cloned hemA gene did not possess one of the appropriate stop codons, an autoregulatory mechanism such as that postulated for the enterobacterial system was ruled out. Three open reading frames of unknown function transcribed in the opposite direction to the hemA gene were found. hemM/orf1 and orf2 were found to be homologous to open reading frames located in the 5' region of enterobacterial hemA genes. Utilization of both transcription start sites was changed in a P. aeruginosa mutant missing the oxygen regulator Anr (Fnr analog), indicating the involvement of the transcription factor in hemA expression. DNA sequences homologous to one half of an Anr binding site were detected at one of the determined

  6. Role of 5-aminolevulinic acid-conjugated gold nanoparticles for photodynamic therapy of cancer

    NASA Astrophysics Data System (ADS)

    Zhang, Zhenxi; Wang, Sijia; Xu, Hao; Wang, Bo; Yao, Cuiping

    2015-05-01

    There are three possible mechanisms for 5-aminolevulinic acid (5-ALA) conjugated gold nanoparticles (GNPs) through electrostatic bonding for photodynamic therapy (PDT) of cancer: GNPs delivery function, singlet oxygen generation (SOG) by GNPs irradiated by light, and surface resonance enhancement (SRE) of SOG. Figuring out the exact mechanism is important for further clinical treatment. 5-ALA-GNPs and human chronic myeloid leukemia K562 cells were used to study delivery function and SOG by GNPs. The SRE of SOG enabled by GNPs was explored by protoporphyrin IX (PpIX)-GNPs conjugate through electrostatic bonding. Cell experiments show that the GNPs can improve the efficiency of PDT, which is due to the vehicle effect of GNPs. PpIX-GNPs conjugate experiments demonstrated that SOG can be improved about 2.5 times over PpIX alone. The experiments and theoretical results show that the local field enhancement (LFE) via localized surface plasmon resonance (LSPR) of GNPs is the major role; the LFE was dependent on the irradiation wavelength and the GNP's size. The LFE increased with an increase of the GNP size (2R ≤50 nm). However, the LSPR function of the GNPs was not found in cell experiments. Our study shows that in 5-ALA-conjugated GNPs PDT, the delivery function of GNPs is the major role.

  7. Role of 5-aminolevulinic acid-conjugated gold nanoparticles for photodynamic therapy of cancer.

    PubMed

    Zhang, Zhenxi; Wang, Sijia; Xu, Hao; Wang, Bo; Yao, Cuiping

    2015-05-01

    There are three possible mechanisms for 5-aminolevulinic acid (5-ALA) conjugated gold nanoparticles (GNPs) through electrostatic bonding for photodynamic therapy (PDT) of cancer: GNPs delivery function,singlet oxygen generation (SOG) by GNPs irradiated by light, and surface resonance enhancement (SRE) of SOG. Figuring out the exact mechanism is important for further clinical treatment. 5-ALA-GNPs and human chronic myeloid leukemia K562 cells were used to study delivery function and SOG by GNPs. The SRE of SOG enabled by GNPs was explored by protoporphyrin IX (PpIX)-GNPs conjugate through electrostatic bonding.Cell experiments show that the GNPs can improve the efficiency of PDT, which is due to the vehicle effect of GNPs. PpIX–GNPs conjugate experiments demonstrated that SOG can be improved about 2.5 times over PpIX alone. The experiments and theoretical results show that the local field enhancement (LFE) via localized surface plasmon resonance (LSPR) of GNPs is the major role; the LFE was dependent on the irradiation wavelength and the GNP's size. The LFE increased with an increase of the GNP size (2R ≤ 50 nm). However, the LSPR function of the GNPs was not found in cell experiments. Our study shows that in 5-ALA-conjugated GNPs PDT, the delivery function of GNPs is the major role.

  8. Physicochemical characterisation of a novel thermogelling formulation for percutaneous penetration of 5-aminolevulinic acid.

    PubMed

    Grüning, Nadja; Müller-Goymann, Christel Charlotte

    2008-06-01

    The present contribution was dedicated to the development and characterisation of a semisolid formulation of 5-aminolevulinic acid (5-ALA), appropriate for the diagnosis and treatment of actinic keratosis in photodynamic therapy. To achieve sufficiently high concentrations of the polar substance within the living epithelium after topical application, the semisolid base was enriched with penetration enhancers. A semisolid liquid crystalline system for drug delivering was the formulation of choice. It was composed of isopropyl alcohol, dimethyl isosorbide, medium chain triglycerides, water, and Pluronic F 127 as a polyoxyethylene-polyoxypropylene surface-active block copolymer. Rheometrical investigations were performed in the oscillatory mode and showed a thermo reversible gelification behaviour of the formulation, which therefore was denoted Thermogel. Permeation studies through human stratum corneum revealed higher permeation coefficients for 5-ALA from the Thermogel than from different German Pharmacopoeia creams. For example a 7.5-fold increase in comparison with Basiscreme DAC, and a 19.5-fold increase compared to water containing hydrophilic ointment. With respect to Dolgit(R) Mikrogel, the permeation coefficient from the Thermogel was 6.4-fold higher. These results were in accordance with those of differential scanning calorimetry measurements. Thermogel disclosed the strongest interactions with stratum corneum lipids.

  9. Clinical utility of 5-aminolevulinic acid HCl to better visualize and more completely remove gliomas.

    PubMed

    Halani, Sameer H; Adamson, D Cory

    2016-01-01

    Surgical resection is typically the first line of treatment for gliomas. However, the neurosurgeon faces a major challenge in achieving maximal resection in high-grade gliomas as these infiltrative tumors make it difficult to discern tumor margins from normal brain with conventional white-light microscopy alone. To aid in resection of these infiltrative tumors, fluorescence-guided surgery has gained much popularity in intraoperative visualization of malignant gliomas, with 5-aminolevulinic acid (5-ALA) leading the way. First introduced in an article in Neurosurgery, 5-ALA has since become a safe, effective, and inexpensive method to visualize and improve resection of gliomas. This has undoubtedly led to improvements in the clinical course of patients as demonstrated by the increased overall and progression-free survival in patients with such devastating disease. This literature review aims to discuss the major studies and trials demonstrating the clinical utility of 5-ALA and its ability to aid in complete resection of malignant gliomas. PMID:27672334

  10. Clinical utility of 5-aminolevulinic acid HCl to better visualize and more completely remove gliomas

    PubMed Central

    Halani, Sameer H; Adamson, D Cory

    2016-01-01

    Surgical resection is typically the first line of treatment for gliomas. However, the neurosurgeon faces a major challenge in achieving maximal resection in high-grade gliomas as these infiltrative tumors make it difficult to discern tumor margins from normal brain with conventional white-light microscopy alone. To aid in resection of these infiltrative tumors, fluorescence-guided surgery has gained much popularity in intraoperative visualization of malignant gliomas, with 5-aminolevulinic acid (5-ALA) leading the way. First introduced in an article in Neurosurgery, 5-ALA has since become a safe, effective, and inexpensive method to visualize and improve resection of gliomas. This has undoubtedly led to improvements in the clinical course of patients as demonstrated by the increased overall and progression-free survival in patients with such devastating disease. This literature review aims to discuss the major studies and trials demonstrating the clinical utility of 5-ALA and its ability to aid in complete resection of malignant gliomas. PMID:27672334

  11. 5-aminolevulinic acid and neuronavigation in high-grade glioma surgery: results of a combined approach.

    PubMed

    Panciani, Pier Paolo; Fontanella, Marco; Garbossa, Diego; Agnoletti, Alessandro; Ducati, Alessandro; Lanotte, Michele

    2012-02-01

    In high-grade glioma surgery, several techniques are used to achieve the maximum cytoreductive treatment preserving neurological functions. However, the effectiveness of all the methods used alone is reduced by specific limitations of each. We assessed the reliability of a multimodal strategy based on 5-aminolevulinic acid (5-ALA) and neuronavigation. We prospectively studied 18 patients with suspected, non eloquent-area malignant gliomas amenable for complete resection. Conventional illumination was used until the excision appeared complete. The cavity was then systematically inspected in violet-blue light to identify any residual tumour. Multiple biopsies of both fluorescent and non-fluorescent tissue were performed in all cases. Each specimen was labelled according to the sampling location (inside or outside the boundary set by the neuronavigator). The samples were analysed by a neuropathologist blinded to the intraoperative classification. We reviewed the results of both methods, either singly or in combination. Individual analysis showed higher 5-ALA reliability compared to neuronavigation. However, several false-negative fluorescent specimens were detected. With the combined use of fluorescence and neuroimaging, only 1 sample (negative for both 5-ALA and navigation) was tumoral tissue. In our experience, the combined approach showed the best sensitivity and it is recommended in cases of lesions involving non-eloquent areas.

  12. Transcriptomic analysis for elucidating the physiological effects of 5-aminolevulinic acid accumulation on Corynebacterium glutamicum.

    PubMed

    Yu, Xiaoli; Jin, Haiying; Cheng, Xuelian; Wang, Qian; Qi, Qingsheng

    2016-11-01

    5-Aminolevulinic acid (ALA), the committed intermediate of the heme biosynthetic pathway, attracts close attention among researchers because of its potential applications to cancer treatment and agriculture. Overexpression of heterologous hemA and hemL, which encode glutamyl-tRNA reductase and glutamate-1-semialdehyde aminotransferase, respectively, in Corynebacterium glutamicum produces ALA, although whether ALA accumulation causes unintended effects on the host is unknown. Here we used an integrated systems approach to compare global transcriptional changes induced by the expression of hemA and hemL. Metabolic pathway such as glycolysis was inhibited, but tricarboxylic acid cycle, pentose phosphate pathway, and respiratory metabolism were stimulated. Moreover, the transcriptional levels of certain genes involved in heme biosynthesis were up-regulated, and the data implicate the two-component system (TCS) HrrSA was involved in the regulation of heme synthesis. With these understandings, it is proposed that ALA accumulation stimulates heme synthesis pathway and respiratory metabolism. Our study illuminates the physiological effects of overexpressing hemA and hemL on the phenotype of C. glutamicum and contributes important insights into the regulatory mechanisms of the heme biosynthetic pathways. PMID:27664748

  13. Alternative Routes for the Synthesis of 5-Aminolevulinic Acid in Maize Leaves 1

    PubMed Central

    Harel, Eitan; Ne'Eman, Emma

    1983-01-01

    Intact plastids from greening maize (Zea mays L.) leaves converted [14C]glutamate and [14C]2-ketoglutarate (KG) to [14C]5-aminolevulinic acid (ALA). Glutamate appeared to be the immediate precursor of ALA, while KG was first converted to glutamate, as shown by the effect of various inhibitors of amino acid metabolism. Plastids from greening leaves contained markedly higher activity as compared with etioplasts or chloroplasts. The synthesis of ALA by intact plastids was light dependent. The enzyme system resides in the stroma of plastids or may be lightly bound to membranes. The solubilized system showed maximal activity around pH 7.9 and required Mg2+, ATP, and NADPH although dependence on the latter was not clear-cut. A relatively high level of activity could be extracted from etioplasts. Maximal activity was obtained from plastids of leaves which had been illuminated for 90 minutes, after which activity declined sharply. The enzyme system solubilized from plastids also catalyzed the conversion of putative glutamate 1-semialdehyde to ALA in a reaction which was not dependent on the addition of an amino donor. The system in maize greatly resembled the one which had been reported from barley. It is suggested that this system is the one responsible for the biosynthesis of ALA destined for chlorophyll formation. PMID:16663121

  14. Rational design of 5-aminolevulinic acid derivatives aimed at improving photodynamic therapy.

    PubMed

    Casas, Adriana; Batlle, Alcira

    2002-07-01

    5-aminolevulinic acid (ALA) is the first intermediate in heme biosynthesis and is therefore a precursor of protoporphyrin IX (PpIX). PpIX is used as an endogenous photosensitizer in photodynamic therapy (PDT). Several chemical modifications have been made, both on the amino and carboxyl groups of ALA to induce higher PpIX production and photosensitisation. Esterification of ALA with aliphatic lineal and cyclic alcohols was found to reduce the amount of ALA required for photosensitization. Esterification by aliphatic alcohols with carbohydrate chains equal or lower than C4 leads to porphyrin accumulation lower than ALA, whereas equal or longer than C6 chains leads to greater synthesis of porphyrin. A branch point in the alcohol located next to the site of ester cleavage limits access of the esters to the esterase active site, resulting in lower PpIX production. ALA esters of the polyethylenglycol family can induce high levels of PpIX, with some selectivity for endothelial cells toward tumor cells. On the basis of the differential expression of some aminopeptidases in tumor vasculature when compared to normal vasculature, some ALA-pseudopeptides were synthesized. In a rational design of ALA derivatives, the transport mechanism of these aminoacids into the cell is central. Due to the similar characteristics between ALA and GABA transport, a novel approach for designing new ALA derivatives which could penetrate more easily into tumoral cells, would be to take into account the structures of the inhibitors of GABA transport. PMID:12678731

  15. Comparison of 5-aminolevulinic acid-encapsulated liposome versus ethosome for skin delivery for photodynamic therapy.

    PubMed

    Fang, Yi-Ping; Tsai, Yi-Hung; Wu, Pao-Chu; Huang, Yaw-Bin

    2008-05-22

    Topical photodynamic therapy (PDT) with 5-aminolevulinic acid (ALA) is an alternative therapy for many non-melanoma skin cancers. The major limitation of this therapy, however, is the low permeability of ALA through the stratum corneum (SC) of the skin. The objective of the present work was to characterize ethosomes containing ALA and to enhance the skin production of protoporphyrin IX (PpIX), compared to traditional liposomes. Results showed that the average particle sizes of the ethosomes were less than those of liposomes. Moreover, the entrapment efficiency of ALA in the ethosome formulations was 8-66% depending on the surfactant added. The particle size of the ethosomes was still approximately <200 nm after 32 days of storage. An in vivo animal study observed the presence of PpIX in the skin by confocal laser scanning microscopy (CLSM). The results indicated that the penetration ability of ethosomes was greater than that of liposomes. The enhancements of all the formulations were ranging from 11- to 15-fold in contrast to that of control (ALA in an aqueous solution) in terms of PpIX intensity. In addition, colorimetry detected no erythema in the irradiated skin. The results demonstrated that the enhancement ratio of ethosome formulations did not significantly differ between the non-irradiated and irradiated groups except for PE/CH/SS, which may have been due to a photobleaching effect of the PDT-irradiation process. PMID:18325699

  16. Optimization of the heme biosynthesis pathway for the production of 5-aminolevulinic acid in Escherichia coli

    PubMed Central

    Zhang, Junli; Kang, Zhen; Chen, Jian; Du, Guocheng

    2015-01-01

    5-Aminolevulinic acid (ALA), the committed intermediate of the heme biosynthesis pathway, shows significant promise for cancer treatment. Here, we identified that in addition to hemA and hemL, hemB, hemD, hemF, hemG and hemH are also the major regulatory targets of the heme biosynthesis pathway. Interestingly, up-regulation of hemD and hemF benefited ALA accumulation whereas overexpression of hemB, hemG and hemH diminished ALA accumulation. Accordingly, by combinatorial overexpression of the hemA, hemL, hemD and hemF with different copy-number plasmids, the titer of ALA was improved to 3.25 g l−1. Furthermore, in combination with transcriptional and enzymatic analysis, we demonstrated that ALA dehydratase (HemB) encoded by hemB is feedback inhibited by the downstream intermediate protoporphyrinogen IX. This work has great potential to be scaled-up for microbial production of ALA and provides new important insights into the regulatory mechanism of the heme biosynthesis pathway. PMID:25716896

  17. Hydrokolloid occlusive dressings for photodynamic therapy (PDT) of cutaneous lesions with endogenous porphyrins induced by 5-aminolevulinic acid

    NASA Astrophysics Data System (ADS)

    Gahlen, Johannes; Stern, Josef; Herfarth, Christian

    1995-03-01

    Protoporphyrin (Pp IX) is the final intermediate product before haem and can be stimulated to a phototoxic reaction with light. The presence of 5-aminolevulinic acid can increase the intracellular biosynthesis of Pp IX in certain types of tumor cells. The photosensitizing concentrations of Pp IX make laser light induced fluorescence diagnostics (LIFD) and photodynamic therapy possible. A topical application of a 5-aminolevulinic acid solution requires a waterproof occlusive dressing for several hours. We developed a simple technique for a practical preparation for PDT using a hydrocolloid dressing. The normal surrounding skin can be spared. We present our first therapeutic experience with a case of cutaneous breast cancer in a 65-year-old female patient. Six hours after topical application of 10% isotonic 5- aminolevulinic acid under the hydrocolloid dressing PDT was performed (Ar-Dye Laser, 630 nm wavelength). Twenty four hours after PDT a superficial tumor necrosis could be observed with a maximum depth of tumor necrosis of 2 - 3 mm. The surrounding normal skin was without any inflammation.

  18. Comparative Study of Photodynamic Therapy with Topical Methyl Aminolevulinate versus 5-Aminolevulinic Acid for Facial Actinic Keratosis with Long-Term Follow-Up

    PubMed Central

    Ko, Dong-Yeob; Kim, Ki-Ho

    2014-01-01

    Background Few studies have compared the efficacy, cosmetic outcomes, and adverse events between 5-aminolevulinic acid photodynamic therapy (ALA-PDT) and methyl aminolevulinate-PDT (MAL-PDT) for actinic keratoses (AKs) in Asian ethnic populations with dark-skin. Objective We retrospectively compared the long-term efficacy, recurrence rates, cosmetic outcomes, and safety of ALA-PDT versus MAL-PDT for facial AKs in Koreans. Methods A total of 222 facial AKs in 58 patients were included in this study. A total of 153 lesions (29 patients) were treated with 5-ALA, and 69 lesions (29 patients) with MAL. ALA and MAL creams were applied for 6 hours and 3 hours, respectively; the lesions were then illuminated with a halogen lamp at 150 J/cm2 for ALA-PDT and a diode lamp at 37 J/cm2 for MAL-PDT. Results The complete response rates of ALA-PDT and MAL-PDT were 56.9% and 50.7%, respectively, with no significant difference at 12 months after treatment. No significant difference in recurrence rates was observed between the 2 PDT modalities at either 6 or 12 months after treatment. There was no significant difference in the cosmetic outcomes between the 2 treatment modalities at 12 months after PDT. However, ALA-PDT caused significantly more painful than MAL-PDT (p=0.005). The adverse events were mild to moderate, transient, and self-limiting for both modalities. Conclusion MAL-PDT was similar to ALA-PDT in terms of long-term efficacy, recurrence rates, cosmetic outcomes, and adverse events; however, it was a significantly less painful procedure than ALA-PDT in our study. PMID:24966631

  19. Photodynamic therapy of urethral condylomata acuminata using topically 5-aminolevulinic acid

    NASA Astrophysics Data System (ADS)

    Wang, Xiuli; Wang, Hongwei; Wang, Haishan; Xu, Shizheng; Liao, Kanghuang; Hillemanns, Peter

    2005-07-01

    Background Electrocoagulation and laser evaporation for urethral condylomata acuminata have high recurrence rates and can be associated with urethral malformations. Objective To investigate the effect of photodynamic therapy (PDT) with topical 5-aminolevulinic acid (ALA) on urethral condylomata acuminata and to examine the histological changes in lesions of condylomata acuminata after ALA-PDT. Methods One hundred and sixty-four urethral condylomata patients were given topical ALA followed by intraurethral PDT through a cylindrical fiber. Among the cases, 16 penile and vulval condylomatous lesions in 11 patients were treated with topical ALA-PDT at same time. After the treatment, biopsy specimens were collected from the 16 penile and vulval lesions. The histological changes were then evaluated by light microscope and electron microscope. Results The complete response rate for urethral condylomata by topical ALA-PDT was 95.12% and the recurrence rate was 5.13% after 6 to 24 months follow-up. Keratinocytes in middle and upper layers of the epidermis with marked vacuolation and some necrocytosis were detected one and three hours after PDT. Necrosis in all layers of the epidermis was noted five hours after PDT by microscopy. In electron microscopy of kerationcytes, distinct ultrastructural abnormalities of mitochondrion, endoplasmic reticulum and membrane damage were observed. Apoptotic bodies were detected three hours after PDT and a large number of the keratinocytes exhibited necrosis five hours after PDT by electron microscope. Conclusions Results suggests that topical ALA-PDT is a simple, effective, relatively safe, less recurrent and comparatively well tolerated treatment for urethral condylomata acuminata. The mechanisms might be that ALA-PDT could trigger apoptotic process and necrosis in the HPV infected keratinocytes. Key words:

  20. Blood interference in fiber-optical based fluorescence guided resection of glioma using 5-aminolevulinic acid

    NASA Astrophysics Data System (ADS)

    Haj-Hosseini, Neda; Lowndes, Shannely; Salerud, Göran; Wårdell, Karin

    2011-03-01

    Fluorescence guidance in brain tumor resection is performed intra-operatively where bleeding is included. When using fiber-optical probes, the transmission of light to and from the tissue is totally or partially blocked if a small amount of blood appears in front of the probe. Sometimes even after rinsing with saline, the remnant blood cells on the optical probe head, disturb the measurements. In such a case, the corresponding spectrum cannot be reliably quantified and is therefore discarded. The optimal case would be to calculate and take out the blood effect systematically from the collected signals. However, the first step is to study the pattern of blood interference in the fluorescence spectrum. In this study, a fiber-optical based fluorescence spectroscopy system with a laser excitation light of 405 nm (1.4 J/cm2) was used during fluorescence guided brain tumor resection using 5-aminolevulinic acid (5-ALA). The blood interference pattern in the fluorescence spectrum collected from the brain was studied in two patients. The operation situation was modeled in the laboratory by placing blood drops from the finger tip on the skin of forearm and the data was compared to the brain in vivo measurements. Additionally, a theoretical model was developed to simulate the blood interference pattern on the skin autofluorescence. The blood affects the collected fluorescence intensity and leaves traces of oxy and deoxy-hemoglobin absorption peaks. According to the developed theoretical model, the autofluorescence signal is considered to be totally blocked by an approximately 500 μm thick blood layer.

  1. Alleviation of salt-induced oxidative damage by 5-aminolevulinic acid in wheat seedlings

    NASA Astrophysics Data System (ADS)

    Genişel, Mucip; Erdal, Serkan

    2016-04-01

    The aim of this study was to elucidate how 5-aminolevulinic acid (ALA), the precursor of chlorophyll compounds, affects the defence mechanisms of wheat seedlings induced by salt stress. To determine the possible stimulative effects of ALA against salinity, 11-day old wheat seedlings were sprayed with ALA at two different concentrations (10 and 20 mg.l-1) and then stressed by exposure to salt (150 mM NaCl). The salt stress led to significant changes in the antioxidant activity. While guaiacol peroxidase activity decreased, the activities of superoxide dismutase, catalase, and ascorbate peroxidase markedly increased under salt stress. Compared to the salt stress alone, the application of ALA beforehand further increased the activity of these enzymes. This study is the first time the effects of ALA have been monitored with regard to protein content and the isoenzyme profiles of the antioxidant enzymes. Although the salt stress reduced both the soluble protein content and protein band intensities, pre-treating with ALA significantly mitigated these stress-induced reductions. The data for the isoenzyme profiles of the antioxidant enzymes paralleled that of the ALA-induced increases in antioxidant activity. As a consequence of the high antioxidant activity in the seedlings pre-treated with ALA, the stress-induced elevations in the reactive oxygen species, superoxide anion, and hydrogen peroxide contents and lipid peroxidation levels were markedly diminished. Taken together, this data demonstrated that pre-treating with ALA confers resistance to salt stress by modulating the protein synthesis and antioxidant activity in wheat seedlings.

  2. [Effect of 5-aminolevulinic acid on photosynthetic characteristics of tomato seedlings under NaCl stress].

    PubMed

    Zhao, Yan-Yan; Yan, Fei; Hu, Li-Pan; Zhou, Xiao-Ting; Zou, Zhi-Rong

    2014-10-01

    In this research, the possibility of exogenous application of 5-aminolevulinic acid (ALA) on photosynthetic characteristics of tomato seedlings under NaCl stress was investigated. Five leaves seedlings of tomato (Solanum lycopersicum cv. Jinpeng No. 1) were used as starting materials, applied with 50 mg · L(-1) ALA by foliage spray or 10 mg · L(-1) ALA by root soaking to study the changes in their photosynthesis and fluorescence parameters under 100 mmol · L(-1) NaCl. The result showed that, photosynthetic gas exchange parameters (net photosynthetic rate P,, stomata conductance g(s), intercellular CO2 concentration Ci, transpiration Tr) and chlorophyll fluorescence parameters (Fv'/Fm', Fm', ΦPS II, ETR, qP, Pc) were severely reduced under NaCl treatment and ALA application by foliage spray or root soaking with proper concentrations exerted positive influences on tomato seedlings under salt stress, while there were some differences between foliage spray and root soaking in the influence on chlorophyll content, photosynthesis and chlorophyll fluorescence. Both foliage spray with 50 mg · L(-1) ALA and root soaking with 10 mg L(-1) ALA significantly increased Pn, Ci, g(s) and Tr of tomato seedlings under NaCl stress, alleviated photosynthetic inhibition. Root application of ALA had a better effect on the chlorophyll content than foliage application. However, the photosynthetic parameters showed that foliage application of ALA had a better effect than root application, and both treatments had no difference in the influence on chlorophyll fluorescence parameters of tomato seedlings. It could be deduced that the regulating effect of ALA on enhancing salt tolerance of tomato seedlings is attributed to its effect on improving chlorophyll biosynthesis and metabolism, increasing stomatal conductance and reducing stomatal limitation, thus, enhancing the photosynthetic capacity and PS II photochemical efficiency of tomato leaves under NaCl stress. PMID:25796901

  3. [Effect of 5-aminolevulinic acid on photosynthetic characteristics of tomato seedlings under NaCl stress].

    PubMed

    Zhao, Yan-Yan; Yan, Fei; Hu, Li-Pan; Zhou, Xiao-Ting; Zou, Zhi-Rong

    2014-10-01

    In this research, the possibility of exogenous application of 5-aminolevulinic acid (ALA) on photosynthetic characteristics of tomato seedlings under NaCl stress was investigated. Five leaves seedlings of tomato (Solanum lycopersicum cv. Jinpeng No. 1) were used as starting materials, applied with 50 mg · L(-1) ALA by foliage spray or 10 mg · L(-1) ALA by root soaking to study the changes in their photosynthesis and fluorescence parameters under 100 mmol · L(-1) NaCl. The result showed that, photosynthetic gas exchange parameters (net photosynthetic rate P,, stomata conductance g(s), intercellular CO2 concentration Ci, transpiration Tr) and chlorophyll fluorescence parameters (Fv'/Fm', Fm', ΦPS II, ETR, qP, Pc) were severely reduced under NaCl treatment and ALA application by foliage spray or root soaking with proper concentrations exerted positive influences on tomato seedlings under salt stress, while there were some differences between foliage spray and root soaking in the influence on chlorophyll content, photosynthesis and chlorophyll fluorescence. Both foliage spray with 50 mg · L(-1) ALA and root soaking with 10 mg L(-1) ALA significantly increased Pn, Ci, g(s) and Tr of tomato seedlings under NaCl stress, alleviated photosynthetic inhibition. Root application of ALA had a better effect on the chlorophyll content than foliage application. However, the photosynthetic parameters showed that foliage application of ALA had a better effect than root application, and both treatments had no difference in the influence on chlorophyll fluorescence parameters of tomato seedlings. It could be deduced that the regulating effect of ALA on enhancing salt tolerance of tomato seedlings is attributed to its effect on improving chlorophyll biosynthesis and metabolism, increasing stomatal conductance and reducing stomatal limitation, thus, enhancing the photosynthetic capacity and PS II photochemical efficiency of tomato leaves under NaCl stress.

  4. In-office Painless Aminolevulinic Acid Photodynamic Therapy

    PubMed Central

    2016-01-01

    Objective: To evaluate the efficacy, safety, and pain of in-office “painless” aminolevulinic acid photodynamic therapy aimed at decreasing treatment-associated pain in patients undergoing removal of actinic keratoses. Design: Prospective split-face study comparing short aminolevulinic acid incubation times of 15 minutes followed by extended exposure (60 minutes) of continuous blue light versus conventional aminolevulinic acid photodynamic therapy. Prospective assessment of pain in patients undergoing in-office “painless” aminolevulinic acid photodynamic therapy. Setting: Clinical practice office. Participants: Three patients with actinic keratoses participated in the split-face study and 101 in the pain assessment study. Measurements: Evaluations in the split-face study included removal of actinic keratoses, skin temperature, and pain measured on a 10-point visual analog scale. Pain was assessed using the visual analog scale in the pain assessment study. Results: In the split-face study, in-office “painless” aminolevulinic acid photodynamic therapy resulted in a 52-percent reduction in lesions versus 44 percent for conventional aminolevulinic acid photodynamic therapy. Maximum pain scores of in-office “painless” aminolevulinic acid photodynamic therapy were all 0 at each time point, and the average score for conventional aminolevulinic acid photodynamic therapy was 7. Baseline skin temperatures increased from a baseline of 29 to 32°C to 34 to 35°C by minute 10 of blue light activation on both sides of the face. Results from the pain assessment study indicated no or minimal (scores 0-2) pain in nearly all patients who received in-office “painless” aminolevulinic acid photodynamic therapy as monotherapy or in combination with 5-fluoruacil or imiquimod used as pretreatments. Conclusions: In-office “painless” aminolevulinic acid photodynamic therapy appears to be effective for removing actinic keratoses and is associated with little or no pain

  5. Aminolevulinic Acid Topical

    MedlinePlus

    ... under the skin that result from exposure to sunlight and can develop into skin cancer) of the ... acid will make your skin very sensitive to sunlight (likely to get sunburn). Avoid exposure of treated ...

  6. Quantification of topically delivered 5-aminolevulinic acid by lontophoresis across ex vivo human stratum corneum.

    PubMed

    Boddé, Harry E; Roemelé, Peter E H; Star, Willem M

    2002-04-01

    Iontophoretic transport of the prodrug 5-aminolevulinic acid (ALA), which is used for photodynamic therapy (PDT), across human stratum corneum (SC) was studied quantitatively in vitro. The experiments were carried out in a three-compartment iontophoresis cell consisting of two electrode chambers equipped with Ag-AgCl electrodes, each separated from a central acceptor chamber by a sheet of SC, supported by a dialysis membrane, to mimic the side-by-side configuration normally used in vivo. Acceptor fluid samples were collected every hour for a period of 30 h in a fraction collector and analyzed by high-performance liquid chromatography-fluorometry after derivatization of the ALA. The iontophoretic ALA flux was studied as a function of the applied current density and the ALA concentration in the donor solution (1, 2.5 or 10% ALA). Depending on the ALA concentration in the donor cell, iontophoresis enhances the flux from close to the detection limit of 0.23 nmol cm(-2) h(-1) at zero current density (passive diffusion) to several hundred or thousand nanomoles per square centimeter per hour at current densities ranging from 100 to 1000 microA cm(-2). For example, interpolating our data we find that with an ALA concentration of 2% in the donor chamber, a current density of 0.255 mA cm(-2) transports 0.065 micromol cm(-2) ALA across the SC in 10 min (conditions of Rhodes et al. (1997), J. Invest. Dermatol. 108, 87-91). For passive diffusion we find that a 5 h topical application of 20% ALA results in the transport of 0.05 micromol cm(-2). Thus, the amount of ALA that passively diffuses through the SC in several hours, leading to therapeutic levels of protoporphyrin IX (PpIX) in the epidermis, can be delivered by iontophoresis in 10 min or less. However, because the formation of sufficient PpIX also requires several hours and also because the SC overlying skin lesions such as basal cell carcinoma (BCC) is not intact, the clinical benefit of topical ALA delivery by

  7. Risk factors for developing oral 5-aminolevulinic acid-induced side effects in patients undergoing fluorescence guided resection.

    PubMed

    Chung, Ivan Wong Hin; Eljamel, Sam

    2013-12-01

    Oral 5 aminolevulinic acid (5-ALA) is used to assist surgical resection of malignant tumours in the brain and other locations. Hypotension and alteration of liver functions have been reported as potential adverse effects. This study was designed to assess the incidence and contributing factors that cause 5-ALA induced side effects in a cohort of 90 patients. Hypotension occurred in 11% of patients irrespective of 5-ALA dose. The only contributing factor was the presence of cardiovascular disease and antihypertensive drug therapy with an odd ratio of 17.7. Liver function were disturbed in 2% in patients who received 20mg or less/kg body weight compared to 4% in those who received a dose of >20mg/kg 5-ALA. The liver dysfunction was minor and was not clinically significant. We concluded that 5-ALA induced side effects were minimal and hypotension more likely to occur in patients receiving antihypertensive drug therapy.

  8. Photodynamic therapy using systemic administration of 5-aminolevulinic acid and a 410-nm wavelength light-emitting diode for methicillin-resistant Staphylococcus aureus-infected ulcers in mice.

    PubMed

    Morimoto, Kuniyuki; Ozawa, Toshiyuki; Awazu, Kunio; Ito, Nobuhisa; Honda, Norihiro; Matsumoto, Sohkichi; Tsuruta, Daisuke

    2014-01-01

    Bacterial resistance to antibiotics has become a worldwide problem. One potential alternative for bacterial control is photodynamic therapy. 5-aminolevulinic acid is a natural precursor of the photosensitizer protoporphyrin IX. Relatively little is known about the antibacterial efficacy of photodynamic therapy using the systemic administration of 5-aminolevulinic acid; a few reports have shown that 5-aminolevulinic acid exerts photodynamic effects on methicillin-resistant Staphylococcus aureus (MRSA) in vitro. In this study, we evaluated the effectiveness of photodynamic therapy using 5-aminolevulinic acid and a 410-nm wavelength light-emitting diode in vitro and in vivo for the treatment of MRSA. We found that 5-aminolevulinic acid photodynamic therapy with the light-emitting diode had an in-vitro bactericidal effect on MRSA. In vivo, protoporphyrin IX successfully accumulated in MRSA on ulcer surfaces after intraperitoneal administration of 5-aminolevulinic acid to mice. Furthermore, 5-aminolevulinic acid photodynamic therapy accelerated wound healing and decreased bacterial counts on ulcer surfaces; in contrast, vancomycin treatment did not accelerate wound healing. Our findings indicate that 5-aminolevulinic acid photodynamic therapy may be a new treatment option for MRSA-infected wounds.

  9. Photodynamic Therapy Using Systemic Administration of 5-Aminolevulinic Acid and a 410-nm Wavelength Light-Emitting Diode for Methicillin-Resistant Staphylococcus aureus-Infected Ulcers in Mice

    PubMed Central

    Morimoto, Kuniyuki; Ozawa, Toshiyuki; Awazu, Kunio; Ito, Nobuhisa; Honda, Norihiro; Matsumoto, Sohkichi; Tsuruta, Daisuke

    2014-01-01

    Bacterial resistance to antibiotics has become a worldwide problem. One potential alternative for bacterial control is photodynamic therapy. 5-aminolevulinic acid is a natural precursor of the photosensitizer protoporphyrin IX. Relatively little is known about the antibacterial efficacy of photodynamic therapy using the systemic administration of 5-aminolevulinic acid; a few reports have shown that 5-aminolevulinic acid exerts photodynamic effects on methicillin-resistant Staphylococcus aureus (MRSA) in vitro. In this study, we evaluated the effectiveness of photodynamic therapy using 5-aminolevulinic acid and a 410-nm wavelength light-emitting diode in vitro and in vivo for the treatment of MRSA. We found that 5-aminolevulinic acid photodynamic therapy with the light-emitting diode had an in-vitro bactericidal effect on MRSA. In vivo, protoporphyrin IX successfully accumulated in MRSA on ulcer surfaces after intraperitoneal administration of 5-aminolevulinic acid to mice. Furthermore, 5-aminolevulinic acid photodynamic therapy accelerated wound healing and decreased bacterial counts on ulcer surfaces; in contrast, vancomycin treatment did not accelerate wound healing. Our findings indicate that 5-aminolevulinic acid photodynamic therapy may be a new treatment option for MRSA-infected wounds. PMID:25140800

  10. Optimization of Influencing Factors on Biomass Accumulation and 5-Aminolevulinic Acid (ALA) Yield in Rhodobacter sphaeroides Wastewater Treatment.

    PubMed

    Liu, Shuli; Li, Xiangkun; Zhang, Guangming; Zhang, Jie

    2015-11-01

    This study aimed to optimize four factors affecting biomass accumulation and 5-aminolevulinic acid (ALA) yield together with pollutants removal in Rhodobacter sphaeroides wastewater treatment. Results showed that it was feasible to produce biomass and ALA in R. sphaeroides wastewater treatment. Microaerobic, 1,000-3,000 lux, and pH 7.0 were optimal conditions for the highest ALA yield of 4.5 ± 0.5 mg/g-biomass. Under these conditions, COD removal and biomass production rate were 93.3 ± 0.9% and 31.8 ± 0.5 mg/l/h, respectively. In addition, trace elements Fe(2+), Mg(2+), Ni(2+), and Zn(2+) further improved the ALA yield, COD removal, and biomass production rate. Specifically, the highest ALA yield (12.5 ± 0.6 mg/g-biomass) was achieved with Fe(2+) addition.

  11. The heme precursor 5-aminolevulinic acid disrupts the Warburg effect in tumor cells and induces caspase-dependent apoptosis.

    PubMed

    Sugiyama, Yuta; Hagiya, Yuichiro; Nakajima, Motowo; Ishizuka, Masahiro; Tanaka, Tohru; Ogura, Shun-Ichiro

    2014-03-01

    Our previous study demonstrated that 5-aminolevulinic acid (ALA) administered to mice stimulates oxidative phosphorylation by upregulation of the mitochondrial respiratory chain complex IV enzyme cytochrome c oxidase (COX). The present study investigated whether ALA disrupts the Warburg effect, which represents a shift in ATP generation from oxidative phosphorylation to glycolysis, protecting tumor cells against oxidative stress-mediated apoptosis. The human lung carcinoma cell line A549 exposed to ALA exhibited enhanced oxidative phosphorylation, which was indicated by an increase in COX protein expression and oxygen consumption. Furthermore, ALA suppressed glycolysis-mediated acidosis. This normalization of the ATP metabolic pathways significantly increased the generation of superoxide anion radical (O2•-) and the functional expression of active caspase-3, leading to caspase-dependent apoptosis. These data demonstrate that ALA inhibits the Warburg effect and induces cancer cell death. Use of this endogenous compound might constitute a novel approach to cancer therapy. PMID:24366173

  12. Optimization of Biomass and 5-Aminolevulinic Acid Production by Rhodobacter sphaeroides ATCC17023 via Response Surface Methodology.

    PubMed

    Liu, Shuli; Zhang, Guangming; Li, Jianzheng; Li, Xiangkun; Zhang, Jie

    2016-06-01

    Microbial 5-aminolevulinic acid (ALA) produced from wastewater is considered as potential renewable energy. However, many hurdles are needed to be overcome such as the regulation of key influencing factors on ALA yield. Biomass and ALA production by Rhodobacter sphaeroides was optimized using response surface methodology. The culturing medium was artificial volatile fatty acids wastewater. Three additives were optimized, namely succinate and glycine that are precursors of ALA biosynthesis, and D-glucose that is an inhibitor of ALA dehydratase. The optimal conditions were achieved by analyzing the response surface plots. Statistical analysis showed that succinate at 8.56 mmol/L, glycine at 5.06 mmol/L, and D-glucose at 7.82 mmol/L were the best conditions. Under these optimal conditions, the highest biomass production and ALA yield of 3.55 g/L and 5.49 mg/g-biomass were achieved. Subsequent verification experiments at optimal values had the maximum biomass production of 3.41 ± 0.002 g/L and ALA yield of 5.78 ± 0.08 mg/g-biomass. PMID:26875086

  13. Effect of 5-aminolevulinic acid on erythropoiesis: A preclinical in vitro characterization for the treatment of congenital sideroblastic anemia

    SciTech Connect

    Fujiwara, Tohru; Takahashi, Kiwamu; Okitsu, Yoko; Fukuhara, Noriko; Onishi, Yasushi; Ishizawa, Kenichi; Ichinohasama, Ryo; Nakamura, Yukio; Nakajima, Motowo; Tanaka, Tohru; Harigae, Hideo

    2014-11-07

    Highlights: • Treatment with ALA induces erythroid differentiation of K562 cells. • Transportation of ALA into erythroid cells occurs predominantly via SLC36A1. • ALA restores defects in ALAS2 in human iPS cell-derived erythroblasts. • ALA may represent a novel therapeutic option for CSA caused by ALAS2 mutations. - Abstract: Congenital sideroblastic anemia (CSA) is a hereditary disorder characterized by microcytic anemia and bone marrow sideroblasts. The most common form of CSA is attributed to mutations in the X-linked gene 5-aminolevulinic acid synthase 2 (ALAS2). ALAS2 is a mitochondrial enzyme, which utilizes glycine and succinyl-CoA to form 5-aminolevulinic acid (ALA), a crucial precursor in heme synthesis. Therefore, ALA supplementation could be an effective therapeutic strategy to restore heme synthesis in CSA caused by ALAS2 defects. In a preclinical study, we examined the effects of ALA in human erythroid cells, including K562 cells and human induced pluripotent stem cell-derived erythroid progenitor (HiDEP) cells. ALA treatment resulted in significant dose-dependent accumulation of heme in the K562 cell line. Concomitantly, the treatment substantially induced erythroid differentiation as assessed using benzidine staining. Quantitative reverse transcription polymerase chain reaction (RT-PCR) analysis confirmed significant upregulation of heme-regulated genes, such as the globin genes [hemoglobin alpha (HBA) and hemoglobin gamma (HBG)] and the heme oxygenase 1 (HMOX1) gene, in K562 cells. Next, to investigate the mechanism by which ALA is transported into erythroid cells, quantitative RT-PCR analysis was performed on previously identified ALA transporters, including solute carrier family 15 (oligopeptide transporter), member (SLC15A) 1, SLC15A2, solute carrier family 36 (proton/amino acid symporter), member (SLC36A1), and solute carrier family 6 (neurotransmitter transporter), member 13 (SLC6A13). Our analysis revealed that SLC36A1 was abundantly

  14. Improvement of systemic 5-aminolevulinic acid-based photodynamic therapy in vivo using light fractionation with a 75-minute interval.

    PubMed

    de Bruijn, H S; van der Veen, N; Robinson, D J; Star, W M

    1999-02-15

    We have studied different single and fractionated illumination schemes after systemic administration of 5-aminolevulinic acid (ALA) to Improve the response of nodular tumors to ALA-mediated photodynamic therapy. Tumors transplanted on the thigh of female WAG/Rij rats were transdermally illuminated with red light (633 nm) after systemic ALA administration (200 mg/kg). The effectiveness of each treatment scheme was determined from the tumor volume doubling time. A single illumination (100 J/cm2 at 100 mW/cm2, 2.5 h after ALA administration) yielded a doubling time of 6.6+/-1.2 days. This was significantly different from the untreated control (doubling time, 1.7+/-0.1 days). The only treatment scheme that yielded a significant improvement compared to all other schemes studied was illumination at both 1 and 2.5 h after ALA administration (both 100 J/cm2 at 100 mW/cm2) and resulted in a tumor volume doubling time of 18.9+/-2.9 days. A possible mechanism to explain this phenomenon is that the protoporphyrin IX formed after administration of ALA is photodegraded by the first illumination. In the 75-min interval, new porphyrin is formed enhancing the effect of the second illumination. PMID:10029082

  15. Prospective study of topical 5-aminolevulinic acid photodynamic therapy for the treatment of severe adolescent acne in Chinese patients.

    PubMed

    Ma, Ying; Liu, Ye; Wang, Qianqian; Ren, Jie; Xiang, Leihong

    2015-05-01

    Acne vulgaris is one of the most common skin diseases in adolescents. In the present study, we aimed to evaluate the effectiveness and safety of topical 5-aminolevulinic acid (ALA)-mediated photodynamic therapy (PDT) for the treatment of severe acne in Chinese adolescent patients. Twenty-one Chinese adolescent patients aged 12-18 years with Pillsbury III-IV severe facial acne were treated with three courses of ALA-PDT. A 5% ALA lotion was applied topically for 60 min followed by irradiation with light-emitting diode light at 633 nm with a light intensity of 75-80 mW/cm(2) and a light dose of 90-96 J/cm(2) . Clinical assessment was conducted before and after each treatment, and at each follow-up session. The total effective rates were 85.71%, 90.48%, and 95.23% after the three PDT sessions, and at the 4- and 8-week follow ups, respectively. ALA-PDT is an effective treatment for severe adolescent acne vulgaris, and is associated with mild and reversible side-effects.

  16. Needle-free injection of 5-aminolevulinic acid in photodynamic therapy for the treatment of condylomata acuminata

    PubMed Central

    LI, XIULI; WANG, XIUXIU; GU, JUNYING; MA, YUE’E; LIU, ZHIYU; SHI, YULING

    2013-01-01

    The external application of 5-aminolevulinic acid (ALA) in photodynamic therapy (PDT) results in a shallow penetration depth in thick or extensive condylomata acuminata (CA) lesions, thus demonstrating a poor therapeutic effect for those patients. To compare the efficacy of needle-free injection with external application of ALA in PDT for the treatment of CA, 160 CA patients with thick or extensive warts received ALA-PDT by means of external application or needle-free injection of ALA, respectively. The complete response (CR) rate and recurrence rate in the two groups were analyzed. The CR rate after the first treatment in the needle-free injection group (68.8%) was significantly higher compared with that in the external application group (52.5%; P=0.035). The recurrence rates in the needle-free injection group and external application group were 4.1 and 15.4%, respectively (P=0.022). The needle-free injection of ALA increases the therapeutic effect of PDT for CA patients with thick or extensive lesions. It shortens the treatment time and reduces the recurrence rate, and has great potential in the treatment of CA. PMID:23935753

  17. Cystic acne improved by photodynamic therapy with short-contact 5-aminolevulinic acid and sequential combination of intense pulsed light and blue light activation.

    PubMed

    Melnick, Stuart

    2005-01-01

    Photodynamic therapy with short-contact 5-aminolevulinic acid (Levulan Kerastick, Dusa Pharmaceuticals, Inc.) and activation by intense pulsed light in an initial treatment and blue light in 3 subsequent treatments has resulted in significant improvement in severity of acne, reduction in the number of lesions, improvement in skin texture, and smoothing of scar edges in an Asian patient with severe (class 4) facial cystic acne and scarring. PMID:16302560

  18. Formation of protoporphyrin IX in mouse skin after topical application of 5-aminolevulinic acid and its methyl esther

    NASA Astrophysics Data System (ADS)

    Sorensen, Roar; Juzenas, Petras; Iani, Vladimir; Moan, Johan

    1999-02-01

    Normal skin of nude mice (Balb/c) was treated topically with 5-aminolevulinic acid (ALA) and its methyl ester (ALA-Me) for 24 hours. Approximately 0.1 gram of freshly prepared cream was applied to a spot of 1 cm2 on the flank of the mice, which was then covered with a transparent dressing. The ALA induced protoporphyrin IX (PpIX) was studied by means of a noninvasive fiber-optic fluorescence probe connected to a luminescence spectrometer. The excitation wavelength was 407 nm, and the emission wavelength was 637 nm. For the first hour a slight lag in PpIX production was observed for the mice treated with ALA-Me compared to the mice treated with ALA. After approximately 12 hours the ALA and the ALA-Me treated mice showed the same PpIX fluorescence intensity. From 12 hours until 24 hours the PpIX fluorescence intensity decreased for both treatment modalities, even though ALA and ALA-Me were continuously present. At 24 hours ALA-Me-treated mice had less than half the amount of PpIX in their skin compared with ALA- treated mice.

  19. Clearance of protoporphyrin IX from mouse skin after topical application of 5-aminolevulinic acid and its methyl ester

    NASA Astrophysics Data System (ADS)

    Juzenas, Petras; Sorensen, Roar; Iani, Vladimir; Moan, Johan

    1999-02-01

    The clearance of protoporphyrin IX (PpIX) from the skin of hairless BALB/c mice after topical application of 5- aminolevulinic acid (ALA) and its methyl ester (ALA-Me) was investigated. Creams containing 2 or 20% of ALA or ALA-Me were topically applied on spots of approximately 1 cm2 for 12 hours. The PpIX fluorescence was detected by the means of a Perkin Elmer LS50B luminescence spectrometer equipped with a fiber-optic probe. The emission spectrum was identical with that of cell-bound PpIX. After 12 hours application of ALA and ALA-Me similar amounts of PpIX were found. After creme removal the ALA-induced PpIX fluorescence decayed with a half-life of about 20 hours (20% ALA cream). The ALA-Me-induced PpIX was faster cleared from the skin than ALA-induced PpIX, and had a half-life of about 7 hours (20% ALA-Me cream).

  20. Photosensitizer fluorescence and singlet oxygen luminescence as dosimetric predictors of topical 5-aminolevulinic acid photodynamic therapy induced clinical erythema

    PubMed Central

    Mallidi, Srivalleesha; Anbil, Sriram; Lee, Seonkyung; Manstein, Dieter; Elrington, Stefan; Kositratna, Garuna; Schoenfeld, David; Pogue, Brian; Davis, Steven J.; Hasan, Tayyaba

    2014-01-01

    Abstract. The need for patient-specific photodynamic therapy (PDT) in dermatologic and oncologic applications has triggered several studies that explore the utility of surrogate parameters as predictive reporters of treatment outcome. Although photosensitizer (PS) fluorescence, a widely used parameter, can be viewed as emission from several fluorescent states of the PS (e.g., minimally aggregated and monomeric), we suggest that singlet oxygen luminescence (SOL) indicates only the active PS component responsible for the PDT. Here, the ability of discrete PS fluorescence-based metrics (absolute and percent PS photobleaching and PS re-accumulation post-PDT) to predict the clinical phototoxic response (erythema) resulting from 5-aminolevulinic acid PDT was compared with discrete SOL (DSOL)-based metrics (DSOL counts pre-PDT and change in DSOL counts pre/post-PDT) in healthy human skin. Receiver operating characteristic curve (ROC) analyses demonstrated that absolute fluorescence photobleaching metric (AFPM) exhibited the highest area under the curve (AUC) of all tested parameters, including DSOL based metrics. The combination of dose-metrics did not yield better AUC than AFPM alone. Although sophisticated real-time SOL measurements may improve the clinical utility of SOL-based dosimetry, discrete PS fluorescence-based metrics are easy to implement, and our results suggest that AFPM may sufficiently predict the PDT outcomes and identify treatment nonresponders with high specificity in clinical contexts. PMID:24503639

  1. Topical photodynamic therapy with 5-aminolevulinic acid in the treatment of actinic keratoses: a first clinical study

    NASA Astrophysics Data System (ADS)

    Karrer, Sigrid; Szeimies, Rolf-Markus; Sauerwald, Angela; Landthaler, Michael

    1996-01-01

    In this first clinical study performed according to GCP- (good clinical practice) guidelines, efficacy, and tolerability of topical photodynamic therapy (PDT) using 5-aminolevulinic acid (ALA) were tested in the treatment of actinic keratoses. Ten patients (6 f, 4 m) with 36 lesions (19 located on hands and arms, 17 on the head) received ALA-PDT once. Five to six hours after occlusive application of ALA (water-in-oil-emulsion containing 10% ALA) irradiation was performed with an incoherent light source. Up to 3 months after treatment patients were monitored. A score evaluating infiltration and keratosis of treated actinic keratoses allowed us to estimate therapeutic efficacy. Compared to the initial score (100%) significantly lower score-sums were observed at the 28 day follow-up at both localizations (head: 15%; hand: 67%). Complete remission (score sum 0) resulted in 71% of actinic keratoses localized on the head. Except for slight pain and burning sensations during and after irradiation there were no notable side effects. This study proved good efficacy and tolerability of topical PDT in the treatment of actinic keratoses. Whether PDT is able to compete with established treatment modalities remains to be shown in further studies.

  2. 5-Aminolevulinic Acid-Mediated Sonodynamic Therapy Inhibits RIPK1/RIPK3-Dependent Necroptosis in THP-1-Derived Foam Cells

    PubMed Central

    Tian, Fang; Yao, Jianting; Yan, Meng; Sun, Xin; Wang, Wei; Gao, Weiwei; Tian, Zhen; Guo, Shuyuan; Dong, Zengxiang; Li, Bicheng; Gao, Tielei; Shan, Peng; Liu, Bing; Wang, Haiyang; Cheng, Jiali; Gao, Qianping; Zhang, Zhiguo; Cao, Wenwu; Tian, Ye

    2016-01-01

    Necroptosis, or programmed necrosis, contributes to the formation of necrotic cores in atherosclerotic plaque in animal models. However, whether inhibition of necroptosis ameliorates atherosclerosis is largely unknown. In this study, we demonstrated that necroptosis occurred in clinical atherosclerotic samples, suggesting that it may also play an important role in human atherosclerosis. We established an in vitro necroptotic model in which necroptosis was induced in THP-1-derived foam cells by serum deprivation. With this model, we demonstrated that 5-aminolevulinic acid-mediated sonodynamic therapy (ALA-SDT) inhibited necroptosis while promoting apoptosis. ALA-SDT activated the caspase-3 and caspase-8 pathways in foam cells, which is responsible for the switch from necroptosis to apoptosis. The inhibition of either caspase-8 or caspase-3 abolished the anti-necroptotic effect of ALA-SDT. In addition, we found that caspase-3 activation peaked 4 hours after ALA-SDT treatment, 2 hours earlier than maximal caspase-8activation. Taken together, our data indicate that ALA-SDT mediates the switch from necroptosis to apoptosis by activating the caspase-3 and caspase-8 pathways and may improve the prognosis of atherosclerosis. PMID:26911899

  3. 5-Aminolevulinic Acid-Mediated Sonodynamic Therapy Inhibits RIPK1/RIPK3-Dependent Necroptosis in THP-1-Derived Foam Cells.

    PubMed

    Tian, Fang; Yao, Jianting; Yan, Meng; Sun, Xin; Wang, Wei; Gao, Weiwei; Tian, Zhen; Guo, Shuyuan; Dong, Zengxiang; Li, Bicheng; Gao, Tielei; Shan, Peng; Liu, Bing; Wang, Haiyang; Cheng, Jiali; Gao, Qianping; Zhang, Zhiguo; Cao, Wenwu; Tian, Ye

    2016-01-01

    Necroptosis, or programmed necrosis, contributes to the formation of necrotic cores in atherosclerotic plaque in animal models. However, whether inhibition of necroptosis ameliorates atherosclerosis is largely unknown. In this study, we demonstrated that necroptosis occurred in clinical atherosclerotic samples, suggesting that it may also play an important role in human atherosclerosis. We established an in vitro necroptotic model in which necroptosis was induced in THP-1-derived foam cells by serum deprivation. With this model, we demonstrated that 5-aminolevulinic acid-mediated sonodynamic therapy (ALA-SDT) inhibited necroptosis while promoting apoptosis. ALA-SDT activated the caspase-3 and caspase-8 pathways in foam cells, which is responsible for the switch from necroptosis to apoptosis. The inhibition of either caspase-8 or caspase-3 abolished the anti-necroptotic effect of ALA-SDT. In addition, we found that caspase-3 activation peaked 4 hours after ALA-SDT treatment, 2 hours earlier than maximal caspase-8activation. Taken together, our data indicate that ALA-SDT mediates the switch from necroptosis to apoptosis by activating the caspase-3 and caspase-8 pathways and may improve the prognosis of atherosclerosis. PMID:26911899

  4. 5-aminolevulinic acid for quantitative seek-and-treat of high-grade dysplasia in Barrett's esophagus cellular models

    NASA Astrophysics Data System (ADS)

    Yeh, Shu-Chi Allison; Ling, Celine S. N.; Andrews, David W.; Patterson, Michael S.; Diamond, Kevin R.; Hayward, Joseph E.; Armstrong, David; Fang, Qiyin

    2015-02-01

    High-grade dysplasia (HGD) in Barrett's esophagus (BE) poses increased risk for developing esophageal adenocarcinoma. To date, early detection and treatment of HGD regions are still challenging due to the sampling error from tissue biopsy and relocation error during the treatment after histopathological analysis. In this study, CP-A (metaplasia) and CP-B (HGD) cell lines were used to investigate the "seek-and-treat" potential using 5-aminolevulinic acid-induced protoporphyrin IX (PpIX). The photodynamic therapy photosensitizer then provides both a phototoxic effect and additional image contrast for automatic detection and real-time laser treatment. Complementary to our studies on automatic classification, this work focused on characterizing subcellular irradiation and the potential phototoxicity on both metaplasia and HGD. The treatment results showed that the HGD cells are less viable than metaplastic cells due to more PpIX production at earlier times. Also, due to mitochondrial localization of PpIX, a better killing effect was achieved by involving mitochondria or whole cells compared with just nucleus irradiation in the detected region. With the additional toxicity given by PpIX and potential morphological/textural differences for pattern recognition, this cellular platform serves as a platform to further investigate real-time "seek-and-treat" strategies in three-dimensional models for improving early detection and treatment of BE.

  5. In vitro skin permeation and retention of 5-aminolevulinic acid ester derivatives for photodynamic therapy.

    PubMed

    De Rosa, Fernanda Scarmato; Tedesco, Antônio Cláudio; Lopez, Renata Fonseca Vianna; Pierre, Maria Bernadete Riemma; Lange, Norbert; Marchetti, Juliana Maldonado; Rotta, Jeane Cristina Gomes; Bentley, Maria Vitória Lopes Badra

    2003-04-29

    In photodynamic therapy (PDT), 5-aminiolevulinic acid (5-ALA) applied topically is converted, via the heme cycle, into protoporphyrin IX (PpIX), a photosensitizing agent, which upon excitation with light can induce tumor destruction. Due to its hydrophilic and zwitterionic characteristics, 5-ALA has limited penetration into the skin. More lipophilic 5-ALA ester derivatives are expected to cross stratum corneum more easily than 5-ALA. According to the determination of the partition coefficients of 5-ALA methyl, n-butyl, n-hexyl and n-octyl esters, these compounds showed an increased affinity to the SC, with 5-ALA hexyl ester and 5-ALA-octyl ester having the highest partition coefficients. Our in vitro skin permeation studies demonstrated an increased permeated amount for hexyl-ALA after 6 h of incubation, compared to other esters and 5-ALA. After 6 h, more 5-ALA-hexyl ester and -octyl ester were retained at viable epidermis and dermis than 5-ALA. According to these results, and considering that the conversion of 5-ALA into PpIX occurs preferentially in epidermis, it can be supposed that topical use of ester derivatives with longer chains (C(6) or C(8)) is an interesting proposal to optimize topical 5-ALA-PDT

  6. Evaluating the efficacy and safety of a novel endoscopic fluorescence imaging modality using oral 5-aminolevulinic acid for colorectal tumors

    PubMed Central

    Tsuruki, Eriko So; Saito, Yutaka; Abe, Seiichiro; Takamaru, Hiroyuki; Yamada, Masayoshi; Sakamoto, Taku; Nakajima, Takeshi; Matsuda, Takahisa; Sekine, Shigeki; Taniguchi, Hirokazu

    2016-01-01

    Background and study aims: Five-aminolevulinic acid (5-ALA) is being increasingly used for photodynamic diagnosis and therapy of various types of tumors including brain, urologic, and other neoplasias. The use of 5-ALA to treat Barrett’s carcinomas has been documented, but its clinical effectiveness for diagnosis of gastrointestinal tumors, particularly early cancers, remains unknown. Patients and methods: The aim of our feasibility study was to evaluate the visibility of colorectal tumors using endoscopic fluorescence imaging (EFI) after oral administration of 5-ALA. The lesions identified by direct visualization and by the spectrums produced using EFI modality with 5-ALA were compared to the clinicopathologic features of resected specimens. Results: Twenty-three patients with a total of 27 known colorectal lesions were enrolled in the study. The median tumor size was 30 mm (range 10 – 75). Eleven of the lesions were flat or depressed lesions and 16 were sessile. Red fluorescence was observed in 22 out of 27 lesions. Red fluorescence was negative in 4 out of 11 flat or depressed lesions. In comparison with histopathologic findings, the rates of red fluorescence visibility were 62.5 % in low-grade intraepithelial neoplasia, 77.8 % in high-grade neoplasia, and 100 % in submucosal carcinoma. Red fluorescence visibility increased with the degree of dysplasia. There were no significant adverse events identified in this study. Conclusions: This feasibility study using EFI with 5-ALA demonstrated high visibility of superficial colorectal neoplasia. EFI with 5-ALA appears to be a novel, safe technique for improving real-time colorectal tumor imaging. PMID:26793782

  7. Efficacy of a Complex of 5-Aminolevulinic Acid and Glycyl-Histidyl-Lysine Peptide on Hair Growth

    PubMed Central

    Sim, Hyun Bo; Jang, Yong Hyun; Lee, Seok-Jong; Kim, Do Won; Yim, Soon-Ho

    2016-01-01

    Background Pattern hair loss is a very common problem. Although effective therapeutics for the treatment of pattern hair loss have been used, novel therapeutic modalities are still required to enhance hair growth. Objective We investigated the efficacy and safety of a complex (ALAVAX) of 5-aminolevulinic acid (5-ALA) and glycyl-histidyl-lysine (GHK) peptide for the treatment of pattern hair loss. Methods Forty-five patients with male pattern hair loss were treated with ALAVAX 100 mg/ml (group A), ALAVAX 50 mg/ml (group B) or placebo (group C) once a day for 6 months. Total hair count, hair length, hair thickness, patient's assessment and adverse events were evaluated at month 1, 3, and 6. Results An increase in hair count for 6 months was 52.6 (p<0.05) in group A, 71.5 (p<0.05) in group B, and 9.6 in group C. The ratio of changes in hair count between group B (2.38) and group C (1.21) at 6 months showed a statistically significant difference (p<0.05). The proportion above good satisfaction was higher in group A (26.7%) than in the other groups (group B: 14.3%, group C: 7.1%). There was no statistically significant difference in hair length and hair thickness among 3 groups at 6 months. There was no adverse event in 3 groups. Conclusion Our study showed that a complex of 5-ALA and GHK peptide may be considered as one of the complementary agents for the treatment of male pattern hair loss. PMID:27489425

  8. In Vivo Curative and Protective Potential of Orally Administered 5-Aminolevulinic Acid plus Ferrous Ion against Malaria

    PubMed Central

    Suzuki, Shigeo; Hikosaka, Kenji; Balogun, Emmanuel O.; Komatsuya, Keisuke; Niikura, Mamoru; Kobayashi, Fumie; Takahashi, Kiwamu; Tanaka, Tohru; Nakajima, Motowo

    2015-01-01

    5-Aminolevulinic acid (ALA) is a naturally occurring amino acid present in diverse organisms and a precursor of heme biosynthesis. ALA is commercially available as a component of cosmetics, dietary supplements, and pharmaceuticals for cancer diagnosis and therapy. Recent reports demonstrated that the combination of ALA and ferrous ion (Fe2+) inhibits the in vitro growth of the human malaria parasite Plasmodium falciparum. To further explore the potential application of ALA and ferrous ion as a combined antimalarial drug for treatment of human malaria, we conducted an in vivo efficacy evaluation. Female C57BL/6J mice were infected with the lethal strain of rodent malaria parasite Plasmodium yoelii 17XL and orally administered ALA plus sodium ferrous citrate (ALA/SFC) as a once-daily treatment. Parasitemia was monitored in the infected mice, and elimination of the parasites was confirmed using diagnostic PCR. Treatment of P. yoelii 17XL-infected mice with ALA/SFC provided curative efficacy in 60% of the mice treated with ALA/SFC at 600/300 mg/kg of body weight; no mice survived when treated with vehicle alone. Interestingly, the cured mice were protected from homologous rechallenge, even when reinfection was attempted more than 230 days after the initial recovery, indicating long-lasting resistance to reinfection with the same parasite. Moreover, parasite-specific antibodies against reported vaccine candidate antigens were found and persisted in the sera of the cured mice. These findings provide clear evidence that ALA/SFC is effective in an experimental animal model of malaria and may facilitate the development of a new class of antimalarial drug. PMID:26324278

  9. Comparative split-face study of 5-aminolevulinic acid photodynamic therapy with intense pulsed light for photorejuvenation of Asian skin.

    PubMed

    Kosaka, Sachiko; Yasumoto, Minako; Akilov, Oleg E; Hasan, Tayyaba; Kawana, Seiji

    2010-12-01

    Photodynamic therapy (PDT) with 5-aminolevulinic acid (ALA) (ALA-PDT) using intense pulsed light (IPL) as a light source (IPL-ALA-PDT) has been used for photorejuvenation, but it is unclear if this protocol can be applied to darker skin types. We performed this study to assess our IPL-ALA-PDT protocol for photorejuvenation in Asian skin. To determine an appropriate dose, ALA ointment (0-20%) was applied to the upper arm of five healthy volunteers and the fluorescence intensity (FI) was measured using a spectrofluorometer. Non-linear regression analysis of FI 2 h after ALA application with global fitting gave a typical sigmoid dose-response curve with R² = 0.9705 and saturation after 5% ALA. The entire faces of 16 Japanese women with photodamage were then treated with IPL (500-670 and 870-1400 nm, 23-30 J/cm²) 2 h after application of 5% ALA to one side of the face. Three treatments were delivered at 4-week intervals with follow-up visits. Comparative analysis of photorejuvenation showed noticeable improvements on both sides of the face, although the reduction in the photoaging score from baseline did not differ significantly between the two sides in all subjects. Despite this finding, 75% of the patients felt that the IPL-ALA-PDT-treated side of the face showed greater improvement than the IPL-treated side. However, all IPL-ALA-PDT-treated sides showed adverse effects such as erythema and pain. Therefore, we conclude that the IPL-ALA-PDT protocol requires optimization for photorejuvenation in Asians.

  10. Treating cutaneous squamous cell carcinoma using 5-aminolevulinic acid polylactic-co-glycolic acid nanoparticle-mediated photodynamic therapy in a mouse model

    PubMed Central

    Wang, Xiaojie; Shi, Lei; Tu, Qingfeng; Wang, Hongwei; Zhang, Haiyan; Wang, Peiru; Zhang, Linglin; Huang, Zheng; Zhao, Feng; Luan, Hansen; Wang, Xiuli

    2015-01-01

    Background Squamous cell carcinoma (SCC) is a common skin cancer, and its treatment is still difficult. The aim of this study was to evaluate the effectiveness of nanoparticle (NP)-assisted 5-aminolevulinic acid (ALA) delivery for topical photodynamic therapy (PDT) of cutaneous SCC. Materials and methods Ultraviolet-induced cutaneous SCCs were established in hairless mice. ALA-loaded polylactic-co-glycolic acid (PLGA) NPs were prepared and characterized. The kinetics of ALA PLGA NP-induced protoporphyrin IX fluorescence in SCCs, therapeutic efficacy of ALA NP-mediated PDT, and immune responses were examined. Results PLGA NPs enhanced protoporphyrin IX production in SCC. ALA PLGA NP-mediated topical PDT was more effective than free ALA of the same concentration in treating cutaneous SCC. Conclusion PLGA NPs provide a promising strategy for delivering ALA in topical PDT of cutaneous SCC. PMID:25609949

  11. In Vitro Comparison of Hypericin and 5-Aminolevulinic Acid-Derived Protoporphyrin IX for Photodynamic Inactivation of Medulloblastoma Cells

    PubMed Central

    Ritz, Rainer; Scheidle, Christian; Noell, Susan; Roser, Florian; Schenk, Martin; Dietz, Klaus; Strauss, Wolfgang S. L.

    2012-01-01

    Background Hypericin (HYP) is a naturally occurring photosensitizer. Cellular uptake and photodynamic inactivation after incubation with this photosensitizer have neither been examined in medulloblastoma cells in vitro, nor compared with 5-aminolevulinic acid-derived protoporphyrin IX (5-ALA-derived PpIX). Methods In 3 medulloblastoma cell lines (D283 Med, Daoy, and D341 Med) the time- and concentration-dependent intracellular accumulation of HYP and 5-ALA-derived PpIX was analyzed by fluorescence microscopy (FM) and FACS. Photocytotoxicity was measured after illumination at 595 nm (HYP) and 635 nm (5-ALA-derived PpIX) in D283 Med cells and compared to U373 MG glioma cells. Results All medulloblastoma cell lines exhibited concentration- and time-dependent uptake of HYP. Incubation with HYP up to 10 µM resulted in a rapid increase in fluorescence intensity, which peaked between 2 and 4 hours. 5-ALA-derived PpIX accumulation increased in D283 Med cells by 22% over baseline after 5-ALA incubation up to 1.2 mM. Photocytotoxicity of 5-ALA-derived PpIX was higher in D283 Med medulloblastoma compared to U373MG glioma. The [lethal dose (light dose that is required to reduce cell survival to 50% of control)] of 5-ALA-derived PpIX was 3.8 J/cm2 in D283 Med cells versus 5.7 J/cm2 in U373MG glioma cells. Photocytotoxicity of HYP in D283 Med cells was determined at 2.5 µM after an incubation time of 2 h and an illumination wavelength of 595 nm. The value was 0.47 J/cm2. Conclusion By its 5-fold increase in fluorescence over autofluorescence levels HYP has excellent properties for tumor visualization in medulloblastomas. The high photocytotoxicity of HYP, compared to 5-ALA-derived PpIX, is convincingly demonstrated by its 8- to 13-fold lower . Therefore HYP might be a promising molecule for intraoperative visualization and photodynamic treatment of medulloblastomas. PMID:23251668

  12. Nitric Oxide Mediates 5-Aminolevulinic Acid-Induced Antioxidant Defense in Leaves of Elymus nutans Griseb. Exposed to Chilling Stress

    PubMed Central

    Fu, Juanjuan; Chu, Xitong; Sun, Yongfang; Miao, Yanjun; Xu, Yuefei; Hu, Tianming

    2015-01-01

    Nitric oxide (NO) and 5-aminolevulinic acid (ALA) are both extremely important signalling molecules employed by plants to control many aspects of physiology. In the present study, the role of NO in ALA-induced antioxidant defense in leaves of two sources of Elymus nutans Griseb. (Damxung, DX and Zhengdao, ZD) was investigated. Chilling stress enhanced electrolyte leakage, accumulation of malondialdehyde (MDA), hydrogen peroxide (H2O2) and superoxide radical in two E. nutans, which were substantially alleviated by exogenous ALA and NO application. Pretreatment with NO scavenger PTIO or NOS inhibitor L-NNA alone and in combination with ALA induced enhancements in electrolyte leakage and the accumulation of MDA, H2O2 and superoxide radical in leaves of DX and ZD exposed to chilling stress, indicating that the inhibition of NO biosynthesis reduced the chilling resistance of E. nutans and the ALA-enhanced chilling resistance. Further analyses showed that ALA and NO enhanced antioxidant defense and activated plasma membrane (PM) H+-ATPase and decreased the accumulation of ROS induced by chilling stress. A pronounced increase in nitric oxide synthase (NOS) activity and NO release by exogenous ALA treatment was found in chilling-resistant DX plants exposed to chilling stress, while only a little increase was observed in chilling-sensitive ZD. Furthermore, inhibition of NO accumulation by PTIO or L-NNA blocked the protective effect of exogenous ALA, while both exogenous NO treatment and inhibition of endogenous NO accumulation did not induce ALA production. These results suggested that NO might be a downstream signal mediating ALA-induced chilling resistance in E. nutans. PMID:26151364

  13. Regulation of Cadmium-Induced Proteomic and Metabolic Changes by 5-Aminolevulinic Acid in Leaves of Brassica napus L.

    PubMed

    Ali, Basharat; Gill, Rafaqat A; Yang, Su; Gill, Muhammad B; Farooq, Muhammad A; Liu, Dan; Daud, Muhammad K; Ali, Shafaqat; Zhou, Weijun

    2015-01-01

    It is evident from previous reports that 5-aminolevulinic acid (ALA), like other known plant growth regulators, is effective in countering the injurious effects of heavy metal-stress in oilseed rape (Brassica napus L.). The present study was carried out to explore the capability of ALA to improve cadmium (Cd2+) tolerance in B. napus through physiological, molecular, and proteomic analytical approaches. Results showed that application of ALA helped the plants to adjust Cd2+-induced metabolic and photosynthetic fluorescence changes in the leaves of B. napus under Cd2+ stress. The data revealed that ALA treatment enhanced the gene expressions of antioxidant enzyme activities substantially and could increase the expression to a certain degree under Cd2+ stress conditions. In the present study, 34 protein spots were identified that differentially regulated due to Cd2+ and/or ALA treatments. Among them, 18 proteins were significantly regulated by ALA, including the proteins associated with stress related, carbohydrate metabolism, catalysis, dehydration of damaged protein, CO2 assimilation/photosynthesis and protein synthesis/regulation. From these 18 ALA-regulated proteins, 12 proteins were significantly down-regulated and 6 proteins were up-regulated. Interestingly, it was observed that ALA-induced the up-regulation of dihydrolipoyl dehydrogenase, light harvesting complex photo-system II subunit 6 and 30S ribosomal proteins in the presence of Cd2+ stress. In addition, it was also observed that ALA-induced the down-regulation in thioredoxin-like protein, 2, 3-bisphosphoglycerate, proteasome and thiamine thiazole synthase proteins under Cd2+ stress. Taken together, the present study sheds light on molecular mechanisms involved in ALA-induced Cd2+ tolerance in B. napus leaves and suggests a more active involvement of ALA in plant physiological processes than previously proposed.

  14. Regulation of Cadmium-Induced Proteomic and Metabolic Changes by 5-Aminolevulinic Acid in Leaves of Brassica napus L.

    PubMed Central

    Ali, Basharat; Gill, Rafaqat A.; Yang, Su; Gill, Muhammad B.; Farooq, Muhammad A.; Liu, Dan; Daud, Muhammad K.; Ali, Shafaqat; Zhou, Weijun

    2015-01-01

    It is evident from previous reports that 5-aminolevulinic acid (ALA), like other known plant growth regulators, is effective in countering the injurious effects of heavy metal-stress in oilseed rape (Brassica napus L.). The present study was carried out to explore the capability of ALA to improve cadmium (Cd2+) tolerance in B. napus through physiological, molecular, and proteomic analytical approaches. Results showed that application of ALA helped the plants to adjust Cd2+-induced metabolic and photosynthetic fluorescence changes in the leaves of B. napus under Cd2+ stress. The data revealed that ALA treatment enhanced the gene expressions of antioxidant enzyme activities substantially and could increase the expression to a certain degree under Cd2+ stress conditions. In the present study, 34 protein spots were identified that differentially regulated due to Cd2+ and/or ALA treatments. Among them, 18 proteins were significantly regulated by ALA, including the proteins associated with stress related, carbohydrate metabolism, catalysis, dehydration of damaged protein, CO2 assimilation/photosynthesis and protein synthesis/regulation. From these 18 ALA-regulated proteins, 12 proteins were significantly down-regulated and 6 proteins were up-regulated. Interestingly, it was observed that ALA-induced the up-regulation of dihydrolipoyl dehydrogenase, light harvesting complex photo-system II subunit 6 and 30S ribosomal proteins in the presence of Cd2+ stress. In addition, it was also observed that ALA-induced the down-regulation in thioredoxin-like protein, 2, 3-bisphosphoglycerate, proteasome and thiamine thiazole synthase proteins under Cd2+ stress. Taken together, the present study sheds light on molecular mechanisms involved in ALA-induced Cd2+ tolerance in B. napus leaves and suggests a more active involvement of ALA in plant physiological processes than previously proposed. PMID:25909456

  15. Clinical efficacy of 5-aminolevulinic acid photodynamic therapy in the treatment of moderate to severe facial acne vulgaris

    PubMed Central

    CHEN, XIANGQI; SONG, HONGTAO; CHEN, SHENGPING; ZHANG, JING; NIU, GAOXIANG; LIU, XIANGNONG

    2015-01-01

    Acne vulgaris is considered as a therapeutic challenge in terms of managing ongoing symptoms and preventing scar formation. Although there are many available treatments for alleviating acne, therapies for resistant or moderate-to-severe forms have been limited to systemic agents that are accompanied by potentially severe side-effects. While, aminolevulinic acid (ALA) photodynamic therapy (PDT) has increasingly been used as a simple and safe therapeutic option of acne vulgaris, the clinical efficacy requires confirmation in further studies. The aim of this study was to investigate the efficacy and safety of 5-ALA-PDT in the treatment of moderate-to-severe facial acne vulgaris. A total of 50 patients with moderate-to-severe facial acne were enrolled in the study and randomly divided equally into a therapy group and a control group. In the therapy group, the patients were treated with 5% 5-ALA for 1.5 h, followed by three 20-min doses of infrared radiation once a week; in the control group, the patients were treated with three 20 min doses of infrared radiation without 5-ALA once a week. Both treatments lasted for 3 weeks. The clinical efficacy was determined by evaluating acne lesion counts at weeks 0, 2, 4 and 6. Total efficacy rate (TER) was the primary endpoint of the study, and was defined as the proportion of the patients whose treatment effectiveness evaluation was cured (≥90% of skin lesions improved) and excellent (60–89% improvement). Adverse effects were recorded throughout the study. The study was completed by 24 patients in the therapy group and 23 patients in the control group. The numbers of acne lesions significantly decreased. The TER of the therapy group was significantly higher than that of the control group at weeks 4 and 6. Adverse effects were observed in 12 patients of the therapy group and 2 patients of the control group. In the therapy group the most common adverse effect was a burning sensation (n=7), followed by transient

  16. Photodynamic Therapy (PDT) using intratumoral injection of the 5- aminolevulinic acid (5-ALA) for the treatment of eye cancer in cattle

    NASA Astrophysics Data System (ADS)

    Hage, Raduan; Mancilha, Geraldo; Zângaro, Renato A.; Munin, Egberto; Plapler, Hélio

    2007-02-01

    A six-year old Holstein cow with an eye cancer (ocular squamous cell carcinoma) involving the third eyelid and conjunctiva was submitted to photodynamic therapy using intratumoral 20% aminolevulinic acid (5-ALA - Aldrich Chemical Company, Milwaukee, USA) and a light emitting diode (LED - VET LED - MMOptics (R)) with wavelength between 600 and 700 nm, 2 cm diameter circular light beam, power of 150 mW, light dose of 50 J/cm2 as a source of irradiation. Fifteen days after the experimental procedure we observed about 50% tumor reduction and complete remission after 3 months. Relapse was not observed up to 12 months after the treatment. Although the study only includes one animal not allowing definite conclusions, it indicates that PDT represents a safe and technically feasible approach in the treatment of eye cancer in cattle.

  17. 5-Aminolevulinic acid ameliorates cadmium-induced morphological, biochemical, and ultrastructural changes in seedlings of oilseed rape.

    PubMed

    Ali, Basharat; Huang, C R; Qi, Z Y; Ali, Shafaqat; Daud, M K; Geng, X X; Liu, H B; Zhou, W J

    2013-10-01

    Due to its prolific growth, oilseed rape (Brassica napus L.) can be grown successfully for phytoremediation of cadmium (Cd)-contaminated soils. Nowadays, use of plant growth regulators against heavy metals stress is one of the major objectives of researchers. The present study evaluates the ameliorate effects of 5-aminolevulinic acid (ALA, 0, 0.4, 2, and 10 mg/l) on the growth of oilseed rape (B. napus L. cv. ZS 758) seedlings under Cd stress (0, 100, and 500 μM). Results have shown that Cd stress hampered the seedling growth by decreasing the radical and hypocotyls length, shoot and root biomass, chlorophyll content, and antioxidants enzymes. On the other hand, Cd stress increased the level of malondialdehyde (MDA) and production of H2O2 and accumulation of Cd in the shoots. The microscopic study of leaf mesophyll cells showed that toxicity of Cd totally destroyed the whole cell structure, and accumulation of Cd also appeared in micrographs. Application of ALA at lower dosage (2 mg/l) enhanced the seedling growth and biomass. The results showed that 2 mg/l ALA significantly improved chlorophyll content under Cd stress and decreased the level of Cd contents in shoots. Application of ALA reduced the MDA and H2O2 levels in the cotyledons. The antioxidants enzymes (ascorbate peroxidase, peroxidase, catalase, glutathione reductase, and superoxide dismutase) enhanced their activities significantly with the application of 2 mg/l ALA under Cd stress. This study also indicated that higher dosage of ALA (10 mg/l) imposed the negative effect on the growth of oilseed rape. Microscopic study showed that application of ALA alleviated the toxic effects of Cd in the mesophyll cell and improved the cell structure. Use of 2 mg/l ALA under 500 μM Cd was found to be more effective, and under this dosage, cell structure was clear, with obvious cell wall and cell membrane as well as a big nucleus, which was found with well-developed two or more nucleoli. Chloroplast was almost round

  18. Photodynamic therapy of human skin tumors using topical application of 5-aminolevulinic acid, dimethylsulfoxide (DMSO), and edetic acid disodium salt (EDTA)

    NASA Astrophysics Data System (ADS)

    Orenstein, Arie; Kostenich, Gennady; Tsur, H.; Roitman, Leonid; Ehrenberg, Benjamin; Malik, Zvi

    1995-01-01

    The results of photodynamic therapy (PDT) in 48 patients bearing basal cell carcinoma (BCC) and 7 patients with squamous cell carcinoma (SCC) of the skin are described. Five- aminolevulinic acid (5-ALA) was applied topically in two formulations. The first formulation contained 20% of 5-ALA in a base cream, and the second formulation (5-ALA composite cream), contained an additional 2% of dimethylsulfoxide (DMSO) and 2% of edetic acid disodium salt (EDTA). The creams were left on the skin for 2 - 5 hours. Production of protoporphyrin (PP) was measured in situ by a laser-induced fluorescence (LIF) method. The results of fluorescence measurement clearly indicate that PP accumulation in tumors induced by the 5-ALA composite cream was markedly higher than that induced by the 5-ALA cream. The tumors were light-irradiated (600 - 720 nm) after 4 - 5 hours of cream applications, using the light delivery system Versa-Light by a light dose of 100 J/cm2. The clinically superficial BCC tumors were highly responsive to PDT; the overall result in BCC patients was an 85.4% complete response. Histological examination showed an initial edematous reaction, followed by necrosis and complete disappearance of the tumor. The superficial SCC tumors showed a 100% complete response after PDT. The ulcerated nodular SCC showed partial responses.

  19. Determination of threshold dose with delta-aminolevulinic acid-induced porphyrins for effective photodynamic therapy

    NASA Astrophysics Data System (ADS)

    Fritsch, Clemens; Abels, Christoph; Bolsen, Klaus; Ruzicka, Thomas; Goetz, Alwin E.; Goerz, Guenter

    1995-03-01

    In this study the metabolism in tumors and various tissues of intravenously administered (delta) -aminolevulinic acid was investigated. Amelanotic melanoma (A-Mel-3) were implanted in the dorsal skin of Syrian golden hamsters. Distribution and metabolism of i.v. injected (delta) -aminolevulinic acid in blood was studied by determination of (delta) - aminolevulinic acid and protoporphyrin concentration in red blood cells. In addition extraction of various tissues, e.g. tumor, liver, kidney, and normal skin was performed, to verify fluorescence kinetic studies by determination of total porphyrin concentration by photometry and of distribution of the porphyrin metabolites by HPLC. In untreated animals the total porphyrin concentration in all tissues examined were comparably low. In red blood cells the maximal concentration of (delta) -aminolevulinic acid as well as protoporphyrin was detected 45 min after i.v. injection of (delta) -aminolevulinic acid. Porphyrins accumulated in melanoma reaching a maximum tumor:skin tissue ratio of 6.9:1 at 45 min after i.v. injection of (delta) -aminolevulinic acid. A second high tumor:skin tissue ratio of 5.7:1 could be measured at 24 h after injection, but at this point in time the protoporphyrin content in normal skin was higher than 45 min after injection. The kidney may not be strongly affected by i.v. administration of (delta) -aminolevulinic acid, whereas the liver reveals an accumulation of porphyrins, e.g. protoporphyrin. Concluding from these results in this experimental tumor model, i.v. administration of (delta) -aminolevulinic acid seems to be a promising modality to perform photodynamic therapy more effectively and more selectively by irradiation 45 - 180 min after injection of (delta) -aminolevulinic acid.

  20. Photodynamic therapy of superficial basal cell carcinoma with 5-aminolevulinic acid with dimethylsulfoxide and ethylendiaminetetraacetic acid: a comparison of two light sources.

    PubMed

    Soler, A M; Angell-Petersen, E; Warloe, T; Tausjø, J; Steen, H B; Moan, J; Giercksky, K E

    2000-06-01

    The aim of this prospective randomized study was to compare the clinical and cosmetic outcome of superficial basal cell carcinomas (BCC), using either laser or broadband halogen light, in photodynamic therapy with topical 5-aminolevulinic acid (ALA). A total of 83 patients with 245 superficial BCC were included in the study. Standard treatment involved 15 min of local pretreatment with 99% dimethylsulfoxide (DMSO) before topical application of 20% ALA with DMSO (2%) and ethylendiaminetetraacetic acid (2%) as cofactors for 3 h before light exposure with either laser or a broadband lamp (BL). A complete response was achieved in 95 lesions (86%) in the laser group and 110 lesions (82%) in the BL group 6 months after treatment. Of these, 80 lesions (84%) in the laser group and 101 lesions (92%) in the lamp group were independently evaluated to have an excellent or good cosmetic post-treatment score. No serious adverse events were reported. This study shows that there is no statistical significant difference in cure the rate (P = 0.49) and the cosmetic outcome (P = 0.075) with topical application of a modified ALA-cream between light exposure from a simple BL with continuous spectrum (570-740 nm) or from a red-light laser (monochromatic 630 nm). Cost and safety are further elements in favor of the BL in this setting.

  1. Generation of reactive oxygen species from 5-aminolevulinic acid and Glutamate in cooperation with excited CdSe/ZnS QDs

    NASA Astrophysics Data System (ADS)

    Duong, Hong Dinh; Lee, Jee Won; Rhee, Jong Il

    2014-08-01

    CdSe/ZnS quantum dots (QDs) can be joined in the reductive pathway involving the electron transfer to an acceptor or in the oxidative pathway involving the hole transfer to a donor. They were exploited in the oxidation reactions of 5-aminolevulinic acid (ALA) and glutamate (GLU) for the generation of reactive oxygen species (ROS) such as hydroxyl radical (HO●) and superoxide anion (O2 ● -). Fast and highly efficient oxidation reactions of ALA to produce HO● and of GLU to produce O2 ●- were observed in the cooperation of mercaptopropionic acid (MPA)-capped CdSe/ZnS QDs under LED irradiation. Fluorescence spectroscopy and electron spin resonance (ESR) spectroscopy were used to evaluate the generation of different forms of ROS. Confocal fluorescent microscopic images of the size and morphology of HeLa cells confirmed the ROS generation from ALA or GLU in cooperation with CdSe/ZnS QDs under LED irradiation.

  2. Treatment of moderate to severe inflammatory acne vulgaris: photodynamic therapy with 5-aminolevulinic acid and a novel advanced fluorescence technology pulsed light source.

    PubMed

    Gold, Michael H; Biron, Julie A; Boring, Molly; Bridges, Tancy M; Bradshaw, Virginia L

    2007-03-01

    The use of photodynamic therapy (PDT) with 20% 5-aminolevulinic acid (ALA) for the treatment of acne vulgaris has been explored. This study evaluates the safety and efficacy of a new Advanced Fluorescence Technology (AFT) pulsed light source (420-950 nm) for photoactivation in ALA PDT for the treatment of moderate to severe inflammatory facial acne vulgaris. Nineteen subjects received 4 ALA PDT treatments with the AFT pulsed light source. Treatments were spaced 2 weeks apart. ALA was incubated for 15 to 30 minutes. At the end of the fourth treatment, the total reductions in inflammatory and noninflammatory lesion counts were 54.5% and 37.5%, respectively. Median Global Severity Scores suggest a trend toward reduction after several treatments. Investigator and subject assessments show moderate to marked improvement in most patients. The new AFT pulsed light source with ALA PDT appears to be a safe and effective modality for the treatment of moderate to severe inflammatory acne vulgaris.

  3. Low-Dose Topical 5-Aminolevulinic Acid Photodynamic Therapy in the Treatment of Different Severity of Acne Vulgaris.

    PubMed

    Tao, Shi-Qin; Li, Fei; Cao, Lei; Xia, Ru-Shan; Fan, Hua; Fan, Ying; Sun, Hui; Jing, Cheng; Yang, Li-Jia

    2015-12-01

    The objective of this article is to investigate the effectiveness and safety of photodynamic therapy (PDT) with 3.6 % topical aminolevulinic acid (ALA) and a short incubation time with red light in moderate to severe acne. One hundred and thirty-six patients with moderate to severe acne were treated with 3.6 % topical ALA-PDT for three sessions with an interval of 2 weeks. Patients were evaluated for efficacy and safety on week 2, 4, 6, 8, and 12 after the initial treatment. Most patients showed apparent clearance of acne lesions at the treated site after three sessions. The effective treatment rates were increased after the multiple therapies. The clinical outcomes are the best at 4 weeks after the final treatment. The total effectiveness rate and cure rate of the low-dose ALA-PDT procedure is 92.65 and 47.06 %, respectively. Thirty-one patients and nineteen patients showed apparent exacerbation of acne lesions before the 2nd and 3rd treatment, respectively, but all of them showed good or excellent improvement after a three-course treatment. A few patients showed mild relapse including papules and comedos at 8 weeks after the final treatment. No significant differences are found in the effects of different acne severity and different genders. Adverse reactions are mild and transient. A 3.6 % topical ALA-PDT with a short time incubation with red light is a simple and an effective treatment option for moderate to severe acne with mild side effects in Chinese people.

  4. Complete resolution of a squamous cell carcinoma of the skin using intralesional 5-aminolevulinic acid photodynamic therapy intralesional PDT for SCC.

    PubMed

    Sotiriou, Eleni; Apalla, Zoi; Ioannides, Demetris

    2010-10-01

    We present an 82-year-old female patient with a 2-year history of an infiltrative squamous cell carcinoma (SCC) on her right cheek. The patient was treated with one intralesional photodynamic therapy (PDT) session using 10% 5-aminolevulinic acid solution. We used red light by a non-coherent light source at a light dose of 100 J/cm² and a fluency rate of 100 mW/cm². Complete clinical and histological response was achieved 3 months after the treatment procedure. Cosmetic outcome was evaluated as fair. The patient remains disease free with the absence of any clinical sign of recurrence 16 months after PDT. Long-term follow-up is needed for assessment of recurrences. Optimization of the therapeutic protocol, as well as justification of our results in larger studies are needed in order to elicit safe conclusions.

  5. Mechanism of rat osteosarcoma cell apoptosis induced by a combination of low-intensity ultrasound and 5-aminolevulinic acid in vitro.

    PubMed

    Li, Y N; Zhou, Q; Yang, B; Hu, Z; Wang, J H; Li, Q S; Cao, W W

    2015-01-01

    We investigated the killing effect of low-intensity ultrasound combined with 5-aminolevulinic acid (5-ALA) on the rat osteosarcoma cell line UMR-106. Logarithmic-phase UMR-106 cells were divided into a control group, ultrasound group and 5-ALA group. The cell apoptotic rate, production of reactive oxygen species, and the change in mitochondrial membrane potential were analyzed by flow cytometry; ultrastructural changes were observed by transmission electron microscopy. Using low-intensity ultrasound at 1.0 MHz and 2.0 W/cm(2) plus 5-ALA at a concentration of 2 mM, the apoptotic rate of the sonodynamic therapy group was 27.2 ± 3.4% which was significantly higher than that of the control group, ultrasound group, and 5-ALA group (P < 0.05). The production of reactive oxygen species was 32.6 ± 2.2% and the decrease in mitochondrial membrane potential was 39.5 ± 2.5%. The 33342 staining showed nuclear condensation and fragmentation in the ultrasound group and 5-ALA group. Structural changes in the cell membrane, mitochondria, Golgi apparatus, and other organelles observed by transmission electron microscopy included formation of apoptotic bodies. The killing effect of low-intensity ultrasound combined with 5-ALA on UMR-106 cells was significant. Cell apoptosis played a vital role in the killing effect, and the mitochondria pathway contributed to the apoptosis of UMR-106 cells. PMID:26345893

  6. Topical glycerol monooleate/propylene glycol formulations enhance 5-aminolevulinic acid in vitro skin delivery and in vivo protophorphyrin IX accumulation in hairless mouse skin.

    PubMed

    Steluti, Regilene; De Rosa, Fernanda Scarmato; Collett, John; Tedesco, Antônio Cláudio; Bentley, Maria Vitória Lopes Badra

    2005-08-01

    Photodynamic therapy (PDT), a potential therapy for cancer treatment, utilizes exogenously applied or endogenously formed photosensitizers, further activated by light in an appropriate wavelength and dose to induce cell death through free radical formation. 5-Aminolevulinic acid (5-ALA) is a pro-drug which can be converted to the effective photosensitizer, protoporphyrin IX (PpIX). However, the use of 5-ALA in PDT is limited by the low penetration capacity of this highly hydrophilic molecule into appropriate skin layers. In the present study, we propose to increase 5-ALA penetration by using formulations containing glycerol monooleate (GMO), an interesting and useful component of pharmaceutical formulations. Propylene glycol solutions containing different concentrations of GMO significantly increased the in vitro skin permeation/retention of 5-ALA in comparison to control solutions. In vivo studies also showed increased PpIX accumulation in mouse hairless skin, after the use of topical 5-ALA formulations containing GMO in a concentration-dependent manner. The results show that skin 5-ALA penetration and PpIX accumulation, important factors for the success of topical 5-ALA-PDT in skin cancer, are optimized by GMO/propylene glycol formulations.

  7. The Safety and Tolerability of 5-Aminolevulinic Acid Phosphate with Sodium Ferrous Citrate in Patients with Type 2 Diabetes Mellitus in Bahrain

    PubMed Central

    Al-Saber, Feryal; Aldosari, Waleed; Alselaiti, Mariam; Khalfan, Hesham; Kaladari, Ahmed; Khan, Ghulam; Harb, George; Rehani, Riyadh; Kudo, Sizuka; Koda, Aya; Tanaka, Tohru

    2016-01-01

    Type 2 diabetes mellitus is prevalent especially in Gulf countries and poses serious long-term risks to patients. A multifaceted treatment approach can include nutritional supplements with antioxidant properties such as 5-aminolevulinic acid (5-ALA) with sodium ferrous citrate (SFC). This prospective, randomized, single-blind, placebo-controlled, dose escalating pilot clinical trial assessed the safety of 5-ALA with SFC at doses up to 200 mg 5-ALA/229.42 mg SFC per day in patients living in Bahrain with type 2 diabetes mellitus that was uncontrolled despite the use of one or more antidiabetic drugs. Fifty-three patients (n = 53) from 3 sites at one center were enrolled by Dr. Feryal (Site #01), Dr. Hesham (Site #02), and Dr. Waleed (Site #03) (n = 35, 5-ALA-SFC; n = 18, placebo). There was no significant difference in incidence of adverse events reported, and the most frequent events reported were gastrointestinal in nature, consistent with the known safety profile of 5-ALA in patients with diabetes. No significant changes in laboratory values and no difference in hypoglycemia between patients receiving 5-ALA and placebo were noted. Overall, the current results support that use of 5-ALA-SFC up to 200 mg per day taken as 2 divided doses is safe in patients taking concomitant oral antidiabetic medications and may offer benefits in the diabetic population. This trial is registered with ClinicalTrials.gov NCT02481141. PMID:27738640

  8. A Pilot Cost-Effectiveness Analysis of Treatments in Newly Diagnosed High-Grade Gliomas: The Example of 5-Aminolevulinic Acid Compared With White-Light Surgery

    PubMed Central

    Alves, Marta; Castel-Branco, Marta; Stummer, Walter

    2015-01-01

    BACKGROUND: High-grade gliomas are aggressive, incurable tumors characterized by extensive diffuse invasion of the normal brain parenchyma. Novel therapies at best prolong survival; their costs are formidable and benefit is marginal. Economic restrictions thus require knowledge of the cost-effectiveness of treatments. Here, we show the cost-effectiveness of enhanced resections in malignant glioma surgery using a well-characterized tool for intraoperative tumor visualization, 5-aminolevulinic acid (5-ALA). OBJECTIVE: To evaluate the cost-effectiveness of 5-ALA fluorescence-guided neurosurgery compared with white-light surgery in adult patients with newly diagnosed high-grade glioma, adopting the perspective of the Portuguese National Health Service. METHODS: We used a Markov model (cohort simulation). Transition probabilities were estimated with the use of data from 1 randomized clinical trial and 1 noninterventional prospective study. Utility values and resource use were obtained from published literature and expert opinion. Unit costs were taken from official Portuguese reimbursement lists (2012 values). The health outcomes considered were quality-adjusted life-years, life-years, and progression-free life-years. Extensive 1-way and probabilistic sensitivity analyses were performed. RESULTS: The incremental cost-effectiveness ratios are below €10 000 in all evaluated outcomes, being around €9100 per quality-adjusted life-year gained, €6700 per life-year gained, and €8800 per progression-free life-year gained. The probability of 5-ALA fluorescence-guided surgery cost-effectiveness at a threshold of €20000 is 96.0% for quality-adjusted life-year, 99.6% for life-year, and 98.8% for progression-free life-year. CONCLUSION: 5-ALA fluorescence-guided surgery appears to be cost-effective in newly diagnosed high-grade gliomas compared with white-light surgery. This example demonstrates cost-effectiveness analyses for malignant glioma surgery to be feasible on

  9. The application of 5-aminolevulinic acid in the treatment of precancerous lesions, skin cancer, and a new approach to the control of therapy

    NASA Astrophysics Data System (ADS)

    Kulas, Zbigniew; Bereś-Pawlik, Elżbieta; Bieniek, Andrzej; Matusiak, Łukasz

    2009-02-01

    The aim of our work was to determine a therapeutic effect of photodynamic therapy (PDT). Twenty five patients with the Bowen's disease, actinic keratosis and basal cell carcinoma (superficial, nodular) were examined. They were treated with photosensitizer - aminolevulinic acid (metabolized in protoporphyrin IX), and the new red light source built of high-power diodes. A new method, based on numerical analysis of fluorescence imaging of tissues, was proposed as a way for controlling therapy.

  10. Inhibitory Effect of Gabaculine on 5-Aminolevulinate Dehydratase Activity in Radish Seedlings 1

    PubMed Central

    Tchuinmogne, Simo J.; Huault, Claude; Aoues, Abdelkader; Balangé, Alain P.

    1989-01-01

    We have compared the activity of 5-aminolevulinate dehydratase (5-ALAD) with the amount of protein detected by specific antibodies in rocket immunoelectrophoresis. Parallel kinetic evolutions of enzymic activity and amount of antigen were observed in radish (Raphanus sativus L.) cotyledons, both in complete darkness or under standard far red light involving phytochrome. However, the treatment of seedlings with gabaculine leads to an important decrease in enzymic activity, while the specific protein content is maintained. This inhibition is not overcome by the addition of glutamic acid, but by 5-aminolevulinic acid which points to a specific control of 5-ALAD activity by its substrate. As there is no discrepancy between the enzymic activity and the amount of antigen during the time course development of seedlings, this could confirm a coordinate cellular control between 5-aminolevulinic acid formation and 5-ALAD protein synthesis, both being amplified by the action of phytochrome. PMID:16666925

  11. 5-Aminolevulinic acid combined with ferrous iron induces carbon monoxide generation in mouse kidneys and protects from renal ischemia-reperfusion injury.

    PubMed

    Hou, Jiangang; Cai, Songjie; Kitajima, Yuya; Fujino, Masayuki; Ito, Hidenori; Takahashi, Kiwamu; Abe, Fuminori; Tanaka, Tohru; Ding, Qiang; Li, Xiao-Kang

    2013-10-15

    Renal ischemia reperfusion injury (IRI) is a major factor responsible for acute renal failure. An intermediate in heme synthesis, 5-aminolevulinic acid (5-ALA) is fundamental in aerobic energy metabolism. Heme oxygenase (HO)-1 cleaves heme to form biliverdin, carbon monoxide (CO), and iron (Fe(2+)), which is used with 5-ALA. In the present study, we investigated the role of 5-ALA in the attenuation of acute renal IRI using a mouse model. Male Balb/c mice received 30 mg/kg 5-ALA with Fe(2+) 48, 24, and 2 h before IRI and were subsequently subjected to bilateral renal pedicle occlusion for 45 min. The endogenous CO concentration of the kidneys from the mice administered 5-ALA/Fe(2+) increased significantly, and the peak concentrations of serum creatinine and blood urea nitrogen decreased. 5-ALA/Fe(2+) treatments significantly decreased the tubular damage and number of apoptotic cells. IRI-induced renal thiobarbituric acid-reactive substance levels were also significantly decreased in the 5-ALA/Fe(2+) group. Furthermore, mRNA expression of HO-1, TNF-α, and interferon-γ was significantly increased after IRI. Levels of HO-1 were increased and levels of TNF-α and interferon-γ were decreased in the 5-ALA/Fe(2+)-pretreated renal parenchyma after IRI. F4/80 staining showed reduced macrophage infiltration, and TUNEL staining revealed that there were fewer interstitial apoptotic cells. These findings suggest that 5-ALA/Fe(2+) can protect the kidneys against IRI by reducing macrophage infiltration and decreasing renal cell apoptosis via the generation of CO.

  12. eEF1A1 binds and enriches protoporphyrin IX in cancer cells in 5-aminolevulinic acid based photodynamic therapy.

    PubMed

    Fan, Zhichao; Cui, Xiaojun; Wei, Dan; Liu, Wei; Li, Buhong; He, Hao; Ye, Huamao; Zhu, Naishuo; Wei, Xunbin

    2016-01-01

    Photodynamic therapy (PDT) with protoporphyrin IX (PpIX), which is endogenously derived from 5-aminolevulinic acid (5-ALA) or its derivatives, is a promising modality for the treatment of both pre-malignant and malignant lesions. However, the mechanisms of how ALA-induced PpIX selectively accumulated in the tumors are not fully elucidated. Here we discovered that eukaryotic translation elongation factor 1 alpha 1 (eEF1A1) interacted with PpIX (with an affinity constant of 2.96 × 10(6) M(-1)). Microscopy imaging showed that ALA-induced PpIX was co-localized with eEF1A1 in cancer cells. eEF1A1 was found to enrich ALA-induced PpIX in cells by competitively blocking the downstream bioavailability of PpIX. Taken together, our study discovered eEF1A1 as a novel photosensitizer binding protein, which may play an essential role in the enrichment of ALA-induced PpIX in cancer cells during PDT. These suggested eEF1A1 as a molecular marker to predict the selectivity and efficiency of 5-ALA based PDT in cancer therapy. PMID:27150264

  13. eEF1A1 binds and enriches protoporphyrin IX in cancer cells in 5-aminolevulinic acid based photodynamic therapy

    NASA Astrophysics Data System (ADS)

    Fan, Zhichao; Cui, Xiaojun; Wei, Dan; Liu, Wei; Li, Buhong; He, Hao; Ye, Huamao; Zhu, Naishuo; Wei, Xunbin

    2016-05-01

    Photodynamic therapy (PDT) with protoporphyrin IX (PpIX), which is endogenously derived from 5-aminolevulinic acid (5-ALA) or its derivatives, is a promising modality for the treatment of both pre-malignant and malignant lesions. However, the mechanisms of how ALA-induced PpIX selectively accumulated in the tumors are not fully elucidated. Here we discovered that eukaryotic translation elongation factor 1 alpha 1 (eEF1A1) interacted with PpIX (with an affinity constant of 2.96 × 106 M‑1). Microscopy imaging showed that ALA-induced PpIX was co-localized with eEF1A1 in cancer cells. eEF1A1 was found to enrich ALA-induced PpIX in cells by competitively blocking the downstream bioavailability of PpIX. Taken together, our study discovered eEF1A1 as a novel photosensitizer binding protein, which may play an essential role in the enrichment of ALA-induced PpIX in cancer cells during PDT. These suggested eEF1A1 as a molecular marker to predict the selectivity and efficiency of 5-ALA based PDT in cancer therapy.

  14. eEF1A1 binds and enriches protoporphyrin IX in cancer cells in 5-aminolevulinic acid based photodynamic therapy

    PubMed Central

    Fan, Zhichao; Cui, Xiaojun; Wei, Dan; Liu, Wei; Li, Buhong; He, Hao; Ye, Huamao; Zhu, Naishuo; Wei, Xunbin

    2016-01-01

    Photodynamic therapy (PDT) with protoporphyrin IX (PpIX), which is endogenously derived from 5-aminolevulinic acid (5-ALA) or its derivatives, is a promising modality for the treatment of both pre-malignant and malignant lesions. However, the mechanisms of how ALA-induced PpIX selectively accumulated in the tumors are not fully elucidated. Here we discovered that eukaryotic translation elongation factor 1 alpha 1 (eEF1A1) interacted with PpIX (with an affinity constant of 2.96 × 106 M−1). Microscopy imaging showed that ALA-induced PpIX was co-localized with eEF1A1 in cancer cells. eEF1A1 was found to enrich ALA-induced PpIX in cells by competitively blocking the downstream bioavailability of PpIX. Taken together, our study discovered eEF1A1 as a novel photosensitizer binding protein, which may play an essential role in the enrichment of ALA-induced PpIX in cancer cells during PDT. These suggested eEF1A1 as a molecular marker to predict the selectivity and efficiency of 5-ALA based PDT in cancer therapy. PMID:27150264

  15. Wavelength-dependent in-vitro and in-vivo photodynamic effects after sensitization with 5-aminolevulinic acid induced protoporphyrin IX

    NASA Astrophysics Data System (ADS)

    Szeimies, Rolf-Markus; Abels, Christoph; Fritsch, Clemens; Steinbach, Pia; Baeumler, Wolfgang; Messmann, Helmut; Goetz, Alwin E.; Goerz, Guenter; Landthaler, Michael

    1996-01-01

    Photodynamic therapy (PDT) with topically applied 5-aminolevulinic acid (ALA) is of growing interest, in particular in dermatology. Due to the fact that PDT with intravenously administered Photofrin is the only clinically approved sensitizer so far and is performed at a wavelength of 630 nm, this wavelength is also used in most experimental and clinical trials with ALA. In this study influence of irradiation with coherent light from a tunable dye laser at different wavelengths ranging from 625 to 649 nm was investigated. In in vitro experiments HaCaT immortalized human keratinocytes were sensitized with 30 (mu) g/ml ALA for 24 hrs. By determination of cell viability with the MTT test, best cell-killing effects were observed following irradiation at 635 nm. In an in vivo setting using an amelanotic melanoma (A-Mel-3) grown subcutaneously in Syrian Golden hamsters, these results were confirmed: tumor growth determined by measuring tumor volume increase after 28 days was less pronounced in animals treated with 100 mg/kg ALA i.v. and irradiated 2.5 hrs. later at 635 nm, as compared to animals receiving an equal dose and irradiated at 630 nm. This observation in vitro is probably due to large amounts of photosensitizing protoporphyrin IX (PP) localized in cell membranes which is visualized by confocal laser scanning microscopy (CLSM) and determined by HPLC analysis. These results suggest that in ALA-PDT when a coherent light source is used probably better results are achieved irradiating at 635 nm.

  16. Alleviation of lead toxicity by 5-aminolevulinic acid is related to elevated growth, photosynthesis, and suppressed ultrastructural damages in oilseed rape.

    PubMed

    Tian, Tian; Ali, Basharat; Qin, Yebo; Malik, Zaffar; Gill, Rafaqat A; Ali, Shafaqat; Zhou, Weijun

    2014-01-01

    Lead (Pb) is a widely spread pollutant and leads to diverse morphological and structural changes in the plants. In this study, alleviating role of 5-aminolevulinic acid (ALA) in oilseed rape (Brassica napus L.) was investigated with or without foliar application of ALA (25 mg L(-1)) in hydroponic environment under different Pb levels (0, 100, and 400 µM). Outcomes stated that plant morphology and photosynthetic attributes were reduced under the application of Pb alone. However, ALA application significantly increased the plant growth and photosynthetic parameters under Pb toxicity. Moreover, ALA also lowered the Pb concentration in shoots and roots under Pb toxicity. The microscopic studies depicted that exogenously applied ALA ameliorated the Pb stress and significantly improved the cell ultrastructures. After application of ALA under Pb stress, mesophyll cell had well-developed nucleus and chloroplast having a number of starch granules. Moreover, micrographs illustrated that root tip cell contained well-developed nucleus, a number of mitochondria, and golgi bodies. These results proposed that under 15-day Pb-induced stress, ALA improved the plant growth, chlorophyll content, photosynthetic parameters, and ultrastructural modifications in leaf mesophyll and root tip cells of the B. napus plants.

  17. Inhibition of MAPK signaling pathways enhances cell death induced by 5-Aminolevulinic acid-photodynamic therapy in skin squamous carcinoma cells.

    PubMed

    Ge, Xinhong; Liu, Jianping; Shi, Zhiyun; Jing, Li; Yu, Nan; Zhang, Xiujuan; Jiao, Yaning; Wang, Yili; Li, P Andy

    2016-04-01

    Combination of a photosensitizer, 5-aminolevulinic acid (ALA), with photodynamic therapy (PDT) has been widely used to treat skin squamous cell carcinoma (SCC). However, a portion of SCC patients do not respond well to PDT. The molecular reason for this resistance is not clear. We hypothesize that mitogen-activated phosphorylation kinase (MAPK) plays a key role in mediating SCC resistance to PDT. To determine whether inhibition of MAPK signaling enhances the anti-tumor effect of ALA-PDT in SCC. The human squamous carcinoma cell line, SCL-1, was either untreated or treated with various combinations of ALA, PDT light source and inhibitors of MAPK signaling components. ALA-PDT treatment significantly decreased cell viability, increased the percentage of annexin-V positive cells and resulted in formation of apoptotic bodies. ALA-PDT treated cells showed increased levels of p-MEK, p-ERK1/2, p-p38, p-Elk-1, p-JNK and p-c-Jun. Addition of inhibitors for ERK1/2 (PD98059), p38 (SB203580) and JNK (SP60125) reversed the changes and led to a more dramatic decrease in SCL-1 cell viability than seen with ALA-PDT alone. Inhibition of the MAPK pathway enhances the cytotoxic effect of ALA-PDT on SCL-1.

  18. Differential antioxidant defense and detoxification mechanisms in photodynamically stressed rice plants treated with the deregulators of porphyrin biosynthesis, 5-aminolevulinic acid and oxyfluorfen.

    PubMed

    Phung, Thu-Ha; Jung, Sunyo

    2015-04-01

    This study focuses on differential molecular mechanisms of antioxidant and detoxification systems in rice plants under two different types of photodynamic stress imposed by porphyrin deregulators, 5-aminolevulinic acid (ALA) and oxyfluorfen (OF). The ALA-treated plants with white necrosis exhibited a greater decrease in photochemical quantum efficiency, Fv/Fm, as well as a greater increase in activity of superoxide dismutase, compared to the OF-treated plants. By contrast, the brown necrosis in OF-treated plants resulted in not only more widely dispersed H2O2 production and greater increases in H2O2-decomposing enzymes, catalase and peroxidase, but also lower ascorbate redox state. In addition, ALA- and OF-treated plants markedly up-regulated transcript levels of genes involved in detoxification processes including transport and movement, cellular homeostasis, and xenobiotic conjugation, with prominent up-regulation of serine/threonine kinase and chaperone only in ALA-treated plants. Our results demonstrate that different photodynamic stress imposed by ALA and OF developed differential actions of antioxidant enzymes and detoxification. Particularly, detoxification system may play potential roles in plant protection against photodynamic stress imposed by porphyrin deregulators, thereby contributing to alleviation of photodynamic damage.

  19. Synergism of herbicide toxicity by 5-aminolevulinic acid is related to physiological and ultra-structural disorders in crickweed (Malachium aquaticum L.).

    PubMed

    Xu, Ling; Zhang, Wenfang; Ali, Basharat; Islam, Faisal; Zhu, Jinwen; Zhou, Weijun

    2015-11-01

    Selection of effective herbicides to control weeds has been one of the major objectives of scientists. This study determines the differential tolerance or susceptibility of crickweed (Malachium aquaticum L.) to various concentration combinations of 5-aminolevulinic acid (ALA) (1, 10 and 100mg/L) and propyl 4-(2-(4,6-dimethoxypyrimidin-2-yloxy)benzylamino)benzoate (ZJ0273) (100, 200, and 500mg/L). ALA was applied as pre- and post-treatment alone or in combination with ZJ0273. Results showed that ZJ0273 stress alone imposed negative effects on M. aquaticum seedling's growth, net photosynthetic rates and SPAD values, and the rate of decline was consistently increased with the increase in ZJ0273 concentration. The ZJ0273 treatment showed a gradual decrease in the activities of antioxidant enzymes peroxidase (POD), superoxide dismutase (SOD), and ascorbate peroxidase (APX), and increase in the accumulation of malondialdehyde (MDA). Changes in chloroplast swelling, increased number of plastoglobuli, disruption of thylakoid, disintegrated mitochondria and turbid nucleoplasm were noticed. Moreover, SDS-PAGE analysis of total proteins revealed that herbicide stress in the leaves was associated with the decrease or disappearance of some protein bands. Further, two-dimensional gel electrophoresis (2-DE) results showed that proteins in different spots were classified into three types for M. aquaticum. These results indicate that the combined treatment of ALA and ZJ0273 synergizes the herbicide toxicity which is different from its independent effects on M. aquaticum and thus, could improve weed control efficacy. PMID:26615151

  20. Inhibition of MAPK signaling pathways enhances cell death induced by 5-Aminolevulinic acid-photodynamic therapy in skin squamous carcinoma cells.

    PubMed

    Ge, Xinhong; Liu, Jianping; Shi, Zhiyun; Jing, Li; Yu, Nan; Zhang, Xiujuan; Jiao, Yaning; Wang, Yili; Li, P Andy

    2016-04-01

    Combination of a photosensitizer, 5-aminolevulinic acid (ALA), with photodynamic therapy (PDT) has been widely used to treat skin squamous cell carcinoma (SCC). However, a portion of SCC patients do not respond well to PDT. The molecular reason for this resistance is not clear. We hypothesize that mitogen-activated phosphorylation kinase (MAPK) plays a key role in mediating SCC resistance to PDT. To determine whether inhibition of MAPK signaling enhances the anti-tumor effect of ALA-PDT in SCC. The human squamous carcinoma cell line, SCL-1, was either untreated or treated with various combinations of ALA, PDT light source and inhibitors of MAPK signaling components. ALA-PDT treatment significantly decreased cell viability, increased the percentage of annexin-V positive cells and resulted in formation of apoptotic bodies. ALA-PDT treated cells showed increased levels of p-MEK, p-ERK1/2, p-p38, p-Elk-1, p-JNK and p-c-Jun. Addition of inhibitors for ERK1/2 (PD98059), p38 (SB203580) and JNK (SP60125) reversed the changes and led to a more dramatic decrease in SCL-1 cell viability than seen with ALA-PDT alone. Inhibition of the MAPK pathway enhances the cytotoxic effect of ALA-PDT on SCL-1. PMID:27032574

  1. Alleviation of Lead Toxicity by 5-Aminolevulinic Acid Is Related to Elevated Growth, Photosynthesis, and Suppressed Ultrastructural Damages in Oilseed Rape

    PubMed Central

    Tian, Tian; Qin, Yebo; Gill, Rafaqat A.; Ali, Shafaqat

    2014-01-01

    Lead (Pb) is a widely spread pollutant and leads to diverse morphological and structural changes in the plants. In this study, alleviating role of 5-aminolevulinic acid (ALA) in oilseed rape (Brassica napus L.) was investigated with or without foliar application of ALA (25 mg L−1) in hydroponic environment under different Pb levels (0, 100, and 400 µM). Outcomes stated that plant morphology and photosynthetic attributes were reduced under the application of Pb alone. However, ALA application significantly increased the plant growth and photosynthetic parameters under Pb toxicity. Moreover, ALA also lowered the Pb concentration in shoots and roots under Pb toxicity. The microscopic studies depicted that exogenously applied ALA ameliorated the Pb stress and significantly improved the cell ultrastructures. After application of ALA under Pb stress, mesophyll cell had well-developed nucleus and chloroplast having a number of starch granules. Moreover, micrographs illustrated that root tip cell contained well-developed nucleus, a number of mitochondria, and golgi bodies. These results proposed that under 15-day Pb-induced stress, ALA improved the plant growth, chlorophyll content, photosynthetic parameters, and ultrastructural modifications in leaf mesophyll and root tip cells of the B. napus plants. PMID:24683549

  2. In vitro study of cell death with 5-aminolevulinic acid based photodynamic therapy to improve the efficiency of cancer treatment

    NASA Astrophysics Data System (ADS)

    Firdous, S.; Nawaz, M.; Ikram, M.; Ahmed, M.

    2012-03-01

    Photodynamic therapy (PDT) is a kind of photochemo therapeutic treatment that exerts its effect mainly through the induction of cell death. Distinct types of cell death may be elicited by different PDT regimes. In this study, efforts are underway to optimize PDT protocols for improved efficacy and combination of all three PDT mechanisms involved in the different human carcinomas cell narcosis. Our in vitro cell culture experiments with 5-aminolevulanic acid (ALA) a clinically approved photiosensitizer (PS) and 635 nm laser light have yielded promising results, as follow: (1) (human cervical cancer (HeLa) cell line incubated, for 18 h, with 30 μg/ml of 5-ALA, treated with laser light dose of 50 J/cm2 can produce 85% of cell killing (2) human larynx carcinoma (Hep2c) cell line incubated, for 7 h, with 55 μg/ml of 5-ALA, treated with laser light dose of 85 J/cm2 can produce 75% of cell killing (3) human liver cancer (HepG2) cell line incubated, for 22-48 h, with 262 μg/ml of 5-ALA, treated with laser light dose of 120 J/cm2 can produce 95% of cell killing (4) human muscle cancer (RD) cell line incubated, for 47 h, with 250 μg/ml of 5-ALA, treated with laser light dose of 80 J/cm2 can produce 76% of cell killing (5) Human embryonic kidney (HEK293T) cell line incu-bated, for 18 h, with 400 μg/ml of 5-ALA, treated with laser light dose of 40 J/cm2 can produce 82% of cell killing confirming the efficacy of photodynamic therapy.

  3. 5-Aminolevulinic Acid Protects against Cisplatin-Induced Nephrotoxicity without Compromising the Anticancer Efficiency of Cisplatin in Rats In Vitro and In Vivo

    PubMed Central

    Matsumoto, Tatsuki; Ishihara, Masayuki; Hamada, Kazu; Shimamura, Yoshiko; Ogata, Koji; Inoue, Kosuke; Taniguchi, Yoshinori; Horino, Taro; Karashima, Takashi; Tamura, Kenji; Fukuhara, Hideo; Fujimoto, Shimpei; Tsuda, Masayuki; Shuin, Taro

    2013-01-01

    Background/Aims Nephrotoxicity is a frequent and major limitation in cisplatin (CDDP)-based chemotherapy. 5-Aminolevulinic acid (ALA) is widely distributed in animal cells, and it is a precursor of tetrapyrole compounds such as heme that is fundamentally important in aerobic energy metabolism. The aim of this study is to evaluate the protective role of ALA in CDDP-induced acute kidney injury (AKI). Method We used CDDP-induced AKI rat model and cultured renal tubular cells (NRK-52E). We divided four groups of rats: control, CDDP only, CDDP + ALA(post);(ALA 10 mg/kg + Fe in drinking water) after CDDP, CDDP + ALA(pre & post). Result CDDP increased Cr up to 6.5 mg/dl, BUN up to 230 mg/dl, and ALA significantly reduced these changes. ALA ameliorates CDDP-induced morphological renal damages, and reduced tubular apoptosis evaluated by TUNEL staining and cleaved caspase 3. Protein and mRNA levels of ATP5α, complex(COX) IV, UCP2, PGC-1α in renal tissue were significantly decreased by CDDP, and ALA ameliorates reduction of these enzymes. In contrast, Heme Oxigenase (HO)-1 level is induced by CDDP treatment, and ALA treatment further up-regulates HO-1 levels. In NRK-52E cells, the CDDP-induced reduction of protein and mRNA levels of mitochondrial enzymes was significantly recovered by ALA + Fe. CDDP-induced apoptosis were ameliorated by ALA + Fe treatment. Furthermore, we evaluated the size of transplantated bladder carcinoma to the rat skin, and ALA did not change the anti cancer effects of CDDP. Conclusion These data suggested that the protective role of ALA in cisplatin-induced AKI is via protection of mitochondrial viability and prevents tubular apoptosis. Also there are no significant effects of ALA on anticancer efficiency of CDDP in rats. Thus, ALA has the potential to prevent CDDP nephrotoxicity without compromising its anticancer efficacy. PMID:24324635

  4. Topical delivery of 5-aminolevulinic acid-encapsulated ethosomes in a hyperproliferative skin animal model using the CLSM technique to evaluate the penetration behavior.

    PubMed

    Fang, Yi-Ping; Huang, Yaw-Bin; Wu, Pao-Chu; Tsai, Yi-Hung

    2009-11-01

    Psoriasis, an inflammatory skin disease, exhibits recurring itching, soreness, and cracked and bleeding skin. Currently, the topical delivery of 5-aminolevulinic acid-photodynamic therapy (ALA-PDT) is an optional treatment for psoriasis which provides long-term therapeutic effects, is non-toxic and enjoys better compliance with patients. However, the precursor of ALA is hydrophilic, and thus its ability to penetrate the skin is limited. Also, little research has provided a platform to investigate the penetration behavior in disordered skin. We employed a highly potent ethosomal carrier (phosphatidylethanolamine; PE) to investigate the penetration behavior of ALA and the recovery of skin in a hyperproliferative murine model. We found that the application of ethosomes produced a significant increase in cumulative amounts of 5-26-fold in normal and hyperproliferative murine skin samples when compared to an ALA aqueous solution; and the ALA aqueous solution appeared less precise in terms of the penetration mode in hyperproliferative murine skin. After the ethosomes had been applied, the protoporphyrin IX (PpIX) intensity increased about 3.64-fold compared with that of the ALA aqueous solution, and the penetration depth reached 30-80 microm. The results demonstrated that the ethosomal carrier significantly improved the delivery of ALA and the formation of PpIX in both normal and hyperproliferative murine skin samples, and the expression level of tumor necrosis factor (TNF)-alpha was reduced after the ALA-ethosomes were applied to treat hyperproliferative murine skin. Furthermore, the results of present study encourage more investigations on the mechanism of the interaction with ethosomes and hyperproliferative murine skin.

  5. Topical delivery of 5-aminolevulinic acid-encapsulated ethosomes in a hyperproliferative skin animal model using the CLSM technique to evaluate the penetration behavior.

    PubMed

    Fang, Yi-Ping; Huang, Yaw-Bin; Wu, Pao-Chu; Tsai, Yi-Hung

    2009-11-01

    Psoriasis, an inflammatory skin disease, exhibits recurring itching, soreness, and cracked and bleeding skin. Currently, the topical delivery of 5-aminolevulinic acid-photodynamic therapy (ALA-PDT) is an optional treatment for psoriasis which provides long-term therapeutic effects, is non-toxic and enjoys better compliance with patients. However, the precursor of ALA is hydrophilic, and thus its ability to penetrate the skin is limited. Also, little research has provided a platform to investigate the penetration behavior in disordered skin. We employed a highly potent ethosomal carrier (phosphatidylethanolamine; PE) to investigate the penetration behavior of ALA and the recovery of skin in a hyperproliferative murine model. We found that the application of ethosomes produced a significant increase in cumulative amounts of 5-26-fold in normal and hyperproliferative murine skin samples when compared to an ALA aqueous solution; and the ALA aqueous solution appeared less precise in terms of the penetration mode in hyperproliferative murine skin. After the ethosomes had been applied, the protoporphyrin IX (PpIX) intensity increased about 3.64-fold compared with that of the ALA aqueous solution, and the penetration depth reached 30-80 microm. The results demonstrated that the ethosomal carrier significantly improved the delivery of ALA and the formation of PpIX in both normal and hyperproliferative murine skin samples, and the expression level of tumor necrosis factor (TNF)-alpha was reduced after the ALA-ethosomes were applied to treat hyperproliferative murine skin. Furthermore, the results of present study encourage more investigations on the mechanism of the interaction with ethosomes and hyperproliferative murine skin. PMID:19660544

  6. Differential antioxidant defense and detoxification mechanisms in photodynamically stressed rice plants treated with the deregulators of porphyrin biosynthesis, 5-aminolevulinic acid and oxyfluorfen

    SciTech Connect

    Phung, Thu-Ha; Jung, Sunyo

    2015-04-03

    This study focuses on differential molecular mechanisms of antioxidant and detoxification systems in rice plants under two different types of photodynamic stress imposed by porphyrin deregulators, 5-aminolevulinic acid (ALA) and oxyfluorfen (OF). The ALA-treated plants with white necrosis exhibited a greater decrease in photochemical quantum efficiency, F{sub v}/F{sub m}, as well as a greater increase in activity of superoxide dismutase, compared to the OF-treated plants. By contrast, the brown necrosis in OF-treated plants resulted in not only more widely dispersed H{sub 2}O{sub 2} production and greater increases in H{sub 2}O{sub 2}-decomposing enzymes, catalase and peroxidase, but also lower ascorbate redox state. In addition, ALA- and OF-treated plants markedly up-regulated transcript levels of genes involved in detoxification processes including transport and movement, cellular homeostasis, and xenobiotic conjugation, with prominent up-regulation of serine/threonine kinase and chaperone only in ALA-treated plants. Our results demonstrate that different photodynamic stress imposed by ALA and OF developed differential actions of antioxidant enzymes and detoxification. Particularly, detoxification system may play potential roles in plant protection against photodynamic stress imposed by porphyrin deregulators, thereby contributing to alleviation of photodynamic damage. - Highlights: • We employ two different types of photodynamic stress, white and brown necrosis. • We examine molecular mechanisms of antioxidative and detoxification systems. • ALA and OF develop differential actions of antioxidant and detoxification systems. • Coordinated mechanism of antioxidants and detoxification works against toxic ROS. • Detoxification system plays critical roles in protection against photodynamic stress.

  7. Effects of exogenous 5-aminolevulinic acid on photosynthesis, stomatal conductance, transpiration rate, and PIP gene expression of tomato seedlings subject to salinity stress.

    PubMed

    Zhao, Y Y; Yan, F; Hu, L P; Zhou, X T; Zou, Z R; Cui, L R

    2015-01-01

    The effects of exogenous 5-aminolevulinic acid (ALA) on photosynthesis, plant growth, and the expression of two aquaporin genes in tomato seedlings under control and salinity conditions were investigated. Exogenous ALA application significantly improved net photosynthetic rate (Pn), total chlorophyll content, and plant biomass accumulation of tomato seedlings under salinity stress. As revealed by real-time PCR analyses, after treatment with ALA alone, expression of both LePIP1 and LePIP2 in the two tomato cultivars was up-regulated at 2 h and subsequently decreased to normal levels. Under salinity stress, transcript levels of LePIP1 in both leaves and roots of salt-sensitive cultivars (cv. Zhongza No.9) increased significantly and were considerably higher than in cultivars exposed to ALA alone. In contrast, the expression levels of LePIP1 and LePIP2 in cvs. Jinpeng No.1 cultivars were slightly lower under salinity stress than under ALA treatment. In addition, transcript levels of both LePIP1 and LePIP2 in the roots of Jinpeng No. 1 cultivars were considerably lower than those in the roots of Zhongza No. 9 cultivars under salinity stress, regardless of ALA supplementation, implying that Jinpeng No. 1 cultivars had a better capacity to maintain membrane intrinsic protein stability. Further, ALA application distinctly counteracted the up- or down-regulation of LePIP1 and LePIP2 in both cultivars under salinity stress, in accordance with the improvements instomatal conductance, transpiration rate, and Pn of tomato leaves. The results presented here indicate that ALA controls aquaporin expression, thus, presumably ALA regulates water homeostasis and enhances salt tolerance of tomato seedlings. PMID:26125845

  8. Impact of 5-aminolevulinic acid with iron supplementation on exercise efficiency and home-based walking training achievement in older women.

    PubMed

    Masuki, Shizue; Morita, Atsumi; Kamijo, Yoshi-ichiro; Ikegawa, Shigeki; Kataoka, Yufuko; Ogawa, Yu; Sumiyoshi, Eri; Takahashi, Kiwamu; Tanaka, Tohru; Nakajima, Motowo; Nose, Hiroshi

    2016-01-01

    A reduction in exercise efficiency with aging limits daily living activities. We examined whether 5-aminolevulinic acid (ALA) with sodium ferrous citrate (SFC) increased exercise efficiency and voluntary achievement of interval walking training (IWT) in older women. Ten women [65 ± 3(SD) yr] who had performed IWT for >12 mo and were currently performing IWT participated in this study. The study was conducted in a placebo-controlled, double-blind crossover design. All subjects underwent two trials for 7 days each in which they performed IWT with ALA+SFC (100 and 115 mg/day, respectively) or placebo supplement intake (CNT), intermittently with a 2-wk washout period. Before and after each trial, subjects underwent a graded cycling test at 27.0 °C atmospheric temperature and 50% relative humidity, and oxygen consumption rate, carbon dioxide production rate, and lactate concentration in plasma were measured. Furthermore, for the first 6 days of each trial, exercise intensity for IWT was measured by accelerometry. We found that, in the ALA+SFC trial, oxygen consumption rate and carbon dioxide production rate during graded cycling decreased by 12% (P < 0.001) and 11% (P = 0.001) at every workload, respectively, accompanied by a 16% reduction in lactate concentration in plasma (P < 0.001), although all remained unchanged in the CNT trial (P > 0.2). All of the reductions were significantly greater in the ALA+SFC than the CNT trial (P < 0.05). Furthermore, the training days, impulse, and time at fast walking were 42% (P = 0.028), 102% (P = 0.027), and 69% (P = 0.039) higher during the ALA+SFC than the CNT intake period, respectively. Thus ALA+SFC supplementation augmented exercise efficiency and thereby improved IWT achievement in older women.

  9. Impact of 5-aminolevulinic acid with iron supplementation on exercise efficiency and home-based walking training achievement in older women

    PubMed Central

    Masuki, Shizue; Morita, Atsumi; Kamijo, Yoshi-ichiro; Ikegawa, Shigeki; Kataoka, Yufuko; Ogawa, Yu; Sumiyoshi, Eri; Takahashi, Kiwamu; Tanaka, Tohru; Nakajima, Motowo

    2015-01-01

    A reduction in exercise efficiency with aging limits daily living activities. We examined whether 5-aminolevulinic acid (ALA) with sodium ferrous citrate (SFC) increased exercise efficiency and voluntary achievement of interval walking training (IWT) in older women. Ten women [65 ± 3(SD) yr] who had performed IWT for >12 mo and were currently performing IWT participated in this study. The study was conducted in a placebo-controlled, double-blind crossover design. All subjects underwent two trials for 7 days each in which they performed IWT with ALA+SFC (100 and 115 mg/day, respectively) or placebo supplement intake (CNT), intermittently with a 2-wk washout period. Before and after each trial, subjects underwent a graded cycling test at 27.0°C atmospheric temperature and 50% relative humidity, and oxygen consumption rate, carbon dioxide production rate, and lactate concentration in plasma were measured. Furthermore, for the first 6 days of each trial, exercise intensity for IWT was measured by accelerometry. We found that, in the ALA+SFC trial, oxygen consumption rate and carbon dioxide production rate during graded cycling decreased by 12% (P < 0.001) and 11% (P = 0.001) at every workload, respectively, accompanied by a 16% reduction in lactate concentration in plasma (P < 0.001), although all remained unchanged in the CNT trial (P > 0.2). All of the reductions were significantly greater in the ALA+SFC than the CNT trial (P < 0.05). Furthermore, the training days, impulse, and time at fast walking were 42% (P = 0.028), 102% (P = 0.027), and 69% (P = 0.039) higher during the ALA+SFC than the CNT intake period, respectively. Thus ALA+SFC supplementation augmented exercise efficiency and thereby improved IWT achievement in older women. PMID:26514619

  10. Effects of exogenous 5-aminolevulinic acid on photosynthesis, stomatal conductance, transpiration rate, and PIP gene expression of tomato seedlings subject to salinity stress.

    PubMed

    Zhao, Y Y; Yan, F; Hu, L P; Zhou, X T; Zou, Z R; Cui, L R

    2015-06-11

    The effects of exogenous 5-aminolevulinic acid (ALA) on photosynthesis, plant growth, and the expression of two aquaporin genes in tomato seedlings under control and salinity conditions were investigated. Exogenous ALA application significantly improved net photosynthetic rate (Pn), total chlorophyll content, and plant biomass accumulation of tomato seedlings under salinity stress. As revealed by real-time PCR analyses, after treatment with ALA alone, expression of both LePIP1 and LePIP2 in the two tomato cultivars was up-regulated at 2 h and subsequently decreased to normal levels. Under salinity stress, transcript levels of LePIP1 in both leaves and roots of salt-sensitive cultivars (cv. Zhongza No.9) increased significantly and were considerably higher than in cultivars exposed to ALA alone. In contrast, the expression levels of LePIP1 and LePIP2 in cvs. Jinpeng No.1 cultivars were slightly lower under salinity stress than under ALA treatment. In addition, transcript levels of both LePIP1 and LePIP2 in the roots of Jinpeng No. 1 cultivars were considerably lower than those in the roots of Zhongza No. 9 cultivars under salinity stress, regardless of ALA supplementation, implying that Jinpeng No. 1 cultivars had a better capacity to maintain membrane intrinsic protein stability. Further, ALA application distinctly counteracted the up- or down-regulation of LePIP1 and LePIP2 in both cultivars under salinity stress, in accordance with the improvements instomatal conductance, transpiration rate, and Pn of tomato leaves. The results presented here indicate that ALA controls aquaporin expression, thus, presumably ALA regulates water homeostasis and enhances salt tolerance of tomato seedlings.

  11. 5-Aminolevulinic Acid Thins Pear Fruits by Inhibiting Pollen Tube Growth via Ca(2+)-ATPase-Mediated Ca(2+) Efflux.

    PubMed

    An, Yuyan; Li, Jie; Duan, Chunhui; Liu, Longbo; Sun, Yongping; Cao, Rongxiang; Wang, Liangju

    2016-01-01

    Chemical fruit thinning has become a popular practice in modern fruit orchards for achieving high quality fruits, reducing costs of hand thinning and promoting return bloom. However, most of the suggested chemical thinners are often concerned for their detrimental effects and environmental problems. 5-Aminolevulic acid (ALA) is a natural, nontoxic, biodegradable, and environment-friendly plant growth regulator. One of its outstanding roles is improving plant photosynthesis and fruit quality. Here, results showed that applying 100-200 mg/L ALA at full bloom stage significantly reduced pear fruit set. Both in vivo and in vitro studies showed that ALA significantly inhibited pollen germination and tube growth. ALA decreased not only cytosolic Ca(2+) concentration ([Ca(2+)]cyt) but also "tip-focused" [Ca(2+)]cyt gradient, indicating that ALA inhibited pollen tube growth by down-regulating calcium signaling. ALA drastically enhanced pollen Ca(2+)-ATPase activity, suggesting that ALA-induced decrease of calcium signaling probably resulted from activating calcium pump. The significant negative correlations between Ca(2+)-ATPase activity and pollen germination or pollen tube length further demonstrated the critical role of calcium pump in ALA's negative effect on pollen germination. Taken together, our results suggest that ALA at low concentrations is a potential biochemical thinner, and it inhibits pollen germination and tube growth via Ca(2+) efflux by activating Ca(2+)-ATPase, thereby thinning fruits by preventing fertilization.

  12. 5-Aminolevulinic Acid Thins Pear Fruits by Inhibiting Pollen Tube Growth via Ca2+-ATPase-Mediated Ca2+ Efflux

    PubMed Central

    An, Yuyan; Li, Jie; Duan, Chunhui; Liu, Longbo; Sun, Yongping; Cao, Rongxiang; Wang, Liangju

    2016-01-01

    Chemical fruit thinning has become a popular practice in modern fruit orchards for achieving high quality fruits, reducing costs of hand thinning and promoting return bloom. However, most of the suggested chemical thinners are often concerned for their detrimental effects and environmental problems. 5-Aminolevulic acid (ALA) is a natural, nontoxic, biodegradable, and environment-friendly plant growth regulator. One of its outstanding roles is improving plant photosynthesis and fruit quality. Here, results showed that applying 100–200 mg/L ALA at full bloom stage significantly reduced pear fruit set. Both in vivo and in vitro studies showed that ALA significantly inhibited pollen germination and tube growth. ALA decreased not only cytosolic Ca2+ concentration ([Ca2+]cyt) but also “tip-focused” [Ca2+]cyt gradient, indicating that ALA inhibited pollen tube growth by down-regulating calcium signaling. ALA drastically enhanced pollen Ca2+-ATPase activity, suggesting that ALA-induced decrease of calcium signaling probably resulted from activating calcium pump. The significant negative correlations between Ca2+-ATPase activity and pollen germination or pollen tube length further demonstrated the critical role of calcium pump in ALA's negative effect on pollen germination. Taken together, our results suggest that ALA at low concentrations is a potential biochemical thinner, and it inhibits pollen germination and tube growth via Ca2+ efflux by activating Ca2+-ATPase, thereby thinning fruits by preventing fertilization. PMID:26904082

  13. Interstitial photodynamic therapy of canine prostate with meso-tetra-(m-hydroxyphenyl) chlorin and 5-aminolevulinic acid: a preliminary study

    NASA Astrophysics Data System (ADS)

    Chang, Shi-Chung; Buonaccorsi, Giovanni A.; MacRobert, Alexander J.; Bown, Stephen G.

    1996-01-01

    Photodynamic therapy (PDT) is proved to have potential for managing various malignancies. We investigated tissue biodistribution and photodynamic effects on a canine model in vivo using second generation photosensitizers, meso-tetra(m-hydroxyphenyl)chlorin (mTHPC) and 5-aminolaevulinic acid (ALA) to evaluate the feasibility and possible future application of PDT on the prostate. Using fluorescence microscopy, the optimal sensitization time of the prostate was between 24 - 72 hours with mTHPC and, 3 hours with ALA. After optimum time of sensitization, prostates of mature beagle were treated with laser at various sites by placing fiber interstitially under the guidance of transrectal ultrasound. The light dose for each treatment site was 100 J (100 mW for 1,000 seconds at the wavelength of 650 and 630 nm, respectively). With mTHPC, single laser fiber was able to induce organ confined PDT lesion as large as 20 by 18 by 18 mm in size. However, the PDT lesion with ALA was negligible 3 days after treatment. Physical distress manifested as urinary retention, poor appetite and body weigh loss, was more prominent with increasing number of treatment sites as a result of extensive prostatic swelling and urethral damages. However, these problems usually alleviated spontaneously 7 to 10 days after PDT. The characteristic histological changes were hemorrhagic necrosis and glandular destruction with preservation of interlobular collagen fibers. Urethral damage seen at the early stage healed by regeneration of urothelium in 4 weeks. We conclude that interstitial PDT with mTHPC is technically possible to produce extensive glandular necrosis in the normal prostate which heals safely and does not change the prostatic architecture. ALA, although it seems promising for bladder tumors, is much less effective than mTHPC on the prostate. With mTHPC, it might have the potential for treating prostate cancers localized in the periphery of the gland.

  14. Effect of cell cycle phase on the sensitivity of SAS cells to sonodynamic therapy using low-intensity ultrasound combined with 5-aminolevulinic acid in vitro.

    PubMed

    Li, Nan; Sun, Miao; Wang, Yao; Lv, Yanhong; Hu, Zheng; Cao, Wenwu; Zheng, Jinhua; Jiao, Xiaohui

    2015-08-01

    Sonodynamic therapy (SDT) with 5-aminolevulinic acid (5-ALA) can effectively inhibit various types of tumor in vitro and in vivo. However, the association between the efficacy of SDT and the phase of the cell cycle remains to be elucidated. 5-ALA may generate different quantities of sonosensitizer, protoporphyrin IX (PpIX), in different phases of the cell cycle, which may result in differences in sensitivity to 5-ALA-induced SDT. The present study aimed to investigate the effect of the cell cycle on the susceptibility of SAS cells to SDT following synchronization to different cell cycle phases. These results indicates that the rates of cell death and apoptosis of the SAS cells in the S and G2/M phases were significantly higher following SDT, compared with those in the G1-phase cells and unsynchronized cells, with a corresponding increase in PpIX in the S and G2/M cells. In addition, the expression of caspase-3 increased, while that of B-cell lymphoma (Bcl)-2 decreased markedly in theS and G2/M cells following SDT. Cyclin A was also expressed at higher levels in the S and G2/M cells, compared with the G1-phase cells. SDT also caused a significant upregulation of cyclin A in all phases of the cell cycle, however this was most marked in the S and G2/M cells. It was hypothesized that high expression levels of cyclin A in the S and G2/M cells may promote the induction of caspase-3 and reduce the induction of Bcl-2 by SDT and, therefore, enhance apoptosis. Taken together, these data demonstrated that cells in The S and G2/M phases generate more intracellular PpIX, have higher levels of cyclin A and are, therefore, more sensitive to SDT-induced cytotoxicity. These findings indicate the potential novel approach to preventing the onset of cancer by combining cell-cycle regulators with SDT. This sequential combination therapy may be a simple and cost-effective way of enhancing the effects of SDT in clinical settings.

  15. Melatonin protects against oxidative stress caused by delta-aminolevulinic acid: implications for cancer reduction.

    PubMed

    Karbownik, Małgorzata; Reiter, Russel J

    2002-01-01

    delta-Aminolevulinic acid (ALA) is a precursor of haem. The increased concentration of ALA is typically related to acute intermittent porphyria, hereditary tyrosinemia, and lead poisoning. delta-Aminolevulinic acid produced in excess accumulates in a number of organs, causes oxidative damage, and often leads to cancer. Melatonin (N-acetyl-5-methoxytryptamine) is a well-known antioxidant, free radical scavenger, and exhibits anticarcinogenic properties. It protects DNA, lipids, and proteins from oxidative damage. The protective effects of melatonin against ALA-induced oxidation of guanine bases, lipid peroxidation, and alterations in membrane fluidity in several organs have been documented. There is an inverse relationship between melatonin and ALA concentrations in both experimental and clinical conditions of porphyria. The marked efficacy of melatonin in protecting against ALA-related oxidative stress, its oncostatic properties, and low toxicity constitute reasons to consider the use of this indoleamine as a co-treatment in patients suffering from disturbances related to ALA accumulation.

  16. Role of delta-Aminolevulinic Acid in the Symptoms of Acute Porphyria

    PubMed Central

    Bissell, D. Montgomery; Lai, Jennifer C.; Meister, Raymond K.; Blanc, Paul D.

    2015-01-01

    Background Attacks of neuropathic pain, usually abdominal, are characteristic of the acute porphyrias and are accompanied by overproduction of heme-precursor molecules, specifically delta-aminolevulinic acid and porphobilinogen. The basis for the acute symptoms in these diseases has been speculative. Methods We review genetic acute porphyria, hereditary tyrosinemia, and an acquired condition, lead poisoning. All perturb heme synthesis and present with a very similar pain syndrome. Results While each of these conditions has characteristic urine biochemistry, all exhibit excess delta-aminolevulinic acid. Moreover, in all, treatment with hemin reduces delta-aminolevulinic acid and relieves symptoms. In contrast, use of recombinant porphobilinogen deaminase to knock down porphobilinogen in acute porphyria was ineffective. Conclusion There is now convincing evidence that delta-aminolevulinic acid is the cause of pain in the acute porphyrias. The efficacy of hemin infusion is due mainly, if not entirely, to its inhibition of hepatic delta-aminolevulinic acid synthase-1, the enzyme that catalyzes delta-aminolevulinic acid formation. Delta-aminolevulinic acid synthase-1 is a rational target for additional therapies to control symptoms in acute porphyria. PMID:25446301

  17. Delta-aminolevulinic acid dehydratase (ALAD) polymorphism in lead exposed Bangladeshi children and its effect on urinary aminolevulinic acid (ALA)

    SciTech Connect

    Tasmin, Saira; Furusawa, Hana; Ahmad, Sk. Akhtar; Watanabe, Chiho

    2015-01-15

    Background and objective: Lead has long been recognized as a harmful environmental pollutant. People in developing countries like Bangladesh still have a higher risk of lead exposure. Previous research has suggested that the delta-aminolevulinic acid dehydratase (ALAD) genotype can modify lead toxicity and individual susceptibility. As children are more susceptible to lead-induced toxicity, this study investigated whether the ALAD genotype influenced urinary excretion of delta-aminolevulinic acid (U-ALA) among children exposed to environmental lead in Bangladesh. Methods: Subjects were elementary schoolchildren from a semi-urban industrialized area in Bangladesh. A total of 222 children were studied. Blood and urine were collected to determine ALAD genotypes, blood lead levels and urinary aminolevulinic acid (U-ALA). Results: The mean BPb level was 9.7 µg/dl for the study children. BPb was significantly positively correlated with hemoglobin (p<0.01). In total, allele frequency for ALAD 1 and 2 was 0.83 and 0.17 respectively. The mean U-ALA concentration was lower in ALAD1-2/2-2 carriers than ALAD1-1 carriers for boys (p=0.001). But for girls, U-ALA did not differ significantly by genotype (p=0.26). When U-ALA was compared by genotype at the same exposure level in a multiple linear regression analysis, boys who were ALAD1-2/2-2 carriers still had a lower level of U-ALA compared to ALAD1-1carriers. Conclusion: This study provides information about the influence of ALAD polymorphism and its association with U-ALA in Bangladeshi children. Our results indicate that the ALAD1-2/2-2 genotype may have a protective effect in terms of U-ALA for environmentally lead exposed boys. - Highlights: • High blood lead level for the environmentally exposed schoolchildren. • BPb was significantly correlated with U-ALA and Hb. • Effect of ALAD genotype on U-ALA is differed by sex. • Lower U-ALA in ALAD2 than ALAD1 carriers only for boys at same exposure.

  18. Characterization of 5-aminolevulinate synthase from Agrobacterium radiobacter, screening new inhibitors for 5-aminolevulinate dehydratase from Escherichia coli and their potential use for high 5-aminolevulinate production.

    PubMed

    Lin, Jianping; Fu, Weiqi; Cen, Peilin

    2009-04-01

    The hemA gene encoding 5-aminolevulinate synthase (ALAS) from Agrobacterium radiobacter zju-0121 showed 92.6% homology with that from A. radiobacter ATCC4718 and contained several rare codons. To enhance the expression of this gene, Escherichia coli Rosetta(DE3), which is a rare codon optimizer strain, was used as the host to construct an efficient recombinant strain. And the encoded protein was over-expressed as fusion protein and was purified by affinity purification on Ni-NTA agarose and by gel filtration chromatography on Sephadex G-25 Medium resin. The recombinant protein was partly characterized, and D-glucose, D-fructose, D-xylose, D-mannose, L-arabinose, D-galactose, lactose, sucrose and maltose were detected to have no distinct inhibition on this recombinant ALAS. Meanwhile, 20mM D-glucose or D-xylose inhibited about 20% activity of ALA dehydratase (ALAD) from Escherichia coli Rosetta(DE3). Combining D-xylose as a new inhibitor for ALAD with D-glucose in fed-batch culture and based on the optimal culture system using Rosetta(DE3)/pET28a-hemA, the yield of ALA achieved was 7.3g/l (56 mM) under the appropriate conditions in the fermenter.

  19. The Value of 5-Aminolevulinic Acid in Low-grade Gliomas and High-grade Gliomas Lacking Glioblastoma Imaging Features: An Analysis Based on Fluorescence, Magnetic Resonance Imaging, 18F-Fluoroethyl Tyrosine Positron Emission Tomography, and Tumor Molecular Factors

    PubMed Central

    Jaber, Mohammed; Wölfer, Johannes; Ewelt, Christian; Holling, Markus; Hasselblatt, Martin; Niederstadt, Thomas; Zoubi, Tarek; Weckesser, Matthias

    2015-01-01

    BACKGROUND: Approximately 20% of grade II and most grade III gliomas fluoresce after 5-aminolevulinic acid (5-ALA) application. Conversely, approximately 30% of nonenhancing gliomas are actually high grade. OBJECTIVE: The aim of this study was to identify preoperative factors (ie, age, enhancement, 18F-fluoroethyl tyrosine positron emission tomography [18F-FET PET] uptake ratios) for predicting fluorescence in gliomas without typical glioblastomas imaging features and to determine whether fluorescence will allow prediction of tumor grade or molecular characteristics. METHODS: Patients harboring gliomas without typical glioblastoma imaging features were given 5-ALA. Fluorescence was recorded intraoperatively, and biopsy specimens collected from fluorescing tissue. World Health Organization (WHO) grade, Ki-67/MIB-1 index, IDH1 (R132H) mutation status, O6-methylguanine DNA methyltransferase (MGMT) promoter methylation status, and 1p/19q co-deletion status were assessed. Predictive factors for fluorescence were derived from preoperative magnetic resonance imaging and 18F-FET PET. Classification and regression tree analysis and receiver-operating-characteristic curves were generated for defining predictors. RESULTS: Of 166 tumors, 82 were diagnosed as WHO grade II, 76 as grade III, and 8 as glioblastomas grade IV. Contrast enhancement, tumor volume, and 18F-FET PET uptake ratio >1.85 predicted fluorescence. Fluorescence correlated with WHO grade (P < .001) and Ki-67/MIB-1 index (P < .001), but not with MGMT promoter methylation status, IDH1 mutation status, or 1p19q co-deletion status. The Ki-67/MIB-1 index in fluorescing grade III gliomas was higher than in nonfluorescing tumors, whereas in fluorescing and nonfluorescing grade II tumors, no differences were noted. CONCLUSION: Age, tumor volume, and 18F-FET PET uptake are factors predicting 5-ALA-induced fluorescence in gliomas without typical glioblastoma imaging features. Fluorescence was associated with an increased

  20. 5-Aminolevulinic Acid-Mediated Sonodynamic Therapy Promotes Phenotypic Switching from Dedifferentiated to Differentiated Phenotype via Reactive Oxygen Species and p38 Mitogen-Activated Protein Kinase in Vascular Smooth Muscle Cells.

    PubMed

    Dan, Juhua; Sun, Xin; Li, Wanlu; Zhang, Yun; Li, Xuesong; Xu, Haobo; Li, Zhitao; Tian, Zhen; Guo, Shuyuan; Yao, Jianting; Gao, Weidong; Tian, Ye

    2015-06-01

    Sonodynamic therapy (SDT) has been found to inhibit in-stent restenosis in animal models. However, the mechanism is not fully elucidated. Here, we investigated the effects of 5-aminolevulinic acid (ALA)-mediated SDT (ALA-SDT) on vascular smooth muscle cells (VSMCs), a cause of restenosis, with a focus on SDT-induced phenotypic switching. Serum-induced dedifferentiated VSMCs were cultured with ALA (1 mm, 24 h) and exposed to ultrasound (0.8 W/cm(2)) for 5 min. Results indicated that ALA-SDT inhibited the migration and proliferation of VSMCs and enhanced the expression of differentiated phenotypic markers in VSMCs. Additionally, ALA-SDT increased intracellular reactive oxygen species accumulation and phosphorylated p38 mitogen-activated protein kinase in VSMCs. Inhibition of reactive oxygen species elevation or p38 mitogen-activated protein kinase activity abolished the expression of smooth muscle 22α (SM22α) in VSMCs induced by ALA-SDT. Taken together, these results suggest that ALA-SDT promotes transformation of the VSMC phenotype from the dedifferentiated to differentiated status via reactive oxygen species and activated p38 mitogen-activated protein kinase.

  1. SOLUBLE HEPATIC δ-AMINOLEVULINIC ACID SYNTHETASE: END-PRODUCT INHIBITION OF THE PARTIALLY PURIFIED ENZYME*

    PubMed Central

    Scholnick, Perry L.; Hammaker, Lydia E.; Marver, Harvey S.

    1969-01-01

    The present study confirms the existence of hepatic δ-aminolevulinic acid synthetase in the cytosol of the liver, suggests that this enzyme may be in transit to the mitochondria, and defines some of the characteristics of the partially purified enzyme. The substrate and cofactor requirements are similar to those of mitochondrial δ-aminolevulinic acid synthetase. Heme strongly inhibits the partially purified enzyme. A number of proteins that bind heme block this inhibition, which explains previous failures to demonstrate heme inhibition in crude systems. End-product inhibition of δ-aminolevulinic acid synthetase in the mitochondria may play an important role in the regulation of heme biosynthesis in eukaryotic cells. PMID:5257968

  2. In vitro study of 5-aminolevulinic acid-based photodynamic therapy for apoptosis in human cervical HeLa cell line

    NASA Astrophysics Data System (ADS)

    Atif, M.; Firdous, S.; Khurshid, A.; Noreen, L.; Zaidi, S. S. Z.; Ikram, M.

    2009-12-01

    5-aminolevulanic acid (ALA), belonging among the promising second generation of sensitizers, was evaluated as an inducer of photodamage on HeLa (human cervical adenocarcinoma) cell line. A diode laser (635 nm) was used as a source for initiation of the photodynamic effect. We studied the influence of different incubation times, various concentrations of sensitizer, different irradiation doses and various combinations of sensitizer and light doses on the photodamage of HeLa cells. Viability of cells was determined by means of neutral red assay. The quantitative cellular uptake of ALA sensitizer was done by spectrophotometric measurements. No prominent cytotoxic or phototoxic effects on HeLa were observed due to sensitizer or light doses when studied independently of each other. However phototoxicity evoked by laser irradiated sensitizer was detected in HeLa cell line.

  3. {Delta}-Aminolevulinic acid dehydratase: A sensitive indicator of lead exposure in broiler chicks: (Gallus domesticus)

    SciTech Connect

    Bakalli, R.I.; Pesti, G.M.; Konjufca, V.

    1995-12-01

    Delta-aminolevulinic acid dehydratase, EC 4.2.1.24 (ALAD) is one of the enzymes participating in heme synthesis. The study reported in this paper was designed to determine the activity of erythrocyte ALAD anbd the relationship between this enzyme and tissue lead levels in chickens, during Pb intake and after withdrawing Bv from the feed. 20 refs., 3 tabs.

  4. 21 CFR 862.1060 - Delta-aminolevulinic acid test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Delta-aminolevulinic acid test system. 862.1060 Section 862.1060 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry...

  5. 21 CFR 862.1060 - Delta-aminolevulinic acid test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Delta-aminolevulinic acid test system. 862.1060 Section 862.1060 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry...

  6. 21 CFR 862.1060 - Delta-aminolevulinic acid test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Delta-aminolevulinic acid test system. 862.1060 Section 862.1060 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry...

  7. 21 CFR 862.1060 - Delta-aminolevulinic acid test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Delta-aminolevulinic acid test system. 862.1060 Section 862.1060 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry...

  8. 21 CFR 862.1060 - Delta-aminolevulinic acid test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Delta-aminolevulinic acid test system. 862.1060 Section 862.1060 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical Chemistry...

  9. Herbicide clomazone effects on δ-aminolevulinic acid activity and metabolic parameters in Cyprinus carpio.

    PubMed

    Menezes, Charlene; Leitemperger, Jossiele; Murussi, Camila; Toni, Cândida; Araújo, Maria do Carmo Santos; Farias, Iria Luiza; Perazzo, Giselle Xavier; Barbosa, Nilda Vargas; Loro, Vania Lucia

    2014-04-01

    The objective of this study was to investigate δ-aminolevulinic acid (δ-ALA-D) activity and metabolic parameters of Cyprinus carpio exposed to clomazone herbicide. Fish were exposed 2.5, 5, 10 and 20 mg L(-1) of clomazone for 192 h. Results indicated that δ-ALA-D activity was decreased in the gills at concentrations of 5 and 10 mg L(-1). Liver glycogen increased, while muscle and gill glycogen levels decreased at 5, 10 and 20 mg L(-1). Glucose was increased in the gills and plasma. Lactate decreased in the gills and liver and increased in the muscle. Protein and amino acids levels increased in the liver and gills and decreased in the muscle. At a clomazone concentration of 20 mg L(-1), ammonia increased in the gills and muscle and decreased in the liver. The results indicated that the metabolic parameters of glycogen, lactate, protein and amino acids in liver, muscle and gills, blood glucose levels, and the enzyme δ-ALA-D in gills may be useful indicators of clomazone toxicity in carp.

  10. The Effect of Multiple Sequential Light Sources to Activate Aminolevulinic Acid in the Treatment of Actinic Keratoses: A Retrospective Study

    PubMed Central

    Goldman, Mitchel P.; Fabi, Sabrina G.; Guiha, Isabella

    2014-01-01

    There is a lack of research regarding the sequential use of multiple light sources for topical 5-aminolevulinic acid activation in photodynamic therapy for actinic keratosis. This study evaluated 5-aminolevulinic acid-photodynamic therapy for actinic keratosis using blue light combined with red light, pulsed dye laser, and/or intense pulsed light in a retrospective fashion. Field-directed 5-aminolevulinic acid-photodynamic therapy was performed with blue light only, blue light + pulsed dye laser, blue light + intense pulsed light, blue light + pulsed dye laser + intense pulsed light, or blue light + red light + pulsed dye laser + intense pulsed light for nonhyperkeratotic actinic keratoses of face, scalp, or upper trunk. Blue light + intense pulsed light + pulsed dye laser produced greater patient-reported improvement in actinic keratoses than blue light or blue light + intense pulsed light and greater subject-reported improvement in overall skin quality than blue light + intense pulsed light. The addition of red light led to no further benefit in either outcome measure. Photodynamic therapy with multiple, sequential laser and light sources led to greater patient-graded improvement in actinic keratoses than that with a single light source (blue light), without significant differences in post-treatment adverse events. However, the small, widely disparate number of patients between groups and follow-up times between patients, as well as retrospective assessments based on subjective patient recall, severely limit the significance of these findings. Nevertheless, the results raise interesting questions regarding the use of multiple light and laser sources for photodynamic therapy of actinic keratoses and warrant further research with a prospective, randomized, controlled study. PMID:25276272

  11. Delineating Normal from Diseased Brain by Aminolevulinic Acid-Induced Fluorescence

    NASA Astrophysics Data System (ADS)

    Stepp, Herbert; Stummer, Walter

    5-Aminolevulinic acid (5-ALA) as a precursor of protoporphyrin IX (PpIX) has been established as an orally applied drug to guide surgical resection of malignant brain tumors by exciting the red fluorescence of PpIX. The accumulation of PpIX in glioblastoma multiforme (GBM) is highly selective and provides excellent contrast to normal brain when using surgical microscopes with appropriately filtered light sources and cameras. The positive predictive value of fluorescent tissue is very high, enabling safe gross total resection of GBM and other brain tumors and improving prognosis of patients. Compared to other intraoperative techniques that have been developed with the aim of increasing the rate of safe gross total resections of malignant gliomas, PpIX fluorescence is considerably simpler, more cost effective, and comparably reliable. We present the basics of 5-ALA-based fluorescence-guided resection, and discuss the clinical results obtained for GBM and the experience with the fluorescence staining of other primary brain tumors and metastases as well as the results for spinal cord tumors. The phototoxicity of PpIX, increasingly used for photodynamic therapy of brain tumors, is mentioned briefly in this chapter.

  12. A Formulation Study of 5-Aminolevulinic Encapsulated in DPPC Liposomes in Melanoma Treatment

    PubMed Central

    Lin, Ming-Wei; Huang, Yaw-Bin; Chen, Chun-Lin; Wu, Pao-Chu; Chou, Chien-Ying; Wu, Ping-Ching; Hung, Shih-Ya

    2016-01-01

    Photodynamic therapy (PDT) is a widely used technique for epithelial skin cancer treatment. 5-aminolevulinic acid (5-ALA) is a drug currently used for PDT and is a hydrophilic molecule at its physiological pH, and this limits its capacity to cross the stratum corneum of skin. Since skin penetration is a key factor in the efficacy of topical 5-ALA-mediated PDT, numerous strategies have been proposed to improve skin penetration. Yet this problem is still ongoing. The results of a previous study showed a low rate of 5-ALA encapsulated in liposomes (5.7%) that were 400 nm in size. In the present study, we used 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) liposomes as vehicles and tested their delivery efficacy of 5-ALA-medicated PDT both in vitro and in vivo. Our data shows that 5-ALA encapsulated in 0.1 or 0.5% DPPC liposomes (5-ALA/DPPC) had a better encapsulated rate (15~16%) and were smaller in size (84~89 nm). We found the 5-ALA/DPPC formulation reduced cell viability, mitochondria membrane potential, and enhanced intracellular ROS accumulation as compared to 5-ALA alone in melanoma cells. Furthermore, the 5-ALA/DPPC formulation also had better skin penetration ability as compared to the 5-ALA in our ex vivo data by assaying 5-ALA converted into protoporphyrin IX (PpIX) in the skin of the mice that were experimented on. In melanoma xenograft models, 5-ALA/DPPC enhanced PpIX accumulation only in tumor tissue but not normal skin. In conclusion, we found DPPC liposomes to be good carriers for 5-ALA delivery and believe that they may prove useful in 5-ALA-mediated PDT in the future. PMID:27429584

  13. δ-Aminolevulinic acid dehydrase activity in the blood of men working with lead alkyls

    PubMed Central

    Millar, J. A.; Thompson, G. G.; Goldberg, A.; Barry, P. S. I.; Lowe, E. H.

    1972-01-01

    Millar, J. A., Thompson, G. G., Goldberg, A., Barry, P. S. I., and Lowe, E. H. (1972).Brit. J. industr. Med.,29, 317-320. δ-Aminolevulinic acid dehydrase activity in the blood of men working with lead alkyls. The activity of erythrocyte ALA1-dehydrase is inhibited in vivo at blood lead (Pb2+) levels within the upper range of normal (20-40 μg/100 ml) and in vitro at lead concentrations greater than 10-7 M. In view of the high sensitivity of the enzyme to Pb2+, the levels of enzyme activity in the blood of men occupationally exposed to lead alkyls, particularly tetraethyllead, were measured. It was found that the enzyme activity in an exposed group of men was significantly less (P<0·001) than in a control group, the respective mean values being 220 and 677 units of enzyme activity. Tetraethyllead is metabolized in the body via triethyllead and diethyllead ions. As the latter compound possesses properties similar to Pb2+, it was synthesized in the laboratory and its effect on ALA-dehydrase was studied. Diethyllead ion was found to inhibit ALA-dehydrase activity at concentrations greater than 5 x 10-5 M, although the degree of inhibition was less than that obtained with Pb2+. These results suggest that exposure to tetraethyllead can cause a decrease in erythrocyte ALA-dehydrase activity. PMID:5044603

  14. Delta-aminolevulinic acid dehydratase enzyme activity in blood, brain, and liver of lead-dosed ducks

    USGS Publications Warehouse

    Dieter, M.P.; Finley, M.T.

    1979-01-01

    Mallard ducks were dosed with a single shotgun pellet (ca. 200 mg lead). After 1 month there was about 1 ppm lead in blood, 2.5 in liver, and 0.5 in brain. Lead-induced inhibition of delta-aminolevulinic acid dehydratase enzyme in blood and cerebellum was much greater than in cerebral hemisphere or liver and was strongly correlated with the lead concentration in these tissues. The cerebellar portion of the brain was more sensitive to delta-aminolevulinic acid dehydratase enzyme inhibition by lead than were the other tissues examined. There was also a greater increase in the glial cell marker enzyme, butyrylcholinesterase, in cerebellum than in cerebral hemisphere, suggesting that nonregenerating neuronal cells were destroyed by lead and replaced by glial cells in that portion of the brain. Even partial loss of cerebellar tissue is severely debilitating in waterfowl, because functions critical to survival such as visual, auditory, motor, and reflex responses are integrated at this brain center.

  15. Regulation of ion homeostasis by aminolevulinic acid in salt-stressed wheat seedlings

    NASA Astrophysics Data System (ADS)

    Türk, Hülya; Genişel, Mucip; Erdal, Serkan

    2016-04-01

    Salinity is regarded as a worldwide agricultural threat, as it seriously limits plant development and productivity. Salt stress reduces water uptake in plants by disrupting the osmotic balance of soil solution. In addition, it creates a damaged metabolic process by causing ion imbalance in cells. In this study, we aim to examine the negative effects of 5-aminolevulinic acid (ALA) (20 mg/l) on the ion balance in wheat seedling leaves exposed to salt stress (150 mM). Sodium is known to be highly toxic for plant cells at high concentrations, and is significantly increased by salt stress. However, it can be reduced by combined application of ALA and salt, compared to salt application alone. On the other hand, while the K+/Na+ ratio was reduced by salt stress, ALA application changed this ratio in favor of K+. Manganese, iron, and copper were also able to reduce stress. However, ALA pre-treatment resulted in mineral level increments. Conversely, the stress-induced rise in magnesium, potassium, calcium, phosphorus, zinc, and molybdenum were further improved by ALA application. These data clearly show that ALA has an important regulatory effect of ion balance in wheat leaves.

  16. In vivo study of an instantly formed lipid-water cubic phase formulation for efficient topical delivery of aminolevulinic acid and methyl-aminolevulinate.

    PubMed

    Evenbratt, Hanne; Jonsson, Charlotte; Faergemann, Jan; Engström, Sven; Ericson, Marica B

    2013-08-16

    We demonstrate a rapidly formed cubic liquid crystalline phase, i.e. typically 1g cubic phase in less than 1 min confirmed by X-ray diffraction, consisting of an ether lipid, 1-glyceryl monooleyl ether (GME), an aprotic solvent (propylene glycol or pentane-1,5-diol) and water. The efficacy of the cubic formulation was tested in vivo by administrating formulations containing 3% (w/w) of the HCl salts of δ-aminolevulinic acid (ALA) or methylaminolevulinate (MAL) to hairless mice. The endogenous formation of protoporphyrin IX (PpIX) was monitored spectrophotometrically as a marker for cellular uptake of active compound. As reference, a commercial product containing 16% (w/w) MAL in an oil-in-water emulsion (Metvix(®)), and a cubic phase based on an ester lipid (glyceryl monooleate, GMO), previously shown to facilitate topical delivery of both ALA and MAL, were applied. It was found that in general the cubic phases gave rise to higher fluorescence levels than the mice exposed to the commercial product. The instantly formed cubic formulations based on GME demonstrated the same efficiency as the GMO based formulations. The results imply that instantly formed cubic formulations opens up new opportunities, particularly for transdermal drug delivery of substances subject to stability problems in, e.g. aqueous environments.

  17. In vivo study of an instantly formed lipid-water cubic phase formulation for efficient topical delivery of aminolevulinic acid and methyl-aminolevulinate.

    PubMed

    Evenbratt, Hanne; Jonsson, Charlotte; Faergemann, Jan; Engström, Sven; Ericson, Marica B

    2013-08-16

    We demonstrate a rapidly formed cubic liquid crystalline phase, i.e. typically 1g cubic phase in less than 1 min confirmed by X-ray diffraction, consisting of an ether lipid, 1-glyceryl monooleyl ether (GME), an aprotic solvent (propylene glycol or pentane-1,5-diol) and water. The efficacy of the cubic formulation was tested in vivo by administrating formulations containing 3% (w/w) of the HCl salts of δ-aminolevulinic acid (ALA) or methylaminolevulinate (MAL) to hairless mice. The endogenous formation of protoporphyrin IX (PpIX) was monitored spectrophotometrically as a marker for cellular uptake of active compound. As reference, a commercial product containing 16% (w/w) MAL in an oil-in-water emulsion (Metvix(®)), and a cubic phase based on an ester lipid (glyceryl monooleate, GMO), previously shown to facilitate topical delivery of both ALA and MAL, were applied. It was found that in general the cubic phases gave rise to higher fluorescence levels than the mice exposed to the commercial product. The instantly formed cubic formulations based on GME demonstrated the same efficiency as the GMO based formulations. The results imply that instantly formed cubic formulations opens up new opportunities, particularly for transdermal drug delivery of substances subject to stability problems in, e.g. aqueous environments. PMID:23727140

  18. Bacterial delta-aminolevulinic acid synthase activity is not essential for leghemoglobin formation in the soybean/Bradyrhizobium japonicum symbiosis

    SciTech Connect

    Guerinot, M.L.; Chelm, B.K.

    1986-03-01

    Previous studies of legume nodules have indicated that formation of the heme moiety of leghemoglobin is a function of the bacterial symbiont. The authors now show that a hemA mutant of Bradyrhizobium japonicum that cannot carry out the first step in heme biosynthesis forms fully effective nodules on soybeans. The bacterial mutant strain was constructed by first isolated the wild-type hemA gene encoding delta-aminolevulinic acid synthase (EC 2.3.1.37) from a cosmid library, using a fragment of the Rhizobium meliloti hemA gene as a hybridization probe. A deletion of the hemA gene region, generated in vitro, then was used to construct the analogous chromosomal mutation by gene-directed mutagenesis. The mutant strain had no delta-aminolevulinic acid synthase activity and was unable to grow in minimal medium unless delta-aminolevulinic acid was added. Despite its auxotrophy, the mutant strain incited nodules that appeared normal, contained heme, and were capable of high levels of acetylene reduction. These results rule out bacterial delta-aminolevulinic acid synthase activity as the exclusive source of delta-aminolevulinic acid for heme formation in soybean nodules.

  19. Neurotransmitter transporter family including SLC6A6 and SLC6A13 contributes to the 5-aminolevulinic acid (ALA)-induced accumulation of protoporphyrin IX and photodamage, through uptake of ALA by cancerous cells.

    PubMed

    Tran, Tai Tien; Mu, Anfeng; Adachi, Yuka; Adachi, Yasushi; Taketani, Shigeru

    2014-01-01

    δ-Aminolevulinic acid (ALA)-induced protoporphyrin accumulation is widely used in the treatment of cancer, as photodynamic therapy (PDT). To clarify the mechanisms of ALA uptake by tumor cells, we have examined the ALA-induced accumulation of protoporphyrin by the treatment of colon cancer DLD-1 and epithelial cancer HeLa cells with γ-aminobutyric acid (GABA)-related compounds. When the cells were treated with GABA, taurine and β-alanine, the level of protoporphyrin was decreased, suggesting that plasma membrane transporters involved in the transport of neurotransmitters contribute to the uptake of ALA. By transfection with neurotransmitter transporters SLC6A6, SLC6A8 and SLC6A13 cDNA, the ALA- and ALA methylester-dependent accumulation of protoporphyrin markedly increased in HEK293T cells, dependent on an increase in the uptake of ALA. When ALA-treated cells were exposed to white light, the extent of photodamage increased in SLC6A6- and SLC6A13-expressing cells. Conversely, knockdown of SLC6A6 or SLC6A13 with siRNAs in DLD-1 and HeLa cells decreased the ALA-induced accumulation. The expression of SLC6A6 and SLC6A13 was found in some cancer cell lines. Immunohistochemical studies revealed that the presence of these transporters was elevated in colon cancerous cells. These results indicated that neurotransmitter transporters including SLC6A6 and SLC6A13 mediate the uptake of ALA and can play roles in the enhancement of ALA-induced accumulation of protoporphyrin in cancerous cells.

  20. Association between delta-aminolevulinic acid dehydratase polymorphism and placental lead levels.

    PubMed

    Kayaaltı, Zeliha; Sert, Selda; Kaya-Akyüzlü, Dilek; Söylemez, Esma; Söylemezoğlu, Tülin

    2016-01-01

    Lead inhibits the delta-aminolevulinic acid dehydratase (ALAD) activity and results in neurotoxic aminolevulinic acid accumulation in the blood. During pregnancy, lead in the maternal blood can easily cross the placenta. The aim of this study was to determine whether the maternal ALAD G177C polymorphism (rs1800435) was related to the placental lead levels. The study population comprised 97 blood samples taken from mothers to investigate ALAD G177C polymorphism and their placentas to measure lead levels. ALAD G177C polymorphism was detected by standard polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) technique and atomic absorption spectrometry (AAS) equipped with a graphite furnace and Zeeman background correction system was used for lead determination. The median placental lead levels for ALAD1-1, ALAD1-2 and ALAD2-2 genotypes were 7.54 μg/kg, 11.78 μg/kg and 18.53 μg/kg, respectively. Statistically significant association was found between the maternal ALAD G177C polymorphism and placental lead levels (p<0.05). This study suggested that maternal ALAD G177C polymorphism was associated with placental lead levels.

  1. Comparison of blood lead and blood and plasma δ-aminolevulinic acid concentrations as biomarkers for lead poisoning in cattle.

    PubMed

    Kang, Hwan Goo; Bischoff, Karyn; Ebel, Joseph G; Cha, Sang Ho; McCardle, James; Choi, Cheong Up

    2010-11-01

    Lead (Pb) concentrations in whole blood and δ-aminolevulinic acid (ALA) concentrations in plasma and whole blood from 37 cattle with suspected Pb exposure were determined in order to investigate the usefulness of ALA as a biological indicator for Pb poisoning in cattle. Cows were divided into 4 groups based on blood Pb, as follows: <30 ppb (group 1), 30-100 ppb (group 2), 100-300 ppb (group 3), and >300 ppb (group 4). The derivatization reaction for ALA was improved by a greater than 2-fold measure in whole blood and by a 10-fold measure in plasma by adding 75 and 50 µl of 0.1 N HCl, respectively. Blood Pb concentrations ranged from <25 ppb to 1,006 ppb (185.5 ± 254.9 ppb), with 17 samples containing >50 ppb Pb. Delta-aminolevulinic acid concentrations in whole blood and plasma ranged from <62.7 ppb to 96.9 ppb (77.4 ± 8.4 ppb) and from <5.0 ppb to 24.0 ppb (4.6 ± 3.8 ppb), respectively. Whole blood ALA did not correlate with blood lead concentrations in any group. Increase in plasma ALA concentration was dependent on blood Pb concentration. There was no correlation between blood Pb concentration and plasma ALA concentration in group 2 (n  =  4), but correlation coefficients were 0.736 in group 3 and 0.807 in group 4, respectively. The correlation coefficient was increased to 0.851 when groups 3 and 4 were combined. Based on these observations, in cattle, plasma ALA is a more reliable biological biomarker for Pb exposure than is blood ALA.

  2. Delta-aminolevulinic acid dehydratase: Inhibition in ducks dosed with lead shot

    USGS Publications Warehouse

    Finley, M.T.; Dieter, M.P.; Locke, L.N.

    1976-01-01

    Lead concentration in blood and erythrocyte delta-aminolevulinic acid dehydratase (ALAD) activity was measured in mallard ducks dosed with one all-lead shot or one lead-iron combination shot. For 2 weeks after dosage, lead in blood of ducks given an all-lead shot was fourfold higher than in those dosed with lead-iron shot. At 3 and 4 weeks, the differences in lead residues were directly proportional to lead content of the shots. ALAD activities measured at these intervals were inversely correlated (P < 0.01) with the concentration of lead in the blood, suggesting that biochemical responses to the two types of shot were dependent upon the quantity of lead present.

  3. Effects of zinc, copper, and lead toxicity on. cap alpha. -aminolevulinic acid dehydratase activity. [Rats

    SciTech Connect

    Shafiq-ur-Rehman

    1984-07-01

    The distribution of lead, zinc and copper in the human environment has been recognized as a major toxicological factor. Lead ions have been shown to inhibit the activity of delta-aminolevulinic acid dehydratase (delta-ALAD), which is involved in the biosynthesis of heme. Copper also has its inhibitory effect on delta-ALAD activity. A study has shown that the delta-ALAD was activated by zinc ions at physiological concentrations. In view of these reports, it was considered worthwhile to study the poisoning effects of lead, zinc and copper on delta-ALAD activity along with the concentrations of these metal ions in the blood. A possible role of Zn/sup + +/, Cu/sup + +/, and Pb/sup + +/ interaction and their influence on delta-ALAD has been explored in the present paper.

  4. Photodynamic diagnosis following intravesical instillation of aminolevulinic acid (ALA): first clinical experiences in urology

    NASA Astrophysics Data System (ADS)

    Baumgartner, Reinhold; Kriegmair, M.; Stepp, Herbert G.; Lumper, W.; Heil, Peter; Riesenberg, Rainer; Stocker, Susanne; Hofstetter, Alfons G.

    1993-06-01

    Delta Aminolevulinic acid (ALA), a precursor of Protoporphyrin IX (PP IX) in hem biosynthesis has been topically applied in urinary bladders in order to study its potential as fluorescent tumor marker. Preclinical experiments have been performed on chemically induced tumors in rats, revealing a ratio of PP IX-fluorescence intensity up to 20:1 in tumors as compared to healthy urothelium. Synthesis of PP IX has been stimulated in 56 patients by intravesical instillation of a pH-neutral ALA-solution. After an incubation time of two to four hours strong red fluorescence was endoscopically observed even in tiny superficial tumors. Brightness and contrast allows visualization of early stage urothelial diseases with naked eyes and without the necessity suppressing background fluorescence or violet excitation light.

  5. Comparison of the beluga whale (Delphinapterus leucas) expressed genes for 5-aminolevulinate synthase with those in other vertebrates.

    PubMed

    Kreiling, J A; Duncan, R; Faggart, M A; Cornell, N W

    1999-06-01

    The cDNA and inferred amino acid sequences were determined for beluga whale (Delphinapterus leucas) erythroid (E) and housekeeping (H) forms of 5-aminolevulinate synthase (ALS), and they were compared with known sequences for five other vertebrates with particular attention to regulatory features. The cDNAs for whale ALS-E and -H encode, respectively, proteins of 582 and 640 amino acids. Sequence alignments suggest that the whale ALS-H, like those for rat and chicken, has an N-terminal mitochondrial targeting sequence of 56 amino acids. There is a high degree of amino acid conservation between the beluga whale proteins and those of other vertebrates, including regulatory elements and functional residues that have been defined in other ALSs. Both whale proteins contain three heme regulatory motifs suggesting that mitochondrial uptake may be regulated by heme. The ALS-E mRNA contains an iron responsive element in its 5'-untranslated region indicating that its expression may be post-transcriptionally regulated by cellular iron. This extensive structural similarity and the presence of the same regulatory elements found in other ALSs indicate that regulation of ALS in beluga whale is similar to that in other vertebrates.

  6. Responses to hexyl 5-aminolevulinate-induced photodynamic treatment in rat bladder cancer model

    NASA Astrophysics Data System (ADS)

    Arum, Carl-Jørgen; Gederas, Odrun; Larsen, Eivind; Randeberg, Lise; Zhao, Chun-Mei

    2010-02-01

    OBJECTIVES: In this study, we evaluated histologically the effects of hexyl 5-aminolevulinateinduced photodynamic treatment in the AY-27 tumor cell induced rat bladder cancer model. MATERIAL & METHODS: The animals (fischer-344 female rats) were divided into 2 groups, half of which were orthotopically implanted with 400,000 syngeniec AY-27 urothelia1 rat bladder cancer cells and half sham implanted. 14 days post implantation 6 rats from each group were treated with hexyl 5-aminolevulinate-induced photodynamic treatment (8mM HAL and light fluence of 20 J/cm2). Additional groups of animals were only given HAL instillation, only light treatment, or no treatment. All animals were sacrificed 7 days after the PDT/only HAL/only light or no treatment. Each bladder was removed, embedded in paraffin and stained with hematoxylin, eosin, and saferin for histological evaluation at high magnification for features of tissue damage by a pathologist blinded to the sample source. RESULTS: In all animals that were AY-27 implanted and not given complete PDT treatment, viable tumors were found in the bladder mucosa and wall. In the animals treated with complete HAL-PDT only 3 of 6 animals had viable tumor. In the 3 animals with viable tumor it was significantly reduced in volume compared to the untreated animals. It was also noted that in the PDT treated animals there was a significantly increased inflammatory response (lymphocytic and mononuclear cell infiltration) in the peri-tumor area compared to implanted animals without complete HAL-PDT. CONCLUSION: Our results suggest that hexyl 5-aminolevulinate-induced photodynamic treatment in a rat bladder cancer model involves both direct effects on cell death (necrosis and apoptosis) and indirect effects to evoke the host immune-response, together contributing to tumor eradication.

  7. Evaluating the Efficacy of Photodynamic Therapy with 20% Aminolevulinic Acid and Microdermabrasion as a Combination Treatment Regimen for Acne Scarring

    PubMed Central

    Jim On, Shelbi; Haddican, Madelaine; Singer, Giselle; Shim-Chang, Helen

    2014-01-01

    Acne scarring is a consequence of abnormal resolution of wound healing after damage that occurs in the sebaceous follicle during acne inflammation. No trial to date has evaluated the efficacy of the combination of microdermabrasion and photodynamic therapy for acne scarring. This single-center, double-blinded pilot study enrolled subjects with moderate-to-severe acne scarring who were randomly assigned in a blinded fashion to use aminolevulinic acid and vehicle in a split-face fashion after full-face treatment with microdermabrasion. On average, 80 percent of the patients displayed more improvement in scarring on the aminolevulinic acid split face versus the vehicle split face after five treatments. Using two different noninvasive mechanisms of targeting acne scarring provided for a safe treatment regimen characterized by more efficacious results with respect to higher rates of scarring improvement. PMID:24847407

  8. Aminolevulinic Acid-Photodynamic Therapy Combined with Topically Applied Vascular Disrupting Agent Vadimezan Led to Enhanced Antitumor Responses

    PubMed Central

    Marrero, Allison; Becker, Theresa; Sunar, Ulas; Morgan, Janet; Bellnier, David

    2011-01-01

    The tumor-vascular disrupting agent (VDA) vadimezan (5,6-dimethylxanthenone-4-acetic acid, DMXAA) has been shown to potentiate the antitumor activity of photodynamic therapy (PDT) using systemically administered photosensitizers. Here, we characterized the response of subcutaneous syngeneic Colon26 murine colon adenocarcinoma tumors to PDT using the locally applied photosensitizer precursor aminolevulinic acid (ALA) in combination with a topical formulation of vadimezan. Diffuse correlation spectroscopy (DCS), a non-invasive method for monitoring blood flow, was utilized to determine tumor vascular response to treatment. Additionally, correlative CD31-immunohistochemistry to visualize endothelial damage, ELISA assays to measure induction of tumor necrosis factor-alpha (TNF-α) and tumor weight measurements were also examined in separate animals. In our previous work, DCS revealed a selective decrease in tumor blood flow over time following topical vadimezan. ALA-PDT treatment also induced a decrease in tumor blood flow. The onset of blood flow reduction was rapid in tumors treated with both ALA-PDT and vadimezan. CD31-immunostaining of tumor sections confirmed vascular damage following topical application of vadimezan. Tumor weight measurements revealed enhanced tumor growth inhibition with combination treatment compared to ALA-PDT or vadimezan treatment alone. In conclusion, vadimezan as a topical agent enhances treatment efficacy when combined with ALA-PDT. This combination could be useful in clinical applications. PMID:21575001

  9. Determination of aminolevulinic-acid-induced protoporphyrin IX in mice skin

    NASA Astrophysics Data System (ADS)

    Stolik, S.; Tomás, S. A.; Ramón-Gallegos, E.; Cruz-Orea, A.; Sánchez-Sinencio, F.

    2003-01-01

    The kinetics of Protoporphyrin IX (PpIX) production in mice skin was studied by photoacoustic spectroscopy. PpIX was induced in mice by intraperitoneal administration of δ-aminolevulinic acid (δ-ALA) in doses of 10, 20, and 30 mg/kg. Mice were sacrificed at specific times within an 8 h interval following δ-ALA administration, and their abdominal skin was excised for the optical measurements. The PpIX content was determined from the photoacoustic amplitude at 410 nm, where PpIX presents its Soret band. For each dose, maximum PpIX was observed at two points. The first maximum occurred at around 15-45 min, depending on the ALA dose, and the second one took place approximately 2 h after δ-ALA administration. These peaks are associated with PpIX production in blood vessels and tissue, respectively. Fluorescence measurements of the PpIX content in plasma extracted intracardiacally confirmed the previous statement. Finally, phase resolved photoacoustic spectroscopy was applied to evaluate the mean depth at which PpIX is generated within the mice skin. This evaluation confirms that the ALA-induced porphyrins in skin are rather produced in the epidermis than in the dermis.

  10. Aminolevulinic Acid-Based Tumor Detection and Therapy: Molecular Mechanisms and Strategies for Enhancement

    PubMed Central

    Yang, Xue; Palasuberniam, Pratheeba; Kraus, Daniel; Chen, Bin

    2015-01-01

    Aminolevulinic acid (ALA) is the first metabolite in the heme biosynthesis pathway in humans. In addition to the end product heme, this pathway also produces other porphyrin metabolites. Protoporphyrin (PpIX) is one heme precursor porphyrin with good fluorescence and photosensitizing activity. Because tumors and other proliferating cells tend to exhibit a higher level of PpIX than normal cells after ALA incubation, ALA has been used as a prodrug to enable PpIX fluorescence detection and photodynamic therapy (PDT) of lesion tissues. Extensive studies have been carried out in the past twenty years to explore why some tumors exhibit elevated ALA-mediated PpIX and how to enhance PpIX levels to achieve better tumor detection and treatment. Here we would like to summarize previous research in order to stimulate future studies on these important topics. In this review, we focus on summarizing tumor-associated alterations in heme biosynthesis enzymes, mitochondrial functions and porphyrin transporters that contribute to ALA-PpIX increase in tumors. Mechanism-based therapeutic strategies for enhancing ALA-based modalities including iron chelators, differentiation agents and PpIX transporter inhibitors are also discussed. PMID:26516850

  11. Pain Associated with Aminolevulinic Acid-Photodynamic Therapy of Skin Disease

    PubMed Central

    Warren, Christine B.; Karai, Laszlo J.; Vidimos, Allison; Maytin, Edward V.

    2012-01-01

    Background Pain during topical aminolevulinic acid (ALA) mediated photodynamic therapy (PDT) limits the use of this treatment of skin diseases. Objective To summarize the effectiveness of interventions to reduce ALA-PDT related pain, and to explore factors contributing to pain induction. Methods A PubMed search was performed to identify all clinical PDT trials (2000–2008) that used ALA or methyl-ALA, enrolled at least 10 patients per trial, and used a semiquantitative pain scale. Results 43 papers were identified for review. Pain intensity is associated with lesion size and location and can be severe for certain diagnoses, such as plaque-type psoriasis. Results are inconsistent for the correlation of pain with light source, wavelength of light, fluence rate, and total light dose. Cooling represents the best topical intervention. Limitations Pain perception differs widely between patients and can contribute to variability in the reported results. Conclusion GABA receptors, cold/ menthol receptors (TRPM8), and vanilloid/capsaicin receptors (TRPV1) may be involved in pain perception during ALA-PDT and are therefore worthy of further investigation. PMID:19925929

  12. In vitro photodynamic therapy of MG-63 osteosarcoma cells mediated by aminolevulinic acid

    NASA Astrophysics Data System (ADS)

    Rossi, Vincent M.; White, Bradley M.; Newton, Mariko J.; Jacques, Steven L.; Baugher, Paige J.

    2011-02-01

    This is an in vitro study of photodynamic therapy (PDT) in the MG-63 line of human osteosarcoma cells, as mediated by aminolevulinic acid (ALA). The primary goal of this work is to determine the feasibility and effectiveness of treating osteosarcoma through PDT. In addition, this work is aimed at determining whether the resulting cell death occurs through apoptosis or cellular necrosis. The MG-63 cells are treated with increasing concentrations of ALA from 0.1-10 mM ALA, leading to the accumulation of the photosensitizer protoporphyrin IX (PpIX) within the cells. After incubation periods of 4 and 24 hours in ALA, the cells are illuminated by 0-10 J/cm2 of 636 nm light in order to activate the PpIX and induce oxidative damage to the cells. Light is administered by an 8x12 array of LED's, which are controlled by an Arduino Duemilanove microcontroller board in order to assure ease of use along with accurate levels of exposure. Controls for this experiment include 0 J/cm2 of light exposure for all experimental concentrations of ALA, as well as illuminating cells that have not been incubated in ALA at all experimental levels of illumination. MG-63 cells are analyzed through fluorimetry and MTT assays in order to determine the effectiveness of ALA mediated PDT of osteosarcoma.

  13. LCAA, a Novel Factor Required for Magnesium Protoporphyrin Monomethylester Cyclase Accumulation and Feedback Control of Aminolevulinic Acid Biosynthesis in Tobacco1[W][OA

    PubMed Central

    Albus, Christin Anne; Salinas, Annabel; Czarnecki, Olaf; Kahlau, Sabine; Rothbart, Maxi; Thiele, Wolfram; Lein, Wolfgang; Bock, Ralph; Grimm, Bernhard; Schöttler, Mark Aurel

    2012-01-01

    Low Chlorophyll Accumulation A (LCAA) antisense plants were obtained from a screen for genes whose partial down-regulation results in a strong chlorophyll deficiency in tobacco (Nicotiana tabacum). The LCAA mutants are affected in a plastid-localized protein of unknown function, which is conserved in cyanobacteria and all photosynthetic eukaryotes. They suffer from drastically reduced light-harvesting complex (LHC) contents, while the accumulation of all other photosynthetic complexes per leaf area is less affected. As the disturbed accumulation of LHC proteins could be either attributable to a defect in LHC biogenesis itself or to a bottleneck in chlorophyll biosynthesis, chlorophyll synthesis rates and chlorophyll synthesis intermediates were measured. LCAA antisense plants accumulate magnesium (Mg) protoporphyrin monomethylester and contain reduced protochlorophyllide levels and a reduced content of CHL27, a subunit of the Mg protoporphyrin monomethylester cyclase. Bimolecular fluorescence complementation assays confirm a direct interaction between LCAA and CHL27. 5-Aminolevulinic acid synthesis rates are increased and correlate with an increased content of glutamyl-transfer RNA reductase. We suggest that LCAA encodes an additional subunit of the Mg protoporphyrin monomethylester cyclase, is required for the stability of CHL27, and contributes to feedback-control of 5-aminolevulinic acid biosynthesis, the rate-limiting step of chlorophyll biosynthesis. PMID:23085838

  14. Catalytically active alkaline molten globular enzyme: Effect of pH and temperature on the structural integrity of 5-aminolevulinate synthase.

    PubMed

    Stojanovski, Bosko M; Breydo, Leonid; Hunter, Gregory A; Uversky, Vladimir N; Ferreira, Gloria C

    2014-12-01

    5-Aminolevulinate synthase (ALAS), a pyridoxal-5'phosphate (PLP)-dependent enzyme, catalyzes the first step of heme biosynthesis in mammals. Circular dichroism (CD) and fluorescence spectroscopies were used to examine the effects of pH (1.0-3.0 and 7.5-10.5) and temperature (20 and 37°C) on the structural integrity of ALAS. The secondary structure, as deduced from far-UV CD, is mostly resilient to pH and temperature changes. Partial unfolding was observed at pH2.0, but further decreasing pH resulted in acid-induced refolding of the secondary structure to nearly native levels. The tertiary structure rigidity, monitored by near-UV CD, is lost under acidic and specific alkaline conditions (pH10.5 and pH9.5/37°C), where ALAS populates a molten globule state. As the enzyme becomes less structured with increased alkalinity, the chiral environment of the internal aldimine is also modified, with a shift from a 420nm to 330nm dichroic band. Under acidic conditions, the PLP cofactor dissociates from ALAS. Reaction with 8-anilino-1-naphthalenesulfonic acid corroborates increased exposure of hydrophobic clusters in the alkaline and acidic molten globules, although the reaction is more pronounced with the latter. Furthermore, quenching the intrinsic fluorescence of ALAS with acrylamide at pH1.0 and 9.5 yielded subtly different dynamic quenching constants. The alkaline molten globule state of ALAS is catalytically active (pH9.5/37°C), although the kcat value is significantly decreased. Finally, the binding of 5-aminolevulinate restricts conformational fluctuations in the alkaline molten globule. Overall, our findings prove how the structural plasticity of ALAS contributes to reaching a functional enzyme.

  15. Catalytically active alkaline molten globular enzyme: Effect of pH and temperature on the structural integrity of 5-aminolevulinate synthase.

    PubMed

    Stojanovski, Bosko M; Breydo, Leonid; Hunter, Gregory A; Uversky, Vladimir N; Ferreira, Gloria C

    2014-12-01

    5-Aminolevulinate synthase (ALAS), a pyridoxal-5'phosphate (PLP)-dependent enzyme, catalyzes the first step of heme biosynthesis in mammals. Circular dichroism (CD) and fluorescence spectroscopies were used to examine the effects of pH (1.0-3.0 and 7.5-10.5) and temperature (20 and 37°C) on the structural integrity of ALAS. The secondary structure, as deduced from far-UV CD, is mostly resilient to pH and temperature changes. Partial unfolding was observed at pH2.0, but further decreasing pH resulted in acid-induced refolding of the secondary structure to nearly native levels. The tertiary structure rigidity, monitored by near-UV CD, is lost under acidic and specific alkaline conditions (pH10.5 and pH9.5/37°C), where ALAS populates a molten globule state. As the enzyme becomes less structured with increased alkalinity, the chiral environment of the internal aldimine is also modified, with a shift from a 420nm to 330nm dichroic band. Under acidic conditions, the PLP cofactor dissociates from ALAS. Reaction with 8-anilino-1-naphthalenesulfonic acid corroborates increased exposure of hydrophobic clusters in the alkaline and acidic molten globules, although the reaction is more pronounced with the latter. Furthermore, quenching the intrinsic fluorescence of ALAS with acrylamide at pH1.0 and 9.5 yielded subtly different dynamic quenching constants. The alkaline molten globule state of ALAS is catalytically active (pH9.5/37°C), although the kcat value is significantly decreased. Finally, the binding of 5-aminolevulinate restricts conformational fluctuations in the alkaline molten globule. Overall, our findings prove how the structural plasticity of ALAS contributes to reaching a functional enzyme. PMID:25240868

  16. Characterization of the RNA Required for Biosynthesis of δ-Aminolevulinic Acid from Glutamate 1

    PubMed Central

    Schneegurt, Mark A.; Beale, Samuel I.

    1988-01-01

    The heme and chlorophyll precursor δ-aminolevulinic acid acid (ALA) is formed in plants and algae from glutamate in a process that requires at least three enzyme components plus a low molecular weight RNA which co-purifies with the tRNA fraction during DEAE-cellulose column chromatography. RNA that is effective in the in vitro ALA biosynthetic system was extracted from several plant and algal species that form ALA via this route. In all cases, the effective RNA contained the UUC glutamate anticodon, as determined by its specific retention on an affinity resin containing an affine ligand directed against this anticodon. Construction of the affinity resin was based on the fact that the UUC glutamate anticodon is complementary to the GAA phenylalanine anticodon. By covalently linking the 3′ terminus of yeast tRNAPhe(GAA) to hydrazine-activated polyacrylamide gel beads, a resin carrying an affine ligand specific for the anticodon of tRNAGlu(UUC) was obtained. Column chromatography of plant and algal RNA extracts over this resin yielded a fraction that was highly enriched in the ability to stimulate ALA formation from glutamate when added to enzyme extracts of the unicellular green alga Chlorella vulgaris. Enhancement of ALA formation per A260 unit added was as much as 50 times greater with the affinity-purified RNA than with the RNA before affinity purification. The affinity column selectively retained RNA which supported ALA formation upon chromatography of RNA extracts from species of the diverse algal groups Chlorophyta (Chlorella Vulgaris), Euglenophyta (Euglena gracilis), Rhodophyta (Cyanidium caldarium), and Cyanophyta (Synechocystis sp. PCC 6803), and a higher plant (spinach). Other glutamate-accepting tRNAs that were not retained by the affinity column were ineffective in supporting ALA formation. These results indicate that possession of the UUC glutamate anticodon is a general requirement for RNA to participate in the conversion of glutamate to ALA in

  17. Distribution of. delta. -aminolevulinic acid biosynthetic pathways among phototrophic and related bacteria

    SciTech Connect

    Avissar, Y.J.; Beale, S.I. ); Ormerod, J.G. )

    1989-04-01

    Two biosynthetic pathways are known for the universal tetrapyrrole precursor, {delta}-aminolevulinic acid (ALA): condensation of glycine and succinyl-CoA to form ALA with the loss of C-1 of glycine as CO{sub 2}, and conversion of the intact carbon skeleton of glutamate to ALA in a process requiring tRNA{sup Glu}, ATP, Mg{sup 2+}, NADPH, and pyridoxal phosphate. The distribution of the two ALA biosynthetic pathways among various bacterial genera was determined, using cell-free extracts obtained from representative organisms. Evidence for the operation of the glutamate pathway was obtained by the measurement of RNase-sensitive label incorporation from glutamate into ALA using 3,4-({sup 3}H)glutamate and 1-({sup 14}C)glutamate as substrate. The glycine pathway was indicated by RNase-insensitive incorporation of level from 2-({sup 14}C)glycine into ALA. The distribution of the two pathways among the bacteria tested was in general agreement with their previously phylogenetic relationships and clearly indicates that the glutamate pathway is the more ancient process, whereas the glycine pathway probably evolved much later. The glutamate pathway is the more widely utilized one among bacteria, while the glycine pathway is apparently limited to the {alpha} subgroup of purple bacteria (including Rhodobacter, Rhodospirillum, and Rhizobium). E. coli was found ALA via the glutamate pathway. The ALA-requiring hemA mutant of E. coli was determined to lack the dehydrogenase activity that utilizes glutamyl-tRNA as a substrate.

  18. Heme biosynthesis modulation via δ-aminolevulinic acid administration attenuates chronic hypoxia-induced pulmonary hypertension

    PubMed Central

    Alhawaj, Raed; Patel, Dhara; Kelly, Melissa R.; Sun, Dong

    2015-01-01

    This study examines how heme biosynthesis modulation with δ-aminolevulinic acid (ALA) potentially functions to prevent 21-day hypoxia (10% oxygen)-induced pulmonary hypertension in mice and the effects of 24-h organoid culture with bovine pulmonary arteries (BPA) with the hypoxia and pulmonary hypertension mediator endothelin-1 (ET-1), with a focus on changes in superoxide and regulation of micro-RNA 204 (miR204) expression by src kinase phosphorylation of signal transducer and activator of transcription-3 (STAT3). The treatment of mice with ALA attenuated pulmonary hypertension (assessed through echo Doppler flow of the pulmonary valve, and direct measurements of right ventricular systolic pressure and right ventricular hypertrophy), increases in pulmonary arterial superoxide (detected by lucigenin), and decreases in lung miR204 and mitochondrial superoxide dismutase (SOD2) expression. ALA treatment of BPA attenuated ET-1-induced increases in mitochondrial superoxide (detected by MitoSox), STAT3 phosphorylation, and decreases in miR204 and SOD2 expression. Because ALA increases BPA protoporphyrin IX (a stimulator of guanylate cyclase) and cGMP-mediated protein kinase G (PKG) activity, the effects of the PKG activator 8-bromo-cGMP were examined and found to also attenuate the ET-1-induced increase in superoxide. ET-1 increased superoxide production and the detection of protoporphyrin IX fluorescence, suggesting oxidant conditions might impair heme biosynthesis by ferrochelatase. However, chronic hypoxia actually increased ferrochelatase activity in mouse pulmonary arteries. Thus, a reversal of factors increasing mitochondrial superoxide and oxidant effects that potentially influence remodeling signaling related to miR204 expression and perhaps iron availability needed for the biosynthesis of heme by the ferrochelatase reaction could be factors in the beneficial actions of ALA in pulmonary hypertension. PMID:25659899

  19. δ-Aminolevulinic acid dehydratase genotype predicts toxic effects of lead on workers' peripheral nervous system.

    PubMed

    Zheng, Guang; Tian, Liting; Liang, Yihuai; Broberg, Karin; Lei, Lijian; Guo, Weijun; Nilsson, Johan; Bergdahl, Ingvar A; Skerfving, Staffan; Jin, Taiyi

    2011-08-01

    There is a wide variation in sensitivity to lead (Pb) exposure, which may be due to genetic susceptibility towards Pb. We investigated whether a polymorphism (rs1800435) in the δ-aminolevulinic acid dehydratase (ALAD) gene affected the toxicokinetics and toxicodynamics of Pb. Among 461 Chinese Pb-exposed storage battery and 175 unexposed workers, allele frequencies for the ALAD1 and ALAD2 alleles were 0.968 and 0.032, respectively. The Pb-exposed workers had a higher fraction of the ALAD1-2/2-2 genotype than unexposed workers (7.8% vs. 2.3%, p=0.01). The Pb levels in blood (B-Pb) and urine (U-Pb) were higher in Pb-exposed workers carrying the ALAD2 allele compared to homozygotes for ALAD1 (median B-Pb: 606 vs. 499 μg/L; U-Pb: 233 vs. 164 μg/g creatinine), while there was no statistically significant difference in the unexposed controls (median: 24 vs. 37 μg/L, and 3.9 vs. 6.4μg/g creatinine, respectively). High B-Pb and U-Pb were associated with statistically significantly lower sensory and motor conduction velocities in the median, ulnar and peroneal nerves. At the same B-Pb and U-Pb, ALAD1 homozygotes had lower conduction velocities than the ALAD2 carriers. There were similar trends for toxic effects on haem synthesis (zinc protoporphyrin and haemoglobin in blood) and renal function (albumin and N-acetyl-d-β-acetylglucosaminidase in urine), but without statistical significance. There was no difference in Pb toxicokinetics and toxicodynamics associated with VDR BsmI polymorphism. Our results show that the ALAD genotype modifies the relationship between Pb and its toxic effects on the peripheral nervous system. This must be considered in the assessment of risks at Pb exposure.

  20. Construction and analysis of a Vibrio cholerae delta-aminolevulinic acid auxotroph which confers protective immunity in a rabbit model.

    PubMed Central

    Rijpkema, S G; Bik, E M; Jansen, W H; Gielen, H; Versluis, L F; Stouthamer, A H; Guinée, P A; Mooi, F R

    1992-01-01

    Vibrio cholerae CVD101 is a very effective live vaccine. Although this strain does not produce active cholera toxin because of a mutation in the gene for the cholera toxin A subunit, it still shows residual pathogenicity. To attenuate CVD101 further, we set out to isolate derivatives of CVD101 which were limited in their ability to proliferate in vivo. Two delta-aminolevulinic acid auxotrophs of CVD101, designated V286 and V287, were isolated by transposon mutagenesis and penicillin enrichment. Southern blotting revealed that the mutants differed with respect to the location of the transposon insertion. Under aerobic conditions, in the absence of delta-aminolevulinic acid, both mutants showed diminished growth compared with CVD101. The growth of V286 was most severely affected. Microaerophilic growth of both mutants was less affected. Competition experiments with a rabbit model showed that strain V286 was found in numbers 10(3)- to 10(4)-fold lower than its parental strain. This observation indicates that strain V286 is impaired in its ability to colonize the rabbit intestine. It also supports an important role for aerobic growth in the colonization of the intestine by V. cholerae. Vaccination of rabbits with a single dose of strain V286 resulted in full protection against challenge with a virulent strain. Strain V286 was not shed from rabbits in a cultivatable form. Our results suggest that delta-aminolevulinic acid auxotrophy can attenuate V. cholerae by limiting its ability to colonize without affecting its capacity to induce protective immunity. Furthermore, this type of mutation may prevent the spread of V. cholerae vaccine strains in the environment. Images PMID:1587587

  1. Hereditary Tyrosinemia and the Heme Biosynthetic Pathway. PROFOUND INHIBITION OF δ-AMINOLEVULINIC ACID DEHYDRATASE ACTIVITY BY SUCCINYLACETONE

    PubMed Central

    Sassa, Shigeru; Kappas, Attallah

    1983-01-01

    Succinylacetone (4,6-dioxoheptanoic acid) is an abnormal metabolite produced in patients with hereditary tyrosinemia as a consequence of an inherited deficiency of fumarylacetoacetate hydrolase. It is known that patients with this hereditary disease excrete excessive amounts of δ-aminolevulinic acid (ALA) in urine and that certain patients have an accompanying clinical syndrome resembling that of acute intermittent porphyria (AIP). In order to elucidate the relation of succinylacetone to the heme biosynthetic pathway, we have examined the effects of this metabolite on the cellular heme content of cultured avian hepatocytes and on the activity of purified ALA dehydratase from normal human erythrocytes and from mouse and bovine liver. Our data indicate that succinylacetone is an extremely potent competitive inhibitor of ALA dehydratase in human as well as in animal tissues. By using purified preparations of the enzyme from human erythrocytes and mouse and bovine liver, an inhibitor constant ranging from 2 × 10-7 M to 3 × 10-7 M was obtained. In cultured hepatocytes, succinylacetone also inhibited ALA dehydratase activity, decreased the cellular content of heme and cytochrome P-450, and greatly potentiated the induction response of ALA synthase to drugs such as phenobarbital, chemicals such as allylisopropylacetamide and 3,5-dicarbethoxy-1,4-dihydrocollidine, and natural steroids such as etiocholanolone. Four patients with hereditary tyrosinemia have been studied and all were found to have greatly depressed levels of erythrocyte ALA dehydratase activity and elevated concentrations of this inhibitor in urine. These findings indicate that tyrosinemia is a disorder of special pharmacogenetic interest because succinylacetone, an abnormal product of the tyrosine metabolic pathway, resulting from the primary gene defect of the disease, profoundly inhibits heme biosynthesis in normal cells through a blockade at the ALA dehydratase level, leading to clinical and metabolic

  2. 5-Aminolevulinate production by Escherichia coli containing the Rhodobacter sphaeroides hemA gene

    SciTech Connect

    Van Der Werf, M.J.; Zeikus, J.G. |

    1996-10-01

    The Rhodobacter sphaeroides hemA gene codes for 5-aminolevulinate (ALA) synthase. This enzyme catalyzes the pyridoxal phosphate-dependent condensation of succinyl coenzyme A and glycine-forming ALA. The R. sphaeroides hemA gene in the pUC18/19 vector system was transformed into Escherichia coli. The effects of both genetic and physiological factors on the expression of ALA synthase and the production of ALA were studied. ALA synthase activity levels were maximal when hemA had the same transcription direction as the lac promoter. The distance between the lac promoter and hemA affected the expression of ALA synthase on different growth substrates. The E. coli host strain used had an enormous effect on the ALA synthase activity level and on the production of ALA, with E. coli DH1 being best suited. The ALA synthase activity level was also dependent on the carbon source. Succinate, L-malate, fumarate, and L-aspartate gave the highest levels of ALA synthase activity, while the use of lactose as a carbon source resulted in a repression of ALA synthase. After growth on succinate, ALA synthase represented {approx}5% of total cellular protein. The ALA synthase activity level was also dependent on the pH of the medium, with maximal activity occurring at pH 6.5. ALA production by whole cells was limited by the availability of glycine, and the addition of 2 g of glycine per liter to the growth medium increased the production of ALA fivefold, to 2.25 mM. In recombinant E. coli extracts, up to 22 mM ALA was produced from succinate, glycine, and ATP. 58 refs., 4 figs., 7 tabs.

  3. Aminolevulinic acid dehydratase activity in American dippers (Cinclus mexicanus) from a metal-impacted stream.

    PubMed

    Strom, Sean M; Ramsdell, Howard S; Archuleta, Andrew S

    2002-01-01

    Blood samples collected from adult and nestling American dippers (Cinclus mexicanus) along the Arkansas River (CO, USA), a stream impacted by discharges from historical mining operations, and a reference stream were analyzed for lead concentration and delta-aminolevulinic acid dehydratase (ALAD) activity. Median ALAD activities of adult and nestling dippers from the Arkansas River were found to be significantly different from median ALAD activities of reference adults and nestlings (p = 0.002 and p = 0.028). Median ALAD activity for adult dippers from the Arkansas River was more than 50% lower relative to reference adults and activity approached a level close to 50% lower in nestlings from the same site. Median blood lead concentrations from adult (range 15.4-386.0 ppb) and nestling (range 12.1-323.0 ppb) dippers from the Arkansas River were found to be significantly different from median blood lead concentrations of reference adult (range 4.2-29.6 ppb) and nestling (range 4.2-8.2 ppb) dippers (p < 0.001 and p = 0.011). The median hematocrit level in adult dippers did not vary between sites (p = 0.73), whereas the median hematocrit level of nestling dippers from the reference site was significantly lower compared to Arkansas River nestlings (p = 0.042). Blood lead concentration in both adult and nestling dippers was found to be significantly correlated with invertebrate lead concentration (r = 0.81, p < 0.001 and r = 0.62, p = 0.01, respectively). Highly significant negative correlations were observed between blood lead concentration and ALAD activity in both adult and nestling dippers (r = -0.86, p < 0.001 and r = -0.84, p < 0.001, respectively). This study suggests that dippers (both adults and nestlings) from the Arkansas River have significantly lower ALAD activity and significantly higher blood lead concentrations compared to reference values. The measurement of ALAD activity may be a sensitive and accurate biomarker for environmental lead exposure in dippers

  4. Irradiance-dependent photobleaching and pain in δ-aminolevulinic acid-photodynamic therapy of superficial basal cell carcinomas

    PubMed Central

    Cottrell, W.J.; Paquette, A.D.; Keymel, K.R.; Foster, T.H.; Oseroff, A.R.

    2009-01-01

    Purpose In superficial basal cell carcinomas (sBCC) treated with photodynamic therapy with topical δ-aminolevulinic acid (ALA-PDT) we examined effects of light irradiance on photodynamic efficiency and pain. The rate of singlet oxygen production depends on the product of irradiance and photosensitizer and oxygen concentrations. High irradiance and/or photosensitizer levels cause inefficient treatment from oxygen depletion in preclinical models. Experimental Design Self-sensitized photobleaching of PpIX fluorescence was used as a surrogate metric for photodynamic dose. We developed instrumentation measuring fluorescence and reflectance from lesions and margins during treatment at 633nm with various irradiances. When PpIX was 90% bleached, irradiance was increased to 150 mW cm−2 until 200 J cm−2 were delivered. Pain was monitored. Results In 33 sBCC in 26 patients, photobleaching efficiency decreased with increasing irradiance above 20 mW cm−2, consistent with oxygen depletion. Fluences bleaching PpIX fluorescence 80% (D80) were 5.7±1.6, 4.5±0.3, 7.5±0.8, 7.4±0.3, 12.4±0.3 and 28.7±7.1 J cm−2, respectively, at 10, 20, 40, 50, 60 and 150 mW cm−2. At 20–150 mW cm−2, D80 doses required 2.5–3.5 min; times for the total 200 J cm−2 were 22.2–25.3 min. No significant pain occurred up to 50 mW cm−2; pain was not significant when irradiance then increased. Clinical responses were comparable to continuous150 mW cm−2 treatment. Conclusions ALA-PDT using ~40 mW cm−2 at 633nm is photodynamically efficient with minimum pain. Once PpIX is largely photobleached, higher irradiances allow efficient, rapid delivery of additional light. Optimal fluence at a single low irradiance is yet to be determined. PMID:18628462

  5. Clinical studies of combined photodynamic therapy using 5-fluorouracil and methyl-aminolevulinate in patients at high risk for squamous cell carcinoma

    NASA Astrophysics Data System (ADS)

    Maytin, Edward V.; Lohser, Sara; Tellez, Alejandra; Wene, Lauren; Ishak, Rim; Anand, Sanjay

    2013-03-01

    Photodynamic therapy (PDT) using aminolevulinic acid or its methyl ester, methyl-aminolevulinate (MAL), is an increasingly recognized approach for treating squamous neoplasia of the skin. Advantages of MAL-PDT include its ability to cover broad diseased areas (field treatment), and to do multiple sessions with little-to-no risk of scarring or mutagenesis. MAL-PDT is especially valuable in certain populations at high risk for skin cancer, including Caucasian patients with extensive solar damage, and organ transplant recipients (OTR) who take immunosuppressive drugs to prevent graft rejection. The latter group has a 65-200 fold increased risk of developing squamous cell carcinoma (SCC), a major cause of mortality. Therapeutic options for those patients, other than frequent surgeries, are very limited. Topical 5-Fluorouracil (5-FU), frequently prescribed in normal patients for pre-SCC of the skin, is only minimally effective in the OTR group. MAL-PDT, however, has ~40% efficacy for pre-SCC in OTR patients. Based upon our preclinical studies in mouse tumor models, which showed that preconditioning with 5-FU can drive higher accumulation of target protoporphyins (PpIX), we proposed a rational combination regimen of 5-FU and MAL-PDT in humans. A clinical trial was designed to test the hypothesis that a combination of 5-FU followed by MAL-PDT will elevate PpIX levels and achieve better clinical outcomes in high-risk OTR patients. Primary endpoints include PpIX levels and biochemical markers (p53) measured noninvasively and in skin biopsies. Lesion clearance and recurrence (via photographs and clinical exam) are secondary endpoints. Ongoing results of this clinical trial are presented.

  6. Human Erythroid 5-Aminolevulinate Synthase Mutations Associated with X-Linked Protoporphyria Disrupt Conformational Equilibrium and Enhance Product Release†

    PubMed Central

    Fratz, Erica J.; Clayton, Jerome; Hunter, Gregory A.; Ducamp, Sarah; Breydo, Leonid; Uversky, Vladimir N.; Deybach, Jean-Charles; Gouya, Laurent; Puy, Hervé; Ferreira, Gloria C.

    2015-01-01

    Regulation of 5-aminolevulinate synthase (ALAS) is at the origin of balanced heme production in mammals. Mutations in the C-terminal region of human erythroid-specific ALAS (hALAS2) are associated with X-linked protoporphyria (XLPP), a disease characterized by extreme photosensitivity, with elevated blood concentrations of free protoporphyrin IX and zinc protoporphyrin. To investigate the molecular basis for this disease, recombinant hALAS2 and variants of the enzyme harboring the gain-of-function XLPP mutations were constructed, purified, and analyzed kinetically, spectroscopically and thermodynamically. Enhanced activities of the XLPP variants resulted from accelerations in the rate at which the product 5-aminolevulinate (ALA) was released from the enzyme. Circular dichroism spectroscopy revealed that the XLPP mutations altered the microenvironment of the pyridoxal 5’-phosphate cofactor, which underwent further and specific alterations upon succinyl-CoA binding. Transient kinetic analyses of the variant-catalyzed reactions and protein fluorescence quenching upon ALA binding to the XLPP variants demonstrated that the protein conformational transition step associated with product release was predominantly affected. Of relevance, XLPP could also be modeled in cell culture. We propose that 1) the XLPP mutations destabilize the succinyl-CoA-induced hALAS2 closed conformation and thus accelerate ALA release, 2) the extended C-terminus of wild-type mammalian ALAS2 provides a regulatory role that allows for allosteric modulation of activity, thereby controlling the rate of erythroid heme biosynthesis, and 3) this control is disrupted in XLPP, resulting in porphyrin accumulation. PMID:26300302

  7. Asn-150 of Murine Erythroid 5-Aminolevulinate Synthase Modulates the Catalytic Balance between the Rates of the Reversible Reaction.

    PubMed

    Stojanovski, Bosko M; Ferreira, Gloria C

    2015-12-25

    5-Aminolevulinate synthase (ALAS) catalyzes the first step in mammalian heme biosynthesis, the pyridoxal 5'-phosphate (PLP)-dependent and reversible reaction between glycine and succinyl-CoA to generate CoA, CO2, and 5-aminolevulinate (ALA). Apart from coordinating the positioning of succinyl-CoA, Rhodobacter capsulatus ALAS Asn-85 has a proposed role in regulating the opening of an active site channel. Here, we constructed a library of murine erythroid ALAS variants with substitutions at the position occupied by the analogous bacterial asparagine, screened for ALAS function, and characterized the catalytic properties of the N150H and N150F variants. Quinonoid intermediate formation occurred with a significantly reduced rate for either the N150H- or N150F-catalyzed condensation of glycine with succinyl-CoA during a single turnover. The introduced mutations caused modifications in the ALAS active site such that the resulting variants tipped the balance between the forward- and reverse-catalyzed reactions. Although wild-type ALAS catalyzes the conversion of ALA into the quinonoid intermediate at a rate 6.3-fold slower than the formation of the same quinonoid intermediate from glycine and succinyl-CoA, the N150F variant catalyzes the forward reaction at a mere 1.2-fold faster rate than that of the reverse reaction, and the N150H variant reverses the rate values with a 1.7-fold faster rate for the reverse reaction than that for the forward reaction. We conclude that the evolutionary selection of Asn-150 was significant for optimizing the forward enzymatic reaction at the expense of the reverse, thus ensuring that ALA is predominantly available for heme biosynthesis.

  8. A gas chromatography-mass spectrometry method for the determination of delta-aminolevulinic acid in plant leaves.

    PubMed

    Hijaz, Faraj; Killiny, Nabil

    2016-05-20

    Delta-aminolevulinic (δ-ALA) acid is an important intermediate for tetrapyrroles biosynthesis and it has recently received great attention in plant physiology and human toxicology. However, the colorimetric method which is the most common method for determination of δ-ALA is time consuming and is not specific. In this study, a method for determination of δ-ALA in plant tissues was developed based on the trimethylsilyl (TMS) derivative of the pyrrole formed from the reaction of δ-ALA with ethyl acetoacetate via Knorr condensation. The δ-ALA in the HCl extract was reacted with ethyl acetoacetate to form a pyrrole. Then, the pyrrole compound was extracted using ethyl acetate and the solvent was evaporated to dryness. The dried sample was derivatized to its TMS ester and analyzed using GC-MS. The concentration of δ-ALA in citrus leaves incubated with levulinic acid was also determined by the conventional colorimetric method. The linear range was 10-200ppm in the full scan mode and 0.1-20ppm in the selected ion monitoring (SIM). The limit of detection was 6ppm in the full scan and 0.05ppm in SIM mode, representing a four-fold increase in sensitivity compared to the colorimetric method. The GC-MS method developed in this study is simple, accurate, sensitive, and could also be used to measure δ-ALA in other biological samples.

  9. Identification of the enzymatic basis for. delta. -aminolevulinic acid auxotrophy in a hemA mutant of escherichia coli

    SciTech Connect

    Avissar, Y.J.; Beale, S.I. )

    1989-06-01

    The hemA mutation of Escherichia coli K-12 confers a requirement for {delta}-aminolevulinic acid (ALA). Cell extract prepared from the hemA strain SASX41B was incapable of producing ALA from either glutamate or glutamyl-tRNA, whereas extract of the hem{sup +} strain HB101 formed colorimetrically detectable amounts of ALA and transferred label from 1-({sup 14}C)glutamate and 3,4-({sup 3}H)glutamyl-tRNA to ALA. Extracts of both strains converted glutamate-1-semialdehyde to ALA and were capable of aminoacylating tRNA{sup Glu}. Glutamyl-tRNA formed by extracts of both strains could be converted to ALA by the extract of hem{sup +} cells. The extract of hemA cells did not convert glutamyl-tRNA formed by either strain to ALA. However, the hemA cell extract, when supplemented in vitro with glutamyl-tRNA dehydrogenase isolated from Chlorella vulgaris cells, formed about as much ALA as did the unsupplemented hem{sup +} cell extract. We conclude from these observations that the enzyme activity that is lacking in the ALA auxotrophic strain carrying the hemA mutation is that of glutamyl-tRNA dehydrogenase.

  10. Tissue-dependent biosynthesis and pharmacokinetics of Protopophyrin IX following intravenous injection of δ-aminolevulinic acid

    NASA Astrophysics Data System (ADS)

    Ronn, Avigdor M.; Lofgren, Lennart A.

    1995-05-01

    Two significant questions arise when a drug for photodynamic therapy is introduced to the preclinical arena: (1) pharmacokinetics for the uptake and elimination and (2) relative retention by various tissues. Theses were addressed by following the pharmacokinetics in 21 rabbits with 130 tumors at different drug doses and at time intervals ranging from minutes to 24 hours. Kinetics were studied spectrofluorometrically by following extracting Protoporphyrin IX (PPIX), a metabolite of delta- aminolevulinic acid (ALA). Samples were compared to a standard, and are thus quantitative. The rise time in plasma was rapid, and reached maximum one hour post injection with drug doses of 50, 100, and 200 mg/kg. The single exponential fall time displayed a half life of fifty minutes, resulting in a complete elimination of PPIX in 24 hours. Uptake and retention in multiple tissues were measured 3 hours post injection of 100 mg/g ALA in 3 animals, with skin, tumor, and plasma measured in all 21 animals. Organs with high vascularity displayed higher values of PPIX. Results of this study indicate that ALA utilized as a systemically administered sensitizer maybe of significant value in PDT of selected tumor types.

  11. Effects of lead on delta-aminolevulinic acid dehydratase activity, growth, hemoglobin content, and reproduction in Daphnia magna

    SciTech Connect

    Berglind, R.; Dave, G.; Sjoebeck, M.L.

    1985-04-01

    The effects of continuous exposure to lead for various periods and recovery in clean water on delta-aminolevulinic acid dehydratase (ALA-D) activity, hemoglobin content, growth, and reproduction were studied in Daphnia magna. Steady-state inhibition of ALA-D activity was reached within 2 days in 16, 64, and 256 micrograms Pb liter-1, but restoration in clean water was prolonged in relation to previous exposure. In spite of the inhibition of ALA-D activity hemoglobin content increased after 2 days in 16 and 24 micrograms Pb liter-1. Furthermore, hemoglobin content in previously exposed animals increased during recovery in clean water. Maximum hemoglobin content (2.9 times control value) was found after 2 days recovery of animals exposed to 64 micrograms Pb liter-1. These findings suggest that some enzyme(s) other than ALA-D in the biosynthetic pathway of hemoglobin formation is (are) more sensitive to lead. Growth, in contrast to reproduction, was stimulated by low concentrations of lead (less than 64 micrograms Pb liter-1), although in 256 micrograms Pb liter-1 growth was also significantly impaired. After 19 days the 16 and 50% reproductive impairment concentrations were less than or equal to 1 and 10 micrograms Pb liter-1, respectively.

  12. Relationships between blood lead concentration and aminolevulinic acid dehydratase in alcoholics and workers industrially exposed to lead

    SciTech Connect

    Bortoli, A.; Fazzin, G.; Marin, V.; Trabuio, G.; Zotti, S.

    1986-07-01

    Blood lead concentration (Pb-B), aminolevulinic acid dehydratase (ALAD), and gamma-GT were measured in 265 workers industrially exposed to lead and in 184 patients with liver disease resulting from alcohol consumption. The first group was divided according to alcohol use, i.e., nondrinkers, moderate drinkers, and heavy drinkers. The second group was divided according to the following criteria: hepatopatic without cirrhosis, hepatopatic with compensated cirrhosis, and hepatopatic with decompensated cirrhosis. Heavy drinkers who were industrially exposed had the highest Pb-B (40.4 +/- 14.6 micrograms/dl) and the lowest ALAD (22.2 +/- 9.1 U/L). The correlations between Pb-B and ALAD show no significant change with the increase of Pb-B. In the alcoholic group, 76 patients with alcoholic liver disease without cirrhosis had the highest Pb-B (40.3-9.1 micrograms/dl) and ALAD the lowest (18.6 +/- 7.7 U/L). The negative correlation between Pb-B and log ALAD disappeared completely in individuals with Pb-B that exceeded 50 micrograms/dl, independent from the seriousness of illness.

  13. Noninvasive fluorescence monitoring of protoporphyrin IX production and clinical outcomes in actinic keratoses following short-contact application of 5-aminolevulinate

    NASA Astrophysics Data System (ADS)

    Warren, Christine B.; Lohser, Sara; Wene, Lauren C.; Pogue, Brian W.; Bailin, Philip L.; Maytin, Edward V.

    2010-09-01

    Topical 5-aminolevulinic acid (ALA) is widely used in photodynamic therapy (PDT) of actinic keratoses (AK), a type of premalignant skin lesion. However, the optimal time between ALA application and exposure to light has not been carefully investigated. Our objective is to study the kinetics of protoporphyrin IX (PpIX) accumulation in AK after short contact ALA and relate this to erythemal responses. Using a noninvasive dosimeter, PpIX fluorescence measurements (5 replicates) were taken at 20-min intervals for 2 h following ALA application, in 63 AK in 20 patients. Data were analyzed for maximal fluorescent signal obtained, kinetic slope, and changes in erythema. Our results show that PpIX accumulation was linear over time, becoming statistically higher than background in 48% of all lesions by 20 min, 92% of lesions by 1 h, and 100% of lesions by 2 h. PpIX accumulation was roughly correlated with changes in lesional erythema post-PDT. We conclude that significant amounts of PpIX are produced in all AK lesions by 2 h. The linear kinetics of accumulation suggest that shorter ALA application times may be efficacious in many patients. Noninvasive fluorescence monitoring of PpIX may be useful to delineate areas of high PpIX accumulation within precancerous areas of the skin.

  14. Delta-aminolevulinic acid dehydratase activity (ALA-D) in red mullet (Mullus barbatus) from Mediterranean waters as biomarker of lead exposure.

    PubMed

    Fernández, B; Martínez-Gómez, C; Benedicto, J

    2015-05-01

    The enzyme delta-aminolevulinic acid dehydratase (ALA-D) has been investigated as biomarker of lead (Pb) exposure in red mullet (Mullus barbatus) from the Spanish continental shelf. Concentrations of Pb and Zn in muscle and organosomatic indices were also measured to explore causality. Blood ALA-D assay conditions were optimized; the optimum pH for this species has been set to 6.5. Results showed that ALA-D activity ranged from 3.2 to 16.9 nmol PBGmin(-1)mg(-1). No significant differences on ALA-D levels between genders have been detected. ALA-D Baseline level and Background Assessment Criteria (BAC) for this species have been set to 9.1 and 6.6 nmol PBGmin(-1)mg(-1), respectively. There have been detected significant differences on ALA-D activity levels among areas, though the markedly low levels of Pb measured in fish muscle seemed not to be able to produce a relevant suppression on ALA-D. In spite of this, a weak inverse relationship detected between ALA-D and Pb concentrations pointed out the potential of this biomarker in red mullet to reflect Pb bioavailability in marine environment. Nevertheless, subsequent research on ALA-D in marine fish species is recommended to be limited to areas where environmental Pb is effectively accumulated by fish.

  15. Associations of blood lead, dimercaptosuccinic acid-chelatable lead, and tibia lead with polymorphisms in the vitamin D receptor and [delta]-aminolevulinic acid dehydratase genes.

    PubMed Central

    Schwartz, B S; Lee, B K; Lee, G S; Stewart, W F; Simon, D; Kelsey, K; Todd, A C

    2000-01-01

    A cross-sectional study was performed to evaluate the influence of polymorphisms in the [delta]-aminolevulinic acid dehydratase (ALAD) and vitamin D receptor (VDR) genes on blood lead, tibia lead, and dimercaptosuccinic acid (DMSA)-chelatable lead levels in 798 lead workers and 135 controls without occupational lead exposure in the Republic of Korea. Tibia lead was assessed with a 30-min measurement by (109)Cd-induced K-shell X-ray fluorescence, and DMSA-chelatable lead was estimated as 4-hr urinary lead excretion after oral administration of 10 mg/kg DMSA. The primary goals of the analysis were to examine blood lead, tibia lead, and DMSA-chelatable lead levels by ALAD and VDR genotypes, controlling for covariates; and to evaluate whether ALAD and VDR genotype modified relations among the different lead biomarkers. There was a wide range of blood lead (4-86 microg/dL), tibia lead (-7-338 microg Pb/g bone mineral), and DMSA-chelatable lead (4.8-2,103 microg) levels among lead workers. Among lead workers, 9.9% (n = 79) were heterozygous for the ALAD(2) allele and there were no homozygotes. For VDR, 10.7% (n = 85) had the Bb genotype, and 0.5% (n = 4) had the BB genotype. Although the ALAD and VDR genes are located on different chromosomes, lead workers homozygous for the ALAD(1) allele were much less likely to have the VDR bb genotype (crude odds ratio = 0.29, 95% exact confidence interval = 0.06-0.91). In adjusted analyses, subjects with the ALAD(2) allele had higher blood lead levels (on average, 2.9 microg/dL, p = 0.07) but no difference in tibia lead levels compared with subjects without the allele. In adjusted analyses, lead workers with the VDR B allele had significantly (p < 0.05) higher blood lead levels (on average, 4.2 microg/dL), chelatable lead levels (on average, 37.3 microg), and tibia lead levels (on average, 6.4 microg/g) than did workers with the VDR bb genotype. The current data confirm past observations that the ALAD gene modifies the

  16. Effects of Delta-Aminolevulinic Acid Dehydratase Polymorphisms on Susceptibility to Lead in Han Subjects from Southwestern China

    PubMed Central

    Yang, Yuelin; Wu, Jin; Sun, Pin

    2012-01-01

    This study is to determine the distribution of the delta-aminolevulinic acid dehydratase (ALAD) polymorphism among Han subjects of the Chinese population and to study whether the polymorphism in the ALAD gene modifies the toxicity of lead in lead-exposed workers. For this purpose we conducted a cross-sectional study on 156 Chinese workers who were exposed to lead in lead-acid battery and electric-flex manufacturing plants. The authors found that the allele frequencies of ALAD1 and ALAD2 were 0.9679 and 0.0321, respectively. Workers with the ALAD 1-1 genotype were associated with higher blood lead levels than those with the ALAD 1-2 genotype. Blood and urine lead levels were much higher in storage battery workers than in cable workers. The self-conscious symptom survey showed that the incidences of debilitation, amnesia and dreaminess were much higher in those had more than five years of tenure or contact with lead on the job within the ALAD 1-1 genotype subgroup. Laboratory examinations showed that serum iron and zinc levels in workers’ with the ALAD 1-2 genotype were higher than those with the ALAD 1-1 genotype, especially in storage-battery workers. Correlation analysis indicated that the blood lead level negatively correlated with serum calcium, iron and zinc level. The data of this study suggest that the ALAD gene polymorphism and serum ion levels may modify the kinetics of lead in blood. Therefore, the authors recommend that an adequate intake of dietary calcium, iron, and zinc or the calcium, iron, and zinc supplementation should be prescribed to Chinese lead exposed workers. PMID:22851944

  17. Effects of delta-aminolevulinic acid dehydratase polymorphisms on susceptibility to lead in Han subjects from southwestern China.

    PubMed

    Yang, Yuelin; Wu, Jin; Sun, Pin

    2012-07-01

    This study is to determine the distribution of the delta-aminolevulinic acid dehydratase (ALAD) polymorphism among Han subjects of the Chinese population and to study whether the polymorphism in the ALAD gene modifies the toxicity of lead in lead-exposed workers. For this purpose we conducted a cross-sectional study on 156 Chinese workers who were exposed to lead in lead-acid battery and electric-flex manufacturing plants. The authors found that the allele frequencies of ALAD1 and ALAD2 were 0.9679 and 0.0321, respectively. Workers with the ALAD 1-1 genotype were associated with higher blood lead levels than those with the ALAD 1-2 genotype. Blood and urine lead levels were much higher in storage battery workers than in cable workers. The self-conscious symptom survey showed that the incidences of debilitation, amnesia and dreaminess were much higher in those had more than five years of tenure or contact with lead on the job within the ALAD 1-1 genotype subgroup. Laboratory examinations showed that serum iron and zinc levels in workers' with the ALAD 1-2 genotype were higher than those with the ALAD 1-1 genotype, especially in storage-battery workers. Correlation analysis indicated that the blood lead level negatively correlated with serum calcium, iron and zinc level. The data of this study suggest that the ALAD gene polymorphism and serum ion levels may modify the kinetics of lead in blood. Therefore, the authors recommend that an adequate intake of dietary calcium, iron, and zinc or the calcium, iron, and zinc supplementation should be prescribed to Chinese lead exposed workers.

  18. Evaluation of photodynamic therapy using topical aminolevulinic acid hydrochloride in the treatment of condylomata acuminate

    PubMed Central

    Zhang, Zhen; Lu, Xiao-Nian; Liang, Jun; Tang, Hui; Yang, Yong-Sheng; Zhu, Xiao-Hua; Du, Juan; Shen, Yan-Yun; Xu, Jin-Hua

    2015-01-01

    Objectives: To investigate the efficacy and safety of topical application of 5-aminolaevulinic acid (ALA) photodynamic therapy (PDT) for the treatment of condylomata acuminata (CA) in larger population. Methods: Patients with CA were given a treatment of ALA-PDT once a week for 3 weeks and followed up at 4, 8, 12 and 24 weeks after the treatment finished. Results: In 531 patients, a clearance rate was observed 95.27%. The rates rouse with PDT cycles. The clearance rate of three PDT cycles was significant higher than one PDT cycles (P < 0.001) and two PDT cycles (P < 0.001). The clearance rate (88.73%) of small lesions (diameter small than 5mm) was significant higher than that (97.74%) of larger lesions (P < 0.001). The clearance rate varied with the location of the lesions. The clearance rate of urethral meatus was highest and that of perianal was lowest. Follow-up for patients with complete response lasted for 24 weeks. The recurrence rate was 5.65%, 11.30%, 15.07%, 15.44% and 16.20% after 1, 4, 8, 12 and 24 weeks. The recurrence rate varied with the location of the lesions. The recurrence rate of perianal was highest and that of labium was lowest. The side effects mainly included flare, pain, erosion, ulcer, and hyperpigmentation. The adverse reaction rate was 7.72%, 8.10%, 2.26%, 0.94% and 0.19%. Sexual dysfunction and urethral malformations were not observed during the 24 weeds visit. Conclusion: Topical application of ALA-PDT is a simple and as effective therapy with a lower incidence of adverse effects in the treatment of condylomata acuminata. PMID:26131281

  19. Heme Inhibition of [delta]-Aminolevulinic Acid Synthesis Is Enhanced by Glutathione in Cell-Free Extracts of Chlorella.

    PubMed Central

    Weinstein, J. D.; Howell, R. W.; Leverette, R. D.; Grooms, S. Y.; Brignola, P. S.; Mayer, S. M.; Beale, S. I.

    1993-01-01

    In plants, algae, and many bacteria, the heme and chlorophyll precursor, [delta]-aminolevulinic acid (ALA), is synthesized from glutamate in a reaction involving a glutamyl-tRNA intermediate and requiring ATP and NADPH as cofactors. In particulate-free extracts of algae and chloroplasts, ALA synthesis is inhibited by heme. Inclusion of 1.0 mM glutathione (GSH) in an enzyme and tRNA extract, derived from the green alga Chlorella vulgaris, lowered the concentration of heme required for 50% inhibition approximately 10-fold. The effect of GSH could not be duplicated with other reduced sulfhydryl compounds, including mercaptoethanol, dithiothreitol, and cysteine, or with imidazole or bovine serum albumin, which bind to heme and dissociate heme dimers. Absorption spectroscopy indicated that heme was fully reduced in incubation medium containing dithiothreitol, and addition of GSH did not alter the heme reduction state. Oxidized GSH was as effective in enhancing heme inhibition as the reduced form. Co-protoporphyrin IX inhibited ALA synthesis nearly as effectively as heme, and 1.0 mM GSH lowered the concentration required for 50% inhibition approximately 10-fold. Because GSH did not influence the reduction state of heme in the incubation medium, and because GSH could not be replaced by other reduced sulfhydryl compounds or ascorbate, the effect of GSH cannot be explained by action as a sulfhydryl protectant or heme reductant. Preincubation of enzyme extract with GSH, followed by rapid gel filtration, could not substitute for inclusion of GSH with heme during the reaction. The results suggest that GSH must specifically interact with the enzyme extract in the presence of the inhibitor to enhance the inhibition. PMID:12231722

  20. Heme inhibition of [delta]-aminolevulinic acid synthesis is enhanced by glutathione in cell-free extracts of Chlorella

    SciTech Connect

    Weinstein, J.D.; Howell, R.W.; Grooms, S.Y.; Brignola, P.S. ); Mayer, S.M.; Beale, S.I. )

    1993-02-01

    In plants, algae, and many bacteria, the heme and chlorophyll precursor, [delta]-aminolevulinic acid (ALA), is synthesized from glutamate in a reaction involving a glutamyl-tRNA intermediate and requiring ATP and NADAPH as cofactors. In particulate-free extracts of algae and chloroplasts, ALA synthesis is inhibited by heme. Inclusion of 1.0 mM glutathione (GSH) in an enzyme and tRNA extract, derived from the green alga Chlorella vulgaris, lowered the concentration of heme required for 50% inhibition approximately 10-fold. The effect of GSH could not be duplicated with other reduced sulfhydryl compounds, including mercaptoethanol, dithiothreitol, and cysteine, or with imidazole or bovine serum albumin, which bind to heme and dissociate heme dimers. Absorption spectroscopy indicated that heme was fully reduced in incubation medium containing dithiothreitol, and addition of GSH did not alter the heme reduction state. Oxidized GSH was as effective in enhancing heme inhibition as the reduced form. Co-protoporphyrin IX inhibited ALA synthesis nearly as effectively as heme, and 1.0 mM GSH lowered the concentration required for 50% inhibition approximately 10-fold. Because GSH did not influence the reduction state of heme in the incubation medium, and because GSH could not be replaced by other reduced sulfhydryl compounds or ascorbate, the effect of GSH cannot be explained by action as a sulfhydryl protectant or heme reductant. Preincubation of enzyme extract with GSH, followed by rapid gel filtration, could not substitute for inclusion of GSH with heme during the reaction. The results suggest that GSH with heme during the reaction. The results suggest that GSH must specifically interact with the enzyme extract in the presence of the inhibitor to enhance the inhibition. 48 refs., 7 figs., 4 tabs.

  1. Inhibition of erythrocytes δ-aminolevulinic acid dehydratase (ALAD) activity in fish from waters affected by lead smelters

    USGS Publications Warehouse

    Schmitt, Christopher J.; Caldwell, Colleen A.; Olsen, Bill; Serdar, Dave; Coffey, Mike

    2002-01-01

    We assessed the effects on fish of lead (Pb) released to streamsby smelters located in Trail, BC (Canada), E. Helena, MT, Herculaneum, MO, and Glover, MO. Fish were collected by electrofishing from sites located downstream of smelters and from reference sites. Blood from each fish was analyzed for δ-aminolevulinic acid dehydratase (ALAD) activity and hemoglobin (Hb), and samples of blood, liver, or carcass were analyzed for Pb, zinc (Zn), or both. Fish collected downstreamof all four smelters sites had elevated Pb concentrations, decreased ALAD activity, or both relative to their respectivereference sites. At E. Helena, fish from the downstream site also had lower Hb concentrations than fish from upstream. Differences among taxa were also apparent. Consistent with previous studies, ALAD activity in catostomids (Pisces: Catostomidae-northern hog sucker,Hypentelium nigricans;river carpsucker, Carpiodes carpio; largescale sucker, Catostomus macrocheilus; and mountain sucker, C. platyrhynchus) seemed more sensitive to Pb-induced ALADinhibition than the salmonids (Pisces: Salmonidae-rainbow trout,Oncorhynchus mykiss; brook trout,Salvelinus fontinalis) or common carp (Cyprinus carpio). Some of these differences may have resulted from differential accumulation of Zn, which was not measured at all sites. We detected noALAD activity in channel catfish (Ictaluruspunctatus) from either site on the Mississippi River at Herculaneum, MO. Our findings confirmed that Pb is releasedto aquatic ecosystems by smelters and accumulated by fish, andwe documented potentially adverse effects of Pb in fish. We recommend that Zn be measured along with Pb when ALAD activityis used as a biomarker and the collection of at least 10 fish ofa species at each site to facilitate statistical analysis.

  2. Aminolevulinic acid dendrimers in photodynamic treatment of cancer and atheromatous disease.

    PubMed

    Rodriguez, L; Vallecorsa, P; Battah, S; Di Venosa, G; Calvo, G; Mamone, L; Sáenz, D; Gonzalez, M C; Batlle, A; MacRobert, A J; Casas, A

    2015-09-26

    The use of endogenous protoporphyrin IX after administration of 5-aminolaevulinic acid (ALA) has led to many applications in photodynamic therapy (PDT). We have previously reported that the conjugation of ALA dendrimers enhances porphyrin synthesis. The first aim of this work was to evaluate the ability of ALA dendrimers carrying 6 and 9 ALA residues (6m-ALA and 9m-ALA) to photosensitise cancer cells. For this aim, we employed LM3 mammary carcinoma cells. In these tumour cells, at low concentrations porphyrin synthesis from dendrimers was higher compared to ALA, whereas at high concentrations, porphyrin synthesis was similar from both compounds. Topical application of ALA dendrimers on the skin overlying a subcutaneous LM3 implanted tumour showed no diffusion of the molecules either to distant skin sites or to the adjacent tumour, suggesting a promising use of the ALA macromolecules in superficial cancer models. As a second objective, we proposed the use of ALA-dendrimers in vascular PDT for the treatment of atherosclerosis. Thus, we focused our studies on ALA-dendrimer's selectivity towards macrophages in comparison with endothelial cells. For this aim we employed Raw 264.7 macrophages and HMEC-1 microvasculature cells. Porphyrin synthesis induced in macrophages by 6m-ALA and 9m-ALA (3 h, 0.025 mM) was 6 and 4.6 times higher respectively compared to the endothelial cell line, demonstrating the high affinity of ALA dendrimers for macrophages. On the other hand, ALA employed at low concentrations was slightly selective (1.7-fold) for macrophages. Inhibition studies suggested that ALA dendrimer uptake in macrophages is mainly mediated by caveloae-mediated endocytosis. Our main conclusion is that in addition to being promising molecules in PDT of superficial cancer, ALA dendrimers may also find applications in vascular PDT, since in vitro they showed selectivity to the macrophage component of the atheromatous plaque, as compared to the vascular endothelium.

  3. Associations of Uric Acid with Polymorphisms in the δ-Aminolevulinic Acid Dehydratase, Vitamin D Receptor, and Nitric Oxide Synthase Genes in Korean Lead Workers

    PubMed Central

    Weaver, Virginia M.; Schwartz, Brian S.; Jaar, Bernard G.; Ahn, Kyu-Dong; Todd, Andrew C.; Lee, Sung-Soo; Kelsey, Karl T.; Silbergeld, Ellen K.; Lustberg, Mark E.; Parsons, Patrick J.; Wen, Jiayu; Lee, Byung-Kook

    2005-01-01

    Recent research suggests that uric acid may be nephrotoxic at lower levels than previously recognized and that it may be one mechanism for lead-related nephrotoxicity. Therefore, in understanding mechanisms for lead-related nephrotoxicity, it would be of value to determine whether genetic polymorphisms that are associated with renal outcomes in lead workers and/or modify associations between lead dose and renal function are also associated with uric acid and/or modify associations between lead dose and uric acid. We analyzed data on three such genetic polymorphisms: δ-aminolevulinic acid dehydratase (ALAD), endothelial nitric oxide synthase (eNOS), and the vitamin D receptor (VDR). Mean (± SD) tibia, blood, and dimercaptosuccinic acid–chelatable lead levels were 37.2 ± 40.4 μg/g bone mineral, 32.0± 15.0 g/dL, and 0.77± 0.86 μg/mg creatinine, respectively, in 798 current and former lead workers. Participants with the eNOS Asp allele had lower mean serum uric acid compared with those with the Glu/Glu genotype. Among older workers (age ≥ median of 40.6 years), ALAD genotype modified associations between lead dose and uric acid levels. Higher lead dose was significantly associated with higher uric acid in workers with the ALAD1-1 genotype; associations were in the opposite direction in participants with the variant ALAD1-2 genotype. In contrast, higher tibia lead was associated with higher uric acid in those with the variant VDR B allele; however, modification was dependent on participants with the bb genotype and high tibia lead levels. We conclude that genetic polymorphisms may modify uric acid mediation of lead-related adverse renal effects. PMID:16263504

  4. [delta-Aminolevulinate dehydratase deficiency].

    PubMed

    Fujita, H; Ishida, N; Akagi, R

    1995-06-01

    delta-Aminolevulinate dehydratase (ALAD: E. C. 4.2.1.24), the second enzyme in the heme biosynthetic pathway, condenses two moles of delta-aminolevulinic acid to form porphobilinogen. ALAD deficiency is well known to develop signs and symptoms of typical hepatic porphyria, and classified into three categories as follows: (i) ALAD porphyria, a genetic defect of the enzyme, (ii) tyrosinemia type I, a genetic defect of fumarylacetoacetase in the tyrosine catabolic pathway, producing succinylacetone (a potent inhibitor of ALAD), and (iii) ALAD inhibition by environmental hazards, such as lead, trichloroethylene, and styrene. In the present article, we will describe molecular and biochemical mechanisms to cause the enzyme defect to discuss the significance of ALAD defect on human health.

  5. The protective effect of delta-aminolevulinic acid dehydratase 1-2 and 2-2 isozymes against blood lead with higher hematologic parameters.

    PubMed Central

    Kim, Hee-Seon; Lee, Sung-Soo; Lee, Gap-Soo; Hwangbo, Young; Ahn, Kyu-Dong; Lee, Byung-Kook

    2004-01-01

    Previous studies have suggested that delta-aminolevulinic acid dehydratase (ALAD) types 1-2 or 2-2 are protective against the toxicity of blood lead (PbB) when zinc protoporphyrin (ZPP) levels are low because of differential binding of lead in erythrocytes. The hypothesis is that subjects with the ALAD 1-1 genotype are more susceptible to lead exposure with impaired hematologic synthesis and therefore that iron nutrition is more important in those with the ALAD 1-1 genotype. The purpose of this study was to prove the protective effect of ALAD 1-2/2-2 against PbB with higher hematologic parameters. Data on 1,219 male workers from eight lead-using factories in the Republic of Korea were examined in this cross-sectional study. Blood samples were evaluated for PbB, ZPP, hemoglobin (Hb), and serum iron (SFe) concentrations and ALAD genotypes. The overall prevalence of the ALAD 1-2/2-2 genotype was 9.3%, which was associated with lower log ZPP (p < 0.001) and higher Hb (p = 0.014) levels. For the subjects with normal iron status (SFe levels > 60 micro g/dL), those with the ALAD 1-1 genotype were more likely to be anemic (adjusted odds ratio of 5.2; 95% confidence interval, 1.2-22.6) than those with ALAD 1-2/2-2. The study confirms the protective effects of ALAD 1-2/2-2 polymorphisms against PbB on hematologic pathways. In order to promote health and to minimize the toxicity of lead exposure more effectively, the nutritional management of iron in Korean workers should take both their ALAD genotypes and occupational lead exposures into account. PMID:15064157

  6. Effect of the delta-aminolevulinic acid dehydratase gene polymorphism on renal and neurobehavioral function in workers exposed to lead in China.

    PubMed

    Gao, Ai; Lu, Xiao-Ting; Li, Qiu-Ying; Tian, Lin

    2010-09-01

    Effects of delta-aminolevulinic acid dehydratase (ALAD) polymorphisms on the renal and neurobehavioral functions were investigated in Chinese workers from a storage battery plant exposed to inorganic lead. Blood and urine were collected from each worker to determine the ALAD genotypes, blood lead levels (PbB), urinary beta2-MG and urinary NAG activity. The World Health Organization Neurobehavioral Core Test Battery (WHO-NCTB) was used. Of the 135 lead workers tested for ALAD genotype, 126 were ALAD1-1, 9 were ALAD1-2 but none were ALAD2-2. The gene frequencies of ALADl-1 and ALADl-2 were 93.33% and 6.67%, respectively. The workers with ALAD1-2 genotype had significantly higher concentrations of PbB (62.52microg/dl vs. 41.02microg/dl), urinary NAG (22.01U/gCr vs. 13.49U/gCr), urinary beta2-MG (194.98microg/gCr vs. 112.88microg/gCr), and digit span backward (DSB) score (6.67 vs. 5.33) than those of ALAD1-1 genotype. Urinary NAG of ALAD1-2 genotype carriers was significantly higher than that of ALAD1-1 genotype under the same blood lead level (b(i) 0.75 vs. b(i) 0.29). Interaction between PbB and ALAD genotypes has a significant influence on NAG (P=0.02) and beta(2)-MG (P=0.01). It is postulated that the workers with the ALAD2 allele appear to be more susceptible to the effects of lead on renal injury, whereas neurobehavioral functions in ALAD1 homozygote tend to be more vulnerable.

  7. Fluorescence detection of flat transitional cell carcinoma after intravesical instillation of aminolevulinic acid

    NASA Astrophysics Data System (ADS)

    D'Hallewin, Marie-Ange; Vanherzeele, Herman A.; Baert, Luc

    1997-12-01

    Carcinoma in situ (CIS) of the bladder is a confounding disease that is difficult to recognize endoscopically since it is a flat cancer. Many studies have suggested its relationship with subsequent invasive disease. Early recognition of CIS therefore is essential in order to offer the patients the most appropriate treatment and the highest cure rate. Since white light cystoscopic examination is not sufficient to reveal areas of dysplasia or carcinoma in situ random biopsies are recommended. We wanted to evaluate whether amino levulinic acid (ALA) fluorescence detection could be helpful in diagnosing carcinoma in situ and if the specificity could be enhanced by reducing the ALA dose. Sixteen patients with papillary bladder cancer and carcinoma in situ and dysplasia were instilled with low dose ALA. Fluorescence detection of the metabolized ALA was performed three hours later, with the naked eye, after blue light illumination. CIS or dysplasia was found in 50 biopsies. The sensitivity for detecting CIS was 94% with a specificity of 89%. Carcinoma in situ can be diagnosed with a very high accuracy through fluorescence detection after ALA instillation. Fluorescence detection can be achieved with the naked eye and does not necessitate complex equipment neither specifically trained personnel.

  8. Enhancement of RNA Synthesis in Avian Liver Cell Cultures by a 5β-Steroid Metabolite During Induction of δ-Aminolevulinate Synthase

    PubMed Central

    Incefy, Genevieve S.; Kappas, Attallah

    1974-01-01

    The porphyrin-heme pathway is controlled in the liver at the level of the mitochondrial enzyme δ-aminolevulinate synthase (EC 2.3.1.37), a protein inducible in cultured avian hepatocytes by a variety of chemicals including certain 5β-metabolites of steroid hormones. The great sensitivity of the induction process to inhibition by agents known to block transcriptional activity of genetic material suggests that some control mechanism may be operating at this level to regulate the formation of the enzyme. We report here enhancement of nuclear RNA synthesis and of Mn2+-(NH4)2SO4-stimulated DNA-dependent RNA polymerase (EC 2.7.7.6) activities by the 5β-steroid metabolite, 3α-hydroxy-5β-androstan-17-one (etiocholanolone), in cultured avian hepatocytes during induction of the enzyme. These changes were demonstrated in the G1 phase of the hepatocyte cell cycle at a time when DNA synthesis is constant. Our findings support the view that one of the early steps in the process of induction of δ-aminolevulinate synthase by steroid metabolites requires new RNA synthesis, very probably messenger RNA, suggesting a 5β-steroid transcriptional control mechanism for induction of this protein. Images PMID:4526207

  9. Associations of blood pressure and hypertension with lead dose measures and polymorphisms in the vitamin D receptor and delta-aminolevulinic acid dehydratase genes.

    PubMed Central

    Lee, B K; Lee, G S; Stewart, W F; Ahn, K D; Simon, D; Kelsey, K T; Todd, A C; Schwartz, B S

    2001-01-01

    Evidence suggests that lead and selected genes known to modify the toxicokinetics of lead--namely, those for the vitamin D receptor (VDR) and delta-aminolevulinic acid dehydratase (ALAD)--may independently influence blood pressure and hypertension risk. We report the relations among ALAD and VDR genotypes, three lead dose measures, and blood pressure and hypertension status in 798 Korean lead workers and 135 controls without occupational exposure to lead. Lead dose was assessed by blood lead, tibia lead measured by X-ray fluorescence, and dimercaptosuccinic acid (DMSA)-chelatable lead. Among lead workers, 9.9% (n = 79) were heterozygous for the ALAD(2) allele, and there were no ALAD(2) homozygotes; 11.2% (n = 89) had at least one copy of the VDR B allele, and 0.5% (n = 4) had the BB genotype. In linear regression models to control for covariates, VDR genotype (BB and Bb vs. bb), blood lead, tibia lead, and DMSA-chelatable lead were all positive predictors of systolic blood pressure. On average, lead workers with the VDR B allele, mainly heterozygotes, had systolic blood pressures that were 2.7-3.7 mm Hg higher than did workers with the bb genotype. VDR genotype was also associated with diastolic blood pressure; on average, lead workers with the VDR B allele had diastolic blood pressures that were 1.9-2.5 mm Hg higher than did lead workers with the VDR bb genotype (p = 0.04). VDR genotype modified the relation of age with systolic blood pressure; compared to lead workers with the VDR bb genotype, workers with the VDR B allele had larger elevations in blood pressure with increasing age. Lead workers with the VDR B allele also had a higher prevalence of hypertension compared to lead workers with the bb genotype [adjusted odds ratio (95% confidence interval) = 2.1 (1.0, 4.4), p = 0.05]. None of the lead biomarkers was associated with diastolic blood pressure, and tibia lead was the only lead dose measure that was a significant predictor of hypertension status. In

  10. Expression of a hemA gene from Agrobacterium radiobacter in a rare codon optimizing Escherichia coli for improving 5-aminolevulinate production.

    PubMed

    Fu, Weiqi; Lin, Jianping; Cen, Peilin

    2010-01-01

    The 5-aminolevulinate (ALA) synthase gene (hemA) from Agrobacterium radiobacter zju-0121, which was cloned previously in our laboratory, contains several rare codons. To enhance the expression of this gene, Escherichia coli Rosetta(DE3), which is a rare codon optimizer strain, was picked out as the host to construct an efficient recombinant strain. Cell extracts of the recombinant E. coli were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis under the appropriate conditions. The results indicated that the activity of ALA synthase expressed in Rosetta(DE3)/pET-28a(+)-hemA was about 20% higher than that in E. coli BL21(DE3). Then the effects of precursors (glycine and succinate) and glucose, which is an inhibitor for ALA dehydratase as well as the carbon sources for cell growth, on the production of 5-aminolevulinate were investigated. Based on an optimal fed-batch culture system described in our previous work, up to 6.5 g/l (50 mM) ALA was produced in a 15-l fermenter.

  11. Red versus blue light illumination in hexyl 5-aminolevulinate photodynamic therapy: the influence of light color and irradiance on the treatment outcome in vitro.

    PubMed

    Helander, Linda; Krokan, Hans E; Johnsson, Anders; Gederaas, Odrun A; Plaetzer, Kristjan

    2014-08-01

    Hexyl 5-aminolevulinate (HAL) is a lipophilic derivative of 5-aminolevulinate, a key intermediate in biosynthesis of the photosensitizer protoporphyrin IX (PpIX). The photodynamic efficacy and cell death mode after red versus blue light illumination of HAL-induced PpIX have been examined and compared using five different cancer cell lines. LED arrays emitting at 410 and 624 nm served as homogenous and adjustable light sources. Our results show that the response after HAL-PDT is cell line specific, both regarding the shape of the dose-survival curve, the overall dose required for efficient cell killing, and the relative amount of apoptosis. The ratio between 410 and 624 nm in absorption coefficient correlates well with the difference in cell killing at the same wavelengths. In general, the PDT efficacy was several folds higher for blue light as compared with red light, as expected. However, HAL-PDT₆₂₄ induced more apoptosis than HAL-PDT₄₁₀ and illumination with low irradiance resulted in more apoptosis than high irradiance at the same lethal dose. This indicates differences in death modes after low and high irradiance after similar total light doses. From a treatment perspective, these differences may be important.

  12. Red versus blue light illumination in hexyl 5-aminolevulinate photodynamic therapy: the influence of light color and irradiance on the treatment outcome in vitro

    NASA Astrophysics Data System (ADS)

    Helander, Linda; Krokan, Hans E.; Johnsson, Anders; Gederaas, Odrun A.; Plaetzer, Kristjan

    2014-08-01

    Hexyl 5-aminolevulinate (HAL) is a lipophilic derivative of 5-aminolevulinate, a key intermediate in biosynthesis of the photosensitizer protoporphyrin IX (PpIX). The photodynamic efficacy and cell death mode after red versus blue light illumination of HAL-induced PpIX have been examined and compared using five different cancer cell lines. LED arrays emitting at 410 and 624 nm served as homogenous and adjustable light sources. Our results show that the response after HAL-PDT is cell line specific, both regarding the shape of the dose-survival curve, the overall dose required for efficient cell killing, and the relative amount of apoptosis. The ratio between 410 and 624 nm in absorption coefficient correlates well with the difference in cell killing at the same wavelengths. In general, the PDT efficacy was several folds higher for blue light as compared with red light, as expected. However, HAL-PDT624 induced more apoptosis than HAL-PDT410 and illumination with low irradiance resulted in more apoptosis than high irradiance at the same lethal dose. This indicates differences in death modes after low and high irradiance after similar total light doses. From a treatment perspective, these differences may be important.

  13. Combination photodynamic therapy using 5-fluorouracil and aminolevulinate enhances tumor-selective production of protoporphyrin IX and improves treatment efficacy of squamous skin cancers and precancers

    NASA Astrophysics Data System (ADS)

    Maytin, Edward V.; Anand, Sanjay

    2016-03-01

    In combination photodynamic therapy (cPDT), a small-molecule drug is used to modulate the physiological state of tumor cells prior to giving aminolevulinate (ALA; a precursor for protoporphyrin IX, PpIX). In our laboratory we have identified three agents (methotrexate, 5-fluorouracil, and vitamin D) that can enhance therapeutic effectiveness of ALAbased photodynamic therapy for cutaneous squamous cell carcinoma (SCC). However, only one (5-fluorouracil; 5-FU) is FDA-approved for skin cancer management. Here, we describe animal and human studies on 5-FU mechanisms of action, in terms of how 5-FU pretreatment leads to enhanced PpIX accumulation and improves selectivity of ALA-PDT treatment. In A431 subcutaneous tumors in mice, 5-FU changed expression of heme enzyme (upregulating coproporphyrinogen oxidase, and down-regulating ferrochelatase), inhibited tumor cell proliferation (Ki-67), enhanced differentiation (E-cadherin), and led to strong, tumor-selective increases in apoptosis. Interestingly, enhancement of apoptosis by 5-FU correlated strongly with an increased accumulation of p53 in tumor cells that persisted for 24 h post- PDT. In a clinical trial using a split-body, bilaterally controlled study design, human subjects with actinic keratoses (AK; preneoplastic precursors of SCC) were pretreated on one side of the face, scalp, or forearms with 5-FU cream for 6 days, while the control side received no 5-FU. On the seventh day, the levels of PpIX in 4 test lesions were measured by noninvasive fluorescence dosimetry, and then all lesions were treated with PDT using methyl-aminolevulinate (MAL) and red light (635 nm). Relative amounts of PpIX were found to be increased ~2-fold in 5-FU pretreated lesions relative to controls. At 3 months after PDT, the overall clinical response to PDT (reduction in lesion counts) was 2- to 3-fold better for the 5-FU pretreated lesions, a clinically important result. In summary, 5-FU is a useful adjuvant to aminolevulinate-based PDT

  14. Quantitative fluorescence using 5-aminolevulinic acid–induced protoporphyrin IX biomarker as a surgical adjunct in low-grade glioma surgery

    PubMed Central

    Valdés, Pablo A.; Jacobs, Valerie; Harris, Brent T.; Wilson, Brian C.; Leblond, Frederic; Paulsen, Keith D.; Roberts, David W.

    2015-01-01

    OBJECT Previous studies in high-grade gliomas (HGGs) have indicated that protoporphyrin IX (PpIX) accumulates in higher concentrations in tumor tissue, and, when used to guide surgery, it has enabled improved resection leading to increased progression-free survival. Despite the benefits of complete resection and the advances in fluorescence-guided surgery, few studies have investigated the use of PpIX in low-grade gliomas (LGGs). Here, the authors describe their initial experience with 5-aminolevulinic acid (ALA)–induced PpIX fluorescence in a series of patients with LGG. METHODS Twelve patients with presumed LGGs underwent resection of their tumors after receiving 20 μg/kg of ALA approximately 3 hours prior to surgery under an institutional review board–approved protocol. Intraoperative assessments of the resulting PpIX emissions using both qualitative, visible fluorescence and quantitative measurements of PpIX concentration were obtained from tissue locations that were subsequently biopsied and evaluated histopathologically. Mixed models for random effects and receiver operating characteristic curve analysis for diagnostic performance were performed on the fluorescence data relative to the gold-standard histopathology. RESULTS Five of the 12 LGGs (1 ganglioglioma, 1 oligoastrocytoma, 1 pleomorphic xanthoastrocytoma, 1 oligodendroglioma, and 1 ependymoma) demonstrated at least 1 instance of visible fluorescence during surgery. Visible fluorescence evaluated on a specimen-by-specimen basis yielded a diagnostic accuracy of 38.0% (cutoff threshold: visible fluorescence score ≥ 1, area under the curve = 0.514). Quantitative fluorescence yielded a diagnostic accuracy of 67% (for a cutoff threshold of the concentration of PpIX [CPpIX] > 0.0056 μg/ml, area under the curve = 0.66). The authors found that 45% (9/20) of nonvisibly fluorescent tumor specimens, which would have otherwise gone undetected, accumulated diagnostically significant levels of CPpIX that were

  15. Lead accumulation and depression of delta-aminolevulinic acid dehydratase (ALAD) in young birds fed automotive waste oil

    USGS Publications Warehouse

    Eastin, W.C.; Hoffman, D.J.; O'Leary, C.T.

    1983-01-01

    The effects of a 3-week dietary exposure to automotive waste crankcase oil (WCO) were examined in 1-week-old mallard (Anas platyrhynchos) ducklings and pheasant (Phasianus colchicus) chicks. Treatment groups consisted of birds exposed to 0.5, 1.5, or 4.5% WCO, to 4.5% clean crankcase oil (CCO), or untreated controls. In both species, red blood cell ALAD activity was significantly inhibited after one week by 50 to 60% in the 0.5% WCO group and by 85 to 90% in the 4.5% WCO group due to the presence of lead. Growth, hematocrit, and hemoglobin were not significantly affected at the end of three weeks. Plasma aspartate aminotransferase (AST) activity was higher in mallards after three weeks of ingesting either 4.5% WCO or 4.5% CCO, suggesting an oil-related effect due to components other than lead. Treatment had no effect on plasma concentration of uric acid, glucose, triglycerides, total protein, or cholesterol. Lead analysis showed the WCO to contain 4,200 ppm Pb and the CCO to contain 2 ppm. Tissues of mallards were examined for accumulation of lead and the order of accumulation at the end of three weeks was kidney > liver > blood ~ brain.

  16. Comparison of photodynamic therapy with different excitation wavelengths using a dynamic model of aminolevulinic acid-photodynamic therapy of human skin

    NASA Astrophysics Data System (ADS)

    Liu, Baochang; Farrell, Thomas J.; Patterson, Michael S.

    2012-08-01

    Different wavelength light sources are used in photodynamic therapy (PDT) of the skin to treat different conditions. Clinical studies show inconsistent results for the effectiveness of aminolevulinic acid (ALA)-PDT performed at different wavelengths. In order to understand the effect of treatment wavelength, a theoretical study was performed to calculate time-resolved depth-dependent distributions of PDT components including ground-state oxygen, sensitizer, and reacted singlet oxygen for different treatment wavelengths (405, 523, and 633 nm) using a numerical model of ALA-PDT of human skin. This model incorporates clinically relevant features of the PDT process including light attenuation, photobleaching, oxygen consumption, and diffusion, as well as tissue perfusion. The calculations show that the distributions of these quantities are almost independent of the treatment wavelength to a depth of about 1 mm. In this surface region, PDT-induced hypoxia is the dominant process. At greater depths, the production of singlet -oxygen is governed by the penetration of the treatment light. Two noninvasive PDT dosimetry approaches: the cumulative singlet oxygen luminescence (CSOL) and the fractional fluorescence bleaching metric, were investigated and compared for all three wavelengths. Although CSOL was more robust, both metrics provided correlations with the singlet oxygen dose in the upper dermis that were almost independent of treatment wavelength. This relationship breaks down at greater depths because light penetration depends on wavelength.

  17. Accumulation of protoporphyrin IX from delta-aminolevulinic acid in bovine skin fibroblasts with hereditary erythropoietic protoporphyria. A gene-dosage effect

    PubMed Central

    1981-01-01

    Bovine skin fibroblasts accumulated protoporphyrin IX when incubated in culture with the porphyrin-heme precursor, delta-aminolevulinic acid (ALA). Fibroblasts from cattle homozygous for erythropoietic protoporphyria (EPP) and with the clinical symptoms of the disease accumulated approximately sixfold greater amounts of protoporphyrin IX than cells from normal control animals. Cells from obligatory heterozygous animals, which are clinically normal, accumulated an intermediate level of protoporphyrin IX. When these cells were incubated with ALA and CaMg EDTA, all types of cells accumulated approximately the same amount of protoporphyrin IX (approximately 500 nmol/mg protein), suggesting that ferrochelatase activity was equally low after inhibition by treatment with CaMg EDTA in all cells. Thus the ratio of protoporphyrin IX accumulation from ALA in cultures treated with CaMg EDTA compared with controls treated with ALA alone was greatest in normal cells, least in EPP cells, and intermediate in the heterozygote cells. These findings suggest that the amount of protoporphyrin IX accumulation from ALA reflects the extent of deficiency of ferrochelatase and is proportional to the dosage of abnormal EPP gene in cultured fibroblasts. Similarly, stimulation of porphyrin accumulation by CaMg EDTA reflects diminished ferrochelatase activity in these cells. Thus, the results of this study demonstrate the usefulness of estimating protoporphyrin IX formation from ALA for the detection of an EPP gene defect in cultured bovine skin fibroblasts. PMID:6788885

  18. No-Needle Jet Intradermal Aminolevulinic Acid Photodynamic Therapy for Recurrent Nodular Basal Cell Carcinoma of the Nose: A Case Report

    PubMed Central

    Barolet, Daniel; Boucher, Annie

    2011-01-01

    Photodynamic therapy (PDT) with aminolevulinic acid (ALA) to treat nodular basal cell carcinoma (BCC) has been shown to be beneficial. The success rate of ALA-PDT in the treatment of nodular BCC is dependent on optimal penetration of the photosensitizing agent and subsequent PpIX production. To enhance topical delivery of drugs intradermally, a needleless jet injection (NLJI), which employs a high-speed jet to puncture the skin without the side effects of needles, was used in one patient with recurrent BCC of the nose. Photoactivation was then performed using red light emitting diode [CW @ λ 630 nm, irradiance 50 mW/cm2, total fluence 51 J/cm2] for 17 minutes. Excellent cosmesis was obtained. Aside from mild crusting present for six days, no other adverse signs were noted. Clinically, there was no recurrent lesion up two years postintervention. Additional studies in larger samples of subjects are needed to further evaluate this promising technique. PMID:21188233

  19. Biomonitoring of lead-contaminated Missouri streams with an assay for erythrocyte δ-aminolevulinic acid dehydratase activity in fish blood

    USGS Publications Warehouse

    Schmitt, C. J.; Wildhaber, M.L.; Hunn, J.B.; Nash, T.; Tieger, M. N.; Steadman, B. L.

    1993-01-01

    The activity of the enzyme δ-aminolevulinic acid dehydratase (ALA-D) in erythrocytes has long been used as a biomarker of lead exposure in humans and waterfowl and, more recently, in fishes. The assay was tested for ALA-D activity in fishes from streams affected by lead in combination with other metals from lead-zinc mining and related activities. Fishes (mostly catostomids) were collected from sites affected by historic and current mining activities, and from sites considered to be unaffected by mining (reference sites). A group of potentially toxic elements was measured in blood and carcass samples of individual fish, as were ALA-D activity, total protein (TP), and hemoglobin (Hb) in blood. Concentrations of mining-related metals (lead, zinc, and cadmium) were significantly greater (P<0.05) in fish blood and carcass at sites affected by historic mining activities than at reference and active mining sites. When analyzed by multiple regression, ALA-D activity, Hb, and TP accounted for 66% of blood-lead and 69% of carcass-lead variability. Differences among species were small. ALA-D activity as a biomarker adequately distinguished sites affected by bioavailable environmental lead. Zinc was the only other metal that affected ALA-D activity; it appeared to ameliorate the inactivation of ALA-D by lead.

  20. Real-time analysis of endogenous protoporphyrin IX fluorescence from δ-aminolevulinic acid and its derivatives reveals distinct time- and dose-dependent characteristics in vitro

    NASA Astrophysics Data System (ADS)

    Kiesslich, Tobias; Helander, Linda; Illig, Romana; Oberdanner, Christian; Wagner, Andrej; Lettner, Herbert; Jakab, Martin; Plaetzer, Kristjan

    2014-08-01

    Photodynamic therapy (PDT) and photodiagnosis based on the intracellular production of the photosensitizer protoporphyrin IX (PPIX) by administration of its metabolic precursor δ-aminolevulinic acid (ALA) achieved their breakthrough upon the clinical approval of MAL (ALA methyl ester) and HAL (ALA hexyl ester). For newly developed ALA derivatives or application in new tumor types, in vitro determination of PPIX formation involves multiparametric experiments covering variable pro-drug concentrations, medium composition, time points of analysis, and cell type(s). This study uses a fluorescence microplate reader with a built-in temperature and atmosphere control to investigate the high-resolution long-term kinetics (72 h) of cellular PPIX fueled by administration of either ALA, MAL, or HAL for each 10 different concentrations. For simultaneous proliferation correction, A431 cells were stably transfected with green fluorescent protein. The results indicate that the peak PPIX level is a function of both, incubation concentration and period: maximal PPIX is generated with 1 to 2-mM ALA/MAL or 0.125-mM HAL; also, the PPIX peak shifts to longer incubation periods with increasing pro-drug concentrations. The results underline the need for detailed temporal analysis of PPIX formation to optimize ALA (derivative)-based PDT or photodiagnosis and highlight the value of environment-controlled microplate readers for automated in vitro analysis.

  1. Tissue responses to hexyl 5-aminolevulinate-induced photodynamic treatment in syngeneic orthotopic rat bladder cancer model: possible pathways of action

    NASA Astrophysics Data System (ADS)

    Arum, Carl-Jørgen; Gederaas, Odrun A.; Larsen, Eivind L. P.; Randeberg, Lise L.; Hjelde, Astrid; Krokan, Hans E.; Svaasand, Lars O.; Chen, Duan; Zhao, Chun-Mei

    2011-02-01

    Orthotopic bladder cancer model in rats mimics human bladder cancer with respect to urothelial tumorigenesis and progression. Utilizing this model at pT1 (superficial stage), we analyze the tissue responses to hexyl 5-aminolevulinate-induced photodynamic therapy (HAL-PDT). In comparison to untreated rats, HAL-PDT causes little change in tumor-free rat bladder but induces inflammatory changes with increased lymphocytes and mononuclear cell infiltration in rat bladders with tumor. Immunohistochemistry reveals that HAL-PDT is without effect on proliferating cell nuclear antigen expression within the tumor and increases caspase-3 expression in both normal urothelium and the tumor. Transmission electron microscopy reveals severe mitochondrial damage, formations of apoptotic bodies, vacuoles, and lipofuscin bodies, but no microvillus-formed niches in HAL-PDT-treated bladder cancer rats. Bioinformatics analysis of the gene expression profile indicates an activation of T-cell receptor signaling pathway in bladder cancer rats without PDT. HAL-PDT increases the expression of CD3 and CD45RA in the tumor (determined by immunohistochemistry). We suggest that pathways of action of HAL-PDT may include, at least, activations of mitochondrial apoptosis and autophagy, breakdown of cancer stem cell niches, and importantly, enhancement of T-cell activation.

  2. Aminolevulinic Acid-Photodynamic Therapy of Basal Cell Carcinoma and Factors Affecting the Response to Treatment: A Clinical Trial

    PubMed Central

    Tehranchinia, Zohreh; Rahimi, Hoda; Ahadi, Mahsa Seyed; Ahadi, Maral Seyed

    2013-01-01

    Background: Basal cell carcinoma (BCC) is the most common type of skin cancer in humans. Photodynamic therapy (PDT) is a non-invasive therapeutic modality that may be considered as a valuable treatment option for BCC. This study was designed with the aim of evaluating the efficacy of PDT in treatment of BCC and factors that may affect the response rate. Materials and Methods: This clinical trial was conducted on 12 patients (28 BCC lesions) who were treated with aminulevulinic acid (ALA)-PDT, monthly, up to 6 sessions and the clinical response, cosmetic results, and possible side effects were evaluated. Results: The study was performed on 28 BCC lesions from 12 patients. Complete response was achieved in 9 (32.1%) lesions. Complete response rate was higher in younger patients (P < 0.01) and those with smaller lesions (P < 0.001). Superficial type also had significant higher response rate (P < 0.05). Patients with history of radiotherapy for the treatment of tinea capitis in childhood showed less response (P < 0.05). Cosmetic results were excellent or good in 77.5% cases. After 6 months of follow-up, none of the resolved lesions recurred. Conclusion: PDT would be a good therapeutic option in treatment of BCC with acceptable efficacy and low side effects. Younger patients, superficial BCCs, and smaller lesions show better response to ALA-PDT. History of radiotherapy may be associated with a lower response rate. PMID:23919025

  3. [Inhibition rate of gamma-aminolevulinic acid dehydratase activity in erythrocytes as a reliable index for individual workers of low lead exposure].

    PubMed

    Hirano, H; Omichi, M; Ohishi, H; Ishikawa, K; Hirashima, N

    1983-09-01

    As the delta-aminolevulinic acid dehydratase (ALAD) activity in erythrocytes is decreased by lead exposure, we considered that a net reduction of ALAD activity by lead in blood should be the difference between the activity fully activated with zinc (Zn2+) and dithiothreitol (DTT) and that without activation. The optimal condition of activation of ALAD was found by addition of 0.25 mM of Zn2+ and 10 mM of DTT in the reaction mixture. Judging from our previous results that the amount of inhibition of ALAD activity can be represented as the rate of inhibition and is closely correlated with the dose of lead administered to rabbits, the inhibition rate of ALAD activity and lead content in blood (Pb-B) of lead workers were measured. The scatter diagram obtained from the inhibition rate and lead content in blood has two groups being divided at 50 micrograms/ml of Pb-B. In one group less than 50 micrograms/100 ml of Pb-B, the inhibition rate has been closely related to Pb-B., the regression equation being Y = 1.82 X + 11.7, and the correlation coefficient + 0.926. In another group more than 50 micrograms/100 ml of Pb-B the inhibition rate remained constant at the 90% level. Measurement of the inhibition rate suggests to have practical validity for monitoring lead exposure in workers, and by means of a nomograph lead content in blood can be estimated from the inhibition rate.

  4. Short Communication: Molecular cloning and expression pattern of the porcine 5-aminolevulinate synthase 1 (ALAS1) gene and its association with reproductive traits.

    PubMed

    Liu, L Q; Li, F E; Deng, C Y

    2016-01-01

    5-Aminolevulinate synthase 1 (ALAS1) is the first enzyme in the heme biosynthetic pathway and is upregulated in follicular tissue during the early stages of ovulation. In this study, we isolated the complete coding sequence of the porcine ALAS1 gene and its 2-9 intron sequence, identified a single nucleotide polymorphism (SNP; T/C) in intron 9, and developed a PCR-MspI-restriction fragment length polymorphism genotyping assay. Association of the SNP with litter size was assessed in two populations [purebred Large White and the experimental synthetic (DIV) line]. Statistical analysis demonstrated that for total number of piglets born (TNB) in all parities, pigs with the CC genotype had an additional 0.68 and 0.74 piglets compared to the TC and TT animals (P < 0.05) in the DIV line, respectively. Purebred Large White sows inheriting the CC and TC genotypes gave birth to an additional 0.96 and 0.70 piglets compared to the TT animals (P < 0.05) in all parities, respectively. In addition, for TNB in all parities, a significant additive effect of 0.48 ± 0.23 and 0.37 ± 0.17 piglets/ litter was detected in sows of both populations (P < 0.05), respectively. The highest levels of ALAS1 gene expression were observed in isolated ovarian granulosa cells 2 and 12 h after stimulation with pregnant mare serum gonadotropin human chorionic gonadotropin, which represents the time of follicular development and ovulation, respectively. Therefore, the ALAS1 gene was significantly associated with litter size in two populations and could be a useful molecular marker for the selection of increasing litter size in pigs. PMID:26910002

  5. Fractionated PDT with 5-aminolevulinic acid: effective, cost effective, and patient friendly

    NASA Astrophysics Data System (ADS)

    de Vijlder, Hannah C.; Middelburg, Tom A.; de Bruijn, Henriette S.; Robinson, Dominic J.; Neumann, H. A. Martino; de Haas, Ellen R. M.

    2009-06-01

    PDT with ALA and MAL is established as a relatively effective treatment for non-melanoma skin cancer and premalignancies. PDT is often repeated, because a single treatment gives poor long term results. Preclinical studies showed that ALA-PDT applying a fractionated illumination scheme with a small first light fraction and a second larger light fraction separated by a dark interval of two hours resulted in a significant increase in efficacy. Whereas the efficacy was not enhanced by fractionating MAL-PDT, indicating that ALA-PDT mechanism is not the same as MAL-PDT mechanism. The increase in efficacy using fractionated PDT was confirmed clinically. A randomized comparative clinical study comparing fractionated ALA-PDT versus non-fractionated ALA-PDT in the treatment of superficial basal cell carcinoma showed a significant higher response rate in the lesions treated with fractionated ALA-PDT after a follow-up of one year ( p<0.002, log-rank test). The five year follow-up is studied at moment. So far the complete response in the group treated with fractionated ALA-PDT seems to be only a few percentages lower compared to the one year follow-up. Besides the gain in response rate, fractionated ALA PDT is cost effective. ALA gel is less expensive than the commercially available MAL (Metvix) and moreover fractionated ALA-PDT takes one treatment day, instead of two treatment days using the Metvix treatment protocol (two MAL-PDT treatments separated by one week), both reducing direct and indirect costs and the burden to the patient.

  6. Induced Protoporphyrin IX Accumulation by the δ-Aminolevulinic Acid in Bacteria and its Potential Use in the Photodynamic Therapy

    NASA Astrophysics Data System (ADS)

    Brígido-Aparicio, Cyntiha; Ramón-Gallegos, Eva; Arenas-Huertero, Francisco Jesús; Uribe-Hernández, Raúl

    2008-08-01

    The increasing incident of resistant strains to antibiotic has encouraged the search of new antibacterial treatments, such as the photodynamic therapy. In recent years, photodynamic therapy has demonstrated being a good technology for the treatment of recurrent bacteria infection. PDT presents a hopeful approach to eliminate Gram positive and negative bacteria in immunological compromised patients. This therapy uses a laser in combination with a photosensibilizer in presence of intracellular molecular oxygen. The process generates an effect of phototoxicity in bacterial cells. The aim of this work was to determine the in vitro conditions to accumulate PpIX in effective concentrations in Staphylococcus aureus ATCC25923 and Streptococcus pyogenes, which are responsible of human cutaneous diseases. A cellular suspension of both strains was prepared in TSB to obtain growth in Log-phase, then, the suspensions were adjusted to a final concentration of 2.61×108 cells/mL. The strains were exposed to increasing concentrations from 0 to 160μg/mL of δ-ALA in order to determinate the concentration that induces the biggest accumulation of PpIX. PpIX was measured using the Piomelli method modified for bacteria. The concentration selected was 40 mg/mL of ALA. It was found that in basal concentration of δ-ALA (0 μg/mL) both strains accumulated similar amount of PpIX. In concentrations of 5 mg/mL of δ-ALA it was observed a significant (p<0.001) increment in PpIX concentration. Finally it was realized a kinetic to determinate the optimal accumulation over the time at 0, 5, 10, 15 and 30 min, and 1, 2, 4, 8, 16 and 32 h. It was found that the ideal time for PDT application, in both strains, was 24 h because in smaller times there was not statistically significant difference. The S. aureus ATCC25923 accumulated significantly the biggest concentration of PpIX with regard to S. pyogenes. In conclusion, it was found that the optimal conditions to apply PDT will be to expose both

  7. Effects of lead shot ingestion on delta-aminolevulinic acid dehydratase activity, hemoglobin concentration, and serum chemistry in bald eagles

    USGS Publications Warehouse

    Hoffman, D.J.; Pattee, O.H.; Wiemeyer, Stanley N.; Mulhern, B.

    1981-01-01

    Lead shot ingestion by bald eagles (Haliaeetus leucocephalus) is considered to be widespread and has been implicated in the death of eagles in nature. It was recently demonstrated under experimental conditions that ingestion of as few as 10 lead shot resulted in death within 12 to 20 days. In the present study hematological responses to lead toxicity including red blood cell ALAD activity, hemoglobin concentration and 23 different blood serum chemistries were examined in five captive bald eagles that were unsuitable for rehabilitation and release. Eagles were dosed by force-feeding with 10 lead shot; they were redosed if regurgitation occurred. Red blood cell ALAD activity was inhibited by nearly 80% within 24 hours when mean blood lead concentration had increased to 0.8 parts per million (ppm). By the end of 1 week there was a significant decrease (20-25%) in hematocrit and hemoglobin, and the mean blood lead concentration was over 3 ppm. Within as little as 1-2 weeks after dosing, significant elevations in serum creatinine and serum alanine aminotransferase occurred, as well as a significant decrease in the ratio of serum aspartic aminotransferase to serum alanine aminotransferase. The mean blood lead concentration was over 5 ppm by the end of 2 weeks. These changes in serum chemistry may be indicative of kidney and liver alterations.

  8. Source and impact of lead contamination on δ-aminolevulinic acid dehydratase activity in several marine bivalve species along the Gulf of Cadiz.

    PubMed

    Company, R; Serafim, A; Lopes, B; Cravo, A; Kalman, J; Riba, I; DelValls, T A; Blasco, J; Delgado, J; Sarmiento, A M; Nieto, J M; Shepherd, T J; Nowell, G; Bebianno, M J

    2011-01-17

    Coastal areas and estuaries are particularly sensitive to metal contamination from anthropogenic sources and in the last few decades the study of space-time distribution and variation of metals has been extensively researched. The Gulf of Cadiz is no exception, with several rivers draining one of the largest concentrations of sulphide deposits in the world, the Iberian Pyrite Belt (IPB). Of these rivers, the Guadiana, one of the most important in the Iberian Peninsula, together with smaller rivers like the Tinto and Odiel, delivers a very high metal load to the adjacent coastal areas. The purpose of this work was to study the source and impact of lead (Pb) drained from historical or active mining areas in the IPB on the activity of a Pb inhibited enzyme (δ-aminolevulinic acid dehydratase, ALAD) in several bivalve species along the Gulf of Cadiz. Seven marine species (Chamelea gallina, Mactra corallina, Donax trunculus, Cerastoderma edule, Mytilus galloprovincialis, Scrobicularia plana and Crassostrea angulata) were collected at 12 sites from Mazagón, near the mouth of the rivers Tinto and Odiel (Spain), to Cacela Velha (Ria Formosa lagoon system, Portugal). Lead concentrations, ALAD activity and lead isotope ratios ((206)Pb/(204)Pb, (207)Pb/(204)Pb and (208)Pb/(204)Pb) were determined in the whole soft tissues. The highest Pb concentrations were determined in S. plana (3.50±1.09 μg g(-1) Pb d.w.) and D. trunculus (1.95±0.10 μg g(-1) Pb d.w.), while M. galloprovincialis and C. angulata showed the lowest Pb levels (<0.38 μg g(-1) Pb d.w.). In general, ALAD activity is negatively correlated with total Pb concentration. However this relationship is species dependent (e.g. linear for C. gallina ALAD=-0.36[Pb]+0.79; r=0.837; or exponential for M. galloprovincialis ALAD=2.48e(-8.3[Pb]); r=0.911). This indicates that ALAD activity has considerable potential as a biomarker of Pb and moreover, in marine bivalve species with different feeding habits. Lead isotope data

  9. Source and impact of lead contamination on δ-aminolevulinic acid dehydratase activity in several marine bivalve species along the Gulf of Cadiz.

    PubMed

    Company, R; Serafim, A; Lopes, B; Cravo, A; Kalman, J; Riba, I; DelValls, T A; Blasco, J; Delgado, J; Sarmiento, A M; Nieto, J M; Shepherd, T J; Nowell, G; Bebianno, M J

    2011-01-17

    Coastal areas and estuaries are particularly sensitive to metal contamination from anthropogenic sources and in the last few decades the study of space-time distribution and variation of metals has been extensively researched. The Gulf of Cadiz is no exception, with several rivers draining one of the largest concentrations of sulphide deposits in the world, the Iberian Pyrite Belt (IPB). Of these rivers, the Guadiana, one of the most important in the Iberian Peninsula, together with smaller rivers like the Tinto and Odiel, delivers a very high metal load to the adjacent coastal areas. The purpose of this work was to study the source and impact of lead (Pb) drained from historical or active mining areas in the IPB on the activity of a Pb inhibited enzyme (δ-aminolevulinic acid dehydratase, ALAD) in several bivalve species along the Gulf of Cadiz. Seven marine species (Chamelea gallina, Mactra corallina, Donax trunculus, Cerastoderma edule, Mytilus galloprovincialis, Scrobicularia plana and Crassostrea angulata) were collected at 12 sites from Mazagón, near the mouth of the rivers Tinto and Odiel (Spain), to Cacela Velha (Ria Formosa lagoon system, Portugal). Lead concentrations, ALAD activity and lead isotope ratios ((206)Pb/(204)Pb, (207)Pb/(204)Pb and (208)Pb/(204)Pb) were determined in the whole soft tissues. The highest Pb concentrations were determined in S. plana (3.50±1.09 μg g(-1) Pb d.w.) and D. trunculus (1.95±0.10 μg g(-1) Pb d.w.), while M. galloprovincialis and C. angulata showed the lowest Pb levels (<0.38 μg g(-1) Pb d.w.). In general, ALAD activity is negatively correlated with total Pb concentration. However this relationship is species dependent (e.g. linear for C. gallina ALAD=-0.36[Pb]+0.79; r=0.837; or exponential for M. galloprovincialis ALAD=2.48e(-8.3[Pb]); r=0.911). This indicates that ALAD activity has considerable potential as a biomarker of Pb and moreover, in marine bivalve species with different feeding habits. Lead isotope data

  10. The concentration of some metals (Pb, Cd, Zn and Cu) and delta aminolevulinic acid dehydratase activity of fruit fly (Drosophila melanogaster) living near lead and zinc smelter ``Trepça'' in Kosova

    NASA Astrophysics Data System (ADS)

    Elezaj, I. R.; Letaj, K. Rr.; Selimi, Q. I.; Zhushi-Etemi, F.

    2003-05-01

    The concentration of Pb, Cd, Zn and Cu, δ-aminolevulinic acid dehydratase activity (ALA-D: EC.4.2.1.24) hemoglobin and protein amount have been determined in three different populations of fruit fly (Drosophila melanogaster) caught at two urban sites (Mitrovica town, which is situated close to smelter of “Trepça” don close and Prishtina the capital of Kosova) and in Luki village as uncontaminated area. The results show that in the fruit fly of Mitrovica the concentration of Pb, Cd and Zn was significantly higher (P<0.00l) in comparison with that on the f-Liit fly of Prishtina and Luki. The concentration of Pb of fruit fly from Mitrovica was 3.1 times higher in comparison with that on fruit fly of Prishtina and 4.9 times higher in comparison with uncontaminated group of fruit fly. The ALA-D activity was significantly inhibited in the homogenate of fruit fly from Mitrovica in comparison with Prishtina and Luki localities (P<0.00l). ALA-D activity was also inhibited in the homogenate of Prishtina fruit fly in comparison with Luki group (P<0.00l). The amount of proteins was significantly lower in Mitrovica fruit fly in comparison with that in control and Prishtina group. The hemoglobin value was relatively unchanged.

  11. Mechanisms of 5-aminolevulic acid ester uptake in mammalian cells

    PubMed Central

    Rodriguez, Lorena; Batlle, Alcira; Di Venosa, Gabriela; Battah, Sinan; Dobbin, Paul; MacRobert, Alexander J; Casas, Adriana

    2006-01-01

    The porphyrin precursor 5-aminolevulinic acid (ALA) is being widely used in photodynamic therapy of cancer. Improvement in ALA delivery has been sought through the use of ALA derivatives, in particular the esterification of ALA with aliphatic alcohols, which in certain cases can improve cellular penetration and selectivity. ALA uptake systems appear to be distinctive for each cell type. The LM3 mammary adenocarcinoma cell line takes ALA up by BETA transporters. In this work, we investigated ALA derivative transport systems through the inhibition of radiolabelled ALA uptake in the LM3 cells. We also performed inhibition studies of γ-aminobutyric acid (GABA) uptake. The more lipohilic ALA derivatives hexyl-ALA and undecanoyl-ALA inhibit ALA uptake, whereas methyl-ALA, R, S-ALA-2-(hydroxymethyl)tetrahydropyranyl ester and the dendron aminomethane tris methyl 5-ALA does not inhibit ALA uptake. A similar pattern was found for GABA, except that the dendron inhibited GABA uptake. However, hexyl-ALA and undecanoyl-ALA are not taken up by BETA transporters, but by simple diffusion, although they still inhibit ALA uptake by binding to the cell membrane. These results show that different modifications to the ALA molecule lead to different uptake mechanisms. Whereas ALA is taken up by BETA transporters, none of the ALA derivatives shares the same mechanism. Knowledge of the mechanisms of ALA derivatives entry into the cells is essential to understand and improve ALA-mediated PDT and to the design of new ALA derivatives that may be taken up at a higher rate than ALA. PMID:16432502

  12. Photodynamic therapy (PDT) and photodiagnosis (PD) using endogenous photosensitization induced by 5-aminolevulinic acid (ALA): current clinical and development status

    NASA Astrophysics Data System (ADS)

    Marcus, Stuart L.; Sobel, Russel S.; Golub, Allyn L.; Carroll, Ronald L.; Lundahl, Scott L.; Shulman, D. Geoffrey

    1996-04-01

    Exogenous provision of ALA to many tissues results in the accumulation of sufficient quantities of the endogenous photosensitizer protoporphyrin IX, (PpIX), to produce a photodynamic effect. Therefore, ALA may be considered the only current PDT agent in clinical development which is a biochemical precursor of a photosensitizer. Topical ALA application, followed by exposure to activating light (ALA PDT), has been reported effective for the treatment of a variety of dermatologic diseases including cutaneous T-cell lymphoma, superficial basal cell carcinoma, Bowen's disease, and actinic (solar) keratoses, and is also being examined for treatment of acne and hirsutism. PpIX induced by ALA application also may serve as a fluorescence detection marker for photodiagnosis (PD) of malignant and pre- malignant conditions of the urinary bladder and other organs. Local internal application of ALA has also been used for selective endometrial ablation in animal model systems and is beginning to be examined in human clinical studies. Systemic, oral administration of ALA has been used for ALA PDT of superficial head and neck cancer, various gastrointestinal cancers, and the condition known as Barrett's esophagus. This brief paper reviews the current clinical and development status of ALA PDT.

  13. Kinetics and comparison of δ-aminolevulinic-acid-induced endogenous protoporphyrin-IX in single cell by steady state and multiphoton fluorescence imaging

    NASA Astrophysics Data System (ADS)

    Ganesan, Singaravelu; Elangovan, Masilamani; Periasamy, Ammasi

    2001-04-01

    Photodynamic Therapy has emerged as a new modality in the treatment of various nonmalignant and malignant diseases. It involves the systemic administration of tumor specific photo-sensitizers with the subsequent application of visible light. This combination causes the generation of cytotoxic species, which damage sensitive targets, producing cell injury and tumor destruction. Although, photofrin is the only photosensitizer currently approved for PDT and tumor detection, its concomitant cutaneous photosensitization poses a significant problem. Hence, δ-aminoleuvulinic acid (δ-ALA) a precursor for the endogenous production of Protoporphyrin IX, through heme biosynthesis pathway, has gained significant importance in the Photodynamic Therapy. Though δ-ALA is present naturally in the cells, exogenous δ-ALA helps to synthesis more of PpIX in the tumor cells, as the fast growing tumor cells take up the administered δ-ALA more than the normal cells. Based on these facts, many invasive studies have been reported on the kinetics of δ-ALA at cellular level by chemical extraction of PpIX from the cells. In the present study we have studied the kinetics of δ-ALA induced PpIX fluorescence from Hela cells by perchloric/Methanol extraction method. However, the amount of PpIX synthesized in the cells at different point of incubation time by noninvasive methods has not been reported. Hence we have also used a noninvasive technique of measuring the kinetics δ-ALA induced PPIX fluorescence from Hela, an epithelial cell derived from human cervical cancer by both single photon (steady state) and multi photon excitation. From the studies it is observed that the δ-ALA induced PpIX is more at 2 hours incubation time for 2 mM of δ-ALA concentration. Further, it is observed that with steady state fluorescence imaging method, the excitation light itself cause the Photodynamic damage, due to the prolonged exposure of the cells than in multi photon excitation, leading to the rounding

  14. Delta-aminolevulinic acid dehydratase (δALAD) activity in four free-living bird species exposed to different levels of lead under natural conditions.

    PubMed

    Espín, Silvia; Martínez-López, Emma; Jiménez, Pedro; María-Mojica, Pedro; García-Fernández, Antonio J

    2015-02-01

    The purposes of this study were: (1) to determine the δALAD activity and δALAD ratio in blood of four free-living bird species (Griffon vulture, Eagle owl, Slender-billed gull and Audouin's gull); (2) and to investigate the correlations between δALAD activity/ratio and Pb concentrations in blood samples. A decrease was observed in δALAD activity in Griffon vultures and Eagle owls exposed to Pb. In addition, negative relationships were found between δALAD ratio or δALAD activity and Log blood Pb levels in Griffon vultures and Eagle owls, and these relationships were stronger in areas with the highest Pb exposure. We provide equations that may be helpful to estimate δALAD activity and δALAD ratio using blood Pb concentrations. Regarding gull species, δALAD activity found in the present study may be considered the normal activity in Slender-billed gull and Audouin's gull species, since very low blood Pb concentrations and no correlations were found in these species. Although both δALAD activity and δALAD ratio are sensitive biomarkers of Pb exposure and effect in birds, the use of δALAD ratio may improve the results. Besides, this study provides blood threshold concentrations at which Pb bears effects on δALAD enzyme (5µg/dl in Eagle owl; 8µg/dl in Griffon vulture; and probably >2µg/dl in Slender-billed gull and Audouin's gull). Our findings show that Eagle owl seems to be more sensitive to δALAD enzymatic inhibition by Pb than Griffon vultures. Eagle owls and Griffon vultures exhibited up to 79% and 94% decrease in δALAD activity when blood Pb concentrations exceeded 19 and 30µg/dl, respectively. Regarding the effects related with δALAD inhibition, significant negative correlations were found between δALAD activity and hematocrit in Eagle owls and Griffon vultures, which may be related to compensatory response associated with a decrease in δALAD activity. In addition, an effect on creatine kinase activity and total proteins in plasma was found

  15. Delta-aminolevulinic acid dehydratase (δALAD) activity in four free-living bird species exposed to different levels of lead under natural conditions.

    PubMed

    Espín, Silvia; Martínez-López, Emma; Jiménez, Pedro; María-Mojica, Pedro; García-Fernández, Antonio J

    2015-02-01

    The purposes of this study were: (1) to determine the δALAD activity and δALAD ratio in blood of four free-living bird species (Griffon vulture, Eagle owl, Slender-billed gull and Audouin's gull); (2) and to investigate the correlations between δALAD activity/ratio and Pb concentrations in blood samples. A decrease was observed in δALAD activity in Griffon vultures and Eagle owls exposed to Pb. In addition, negative relationships were found between δALAD ratio or δALAD activity and Log blood Pb levels in Griffon vultures and Eagle owls, and these relationships were stronger in areas with the highest Pb exposure. We provide equations that may be helpful to estimate δALAD activity and δALAD ratio using blood Pb concentrations. Regarding gull species, δALAD activity found in the present study may be considered the normal activity in Slender-billed gull and Audouin's gull species, since very low blood Pb concentrations and no correlations were found in these species. Although both δALAD activity and δALAD ratio are sensitive biomarkers of Pb exposure and effect in birds, the use of δALAD ratio may improve the results. Besides, this study provides blood threshold concentrations at which Pb bears effects on δALAD enzyme (5µg/dl in Eagle owl; 8µg/dl in Griffon vulture; and probably >2µg/dl in Slender-billed gull and Audouin's gull). Our findings show that Eagle owl seems to be more sensitive to δALAD enzymatic inhibition by Pb than Griffon vultures. Eagle owls and Griffon vultures exhibited up to 79% and 94% decrease in δALAD activity when blood Pb concentrations exceeded 19 and 30µg/dl, respectively. Regarding the effects related with δALAD inhibition, significant negative correlations were found between δALAD activity and hematocrit in Eagle owls and Griffon vultures, which may be related to compensatory response associated with a decrease in δALAD activity. In addition, an effect on creatine kinase activity and total proteins in plasma was found

  16. Levulinic Acid Biorefineries: New Challenges for Efficient Utilization of Biomass.

    PubMed

    Pileidis, Filoklis D; Titirici, Maria-Magdalena

    2016-03-21

    Levulinic acid is a sustainable platform molecule that can be upgraded to valuable chemicals and fuel additives. This article focuses on the catalytic upgrading of levulinic acid into various chemicals such as levulinate esters, δ-aminolevulinic acid, succinic acid, diphenolic acid, γ-valerolactone, and γ-valerolactone derivatives such valeric esters, 5-nonanone, α-methylene-γ valerolactone, and other various molecular-weight alkanes (C9 and C18-C27 olefins). PMID:26847212

  17. Identification of atherosclerosis using aminolevulinic gold nanoparticle assay in fecal specimens

    NASA Astrophysics Data System (ADS)

    Gonçalves, Karina de O.; da Silva, Mônica N.; Courrol, Lilia C.

    2015-06-01

    The atheromatous plaques exhibit an accumulation of protoporphyrin IX, or PpIX, which is transferred to the feces. In this work it was associated a precursor of the PpIX, the 5-aminolevulinic acid, ALA, with gold nanoparticles (ALA:AuNps). The objective was verify the possibility to use ALA:AuNPs as a diagnosis agent for atherosclerosis. ALA:AuNps were synthesized mixing ALA with Tetrachloroauric(III) acid in miliQ water solution followed by photoreduction with light from a Xenon lamp. A total of 22 Male New Zealand rabbits were divided into 3 groups: control group (CG) where animals received normal diet, control group with ALA (CGALA ) and Experimental Group with ALA:AuNPs ( EGALAAu ) in which the animals received a diet with 1% cholesterol. Measurements of the emission intensity of extracted porphyrins from the feces in the region between 575 and 725 nm were done. An increase in the feces porphyrin emission after ALA and ALA:AuNPs administration was observed.

  18. The nine amino-terminal residues of delta-aminolevulinate synthase direct beta-galactosidase into the mitochondrial matrix.

    PubMed Central

    Keng, T; Alani, E; Guarente, L

    1986-01-01

    delta-Aminolevulinate synthase, the first enzyme in the heme biosynthetic pathway, is encoded by the nuclear gene HEM1. The enzyme is synthesized as a precursor in the cytoplasm and imported into the matrix of the mitochondria, where it is processed to its mature form. Fusions of beta-galactosidase to various lengths of amino-terminal fragments of delta-aminolevulinate synthase were constructed and transformed into yeast cells. The subcellular location of the fusion proteins was determined by organelle fractionation. Fusion proteins were found to be associated with the mitochondria. Protease protection experiments involving the use of intact mitochondria or mitoplasts localized the fusion proteins to the mitochondrial matrix. This observation was confirmed by fractionation of the mitochondrial compartments and specific activity measurements of beta-galactosidase activity. The shortest fusion protein contains nine amino acid residues of delta-aminolevulinate synthase, indicating that nine amino-terminal residues are sufficient to localize beta-galactosidase to the mitochondrial matrix. The amino acid sequence deduced from the DNA sequence of HEM1 showed that the amino-terminal region of delta-aminolevulinate synthase was largely hydrophobic, with a few basic residues interspersed. Images PMID:3023841

  19. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  20. Vitamin D as a potential enhancer of aminolevulinate-based photodynamic therapy for nonmelanoma skin cancer

    NASA Astrophysics Data System (ADS)

    Maytin, Edward V.; Anand, Sanjay; Atanaskova, Natasha; Wilson, Clara

    2010-02-01

    Vitamin D3 (Vit D3) is a hormone essential for normal bone and cardiovascular health, and may participate in preventing nonmelanoma skin cancers (NMSC). Calcitriol (1,25 dihydroxyD3) is the active form of the hormone. We showed previously that calcitriol is a potent inducer of protoporphyrin IX (PpIX) in skin keratinocytes grown in organotypic cultures. Here, we investigated the ability of Vit D3 to enhance PpIX levels within skin tumors in vivo. Squamous tumors, generated by chemical carcinogenesis in mice, were pretreated for 3 days with topical calcitriol. Then 5-aminolevulinic acid (5-ALA) was applied topically, and PpIX levels were measured by noninvasive fluorimetry and in biopsied tissue. Calcitriol pretreatment resulted in a 3 to 4-fold elevation of PpIX in tumors, relative to no pretreatmen, providing significantly more photosensitizer available for tumor destruction. For deep tumors, topical calcitriol may not penetrate sufficiently. Therefore we explored whether systemic Vit D3, given short-term (3 days), might elevate PpIX within NMSC in a deep tumor model (subcutaneously-implanted A431 human squamous carcinoma cells). Defined amounts of calcitriol were injected into the mice for 3 d, followed by systemic 5-ALA, tissue biopsy, and confocal microscopic measurement of PpIX in frozen tissues. PpIX was clearly elevated after systemically delivered calcitriol. More work is needed, but if the amount of calcitriol required to elevate PpIX levels proves to be small, then the approach may ultimately prove attractive. Since most Americans are currently Vitamin D deficient, a small increase in calcitriol might be possible without risk of hypercalcemia.

  1. Photodynamic therapy with 5-aminoolevulinic acid-induced porphyrins and DMSO/EDTA for basal cell carcinoma

    NASA Astrophysics Data System (ADS)

    Warloe, Trond; Peng, Qian; Heyerdahl, Helen; Moan, Johan; Steen, Harald B.; Giercksky, Karl-Erik

    1995-03-01

    Seven hundred sixty three basal cell carcinomas (BCCs) in 122 patients were treated by photodynamic therapy by 5-aminolevulinic acid (ALA) in cream topically applied, either alone, in combination with dimethyl sulphoxide (DMSO) and ethylenediaminetetraacetic acid disodium salt (EDTA), or with DMSO as a pretreatment. After 3 hours cream exposure 40 - 200 Joules/cm2 of 630 nm laser light was given. Fluorescence imaging of biopsies showed highly improved ALA penetration depth and doubled ALA-induced porphyrin production using DMSO/EDTA. Treatment response was recorded after 3 months. After a single treatment 90% of 393 superficial lesions responded completely, independent of using DMSO/EDTA. In 363 nodulo-ulcerative lesions the complete response rate increased from 67% to above 90% with DMSO/EDTA for lesions less than 2 mm thickness and from 34% to about 50% for lesions thicker than 2 mm. Recurrence rate observed during a follow-up period longer than 12 months was 2 - 5%. PDT of superficial thin BCCs with ALA-induced porphyrins and DMSO/EDTA equals surgery and radiotherapy with respect to cure rate and recurrence. Cosmetic results of ALA-based PDT seemed to be better than those after other therapies. In patients with the nevoid BCC syndrome the complete response rate after PDT was far lower.

  2. Mechanism of action of 5-arninosalicylic acid

    PubMed Central

    Greenfield, S. M.; Thompson, R. P. H.

    1992-01-01

    5-Aminosalicylic Acid (5-ASA) has been used for over 50 years in the treatment of inflammatory bowel disease in the pro-drug form sulphasalazine (SASP). SASP is also used to treat rheumatoid arthritis. However whether the therapeutic properties of SASP are due to the intact molecule, the 5-ASA or sulphapyridine components is unknown. Several mechanisms of action have been proposed for 5-ASA and SASP including interference in the metabolism of arachidonic acid to prostaglandins and leukotrienes, scavenging,of reactive oxygen species, effects on leucocyte function and production of cytokines. However, it is unlikely that the anti-inflammatory properties of SASP and 5-ASA are due to several different properties but more likely that a single property of 5-ASA explains the theraapeutic effects of 5-ASA and SASP. Reactive oxygen species (ROS) are involved in the metabolism of prostaglandins and leukotrienes and can act as second messengers, and so the scavenging of ROS may be the single mechanism of action of 5-ASA that gives rise to its antiinflammatory effects in both inflammatory bowel disease and rheumatoid arthritis. PMID:18475455

  3. 5-aminolevulinic acid induced protoporphyrin IX as a fluorescence marker for quantitative image analysis of high-grade dysplasia in Barrett's esophagus cellular models

    NASA Astrophysics Data System (ADS)

    Yeh, Shu-Chi Allison; Sahli, Samir; Andrews, David W.; Patterson, Michael S.; Armstrong, David; Provias, John; Fang, Qiyin

    2015-03-01

    Early detection and treatment of high-grade dysplasia (HGD) in Barrett's esophagus may reduce the risk of developing esophageal adenocarcinoma. Confocal endomicroscopy (CLE) has shown advantages over routine white-light endoscopic surveillance with biopsy for histological examination; however, CLE is compromised by insufficient contrast and by intra- and interobserver variation. An FDA-approved PDT photosensitizer was used here to reveal morphological and textural features similar to those found in histological analysis. Support vector machines were trained using the aforementioned features to obtain an automatic and robust detection of HGD. Our results showed 95% sensitivity and 87% specificity using the optimal feature combination and demonstrated the potential for extension to a three-dimensional cell model.

  4. Dexamethasone alone and in combination with desipramine, phenytoin, valproic acid or levetiracetam interferes with 5-ALA-mediated PpIX production and cellular retention in glioblastoma cells.

    PubMed

    Lawrence, Johnathan E; Steele, Christopher J; Rovin, Richard A; Belton, Robert J; Winn, Robert J

    2016-03-01

    Extent of resection of glioblastoma (GBM) correlates with overall survival. Fluorescence-guided resection (FGR) using 5-aminolevulinic acid (5-ALA) can improve the extent of resection. Unfortunately not all patients given 5-ALA accumulate sufficient quantities of protoporphyrin IX (PpIX) for successful FGR. In this study, we investigated the effects of dexamethasone, desipramine, phenytoin, valproic acid, and levetiracetam on the production and accumulation of PpIX in U87MG cells. All of these drugs, except levetiracetam, reduce the total amount of PpIX produced by GBM cells (p < 0.05). When dexamethasone is mixed with another drug (desipramine, phenytoin, valproic acid or levetiracetam) the amount of PpIX produced is further decreased (p < 0.01). However, when cells are analyzed for PpIX cellular retention, dexamethasone accumulated significantly more PpIX than the vehicle control (p < 0.05). Cellular retention of PpIX was not different from controls in cells treated with dexamethasone plus desipramine, valproic acid or levetiracetam, but was significantly less for dexamethasone plus phenytoin (p < 0.01). These data suggest that medications given before and during surgery may interfere with PpIX accumulation in malignant cells. At this time, levetiracetam appears to be the best medication in its class (anticonvulsants) for patients undergoing 5-ALA-mediated FGR.

  5. Evaluation of the pharmacological properties of salicylic acid-derivative organoselenium: 2-hydroxy-5-selenocyanatobenzoic acid as an anti-inflammatory and antinociceptive compound.

    PubMed

    Chagas, Pietro Maria; Rosa, Suzan Gonçalves; Sari, Marcel Henrique Marcondes; Oliveira, Carla Elena Sartori; Canto, Rômulo Faria Santos; da Luz, Sônia Cristina Almeida; Braga, Antonio Luiz; Nogueira, Cristina Wayne

    2014-03-01

    The present study evaluated the antinociceptive and anti-inflammatory effects of per oral (p.o.) administration of salicylic acid-derivative organoselenium compounds in chemical models of nociception in mice. The compounds (50 mg/kg; p.o.) were administered 30 and 60 min before the nociceptive behavior and compared to the positive-control, acetylsalicylic acid (ASA; 200 mg/kg; p.o.). In addition, a dose-response curve (25-100 mg/kg) for compounds was carried out in the formalin test. When assessed in the chemical models, acetic acid-induced writhing behavior, formalin and glutamate tests, the compounds showed the following antinociceptive profile 1B>2B>1A>2A, suggesting a chemical structure-dependent relationship. Then, the anti-inflammatory properties and toxicological potential of compound 1B were investigated. Compound 1B, similar to the positive-control, ASA, diminished the edema formation and decreased the myeloperoxidase activity induced by croton oil (2.5%) in the ear tissue. The results also indicate that a single oral administration of 1B caused neither signs of acute toxicity nor those of gastrointestinal injury. The administration of 1B did not alter the water and food intakes, plasma alanine and aspartate aminotransferase activities or urea levels and cerebral or hepatic δ-aminolevulinate dehydratase activity. Salicylic acid-derivative organoseleniums, mainly compound 1B, have been found to be novel compounds with antinociceptive/anti-inflammatory properties; nevertheless, more studies are required to examine their therapeutic potential for pain treatment.

  6. Levels of delta-aminolevulinate dehydratase, uroporphyrinogen-I synthase, and protoporphyrin IX in erythrocytes from anemic mutant mice.

    PubMed Central

    Sassa, S; Bernstein, S E

    1977-01-01

    Levels of erythrocyte delta-aminolevulinate dehydratase [ALA-dehydratase; porphobilinogen synthase; 5-aminolevulinate hydro-lyase (adding 5-aminolevulinate and cyclizing), EC 4.2.1.24], UROPORPHYRINOGEN-I synthase [Uro-synthase; porphobilinogen ammonia-lyase (polymerizing), EC 4.3;1.8], AND PROTOPORPHYRIN IX (Proto) were measured by sensitive semimicroassays using 2-5 mul of whole blood obtained from normal and anemic mutant mice. The levels of erythrocyte ALA-dehydratase and Uro-synthase showed marked developmental changes and ALA-dehydratase was influenced by the Lv gene. Mice with overt hemolytic diseases (ja/ja, sph/sph, nb/nb, ha/ha) had 10- to 20-fold increases in ALA-dehydratase, Uro-synthase, and Proto compared with their normal controls. Mice with an iron deficiency (mk/mk) and mice with hypoplastic anemias (W/Wv, Sl/Sld, an/an) had mild to moderate increases in these parameters. Elevated enzyme activities and Proto correlated well with the number of reticulocytes. Because all mice with anemias possessed elevated levels of ALA-dehydratase, Uro-synthase, and Proto independent of differences in their genotypes, the increase in these parameters is not likely to be the result of a specific gene defect. The increased enzyme activities and Proto concentration probably reflect increased frequency of young red cells that are still active in heme biosynthesis. PMID:265562

  7. 5-Caffeoylquinic acid and caffeic acid orally administered suppresses P-selectin expression on mouse platelets

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Caffeic acid and 5-caffeoylquinic acid are a naturally occurring phenolic acid and its ester found in human diets. In this paper, potential effects of caffeic acid and 5-caffeoylquinic acid found in coffee and other plant sources on platelet activation were studied via investigating P-selectin expre...

  8. Synthesis of l-(+)-Tartaric Acid from l-Ascorbic Acid via 5-Keto-d-Gluconic Acid in Grapes

    PubMed Central

    Saito, Kazumi; Kasai, Zenzaburo

    1984-01-01

    5-Keto-l-idionic acid (≡5-keto-d-gluconic acid, d-xylo-5-hexulosonic acid) was found as a metabolic product of l-ascorbic acid in slices of immature grapes, Vitis labrusca L. cv `Delaware'. Specifically labeled compounds, recognized as metabolic products of l-ascorbic acid in grapes, were fed to young grape tissues to investigate the metabolic pathway from l-ascorbic acid to l-(+)-tartaric acid. Label from dehydro-l-[1-14C]ascorbic acid, 2-keto-l-[1-14C]idonic acid (l-xylo-2-hexulosonic acid), l-[1-14C]idonic acid, or 5-keto-l-[1-14C] idonic acid was incorporated into l-(+)-tartaric acid in high yields as it was in the l-[1-14C]ascorbic acid experiment. In a double label experiment involving a mixture of l-[1-14C]idonic acid and l-[2-3H]idonic acid, the 3H/14C ratios of 5-keto-l-idonic acid and l-(+)-tartaric acid synthesized in young grape leaves were almost the same as the value of the l-idonic acid fed. Label from 5-keto-l-[6-14C]idonic acid was incorporated into sugars and insoluble residue in the same way as l-[6-14C]ascorbic acid was metabolized in grapes. These results provide strong evidence that in grapes l-(+)-tartaric acid is synthesized from the C4 fragment that corresponds to the C1 to C4 group of the 5-keto-l-idonic acid derived from l-ascorbic acid via 2-keto-l-idonic acid and l-idonic acid. PMID:16663792

  9. 5-Caffeoylquinic acid and caffeic acid orally administered suppress P-selectin expression on mouse platelets.

    PubMed

    Park, Jae B

    2009-10-01

    Caffeic acid and 5-caffeoylquinic acid are naturally occurring phenolic acid and its quinic acid ester found in plants. In this article, potential effects of 5-caffeoylquinic acid and caffeic acid on P-selectin expression were investigated due to its significant involvement in platelet activation. First, the effects of 5-caffeoylquinic acid and caffeic acid on cyclooxygenase (COX) enzymes were determined due to their profound involvement in regulating P-selectin expression on platelets. At the concentration of 0.05 microM, 5-caffeoylquinic acid and caffeic acid were both able to inhibit COX-I enzyme activity by 60% (P<.013) and 57% (P<.017), respectively. At the same concentration, 5-caffeoylquinic acid and caffeic acid were also able to inhibit COX-II enzyme activity by 59% (P<.012) and 56% (P<.015), respectively. As expected, 5-caffeoylquinic acid and caffeic acid were correspondingly able to inhibit P-selectin expression on the platelets by 33% (P<.011) and 35% (P<.018), at the concentration of 0.05 microM. In animal studies, 5-caffeoylquinic acid and caffeic acid orally administered to mice were detected as intact forms in the plasma. Also, P-selectin expression was respectively reduced by 21% (P<.016) and 44% (P<.019) in the plasma samples from mice orally administered 5-caffeoylquinic acid (400 microg per 30 g body weight) and caffeic acid (50 microg per 30 g body weight). These data suggest that both 5-caffeoylquinic acid and caffeic acid orally administered can be absorbed and suppress P-selectin expression on mouse platelets.

  10. 5-Aminolevolinic acid mitigates the cadmium-induced changes in Brassica napus as revealed by the biochemical and ultra-structural evaluation of roots.

    PubMed

    Ali, Basharat; Tao, Qiaojing; Zhou, Yuanfei; Gill, Rafaqat A; Ali, Shafaqat; Rafiq, Muhammad T; Xu, Ling; Zhou, Weijun

    2013-06-01

    In the present study, the ameliorating effects of 5-aminolevulinic acid (ALA) under cadmium (Cd) stress conditions were studied with special emphasis on root morphology and ultra-structure in oilseed rape. For this purpose, plants were treated hydroponically at three different Cd levels (0, 100, 500μM) and foliar spray of ALA with three concentrations (0, 12.5, 25mg/l) simultaneously. The results showed that foliar application of ALA improved the plant growth, root morphology and reduced the reactive oxygen species and malondialdehyde contents in roots under Cd stress conditions. The higher concentration of Cd (500μM) decreased the activities of antioxidants enzymes like catalase (CAT), superoxide dismutase (SOD), peroxidase (POD) and glutathione reductase (GR) and also reduced the oxidized glutathione and total glutathione contents in roots. Application of ALA at 25mg/l dosage significantly enhanced the antioxidant activities e.g. APX, SOD, POD, and GSH contents under Cd stress. The microscopic micrographs showed that application of exogenous ALA improved the cell structure under Cd toxicity. A whole cell with developed nucleus, nuclear membrane, smooth cell wall, continuous endoplasmic reticulum, and well shaped mitochondria was observed under the combine application of ALA and Cd. These results suggest that, application of ALA helped the plants to improve root growth, root antioxidant enzymes, and ultra-structural changes in root tip cells under fifteen days Cd-induced stress. PMID:23490193

  11. Stereochemistry of 2',5' nucleic acids and their constituents.

    PubMed

    Premraj, B J; Yathindra, N

    1998-10-01

    Shape and dimension of the preferred nucleotide repeats in nucleic acids are found to depend on whether the sugar-phosphate linkage is of 2',5' or 3',5' type. It is shown that a nucleotide which is "compact" in 3',5' nucleic acids is rendered "extended" and vice versa for a given sugar pucker. It is interesting that this feature is accompanied by a switch in the preferred sugar ring conformation in 3',5' and 2',5' nucleic acids. 3' ribose and 3' deoxyribose rings (in 2',5' linkages) tend to favour C2' endo and C3' endo puckers respectively in contrast to C3' endo and C2' endo puckers favored by 2' ribose and 2' deoxyribose sugars (in 3',5' linkages). The distinguishable features between the nucleotide repeats of 3',5' and 2',5' nucleic acids need to be recognised while discussing their structural properties, as well as those of a variety of complexes that could be formed involving 2',5' and 3',5' strands of DNA and RNA. Ability and stability, or lack of them, for formation of a specific combination of these complexes may be directly related to the stereochemical constraints imposed as a consequence of conformationally homogeneous or heterogeneous nature of the repeating nucleotides of the complexing chains. As a first step towards delineating stereochemical features that distinguish 2',5' nucleic acids from their naturally occurring isomer A and B type helices have been modelled using the new concept of "compact" and "extended" nucleotide repeat that seemingly unifies helix generation of both types of linkages. Helical models for 2',5' RNA with "dinucleotide" repeat based on the crystal structure of 2',5' ApU have also been obtained.

  12. Synthesis of the (5Z)-5-Pentacosenoic and 5-Pentacosynoic Acids as Novel HIV-1 Reverse Transcriptase Inhibitors

    PubMed Central

    Moreira, Lizabeth Giménez; Orellano, Elsie A.; Rosado, Karolyna; Guido, Rafael V. C.; Andricopulo, Adriano D.; Soto, Gabriela O.; Rodríguez, José W.; Sanabria-Ríos, David J.; Carballeira, Néstor M.

    2016-01-01

    The natural fatty acids (5Z)-5-pentacosenoic and (9Z)-9-pentacosenoic acids were synthesized for the first time in eight steps starting from either 4-bromo-1-butanol or 8-bromo-1-butanol and in 20-58% overall yields, while the novel fatty acids 5-pentacosynoic and 9-pentacosynoic acids were also synthesized in six steps and in 34-43% overall yields. The Δ5 acids displayed the best IC50’s (24-38 µM) against the HIV-1 reverse transcriptase (RT) enzyme, comparable to nervonic acid (IC50 = 12 µM). The Δ9 acids were not as effective towards HIV-RT with the (9Z)-9-pentacosenoic acid displaying an IC50 = 54 µM. Fatty acid chain length and position of the unsaturation was critical for the observed inhibition. Molecular modeling studies indicated the structural determinants underlying the biological activity of the most potent compounds. These results provide new insights into the structural requirements that must be present in fatty acids so as to enhance their inhibitory potential towards HIV-RT. PMID:26345647

  13. Oxidative Profile and δ-Aminolevulinate Dehydratase Activity in Healthy Pregnant Women with Iron Supplementation.

    PubMed

    De Lucca, Leidiane; Rodrigues, Fabiane; Jantsch, Letícia B; Neme, Walter S; Gallarreta, Francisco M P; Gonçalves, Thissiane L

    2016-05-03

    An oxidative burst occurs during pregnancy due to the large consumption of oxygen in the tissues and an increase in metabolic demands in response to maternal physiological changes and fetal growth. This study aimed to determine the oxidative profile and activity of δ-aminolevulinate dehydratase (δ-ALA-D) in pregnant women who received iron supplementation. Oxidative stress parameters were evaluated in 25 pregnant women with iron supplementation, 25 pregnant women without supplementation and 25 non-pregnant women. The following oxidative stress parameters were evaluated: thiobarbituric acid reactive substances (TBARS), protein thiol groups (P-SH), non-protein thiol levels (NP-SH), vitamin C levels, catalase and δ-ALA-D activity. Markers of oxidative stress and cell damage, such as TBARS in plasma were significantly higher in pregnant women without supplementation. Levels of P-SH, NP-SH and δ-ALA-D activity were significantly lower in pregnant women without supplementation compared to non-pregnant and pregnant women with supplementation, while vitamin C levels were significantly lower in pregnant women without supplementation when compared to non-pregnant women. The increase in the generation of oxidative species and decrease of antioxidants suggest the loss of physiological oxidative balance during normal pregnancy, which was not observed in pregnant women with iron supplementation, suggesting a protective effect of iron against oxidative damage.

  14. Oxidative Profile and δ-Aminolevulinate Dehydratase Activity in Healthy Pregnant Women with Iron Supplementation

    PubMed Central

    De Lucca, Leidiane; Rodrigues, Fabiane; Jantsch, Letícia B.; Neme, Walter S.; Gallarreta, Francisco M. P.; Gonçalves, Thissiane L.

    2016-01-01

    An oxidative burst occurs during pregnancy due to the large consumption of oxygen in the tissues and an increase in metabolic demands in response to maternal physiological changes and fetal growth. This study aimed to determine the oxidative profile and activity of δ-aminolevulinate dehydratase (δ-ALA-D) in pregnant women who received iron supplementation. Oxidative stress parameters were evaluated in 25 pregnant women with iron supplementation, 25 pregnant women without supplementation and 25 non-pregnant women. The following oxidative stress parameters were evaluated: thiobarbituric acid reactive substances (TBARS), protein thiol groups (P-SH), non-protein thiol levels (NP-SH), vitamin C levels, catalase and δ-ALA-D activity. Markers of oxidative stress and cell damage, such as TBARS in plasma were significantly higher in pregnant women without supplementation. Levels of P-SH, NP-SH and δ-ALA-D activity were significantly lower in pregnant women without supplementation compared to non-pregnant and pregnant women with supplementation, while vitamin C levels were significantly lower in pregnant women without supplementation when compared to non-pregnant women. The increase in the generation of oxidative species and decrease of antioxidants suggest the loss of physiological oxidative balance during normal pregnancy, which was not observed in pregnant women with iron supplementation, suggesting a protective effect of iron against oxidative damage. PMID:27153075

  15. Identification of sulfonic acids as efficient ecto-5'-nucleotidase inhibitors.

    PubMed

    Iqbal, Jamshed; Saeed, Aamer; Raza, Rabia; Matin, Abdul; Hameed, Abdul; Furtmann, Norbert; Lecka, Joanna; Sévigny, Jean; Bajorath, Jürgen

    2013-01-01

    Ecto-5'-nucleotidase (CD73) is well known for its implication in cancer. Inhibition of ecto-5'-nucleotidases is thought to provide an attractive approach to cancer therapy. This study identifies sulfonic acid compounds as efficient inhibitors of ecto-5'-nucleotidases. The compounds were tested against recombinant human and rat ecto-5'-nucleotidases. The most potent new sulfonic acid inhibitor 6-amino-4-hydroxynaphthalene-2-sulfonic acid (1) of ecto-5'-nucleotidase had an IC₅₀ of 1.32 ± 0.09 μM for the human and 10.4 ± 3.3 μM for the rat enzyme. Generally, all compounds were more active against the human enzyme. Plausible binding mode models were developed for this new class of inhibitors. Furthermore, several sulfonic acid inhibitors were efficient cytotoxic agents when tested on H157 cancer cell lines. Hence, new ecto-5'-nucleotidases inhibitors displayed significant potential for further development as compounds for anti-cancer therapy.

  16. Probing the Binding Site of Bile Acids in TGR5.

    PubMed

    Macchiarulo, Antonio; Gioiello, Antimo; Thomas, Charles; Pols, Thijs W H; Nuti, Roberto; Ferrari, Cristina; Giacchè, Nicola; De Franco, Francesca; Pruzanski, Mark; Auwerx, Johan; Schoonjans, Kristina; Pellicciari, Roberto

    2013-12-12

    TGR5 is a G-protein-coupled receptor (GPCR) mediating cellular responses to bile acids (BAs). Although some efforts have been devoted to generate homology models of TGR5 and draw structure-activity relationships of BAs, none of these studies has hitherto described how BAs bind to TGR5. Here, we present an integrated computational, chemical, and biological approach that has been instrumental to determine the binding mode of BAs to TGR5. As a result, key residues have been identified that are involved in mediating the binding of BAs to the receptor. Collectively, these results provide new hints to design potent and selective TGR5 agonists. PMID:24900622

  17. Probing the Binding Site of Bile Acids in TGR5

    PubMed Central

    2013-01-01

    TGR5 is a G-protein-coupled receptor (GPCR) mediating cellular responses to bile acids (BAs). Although some efforts have been devoted to generate homology models of TGR5 and draw structure–activity relationships of BAs, none of these studies has hitherto described how BAs bind to TGR5. Here, we present an integrated computational, chemical, and biological approach that has been instrumental to determine the binding mode of BAs to TGR5. As a result, key residues have been identified that are involved in mediating the binding of BAs to the receptor. Collectively, these results provide new hints to design potent and selective TGR5 agonists. PMID:24900622

  18. 2,4,5-Trichlorophenoxyacetic acid (2,4,5-T)

    Integrated Risk Information System (IRIS)

    2,4,5 - Trichlorophenoxyacetic acid ( 2,4,5 - T ) ; CASRN 93 - 76 - 5 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard

  19. Thermal transformation of trans-5-O-caffeoylquinic acid (trans-5-CQA) in alcoholic solutions.

    PubMed

    Dawidowicz, Andrzej L; Typek, Rafal

    2015-01-15

    Chlorogenic acid (CQA), the ester of caffeic acid with quinic acid supplied to human organisms mainly with coffee, tea, fruit and vegetables, has been one of the most studied polyphenols. It is potentially useful in pharmaceuticals, food additives, and cosmetics due to its recently discovered biomedical activity, which revived interest in its properties, isomers and natural occurrence. We found that the heating of the alcoholic solution of trans-5-O-caffeoylquinic acid produced at least twenty compounds (chlorogenic acid derivatives and its reaction products with water and alcohol). The formation of three of them (methoxy, ethoxy and propoxy adducts) has not been reported yet. No reports exist either on methoxy adducts of 3- and 4-O-caffeoylquinic acid appearing in buffered methanol/water mixtures at pH exceeding 7. We observed that the amount of each formed component depended on the heating time, type of alcohol, its concentration in alcoholic/water mixture, and pH.

  20. Gas Phase Electronic Spectroscopy of 5-FLUOROSALICYLIC Acid.

    NASA Astrophysics Data System (ADS)

    Young, Justin W.; Fleisher, Adam J.; Pratt, David W.

    2010-06-01

    Methyl salicylate and its derivatives have generated large amounts of interest due to the possibility of intramolecular proton transfer in their electronically excited states (ESPT). Here, the excited state dynamics of 5-fluorosalicylic acid and its dimer will be discussed within the context of their vibrationally and rotationally resolved electronic spectra. Stark effect studies of the latter permit identification of specific conformers of 5FSA. However, some species exhibit broadened spectra, whereas others do not, suggesting a species-specific ESPT reaction. thanks

  1. Release kinetics of 5-aminosalicylic acid from halloysite.

    PubMed

    Aguzzi, C; Viseras, C; Cerezo, P; Salcedo, I; Sánchez-Espejo, R; Valenzuela, C

    2013-05-01

    This paper investigates desorption of 5-aminosalicilyc acid (5-ASA) adsorbed onto halloysite (HL). Desorption isotherms were fitted according to kinetic laws obtained considering release of 5-ASA from HL as the phase of desorption of the previously adsorbed drug molecules both inside the nanotubes of HL as onto the surface of clay particles and/or in the inter-particle spaces of their aggregates. Desorption isotherms has been also fitted with other equations frequently used in drug release kinetics studies. The best fitting corresponded to the kinetic model proposed; in agreement with the results of adsorption.

  2. 2(2,4,5-Trichlorophenoxy) propionic acid (2,4,5-TP)

    Integrated Risk Information System (IRIS)

    2 ( 2,4,5 - Trichlorophenoxy ) propionic acid ( 2,4,5 - TP ) ; CASRN 93 - 72 - 1 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Hea

  3. Conversion of biomass into 5-hydroxymethylfurfural using solid acid catalyst.

    PubMed

    Yang, Fengli; Liu, Qishun; Bai, Xuefang; Du, Yuguang

    2011-02-01

    5-Hydroxymethylfurfural (HMF) was produced from monosaccharide (fructose and glucose), polysaccharide (inulin) and the Jerusalem artichoke juice by a simple one-pot reaction including hydrolysis and dehydration using solid acid under mild condition. Hydrated niobium pentoxide (Nb(2)O(5)·nH(2)O(2)) after pretreatment showed high catalytic activities for dehydration of mono- and polysaccharide to HMF at 433 K in water-2-butanol (2:3 v/v) biphasic system, giving high HMF yield of 89% and 54% from fructose and inulin, respectively. The HMF yield was up to 74% and 65% when inulin and Jerusalem artichoke juice were hydrolyzed by exoinulinase. The solid acid made the process environment-friendly and energy-efficient to convert carbohydrates into bio-fuels and platform chemicals. PMID:21036606

  4. Electrocatalytic hydrogenation of 5-hydroxymethylfurfural in acidic solution.

    PubMed

    Kwon, Youngkook; Birdja, Yuvraj Y; Raoufmoghaddam, Saeed; Koper, Marc T M

    2015-05-22

    Electrocatalytic hydrogenation of 5-hydroxymethylfurfural (HMF) is studied on solid metal electrodes in acidic solution (0.5 M H2 SO4 ) by correlating voltammetry with on-line HPLC product analysis. Three soluble products from HMF hydrogenation are distinguished: 2,5-dihydroxymethylfuran (DHMF), 2,5-dihydroxymethyltetrahydrofuran (DHMTHF), and 2,5-dimethyl-2,3-dihydrofuran (DMDHF). Based on the dominant reaction products, the metal catalysts are divided into three groups: (1) metals mainly forming DHMF (Fe, Ni, Cu, and Pb), (2) metals forming DHMF and DMDHF depending on the applied potentials (Co, Ag, Au, Cd, Sb, and Bi), and (3) metals forming mainly DMDHF (Pd, Pt, Al, Zn, In, and Sb). Nickel and antimony are the most active catalysts for DHMF (0.95 mM cm(-2) at ca. -0.35 VRHE and -20 mA cm(-2) ) and DMDHF (0.7 mM cm(-2) at -0.6 VRHE and -5 mA cm(-2) ), respectively. The pH of the solution plays an important role in the hydrogenation of HMF: acidic condition lowers the activation energy for HMF hydro-genation and hydrogenates the furan ring further to tetrahydrofuran.

  5. Oleanolic acid and ursolic acid: novel hepatitis C virus antivirals that inhibit NS5B activity.

    PubMed

    Kong, Lingbao; Li, Shanshan; Liao, Qingjiao; Zhang, Yanni; Sun, Ruina; Zhu, Xiangdong; Zhang, Qinghua; Wang, Jun; Wu, Xiaoyu; Fang, Xiaonan; Zhu, Ying

    2013-04-01

    Hepatitis C virus (HCV) infects up to 170 million people worldwide and causes significant morbidity and mortality. Unfortunately, current therapy is only curative in approximately 50% of HCV patients and has adverse side effects, which warrants the need to develop novel and effective antivirals against HCV. We have previously reported that the Chinese herb Fructus Ligustri Lucidi (FLL) directly inhibited HCV NS5B RNA-dependent RNA polymerase (RdRp) activity (Kong et al., 2007). In this study, we found that the FLL aqueous extract strongly suppressed HCV replication. Further high-performance liquid chromatography (HPLC) analysis combined with inhibitory assays indicates that oleanolic acid and ursolic acid are two antiviral components within FLL aqueous extract that significantly suppressed the replication of HCV genotype 1b replicon and HCV genotype 2a JFH1 virus. Moreover, oleanolic acid and ursolic acid exhibited anti-HCV activity at least partly through suppressing HCV NS5B RdRp activity as noncompetitive inhibitors. Therefore, our results for the first time demonstrated that natural products oleanolic acid and ursolic acid could be used as potential HCV antivirals that can be applied to clinic trials either as monotherapy or in combination with other HCV antivirals. PMID:23422646

  6. Spectral, coordination and thermal properties of 5-arylidene thiobarbituric acids

    NASA Astrophysics Data System (ADS)

    Masoud, Mamdouh S.; El-Marghany, Adel; Orabi, Adel; Ali, Alaa E.; Sayed, Reham

    2013-04-01

    Synthesis of 5-arylidine thiobarbituric acids containing different functional groups with variable electronic characters were described and their Co2+, Ni2+ and Cu2+ complexes. The stereochemistry and mode of bonding of 5-(substituted benzylidine)-2-TBA complexes were achieved based on elemental analysis, spectral (UV-VIS, IR, 1H NMR, MS), magnetic susceptibility and conductivity measurements. The ligands were of bidentate and tridentate bonding through S, N and O of pyrimidine nucleolus. All complexes were of octahedral configuration. The thermal data of the complexes pointed to their stability. The mechanism of the thermal decomposition is discussed. The thermodynamic parameters of the dissociation steps were evaluated and discussed.

  7. Fatty Acid-Binding Protein 5 Facilitates the Blood-Brain Barrier Transport of Docosahexaenoic Acid.

    PubMed

    Pan, Yijun; Scanlon, Martin J; Owada, Yuji; Yamamoto, Yui; Porter, Christopher J H; Nicolazzo, Joseph A

    2015-12-01

    The brain has a limited ability to synthesize the essential polyunsaturated fatty acid (PUFA) docosahexaenoic acid (DHA) from its omega-3 fatty acid precursors. Therefore, to maintain brain concentrations of this PUFA at physiological levels, plasma-derived DHA must be transported across the blood-brain barrier (BBB). While DHA is able to partition into the luminal membrane of brain endothelial cells, its low aqueous solubility likely limits its cytosolic transfer to the abluminal membrane, necessitating the requirement of an intracellular carrier protein to facilitate trafficking of this PUFA across the BBB. As the intracellular carrier protein fatty acid-binding protein 5 (FABP5) is expressed at the human BBB, the current study assessed the putative role of FABP5 in the brain endothelial cell uptake and BBB transport of DHA in vitro and in vivo, respectively. hFAPB5 was recombinantly expressed and purified from Escherichia coli C41(DE3) cells and the binding affinity of DHA to hFABP5 assessed using isothermal titration calorimetry. The impact of FABP5 siRNA on uptake of (14)C-DHA into immortalized human brain microvascular endothelial (hCMEC/D3) cells was assessed. An in situ transcardiac perfusion method was optimized in C57BL/6 mice and subsequently used to compare the BBB influx rate (Kin) of (14)C-DHA between FABP5-deficient (FABP5(-/-)) and wild-type (FABP5(+/+)) C57BL/6 mice. DHA bound to hFABP5 with an equilibrium dissociation constant of 155 ± 8 nM (mean ± SEM). FABP5 siRNA transfection decreased hCMEC/D3 mRNA and protein expression of FABP5 by 53.2 ± 5.5% and 44.8 ± 13.7%, respectively, which was associated with a 14.1 ± 2.7% reduction in (14)C-DHA cellular uptake. By using optimized conditions for the in situ transcardiac perfusion (a 1 min preperfusion (10 mL/min) followed by perfusion of (14)C-DHA (1 min)), the Kin of (14)C-DHA was 0.04 ± 0.01 mL/g/s. Relative to FABP5(+/+) mice, the Kin of (14)C-DHA decreased 36.7 ± 12.4% in FABP5(-/-) mice

  8. Acid-coated Textiles (pH 5.5-6.5)--a New Therapeutic Strategy for Atopic Eczema?

    PubMed

    Jaeger, Teresa; Rothmaier, Markus; Zander, Holger; Ring, Johannes; Gutermuth, Jan; Anliker, Mark D

    2015-07-01

    Increased transepidermal water loss (TEWL) and decreased skin capacitance are characteristic features of the disturbed epidermal barrier in atopic eczema (AE). The "acid mantle", which is a slightly acidic film on the surface of the skin has led to the development of acidic emollients for skin care. In this context, the effect of citric acid-coated textiles on atopic skin has not been examined to date. A textile carrier composed of cellulose fibres was coated with a citric acid surface layer by esterification, ensuring a constant pH of 5.5-6.5. Twenty patients with AE or atopic diathesis were enrolled in the study. In a double-blind, half-side experiment, patients had to wear these textiles for 12 h a day for 14 days. On day 0 (baseline), 7 and 14, tolerability (erythema, pruritus, eczema, wearing comfort) and efficacy on skin barrier were assessed by TEWL skin hydration (corneometry/capacitance), pH and clinical scoring of eczema (SCORAD). Citric acid-coated textiles were well tolerated and improved eczema and objective parameters of skin physiology, including barrier function and a reduced skin surface pH, with potential lower pathogenic microbial colonisation.

  9. Molecular cloning and amino acid sequence of human 5-lipoxygenase

    SciTech Connect

    Matsumoto, T.; Funk, C.D.; Radmark, O.; Hoeoeg, J.O.; Joernvall, H.; Samuelsson, B.

    1988-01-01

    5-Lipoxygenase (EC 1.13.11.34), a Ca/sup 2 +/- and ATP-requiring enzyme, catalyzes the first two steps in the biosynthesis of the peptidoleukotrienes and the chemotactic factor leukotriene B/sub 4/. A cDNA clone corresponding to 5-lipoxygenase was isolated from a human lung lambda gt11 expression library by immunoscreening with a polyclonal antibody. Additional clones from a human placenta lambda gt11 cDNA library were obtained by plaque hybridization with the /sup 32/P-labeled lung cDNA clone. Sequence data obtained from several overlapping clones indicate that the composite DNAs contain the complete coding region for the enzyme. From the deduced primary structure, 5-lipoxygenase encodes a 673 amino acid protein with a calculated molecular weight of 77,839. Direct analysis of the native protein and its proteolytic fragments confirmed the deduced composition, the amino-terminal amino acid sequence, and the structure of many internal segments. 5-Lipoxygenase has no apparent sequence homology with leukotriene A/sub 4/ hydrolase or Ca/sup 2 +/-binding proteins. RNA blot analysis indicated substantial amounts of an mRNA species of approx. = 2700 nucleotides in leukocytes, lung, and placenta.

  10. Delta aminolevulinate dehydratase (ALA-D) activity in human and experimental diabetes mellitus.

    PubMed

    Fernández-Cuartero, B; Rebollar, J L; Batlle, A; Enriquez de Salamanca, R

    1999-01-01

    The haem pathway is impaired in porphyrias and a frequent coexistence of diabetes mellitus and porphyria disease has been reported. We have therefore decided to investigate delta-aminolevulinate dehydratase, one of the more sensitive enzymes in the haem pathway, in both human diabetic patients and diabetic rats. We have studied 131 diabetes mellitus patients, 32 insulin dependent and 99 non-insulin dependent. The latter group was further subdivided according to treatment: diet alone (n = 24), diet plus oral hypoglycemic agents (n = 28) and diet plus insulin (n = 47). We have also performed similar studies in the rat model of diabetes mellitus, induced in 11 Wistar rats by streptozotocin. Control groups of both humans and animals were used. Erythrocytic aminolevulinate dehydratase activity was reduced in both insulin dependent and non-insulin dependent diabetic patients as compared to their controls (p < 0.001). This activity was only partially restored by addition of zinc and thiols to the incubation media. In insulin-dependent diabetes mellitus, reduction of enzyme activity was related to the glycosilated hemoglobin concentration (p < 0.05) and in non-insulin dependent diabetes mellitus to the glycemia (p < 0.01). In the diabetic rat, aminolevulinate dehydratase activity was diminished on both erythrocytes (p < 0.01) and hepatic tissue (p < 0.01) when compared to the control group. The decrease in activity of erythrocyte aminolevulinate dehydratase observed in diabetic patients, may represent an additional and useful parameter for the assessment of the severity of carbohydrate metabolism impairment.

  11. Kinetic investigation of human 5-lipoxygenase with arachidonic acid.

    PubMed

    Mittal, Monica; Kumar, Ramakrishnan B; Balagunaseelan, Navisraj; Hamberg, Mats; Jegerschöld, Caroline; Rådmark, Olof; Haeggström, Jesper Z; Rinaldo-Matthis, Agnes

    2016-08-01

    Human 5-lipoxygenase (5-LOX) is responsible for the formation of leukotriene (LT)A4, a pivotal intermediate in the biosynthesis of the leukotrienes, a family of proinflammatory lipid mediators. 5-LOX has thus gained attention as a potential drug target. However, details of the kinetic mechanism of 5-LOX are still obscure. In this Letter, we investigated the kinetic isotope effect (KIE) of 5-LOX with its physiological substrate, arachidonic acid (AA). The observed KIE is 20±4 on kcat and 17±2 on kcat/KM at 25°C indicating a non-classical reaction mechanism. The observed rates show slight temperature dependence at ambient temperatures ranging from 4 to 35°C. Also, we observed low Arrhenius prefactor ratio (AH/AD=0.21) and a small change in activation energy (Ea(D)-Ea(H)=3.6J/mol) which suggests that 5-LOX catalysis involves tunneling as a mechanism of H-transfer. The measured KIE for 5-LOX involves a change in regioselectivity in response to deuteration at position C7, resulting in H-abstraction form C10 and formation of 8-HETE. The viscosity experiments influence the (H)kcat, but not (D)kcat. However the overall kcat/KM is not affected for labeled or unlabeled AA, suggesting that either the product release or conformational rearrangement might be involved in dictating kinetics of 5-LOX at saturating conditions. Investigation of available crystal structures suggests the role of active site residues (F421, Q363 and L368) in regulating the donor-acceptor distances, thus affecting H-transfer as well as regiospecificity. In summary, our study shows that that the H-abstraction is the rate limiting step for 5-LOX and that the observed KIE of 5-LOX is masked by a change in regioselectivity. PMID:27363940

  12. 3,5-Dihydroxybenzoic acid, a specific agonist for hydroxycarboxylic acid 1, inhibits lipolysis in adipocytes.

    PubMed

    Liu, Changlu; Kuei, Chester; Zhu, Jessica; Yu, Jingxue; Zhang, Li; Shih, Amy; Mirzadegan, Taraneh; Shelton, Jonathan; Sutton, Steven; Connelly, Margery A; Lee, Grace; Carruthers, Nicholas; Wu, Jiejun; Lovenberg, Timothy W

    2012-06-01

    Niacin raises high-density lipoprotein and lowers low-density lipoprotein through the activation of the β-hydroxybutyrate receptor hydroxycarboxylic acid 2 (HCA2) (aka GPR109a) but with an unwanted side effect of cutaneous flushing caused by vascular dilation because of the stimulation of HCA2 receptors in Langerhans cells in skin. HCA1 (aka GPR81), predominantly expressed in adipocytes, was recently identified as a receptor for lactate. Activation of HCA1 in adipocytes by lactate results in the inhibition of lipolysis, suggesting that agonists for HCA1 may be useful for the treatment of dyslipidemia. Lactate is a metabolite of glucose, suggesting that HCA1 may also be involved in the regulation of glucose metabolism. The low potency of lactate to activate HCA1, coupled with its fast turnover rate in vivo, render it an inadequate tool for studying the biological role of lactate/HCA1 in vivo. In this article, we demonstrate the identification of 3-hydroxybenzoic acid (3-HBA) as an agonist for both HCA2 and HCA1, whereas 3,5-dihydroxybenzoic acid (3,5-DHBA) is a specific agonist for only HCA1 (EC(50) ∼150 μM). 3,5-DHBA inhibits lipolysis in wild-type mouse adipocytes but not in HCA1-deficient adipocytes. Therefore, 3,5-DHBA is a useful tool for the in vivo study of HCA1 function and offers a base for further HCA1 agonist design. Because 3-HBA and 3,5-DHBA are polyphenolic acids found in many natural products, such as fruits, berries, and coffee, it is intriguing to speculate that other heretofore undiscovered natural substances may have therapeutic benefits.

  13. High Uric Acid (UA) Negatively Affects Serum Tartrate-Resistant Acid Phosphatase 5b (TRACP 5b) Immunoassay

    PubMed Central

    Wu, Zhi-Qi; Zhang, Yan; Xie, Erfu; Song, Wei-Juan; Yang, Rui-Xia; Yan, Cheng-Jing; Zhang, Bing-Feng; Xu, Hua-Guo

    2016-01-01

    Background Bone metastases often occur in the majority of patients with advanced cancer, such as prostate cancer, lung cancer and breast cancer. Serum tartrate-resistant acid phosphatase 5b (TRACP 5b), a novel bone resorption marker, has been used gradually in the clinics as a specific and sensitive marker of bone resorption for the early diagnosis of cancer patients with bone metastasis. Here, we reported that high concentrations of uric acid (UA) lead to decrease of TRACP 5b levels and determined whether TRACP 5b level was associated with UA in interference experiment. Methods A total of 77 patients with high concentrations of UA and 77 healthy subjects were tested to evaluate the differences in their TRACP 5b levels. Serial dilutions of UA were respectively spiked with a known concentration of TRACP 5b standard sample, then Serum TRACP 5b was detected by using bone TRAP® Assay. A correction equation was set to eliminate UA-derived TRACP 5b false-decrease. The effect of this correction was evaluated in high-UA individuals. Results The average TRACP level of the high-UA individuals (1.47± 0.62 U/L) was significantly lower than that of the healthy subjects (2.62 ± 0.63 U/L) (t-test, p<0.0001). The UA correction equation derived: ΔTRACP 5b = -1.9751lgΔUA + 3.7365 with an R2 = 0.98899. Application of the UA correction equation resulted in a statistically non-significant difference in TRACP 5b values between the healthy subjects and high-UA individuals (p = 0.24). Conclusions High UA concentrations can falsely decrease TRACP 5b levels due to a method-related systematic error. To avoid misdiagnoses or inappropriate therapeutic decisions, increased attention should be paid to UA interference, when TRACP 5b is used for early diagnosis of cancer patients with bone metastasis, evaluation of the aggressiveness of osteosarcoma or prediction of survival in prostate cancer and breast cancer with bone metastases. PMID:26800211

  14. A pulse radiolysis study of salicylic acid and 5-sulpho-salicylic acid in aqueous solutions

    NASA Astrophysics Data System (ADS)

    Kishore, Kamal; Mukherjee, T.

    2006-01-01

    Reactions of H, OH, eaq- and some one-electron oxidants have been studied with salicylic acid and 5-sulpho-salicylic acid in aqueous solutions. Rate constants for the reaction of eaq- with these compounds were of the order of 10 9 dm 3 mol -1 s -1 and this reaction led to the formation of reducing radicals which could transfer electron to methyl viologen. Other one-electron reductants were not able to reduce these compounds. OH radicals reacted with these compounds by addition pathway with very high rate constants (>10 10 dm 3 mol -1 s -1) while O rad - radical anions could oxidize these molecules to give phenoxyl type of radicals. Amongst the one-electron oxidants, only N 3rad and SO 4rad - could oxidize salicylic acid while 5-sulpho-salicylic acid could be oxidized only by SO 4- radicals indicating that while one-electron reduction potential for semi-oxidized SA may be<1.33 V vs. NHE (the E o1 for N 3rad radical), it is more than 1.33 V vs. NHE for semi-oxidized SSA species.

  15. Absorption cross section for the 5νOH stretch of acetic acid and peracetic acid

    NASA Astrophysics Data System (ADS)

    Begashaw, I. G.; Collingwood, M.; Bililign, S.

    2009-12-01

    We report measurements of the absorption cross sections for the vibrational O-H stretch (5νOH) overtone transitions in glacial acetic acid and peracetic acid. The photochemistry that results from overtone excitation has been shown to lead to OH radical production in molecules containing O-H (HNO3, H2O2). In addition the overtone excitation has been observed to result in light initiated chemical reaction. A Cavity ring-down spectroscopy (CRDS) instrument comprising of an Nd:YAG pumped dye laser and 620nm high reflectivity mirrors (R=99.995%) was used to measure the cross sections. The dye laser wavelength was calibrated using water vapor spectrum and the HITRAN 2008 database. The instrument’s minimum detectable absorption is αmin =4.5 *10-9cm-1 Hz-1/2 at 2σ noise level near the peak of the absorption feature. This measurement is the first for acetic acid at this excitation level. Preliminary results for acetic acid show the peak occurs near 615nm. Procedures for separating the monomer and dimer contribution will be presented. We would like to acknowledge support from NSF award #0803016 and NOAA-EPP award #NA06OAR4810187.

  16. Supramolecular structure of 5-aminosalycilic acid/halloysite composites.

    PubMed

    Viseras, Maria-Teresa; Aguzzi, Carola; Cerezo, Pilar; Cultrone, Giuseppe; Viseras, Cesar

    2009-05-01

    This paper assesses the supramolecular structure of nanocomposites prepared by including the anti-inflammatory drug 5-aminosalycilic acid in halloysite nanotubes. Halloysite tubes have sub-micron individual lengths with outer diameters ∼0.1 µm, as observed by FESEM. The mercury intrusion plots showed bimodal profiles with pore dimensions ∼10 and 0.06 µm. X-ray diffraction and thermogravimetric results revealed changes in the hydration form of the clay after the interaction. The groups associated to the interaction were studied by FTIR. The location of the drug in the composites was determined after uranium staining of its amino groups by X-EDS microanalysis coupled with HREM. The drug was located both inside and on the surface of the halloysite nanotubes. These results confirm the occurrence of two concomitant interaction mechanisms: rapid adsorption of 5-ASA at the external halloysite surface followed by slow adsorption of the drug inside the tubes.

  17. Salicylic acid diminishes Staphylococcus aureus capsular polysaccharide type 5 expression.

    PubMed

    Alvarez, Lucía P; Barbagelata, María S; Gordiola, Mariana; Cheung, Ambrose L; Sordelli, Daniel O; Buzzola, Fernanda R

    2010-03-01

    Capsular polysaccharides (CP) of serotypes 5 (CP5) and 8 (CP8) are major Staphylococcus aureus virulence factors. Previous studies have shown that salicylic acid (SAL), the main aspirin metabolite, affects the expression of certain bacterial virulence factors. In the present study, we found that S. aureus strain Reynolds (CP5) cultured with SAL was internalized by MAC-T cells in larger numbers than strain Reynolds organisms not exposed to SAL. Furthermore, the internalization of the isogenic nonencapsulated Reynolds strain into MAC-T cells was not significantly affected by preexposure to SAL. Pretreatment of S. aureus strain Newman with SAL also enhanced internalization into MAC-T cells compared with that of untreated control strains. Using strain Newman organisms, we evaluated the activity of the major cap5 promoter, which was significantly decreased upon preexposure to SAL. Diminished transcription of mgrA and upregulation of the saeRS transcript, both global regulators of CP expression, were found in S. aureus cultured in the presence of SAL, as ascertained by real-time PCR analysis. In addition, CP5 production by S. aureus Newman was also decreased by treatment with SAL. Collectively, our data demonstrate that exposure of encapsulated S. aureus strains to low concentrations of SAL reduced CP production, thus unmasking surface adhesins and leading to an increased capacity of staphylococci to invade epithelial cells. The high capacity of internalization of the encapsulated S. aureus strains induced by SAL pretreatment may contribute to the persistence of bacteria in certain hosts.

  18. Topical photodynamic therapy with 5-ALA in the treatment of arsenic-induced skin tumors

    NASA Astrophysics Data System (ADS)

    Karrer, Sigrid; Szeimies, Rolf-Markus; Landthaler, Michael

    1995-03-01

    A case of a 62-year-old woman suffering from psoriasis who was treated orally with arsenic 25 years ago is reported. The cumulative dose of arsenic trioxide was 800 mg. Since 10 years ago arsenic keratoses, basal cell carcinomas, Bowen's disease and invasive squamous cell carcinomas mainly on her hands and feet have developed, skin changes were clearly a sequence of arsenic therapy. Control of disease was poor, her right little finger had to be amputated. Topical photodynamic therapy with 5-aminolevulinic acid was performed on her right hand. Clinical and histological examinations 6 months after treatment showed an excellent cosmetic result with no signs of tumor residue.

  19. BGL5 .beta.-glucosidase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2006-02-28

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl5, and the corresponding BGL5 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL5, recombinant BGL5 proteins and methods for producing the same.

  20. BGL5 .beta.-glucosidase and nucleic acids encoding the same

    DOEpatents

    Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yao, Jian

    2008-03-18

    The present invention provides a novel .beta.-glucosidase nucleic acid sequence, designated bgl5, and the corresponding BGL5 amino acid sequence. The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding BGL5, recombinant BGL5 proteins and methods for producing the same.

  1. 21 CFR 862.1390 - 5-Hydroxyindole acetic acid/serotonin test system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false 5-Hydroxyindole acetic acid/serotonin test system... Test Systems § 862.1390 5-Hydroxyindole acetic acid/serotonin test system. (a) Identification. A 5-hydroxyindole acetic acid/serotonin test system is a device intended to measure 5-hydroxyindole acetic...

  2. 21 CFR 862.1390 - 5-Hydroxyindole acetic acid/serotonin test system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false 5-Hydroxyindole acetic acid/serotonin test system... Test Systems § 862.1390 5-Hydroxyindole acetic acid/serotonin test system. (a) Identification. A 5-hydroxyindole acetic acid/serotonin test system is a device intended to measure 5-hydroxyindole acetic...

  3. 21 CFR 862.1390 - 5-Hydroxyindole acetic acid/serotonin test system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false 5-Hydroxyindole acetic acid/serotonin test system... Test Systems § 862.1390 5-Hydroxyindole acetic acid/serotonin test system. (a) Identification. A 5-hydroxyindole acetic acid/serotonin test system is a device intended to measure 5-hydroxyindole acetic...

  4. 21 CFR 862.1390 - 5-Hydroxyindole acetic acid/serotonin test system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false 5-Hydroxyindole acetic acid/serotonin test system... Test Systems § 862.1390 5-Hydroxyindole acetic acid/serotonin test system. (a) Identification. A 5-hydroxyindole acetic acid/serotonin test system is a device intended to measure 5-hydroxyindole acetic...

  5. Retinoic acid 5,6-epoxidation by hemoproteins.

    PubMed

    Iwahashi, H; Ikeda, A; Negoro, Y; Kido, R

    1986-01-01

    Retinoic acid 5,6-epoxidase activity was found in several hemoproteins such as human oxy- and methemoglobin (HbO2 and MetHb), equine skeletal muscle oxy- and metmyoglobin (MbO2 and MetMb), bovine liver catalase, and horseradish peroxidase. Hematin also catalyzed retinoic acid 5,6-epoxidation. The results suggest that the heme moiety participates in the epoxidation. However, neither horse heart cytochrome c, nor free ferrous ion nor free ferric ion exhibited the epoxidase activity. Some hemoproteins (HbO2, MetHb, MbO2, MetMb, catalase, peroxidase, and hematin) exhibited characteristic individual pH dependences of the activity, suggesting that the epoxidase activities of the hemoproteins are influenced by the apoenzymes to some degree. This view is also supported by the finding that preincubation of an HbO2 preparation at various temperatures (37-70 degrees C) reduced its epoxidase activity with increasing temperature, whereas the activity of hematin was unaffected. Active oxygen scavengers such as mannitol, catalase, and superoxide dismutase exhibited no effect on the epoxidase activities of HbO2, MetHb, MbO2, and MetMb. A ligand of heme, CN- (100 mM), inhibited the epoxidase activities but N3- (100 mM) did not. The epoxidase activities were completely inhibited by NADPH, NADH, and/or 2-mercaptoethanol but not by NADP+ and/or NAD+. An intermediate in the epoxidation may be reduced by NADPH, NADH and/or 2-mercaptoethanol. Radical species can be considered as plausible candidates for the intermediate. PMID:3957898

  6. Conversion of 5-formyltetrahydrofolic acid to 5-methyltetrahydrofolic acid is unimpaired in folate-adequate persons homozygous for the C677T mutation in the methylenetetrahydrofolate reductase gene.

    PubMed

    Stern, L L; Bagley, P J; Rosenberg, I H; Selhub, J

    2000-09-01

    Methylenetetrahydrofolate reductase (MTHFR) catalyzes the synthesis of 5-methyltetrahydrofolic acid (5-CH(3)-H(4) folic acid), the methyl donor for the formation of methionine from homocysteine. A common C677T transition in the MTHFR gene results in a variant with a lower specific activity and a greater sensitivity to heat than the normal enzyme, as measured in vitro. This study was undertaken to determine the capacity of homozygotes for the MTHFR C677T transition to convert 5-formyltetrahydrofolic acid (5-HCO-H(4) folic acid) to 5-CH(3)-H(4) folic acid, a process that requires the action of MTHFR. Six subjects homozygous for the C677T transition (T/T) and 6 subjects with wild-type MTHFR (C/C) were given a 5-mg oral dose of (6R:,S:)-5-HCO-H(4) folic acid. Plasma and urine were analyzed for 5-CH(3)-H(4) folic acid concentrations using affinity/HPLC coupled with fluorescence or UV detection. The mean areas under the curves created by the rise and fall of plasma 5-CH(3)-H(4) folic acid after the oral dose did not differ between the two genotypes, 424.5 +/- 140.3 (T/T) vs. 424.1+/- 202.4 h.nmol/L (C/C). There also was no significant difference in the mean cumulative 7-h urinary excretion of 5-CH(3)-H(4) folic acid between the T/T (2.5 +/- 1.4 micromol) and C/C (1.9 +/- 1.0 micromol) genotypes. Under the conditions employed, the conversion of oral 5-HCO-H(4) folic acid to 5-CH(3)-H(4) folic acid is not impaired in persons with the T/T MTHFR genotype. Possible reasons for these findings are discussed. PMID:10958818

  7. Saturated fatty acids regulate retinoic acid signalling and suppress tumorigenesis by targeting fatty acid-binding protein 5.

    PubMed

    Levi, Liraz; Wang, Zeneng; Doud, Mary Kathryn; Hazen, Stanley L; Noy, Noa

    2015-01-01

    Long chain fatty acids (LCFA) serve as energy sources, components of cell membranes and precursors for signalling molecules. Here we show that these biological compounds also regulate gene expression and that they do so by controlling the transcriptional activities of the retinoic acid (RA)-activated nuclear receptors RAR and PPARβ/δ. The data indicate that these activities of LCFA are mediated by FABP5, which delivers ligands from the cytosol to nuclear PPARβ/δ. Both saturated and unsaturated LCFA (SLCFA, ULCFA) bind to FABP5, thereby displacing RA and diverting it to RAR. However, while SLCFA inhibit, ULCFA activate the FABP5/PPARβ/δ pathway. We show further that, by concomitantly promoting the activation of RAR and inhibiting the activation of PPARβ/δ, SLCFA suppress the oncogenic properties of FABP5-expressing carcinoma cells in cultured cells and in vivo. The observations suggest that compounds that inhibit FABP5 may constitute a new class of drugs for therapy of certain types of cancer. PMID:26592976

  8. Synthesis and evaluation of mutual azo prodrug of 5-aminosalicylic acid linked to 2-phenylbenzoxazole-2-yl-5-acetic acid in ulcerative colitis

    PubMed Central

    Jilani, Jamal A; Shomaf, Maha; Alzoubi, Karem H

    2013-01-01

    In this study, the syntheses of 4-aminophenylbenzoxazol-2-yl-5-acetic acid, (an analogue of a known nonsteroidal anti-inflammatory drug [NSAID]) and 5-[4-(benzoxazol-2-yl-5-acetic acid)phenylazo]-2-hydroxybenzoic acid (a novel mutual azo prodrug of 5-aminosalicylic acid [5-ASA]) are reported. The structures of the synthesized compounds were confirmed using infrared (IR), hydrogen-1 nuclear magnetic resonance (1H NMR), and mass spectrometry (MS) spectroscopy. Incubation of the azo compound with rat cecal contents demonstrated the susceptibility of the prepared azo prodrug to bacterial azoreductase enzyme. The azo compound and the 4-aminophenylbenzoxazol-2-yl-5-acetic acid were evaluated for inflammatory bowel diseases, in trinitrobenzenesulfonic acid (TNB)-induced colitis in rats. The synthesized diazo compound and the 4-aminophenylbenzoxazol-2-yl-5-acetic acid were found to be as effective as 5-aminosalicylic acid for ulcerative colitis. The results of this work suggest that the 4-aminophenylbenzoxazol-2-yl-5-acetic acid may represent a new lead for treatment of ulcerative colitis. PMID:23983456

  9. 5'Azido-N-1-napthylphthalamic acid, a photolabile analog of N-1-naphthylphthalamic acid

    SciTech Connect

    Voet, J.G.; Howley, K.S.; Shumsky, J.S.

    1987-09-01

    A photolabile analog of N-1-naphthylphthalamic acid (NPA), 5'-azido-N-1-naphthylphthalamic acid (Az-NPA), has been synthesized and characterized. This potential photoaffinity label for the plasma membrane NPA binding protein competes with (/sup 3/H)NPA for binding sites on Curcurbita pepo L. (zucchini) hypocotyl cell membranes with K/sub 0.5/ = 2.8 x 10/sup -7/ molar. The K/sub 0.5/ for NPA under these conditions is 2 x 10/sup -8/ molar, indicating that the affinity of Az-NPA for the membranes is only 14-fold lower than NPA. While the binding of Az-NPA to NPA binding sites is reversible in the dark, exposure of the Az-NPA treated membranes to light results in a 30% loss in (/sup 3/H)NPA binding ability. Pretreatment of the membranes with NPA protects the membranes against photodestruction of (/sup 3/H)NPA binding sites by Az-NPA supporting the conclusion that Az-NPA destroys these sites by specific covalent attachment.

  10. Epidermodysplasia verruciformis treated using topical 5-aminolaevulinic acid photodynamic therapy.

    PubMed

    Karrer, S; Szeimies, R M; Abels, C; Wlotzke, U; Stolz, W; Landthaler, M

    1999-05-01

    We describe a 65-year-old woman who had had wart-like lesions on the hands, lower arms and forehead for about 45 years. She had already had several basal cell carcinomas excised. Histological study, electron microscopy and in situ hybridization [human papilloma virus (HPV)-types 5/8/12/14/19-23/25/36] of skin biopsies confirmed a diagnosis of epidermodysplasia verruciformis (EV). Photodynamic therapy (PDT) was performed using a 20% 5-aminolaevulinic acid ointment applied for 6 h to the lesions and irradiating using an incoherent light source (lambda = 580-740 nm, 160 mW/cm2, 160 J/cm2). Following PDT, blistering and crusting of the lesions occurred, but these healed completely within 2-3 weeks without scarring, and the cosmetic result was excellent. Six months after PDT a skin biopsy was taken. In situ hybridization was positive for HPV type 8 in skin which was clinically and histologically normal. Twelve months after PDT a few lesions had recurred on the hands. Although permanent cure of EV cannot be achieved by any therapy at present and single lesions continue to appear in this patient, topical PDT might result in better control of HPV-induced lesions.

  11. Epidermodysplasia verruciformis treated using topical 5-aminolaevulinic acid photodynamic therapy.

    PubMed

    Karrer, S; Szeimies, R M; Abels, C; Wlotzke, U; Stolz, W; Landthaler, M

    1999-05-01

    We describe a 65-year-old woman who had had wart-like lesions on the hands, lower arms and forehead for about 45 years. She had already had several basal cell carcinomas excised. Histological study, electron microscopy and in situ hybridization [human papilloma virus (HPV)-types 5/8/12/14/19-23/25/36] of skin biopsies confirmed a diagnosis of epidermodysplasia verruciformis (EV). Photodynamic therapy (PDT) was performed using a 20% 5-aminolaevulinic acid ointment applied for 6 h to the lesions and irradiating using an incoherent light source (lambda = 580-740 nm, 160 mW/cm2, 160 J/cm2). Following PDT, blistering and crusting of the lesions occurred, but these healed completely within 2-3 weeks without scarring, and the cosmetic result was excellent. Six months after PDT a skin biopsy was taken. In situ hybridization was positive for HPV type 8 in skin which was clinically and histologically normal. Twelve months after PDT a few lesions had recurred on the hands. Although permanent cure of EV cannot be achieved by any therapy at present and single lesions continue to appear in this patient, topical PDT might result in better control of HPV-induced lesions. PMID:10354037

  12. Urticaria after methyl aminolevulinate photodynamic therapy in a patient with nevoid basal cell carcinoma syndrome.

    PubMed

    Wolfe, Christopher M; Green, W Harris; Hatfield, H Keith; Cognetta, Armand B

    2012-11-01

    Methyl aminolevulinate photodynamic therapy (MAL-PDT) is utilized in several countries for the treatment of basal cell carcinoma, but allergic sensitization has been reported by the manufacturer. To the best of our knowledge, we report the first case of urticaria following MAL-PDT in a patient with nevoid basal cell carcinoma syndrome. Prophylactic use of antihistamines may allow continued use of MAL-PDT in this setting.

  13. Experimental and computational thermochemical study and solid-phase structure of 5,5-dimethylbarbituric acid.

    PubMed

    Roux, María Victoria; Notario, Rafael; Foces-Foces, Concepción; Temprado, Manuel; Ros, Francisco; Emel'yanenko, Vladimir N; Verevkin, Sergey P

    2010-03-18

    This paper reports an experimental and computational thermochemical study on 5,5-dimethylbarbituric acid and the solid-phase structure of the compound. The value of the standard (p(o) = 0.1 MPa) molar enthalpy of formation in the gas phase at T = 298.15 K has been determined. The energy of combustion was measured by static bomb combustion calorimetry, and from the result obtained, the standard molar enthalpy of formation in the crystalline state at T = 298.15 K was calculated as -(706.4 +/- 2.2) kJ x mol(-1). The enthalpy of sublimation was determined using a transference (transpiration) method in a saturated NB(2) stream, and a value of the enthalpy of sublimation at T = 298.15 K was derived as (115.8 +/- 0.5) kJ x mol(-1). From these results a value of -(590.6 +/- 2.3) kJ x mol(-1) for the gas-phase enthalpy of formation at T = 298.15 K was determined. Theoretical calculations at the G3 level were performed, and a study on molecular and electronic structure of the compound has been carried out. Calculated enthalpies of formation are in reasonable agreement with the experimental value. 5,5-Dimethylbarbituric acid was characterized by single crystal X-ray diffraction analysis. In the crystal structure, N-H...O=C hydrogen bonds lead to the formation of ribbons connected further by weak C-H...O=C hydrogen bonds into a three-dimensional network. The molecular and supramolecular structures observed in the solid state were also investigated in the gas phase by DFT calculations. PMID:20180529

  14. Experimental and computational thermochemical study and solid-phase structure of 5,5-dimethylbarbituric acid.

    PubMed

    Roux, María Victoria; Notario, Rafael; Foces-Foces, Concepción; Temprado, Manuel; Ros, Francisco; Emel'yanenko, Vladimir N; Verevkin, Sergey P

    2010-03-18

    This paper reports an experimental and computational thermochemical study on 5,5-dimethylbarbituric acid and the solid-phase structure of the compound. The value of the standard (p(o) = 0.1 MPa) molar enthalpy of formation in the gas phase at T = 298.15 K has been determined. The energy of combustion was measured by static bomb combustion calorimetry, and from the result obtained, the standard molar enthalpy of formation in the crystalline state at T = 298.15 K was calculated as -(706.4 +/- 2.2) kJ x mol(-1). The enthalpy of sublimation was determined using a transference (transpiration) method in a saturated NB(2) stream, and a value of the enthalpy of sublimation at T = 298.15 K was derived as (115.8 +/- 0.5) kJ x mol(-1). From these results a value of -(590.6 +/- 2.3) kJ x mol(-1) for the gas-phase enthalpy of formation at T = 298.15 K was determined. Theoretical calculations at the G3 level were performed, and a study on molecular and electronic structure of the compound has been carried out. Calculated enthalpies of formation are in reasonable agreement with the experimental value. 5,5-Dimethylbarbituric acid was characterized by single crystal X-ray diffraction analysis. In the crystal structure, N-H...O=C hydrogen bonds lead to the formation of ribbons connected further by weak C-H...O=C hydrogen bonds into a three-dimensional network. The molecular and supramolecular structures observed in the solid state were also investigated in the gas phase by DFT calculations.

  15. Reduction of 3-keto-5 beta-cholanoic acid to lithocholic and isolithocholic acids by human liver cytosol in vitro.

    PubMed

    Amuro, Y; Yamade, W; Maebo, A; Hada, T; Higashino, K

    1985-10-23

    The formation of lithocholic and isolithocholic acids from 3-keto-5 beta-cholanoic acid by human liver cytosol was examined in vitro. Liver cytosol was incubated at various pH levels with 3-keto-5 beta-cholanoic acid in a phosphate buffer containing NADPH or NADH; the products formed were analyzed by gas chromatography. Results showed that human liver cytosol reduced 3-keto-5 beta-cholanoic acid to lithocholic acid at a pH level of 7.0 or above and to isolithocholic acid at a pH level of 6.0 or below when NADPH was used as a coenzyme, and it was reduced to isolithocholic acid only when NADH was used. Furthermore, two peaks for the reducing enzymes could be clearly found by column chromatography of Affi-Gel Blue. These results indicate that human liver cytosol contains two enzymes acting on reduction of 3-keto-5 beta-cholanoic acid to lithocholic and isolithocholic acids, which are dependent on the pH level and the use of NADPH or NADH in vitro. Since the 3 beta-dehydrogenation was inhibited by the addition of pyrazole, an alcohol dehydrogenase inhibitor or ethanol, and the major peak of 3 beta-hydroxysteroid dehydrogenase coincided with the peak of alcohol dehydrogenase on Affi-Gel Blue chromatography, at least some of the cytosolic 3 beta-hydroxysteroid dehydrogenase seemed to be identical to or to have characteristics similar to alcohol dehydrogenase. PMID:2932163

  16. Root uptake of cationic amino acids by Arabidopsis depends on functional expression of amino acid permease 5.

    PubMed

    Svennerstam, Henrik; Ganeteg, Ulrika; Näsholm, Torgny

    2008-01-01

    * Specific transporters mediate uptake of amino acids by plant roots. Earlier studies have indicated that the lysine histidine transporter 1 and amino acid permease 1 participate in this process, but although plant roots have been shown to absorb cationic amino acids with high affinity, neither of these transporters seems to mediate transport of L-arginine (L-Arg) or L-lysine (L-Lys). * Here, a collection of T-DNA knockout mutants were screened for alterations in Arabidopsis root uptake rates of L-Arg and it was found that only the AAP5 mutant displayed clear phenotypic divergence on high concentrations of L-Arg. A second screen using low concentrations of (15)N-labelled L-Arg in the growth media also identified AAP5 as being involved in L-Arg acquisition. * Momentaneous root uptake of basic amino acids was strongly affected in AAP5 mutant lines, but their uptake of other types of amino acids was only marginally affected. Comparisons of the root uptake characteristics of AAP5 and LHT1 mutants corroborated the hypothesis that the two transporters have distinct affinity spectra in planta. * Root uptake of all tested amino acids, except L-aspartic acid (L-Asp), was significantly affected in double AAP5*LHT1 mutants, suggesting that these two transporters account for a major proportion of roots' uptake of amino acids at low concentrations. PMID:18681934

  17. Synthesis and biological activity of some 5-substituted aminomethyl-8-hydroxyquinoline-7-sulphonic acids.

    PubMed

    Yanni, A S; Mohharam, A M

    1990-01-01

    5-Aryl (or alkyl)-8-hydroxyquinoline-7-sulphonic acids have been prepared by the Mannich reaction of 8-hydroxyquinoline-7-sulphonic acid with primary and secondary amines. Their bactericidal activities have been determined.

  18. 31. Public Works Department Drawing 463M5 (1992), 'Replace Acid Tank ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    31. Public Works Department Drawing 463-M-5 (1992), 'Replace Acid Tank No. 3-Plan, Elevation, Details' - Mare Island Naval Shipyard, Acid Mixing Facility, California Avenue & E Street, Vallejo, Solano County, CA

  19. Selective Aerobic Oxidation of 5-(Hydroxymethyl)furfural to 5-Formyl-2-furancarboxylic Acid in Water.

    PubMed

    Ventura, Maria; Aresta, Michele; Dibenedetto, Angela

    2016-05-23

    A simple, cheap, and selective catalyst based on copper/cerium oxides is described for the oxidation of 5-(hydroxymethyl)furfural (5-HMF) in water. An almost quantitative conversion (99 %) with excellent (90 %) selectivity towards the formation of 5-formyl-2-furancarboxylic acid, a platform molecule for other high value chemicals, is observed. The catalyst does not require any pretreatment or additives, such as bases, to obtain high yield and selectivity in water as solvent and using oxygen as oxidant. When a physical mixture of the oxides is used, low conversion and selectivity are observed. Air can be used instead of oxygen, but a lower conversion rate is observed if the same overall pressure is used, and the selectivity remains high. The catalyst can be recovered almost quantitatively and reused. Deactivation of the catalyst, observed in repeated runs, is due to the deposition of humins on its surface. Upon calcination the catalyst almost completely recovers its activity and selectivity, proving that the catalyst is robust. PMID:27101568

  20. Long-term follow-up of metil aminolevulinate (MAL)-PDT in difficult-to-treat cutaneous Bowen's disease.

    PubMed

    Cavicchini, Stefano; Serini, Stefano Maria; Fiorani, Roberta; Girgenti, Valentina; Ghislanzoni, Massimo; Sala, Francesco

    2011-08-01

    Bowen's disease (BD) is a form of intraepidermal squamous cell carcinoma, which is clinically characterized by gradually enlarging, well-demarcated erythematous plaques with irregular borders and surface crusting or scaling, affecting primarily the elderly. BD often presents with lesions difficult to treat with standard therapy as surgery, cryosurgery, or 5-fluorouracil (5-FU) for the risk of significantly poor cosmetic outcome, failure rate, and adverse events, related mainly to the age of the patients. Topical PDT with methyl aminolevulinate (MAL) represents a valid and approved therapy for BD lesions in many cases, especially for lesions located at poor healing sites or for large patches of disease, due to its high efficacy coupled with good tolerability and tissue-sparing attitude. In this study, we sought to investigate the efficacy, safety, and cosmetic outcome of MAL-PDT in a series of patients with BD lesions which were challenging to treat for clinical, surgical, and patient-related reasons, such as size of the lesion, difficult surgical approach for anatomical sites, or age of patients and request of the best cosmetic result. We also performed a long-term follow-up to assess recurrence rates and eventual late-onset adverse events.

  1. Chlorogenic acid increased 5-hydroxymethylfurfural formation when heating fructose alone or with aspartic acid at two pH levels.

    PubMed

    Zhang, Zhenhua; Zou, Yueyu; Wu, Taigang; Huang, Caihuan; Pei, Kehan; Zhang, Guangwen; Lin, Xiaohua; Bai, Weibin; Ou, Shiyi

    2016-01-01

    Chlorogenic acid (CGA) is a phenolic acid that ubiquitously exists in fruits. This work aims to investigate whether and how CGA influences HMF formation during heating fructose alone, or with an amino acid. The results showed that that CGA increased 5-hydroxymethylfurfural (HMF) formation. At pH 5.5 and 7.0, the addition of 5.0 μmol/ml CGA increased HMF formation by 49.4% and 25.2%, respectively when heating fructose alone, and by 9.0% and 16.7%, respectively when heating fructose with aspartic acid. CGA significantly increased HMF formation by promoting 3-deoxosone formation, and its conversion to HMF by inhibiting HMF elimination, especially in the Maillard reaction system. A comparison of the catalytic capacity of CGA with its six analogous compounds showed that both its di-hydroxyphenyl and carboxyl groups function in increasing HMF formation.

  2. Parallel Chemoenzymatic Synthesis of Sialosides Containing a C5-Diversified Sialic Acid

    PubMed Central

    Cao, Hongzhi; Muthana, Saddam; Li, Yanhong; Cheng, Jiansong; Chen, Xi

    2009-01-01

    A convenient chemoenzymatic strategy for synthesizing sialosides containing a C5-diversified sialic acid was developed. The α2,3- and α2,6-linked sialosides containing a 5-azido neuraminic acid synthesized by a highly efficient one-pot three-enzyme approach were converted to C5″-amino sialosides, which were used as common intermediates for chemical parallel synthesis to quickly generate a series of sialosides containing various sialic acid forms. PMID:19740656

  3. New 5-O-caffeoylquinic acid derivatives in fruit of the wild eggplant relative Solanum viarum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fruit of cultivated eggplant (Solanum melongena) and several wild relatives (S. aethiopicum, S. macrocarpon, S. anguivi, and S. incanum) have a high content of hydroxycinnamic acid (HCA) conjugates. Typically, caffeoylquinic acid esters predominate, and in particular chlorogenic acid [5-O-(E)-caffeo...

  4. Basic principles of fluorescence detection with use of 5-ALA

    NASA Astrophysics Data System (ADS)

    Baumgartner, Reinhold; Stepp, Herbert G.

    2000-06-01

    5-Aminolevulinic acid (5-ALA) has been proven to induce selective accumulation of flourescent Protoporphyrin IX (PPIX) in many types of malignant tissue. According to the target to treatment different routes of topical and systemical application of 5-ALA can be chosen. They include techniques like inhalation, installation and rinsing. For fluorescence detection a lamp based system have been developed in the laser-Forschungslabor in Munich together with Storz company. By skillful balancing of excitation filter centered around 400 nm and the observation filter with transmission above 450 nm images with high color contrast can be obtained. The universal application of the D-LIGHT could be demonstrated in different clinical disciplines like urology, neurosurgery, ENT clinic, gynecology and others.

  5. Biotransformation of 5-hydroxy-methylfurfural into 2,5-furan-dicarboxylic acid by bacterial isolate using thermal acid algal hydrolysate.

    PubMed

    Yang, Chu-Fang; Huang, Ci-Ruei

    2016-08-01

    Thermal acid hydrolysis is often used to deal with lignocellulosic biomasses, but 5-hydroxy-methylfurfural (5-HMF) formed during hydrolysis deeply influences downstream fermentation. 2,5-Furan-dicarboxylic acid (FDCA), which is in the list of future important biomass platform molecules can be obtained using 5-HMF biotransformation. Based on the connection between 5-HMF removal in acid hydrolysate and FDCA production, the optimum thermal acid hydrolysis condition for macroalgae Chaetomorpha linum was established. Potential microbes capable of transforming 5-HMF into FDCA were isolated and characterized under various parameters and inoculated into algal hydrolysate to perform 5-HMF biotransformation. The optimum hydrolysis condition was to apply 0.5M HCl to treat 3% algal biomass under 121°C for 15min. Isolated Burkholderia cepacia H-2 could transform 2000mg/L 5-HMF at the initial pH of 7 at 28°C and 1276mg/L FDCA was received. Strain B. cepacia H-2 was suitable for treating the algal hydrolysate without dilution, receiving 989.5mg/L FDCA. PMID:27151683

  6. Cell nucleus directed 2,3,5-triiodobenzoic acid conjugates.

    PubMed

    Sturzu, Alexander; Vogel, Ulrich; Gharabaghi, Alireza; Beck, Alexander; Kalbacher, Hubert; Echner, Hartmut; Heckl, Stefan

    2009-07-01

    Triiodobenzoic acid (TIBA) represents the core structure of most clinically used contrast agents for computed tomography and other X-ray procedures. To construct an intracellular radiopaque contrast agent, TIBA was coupled to various different positively and negatively charged fluorescein iothiocyanate (FITC)-labelled peptides. TIBA coupled to the SV40 T Antigen nuclear localization sequence (NLS) stained 80% of human glioma cells and caused cell death. This occurred with C- or N-terminal binding of TIBA and with the correct or mutant NLS. No cell death and only small numbers of stained cells (below 3 %) were observed after incubation with NLS conjugates lacking TIBA or after incubation with TIBA-conjugates containing a negatively charged polyglutamic acid stretch. TIBA-conjugates containing the Antennapedia-derived cell-penetrating peptide penetratin were only nuclearly taken up when TIBA and FITC were coupled to lysines outside the 16-amino acid peptide sequence. The study shows that intracellular TIBA may have potential as a chemotherapeutic agent rather than a contrast agent.

  7. Gluconic acid produced by Gluconacetobacter diazotrophicus Pal5 possesses antimicrobial properties.

    PubMed

    Nieto-Peñalver, Carlos G; Savino, María J; Bertini, Elisa V; Sánchez, Leandro A; de Figueroa, Lucía I C

    2014-09-01

    Gluconic acid is produced in large quantities by the endophytic and diazotrophic bacterium Gluconacetobacter diazotrophicus Pal5. This organic acid derives from direct oxidation of glucose by a pyrroloquinoline-quinone-linked glucose dehydrogenase in this plant growth-promoting bacterium. In the present article, evidence is presented showing that gluconic acid is also responsible for the antimicrobial activity of G. diazotrophicus Pal5. The broad antagonistic spectrum includes Gram-positive and -negative bacteria. Eukaryotic microorganisms are more resistant to growth inhibition by this acid. Inhibition by gluconic acid can be modified through the presence of other organic acids. In contrast to other microorganisms, the Quorum Sensing system of G. diazotrophicus Pal5, a regulatory mechanism that plays a key role in several microbe-microbe interactions, is not related to gluconic acid production and the concomitant antagonistic activity. PMID:25049167

  8. Gluconic acid produced by Gluconacetobacter diazotrophicus Pal5 possesses antimicrobial properties.

    PubMed

    Nieto-Peñalver, Carlos G; Savino, María J; Bertini, Elisa V; Sánchez, Leandro A; de Figueroa, Lucía I C

    2014-09-01

    Gluconic acid is produced in large quantities by the endophytic and diazotrophic bacterium Gluconacetobacter diazotrophicus Pal5. This organic acid derives from direct oxidation of glucose by a pyrroloquinoline-quinone-linked glucose dehydrogenase in this plant growth-promoting bacterium. In the present article, evidence is presented showing that gluconic acid is also responsible for the antimicrobial activity of G. diazotrophicus Pal5. The broad antagonistic spectrum includes Gram-positive and -negative bacteria. Eukaryotic microorganisms are more resistant to growth inhibition by this acid. Inhibition by gluconic acid can be modified through the presence of other organic acids. In contrast to other microorganisms, the Quorum Sensing system of G. diazotrophicus Pal5, a regulatory mechanism that plays a key role in several microbe-microbe interactions, is not related to gluconic acid production and the concomitant antagonistic activity.

  9. Comparison of clindamycin 1% and benzoyl peroxide 5% gel to a novel composition containing salicylic acid, capryloyl salicylic acid, HEPES, glycolic acid, citric acid, and dioic acid in the treatment of acne vulgaris.

    PubMed

    Baumann, Leslie S; Oresajo, Christian; Yatskayer, Margarita; Dahl, Amanda; Figueras, Kristian

    2013-03-01

    This study evaluated the tolerance and efficacy of 2 facial skin products in subjects with acne using the following acne treatments: 1) treatment A, a combination of salicylic acid, capryloyl salicylic acid, HEPES, glycolic acid, citric acid, and dioic acid, and 2) treatment B (BenzaClin®, clindamycin 1% and benzoyl peroxide 5% gel). The treatment design included the split-face application of treatment A and treatment B and the full-face application of the cleanser, moisturizer, and sunscreen. Data were collected through physician visual assessments, subject irritation questionnaires and assessments, along with clinical photography. Results showed similar tolerance and efficacy for both treatments.

  10. 5-Hydroxyquinoline-2-Carboxylic Acid, a Dead-End Metabolite from the Bacterial Oxidation of 5-Aminonaphthalene-2-Sulfonic Acid

    PubMed Central

    Nörtemann, Bernd; Glässer, Andrea; Machinek, Reinhard; Remberg, Gerd; Knackmuss, Hans-Joachim

    1993-01-01

    5-Aminonaphthalene-2-sulfonate (5A2NS) is converted by strain BN6 into 5-hydroxyquinoline-2-carboxylate (5H2QC). The authenticity of this new compound is confirmed by nuclear magnetic resonance and mass spectrometry. Its formation is explained by a spontaneous cyclization of the hypothetical metabolite 6′-amino-2′-hydroxybenzalpyruvate. The formation of 5H2QC as a dead-end product of 5A2NS prevents NADH regeneration so that 5A2NS oxidation is limited by the internal NADH pool. PMID:16348967

  11. On the interference of boswellic acids with 5-lipoxygenase: mechanistic studies in vitro and pharmacological relevance.

    PubMed

    Siemoneit, Ulf; Pergola, Carlo; Jazzar, Bianca; Northoff, Hinnak; Skarke, Carsten; Jauch, Johann; Werz, Oliver

    2009-03-15

    Boswellic acids are pharmacologically active ingredients of frankincense with anti-inflammatory properties. It was shown that in vitro 11-keto-boswellic acids inhibit 5-lipoxygenase (5-LO, EC 1.13.11.34), the key enzyme in leukotriene biosynthesis, which may account for their anti-inflammatory effectiveness. However, whether 11-keto-boswellic acids interfere with 5-LO under physiologically relevant conditions (i.e., in whole blood assays) and whether they inhibit 5-LO in vivo is unknown. Inhibition of human 5-LO by the major naturally occurring boswellic acids was analyzed in cell-free and cell-based activity assays. Moreover, interference of boswellic acids with 5-LO in neutrophil incubations in the presence of albumin and in human whole blood was assessed, and plasma leukotriene B(4) of frankincense-treated healthy volunteers was determined. Factors influencing 5-LO activity (i.e., Ca(2+), phospholipids, substrate concentration) significantly modulate the potency of 11-keto-boswellic acids to inhibit 5-LO. Moreover, 11-keto-boswellic acids efficiently suppressed 5-LO product formation in isolated neutrophils (IC(50)=2.8 to 8.8 muM) but failed to inhibit 5-LO product formation in human whole blood. In the presence of albumin (10 mg/ml), 5-LO inhibition by 11-keto-boswellic acids (up to 30 muM) in neutrophils was abolished, apparently due to strong albumin-binding (>95%) of 11-keto-boswellic acids. Finally, single dose (800 mg) oral administration of frankincense extracts to human healthy volunteers failed to suppress leukotriene B(4) plasma levels. Our data show that boswellic acids are direct 5-LO inhibitors that efficiently suppress 5-LO product synthesis in common in vitro test models, however, the pharmacological relevance of such interference in vivo seems questionable.

  12. 5-lipoxygenase and 5-lipoxygenase-activating protein gene polymorphisms, dietary linoleic acid, and risk for breast cancer.

    PubMed

    Wang, Jun; John, Esther M; Ingles, Sue Ann

    2008-10-01

    The n-6 polyunsaturated fatty acid 5-lipoxygenase pathway has been shown to play a role in the carcinogenesis of breast cancer. We conducted a population-based case-control study among Latina, African-American, and White women from the San Francisco Bay area to examine the association of the 5-lipoxygenase gene (ALOX5) and 5-lipoxygenase-activating protein gene (ALOX5AP) with breast cancer risk. Three ALOX5AP polymorphisms [poly(A) microsatellite, -4900 A>G (rs4076128), and -3472 A>G (rs4073259)] and three ALOX5 polymorphisms [Sp1-binding site (-GGGCGG-) variable number of tandem repeat polymorphism, -1279 G>T (rs6593482), and 760 G>A (rs2228065)] were genotyped in 802 cases and 888 controls. We did not find significant main effects of ALOX5 and ALOX5AP genotypes on breast cancer risk that were consistent across race or ethnicity; however, there was a significant interaction between the ALOX5AP -4900 A>G polymorphism and dietary linoleic acid intake (P=0.03). Among women consuming a diet high in linoleic acid (top quartile of intake, >17.4 g/d), carrying the AA genotype was associated with higher breast cancer risk (age- and race-adjusted odds ratio, 1.8; 95% confidence interval, 1.2-2.9) compared with carrying genotypes AG or GG. Among women consuming acid, ALOX5AP -4900 genotype was not associated with breast cancer risk (age- and race-adjusted odds ratio, 0.9; 95% confidence interval, 0.7-1.2). These results support a role for n-6 polyunsaturated fatty acids in breast carcinogenesis and suggest that epidemiologic studies on dietary fat and breast cancer should take into account genetic predisposition related to n-6 polyunsaturated fatty acid metabolism.

  13. Lysergic acid diethylamide: role in conversion of plasma tryptophan to brain serotonin (5-hydroxytryptamine).

    PubMed

    Lin, R C; Ngai, S H; Costa, E

    1969-10-10

    Injections of D-lysergic acid diethylamide decrease the turnover rate of 5-hydroxytryptamine of rat brain, as measured from the conversion of (14)C-tryptophan into (14)C-5-hydroxytryptamine. The 2-bromolysergic acid diethylamide given in doses fivefold greater than those of lysergic acid diethylamide fails to change the rate of (14)C-tryptophan conversion into (14)C-5-hydroxytryptamine. The effect of D-lysergic acid diethylamide is discussed with regard to its action on brain serotonergic neurons and its psychotomimetic effects.

  14. Ion-exclusion chromatography determination of organic acid in uridine 5'-monophosphate fermentation broth.

    PubMed

    Niu, Huanqing; Chen, Yong; Xie, Jingjing; Chen, Xiaochun; Bai, Jianxin; Wu, Jinglan; Liu, Dong; Ying, Hanjie

    2012-09-01

    Simultaneous determination of organic acids using ion-exclusion liquid chromatography and ultraviolet detection is described. The chromatographic conditions are optimized when an Aminex HPX-87H column (300 × 7.8 mm) is employed, with a solution of 3 mmol/L sulfuric acid as eluent, a flow rate of 0.4 mL/min and a column temperature of 60°C. Eight organic acids (including orotic acid, α-ketoglutaric acid, citric acid, pyruvic acid, malic acid, succinic acid, lactic acid and acetic acid) and one nucleotide are successfully quantified. The calibration curves for these analytes are linear, with correlation coefficients exceeding 0.999. The average recovery of organic acids is in the range of 97.6% ∼ 103.1%, and the relative standard deviation is in the range of 0.037% ∼ 0.38%. The method is subsequently applied to obtain organic acid profiles of uridine 5'-monophosphate culture broth fermented from orotic acid by Saccharomyces cerevisiae. These data demonstrate the quantitative accuracy for nucleotide fermentation mixtures, and suggest that the method may also be applicable to other biological samples. PMID:22634191

  15. RNA is required for enzymatic conversion of glutamate to delta-aminolevulinate by extracts of Chlorella vulgaris.

    PubMed

    Weinstein, J D; Beale, S I

    1985-05-15

    Formation of delta-aminolevulinic acid (ALA) from glutamete catalyzed by a soluble extract from the unicellular green alga, Chlorella vulgaris, was abolished after incubation of the cell extract with bovine pancreatic ribonuclease A (RNase). Cell extract was prepared for the ALA formation assay by high-speed centrifugation and gel-filtration through Sephadex G-25 to remove insoluble and endogenous low-molecular-weight components. RNA hydrolysis products did not affect ALA formation, and RNase did not affect the ability of ATP and NADPH to serve as reaction substrates, indicating that the effect of RNase cannot be attributed to degradation of reaction substrates or transformation of a substrate or cofactor into an inhibitor. The effect of RNase was blocked by prior addition of placental RNase inhibitor (RNasin) to the cell extract, but RNasin did not reverse the effect of prior incubation of the cell extract with RNase, indicating that RNase does not act by degrading a component generated during the ALA-forming reaction, but instead degrades an essential component already present in active cell extract at the time the ALA-forming reaction is initiated. After inactivation of the cell extract by incubation with RNase, followed by administration of RNasin to block further RNase action, ALA-forming activity could be restored to a higher level than originally present by addition of a C. vulgaris tRNA-containing fraction isolated from an active ALA-forming preparation by phenol extraction and DEAE-cellulose chromatography. Baker's yeast tRNA, wheat germ tRNA, Escherichia coli tRNA, and E. coli tRNAglu type II were unable to reconstitute ALA-forming activity in RNase-treated cell extract, even though the cell extract was capable of catalyzing the charging of some of these RNAs with glutamate.

  16. Comparative spectroscopic, calorimetric, and computational studies of nucleic acid complexes with 2',5"-versus 3',5"-phosphodiester linkages.

    PubMed Central

    Jin, R; Chapman, W H; Srinivasan, A R; Olson, W K; Breslow, R; Breslauer, K J

    1993-01-01

    We have used a combination of spectroscopic, calorimetric, and computational techniques to characterize the properties of nucleic acid complexes with 2',5''- and 3',5''-phosphodiester linkages. Specifically, we have compared the properties of complexes formed by the association of 3',5'' single-stranded 16-mers of adenylic acid (A16) and thymidylic acid (T16) with the complexes formed by the corresponding single-stranded 16-mers with 2',5''-phosphodiester linkages (A*16 and T*16). Our results reveal the following differential features: (i) the 3',5'' strands form either a duplex or a triplex, depending on the sodium ion concentration, whereas the 2',5'' strands form either a triplex or no complex at all; (ii) the 2',5'' and 3',5'' triplexes exhibit significantly different CD spectra, suggesting that the two triplex states are conformationally nonequivalent; (iii) the 2',5'' triplex has a lower charge density than the 3',5'' triplex; (iv) the thermal stability of the 3',5'' triplex, as expected, is concentration dependent, whereas the thermal stability of the 2',5'' triplex is concentration independent; (v) relative to their component single strands, the 2',5'' triplex is thermodynamically much less stable than the 3',5'' triplex, despite being thermally more stable; (vi) the reduced thermodynamic stability of the 2',5'' triplex relative to the 3',5'' triplex is overwhelmingly enthalpic in origin. In the aggregate, our results reveal and characterize significant differences in the properties of complexes formed by the association of strands with identical base sequences but different phosphodiester linkages. We describe a structural model that is consistent with many of the differential properties observed. We also speculate on how these differential properties may have provided an evolutionary advantage for 3',5'' linkages and how the properties of 2',5'' complexes might be exploited in antisense strategies. Images Fig. 3 PMID:8248146

  17. Characterization of 2,4-dichlorophenoxyacetic acid and 2,4,5-trichlorophenoxyacetic acid-degrading fungi in Vietnamese soils.

    PubMed

    Itoh, Kazuhito; Kinoshita, Masahiro; Morishita, Shigeyuki; Chida, Masateru; Suyama, Kousuke

    2013-04-01

    Sixty-nine fungal strains were isolated countrywide from 10 Vietnamese soils, in areas both with and without a history of exposure to Agent Orange, and their degrading activities on the phenoxy acid herbicides 2,4-dichlorophenoxyacetic acid (2,4-D) and 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), as well as related compounds, were examined. Among taxonomically various fungi, 45, 12 and 4% of the isolates degraded phenoxyacetic acid (PA), 2,4-D and 2,4,5-T, respectively. While the PA-degrading fungi were distributed to all sites and among many genera, the 2,4-D-degraders were found only in order Eurotiales in class Eurotiomycetes. All of the 2,4,5-T-degrading fungal strains were phylogenetically close to Eupenicillium spp. and were isolated from southern Vietnam. As a degradation intermediate, the corresponding phenol compounds were detected in some strains. The degradation substrate spectrum for 26 compounds of Eupenicillium spp. strains including 2,4,5-T-degraders and -non-degraders seemed to be related to phylogenetic similarity and soil sampling location of the isolates. These results suggest that the heavily contaminated environments enhanced the adaptation of the phylogenetic group of Eupenicillium spp. toward to obtain the ability to degrade 2,4,5-T. PMID:23167922

  18. Characterization of 2,4-dichlorophenoxyacetic acid and 2,4,5-trichlorophenoxyacetic acid-degrading fungi in Vietnamese soils.

    PubMed

    Itoh, Kazuhito; Kinoshita, Masahiro; Morishita, Shigeyuki; Chida, Masateru; Suyama, Kousuke

    2013-04-01

    Sixty-nine fungal strains were isolated countrywide from 10 Vietnamese soils, in areas both with and without a history of exposure to Agent Orange, and their degrading activities on the phenoxy acid herbicides 2,4-dichlorophenoxyacetic acid (2,4-D) and 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), as well as related compounds, were examined. Among taxonomically various fungi, 45, 12 and 4% of the isolates degraded phenoxyacetic acid (PA), 2,4-D and 2,4,5-T, respectively. While the PA-degrading fungi were distributed to all sites and among many genera, the 2,4-D-degraders were found only in order Eurotiales in class Eurotiomycetes. All of the 2,4,5-T-degrading fungal strains were phylogenetically close to Eupenicillium spp. and were isolated from southern Vietnam. As a degradation intermediate, the corresponding phenol compounds were detected in some strains. The degradation substrate spectrum for 26 compounds of Eupenicillium spp. strains including 2,4,5-T-degraders and -non-degraders seemed to be related to phylogenetic similarity and soil sampling location of the isolates. These results suggest that the heavily contaminated environments enhanced the adaptation of the phylogenetic group of Eupenicillium spp. toward to obtain the ability to degrade 2,4,5-T.

  19. 40 CFR 721.5262 - 2,7-Naphthalenedisulfonic acid, 5-[[4-chloro-6-[substituted] amino]-1,3,5-triazin-2-yl]amino]-4...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...,7-Naphthalenedisulfonic acid, 5- amino]-1,3,5-triazin-2-yl]amino]-4-hydroxy-3- -, trisodium salt... identified generically as 2,7-Naphthalenedisulfonic acid, 5- amino]-1,3,5-triazin-2-yl]amino]-4-hydroxy-3... 40 Protection of Environment 30 2010-07-01 2010-07-01 false 2,7-Naphthalenedisulfonic acid,...

  20. 40 CFR 721.5262 - 2,7-Naphthalenedisulfonic acid, 5-[[4-chloro-6-[substituted] amino]-1,3,5-triazin-2-yl]amino]-4...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...,7-Naphthalenedisulfonic acid, 5- amino]-1,3,5-triazin-2-yl]amino]-4-hydroxy-3- -, trisodium salt... identified generically as 2,7-Naphthalenedisulfonic acid, 5- amino]-1,3,5-triazin-2-yl]amino]-4-hydroxy-3... 40 Protection of Environment 32 2012-07-01 2012-07-01 false 2,7-Naphthalenedisulfonic acid,...

  1. 40 CFR 721.5262 - 2,7-Naphthalenedisulfonic acid, 5-[[4-chloro-6-[substituted] amino]-1,3,5-triazin-2-yl]amino]-4...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...,7-Naphthalenedisulfonic acid, 5- amino]-1,3,5-triazin-2-yl]amino]-4-hydroxy-3- -, trisodium salt... identified generically as 2,7-Naphthalenedisulfonic acid, 5- amino]-1,3,5-triazin-2-yl]amino]-4-hydroxy-3... 40 Protection of Environment 31 2011-07-01 2011-07-01 false 2,7-Naphthalenedisulfonic acid,...

  2. 40 CFR 721.5262 - 2,7-Naphthalenedisulfonic acid, 5-[[4-chloro-6-[substituted] amino]-1,3,5-triazin-2-yl]amino]-4...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...,7-Naphthalenedisulfonic acid, 5- amino]-1,3,5-triazin-2-yl]amino]-4-hydroxy-3- -, trisodium salt... identified generically as 2,7-Naphthalenedisulfonic acid, 5- amino]-1,3,5-triazin-2-yl]amino]-4-hydroxy-3... 40 Protection of Environment 32 2013-07-01 2013-07-01 false 2,7-Naphthalenedisulfonic acid,...

  3. Identification of Delta5-fatty acid desaturase from the cellular slime mold dictyostelium discoideum.

    PubMed

    Saito, T; Ochiai, H

    1999-10-01

    cDNA fragments putatively encoding amino acid sequences characteristic of the fatty acid desaturase were obtained using expressed sequence tag (EST) information of the Dictyostelium cDNA project. Using this sequence, we have determined the cDNA sequence and genomic sequence of a desaturase. The cloned cDNA is 1489 nucleotides long and the deduced amino acid sequence comprised 464 amino acid residues containing an N-terminal cytochrome b5 domain. The whole sequence was 38.6% identical to the initially identified Delta5-desaturase of Mortierella alpina. We have confirmed its function as Delta5-desaturase by over expression mutation in D. discoideum and also the gain of function mutation in the yeast Saccharomyces cerevisiae. Analysis of the lipids from transformed D. discoideum and yeast demonstrated the accumulation of Delta5-desaturated products. This is the first report concering fatty acid desaturase in cellular slime molds.

  4. Identification of Delta5-fatty acid desaturase from the cellular slime mold dictyostelium discoideum.

    PubMed

    Saito, T; Ochiai, H

    1999-10-01

    cDNA fragments putatively encoding amino acid sequences characteristic of the fatty acid desaturase were obtained using expressed sequence tag (EST) information of the Dictyostelium cDNA project. Using this sequence, we have determined the cDNA sequence and genomic sequence of a desaturase. The cloned cDNA is 1489 nucleotides long and the deduced amino acid sequence comprised 464 amino acid residues containing an N-terminal cytochrome b5 domain. The whole sequence was 38.6% identical to the initially identified Delta5-desaturase of Mortierella alpina. We have confirmed its function as Delta5-desaturase by over expression mutation in D. discoideum and also the gain of function mutation in the yeast Saccharomyces cerevisiae. Analysis of the lipids from transformed D. discoideum and yeast demonstrated the accumulation of Delta5-desaturated products. This is the first report concering fatty acid desaturase in cellular slime molds. PMID:10504413

  5. Latest results of 5-ALA-based fluorescence diagnosis and other medical disciplines

    NASA Astrophysics Data System (ADS)

    Baumgartner, Reinhold

    1999-02-01

    Preclinical and clinical studies on 5-aminolevulinic acid (5- ALA) induced Protoporphyrin IX (PPIX) are performed in various departments now following promising clinical results for the detection of bladder cancer in urology. This paper provides an overview on the progress of 5-ALA assisted fluorescence diagnosis in urology, pulmonology, neurosurgery, gynecology and ENT coordinated by the Laser Research Laboratory of the Ludwig-Maximilians-University in Munich. 5-ALA can be applied either topically or systematically to induce an intracellular accumulation of fluorescing PPIX. With appropriate dosage of 5-ALA, malignant tissue can be stained selectively, and irradiation with violet light excites a bright red fluorescence of the tumor visible with naked eyes. Optical properties of the tissue tend to hamper the precise identification and demarcation of suspect areas in fluorescence images. Multicolor remission and fluorescence imaging, therefore, should improve tumor localization in future.

  6. Bile acid receptor TGR5, NADPH Oxidase NOX5-S and CREB Mediate Bile Acid-Induced DNA Damage In Barrett’s Esophageal Adenocarcinoma Cells

    PubMed Central

    Li, Dan; Cao, Weibiao

    2016-01-01

    The mechanisms whereby bile acid reflux may accelerate the progression from Barrett’s esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. In this study we found that bile acid taurodeoxycholic acid (TDCA) significantly increased the tail moment (TM) and histone H2AX phosphorylation in FLO-1 EA cells, an increase which was significantly decreased by knockdown of TGR5. Overexpression of TGR5 significantly increased TDCA-induced TM increase and H2AX phosphorylation. In addition, NADPH oxidase inhibitor diphenylene iodonium significantly inhibited the TDCA-induced increase in TM and H2AX phosphorylation. TDCA-induced increase in TM and H2AX phosphorylation was significantly decreased by knockdown of NOX5-S and overexpression of NOX5-S significantly increased TDCA-induced increase in the tail moment and H2AX phosphorylation. Furthermore, TDCA significantly increased cAMP response element binding protein (CREB) phosphorylation in FLO-1 cells. Knockdown of CREB significantly decreased TDCA-induced increase in NOX5-S mRNA and the tail moment. Conversely, overexpression of CREB significantly increased TDCA-induced TM increase. We conclude that TDCA-induced DNA damage may depend on the activation of TGR5, CREB and NOX5-S. It is possible that in Barrett’s patients bile acids may activate NOX5-S and increase reactive oxygen species (ROS) production via activation of TGR5 and CREB. NOX5-S-derived ROS may cause DNA damage, thereby contributing to the progression from BE to EA. PMID:27511066

  7. Bile acid receptor TGR5, NADPH Oxidase NOX5-S and CREB Mediate Bile Acid-Induced DNA Damage In Barrett's Esophageal Adenocarcinoma Cells.

    PubMed

    Li, Dan; Cao, Weibiao

    2016-01-01

    The mechanisms whereby bile acid reflux may accelerate the progression from Barrett's esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. In this study we found that bile acid taurodeoxycholic acid (TDCA) significantly increased the tail moment (TM) and histone H2AX phosphorylation in FLO-1 EA cells, an increase which was significantly decreased by knockdown of TGR5. Overexpression of TGR5 significantly increased TDCA-induced TM increase and H2AX phosphorylation. In addition, NADPH oxidase inhibitor diphenylene iodonium significantly inhibited the TDCA-induced increase in TM and H2AX phosphorylation. TDCA-induced increase in TM and H2AX phosphorylation was significantly decreased by knockdown of NOX5-S and overexpression of NOX5-S significantly increased TDCA-induced increase in the tail moment and H2AX phosphorylation. Furthermore, TDCA significantly increased cAMP response element binding protein (CREB) phosphorylation in FLO-1 cells. Knockdown of CREB significantly decreased TDCA-induced increase in NOX5-S mRNA and the tail moment. Conversely, overexpression of CREB significantly increased TDCA-induced TM increase. We conclude that TDCA-induced DNA damage may depend on the activation of TGR5, CREB and NOX5-S. It is possible that in Barrett's patients bile acids may activate NOX5-S and increase reactive oxygen species (ROS) production via activation of TGR5 and CREB. NOX5-S-derived ROS may cause DNA damage, thereby contributing to the progression from BE to EA. PMID:27511066

  8. Regulation of indole-3-acetic acid biosynthesis by branched-chain amino acids in Enterobacter cloacae UW5.

    PubMed

    Parsons, Cassandra V; Harris, Danielle M M; Patten, Cheryl L

    2015-09-01

    The soil bacterium Enterobacter cloacae UW5 produces the rhizosphere signaling molecule indole-3-acetic acid (IAA) via the indolepyruvate pathway. Expression of indolepyruvate decarboxylase, a key pathway enzyme encoded by ipdC, is upregulated by the transcription factor TyrR in response to aromatic amino acids. Some members of the TyrR regulon may also be controlled by branched-chain amino acids and here we show that expression from the ipdC promoter and production of IAA are downregulated by valine, leucine and isoleucine. Regulation of the IAA synthesis pathway by both aromatic and branched-chain amino acids suggests a broader role for this pathway in bacterial physiology, beyond plant interactions.

  9. trans fatty acids. 5. Fatty acid composition of lipids of the brain and other organs in suckling piglets.

    PubMed

    Pettersen, J; Opstvedt, J

    1992-10-01

    The effects of dietary trans fatty acids on the fatty acid composition of the brain in comparison with other organs were studied in 3-wk-old suckling piglets. In Experiment (Expt.) 1 the piglets were delivered from sows fed partially hydrogenated fish oil (PHFO) (28% trans), partially hydrogenated soybean oil (PHSBO) (36% trans) or lard (0% trans). In Expt. 2 the piglets were delivered from sows fed PHFO, hydrogenated fish oil (HFO) (19% trans) or coconut fat (CF) (0% trans) with two levels of dietary linoleic acid (1 and 2.7%) according to factorial design. In both experiments the mother's milk was the piglets' only food. The level of incorporation of trans fatty acids in the organs was dependent on the levels in the diets and independent of fat source (i.e., PHSBO, PHFO or HFO). Incorporation of trans fatty acids into brain PE (phosphatidylethanolamine) was non-detectable in Expt. 1. In Expt. 2, small amounts (less than 0.5%) of 18:1 trans isomers were found in the brain, the level being slightly more on the lower level of dietary linoleic acid compared to the higher. In the other organs the percentage of 18:1 trans increased in the following order: heart PE, liver mitochondria PE, plasma lipids and subcutaneous adipose tissue. Small amounts of 20:1 trans were found in adipose tissue and plasma lipids. Other very long-chain fatty acids from PHFO or HFO (i.e., 20:1 cis and 22:1 cis + trans) were found in all organ lipids except for brain PE. Dietary trans fatty acids increased the percentage of 22:5n-6 in brain PE.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1435095

  10. An enhanced procedure for measuring organic acids and methyl esters in PM2.5

    NASA Astrophysics Data System (ADS)

    Liu, F.; Duan, F. K.; He, K. B.; Ma, Y. L.; Rahn, K. A.; Zhang, Q.

    2015-11-01

    A solid-phase extraction (SPE) pretreatment procedure allowing organic acids to be separated from methyl esters in fine aerosol has been developed. The procedure first separates the organic acids from fatty acid methyl esters (FAMEs) and other nonacid organic compounds by aminopropyl-based SPE cartridge and then quantifies them by gas chromatography/mass spectrometry. The procedure prevents the fatty acids and dimethyl phthalate from being overestimated, and so allows us to accurately quantify the C4-C11 dicarboxylic acids (DCAs) and the C8-C30 monocarboxylic acids (MCAs). Results for the extraction of DCAs, MCAs, and AMAs in eluate and FAMEs in effluate by SAX and NH2 SPE cartridges exhibited that the NH2 SPE cartridge gave higher extraction efficiency than the SAX cartridge. The recoveries of analytes ranged from 67.5 to 111.3 %, and the RSD ranged from 0.7 to 10.9 %. The resulting correlations between the aliphatic acids and FAMEs suggest that the FAMEs had sources similar to those of the carboxylic acids, or were formed by esterifying carboxylic acids, or that aliphatic acids were formed by hydrolyzing FAMEs. Through extraction and cleanup using this procedure, 17 aromatic acids in eluate were identified and quantified by gas chromatography/tandem mass spectrometry, including five polycyclic aromatic hydrocarbon (PAH): acids 2-naphthoic, biphenyl-4-carboxylic, 9-oxo-9H-fluorene-1-carboxylic, biphenyl-4,4´-dicarboxylic, and phenanthrene-1-carboxylic acid, plus 1,8-naphthalic anhydride. Correlations between the PAH acids and the dicarboxylic and aromatic acids suggested that the first three acids and 1,8-naphthalic anhydride were secondary atmospheric photochemistry products and the last two mainly primary.

  11. Amino acid limitation induces down-regulation of WNT5a at transcriptional level

    SciTech Connect

    Wang Zuguang; Chen Hong

    2009-01-23

    An aberrant WNT signaling contributes to the development and progression of multiple cancers. WNT5a is one of the WNT signaling molecules. This study was designed to test the hypothesis that amino acid deprivation induces changes in the WNT signaling pathway in colon cancer cells. Results showed that targets of the amino acid response pathway, ATF3 and p21, were induced in the human colon cancer cell line SW480 during amino acid limitation. There was a significant decrease in the WNT5a mRNA level following amino acid deprivation. The down-regulation of WNT5a mRNA by amino acid deprivation is not due to mRNA destabilization. There is a reduction of nuclear {beta}-catenin protein level by amino acid limitation. Under amino acid limitation, phosphorylation of ERK1/2 was increased and the blockage of ERK1/2 by the inhibitor U0126 partially restored WNT5a mRNA level. In conclusion, amino acid limitation in colon cancer cells induces phosphorylation of ERK1/2, which then down-regulates WNT5a expression.

  12. 5,7-Diamino-5,7,9-trideoxynon-2-ulosonic acid: a novel sugar from a phytopathogenic Pseudomonas lipopolysaccharide.

    PubMed

    Corsaro, Maria Michela; Evidente, Antonio; Lanzetta, Rosa; Lavermicocca, Paola; Parrilli, Michelangelo; Ummarino, Salvatore

    2002-05-13

    Preliminary results on the structure of a novel sugar from a lipopolysaccharide from Pseudomonas corrugata, a plant pathogenic bacterium whose several aspects of phytopathogenic mechanism are under investigation, are described. This is a 5,7-diamino-5,7,9-trideoxynon-2-ulosonic acid, isolated as an O-glycoside from the Smith degradation of the O-chain. The structure was obtained both with NMR and MS methodologies. To the best of our knowledge, this is the first example of 3-hydroxylated non-2-ulosonic acid.

  13. Polymerase-directed synthesis of C5-ethynyl locked nucleic acids.

    PubMed

    Veedu, Rakesh N; Burri, Harsha V; Kumar, Pawan; Sharma, Pawan K; Hrdlicka, Patrick J; Vester, Birte; Wengel, Jesper

    2010-11-15

    Modified nucleic acids have considerable potential in nanobiotechnology for the development of nanomedicines and new materials. Locked nucleic acid (LNA) is one of the most prominent nucleic acid analogues reported so far and we herein for the first time report the enzymatic incorporation of LNA-U and C5-ethynyl LNA-U nucleotides into oligonucleotides. Phusion High Fidelity and KOD DNA polymerases efficiently incorporated LNA-U and C5-ethynyl LNA-U nucleotides into a DNA strand and T7 RNA polymerase successfully accepted the LNA-U nucleoside 5'-triphosphate as substrate for RNA transcripts. PMID:20932755

  14. NMR analysis and tacticity determination of poly(lactic acid) in C5D5N

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In this work tacticity assignments of poly(lactic acid), (PLA), are reported for the NMR peaks from CH carbon and CH3 proton at the tetrad level in deuterated pyridine. The methyl protons are better resolved in pyridine due to solvent effects such as ring current shielding of the aromatic ring and ...

  15. Effect of 5-aminosalicylic acid (5-ASA) and other salicylates on short-chain fat metabolism in the colonic mucosa. Pharmacological implications for ulcerative colitis.

    PubMed

    Roediger, W; Schapel, G; Lawson, M; Radcliffe, B; Nance, S

    1986-01-15

    5-Aminosalicylic acid (5-ASA) suppressed nitrite-stimulated oxidation of the fatty acid n-butyrate in a dose-dependent manner in isolated human and rat colonic epithelial cells. 4-ASA had one-sixth of the capacity of 5-ASA and sulphapyridine (SP) little of the capacity of 5-ASA to suppress fatty acid oxidation in human colonic epithelial cells. Sulphasalazine (SASP), azodisalicylic acid (ADS), acetyl-5-ASA and acetyl salicylic acid (ASA) did not suppress fatty acid oxidation in rat colonocytes. The suppression index of fatty acid oxidation (SIFO) of respective salicylic acids correlated with the reported clinical effectiveness of each drug against ulcerative colitis (UC). The capacity of 5-ASA to affect nitrite-stimulated oxidation of fat in the colonic mucosa suggests that nitrite ions and control of fatty acid oxidation play a central role in the development and therapy of active UC. PMID:2867767

  16. Thermal stability of 5-o-caffeoylquinic acid in aqueous solutions at different heating conditions.

    PubMed

    Dawidowicz, Andrzej L; Typek, Rafal

    2010-12-22

    Chlorogenic acid is a naturally occurring phenolic compound found in all higher plants. This component, being the ester of caffeic acid with quinic acid, is an important biosynthetic intermediate and plays an important role in the plant's response to stress. Potential uses of chlorogenic acid are suggested in pharmaceuticals, foodstuffs, feed additives, and cosmetics due to its recently discovered biomedical activity. This finding caused new interest in chlorogenic acid properties, its isomers, and its natural occurrence. It has been found that as many as nine compounds (chlorogenic acid derivatives and its reaction product with water) can be formed from 5-o-caffeoylquinic acid during the heating of its water solution. Three of them, two hydroxylated 5-o-caffeoylquinic acid derivatives and 4,5-dicaffeoylquinic acid, have been not reported, yet. The amount of each formed component depends on the heating time and temperature. The presented results are important for researchers investigating plant metabolism and looking for new plant components. The transformation product can be mistakenly treated as a new component, not found before in the examined plant, or can be a cause of erroneous quantitative estimations of plant composition.

  17. Tailoring acidity of HZSM-5 nanoparticles for methyl bromide dehydrobromination by Al and Mg incorporation

    PubMed Central

    2014-01-01

    Three kinds of HZSM-5 nanoparticles with different acidity were tailored by impregnating MgO or varying Si/Al ratios. Both the textural and acidic properties of the as-prepared nanoparticles were characterized by nitrogen adsorption-desorption measurements, X-ray diffraction (XRD), scanning electron microscopy (SEM), ammonia temperature-programmed desorption (NH3-TPD) and Fourier transform infrared spectroscopy (FTIR or Py-FTIR). It was found that the intensity of Lewis acid sites with weak strength was enhanced by impregnating MgO or reducing Al concentration, and such an enhancement could be explained by the formation of Mg(OH)+ or charge unbalance of the MgO framework on the surface of HZSM-5 support. The effect of HZSM-5 nanoparticles' acidity on methyl bromide dehydrobromination as catalyst was evaluated. As the results, MgHZ-360 catalyst with the highest concentration of Lewis acid sites showed excellent stability, which maintained methyl bromide conversion of up 97% in a period of 400 h on stream. Coke characterization by BET measurements and TGA/DTA and GC/MS analysis revealed that polymethylated naphthalenes species were formed outside the channels of the catalyst with higher acid intensity and higher Brønsted acid concentration during the initial period of reaction, while graphitic carbon formed in the channels of catalyst with lower acid intensity and higher Lewis acid concentration during the stable stage. PMID:25328502

  18. Isocholic acid formation from 7 alpha,12 alpha-dihydroxy-3-keto-5 beta-cholanoic acid with human liver enzyme.

    PubMed

    Amuro, Y; Yamade, W; Yamamoto, T; Kudo, K; Fujikura, M; Maebo, A; Hada, T; Higashino, K

    1986-12-01

    The formation of isocholic acid from 7 alpha, 12 alpha-dihydroxy-3-keto-5 beta-cholanoic acid by human liver preparations was examined in vitro. Liver preparations were incubated with 7 alpha, 12 alpha-dihydroxy-3-keto-5 beta-cholanoic acid at pH 7.4 in a phosphate buffer containing NADPH or NADH. The products formed were analyzed by gas chromatography and gas chromatography/mass spectrometry. Results showed that 7 alpha,12 alpha-dihydroxy-3-keto-5 beta-cholanoic acid was reduced mainly to isocholic acid and to cholic acid in a smaller amount in the presence of NADPH, while it was reduced only to cholic acid in the presence of NADH. The reducing enzyme participating in the formation of isocholic acid was localized largely in the cytosol and had more specificity to the unconjugated form as substrate than to the conjugated forms. 3-Keto bile acid analogues, 3-keto-5 beta-cholanoic and 7 alpha-hydroxy-3-keto-5 beta-cholanoic acids were not reduced to the corresponding iso-bile acids by the cytosol in the same conditions used in the isocholic acid formation and the activity of the enzyme catalyzing the reduction of 7 alpha,12 alpha-dihydroxy-3-keto-5 beta-cholanoic acid to isocholic acid was not inhibited by the addition of 3-keto-5 beta-cholanoic acid or 7 alpha-hydroxy-3-keto-5 beta-cholanoic acid to the reaction mixture. Furthermore, on column chromatography of Affi-Gel Blue, the peak of the enzyme catalyzing the reduction of 7 alpha,12 alpha-dihydroxy-3-keto-5 beta-cholanoic acid to isocholic acid was clearly distinguished from that of the enzyme catalyzing the reduction of 3-keto-5 beta-cholanoic acid to isolithocholic acid and that of alcohol dehydrogenase. These results indicate that this enzyme catalyzing the reduction of 7 alpha,12 alpha-dihydroxy-3-keto-5 beta-cholanoic acid to isocholic acid is different from the enzyme(s) catalyzing the reduction 3-keto-5 beta-cholanoic and 7 alpha-hydroxy-3-keto-5 beta-cholanoic acids to the corresponding iso-bile acids

  19. Discovery of a novel activator of 5-lipoxygenase from an anacardic acid derived compound collection

    PubMed Central

    Wisastra, Rosalina; Kok, Petra A.M; Eleftheriadis, Nikolaos; Baumgartner, Matthew P.; Camacho, Carlos J.; Haisma, Hidde J.; Dekker, Frank J.

    2013-01-01

    Lipoxygenases (LOXs) and cyclooxygenases (COXs) metabolize poly-unsaturated fatty acids into inflammatory signaling molecules. Modulation of the activity of these enzymes may provide new approaches for therapy of inflammatory diseases. In this study, we screened novel anacardic acid derivatives as modulators of human 5-LOX and COX-2 activity. Interestingly, a novel salicylate derivative 23a was identified as a surprisingly potent activator of human 5-LOX. This compound showed both non-competitive activation towards the human 5-LOX activator adenosine triphosphate (ATP) and non-essential mixed type activation against the substrate linoleic acid, while having no effect on the conversion of the substrate arachidonic acid. The kinetic analysis demonstrated a non-essential activation of the linoleic acid conversion with a KA of 8.65 μM, αKA of 0.38 μM and a β value of 1.76. It is also of interest that a comparable derivative 23d showed a mixed type inhibition for linoleic acid conversion. These observations indicate the presence of an allosteric binding site in human 5-LOX distinct from the ATP binding site. The activatory and inhibitory behavior of 23a and 23d on the conversion of linoleic compared to arachidonic acid are rationalized by docking studies, which suggest that the activator 23a stabilizes linoleic acid, whereas the larger inhibitor 23d blocks the enzyme active site. PMID:24231650

  20. Bis-sulfonic acid ionic liquids for the conversion of fructose to 5-hydroxymethyl-2-furfural.

    PubMed

    Sim, Sang Eun; Kwon, Sunjeong; Koo, Sangho

    2012-10-31

    Homogenous bis-sulfonic acid ionic liquids (1 mol equiv.) in DMSO (10 mol equiv.) at 100 °C efficiently mediated the conversion of D-fructose into 5-hydroxymethyl-2-furfural in 75% isolated yield, which was roughly a 10% increment compared to the case of the mono-sulfonic acid ionic liquids.

  1. The epithelial differentiating activity in vivo of (E)-4-[2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthylenyl) -1-propenyl]benzoic acid and 4,4-difluororetinoic acid.

    PubMed Central

    Miller, D A; Stephens-Jarnagin, A; DeLuca, H F

    1985-01-01

    Female rats fed on a vitamin A-deficient diet from weaning were oophorectomized after introitus and used to test analogues of all-trans-retinoic acid for epithelial differentiation activity by the vaginal-smear assay. Several modifications have been made in the assay; housing facilities were modified, the diet changed and the existing scoring system for the assay altered. The arotinoid (E)-4-[2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthylenyl)-1 -propenyl] benzoic acid was 12-fold more active than all-trans-retinoic acid, which had a 50% effective dose (ED50) of 80 pmol/vagina. The fluorinated analogue 4,4-difluororetinoic acid had an ED50 of 2.5 nmol/vagina and was therefore 30-fold less active than all-trans-retinoic acid. PMID:3994687

  2. 40 CFR 721.5262 - 2,7-Naphthalenedisulfonic acid, 5-[[4-chloro-6-[substituted] amino]-1,3,5-triazin-2-yl]amino]-4...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...,7-Naphthalenedisulfonic acid, 5- amino]-1,3,5-triazin-2-yl]amino]-4-hydroxy-3- -, trisodium salt...-Naphthalenedisulfonic acid, 5- amino]-1,3,5-triazin-2-yl]amino]-4-hydroxy-3- -, trisodium salt (PMN P-00-0803) is...-naphthalenedisulfonic acid, 5- ethyl]amino]-1,3,5-triazin-2-yl]amino]-4-hydroxy-3- -, sodium salt (1:3) (PMN......

  3. 2-(2-Chloro-phen-yl)-5-methyl-1,3-dioxane-5-carboxylic acid.

    PubMed

    Jia, Guo-Kai; Yuan, Lin; Zhang, Min; Yuan, Xian-You

    2012-07-01

    In the title compound, C(12)H(13)ClO(4), the 1,3-dioxane ring adopts a chair conformation and the 2-chloro-benzene and methyl substituents occupy equatorial sites. The carboxyl group is in an axial inclination. In the crystal, carb-oxy-lic acid inversion dimers linked by pairs of O-H⋯O hydrogen bonds generate R(2) (2)(8) loops. PMID:22807863

  4. Catalytic conversion of carbohydrates to 5-hydroxymethylfurfural from the waste liquid of acid hydrolysis NCC.

    PubMed

    Sun, Yonghui; Liu, Pengtao; Liu, Zhong

    2016-05-20

    The principal goal of this work was to reuse the carbohydrates and recycle sulfuric acid in the waste liquid of acid hydrolysis nanocrystalline cellulose (NCC). Therefore, in this work, the optimizations of further hydrolysis of waste liquid of acid hydrolysis NCC and catalytic conversion of L4 to 5-hydroxymethylfurfural (5-HMF) were studied. Sulfuric acid was separated by spiral wound diffusion dialysis (SWDD). The results revealed that cellulose can be hydrolyze to glucose absolutely under the condition of temperature 35 °C, 3 h, and sulfuric acid's concentration 62 wt%. And 78.3% sulfuric acid was recovered by SWDD. The yield of 5-HMF was highest in aqueous solution under the optimal condition was as follows, temperature 160 °C, 3 h, and sulfuric acid's concentration 12 wt%. Then the effect of biphasic solvent systems catalytic conversion and inorganic salt as additives were still examined. The results showed that both of them contributed to prepare 5-HMF. The yield and selectivity of 5-HMF was up to 21.0% and 31.4%, respectively.

  5. Poly[(μ-3,5-dinitro-benzoato)(μ-3,5-dinitro-benzoic acid)rubidium].

    PubMed

    Miao, Yanqing; Fan, Tao

    2011-08-01

    The asymmetric unit of the title compound, [Rb(C(7)H(3)N(2)O(6))(C(7)H(4)N(2)O(6))](n), comprises an Rb(+) cation, a 3,5-dinitro-benzoate anion and a 3,5-dinitro-benzoic acid ligand. The Rb(+) cation is nine-coordinated by O atoms from four 3,5-dinitro-benzoate anions and three neutral 3,5-dinitro-benzoic acid ligands. The metal atom is firstly linked by four bridging carboxyl groups, forming a binuclear motif, which is further linked by the nitro groups into a two-dimensional framework along the [110] direction. A short O-H⋯O hydrogen bond between two adjacent carboxy/carboxylate groups occurs. PMID:22090832

  6. Biosynthesis of resorcylic acid lactone (5S)-5-hydroxylasiodiplodin in Lasiodiplodia theobromae.

    PubMed

    Kashima, Takasumi; Takahashi, Kosaku; Matsuura, Hideyuki; Nabeta, Kensuke

    2009-11-01

    An administration study of (2)H-labeled precursors showed that the 9-hydroxydecanoyl unit, the acyl intermediate of lasiodiplodin (1), was also the intermediate of (5S)-5-hydroxylasiodiplodin (2) in Lasiodiplodia theobromae. The incorporation of [O-methyl-(2)H(3)]-lasiodiplodin (6) into 2 indicated that hydroxylation at C-5 occurred after cyclization. PMID:19897901

  7. A second functional delta5 fatty acid desaturase in the cellular slime mould Dictyostelium discoideum.

    PubMed

    Saito, T; Morio, T; Ochiai, H

    2000-03-01

    A cDNA with homology to fatty acid desaturases was selected by searching the cDNA data bank of Dictyostelium discoideum (http://www. csm.biol.tsukuba.ac.jp/cDNAproject.html) with conserved histidine box motifs. Using this sequence, genomic DNA encoding the Delta5 desaturase was amplified from the genomic DNA of D. discoideum, and its desaturase activity was confirmed by the overexpression mutation in D. discoideum and the gain-of-function mutation in yeast. The cloned cDNA is 1565 nucleotides in length, and the deduced amino-acid sequence comprised 467 amino-acid residues containing an N-terminal cytochrome b5 domain that shared 43% identity with cytochrome b5 of Oryza sativa. The whole sequence was 42% identical to the Delta5 desaturase of Mortierella alpina. This desaturase is a novel member of the cytochrome b5-containing Delta5 fatty acid desaturase. As we have already reported one other Delta5 desaturase in Dictyostelium, this organism is the first to be confirmed as having two functional Delta5 fatty acid desaturase genes. The substrate specificities of the two functional Delta5 desaturases of D. discoideum were also examined.

  8. Conversion of red-algae Gracilaria verrucosa to sugars, levulinic acid and 5-hydroxymethylfurfural.

    PubMed

    Jeong, Gwi-Taek; Ra, Chae Hun; Hong, Yong-Ki; Kim, Joong Kyun; Kong, In-Soo; Kim, Sung-Koo; Park, Don-Hee

    2015-02-01

    This study employed a statistical methodology to investigate the optimization of conversion conditions and evaluate the reciprocal interaction of reaction factors related to the process of red-algae Gracilaria verrucosa conversion to sugars (glucose, galactose), levulinic acid and 5-hydroxymethylfurfural (5-HMF) by acidic hydrolysis. Overall, the conditions optimized for glucose formation included a higher catalyst concentration than did those for galactose, and these conditions for galactose were similar to those for 5-HMF. Levulinic acid production, meanwhile, was optimized at a higher reaction temperature, a higher catalyst concentration, and a longer reaction time than was glucose, galactose or 5-HMF production. By this approach, the optimal yields (and reaction conditions) for glucose, galactose, levulinic acid, and 5-HMF were as follows: glucose 5.29 g/L (8.46 wt%) (reaction temperature 160 °C, catalyst concentration 1.92%, reaction time 20 min), galactose 18.38 g/L (29.4 wt%) (160 °C, 1.03%, 20 min), levulinic acid 14.65 g/L (18.64 wt%) (180.9 °C, 2.85%, 50 min), and 5-HMF 3.74 g/L (5.98 wt%) (160.5 °C, 1%, 20 min).

  9. [Optimization of the fermentation conditions for 5-keto-D-gluconic acid production].

    PubMed

    Li, Boyi; Pan, Haifeng; Sun, Weirong; Cheng, Yongqing; Xie, Zhipeng; Zhang, Jianguo

    2014-09-01

    Gluconobacter oxydans converts glucose to gluconic acid and subsequently to 5-keto-D-gluconic acid (5-KGA), a precursor of industrially important L(+)-tartaric acid. To increase the yield of 5-KGA, fermentation conditions of 5-KGA production was optimized. Under the optimum medium and culture conditions in the shake flask, the highest 5-KGA production reached 19.7 g/L, increased by 43.8% after optimization. In a 5-L bioreactor, the pH was controlled at 5.5 and dissolved oxygen (DO) at 15%, 5-KGA production reached 46.0 g/L, raised at least 1.3 times than in the shake flask. Glucose feeding fermentation process was further developed, and the highest 5-KGA production of 75.5 g/L with 70% of yield was obtained, 32.0% higher than the highest reported value. Therefore, this newly developed fermentation process provided a practical and effective alternative for the commercial production of 5-KGA, and further of L(+)-tartaric acid.

  10. Lauric Acid Stimulates Ketone Body Production in the KT-5 Astrocyte Cell Line.

    PubMed

    Nonaka, Yudai; Takagi, Tetsuo; Inai, Makoto; Nishimura, Shuhei; Urashima, Shogo; Honda, Kazumitsu; Aoyama, Toshiaki; Terada, Shin

    2016-08-01

    Coconut oil has recently attracted considerable attention as a potential Alzheimer's disease therapy because it contains large amounts of medium-chain fatty acids (MCFAs) and its consumption is thought to stimulate hepatic ketogenesis, supplying an alternative energy source for brains with impaired glucose metabolism. In this study, we first reevaluated the responses of plasma ketone bodies to oral administration of coconut oil to rats. We found that the coconut oil-induced increase in plasma ketone body concentration was negligible and did not significantly differ from that observed after high-oleic sunflower oil administration. In contrast, the administration of coconut oil substantially increased the plasma free fatty acid concentration and lauric acid content, which is the major MCFA in coconut oil. Next, to elucidate whether lauric acid can activate ketogenesis in astrocytes with the capacity to generate ketone bodies from fatty acids, we treated the KT-5 astrocyte cell line with 50 and 100 μM lauric acid for 4 h. The lauric acid treatments increased the total ketone body concentration in the cell culture supernatant to a greater extent than oleic acid, suggesting that lauric acid can directly and potently activate ketogenesis in KT-5 astrocytes. These results suggest that coconut oil intake may improve brain health by directly activating ketogenesis in astrocytes and thereby by providing fuel to neighboring neurons.

  11. Lauric Acid Stimulates Ketone Body Production in the KT-5 Astrocyte Cell Line.

    PubMed

    Nonaka, Yudai; Takagi, Tetsuo; Inai, Makoto; Nishimura, Shuhei; Urashima, Shogo; Honda, Kazumitsu; Aoyama, Toshiaki; Terada, Shin

    2016-08-01

    Coconut oil has recently attracted considerable attention as a potential Alzheimer's disease therapy because it contains large amounts of medium-chain fatty acids (MCFAs) and its consumption is thought to stimulate hepatic ketogenesis, supplying an alternative energy source for brains with impaired glucose metabolism. In this study, we first reevaluated the responses of plasma ketone bodies to oral administration of coconut oil to rats. We found that the coconut oil-induced increase in plasma ketone body concentration was negligible and did not significantly differ from that observed after high-oleic sunflower oil administration. In contrast, the administration of coconut oil substantially increased the plasma free fatty acid concentration and lauric acid content, which is the major MCFA in coconut oil. Next, to elucidate whether lauric acid can activate ketogenesis in astrocytes with the capacity to generate ketone bodies from fatty acids, we treated the KT-5 astrocyte cell line with 50 and 100 μM lauric acid for 4 h. The lauric acid treatments increased the total ketone body concentration in the cell culture supernatant to a greater extent than oleic acid, suggesting that lauric acid can directly and potently activate ketogenesis in KT-5 astrocytes. These results suggest that coconut oil intake may improve brain health by directly activating ketogenesis in astrocytes and thereby by providing fuel to neighboring neurons. PMID:27430387

  12. 5'to 3' nucleic acid synthesis using 3'-photoremovable protecting group

    DOEpatents

    Pirrung, Michael C.; Shuey, Steven W.; Bradley, Jean-Claude

    1999-01-01

    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5' to 3' nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5' end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

  13. 5[prime] to 3[prime] nucleic acid synthesis using 3[prime]-photoremovable protecting group

    DOEpatents

    Pirrung, M.C.; Shuey, S.W.; Bradley, J.C.

    1999-06-01

    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5[prime] to 3[prime] nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5[prime] end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

  14. Folate, folic acid and 5-methyltetrahydrofolate are not the same thing.

    PubMed

    Scaglione, Francesco; Panzavolta, Giscardo

    2014-05-01

    1. Folate, an essential micronutrient, is a critical cofactor in one-carbon metabolism. Mammals cannot synthesize folate and depend on supplementation to maintain normal levels. Low folate status may be caused by low dietary intake, poor absorption of ingested folate and alteration of folate metabolism due to genetic defects or drug interactions. 2. Folate deficiency has been linked with an increased risk of neural tube defects, cardiovascular disease, cancer and cognitive dysfunction. Most countries have established recommended intakes of folate through folic acid supplements or fortified foods. External supplementation of folate may occur as folic acid, folinic acid or 5-methyltetrahydrofolate (5-MTHF). 3. Naturally occurring 5-MTHF has important advantages over synthetic folic acid - it is well absorbed even when gastrointestinal pH is altered and its bioavailability is not affected by metabolic defects. Using 5-MTHF instead of folic acid reduces the potential for masking haematological symptoms of vitamin B12 deficiency, reduces interactions with drugs that inhibit dihydrofolate reductase and overcomes metabolic defects caused by methylenetetrahydrofolate reductase polymorphism. Use of 5-MTHF also prevents the potential negative effects of unconverted folic acid in the peripheral circulation. 4. We review the evidence for the use of 5-MTHF in preventing folate deficiency.

  15. Effects of cyanobacterial extracellular products and gibberellic acid on salinity tolerance in Oryza sativa L

    PubMed Central

    Rodríguez, AA; Stella, AM; Storni, MM; Zulpa, G; Zaccaro, MC

    2006-01-01

    Salt stress is one of the most serious factors limiting the productivity of rice, the staple diet in many countries. Gibberellic acid has been reported to reduce NaCl-induced growth inhibition in some plants including rice. Most paddy soils have a natural population of Cyanobacteria, prokaryotic photosynthethic microorganisms, which synthesize and liberate plant growth regulators such as gibberellins that could exert a natural beneficial effect on salt stressed rice plants. The aim of this work was to evaluate the effect of the cyanobacterium Scytonema hofmanni extracellular products on the growth of rice seedlings inhibited by NaCl and to compare it with the effect of the gibberellic acid in the same stress condition. Growth (length and weight of the seedlings) and biochemical parameters (5-aminolevulinate dehydratase activity, total free porphyrin and pigments content) were evaluated. Salt exposure negatively affected all parameters measured, with the exception of chlorophyll. Chlrorophyll concentrations nearly doubled upon exposure to high salt. Gibberellic acid counteracted the effect of salt on the length and dry weight of the shoot, and on carotenoid and chlorophyll b contents. Extracellular products nullified the salt effect on shoot dry weight and carotenoid content; partially counteracted the effect on shoot length (from 54% to 38% decrease), root dry weight (from 59% to 41% decrease) and total free porphyrin (from 31 to 13% decrease); reduced by 35% the salt increase of chlorophyll a; had no effect on root length and chlorophyll b. Gibberellic acid and extracellular products increased 5-aminolevulinate dehydratase activity over the control without salt. When coincident with high salinity, exposure to either EP or GA3, resulted in a reversal of shoot-related responses to salt stress. We propose that Scytonema hofmanni extracellular products may counteract altered hormone homeostasis of rice seedlings under salt stress by producing gibberellin-like plant

  16. Electrophilic Fatty Acid Species Inhibit 5-Lipoxygenase and Attenuate Sepsis-Induced Pulmonary Inflammation

    PubMed Central

    Awwad, Khader; Steinbrink, Svenja D.; Frömel, Timo; Lill, Nicole; Isaak, Johann; Häfner, Ann-Kathrin; Roos, Jessica; Hofmann, Bettina; Heide, Heinrich; Geisslinger, Gerd; Steinhilber, Dieter; Freeman, Bruce A.; Maier, Thorsten J.; Fleming, Ingrid

    2014-01-01

    Abstract Aims: The reaction of nitric oxide and nitrite-derived species with polyunsaturated fatty acids yields electrophilic fatty acid nitroalkene derivatives (NO2-FA), which display anti-inflammatory properties. Given that the 5-lipoxygenase (5-LO, ALOX5) possesses critical nucleophilic amino acids, which are potentially sensitive to electrophilic modifications, we determined the consequences of NO2-FA on 5-LO activity in vitro and on 5-LO-mediated inflammation in vivo. Results: Stimulation of human polymorphonuclear leukocytes (PMNL) with nitro-oleic (NO2-OA) or nitro-linoleic acid (NO2-LA) (but not the parent lipids) resulted in the concentration-dependent and irreversible inhibition of 5-LO activity. Similar effects were observed in cell lysates and using the recombinant human protein, indicating a direct reaction with 5-LO. NO2-FAs did not affect the activity of the platelet-type 12-LO (ALOX12) or 15-LO-1 (ALOX15) in intact cells or the recombinant protein. The NO2-FA-induced inhibition of 5-LO was attributed to the alkylation of Cys418, and the exchange of Cys418 to serine rendered 5-LO insensitive to NO2-FA. In vivo, the systemic administration of NO2-OA to mice decreased neutrophil and monocyte mobilization in response to lipopolysaccharide (LPS), attenuated the formation of the 5-LO product 5-hydroxyeicosatetraenoic acid (5-HETE), and inhibited lung injury. The administration of NO2-OA to 5-LO knockout mice had no effect on LPS-induced neutrophil or monocyte mobilization as well as on lung injury. Innovation: Prophylactic administration of NO2-OA to septic mice inhibits inflammation and promotes its resolution by interfering in 5-LO-mediated inflammatory processes. Conclusion: NO2-FAs directly and irreversibly inhibit 5-LO and attenuate downstream acute inflammatory responses. Antioxid. Redox Signal. 20, 2667–2680. PMID:24206143

  17. Valerian extract and valerenic acid are partial agonists of the 5-HT5a receptor in vitro.

    PubMed

    Dietz, Birgit M; Mahady, Gail B; Pauli, Guido F; Farnsworth, Norman R

    2005-08-18

    Insomnia is the most frequently encountered sleep complaint worldwide. While many prescription drugs are used to treat insomnia, extracts of valerian (Valeriana officinalis L., Valerianaceae) are also used for the treatment of insomnia and restlessness. To determine novel mechanisms of action, radioligand binding studies were performed with valerian extracts (100% methanol, 50% methanol, dichloromethane [DCM], and petroleum ether [PE]) at the melatonin, glutamate, and GABA(A) receptors, and 8 serotonin receptor subtypes. Both DCM and PE extracts had strong binding affinity to the 5-HT(5a) receptor, but only weak binding affinity to the 5-HT(2b) and the serotonin transporter. Subsequent binding studies focused on the 5-HT(5a) receptor due to the distribution of this receptor in the suprachiasmatic nucleus of the brain, which is implicated in the sleep-wake cycle. The PE extract inhibited [(3)H]lysergic acid diethylamide (LSD) binding to the human 5-HT(5a) receptor (86% at 50 microg/ml) and the DCM extract inhibited LSD binding by 51%. Generation of an IC(50) curve for the PE extract produced a biphasic curve, thus GTP shift experiments were also performed. In the absence of GTP, the competition curve was biphasic (two affinity sites) with an IC(50) of 15.7 ng/ml for the high-affinity state and 27.7 microg/ml for the low-affinity state. The addition of GTP (100 microM) resulted in a right-hand shift of the binding curve with an IC(50) of 11.4 microg/ml. Valerenic acid, the active constituent of both extracts, had an IC(50) of 17.2 microM. These results indicate that valerian and valerenic acid are new partial agonists of the 5-HT(5a) receptor. PMID:15921820

  18. Enzymatic Synthesis of Nucleic Acids with Defined Regioisomeric 2'-5' Linkages.

    PubMed

    Cozens, Christopher; Mutschler, Hannes; Nelson, Geoffrey M; Houlihan, Gillian; Taylor, Alexander I; Holliger, Philipp

    2015-12-14

    Information-bearing nucleic acids display universal 3'-5' linkages, but regioisomeric 2'-5' linkages occur sporadically in non-enzymatic RNA synthesis and may have aided prebiotic RNA replication. Herein we report on the enzymatic synthesis of both DNA and RNA with site-specific 2'-5' linkages by an engineered polymerase using 3'-deoxy- or 3'-O-methyl-NTPs as substrates. We also report the reverse transcription of the resulting modified nucleic acids back to 3'-5' linked DNA with good fidelity. This enables a fast and simple method for "structural mutagenesis" by the position-selective incorporation of 2'-5' linkages, whereby nucleic acid structure and function may be probed through local distortion by regioisomeric linkages while maintaining the wild-type base sequence as we demonstrate for the 10-23 RNA endonuclease DNAzyme.

  19. Transformation of 5-O-caffeoylquinic acid in blueberries during high-temperature processing.

    PubMed

    Dawidowicz, Andrzej L; Typek, Rafal

    2014-11-12

    Chlorogenic acid (CQA), an ester of caffeic with quinic acid, is a natural compound found in a wide array of plants. Although coffee beans are most frequently mentioned as plant products remarkably rich in CQAs, their significant amounts can also be found in many berries, for example, blueberries. This paper shows and discusses the thermal stability of the main CQA representative, that is, 5-O-caffeoylquinic acid (5-CQA), during high-temperature processing of blueberries (as in the production of blueberry foods) in systems containing sucrose in low and high concentration. It has been found that up to 11 components (5-CQA derivatives and its reaction product with water) can be formed from 5-CQA during the processing of blueberries. Their formation speed depends on the sucrose concentration in the processed system, which has been confirmed in the artificial system composed of 5-CQA water solution containing different amounts of the sugar.

  20. Selective activity of 5-fluoroorotic acid against Plasmodium falciparum in vitro.

    PubMed Central

    Rathod, P K; Khatri, A; Hubbert, T; Milhous, W K

    1989-01-01

    Unlike mammalian cells, malarial parasites are completely dependent on de novo pyrimidine metabolism. Even though these parasites do not use external uracil or uridine, orotic acid, an intermediate of pyrimidine biosynthesis, is successfully transported into the parasite and incorporated into parasite nucleic acids. On this basis, it was hypothesized that 5-fluoroorotate, a cytotoxic derivative of orotic acid, may be a potent and selective antimalarial agent. In vitro, 5-fluoroorotate caused 50% inhibition of the growth of Plasmodium falciparum at a concentration of 6.0 nM. In contrast, 5-fluorouracil, 5-fluorouridine, and 5-fluoro 2'-deoxyuridine were much less effective against malarial parasites. Chloroquine-susceptible and chloroquine-resistant clones of P. falciparum were equally susceptible to 5-fluoroorotate. The toxicity of 5-fluoroorotate was evaluated on four human cell lines (HT-1080, IMR-90, HeLa S3, and HL-60) and one mouse cell line (L-1210). Compared with malarial parasites, the mammalian cells were relatively tolerant of 5-fluoroorotic acid (50% inhibitory concentration, 0.9 to 10 microM). Finally, in the presence of 1 mM uridine, all mammalian cells were partially protected from 5-fluoroorotate cytotoxicity, but uridine offered no protection to P. falciparum. PMID:2675756

  1. Actikerall™ (5-Fluorouracil 0.5% and Salicylic Acid 10%) Topical Solution for Patient-directed Treatment of Actinic Keratoses.

    PubMed

    Nguyen, H P; Rivers, J K

    2016-05-01

    Actinic keratosis (AK), a common cutaneous lesion with the potential to transform into squamous cell carcinoma, has traditionally been treated with ablative and/or surgical procedures. Recently, a topical formulation combining 0.5% 5-fluorouracil with 10% salicylic acid (5-FU-SA) was introduced in Europe under the trade name Actikerall™ for the treatment of grade I/II AKs. In a single randomized phase III trial, 5-FU-SA was shown to be superior to diclofenac 3% gel in hyaluronic acid, as measured by the histological clearance of one defined lesion (72% vs. 59.1%) and by complete clinical clearance (55.4% vs. 32.0%). 5-FU-SA should be applied once daily to a total area of up to 25 cm(2), which may include the lesion(s) and a small area of surrounding skin (rim of healthy skin should not exceed 0.5 cm), for up to 12 weeks. The most common side effects are local inflammation and pruritus at the application site, and no serious adverse effects have been reported to date. Now commercially available in Canada, 5-FU-SA represents a patientapplied therapeutic option for the treatment of both overt and subclinical AKs.

  2. Characteristic constants of 2,2',4'-trihydroxyazobenzene-5-sulfonic acid, a reagent for spectrophotometric analysis

    USGS Publications Warehouse

    Fletcher, Mary H.

    1960-01-01

    The dye 2,2',4'-trihydroxyazobenzene-5-sulfonic acid, has shown promise as a reagent for the determination of zirconium. As the literature contains very little information about this dye, basic data pertinent to its use as a reagent were determined. The sulfonic acid group and all three of the hydroxy groups show acidic characteristics. Apparent dissociation constants were determined for the three more labile protons and the approximate order of magnitude for the fourth constant was estimated. Absorption spectra for the different ionization species are given. A curve is also included which shows the fraction of dye in the different ionization forms at acidities from 10.35M hydrochloric acid to pH 11.9. A sixth dye species was found in 1.0 to 8.4M potassium hydroxide solutions, but its nature is unknown.

  3. Reversal learning enhanced by lysergic acid diethylamide (LSD): concomitant rise in brain 5-hydroxytryptamine levels.

    PubMed

    King, A R; Martin, I L; Melville, K A

    1974-11-01

    1 Small doses of lysergic acid diethylamide (LSD) (12.5-50 mug/kg) consistently facilitated learning of a brightness discrimination reversal.2 2-Bromo-lysergic acid diethylamide (BOL-148), a structural analogue of LSD, with similar peripheral anti-5-hydroxytrypamine activity but no psychotomimetic properties, had no effect in this learning situation at a similar dose (25 mug/kg).3 LSD, but not BOL-148, caused a small but significant increase in brain 5-hydroxytryptamine levels, but had no effect on the levels of catecholamines in the brain at 25 mug/kg.

  4. Crystal and molecular structure of adduct of 6-benzylaminopurine and 5-sulfosalicylic acid

    SciTech Connect

    Xia Min Ma Kuirong

    2010-12-15

    The crystal structure of adduct of 6-benzylaminopurine and 5-sulfosalicylic acid C{sub 19}H{sub 25}N{sub 5}O{sub 10}S 1 is studied using single-crystal diffraction (R = 0.0482 for 2852 reflections with I > 2{sigma}(I)). The asymmetric unit of 1 contains one 6-benzylaminopurine molecule and one 5-sulfosalicylic acid molecule, as well as four lattice water molecules. Hydrogen bonds, formed by 6-benzylaminopurine and 5-sulfosalicylic acid, link the two molecules into one-dimensional chain (omitting four water molecules), further joined to two-dimensional layer network. Short ring-interactions with intra-chain {pi}-{pi} stacking are observed. The data of IR spectroscopy confirm the formation of the two-dimensional supramolecular layer structure. At last, a 3D supramolecular network constructs via hydrogen bonds.

  5. Response of Dipicolinic Acid (C5H5N(COOH)2) to Ultrafast Laser Pulses

    NASA Astrophysics Data System (ADS)

    Sauer, Petra; Allen, Roland

    2006-03-01

    Dipicolinic acid (DPA) and its salts are common constituents of bacterial spores, including those of anthrax. It has been proposed that such spores can be detected via spectroscopic techniques which employ ultrashort laser pulses. The development of these techniques should be enhanced by a detailed understanding of the microscopic processes that transpire when a molecule is subjected to femtosecond-scale pulses of various intensities, durations, and polarizations. We have recently developed a model that can be used to perform realistic simulations of the electronic and nuclear dynamics of biological molecules (containing carbon, hydrogen, oxygen and nitrogen) when they are subjected to such pulses. The bond lengths and vibrational frequencies for a variety of test molecules are in reasonable agreement with those obtained in experiment and ab initio calculations. Here we report results of simulations for DPA responding to femtosecond-scale laser pulses, with an analysis of the vibrational modes and electronic states which are most relevant for various choices of the laser pulse parameters.

  6. Effects of preservation methods on amino acids and 5'-nucleotides of Agaricus bisporus mushrooms.

    PubMed

    Liu, Ying; Huang, Fan; Yang, Hong; Ibrahim, S A; Wang, Yan-Feng; Huang, Wen

    2014-04-15

    In this study, the proximate composition, free amino acids content and 5'-nucleotides in frozen, canned and salted Agaricus bisporus (A. bisporus) were investigated. We found that the three kinds of A. bisporus products were good sources of protein, with amount varying in the ranges of 16.54-24.35g/100g (dry weight). Freezing, canning and salting process, followed by 6months of storage led to a significant reduction in free amino acids, especially tyrosine, alanine, glutamine and cysteine. There were medium levels of MSG-like amino acids in frozen A. bisporus and canned A. bisporus, and low levels of MSG-like amino acids in salted A. bisporus. The mount of flavor 5'-nucleotides in frozen A. bisporus was higher than that of canned and salted A. bisporus. The present study thus suggests that freezing is beneficial for the preservation of A. bisporus.

  7. [Effects of furfural and 5-hydroxymethylfurfural on succinic acid production by Escherichia coli].

    PubMed

    Wang, Dan; Wang, Honghui; Wang, Jing; Wang, Nan; Zhang, Jie; Xing, Jianmin

    2013-10-01

    Succinic acid production by fermentation from biomass, especially the lignocellulosic hydrolysate, is an alternative to chemical synthesis. Many studies report the inhibition of cell growth and succinic acid production from lignocellulosic hydrolysate, hardly is known about the actual kinetic and mechanism of the inhibition of individual factors. In this study, we studied inhibition effects of furfurals and 5-hydroxymethylfurfural (5-HMF) on cell growth and succinic acid production of engineered E. coli. Cell growth and succinic acid titer were severely inhibited by furfural and HMF with both concentrations higher than 0.8 g/L. Cell growth was totally inhibited when the concentration of furfural was above 6.4 g/L, or the concentration of HMF was above 12.8 g/L. At the concentration of maximum toleration, which was 3.2 g/L, furfural decreased the cell mass by 77.8% and the succinic acid titer by 36.1%. HMF decreased the cell mass by 13.6% and the succinic acid titer by 18.3%. Activity measurements of key enzymes revealed that phosphoenolpyruvate carboxylase, malate dehydrogenase, fumarate reductase all were inhibited by furfural and HMF. This study gave a quantitative view to the succinic acid production under the inhibition of lignocellulose degradation products and will help overcome the difficulties of the lignocellulosic hydrolysate fermentation.

  8. Phosphatidic acid stimulates inositol 1,4,5-trisphosphate production in adult cardiac myocytes.

    PubMed

    Kurz, T; Wolf, R A; Corr, P B

    1993-03-01

    The cellular content of phosphatidic acid can increase in response to several agonists either by phosphorylation of diacylglycerol after phospholipase C-catalyzed hydrolysis of phospholipids or directly through activation of phospholipase D. Although previous findings indicated that the generation of phosphatidic acid was exclusively a means of regulation of the cellular concentration of diacylglycerol, more recent studies have indicated that phosphatidic acid may also directly regulate several cellular functions. Accordingly, the present study was performed to assess whether phosphatidic acid could stimulate cardiac phospholipase C in intact adult rabbit ventricular myocytes. The mass of inositol 1,4,5-trisphosphate [Ins (1,4,5)P3] was determined by a specific and sensitive binding protein assay and by direct mass measurement using anion exchange chromatography for separation of selected inositol phosphates and gas chromatography and mass spectrometry for quantification of inositol monophosphate (IP1), inositol bisphosphate (IP2), inositol trisphosphate (IP3), and inositol tetrakisphosphate (IP4). Phosphatidic acid (10(-9)-10(-6) M) elicited a rapid concentration-dependent increase in Ins (1,4,5)P3 accumulation, with the peak fourfold to fivefold increase at 30 seconds of stimulation; the concentration required for 50% of maximal stimulation was 4.4 x 10(-8) M. The time course of individual inositol phosphates indicated a successive increase in the mass of IP3, IP4, IP2, and IP1 in response to stimulation with phosphatidic acid. The production of Ins (1,4,5)P3 in response to phosphatidic acid was not altered in the absence of extracellular calcium or in the presence of extracellular EGTA (10(-3) M). Thus, these findings indicate that phosphatidic acid is a potent activator of inositol phosphate production in adult ventricular myocytes.(ABSTRACT TRUNCATED AT 250 WORDS)

  9. Ciliary subcellular localization of TGR5 determines the cholangiocyte functional response to bile acid signaling

    PubMed Central

    Masyuk, Anatoliy I.; Huang, Bing Q.; Radtke, Brynn N.; Gajdos, Gabriella B.; Splinter, Patrick L.; Masyuk, Tatyana V.; Gradilone, Sergio A.

    2013-01-01

    TGR5, the G protein-coupled bile acid receptor that transmits bile acid signaling into a cell functional response via the intracellular cAMP signaling pathway, is expressed in human and rodent cholangiocytes. However, detailed information on the localization and function of cholangiocyte TGR5 is limited. We demonstrated that in human (H69 cells) and rat cholangiocytes, TGR5 is localized to multiple, diverse subcellular compartments, with its strongest expression on the apical plasma, ciliary, and nuclear membranes. To evaluate the relationship between ciliary TGR5 and the cholangiocyte functional response to bile acid signaling, we used a model of ciliated and nonciliated H69 cells and demonstrated that TGR5 agonists induce opposite changes in cAMP and ERK levels in cells with and without primary cilia. The cAMP level was increased in nonciliated cholangiocytes but decreased in ciliated cells. In contrast, ERK signaling was induced in ciliated cholangiocytes but suppressed in cells without cilia. TGR5 agonists inhibited proliferation of ciliated cholangiocytes but activated proliferation of nonciliated cells. The observed differential effects of TGR5 agonists were associated with the coupling of TGR5 to Gαi protein in ciliated cells and Gαs protein in nonciliated cholangiocytes. The functional responses of nonciliated and ciliated cholangiocytes to TGR5-mediated bile acid signaling may have important pathophysiological significance in cilia-related liver disorders (i.e., cholangiociliopathies), such as polycystic liver disease. In summary, TGR5 is expressed on diverse cholangiocyte compartments, including a primary cilium, and its ciliary localization determines the cholangiocyte functional response to bile acid signaling. PMID:23578785

  10. Comparative analysis of the 5'-end regions of two repressible acid phosphatase genes in Saccharomyces cerevisiae.

    PubMed Central

    Thill, G P; Kramer, R A; Turner, K J; Bostian, K A

    1983-01-01

    The nucleotide sequence of 5'-noncoding and N-terminal coding regions of two coordinately regulated, repressible acid phosphatase genes from Saccharomyces cerevisiae were determined. These unlinked genes encode different, but structurally related polypeptides of molecular weights 60,000 and 56,000. The DNA sequences of their 5'-flanking regions show stretches of extensive homology upstream of, and surrounding, a "TATA" sequence and in a region in which heterogeneous 5' ends of the p60 mRNA were mapped. The predicted amino acid sequences encoded by the N-terminal regions of both genes were confirmed by determination of the amino acid sequence of the native exocellular acid phosphatase and the partial sequence of the presecretory polypeptide synthesized in a cell-free protein synthesizing system. The N-terminal region of the p60 polypeptide was shown to be characterized by a hydrophobic 17-amino acid signal polypeptide which is absent in the native exocellular protein and thought to be necessary for acid phosphatase secretion. Images PMID:6343840

  11. [Effects of carbon and nitrogen sources on 5-keto-gluconic acid production].

    PubMed

    Tan, Zhilei; Wang, Hongcui; Wei, Yuqiao; Li, Yanyan; Zhong, Cheng; Jia, Shiru

    2014-01-01

    Gluconobacter oxydans is known to oxidize glucose to gluconic acid (GA), and subsequently, to 2-keto-gluconic acid (2KGA) and 5-keto-gluconic acid (5KGA), while 5KGA can be converted to L-(+)-tartaric acid. In order to increase the production of 5KGA, Gluconobacter oxydans HGI-1 that converts GA to 5KGA exclusively was chosen in this study, and effects of carbon sources (lactose, maltose, sucrose, amylum and glucose) and nitrogen sources (yeast extract, fish meal, corn steep liquor, soybean meal and cotton-seed meal) on 5KGA production were investigated. Results of experiment in 500 mL shake-flask show that the highest yield of 5KGA (98.20 g/L) was obtained using 100 g/L glucose as carbon source. 5KGA reached 100.20 g/L, 109.10 g/L, 99.83 g/L with yeast extract, fish meal and corn steep liquor as nitrogen source respectively, among which the optimal nitrogen source was fish meal. The yield of 5KGA by corn steep liquor is slightly lower than that by yeast extract. For the economic reason, corn steep liquor was selected as nitrogen source and scaled up to 5 L stirred-tank fermentor, and the final concentration of 5KGA reached 93.80 g/L, with its maximum volumetric productivity of 3.48 g/(L x h) and average volumetric productivity of 1.56 g/(L x h). The result obtained in this study showed that carbon and nitrogen sourses for large-scale production of 5KGA by Gluconobacter oxydans HGI-1 were glucose and corn steep liquor, respectively, and the available glucose almost completely (85.93%) into 5KGA.

  12. Semisynthetic bile acid FXR and TGR5 agonists: physicochemical properties, pharmacokinetics, and metabolism in the rat.

    PubMed

    Roda, Aldo; Pellicciari, Roberto; Gioiello, Antimo; Neri, Flavia; Camborata, Cecilia; Passeri, Daniela; De Franco, Francesca; Spinozzi, Silvia; Colliva, Carolina; Adorini, Luciano; Montagnani, Marco; Aldini, Rita

    2014-07-01

    We report on the relationship between the structure-pharmacokinetics, metabolism, and therapeutic activity of semisynthetic bile acid analogs, including 6α-ethyl-3α,7α-dihydroxy-5β-cholan-24-oic acid (a selective farnesoid X receptor [FXR] receptor agonist), 6α-ethyl-23(S)-methyl-3α,7α,12α-trihydroxy-5β-cholan-24-oic acid (a specific Takeda G protein-coupled receptor 5 [TGR5] receptor agonist), and 6α-ethyl-3α,7α-dihydroxy-24-nor-5β-cholan-23-sulfate (a dual FXR/TGR5 agonist). We measured the main physicochemical properties of these molecules, including ionization constants, water solubility, lipophilicity, detergency, and protein binding. Biliary secretion and metabolism and plasma and hepatic concentrations were evaluated by high-pressure liquid chromatography-electrospray-mass spectrometry/mass spectrometry in bile fistula rat and compared with natural analogs chenodeoxycholic, cholic acid, and taurochenodexycholic acid and intestinal bacteria metabolism was evaluated in terms of 7α-dehydroxylase substrate-specificity in anaerobic human stool culture. The semisynthetic derivatives detergency, measured in terms of their critical micellar concentration, was quite similar to the natural analogs. They were slightly more lipophilic than the corresponding natural analogs, evaluated by their 1-octanol water partition coefficient (log P), because of the ethyl group in 6 position, which makes these molecules very stable toward bacterial 7-dehydroxylation. The hepatic metabolism and biliary secretion were different: 6α-ethyl-3α,7α-dihydroxy-5β-cholan-24-oic acid, as chenodeoxycholic acid, was efficiently conjugated with taurine in the liver and, only in this form, promptly and efficiently secreted in bile. 6α-Ethyl-23(S)-methyl-3α,7α,12α-trihydroxy-5β-cholan-24-oic acid was poorly conjugated with taurine because of the steric hindrance of the methyl at C23(S) position metabolized to the C23(R) isomer and partly conjugated with taurine. Conversely, 6

  13. Semisynthetic bile acid FXR and TGR5 agonists: physicochemical properties, pharmacokinetics, and metabolism in the rat.

    PubMed

    Roda, Aldo; Pellicciari, Roberto; Gioiello, Antimo; Neri, Flavia; Camborata, Cecilia; Passeri, Daniela; De Franco, Francesca; Spinozzi, Silvia; Colliva, Carolina; Adorini, Luciano; Montagnani, Marco; Aldini, Rita

    2014-07-01

    We report on the relationship between the structure-pharmacokinetics, metabolism, and therapeutic activity of semisynthetic bile acid analogs, including 6α-ethyl-3α,7α-dihydroxy-5β-cholan-24-oic acid (a selective farnesoid X receptor [FXR] receptor agonist), 6α-ethyl-23(S)-methyl-3α,7α,12α-trihydroxy-5β-cholan-24-oic acid (a specific Takeda G protein-coupled receptor 5 [TGR5] receptor agonist), and 6α-ethyl-3α,7α-dihydroxy-24-nor-5β-cholan-23-sulfate (a dual FXR/TGR5 agonist). We measured the main physicochemical properties of these molecules, including ionization constants, water solubility, lipophilicity, detergency, and protein binding. Biliary secretion and metabolism and plasma and hepatic concentrations were evaluated by high-pressure liquid chromatography-electrospray-mass spectrometry/mass spectrometry in bile fistula rat and compared with natural analogs chenodeoxycholic, cholic acid, and taurochenodexycholic acid and intestinal bacteria metabolism was evaluated in terms of 7α-dehydroxylase substrate-specificity in anaerobic human stool culture. The semisynthetic derivatives detergency, measured in terms of their critical micellar concentration, was quite similar to the natural analogs. They were slightly more lipophilic than the corresponding natural analogs, evaluated by their 1-octanol water partition coefficient (log P), because of the ethyl group in 6 position, which makes these molecules very stable toward bacterial 7-dehydroxylation. The hepatic metabolism and biliary secretion were different: 6α-ethyl-3α,7α-dihydroxy-5β-cholan-24-oic acid, as chenodeoxycholic acid, was efficiently conjugated with taurine in the liver and, only in this form, promptly and efficiently secreted in bile. 6α-Ethyl-23(S)-methyl-3α,7α,12α-trihydroxy-5β-cholan-24-oic acid was poorly conjugated with taurine because of the steric hindrance of the methyl at C23(S) position metabolized to the C23(R) isomer and partly conjugated with taurine. Conversely, 6

  14. Synthesis, structural and computational characterization of 2-amino-3,5-diiodobenzoic acid and 2-amino-3,5-dibromobenzoic acid

    NASA Astrophysics Data System (ADS)

    Yıldırım, M. Hakkı; Paşaoğlu, Hümeyra; Odabaşoğlu, Hakkı Yasin; Odabaşoğlu, Mustafa; Yıldırım, Arzu Özek

    2015-07-01

    The benzoic acid compounds 2-amino-3,5-dibromobenzoic acid (2A35Br) and 2-amino-3,5-diiodobenzoic (2A35I) acid have been synthesized and characterized by single-crystal X-ray diffraction, FT-IR spectroscopy, UV-Vis spectroscopy and computational methods. Molecular geometry, intra- and inter-molecular interactions have been investigated by using X-ray diffraction technique. Fundamental vibrational bands of the title compounds were founded by FT-IR and UV-Vis method was used to obtain electronic bands. Geometry optimizations and the calculation of IR frequencies were performed both Gaussian type orbitals at Gaussian 09W and Slater type orbitals at ADF2009.01 software. The calculations are compatible with the experiment results. In addition, geometrical parameters, energies, HOMO-LUMO gaps and electrophilicity indexes have been calculated for thirty possible positional isomers of 2A35Br and 2A35I. Calculations show that 2A35Br and 2A35I isomers have the lowest energy, the narrowest HOMO-LUMO gap and the highest electrophilicity index values. Molecular electrostatic potential maps, Fukui indices, natural bond orbital analysis, thermodynamic parameters and non-linear optical properties of the 2A35Br and 2A35I were also investigated by theoretical calculations.

  15. Purification of biomass-derived 5-hydroxymethylfurfural and its catalytic conversion to 2,5-furandicarboxylic Acid.

    PubMed

    Yi, Guangshun; Teong, Siew Ping; Li, Xiukai; Zhang, Yugen

    2014-08-01

    A simple and effective water extraction method is presented for the purification 5-hydroxylmethylfurfural (HMF) obtained from a biomass dehydration system. Up to 99% of the HMF can be recovered and the HMF in aqueous solution is directly converted to 2,5-furandicarboxylic acid (FDCA) as the sole product. This purification technique allows an integrated process to produce FDCA from fructose via HMF prepared in an isopropanol monophasic system, with an overall FDCA yield of 83% obtained. From Jerusalem raw artichoke biomass to FDCA via HMF prepared in a water/MIBK (methyl isobutyl ketone) biphasic system, an overall FDCA yield of 55% is obtained. PMID:24889713

  16. Metabolism of 5'alpha,8'-cycloabscisic acid, a highly potent and long-lasting abscisic acid analogue, in radish seedlings.

    PubMed

    Todoroki, Yasushi; Sawada, Masao; Matsumoto, Miyuki; Tsukada, Shigeko; Ueno, Kotomi; Isaka, Masatoshi; Owaki, Mariko; Hirai, Nobuhiro

    2004-01-15

    We synthesized 5'alpha,8'-cycloabscisic acid (CycloABA), a highly potent and long-lasting abscisic acid (ABA) analogue, by a different method from that reported before. CycloABA fed to radish seedlings had more metabolic tolerance than ABA. The major metabolite of CycloABA was the glucose conjugate, which was the minor metabolite of ABA. The 8'-hydroxylated metabolite and its cyclized isomer, which were major metabolites of ABA, were not found as metabolites of CycloABA. The present results suggest that the highly potent and long-lasting activity of CycloABA is caused by resistance to ABA 8'-hydroxylase, and that CycloABA is partially metabolized to the glucose conjugate by ABA glucosyltransferase.

  17. Spontaneous charge separation induced by phenothiazine sorption within acidic H(n)ZSM-5.

    PubMed

    Moissette, A; Luchez, F; Brémard, C; Vezin, H; Hureau, M

    2009-06-01

    In situ diffuse reflectance UV-visible, Raman scattering and EPR experiments, carried out as a function of time after phenothiazine (PTZ) direct exposure to thermally activated acid H(n)ZSM-5 zeolite without any solvent, provide evidence of phenothiazine sorption and simultaneous spontaneous ionization. For comparison, phenothiazine behavior was investigated within non acidic zeolite and showed that most of the phenothiazine molecules were occluded as intact molecules and that ionization was very weak. The multivariate curve resolution analysis of the diffuse reflectance UV-visible spectra set recorded during the sorption process resolve the absorption spectra and respective concentrations of individual species involved in the sorption course. When PTZ entered through the acidic zeolite channels, PTZ (+)@H(n)ZSM-5 (-) radical pair is generated by the polarization energy. Subsequent PTZ(2+) formation was fast but only partial. After months, equilibrium including PTZ (+), PTZ(2+) and occluded PTZ was reached within acid H(n)ZSM-5 but depends on the Si/Al ratio: the higher the Al content, the easier the spontaneous ionization. The close match between PTZ and the pore size of zeolites combined with efficient polarizing effect of proton and aluminium electron trapping sites appear to be the most important factors responsible for the stabilization of PTZ (+) and PTZ(2+) and hinder efficiently the charge recombination. No evidence of Brønsted acid sites of H(n)ZSM-5 was found during the sorption of phenothiazine through generation of protonated species.

  18. [Raoultella planticola, a new strain degrading 2,4,5-trichlorophenoxyacetic acid].

    PubMed

    Zharikova, N V; Markusheva, T V; Galkin, E G; Korobov, V V; Zhurenko, E Iu; Sitdikova, L R; Kolganova, T V; Kuznetsov, B B; Turova, T P

    2006-01-01

    A new strain that degrades the herbicide 2,4,5-trichlorophenoxyacetic acid (2,4,5-T) was isolated from soil, which was exposed to factors related to the petrochemical industry. According to its physiological, biochemical, cultural, and morphological traits, together with the sequence of the 16S rRNA gene, the strain was identified as Raoultella planticola 33-4ch. The strain could consume 2,4,5-T as a sole source of carbon and energy. The amount of 2,4,5-T in the culture medium decreased by 51% after five days of incubation. Raoultella planticola 33-4ch consumes 2,4,5-T to produce 4-chlorophenoxyacetic, phenoxyacetic, and 3-methyl-2,6-dioxo-4-hexenoic acids.

  19. Viscosity controls humidity dependence of N2O5 uptake to citric acid aerosol

    NASA Astrophysics Data System (ADS)

    Gržinić, G.; Bartels-Rausch, T.; Berkemeier, T.; Türler, A.; Ammann, M.

    2015-08-01

    The heterogeneous loss of dinitrogen pentoxide (N2O5) to aerosol particles has a significant impact on the night time nitrogen oxide cycle and therefore the oxidative capacity in the troposphere. Using a 13N short lived radioactive tracer method we studied the uptake kinetics of N2O5 on citric acid aerosol particles as a function of relative humidity (RH). The results show that citric acid exhibits lower reactivity than similar di- and polycarboxylic acids, with uptake coefficients between ~ 3 × 10-4-~ 3 × 10-3 depending on humidity (17-70 % RH). This humidity dependence can be explained by a changing viscosity and, hence, diffusivity in the organic matrix. Since the viscosity of highly concentrated citric acid solutions is not well established, we present four different parameterizations of N2O5 diffusivity based on the available literature data or estimates for viscosity and diffusivity. Above 50 % RH, uptake is consistent with the reacto-diffusive kinetic regime whereas below 50 % RH, the uptake coefficient is higher than expected from hydrolysis of N2O5 within the bulk of the particles, and the uptake kinetics may be limited by loss on the surface only. This study demonstrates the impact of viscosity in highly oxidized and highly functionalized secondary organic aerosol material on the heterogeneous chemistry of N2O5 and may explain some of the unexpectedly low loss rates to aerosol derived from field studies.

  20. 40 CFR 721.5280 - 2,7-Naphthalenedisulfonic acid, 4-amino-5-hydroxy-, coupled with diazotized 4-butylbenzenamine...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... Specific Chemical Substances § 721.5280 2,7-Naphthalenedisulfonic acid, 4-amino-5-hydroxy-, coupled with... 2,7-naphthalenedisulfonic acid, 4-amino-5-hydroxy-, coupled with diazotized 4-butylbenzenamine... 40 Protection of Environment 32 2012-07-01 2012-07-01 false 2,7-Naphthalenedisulfonic acid,...

  1. 40 CFR 721.5280 - 2,7-Naphthalenedisulfonic acid, 4-amino-5-hydroxy-, coupled with diazotized 4-butylbenzenamine...

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... Specific Chemical Substances § 721.5280 2,7-Naphthalenedisulfonic acid, 4-amino-5-hydroxy-, coupled with... 2,7-naphthalenedisulfonic acid, 4-amino-5-hydroxy-, coupled with diazotized 4-butylbenzenamine... 40 Protection of Environment 32 2013-07-01 2013-07-01 false 2,7-Naphthalenedisulfonic acid,...

  2. 40 CFR 721.5280 - 2,7-Naphthalenedisulfonic acid, 4-amino-5-hydroxy-, coupled with diazotized 4-butylbenzenamine...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... Specific Chemical Substances § 721.5280 2,7-Naphthalenedisulfonic acid, 4-amino-5-hydroxy-, coupled with... 2,7-naphthalenedisulfonic acid, 4-amino-5-hydroxy-, coupled with diazotized 4-butylbenzenamine... 40 Protection of Environment 30 2010-07-01 2010-07-01 false 2,7-Naphthalenedisulfonic acid,...

  3. 40 CFR 721.5280 - 2,7-Naphthalenedisulfonic acid, 4-amino-5-hydroxy-, coupled with diazotized 4-butylbenzenamine...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... Specific Chemical Substances § 721.5280 2,7-Naphthalenedisulfonic acid, 4-amino-5-hydroxy-, coupled with... 2,7-naphthalenedisulfonic acid, 4-amino-5-hydroxy-, coupled with diazotized 4-butylbenzenamine... 40 Protection of Environment 31 2011-07-01 2011-07-01 false 2,7-Naphthalenedisulfonic acid,...

  4. 40 CFR 721.5280 - 2,7-Naphthalenedisulfonic acid, 4-amino-5-hydroxy-, coupled with diazotized 4-butylbenzenamine...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... Specific Chemical Substances § 721.5280 2,7-Naphthalenedisulfonic acid, 4-amino-5-hydroxy-, coupled with... 2,7-naphthalenedisulfonic acid, 4-amino-5-hydroxy-, coupled with diazotized 4-butylbenzenamine... 40 Protection of Environment 31 2014-07-01 2014-07-01 false 2,7-Naphthalenedisulfonic acid,...

  5. (-)-3,6-Dioxo-5beta-cholanic acid: hydrogen bonding in the hemihydrate of a steroidal diketo acid.

    PubMed

    Thompson, H W; Lalancette, R A; Brunskill, A P

    2001-05-01

    The hemihydrate of the title diketo acid, C(24)H(36)O(4).0.5H(2)O, forms hydrogen-bonded carboxyl dimers related by a C(2) axis at crystallographic sites on the a and b edges of the chosen cell [O.O = 2.643 (7) and 2.716 (7) A]. The ketone ends of the molecules approach each other at sites near ((1/2),(1/2),(1/2)), ((1/2),0,(1/2)), (0,0,(1/2)) and (0,(1/2),(1/2)) in an interleaved arrangement incorporating partial-occupancy water hydrogen bonded to the B-ring ketone. PMID:11353275

  6. 5 beta-hydroxylation by the liver. Identification of 3,5,7-trihydroxy nor-bile acids as new major biotransformation products of 3,7-dihydroxy nor-bile acids in rodents.

    PubMed

    Schteingart, C D; Hagey, L R; Setchell, K D; Hofmann, A F

    1993-05-25

    24-Norursodeoxycholic acid (nor-UDCA), when administered into the anesthetized biliary fistula hamster or injected into the perfusate of an isolated liver, was hydroxylated at C-5 to give 5 beta-hydroxynorursodeoxycholic acid 2 (3 alpha,5,7 beta-trihydroxy-24-nor-5 beta-cholan-23-oic acid), which was secreted into bile mainly as such. Similarly, 24-norchenodeoxycholic acid (nor-CDCA) was 5 beta-hydroxylated to give 5 beta-hydroxynor-chenodeoxycholic acid 4 (3 alpha,5,7 alpha-trihydroxy-24-nor-5 beta-cholan-23-oic acid), which was also secreted into bile without appreciable further biotransformation. The site of hydroxylation was assigned by 13C and 1H NMR and mass spectrometry. 5-Hydroxylation was a major biotransformation pathway at physiological bile acid loads. 5-Hydroxylation of UDCA also occurred in the perfused rat liver but to a lesser extent. 5-Hydroxylation of nor-UDCA was not observed in rabbit, dog, or man, indicating that its formation is species-specific. 5-Hydroxylation of nor-CDCA and nor-UDCA is the first reported example of hydroxylation of a tertiary carbon atom of bile acids. Nor-dihydroxy bile acids appear to be useful for the detection of minor hydroxylation pathways, because their prolonged hepatobiliary retention exposes them repeatedly to hydroxylases present in the hepatobiliary system.

  7. Recurrent high anion gap metabolic acidosis secondary to 5-oxoproline (pyroglutamic acid).

    PubMed

    Tailor, Prayus; Raman, Tuhina; Garganta, Cheryl L; Njalsson, Runa; Carlsson, Katarina; Ristoff, Ellinor; Carey, Hugh B

    2005-07-01

    High anion gap metabolic acidosis in adults is a severe metabolic disorder for which the primary organic acid usually is apparent by clinical history and standard laboratory testing. We report a case of recurrent high anion gap metabolic acidosis in a 48-year-old man who initially presented with anorexia and malaise. Physical examination was unrevealing. Arterial pH was 6.98, P co 2 was 5 mm Hg, and chemistry tests showed a bicarbonate level of 3 mEq/L (3 mmol/L), anion gap of 32 mEq/L (32 mmol/L), and a negative toxicology screen result, except for an acetaminophen (paracetamol) level of 7.5 mug/mL. Metabolic acidosis resolved with administration of intravenous fluids. Subsequently, he experienced 5 more episodes of high anion gap metabolic acidosis during an 8-month span. Methanol, ethylene glycol, acetone, ethanol, d -lactate, and hippuric acid screens were negative. Lactate levels were modestly elevated, and acetaminophen levels were elevated for 5 of 6 admissions. These episodes defied explanation until 3 urinary organic acid screens, obtained on separate admissions, showed striking elevations of 5-oxoproline levels. Inborn errors of metabolism in the gamma-glutamyl cycle causing recurrent 5-oxoprolinuria and high anion gap metabolic acidosis are rare, but well described in children. Recently, there have been several reports of apparent acquired 5-oxoprolinuria and high anion gap metabolic acidosis in adults in association with acetaminophen use. Acetaminophen may, in susceptible individuals, disrupt regulation of the gamma-glutamyl cycle and result in excessive 5-oxoproline production. Suspicion for 5-oxoproline-associated high anion gap metabolic acidosis should be entertained when the cause of high anion gap metabolic acidosis remains poorly defined, the anion gap cannot be explained reasonably by measured organic acids, and there is concomitant acetaminophen use.

  8. Iontophoretic release of acetylcholine, noradrenaline, 5-hydroxytryptamine and D-lysergic acid diethylamide from micropipettes.

    PubMed

    Bradley, P B; Candy, J M

    1970-10-01

    1. The in vitro iontophoretic release of tritium-labelled acetylcholine and 5-hydroxytryptamine from large and small micropipettes and noradrenaline and D-lysergic acid diethylamide from small micropipettes was determined by liquid scintillation counting.2. The release was directly proportional to the electrical charge passed in the range normally used in the iontophoretic study of these compounds. The transport numbers obtained for the large micropipettes were approximately double those with the small micropipettes. A very low transport number was found for D-lysergic acid diethylamide.3. The spontaneous leakage was small and did not vary appreciably with time.4. The iontophoretic release of acetylcholine in vitro agreed with the in vitro measurements.5. The brain-stem tissue concentration of D-lysergic acid diethylamide after intravenous injection into intact and decerebrate cats was determined.

  9. The application of (Z)-3-aryl-3-haloenoic acids to the synthesis of (Z)-5-benzylidene-4-arylpyrrol-2(5H)-ones

    PubMed Central

    Gupton, John T.; Telang, Nakul; Banner, Edith J.; Kluball, Emily J.; Hall, Kayleigh E.; Finzel, Kara L.; Jia, Xin; Bates, Spencer R.; Welden, R. Scott; Giglio, Benjamin C.; Eaton, James E.; Barelli, Peter J.; Firich, Lauren T.; Stafford, John A.; Coppock, Matthew B.; Worrall, Eric F.; Kanters, Rene P.F.; Keertikar, Kerry; Osterman, Rebecca

    2010-01-01

    Studies directed at the synthesis of (Z)-5-benzylidene-4-arylpyrrol-2(5H)-ones from (Z)-3-aryl-3-haloenoic acids are described. The successful strategy relies on the preparation of (Z)-3-aryl-3-haloenoic acids from acetophenones through the corresponding (Z)-3-aryl-3-haloenals and the conversion of the (Z)-3-aryl-3-haloenoic acids to (Z)-5-benzylidene-4-aryl-5H-furan-2-ones. The furanones were subsequently treated with primary amines and dehydrated to the corresponding (Z)-5-benzylidene-4-arylpyrrol-2(5H)-ones. PMID:21135918

  10. Viscosity controls humidity dependence of N2O5 uptake to citric acid aerosol

    NASA Astrophysics Data System (ADS)

    Gržinić, G.; Bartels-Rausch, T.; Berkemeier, T.; Türler, A.; Ammann, M.

    2015-12-01

    The heterogeneous loss of dinitrogen pentoxide (N2O5) to aerosol particles has a significant impact on the night-time nitrogen oxide cycle and therefore the oxidative capacity in the troposphere. Using a 13N short-lived radioactive tracer method, we studied the uptake kinetics of N2O5 on citric acid aerosol particles as a function of relative humidity (RH). The results show that citric acid exhibits lower reactivity than similar dicarboxylic and polycarboxylic acids, with uptake coefficients between ∼ 3 × 10-4-∼ 3 × 10-3 depending on humidity (17-70 % RH). At RH above 50 %, the magnitude and the humidity dependence can be best explained by the viscosity of citric acid as compared to aqueous solutions of simpler organic and inorganic solutes and the variation of viscosity with RH and, hence, diffusivity in the organic matrix. Since the diffusion rates of N2O5 in highly concentrated citric acid solutions are not well established, we present four different parameterizations of N2O5 diffusivity based on the available literature data or estimates for viscosity and diffusivity of H2O. Above 50 % RH, uptake is consistent with the reacto-diffusive kinetic regime whereas below 50 % RH, the uptake coefficient is higher than expected from hydrolysis of N2O5 within the bulk of the particles, and the uptake kinetics is most likely limited by loss on the surface only. This study demonstrates the impact of viscosity in highly oxidized and highly functionalized secondary organic aerosol material on the heterogeneous chemistry of N2O5 and may explain some of the unexpectedly low loss rates to aerosol derived from field studies.

  11. Stable 5,6-epoxyeicosatrienoic acid analog relaxes coronary arteries through potassium channel activation.

    PubMed

    Yang, Wenqi; Gauthier, Kathryn M; Reddy, L Manmohan; Sangras, Bhavani; Sharma, Kamalesh K; Nithipatikom, Kasem; Falck, John R; Campbell, William B

    2005-04-01

    5,6-epoxyeicosatrienoic acid (5,6-EET) is a cytochrome P450 epoxygenase metabolite of arachidonic acid that causes vasorelaxation. However, investigations of its role in biological systems have been limited by its chemical instability. We developed a stable agonist of 5,6-EET, 5-(pentadeca-3(Z),6(Z),9(Z)-trienyloxy)pentanoic acid (PTPA), in which the 5,6-epoxide was replaced with a 5-ether. PTPA obviates chemical and enzymatic hydrolysis. In bovine coronary artery rings precontracted with U46619, PTPA (1 nmol/L to 10 micromol/L) induced concentration-dependent relaxations, with maximal relaxation of 86+/-5% and EC50 of 1 micromol/L. The relaxations were inhibited by the cyclooxygenase inhibitor indomethacin (10 micromol/L; max relaxation 43+/-9%); the ATP-sensitive K+ channel inhibitor glybenclamide (10 micromol/L; max relaxation 49+/-6%); and the large conductance calcium-activated K+ channel inhibitor iberiotoxin (100 nmol/L; max relaxation 38+/-6%) and abolished by the combination of iberiotoxin with indomethacin or glybenclamide or increasing extracellular K+ to 20 mmol/L. Whole-cell outward K+ current was increased nearly 6-fold by PTPA (10 micromol/L), which was also blocked by iberiotoxin. Additionally, we synthesized 5-(pentadeca-6(Z),9(Z)-dienyloxy)pentanoic acid and 5-(pentadeca-3(Z),9(Z)-dienyloxy)pentanoic acid (PDPA), PTPA analogs that lack the 8,9 or 11,12 double bonds of arachidonic acid and therefore are not substrates for cyclooxygenase. The PDPAs caused concentration-dependent relaxations (max relaxations 46+/-13% and 52+/-7%, respectively; EC50 1micromol/L), which were not altered by glybenclamide but blocked by iberiotoxin. These studies suggested that PTPA induces relaxation through 2 mechanisms: (1) cyclooxygenase-dependent metabolism to 5-ether-containing prostaglandins that activate ATP-sensitive K+ channels and (2) activation of smooth muscle large conductance calcium-activated K+ channels. PDPAs only activate large conductance calcium

  12. Design, Synthesis, and Testing of a Molecular Truck for Colonic Delivery of 5-Aminosalicylic Acid

    PubMed Central

    2012-01-01

    A molecular scaffold bearing eight terminal alkyne groups was synthesized from sucrose. Eight copies of an azide-terminated, azo-linked precursor to 5-aminosalicylic acid were attached to the scaffold via copper(I)-catalyzed azide–alkyne cycloaddition. The resulting compound was evaluated in a DSS model of colitis in BALB/c mice against sulfasalazine as a control. Two independent studies verified that the novel pro-drug, administered in a dose calculated to result in an equimolar 5-ASA yield, outperformed sulfasalazine in terms of protection from mucosal inflammation and T cell activation. A separate study established that 5-ASA appeared in feces produced 24–48 h following administration of the pro-drug. Thus, a new, orally administered pro-drug form of 5-aminosalicylic acid has been developed and successfully demonstrated. PMID:23029601

  13. Inhibitory effects of lysophosphatidic acid receptor-5 on cellular functions of sarcoma cells.

    PubMed

    Araki, Mutsumi; Kitayoshi, Misaho; Dong, Yan; Hirane, Miku; Ozaki, Shuhei; Mori, Shiori; Fukushima, Nobuyuki; Honoki, Kanya; Tsujiuchi, Toshifumi

    2014-06-01

    Lysophosphatidic acid (LPA) is a bioactive lipid that interacts with G protein-coupled LPA receptors (LPA receptor-1 (LPA1) to LPA6). Here, we investigated the effects of LPA signaling via LPA5 on cellular functions of sarcoma cells by generating Lpar5 overexpressing and Lpar5 knockdown cells from rat osteosarcoma and malignant fibrous histiocytoma cells, respectively. The cell motility activity of Lpar5 overexpressing cells was significantly lower, while Lpar5 knockdown cells showed high cell motility, compared with respective controls. Gelatin zymography showed that LPA5 suppressed the activation of matrix metalloproteinase-2. LPA5 also inhibited the cell motility activity of endothelial cells, correlating with the expression levels of vascular endothelial growth factor genes. These results suggest that LPA signaling via LPA5 negatively regulates the cellular functions of rat sarcoma cells. PMID:24798396

  14. Effect of tannic acid on the transcriptome of the soil bacterium Pseudomonas protegens Pf-5

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Tannins are plant-produced organic compounds that are found in soils, are able to sequester iron, and have antimicrobial properties. We studied the effect of tannic acid on the molecular physiology of the soil-inhabiting biocontrol bacterium Pseudomonas protegens Pf-5 (formerly Pseudomonas fluoresce...

  15. Diffusion of cis-5,8,11,14,17-eicosapentaenoic acid (1); carbon dioxide (2)

    NASA Astrophysics Data System (ADS)

    Winkelmann, J.

    This document is part of Subvolume A `Gases in Gases, Liquids and their Mixtures' of Volume 15 `Diffusion in Gases, Liquids and Electrolytes' of Landolt-Börnstein Group IV `Physical Chemistry'. It is part of the chapter of the chapter `Diffusion in Pure Gases' and contains data on diffusion of (1) cis-5,8,11,14,17-eicosapentaenoic acid; (2) carbon dioxide

  16. 21 CFR 862.1390 - 5-Hydroxyindole acetic acid/serotonin test system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false 5-Hydroxyindole acetic acid/serotonin test system. 862.1390 Section 862.1390 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES CLINICAL CHEMISTRY AND CLINICAL TOXICOLOGY DEVICES Clinical...

  17. A TRP5/5-fluoroanthranilic acid counter-selection system for gene disruption in Candida guilliermondii.

    PubMed

    Foureau, Emilien; Clastre, Marc; Millerioux, Yoann; Simkin, Andrew J; Cornet, Lucie; Dutilleul, Christelle; Besseau, Sébastien; Marais, Emeline; Melin, Céline; Guillard, Jérôme; Crèche, Joël; Giglioli-Guivarc'h, Nathalie; Courdavault, Vincent; Papon, Nicolas

    2012-08-01

    Candida guilliermondii is an interesting biotechnological model for the industrial production of value-added metabolites and also remains an opportunistic emerging fungal agent of candidiasis often associated with oncology patients. The aim of the present study was to establish a convenient transformation system for C. guilliermondii by developing both an ATCC 6260-derived recipient strain and a recyclable selection marker. We first disrupted the TRP5 gene in the wild-type strain and demonstrated that trp5 mutants were tryptophan auxotroph as well as being resistant to the antimetabolite 5-fluoroanthranilic acid (FAA). Following an FAA selection of spontaneous mutants derived from the ATCC 6260 strain and complementation analysis, we demonstrated that trp5 genotypes could be directly recovered on FAA-containing medium. The TRP5 wild-type allele, flanked by two short repeated sequences of its 3'UTR, was then used to disrupt the FCY1 gene in C. guilliermondii trp5 recipient strains. The resulting fcy1 mutants displayed strong flucytosine resistance and a counter-selection on FAA allowed us to pop-out the TRP5 allele from the FCY1 locus. To illustrate the capacity of this blaster system to achieve a second round of gene disruption, we knocked out both the LEU2 and the HOG1 genes in the trp5, fcy1 background. Although all previously described yeast "TRP blaster" disruption systems used TRP1 as counter-selectable marker, this study demonstrated the potential of the TRP5 gene in such strategies. This newly created "TRP5 blaster" disruption system thus represents a powerful genetic tool to study the function of a large pallet of genes in C. guilliermondii. PMID:22618436

  18. Immobilization of DNA via oligonucleotides containing an aldehyde or carboxylic acid group at the 5' terminus.

    PubMed Central

    Kremsky, J N; Wooters, J L; Dougherty, J P; Meyers, R E; Collins, M; Brown, E L

    1987-01-01

    A general method for the immobilization of DNA through its 5'-end has been developed. A synthetic oligonucleotide, modified at its 5'-end with an aldehyde or carboxylic acid, was attached to latex microspheres containing hydrazide residues. Using T4 polynucleotide ligase and an oligonucleotide splint, a single stranded 98mer was efficiently joined to the immobilized synthetic fragment. After impregnation of the latex microspheres with the fluorescent dye, Nile Red and attachment of an aldehyde 16mer, 5 X 10(5) bead-DNA conjugates could be detected with a conventional fluorimeter. Images PMID:3562241

  19. Unsurmountable antagonism of brain 5-hydroxytryptamine2 receptors by (+)-lysergic acid diethylamide and bromo-lysergic acid diethylamide.

    PubMed

    Burris, K D; Sanders-Bush, E

    1992-11-01

    Lysergic acid diethylamide (LSD) and its structural analogue 2-bromo-lysergic acid diethylamide (BOL) act as unsurmountable antagonists of serotonin-elicited contractions in smooth muscle preparations. Two different models, allosteric and kinetic, have been invoked to explain these findings. The present studies investigate the mechanism of antagonism of brain 5-hydroxytryptamine (5HT)2 receptors, utilizing cells transfected with 5HT2 receptor cDNA cloned from rat brain. A proximal cellular response, phosphoinositide hydrolysis, was examined in order to minimize possible postreceptor effects. Even though LSD behaved as a partial agonist and BOL as a pure antagonist, both drugs blocked the effect of serotonin in an unsurmountable manner, i.e., increasing concentrations of serotonin could not overcome the blocking effect of LSD or BOL. Radioligand binding studies showed that preincubation of membranes with either LSD or BOL reduced the density of [3H]ketanserin binding sites, suggesting that the drugs bind tightly to the 5HT2 receptor and are not displaced during the binding assay. Two additional experiments supported this hypothesis. First, the off-rate of [3H] LSD was slow (20 min), relative to that of [3H]ketanserin (approximately 4 min). Second, when the length of incubation with [3H]ketanserin was increased to 60 min, the LSD-induced decrease in Bmax was essentially eliminated. The possibility that LSD and BOL decrease [3H]ketanserin binding by interacting with an allosteric site was rejected, because neither drug altered the rate of dissociation of [3H]ketanserin. The most parsimonious interpretation of these results is that unsurmountable antagonism reflects prolonged occupancy of the receptor by slowly reversible antagonists.

  20. Production of Siderophores Increases Resistance to Fusaric Acid in Pseudomonas protegens Pf-5

    PubMed Central

    Ruiz, Jimena A.; Bernar, Evangelina M.; Jung, Kirsten

    2015-01-01

    Fusaric acid is produced by pathogenic fungi of the genus Fusarium, and is toxic to plants and rhizobacteria. Many fluorescent pseudomonads can prevent wilt diseases caused by these fungi. This study was undertaken to evaluate the effect of fusaric acid on P. protegens Pf-5 and elucidate the mechanisms that enable the bacterium to survive in the presence of the mycotoxin. The results confirm that fusaric acid negatively affects growth and motility of P. protegens. Moreover, a notable increase in secretion of the siderophore pyoverdine was observed when P. protegens was grown in the presence of fusaric acid. Concomitantly, levels of enzymes involved in the biosynthesis of pyoverdine and enantio-pyochelin, the second siderophore encoded by P. protegens, increased markedly. Moreover, while similar levels of resistance to fusaric acid were observed for P. protegens mutants unable to synthesize either pyoverdine or enanto-pyochelin and the wild type strain, a double mutant unable to synthesize both kinds of siderophores showed a dramatically reduced resistance to this compound. This reduced resistance was not observed when this mutant was grown under conditions of iron excess. Spectrophotometric titrations revealed that fusaric acid binds not only Fe2+ and Fe3+, but also Zn2+, Mn2+ and Cu2+, with high affinity. Our results demonstrate that iron sequestration accounts at least in part for the deleterious effect of the mycotoxin on P. protegens. PMID:25569682

  1. Production of siderophores increases resistance to fusaric acid in Pseudomonas protegens Pf-5.

    PubMed

    Ruiz, Jimena A; Bernar, Evangelina M; Jung, Kirsten

    2015-01-01

    Fusaric acid is produced by pathogenic fungi of the genus Fusarium, and is toxic to plants and rhizobacteria. Many fluorescent pseudomonads can prevent wilt diseases caused by these fungi. This study was undertaken to evaluate the effect of fusaric acid on P. protegens Pf-5 and elucidate the mechanisms that enable the bacterium to survive in the presence of the mycotoxin. The results confirm that fusaric acid negatively affects growth and motility of P. protegens. Moreover, a notable increase in secretion of the siderophore pyoverdine was observed when P. protegens was grown in the presence of fusaric acid. Concomitantly, levels of enzymes involved in the biosynthesis of pyoverdine and enantio-pyochelin, the second siderophore encoded by P. protegens, increased markedly. Moreover, while similar levels of resistance to fusaric acid were observed for P. protegens mutants unable to synthesize either pyoverdine or enanto-pyochelin and the wild type strain, a double mutant unable to synthesize both kinds of siderophores showed a dramatically reduced resistance to this compound. This reduced resistance was not observed when this mutant was grown under conditions of iron excess. Spectrophotometric titrations revealed that fusaric acid binds not only Fe2+ and Fe3+, but also Zn2+, Mn2+ and Cu2+, with high affinity. Our results demonstrate that iron sequestration accounts at least in part for the deleterious effect of the mycotoxin on P. protegens. PMID:25569682

  2. Targeted delivery of 5-fluorouracil to cholangiocarcinoma cells using folic acid as a targeting agent.

    PubMed

    Ngernyuang, Nipaporn; Seubwai, Wunchana; Daduang, Sakda; Boonsiri, Patcharee; Limpaiboon, Temduang; Daduang, Jureerut

    2016-03-01

    There are limits to the standard treatment for cholangiocarcinoma (CCA) including drug resistance and side effects. The objective of this study was to develop a new technique for carrying drugs by conjugation with gold nanoparticles and using folic acid as a targeting agent in order to increase drug sensitivity. Gold nanoparticles (AuNPs) were functionalized with 5-fluorouracil (5FU) and folic acid (FA) using polyethylene glycol (PEG) shell as a linker (AuNPs-PEG-5FU-FA). Its cytotoxicity was tested in CCA cell lines (M139 and M213) which express folic acid receptor (FA receptor). The results showed that AuNPs-PEG-5FU-FA increased the cytotoxic effects in the M139 and M213 cells by 4.76% and 7.95%, respectively compared to those treated with free 5FU+FA. It is found that the cytotoxicity of the AuNPs-PEG-5FU-FA correlates with FA receptor expression suggested the use of FA as a targeted therapy. The mechanism of cytotoxicity was mediated via mitochondrial apoptotic pathway as determined by apoptosis array. In conclusion, our findings shed some light on the use of gold nanoparticles for conjugation with potential compounds and FA as targeted therapy which contribute to the improvement of anti-cancer drug efficacy. In vivo study should be warranted for its effectiveness of stability, biosafety and side effect reduction.

  3. Wnt-Lrp5 Signaling Regulates Fatty Acid Metabolism in the Osteoblast

    PubMed Central

    Frey, Julie L.; Li, Zhu; Ellis, Jessica M.; Zhang, Qian; Farber, Charles R.; Aja, Susan; Wolfgang, Michael J.; Clemens, Thomas L.

    2015-01-01

    The Wnt coreceptors Lrp5 and Lrp6 are essential for normal postnatal bone accrual and osteoblast function. In this study, we identify a previously unrecognized skeletal function unique to Lrp5 that enables osteoblasts to oxidize fatty acids. Mice lacking the Lrp5 coreceptor specifically in osteoblasts and osteocytes exhibit the expected reductions in postnatal bone mass but also exhibit an increase in body fat with corresponding reductions in energy expenditure. Conversely, mice expressing a high bone mass mutant Lrp5 allele are leaner with reduced plasma triglyceride and free fatty acid levels. In this context, Wnt-initiated signals downstream of Lrp5, but not the closely related Lrp6 coreceptor, regulate the activation of β-catenin and thereby induce the expression of key enzymes required for fatty acid β-oxidation. These results suggest that Wnt-Lrp5 signaling regulates basic cellular activities beyond those associated with fate specification and differentiation in bone and that the skeleton influences global energy homeostasis via mechanisms independent of osteocalcin and glucose metabolism. PMID:25802278

  4. Membrane bile acid receptor TGR5 predicts good prognosis in ampullary adenocarcinoma patients with hyperbilirubinemia

    PubMed Central

    Chen, Min-Chan; Chen, Yi-Ling; Wang, Tzu-Wen; Hsu, Hui-Ping; Lai, Ming-Derg

    2016-01-01

    Bile acids are potential carcinogens in gastrointestinal cancer, and interact with nuclear and membrane receptors to initiate downstream signaling. The effect of TGR5 [also known as G protein-coupled bile acid receptor 1 (GPBAR1)] on cancer progression is dependent on the tissue where it is activated. In this report, the function of TGR5 expression in cancer was studied using a bioinformatic approach. TGR5 expression in ampullary adenocarcinoma and normal duodenum was compared by western blotting, reverse transcription polymerase chain reaction, and immunohistochemistry (IHC). High GPBAR1 gene expression was found to be an indicator of worse prognosis in gastric and breast cancer patients, and an indication of better prognosis in ovarian cancer patients. The level of GPBAR1 gene expression was higher in bile-acid exposed cancer than in other types of cancer, and was increased in well-differentiated ampullary adenocarcinoma. Negative, weak or mild expression of TGR5 was correlated with younger age, higher plasma level of total/direct bilirubin, higher plasma concentration of CA-125, advanced tumor stage and advanced AJCC TNM stage. The disease-specific survival rate was highest in ampullary adenocarcinoma patients with high TGR5 expression and high total bilirubin level. In summary, TGR5 functions as a tumor-suppressor in patients with ampullary adenocarcinoma and preoperative hyperbilirubinemia. Further study of the suppressive mechanism may provide a new therapeutic option for patients with ampullary adenocarcinoma. PMID:27510297

  5. Membrane bile acid receptor TGR5 predicts good prognosis in ampullary adenocarcinoma patients with hyperbilirubinemia.

    PubMed

    Chen, Min-Chan; Chen, Yi-Ling; Wang, Tzu-Wen; Hsu, Hui-Ping; Lai, Ming-Derg

    2016-10-01

    Bile acids are potential carcinogens in gastrointestinal cancer, and interact with nuclear and membrane receptors to initiate downstream signaling. The effect of TGR5 [also known as G protein-coupled bile acid receptor 1 (GPBAR1)] on cancer progression is dependent on the tissue where it is activated. In this report, the function of TGR5 expression in cancer was studied using a bioinformatic approach. TGR5 expression in ampullary adenocarcinoma and normal duodenum was compared by western blotting, reverse transcription polymerase chain reaction, and immunohistochemistry (IHC). High GPBAR1 gene expression was found to be an indicator of worse prognosis in gastric and breast cancer patients, and an indication of better prognosis in ovarian cancer patients. The level of GPBAR1 gene expression was higher in bile‑acid exposed cancer than in other types of cancer, and was increased in well-differentiated ampullary adenocarcinoma. Negative, weak or mild expression of TGR5 was correlated with younger age, higher plasma level of total/direct bilirubin, higher plasma concentration of CA-125, advanced tumor stage and advanced AJCC TNM stage. The disease-specific survival rate was highest in ampullary adenocarcinoma patients with high TGR5 expression and high total bilirubin level. In summary, TGR5 functions as a tumor-suppressor in patients with ampullary adenocarcinoma and preoperative hyperbilirubinemia. Further study of the suppressive mechanism may provide a new therapeutic option for patients with ampullary adenocarcinoma. PMID:27510297

  6. Targeted delivery of 5-fluorouracil to cholangiocarcinoma cells using folic acid as a targeting agent.

    PubMed

    Ngernyuang, Nipaporn; Seubwai, Wunchana; Daduang, Sakda; Boonsiri, Patcharee; Limpaiboon, Temduang; Daduang, Jureerut

    2016-03-01

    There are limits to the standard treatment for cholangiocarcinoma (CCA) including drug resistance and side effects. The objective of this study was to develop a new technique for carrying drugs by conjugation with gold nanoparticles and using folic acid as a targeting agent in order to increase drug sensitivity. Gold nanoparticles (AuNPs) were functionalized with 5-fluorouracil (5FU) and folic acid (FA) using polyethylene glycol (PEG) shell as a linker (AuNPs-PEG-5FU-FA). Its cytotoxicity was tested in CCA cell lines (M139 and M213) which express folic acid receptor (FA receptor). The results showed that AuNPs-PEG-5FU-FA increased the cytotoxic effects in the M139 and M213 cells by 4.76% and 7.95%, respectively compared to those treated with free 5FU+FA. It is found that the cytotoxicity of the AuNPs-PEG-5FU-FA correlates with FA receptor expression suggested the use of FA as a targeted therapy. The mechanism of cytotoxicity was mediated via mitochondrial apoptotic pathway as determined by apoptosis array. In conclusion, our findings shed some light on the use of gold nanoparticles for conjugation with potential compounds and FA as targeted therapy which contribute to the improvement of anti-cancer drug efficacy. In vivo study should be warranted for its effectiveness of stability, biosafety and side effect reduction. PMID:26706547

  7. Liver δ-aminolevulinate dehydratase activity is inhibited by neonicotinoids and restored by antioxidant agents.

    PubMed

    Sauer, Elisa; Moro, Angela M; Brucker, Natália; Nascimento, Sabrina; Gauer, Bruna; Fracasso, Rafael; Gioda, Adriana; Beck, Ruy; Moreira, José C F; Eifler-Lima, Vera Lucia; Garcia, Solange Cristina

    2014-11-01

    Neonicotinoids represent the most used class of insecticides worldwide, and their precursor, imidacloprid, is the most widely marketed. The aim of this study was to evaluate the effect of imidacloprid on the activity of hepatic δ-aminolevulinate dehydratase (δ-ALA-D), protective effect of potential antioxidants against this potential effect and presence of chemical elements in the constitution of this pesticide. We observed that δ-ALA-D activity was significantly inhibited by imidacloprid at all concentrations tested in a dose-dependent manner. The IC50 value was obtained and used to evaluate the restoration of the enzymatic activity. δ-ALA-D inhibition was completely restored by addition of dithiotreitol (DTT) and partly by ZnCl2, demonstrating that the inhibition occurs by oxidation of thiol groups and by displacement of the Zn (II), which can be explained by the presence of chemical elements found in the constitution of pesticides. Reduced glutathione (GSH) had the best antioxidant effect against to δ-ALA-D inhibition caused by imidacloprid, followed by curcumin and resveratrol. It is well known that inhibition of the enzyme δ-ALA-D may result in accumulation of its neurotoxic substrate (δ-ALA), in this line, our results suggest that further studies are needed to investigate the possible neurotoxicity induced by neonicotinoids and the involvement of antioxidants in cases of poisoning by neonicotinoids. PMID:25402564

  8. Acne treatment by methyl aminolevulinate photodynamic therapy with red light vs. intense pulsed light.

    PubMed

    Hong, Jong Soo; Jung, Jae Yoon; Yoon, Ji Young; Suh, Dae Hun

    2013-05-01

    Various methods of photodynamic therapy (PDT) for acne have been introduced. However, comparative studies among them are still needed. We performed this study to compare the effect of methyl aminolevulinate (MAL) PDT for acne between red light and intense pulsed light (IPL). Twenty patients were enrolled in this eight-week, prospective, split-face study. We applied MAL cream over the whole face with a three-hour incubation time. Then patients were irradiated with 22 J/cm(2) of red light on one-half of the face and 8-10 J/cm(2) of IPL on the other half during each treatment session. We performed three treatment sessions at two-week intervals and followed-up patients until four weeks after the last session. Inflammatory and non-inflammatory acne lesions were reduced significantly on both sides. The red light side showed a better response than the IPL side after the first treatment. Serious adverse effects after treatment were not observed. MAL-PDT with red light and IPL are both an effective and safe modality in acne treatment. Red light showed a faster response time than IPL. After multiple sessions, both light sources demonstrated satisfactory results. We suggest that reducing the total dose of red light is desirable when performing MAL-PDT in Asian patients with acne compared with Caucasians.

  9. Dermoscopy and methyl aminolevulinate: A study for detection and evaluation of field cancerization.

    PubMed

    Rossi, A; Garelli, V; Pranteda, G; Cardone, M; Anzalone, A; Fortuna, M C; Di Nunno, D; Mari, E; De Vita, G; Carlesimo, M

    2016-09-01

    Actinic keratosis (AK) is a keratinocyte intraepidermal neoplasia UV light-induced that frequently appears in sun-exposed areas of the skin. Although historically AK was defined as "precancerous", actually it is considered as the earliest stage of squamous cell carcinoma (SCC) in situ. Since AKs can progress into invasive SCC, their treatment is recommended. AKs rarely develop as a single lesion; usually multiple lesions commonly affect an entire area of chronically actinic damaged skin. This has led to the concept of "field cancerization", an area chronically sun-exposed that surrounds peripherally visible lesions, in which are individualized subclinical alterations. One of the main principles endpoint in the management of AKs is the evaluation and the treatment of field cancerization. In this view, in order to detect and quantify field cancerization, we employed a method based on the topical application of methyl aminolevulinate (MAL) and the detection of the fluorescence emitted by its metabolite Protoporphyrin IX (PpIX); then, considering the extension and the intensity of measured fluorescence, we create a score of field cancerization. The results show that patients underwent to daylight PDT had a reduction of total score, from T0 to T2. Whereas in the group untreated we observed a stability of total score or a slightly worse. So, the method and the score used allows to evaluate with a good approximation the dimension of field cancerization and show the modification of it after treatment. PMID:27344021

  10. In vitro study on methemoglobin formation in erythrocytes following hexyl-aminolevulinate induced photodynamic therapy

    NASA Astrophysics Data System (ADS)

    Larsen, Eivind L. P.; Randeberg, Lise L.; Gederaas, Odrun A.; Krokan, Hans E.; Hjelme, Dag R.; Svaasand, Lars O.

    2007-02-01

    Photodynamic therapy (PDT) is a treatment modality which has been shown to be effective for both malignant and non-malignant diseases. New photosensitizers such as hexyl-aminolevulinate (HAL) may increase the efficiency of PDT. HAL penetrates into the cell where the photosensitizer protoporphyrin IX (PPIX) is produced endogenously. In a previous study on HAL based PDT treatment of rat bladder cancer (AY-27 transitional cell carcinoma), a depression of the optical reflectance spectra after treatment was observed in some of the animals. This depression of the spectra was caused by metHemoglobin (metHb). MetHb is an indication of oxidative stress, and can be formed as a result of for instance UV-radiation and heating of blood. The aim of this study was to identify if metHb can be formed in vitro as a result of oxidative stress caused by singlet oxygen and ROS produced during PDT. Methemoglobin formed during PDT might thus be used as an indirect measure of the photochemical processes. This may help predict the PDT treatment outcome. Red blood cells mixed with AY-27 cells exposed to HAL, or PPIX received light treatment, and the changes in the absorption spectra were measured spectrophotometrically. The methemoglobin absorbance spectrum was also studied, and found to be strongly dependant on pH. Hemolysis of erythrocytes by PDT was found, however no metHb was formed in vitro.

  11. Liver δ-Aminolevulinate Dehydratase Activity is Inhibited by Neonicotinoids and Restored by Antioxidant Agents

    PubMed Central

    Sauer, Elisa; Moro, Angela M.; Brucker, Natália; Nascimento, Sabrina; Gauer, Bruna; Fracasso, Rafael; Gioda, Adriana; Beck, Ruy; Moreira, José C. F.; Eifler-Lima, Vera Lucia; Garcia, Solange Cristina

    2014-01-01

    Neonicotinoids represent the most used class of insecticides worldwide, and their precursor, imidacloprid, is the most widely marketed. The aim of this study was to evaluate the effect of imidacloprid on the activity of hepatic δ-aminolevulinate dehydratase (δ-ALA-D), protective effect of potential antioxidants against this potential effect and presence of chemical elements in the constitution of this pesticide. We observed that δ-ALA-D activity was significantly inhibited by imidacloprid at all concentrations tested in a dose-dependent manner. The IC50 value was obtained and used to evaluate the restoration of the enzymatic activity. δ-ALA-D inhibition was completely restored by addition of dithiotreitol (DTT) and partly by ZnCl2, demonstrating that the inhibition occurs by oxidation of thiol groups and by displacement of the Zn (II), which can be explained by the presence of chemical elements found in the constitution of pesticides. Reduced glutathione (GSH) had the best antioxidant effect against to δ-ALA-D inhibition caused by imidacloprid, followed by curcumin and resveratrol. It is well known that inhibition of the enzyme δ-ALA-D may result in accumulation of its neurotoxic substrate (δ-ALA), in this line, our results suggest that further studies are needed to investigate the possible neurotoxicity induced by neonicotinoids and the involvement of antioxidants in cases of poisoning by neonicotinoids. PMID:25402564

  12. An overview of a 5-year research program on acid deposition in China

    NASA Astrophysics Data System (ADS)

    Wang, T.; He, K.; Xu, X.; Zhang, P.; Bai, Y.; Wang, Z.; Zhang, X.; Duan, L.; Li, W.; Chai, F.

    2011-12-01

    Despite concerted research and regulative control of sulfur dioxide in China, acid rain remained a serious environmental issue, due to a sharp increase in the combustion of fossil fuel in the 2000s. In 2005, the Ministry of Science and Technology of China funded a five-year comprehensive research program on acid deposition. This talk will give an overview of the activities and the key findings from this study, covering emission, atmospheric processes, and deposition, effects on soil and stream waters, and impact on typical trees/plants in China. The main results include (1) China still experiences acidic rainfalls in southern and eastern regions, although the situation has stabilized after 2006 due to stringent control of SO2 by the Chinese Government; (2) Sulfate is the dominant acidic compound, but the contribution of nitrate has increased; (3) cloud-water composition in eastern China is strongly influenced by anthropogenic emissions; (4) the persistent fall of acid rain in the 30 years has lead to acidification of some streams/rivers and soils in southern China; (5) the studied plants have shown varying response to acid rain; (6) some new insights have been obtained on atmospheric chemistry, atmospheric transport, soil chemistry, and ecological impacts, some of which will be discussed in this talk. Compared to the situation in North America and Europe, China's acid deposition is still serious, and continued control of sulfur and nitrogen emission is required. There is an urgent need to establish a long-term observation network/program to monitor the impact of acid deposition on soil, streams/rivers/lakes, and forests.

  13. A dual inhibitor of cyclooxygenase and 5-lipoxygenase protects against kainic acid-induced brain injury.

    PubMed

    Minutoli, Letteria; Marini, Herbert; Rinaldi, Mariagrazia; Bitto, Alessandra; Irrera, Natasha; Pizzino, Gabriele; Pallio, Giovanni; Calò, Margherita; Adamo, Elena Bianca; Trichilo, Vincenzo; Interdonato, Monica; Galfo, Federica; Squadrito, Francesco; Altavilla, Domenica

    2015-06-01

    Systemic administration of kainic acid causes inflammation and apoptosis in the brain, resulting in neuronal loss. Dual cyclooxygenase/5-lipoxygenase (COX/5-LOX) inhibitors could represent a possible neuroprotective approach in preventing glutamate excitotoxicity. Consequently, we investigated the effects of a dual inhibitor of COX/5-LOX following intraperitoneal administration of kainic acid (KA, 10 mg/kg) in rats. Animals were randomized to receive either the dual inhibitor of COX/5-LOX (flavocoxid, 20 mg/kg i.p.) or its vehicle (1 ml/kg i.p.) 30 min after KA administration. Sham brain injury rats were used as controls. We evaluated protein expression of phosphorylated extracellular signal-regulated kinase (p-ERK1/2) and tumor necrosis factor alpha (TNF-α) as well as levels of malondialdehyde (MDA), prostaglandin E2 (PGE2) and leukotriene B4 (LTB4) in the hippocampus. Animals were also observed for monitoring behavioral changes according to Racine Scale. Finally, histological analysis and brain edema evaluation were carried out. Treatment with the dual inhibitor of COX/5-LOX decreased protein expression of p-ERK1/2 and TNF-α in hippocampus, markedly reduced MDA, LTB4 and PGE2 hippocampal levels, and also ameliorated brain edema. Histological analysis showed a reduction in cell damage in rats treated with the dual inhibitor of COX/5-LOX, particularly in hippocampal subregion CA3c. Moreover, flavocoxid significantly improved behavioral signs following kainic acid administration. Our results suggest that dual inhibition of COX/5-LOX by flavocoxid has neuroprotective effects during kainic acid-induced excitotoxicity. PMID:25893744

  14. Synthesis, aggregation behavior and cholesterol solubilization studies of 16-epi-pythocholic acid (3 alpha,12 alpha,16 beta-trihydroxy-5 beta-cholan-24-oic acid).

    PubMed

    Nonappa; Maitra, Uday

    2010-07-01

    Synthesis, aggregation behavior and in vitro cholesterol solubilization studies of 16-epi-pythocholic acid (3 alpha,12 alpha,16 beta-trihydroxy-5 beta-cholan-24-oic acid, EPCA) are reported. The synthesis of this unnatural epimer of pythocholic acid (3 alpha,12 alpha,16 alpha-trihydroxy-5 beta-cholan-24-oic acid, PCA) involves a series of simple and selective chemical transformations with an overall yield of 21% starting from readily available cholic acid (CA). The critical micellar concentration (CMC) of 16-epi-pythocholate in aqueous media was determined using pyrene as a fluorescent probe. In vitro cholesterol solubilization ability was evaluated using anhydrous cholesterol and results were compared with those of other natural di- and trihydroxy bile acids. These studies showed that 16-epi-pythocholic acid (16 beta-hydroxy-deoxycholic acid) behaves similar to cholic acid (CA) and avicholic acid (3 alpha,7 alpha,16 alpha-trihydroxy-5 beta-cholan-24-oic acid, ACA) in its aggregation behavior and cholesterol dissolution properties.

  15. Structure and simulation of a Zundel ion stabilized by 8-hydroxyquinoline-5, 7 disulphonic acid

    NASA Astrophysics Data System (ADS)

    Venkatakrishnan, Hasthi Annapurna; Venkatakrishnan, Ramaseshan; Pennathur, Anuj Krishnasundar; Pennathur, Gautam

    2016-07-01

    8-hydroxyquinoline-5, 7 disulphonic was synthesized and recrystallized in methanol to strip away molecules of water. The structure of the molecule revealed that Zundel ion was stabilized in the crystal. Ab-initio molecular dynamics simulation was then carried out to understand the dynamics of proton hopping in this complex. During the course of simulation, the Zundel ion coordinates with a water molecule to form an open H7O3+ structure. This transition state structure de-solvated rapidly forming Zundel ion facilitating proton hopping in the first solvation shell. One of the sulphonic acid groups in the 5 or 7 position of the 8-hydroxyquinoline 5,7 disulphonic acid bonds with the Zundel ion favoring the proton to be transferred to the nearby water molecule through the formation of proton defects. The simulation results support the structural diffusion mechanism and that charged complex migrates through the hydrogen bond network.

  16. 2-Amino-5-bromo­pyridine–benzoic acid (1/1)

    PubMed Central

    Hemamalini, Madhukar; Fun, Hoong-Kun

    2010-01-01

    In the title adduct, C5H5BrN2·C7H6O2, the carboxyl group of the benzoic acid mol­ecule is twisted away from the attached ring by 12.97 (11)°. The 2-amino-5-bromo­pyridine mol­ecules inter­act with the carboxylic group of neighbouring benzoic acid mol­ecules through N—H⋯O and O—H⋯N hydrogen bonds, forming cyclic R 2 2(8) hydrogen-bonded motifs and linking the mol­ecules into a two-dimensional network lying parallel to (100). The crystal structure is further stabilized by weak C—H⋯O hydrogen bonds. PMID:21580411

  17. Reduction of 3 alpha-hydroxy-5 beta-chol-6-en-24-oic acid to lithocholic acid in rats

    SciTech Connect

    Kimura, K.; Ogura, M.

    1988-03-01

    After (24-/sup 14/C)delta 6-lithocholic acid was injected into the cecum of rats, (/sup 14/C)lithocholic acid was identified as a metabolite in feces. When the labeled delta 6-bile acid was injected intraperitoneally into bile-fistula rats, radioactivity excreted in bile was contained most abundantly in the taurine-conjugated fraction of bile acids. In the fraction, taurine conjugate of (/sup 14/C)delta 6-lithocholic acid but of neither (/sup 14/C)lithocholic acid nor other bile acids was found. The results showed that (24-/sup 14/C)delta 6-lithocholic acid was reduced to (/sup 14/C)lithocholic acid by the intestinal flora but not by the liver, which, however, was capable of conjugating delta 6-lithocholic acid with taurine.

  18. Endoscopy imaging of 5-ALA-induced PPIX fluorescence for detecting early neoplasms in the oral cavity

    NASA Astrophysics Data System (ADS)

    Zheng, Wei; Olivo, Malini; Sivanandan, Ranjiv; Karuman, Philip; Lim, Tuan-Kay; Soo, K. C.

    2001-10-01

    A digitized fluorescence endoscopy imaging system combined with 5-Aminolevulinic Acid (5-ALA) induced Protoporphyrin IX (PPIX) has been developed for the detection of neoplasms in oral cavity. It mainly consists of the illumination console, fluorescence detection unit, computer system for image acquisition, processing and analysis, and online image display system as well. The developed system can produce both the digital and video fluorescence images in real time, and can be used to quantify fluorescence images acquired. Preliminary results from the Head and Neck clinic show that high sensitivity and high specificity can be achieved. Furthermore, applying the intensity ratios at two different wavelength regions, the developed system shows the capability of differentiating between different histopathological stages of oral lesions, suggesting a significant potential for realizing the non-invasive optical biopsy for early cancer diagnosis.

  19. Assembling supramolecular networks by halogen bonding in coordination polymers driven by 5-bromonicotinic acid

    SciTech Connect

    Gu, Jin-Zhong; Wu, Jiang; Kirillov, Alexander M.; Lv, Dong-Yu; Tang, Yu; Wu, Jin-Cai

    2014-05-01

    A series of six coordination compounds ([Zn(5-Brnic){sub 2}]·1.5H{sub 2}O){sub n} (1), [Cd(5-Brnic){sub 2}]{sub n} (2), [Co(5-Brnic){sub 2}(H{sub 2}O){sub 2}]{sub n} (3), [Zn(5-Brnic){sub 2}(H{sub 2}biim)]{sub n} (4), ([Cd(5-Brnic){sub 2}(phen)]·H{sub 2}O){sub n} (5), and [Pb(5-Brnic){sub 2}(phen)] (6) have been generated by the hydrothermal method from the metal(II) nitrates, 5-bromonicotinic acid (5-BrnicH), and an optional ancillary 1,10-phenanthroline (phen) or 2,2′-biimidazole (H{sub 2}biim) ligand. All the products 1–6 have been characterized by IR spectroscopy, elemental, thermal, powder and single-crystal X-ray diffraction analyses. Their 5-bromonicotinate-driven structures vary from the 3D metal-organic framework with the seh-3,5-P21/c topology (in 2) and the 2D interdigitated layers with the sql topology (in 1 and 3), to the 1D chains (in 4 and 5) and the 0D discrete monomers (in 6). The 5-bromonicotinate moiety acts as a versatile building block and its tethered bromine atom plays a key role in reinforcing and extending the structures into diverse 3D supramolecular networks via the various halogen bonding Br⋯O, Br⋯Br, and Br⋯π interactions, as well as the N–H⋯O and C–H⋯O hydrogen bonds. The obtained results demonstrate a useful guideline toward engineering the supramolecular architectures in the coordination network assembly under the influence of various halogen bonding interactions. The luminescent (for 1, 2, 4, 5, and 6) and magnetic (for 3) properties have also been studied and discussed in detail. - Graphical abstract: Six coordination compounds driven by 5-bromonicotinic acid have been generated and structurally characterized, revealing diverse metal-organic networks that are further reinforced and extended via various halogen bonding interactions. - Highlights: • 5-Bromonicotinic acid is a versatile ligand for Zn, Cd, Co and Pb derivatives. • Careful selection of co-ligands and metals resulted in different network

  20. Inhibitory effects of gallic acid ester derivatives on Saccharomyces cerevisiae multidrug resistance protein Pdr5p.

    PubMed

    Pereira Rangel, Luciana; Fritzen, Márcio; Yunes, Rosendo Augusto; Leal, Paulo César; Creczynski-Pasa, Tânia Beatriz; Ferreira-Pereira, Antônio

    2010-05-01

    Overexpression of the Saccharomyces cerevisiae ABC transporter Pdr5p confers resistance to a range of structurally unrelated xenobiotics. This property allows Pdr5p to be used as a target for novel multidrug resistance reversal reagents or chemosensitizers. Herein, we report the effects of gallic acid derivatives with substitutions either on the ester moiety or in the benzene ring on the activity of Pdr5p. Compounds with a longer side chain (8-16 carbons) resulted in greater inhibition of Pdr5p ATPase. Derivatives with side chains of 8-12 carbons that retained hydroxyl groups on the benzene ring extensively inhibited Pdr5p ATPase activity. These compounds almost completely inhibited the efflux of the Pdr5p fluorescent substrate Rhodamine 6G and at 25 muM chemosensitized the Pdr5p-overexpressing strain AD124567 to fluconazole (0.4 mg mL(-1)). Gallic acid derivatives may be a new class of Pdr5p inhibitors.

  1. Optimal level of purple acid phosphatase5 is required for maintaining complete resistance to Pseudomonas syringae

    PubMed Central

    Ravichandran, Sridhar; Stone, Sophia L.; Benkel, Bernhard; Zhang, Junzeng; Berrue, Fabrice; Prithiviraj, Balakrishnan

    2015-01-01

    Plants possess an exceedingly complex innate immune system to defend against most pathogens. However, a relative proportion of the pathogens overcome host's innate immunity and impair plant growth and productivity. We previously showed that mutation in purple acid phosphatase (PAP5) lead to enhanced susceptibility of Arabidopsis to the bacterial pathogen Pseudomonas syringae pv. tomato DC3000 (Pst DC3000). Here, we report that an optimal level of PAP5 is crucial for mounting complete basal resistance. Overexpression of PAP5 impaired ICS1, PR1 expression and salicylic acid (SA) accumulation similar to pap5 knockout mutant plants. Moreover, plant overexpressing PAP5 was impaired in H2O2 accumulation in response to Pst DC3000. PAP5 is localized in to peroxisomes, a known site of generation of reactive oxygen species for activation of defense responses. Taken together, our results demonstrate that optimal levels of PAP5 is required for mounting resistance against Pst DC3000 as both knockout and overexpression of PAP5 lead to compromised basal resistance. PMID:26300891

  2. Theoretical stusy of the reaction between 2,2',4' - trihydroxyazobenzene-5-sulfonic acid and zirconium

    USGS Publications Warehouse

    Fletcher, Mary H.

    1960-01-01

    Zirconium reacts with 2,2',4'-trihydroxyazobenzene-5-sulfonic acid in acid solutions to Form two complexes in which the ratios of dye to zirconium are 1 to 1 and 2 to 1. Both complexes are true chelates, with zirconium acting as a bridge between the two orthohydroxy dye groups. Apparent equilibrium constants for the reactions to form each of the complexes are determined. The reactions are used as a basis for the determination of the active component in the dye and a graphical method for the determination of reagent purity is described. Four absorption spectra covering the wave length region from 350 to 750 mu are given, which completely define the color system associated with the reactions in solutions where the hydrochloric acid concentration ranges from 0.0064N to about 7N.

  3. Development of betulinic acid as an agonist of TGR5 receptor using a new in vitro assay

    PubMed Central

    Lo, Shih-Hsiang; Cheng, Kai-Chung; Li, Ying-Xiao; Chang, Chin-Hong; Cheng, Juei-Tang; Lee, Kung-Shing

    2016-01-01

    Background G-protein-coupled bile acid receptor 1, also known as TGR5 is known to be involved in glucose homeostasis. In animal models, treatment with a TGR5 agonist induces incretin secretion to reduce hyperglycemia. Betulinic acid, a triterpenoid present in the leaves of white birch, has been introduced as a selective TGR5 agonist. However, direct activation of TGR5 by betulinic acid has not yet been reported. Methods Transfection of TGR5 into cultured Chinese hamster ovary (CHO-K1) cells was performed to establish the presence of TGR5. Additionally, TGR5-specific small interfering RNA was employed to silence TGR5 in cells (NCI-H716 cells) that secreted incretins. Uptake of glucose by CHO-K1 cells was evaluated using a fluorescent indicator. Amounts of cyclic adenosine monophosphate and glucagon-like peptide were quantified using enzyme-linked immunosorbent assay kits. Results Betulinic acid dose-dependently increases glucose uptake by CHO-K1 cells transfected with TGR5 only, which can be considered an alternative method instead of radioligand binding assay. Additionally, signals coupled to TGR5 activation are also increased by betulinic acid in cells transfected with TGR5. In NCI-H716 cells, which endogenously express TGR5, betulinic acid induces glucagon-like peptide secretion via increasing calcium levels. However, the actions of betulinic acid were markedly reduced in NCI-H716 cells that received TGR5-silencing treatment. Therefore, the present study demonstrates the activation of TGR5 by betulinic acid for the first time. Conclusion Similar to the positive control lithocholic acid, which is the established agonist of TGR5, betulinic acid has been characterized as a useful agonist of TGR5 and can be used to activate TGR5 in the future. PMID:27578964

  4. 40 CFR 721.10108 - Naphthalenedisulfonic acid, hydrozy-[[[(hydroxyl-disulfo-naphthaleneyl)azo]-alkyl(C=1-5...

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...- -alkyl(C=1-5)-(sulfoalkoxy)cyclic]azo]-substituted azo-, metal salt (generic). 721.10108 Section 721... Naphthalenedisulfonic acid, hydrozy- -alkyl(C=1-5)-(sulfoalkoxy)cyclic]azo]-substituted azo-, metal salt (generic). (a... generically as naphthalenedisulfonic acid, hydrozy- -alkyl(C=1-5)-(sulfoalkoxy)cyclic]azo]-substituted...

  5. 40 CFR 721.10108 - Naphthalenedisulfonic acid, hydrozy-[[[(hydroxyl-disulfo-naphthaleneyl)azo]-alkyl(C=1-5...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...- -alkyl(C=1-5)-(sulfoalkoxy)cyclic]azo]-substituted azo-, metal salt (generic). 721.10108 Section 721... Naphthalenedisulfonic acid, hydrozy- -alkyl(C=1-5)-(sulfoalkoxy)cyclic]azo]-substituted azo-, metal salt (generic). (a... generically as naphthalenedisulfonic acid, hydrozy- -alkyl(C=1-5)-(sulfoalkoxy)cyclic]azo]-substituted...

  6. 40 CFR 721.10108 - Naphthalenedisulfonic acid, hydrozy-[[[(hydroxyl-disulfo-naphthaleneyl)azo]-alkyl(C=1-5...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...- -alkyl(C=1-5)-(sulfoalkoxy)cyclic]azo]-substituted azo-, metal salt (generic). 721.10108 Section 721... Naphthalenedisulfonic acid, hydrozy- -alkyl(C=1-5)-(sulfoalkoxy)cyclic]azo]-substituted azo-, metal salt (generic). (a... generically as naphthalenedisulfonic acid, hydrozy- -alkyl(C=1-5)-(sulfoalkoxy)cyclic]azo]-substituted...

  7. 5-fluoro-orotic acid induces chromosome alterations in genetically manipulated strains of Candida albicans.

    PubMed

    Wellington, Melanie; Kabir, M Anaul; Rustchenko, Elena

    2006-01-01

    We previously reported the occurrence of chromosome alterations in a Candida albicans prototrophic strain 3153A treated with 5-fluoro-orotic acid (5-FOA). In this study we investigated the mutagenic properties of 5-FOA with two derivatives of C. albicans strain CAF4-2 (ura3/ura3), each containing an ectopic copy of URA3 gene (ura3/ ura3 URA3) on a different chromosome. As expected, after the ura3/ura3 URA3 constructs were applied to 5-FOA containing solid medium, the "pop-outs" that lost URA3 appeared. However most of the "pop-outs" acquired various chromosome alterations. Thus constructs exposed to 5-FOA should be examined for chromosome alterations or the use of 5-FOA should be avoided. PMID:17040068

  8. Tannic Acid Inhibits Hepatitis C Virus Entry into Huh7.5 Cells

    PubMed Central

    Hagedorn, Curt H.

    2015-01-01

    Chronic infection with the hepatitis C virus (HCV) is a cause of cirrhosis and hepatocellular carcinoma worldwide. Although antiviral therapy has dramatically improved recently, a number of patients remain untreated and some do not clear infection with treatment. Viral entry is an essential step in initiating and maintaining chronic HCV infections. One dramatic example of this is the nearly 100% infection of newly transplanted livers in patients with chronic hepatitis C. HCV entry inhibitors could play a critical role in preventing HCV infection of newly transplanted livers. Tannic acid, a polymer of gallic acid and glucose molecules, is a plant-derived polyphenol that defends some plants from insects and microbial infections. It has been shown to have a variety of biological effects, including antiviral activity, and is used as a flavoring agent in foods and beverages. In this study, we demonstrate that tannic acid is a potent inhibitor of HCV entry into Huh7.5 cells at low concentrations (IC50 5.8 μM). It also blocks cell-to-cell spread in infectious HCV cell cultures, but does not inhibit HCV replication following infection. Moreover, experimental results indicate that tannic acid inhibits an early step of viral entry, such as the docking of HCV at the cell surface. Gallic acid, tannic acid’s structural component, did not show any anti-HCV activity including inhibition of HCV entry or replication at concentrations up to 25 μM. It is possible the tannin structure is related on the effect on HCV inhibition. Tannic acid, which is widely distributed in plants and foods, has HCV antiviral activity in cell culture at low micromolar concentrations, may provide a relative inexpensive adjuvant to direct-acting HCV antivirals and warrants future investigation. PMID:26186636

  9. Inhibitory effect of unconjugated bile acids on the intestinal transport of 5-methyltetrahydrofolate in rat jejunum in vitro.

    PubMed Central

    Said, H M; Hollander, D; Strum, W B

    1984-01-01

    The effect of the unconjugated bile acids, cholic, deoxycholic, chenodeoxycholic, and ursodeoxycholic acids, and of the conjugated bile acid taurocholic acid on the mucosal-to-serosal transport and tissue uptake of the naturally occurring folate derivative, 5-methyltetrahydrofolate (5-CH3H4PteGlu) was examined in everted sacs of rat jejunum. Each of the unconjugated bile acids examined inhibited the transport and tissue uptake of 5-CH3H4PteGlu in a concentration dependent manner. At low concentrations (0.01-0.1 mM) of cholic and deoxycholic acids, no structural or functional damage to the intestinal mucosa occurred and the transport of 5-CH3H4PteGlu was inhibited competitively with Ki values of 0.114 mM and 0.055 mM for cholic and deoxycholic acids, respectively. The greater inhibition of 5-CH3H4PteGlu transport by unconjugated bile acids at 1 mM can be attributed to observed structural and functional damage to the intestinal mucosa. The addition of 2 mM lecithin to the mucosal medium failed to prevent the inhibitory effect of 0.1 mM deoxycholic acid on the transport of 0.5 microM 5-CH3H4PteGlu. Compared with the effect of unconjugated bile acids, the conjugated bile acid taurocholic acid (0.01-5 mM) showed no effect on the transport and tissue uptake of 5-CH3H4PteGlu. The results of this study show that intestinal transport and tissue uptake of 5-CH3H4PteGlu are inhibited by unconjugated bile acids in a dose-dependent fashion. The clinical and physiological implications of these observations are discussed. PMID:6510770

  10. The Arabidopsis LYST INTERACTING PROTEIN 5 Acts in Regulating Abscisic Acid Signaling and Drought Response.

    PubMed

    Xia, Zongliang; Huo, Yongjin; Wei, Yangyang; Chen, Qiansi; Xu, Ziwei; Zhang, Wei

    2016-01-01

    Multivesicular bodies (MVBs) are unique endosomes containing vesicles in the lumens and play essential roles in many eukaryotic cellular processes. The Arabidopsis LYST INTERACTING PROTEIN 5 (LIP5), a positive regulator of MVB biogenesis, has critical roles in biotic and abiotic stress responses. However, whether the abscisic acid (ABA) signaling is involved in LIP5-mediated stress response is largely unknown. Here, we report that LIP5 functions in regulating ABA signaling and drought response in Arabidopsis. Analyses of a LIP5 promoter-β-glucuronidase (GUS) construct revealed substantial GUS activity in whole seedlings. The expression of LIP5 was induced by ABA and drought, and overexpression of LIP5 led to ABA hypersensitivity, enhanced stomatal closure, reduced water loss, and, therefore, increased drought tolerance. On the contrary, LIP5 knockdown mutants showed ABA-insensitive phenotypes and reduced drought tolerance; suggesting that LIP5 acts in regulating ABA response. Further analysis using a fluorescent dye revealed that ABA and water stress induced cell endocytosis or vesicle trafficking in a largely LIP5-dependent manner. Furthermore, expression of several drought- or ABA-inducible marker genes was significantly down-regulated in the lip5 mutant seedlings. Collectively, our data suggest that LIP5 positively regulates drought tolerance through ABA-mediated cell signaling. PMID:27313589

  11. 5-amino salicylic acid bound nanoparticles for the therapy of inflammatory bowel disease.

    PubMed

    Pertuit, David; Moulari, Brice; Betz, Thomas; Nadaradjane, Arulraj; Neumann, Dirk; Ismaïli, Lhassane; Refouvelet, Bernard; Pellequer, Yann; Lamprecht, Alf

    2007-11-20

    Nanoparticles (NP) are known for their specific accumulation in the inflamed tissues in the colon and may therefore allow a selective delivery to the site of inflammation including a reduction of adverse effects. 5-amino salicylic acid (5ASA) loaded NP were designed in order to investigate their therapeutic potential in the treatment of inflammatory bowel disease. 5ASA was covalently bound to poly(caprolactone) prior to all formulation steps. Oil/water emulsification or nanoprecipitation methods were used for the NP formulation. Particle diameters were either 200 or 350 nm for emulsification or nanoprecipitation, respectively. In-vitro drug release demonstrated a significant drug retention inside the NP formulation. Toxicity of the different formulations was evaluated on Caco-2 and HEK cell culture which was slightly increased for 5ASA grafted NP in comparison to blank NP (Me5ASA-NP: 75 microg/l; blank NP: 210 microg/l). In-vivo, clinical activity score and myeloperoxidase activity decreased after administration of all 5ASA containing formulations (untreated control: 28.0+/-5.6 U/mg; 5ASA-NP (0.5 mg/kg): 15.2+/-5.6 U/mg; 5ASA solution (30 mg/kg): 16.2+/-3.6 U/mg). NP formulations allowed to lower significantly the dose of 5ASA. These oral NP formulations demonstrated their therapeutic potential and appear to be an interesting approach for the therapy of inflammatory bowel disease.

  12. The Arabidopsis LYST INTERACTING PROTEIN 5 Acts in Regulating Abscisic Acid Signaling and Drought Response

    PubMed Central

    Xia, Zongliang; Huo, Yongjin; Wei, Yangyang; Chen, Qiansi; Xu, Ziwei; Zhang, Wei

    2016-01-01

    Multivesicular bodies (MVBs) are unique endosomes containing vesicles in the lumens and play essential roles in many eukaryotic cellular processes. The Arabidopsis LYST INTERACTING PROTEIN 5 (LIP5), a positive regulator of MVB biogenesis, has critical roles in biotic and abiotic stress responses. However, whether the abscisic acid (ABA) signaling is involved in LIP5-mediated stress response is largely unknown. Here, we report that LIP5 functions in regulating ABA signaling and drought response in Arabidopsis. Analyses of a LIP5 promoter-β-glucuronidase (GUS) construct revealed substantial GUS activity in whole seedlings. The expression of LIP5 was induced by ABA and drought, and overexpression of LIP5 led to ABA hypersensitivity, enhanced stomatal closure, reduced water loss, and, therefore, increased drought tolerance. On the contrary, LIP5 knockdown mutants showed ABA-insensitive phenotypes and reduced drought tolerance; suggesting that LIP5 acts in regulating ABA response. Further analysis using a fluorescent dye revealed that ABA and water stress induced cell endocytosis or vesicle trafficking in a largely LIP5-dependent manner. Furthermore, expression of several drought- or ABA-inducible marker genes was significantly down-regulated in the lip5 mutant seedlings. Collectively, our data suggest that LIP5 positively regulates drought tolerance through ABA-mediated cell signaling. PMID:27313589

  13. Equivalent absorption and in vivo kinetics of tritiated folic acid and 5-formyl-tetrahydrofolic acid in rats

    SciTech Connect

    Bhandari, S.D.; Gregory, J.F. )

    1990-02-26

    The intestinal absorption and in vivo turnover kinetics of ({sup 3}H)folic acid (FA) and (6S)-5-formyl-({sup 3}H)tetrahydrofolate (5-CHO-THF) were examined to determine whether differences exist in the inherent bioavailability of these forms of the vitamin. Following oral administration of 2 {mu}Ci/100 g body weight (in 50 mM sodium ascorbate, pH 7), a biphasic pattern of urinary tritium excretion was observed for each labeled folate. The following kinetic results were obtained (n=9). Little tritium was found in the GI tract after 8 hours, which indicated nearly complete absorption of each folate. HPLC analysis of urine revealed similar excretory patterns over 0-8 days post-dose for each folate administered, and the patterns of hepatic ({sup 3}H)folates were equivalent when examined after 8 hours and 4 days post-dose. These findings indicate that the bioavailability FA and 5-formyl-THF is equivalent.

  14. Kinetic flow-injection analysis of boron using 5-fluorosalicylaldehyde and H-acid.

    PubMed

    Sarenqiqige; Kodani, Takamasa; Kajiwara, Mari; Takehara, Kô; Yoshimura, Kazuhisa

    2014-01-01

    Boric acid reacts with 5-fluorosalicylaldehyde (F-SA) and 8-amino-1-naphthol-3,6-disulfonic acid (HA) to form the boric acid-fluoroazomethine H complex (F-AzB) that is now being used for the flow-injection analysis (FIA) of boric acid. At pH 6.5, the F-AzB complexation proceeded fairly fast, whereas the fluoroazomethine H (F-AzH) formation was slow. Thus, highly sensitive measurement of F-AzB was possible if the reaction time was controlled using the FIA method to decrease the background absorbance of F-AzH at the analytical wavelength. The optimum conditions for the color developing reaction were investigated for single and dual channel systems. The former system was simple, applicable to the determination of boron in reversed osmosis (RO) desalination water with a detection limit (LOD) of 4 μg B dm(-3). For the latter system, the calibration range was 0.005 to 10 mg B dm(-3) with an LOD of 1 μg B dm(-3), which can be applicable to natural water analyses of boron. These methods could analyze 15 - 20 samples in one hour. The results of the boron concentration measurement for water samples from an RO desalination plant, industrial wastewater and river water were in fairly good agreement with those obtained by other methods.

  15. Activation of transmembrane bile acid receptor TGR5 stimulates insulin secretion in pancreatic {beta} cells

    SciTech Connect

    Kumar, Divya P.; Rajagopal, Senthilkumar; Mahavadi, Sunila; Mirshahi, Faridoddin; Grider, John R.; Murthy, Karnam S.; Sanyal, Arun J.

    2012-10-26

    Highlights: Black-Right-Pointing-Pointer G protein coupled receptor TGR5 is expressed in mouse and human islets. Black-Right-Pointing-Pointer TGR5 is coupled to activation of Gs and Ca{sup 2+} release via cAMP/Epac/PLC-{epsilon} pathway. Black-Right-Pointing-Pointer Activation of TGR5 by bile salts and selective ligands causes insulin secretion. Black-Right-Pointing-Pointer TGR5 could be a potential therapeutic target to treat diabetes. -- Abstract: Bile acids act as signaling molecules and stimulate the G protein coupled receptor, TGR5, in addition to nuclear farnesoid X receptor to regulate lipid, glucose and energy metabolism. Bile acid induced activation of TGR5 in the enteroendocrine cells promotes glucagon like peptide-1 (GLP-1) release, which has insulinotropic effect in the pancreatic {beta} cells. In the present study, we have identified the expression of TGR5 in pancreatic {beta} cell line MIN6 and also in mouse and human pancreatic islets. TGR5 selective ligands, oleanolic acid (OA) and INT-777 selectively activated G{alpha}{sub s} and caused an increase in intracellular cAMP and Ca{sup 2+}. OA and INT-777 also increased phosphoinositide (PI) hydrolysis and the increase was blocked by NF449 (a selective G{alpha}{sub s} inhibitor) or (U73122) (PI hydrolysis inhibitor). OA, INT-777 and lithocholic acid increased insulin release in MIN6 and human islets and the increase was inhibited by treatment with NF449, (U73122) or BAPTA-AM (chelator of calcium), but not with myristoylated PKI (PKA inhibitor), suggesting that the release is dependent on G{sub s}/cAMP/Ca{sup 2+} pathway. 8-pCPT-2 Prime -O-Me-cAMP, a cAMP analog, which activates Epac, but not PKA also stimulated PI hydrolysis. In conclusion, our study demonstrates that the TGR5 expressed in the pancreatic {beta} cells regulates insulin secretion and highlights the importance of ongoing therapeutic strategies targeting TGR5 in the control of glucose homeostasis.

  16. Diphenyl diselenide [(PhSe)2] inhibits Drosophila melanogaster delta-aminolevulinate dehydratase (delta-ALA-D) gene transcription and enzyme activity.

    PubMed

    Golombieski, R M; Graichen, D A S; Pivetta, L A; Nogueira, C W; Loreto, E L S; Rocha, J B T

    2008-03-01

    The main objective of the present study was to compare the inhibitory effect of diphenyl diselenide (PhSe)(2) and Pb(2+) on mice and fruit fly delta-Aminolevulinate dehydratase (delta-ALA-D). Optimum pH was quite different for mice (pH 6.5) and flies (pH 8.5). At pH 8.5, the inhibitory potency of (PhSe)(2) was higher for the fruit flies (IC(50) 8.2 micromol/l) than for mice (IC(50) 19.5 micromol/l). Pb(2+) inhibited mice delta-ALA-D at pH 6.5 (IC(50) 6.2 micromol/l) and 8.5 (IC(50) 5.6 micromol/l) with higher potency than the fly enzyme (IC(50) 43.7 micromol/l). delta-ALA-D transcription was reduced by 15% in flies exposed to 0.3 mmol/kg (PhSe)(2), which is similar to the reduction observed in activity measured in the presence of dithiothreitol. The three-dimensional prediction by SWISS-PROT mouse and fly delta-ALA-D revealed differences in the number of hydrogen bonds and turns for the 2 enzymes. Sulfhydryl groups (-SH) that could be oxidized by (PhSe)(2) are conserved in the two sources of enzyme. Distinct responsiveness to pH, (PhSe)(2) and Pb(2+) of these enzymes may be related to subtle differences in tertiary or quaternary structure of mouse and fly delta-ALA-D. Furthermore, mechanism underlying enzyme inhibition after in vivo exposure seems to be different for Drosophila melanogaster and rodent enzymes. PMID:17936691

  17. Structure and polymer form of poly-3-hydroxyalkanoates produced by Pseudomonas oleovorans grown with mixture of sodium octanoate/undecylenic acid and sodium octanoate/5-phenylvaleric acid.

    PubMed

    Ho, I-Ching; Yang, Sheng-Pin; Chiu, Wen-Yen; Huang, Shih-Yow

    2007-01-30

    PHAs (poly-3-hydroxyalkanoates) obtained by Pseudomonas oleovorans grown with mixed carbon sources were investigated. Mixed carbon sources were sodium octanoate/undecylenic acid and sodium octanoate/5-phenylvaleric acid. Effect of carbon source in pre-culture on PHAs structure was investigated. Main fermentation was conducted with mixture of sodium octanoate/undecylenic acid, and PHA contained both saturated and unsaturated units. When more undecylenic acid was used in the medium, the ratio of unsaturated unit increased and the T(g) of the products also changed. The PHA grown with mixture of sodium octanoate and undecylenic acid was a random copolymer, which was determined by DSC analysis. Using mixed carbon sources of sodium octanoate and 5-phenylvaleric acid, highest dry cell weight and PHA concentration were obtained when 0.02g or 0.04g of 5-phenylvaleric acid were added in 50mL medium. Cultured with sodium octanoate and 5-phenylvaleric acid, PHA containing HO (3-hydroxyoctanoate) unit and HPV (3-hydroxy-5-phenylvalerate) unit was produced. T(g) of the products fell between those of pure PHO and pure PHPV. By means of DSC analysis and fractionation method, the PHA obtained was regarded as a random copolymer. PMID:16919325

  18. Acid Functionalized Mesoporous Ordered Materials for the Production of 5-Hydroxymethyfurfural from Carbohydrates

    NASA Astrophysics Data System (ADS)

    Crisci, Anthony J.

    Solid acid catalysts were designed for the conversion of fructose to 5-hydroxymethylfurfural (HMF). Some of the catalysts incorporate thioether groups to promote the tautomerization of fructose to its furanose form, as well as sulfonic acid groups to catalyze its dehydration. A bifunctional silane, 3-((3-(trimethoxysilyl)propyl)thio)propane-1-sulfonic acid (TESAS), was designed for incorporation into SBA-15-type silica by co-condensation. To achieve mesopore ordering in the functionalized silica, the standard SBA-15 synthetic protocol was modified, resulting in well-formed hexagonal particles. Functional groups incorporated into mesoporous silica by co-condensation are more robust under the reaction conditions than those grafted onto a non-porous silica. In a variation, the thioether group of TESAS was oxidized by H2O 2 to the sulfone during the synthesis of the modified SBA-15. The materials were tested in batch reactors and compared in the selective dehydration of fructose to 5-hydroxymethylfurfural (HMF). Compared to benchmark catalysts, the thioether-containing TESAS-SBA-15 showed the highest activity in the dehydration of aqueous fructose, as well as the highest selectivity towards HMF (71 % at 84 % conversion). In addition, the stability of several supported acid catalysts was evaluated in tubular reactors designed to produce 5-hydroxymethylfurfural (HMF) continuously. The reactors, packed with the solid catalysts, were operated at 403 K for extended periods, up to 180 h. The behaviors of three propylsulfonic acid-functionalized, ordered porous silicas (one inorganic SBA-15-type silica, and two ethane-bridged SBA-15-type organosilicas) were compared with that of a propylsulfonic acid-modified, non-ordered porous silica. The HMF selectivity of the catalysts with ordered pore structures ranged from 60 to 75 %, while the selectivity of the non-ordered catalyst peaked at 20 %. The latter was also the least stable, deactivating with a first-order rate constant of

  19. Identification of small molecule sulfonic acids as ecto-5'-Nucleotidase inhibitors.

    PubMed

    Raza, Rabia; Saeed, Aamer; Lecka, Joanna; Sévigny, Jean; Iqbal, Jamshed

    2012-11-01

    Ecto-5'-Nucleotidase inhibitors have great potential as anti-tumor agents. We have investigated biochemical properties of human and rat ecto-5'-Nucleotidases and characterized 19 small molecule sulfonic acid derivatives as potential inhibitors of ecto-5'-Nucleotidases. We identified 11 potent inhibitors of human and rat ecto-5'-Nucleotidases and checked their selectivity. Compound 10 (Sodium 2,4-dinitrobenzenesulfonate) with K(i) value of 0.66 μM and 19 (N-(4-sulfamoylphenylcarbamothioyl) pivalamide) with K(i) value of 0.78 μM were identified as the most potent inhibitors for human and rat ecto-5'-Nucleotidase, respectively. The present compounds have low molecular weights, water solubility and equal potency as compared to the reported inhibitors.

  20. Preclinical in vitro and in vivo activity of 5,6-dimethylxanthenone-4-acetic acid.

    PubMed Central

    Laws, A. L.; Matthew, A. M.; Double, J. A.; Bibby, M. C.

    1995-01-01

    5,6-Dimethylxanthenone-4-acetic acid (5,6-MeXAA) is a fused tricyclic analogue of flavone acetic acid (FAA) which was developed in an attempt to improve on the activity of FAA. Previous studies have shown 5,6-MeXAA to be curative in 80% of mice bearing colon 38 tumours and 12 times more dose potent than FAA. This investigation has demonstrated that a murine colon tumour cell line (MAC15A) is approximately 60 times more sensitive to 5,6-MeXAA than to FAA, although these differences were not seen in three human cell lines tested. 5,6-MeXAA caused significant blood flow shutdown and haemorrhagic necrosis in subcutaneous MAC15A tumours in syngeneic and nude hosts, but measurable changes in tumour volume were seen only in syngeneic hosts. 5,6-MeXAA was inactive against intraperitoneal MAC15A but produced significant anti-tumour effects against the same cell line inoculated via an intravenous route. FAA has been shown previously to be inactive in this model. Interestingly, the effects against lung colonies were not accompanied by obvious necrotic changes, suggesting that they may be the result of increased direct cytotoxicity rather than an indirect host mechanism. Further studies to investigate the effects against systemic tumour deposits are under way. Images Figure 3 PMID:7779712

  1. Effect of tannic acid on the transcriptome of the soil bacterium Pseudomonas protegens Pf-5.

    PubMed

    Lim, Chee Kent; Penesyan, Anahit; Hassan, Karl A; Loper, Joyce E; Paulsen, Ian T

    2013-05-01

    Tannins are a diverse group of plant-produced, polyphenolic compounds with metal-chelating and antimicrobial properties that are prevalent in many soils. Using transcriptomics, we determined that tannic acid, a form of hydrolysable tannin, broadly affects the expression of genes involved in iron and zinc homeostases, sulfur metabolism, biofilm formation, motility, and secondary metabolite biosynthesis in the soil- and rhizosphere-inhabiting bacterium Pseudomonas protegens Pf-5.

  2. Effect of Tannic Acid on the Transcriptome of the Soil Bacterium Pseudomonas protegens Pf-5

    PubMed Central

    Lim, Chee Kent; Penesyan, Anahit; Hassan, Karl A.

    2013-01-01

    Tannins are a diverse group of plant-produced, polyphenolic compounds with metal-chelating and antimicrobial properties that are prevalent in many soils. Using transcriptomics, we determined that tannic acid, a form of hydrolysable tannin, broadly affects the expression of genes involved in iron and zinc homeostases, sulfur metabolism, biofilm formation, motility, and secondary metabolite biosynthesis in the soil- and rhizosphere-inhabiting bacterium Pseudomonas protegens Pf-5. PMID:23435890

  3. 3-(4-Meth-oxy-phen-yl)-5-methylisoxazole-4-carb-oxy-lic acid.

    PubMed

    Chandra; Raghu, K; Srikantamurthy, N; Umesha, K B; Palani, K; Mahendra, M

    2013-03-01

    In the title compound, C12H11NO4, the dihedral angle between the benzene and isoxazole rings is 42.52 (8)°. The carb-oxy-lic acid group is close to being coplanar with the isoxazole ring [dihedral angle = 5.3 (2)°]. In the crystal, inversion dimers linked by pairs of O-H⋯O hydrogen bonds generate R2(2)(8) loops. PMID:23476573

  4. Nematicidal activity of 5-hydroxymethyl-2-furoic acid against plant-parasitic nematodes.

    PubMed

    Kimura, Yasuo; Tani, Satoko; Hayashi, Asami; Ohtani, Kouhei; Fujioka, Shozo; Kawano, Tsuyoshi; Shimada, Atsumi

    2007-01-01

    A nematicide, 5-hydroxymethyl-2-furoic acid (1), was isolated from cultures of the fungus Aspergillus sp. and its structure was identified by spectroscopic analysis. Compound 1 showed effective nematicidal activities against the pine wood nematode Bursaphelenchus xylophilus and the free-living nematode Caenorhabditis elegans without inhibitory activity against plant growth, but 1 did not show any effective nematicidal activity against Pratylenchus penetrans. PMID:17542490

  5. Natural selection for 2,4,5-trichlorophenoxyacetic acid mineralizing bacteria in agent orange contaminated soil.

    PubMed

    Rice, J F; Menn, F M; Hay, A G; Sanseverino, J; Sayler, G S

    2005-12-01

    Agent Orange contaminated soils were utilized in direct enrichment culture studies to isolate 2,4,5-trichlorophenoxyacetic acid (2,4,5-T) and 2,4-dichlorophenoxyacetic acid (2,4-D) mineralizing bacteria. Two bacterial cultures able to grow at the expense of 2,4,5-T and/or 2,4-D were isolated. The 2,4,5-T degrading culture was a mixed culture containing two bacteria, Burkholderia species strain JR7B2 and Burkholderia species strain JR7B3. JR7B3 was able to metabolize 2,4,5-T as the sole source of carbon and energy, and demonstrated the ability to affect metabolism of 2,4-D to a lesser degree. Strain JR7B3 was able to mineralize 2,4,5-T in pure culture and utilized 2,4,5-T in the presence of 0.01% yeast extract. Subsequent characterization of the 2,4-D degrading culture showed that one bacterium, Burkholderia species strain JRB1, was able to utilize 2,4-D as a sole carbon and energy source in pure culture. Polymerase chain reaction (PCR) experiments utilizing known genetic sequences from other 2,4-D and 2,4,5-T degrading bacteria demonstrated that these organisms contain gene sequences similar to tfdA, B, C, E, and R (Strain JRB1) and the tftA, C, and E genes (Strain JR7B3). Expression analysis confirmed that tftA, C, and E and tfdA, B, and C were transcribed during 2,4,5-T and 2,4-D dependent growth, respectively. The results indicate a strong selective pressure for 2,4,5-T utilizing strains under field condition. PMID:15865343

  6. Natural selection for 2,4,5-trichlorophenoxyacetic acid mineralizing bacteria in agent orange contaminated soil.

    PubMed

    Rice, J F; Menn, F M; Hay, A G; Sanseverino, J; Sayler, G S

    2005-12-01

    Agent Orange contaminated soils were utilized in direct enrichment culture studies to isolate 2,4,5-trichlorophenoxyacetic acid (2,4,5-T) and 2,4-dichlorophenoxyacetic acid (2,4-D) mineralizing bacteria. Two bacterial cultures able to grow at the expense of 2,4,5-T and/or 2,4-D were isolated. The 2,4,5-T degrading culture was a mixed culture containing two bacteria, Burkholderia species strain JR7B2 and Burkholderia species strain JR7B3. JR7B3 was able to metabolize 2,4,5-T as the sole source of carbon and energy, and demonstrated the ability to affect metabolism of 2,4-D to a lesser degree. Strain JR7B3 was able to mineralize 2,4,5-T in pure culture and utilized 2,4,5-T in the presence of 0.01% yeast extract. Subsequent characterization of the 2,4-D degrading culture showed that one bacterium, Burkholderia species strain JRB1, was able to utilize 2,4-D as a sole carbon and energy source in pure culture. Polymerase chain reaction (PCR) experiments utilizing known genetic sequences from other 2,4-D and 2,4,5-T degrading bacteria demonstrated that these organisms contain gene sequences similar to tfdA, B, C, E, and R (Strain JRB1) and the tftA, C, and E genes (Strain JR7B3). Expression analysis confirmed that tftA, C, and E and tfdA, B, and C were transcribed during 2,4,5-T and 2,4-D dependent growth, respectively. The results indicate a strong selective pressure for 2,4,5-T utilizing strains under field condition.

  7. The free energy landscape of pseudorotation in 3'-5' and 2'-5' linked nucleic acids.

    PubMed

    Li, Li; Szostak, Jack W

    2014-02-19

    The five-membered furanose ring is a central component of the chemical structure of biological nucleic acids. The conformations of the furanose ring can be analytically described using the concept of pseudorotation, and for RNA and DNA they are dominated by the C2'-endo and C3'-endo conformers. While the free energy difference between these two conformers can be inferred from NMR measurements, a free energy landscape of the complete pseudorotation cycle of nucleic acids in solution has remained elusive. Here, we describe a new free energy calculation method for molecular dynamics (MD) simulations using the two pseudorotation parameters directly as the collective variables. To validate our approach, we calculated the free energy surface of ribose pseudorotation in guanosine and 2'-deoxyguanosine. The calculated free energy landscape reveals not only the relative stability of the different pseudorotation conformers, but also the main transition path between the stable conformations. Applying this method to a standard A-form RNA duplex uncovered the expected minimum at the C3'-endo state. However, at a 2'-5' linkage, the minimum shifts to the C2'-endo conformation. The free energy of the C3'-endo conformation is 3 kcal/mol higher due to a weaker hydrogen bond and a reduced base stacking interaction. Unrestrained MD simulations suggest that the conversion from C3'-endo to C2'-endo and vice versa is on the nanosecond and microsecond time scale, respectively. These calculations suggest that 2'-5' linkages may enable folded RNAs to sample a wider spectrum of their pseudorotation conformations.

  8. Theoretical and spectroscopic studies of lanthanum (III) complex of 5-aminoorotic acid

    NASA Astrophysics Data System (ADS)

    Kostova, Irena; Peica, Niculina; Kiefer, Wolfgang

    2006-09-01

    The lanthanum (III) complex of 5-aminoorotic acid (HAOA) was synthesized and its structure was determined by means of elemental analysis and IR, Raman, and 1H NMR spectroscopies. Significant differences in the IR, Raman, and 1H NMR spectra of the complex were observed as compared to the spectra of the ligand. The geometry of 5-aminoorotic acid was computed and optimized with the Gaussian 03 program employing the B3PW91 and B3LYP methods with the 6-311++G and LANL2DZ basis sets, while the geometry of the La(III) complex of 5-aminoorotic acid was also calculated and optimized with B3PW91/LANL2DZ and B3LYP/LANL2DZ methods. The density functional calculations revealed that the binding mode in the complex was bidentate through the carboxylic oxygen atoms. Detailed vibrational analysis of HAOA and La(III)-AOA systems based on both the calculated and experimental spectra confirmed the suggested metal-ligand binding mode. The density functional theory (DFT) calculated geometries, harmonic vibrational wavenumbers including IR and Raman scattering activities for the ligand and its La(III) complex were in good agreement with the experimental data, a complete vibrational assignment being proposed.

  9. Retrograde spread of 5-aminosalicylic acid enemas in patients with active ulcerative colitis

    SciTech Connect

    Campieri, M.; Lanfranchi, G.A.; Brignola, C.; Bazzocchi, G.; Gionchetti, P.; Minguzzi, M.R.; Cappello, I.P.; Corbelli, C.; Boschi, S.

    1986-02-01

    In an attempt to know the exact retrograde spread of high-dosage 5-aminosalicylic acid enemas, we have studied eight patients with active left-sided colitis, by adding a small amount of barium sulfate to the enemas and by checking the spread radiologically after 15 minutes, 1 hour, and 6 hours. Four grams of 5-aminosalicylic acid in 100-ml enemas and 4 gm in 200-ml enemas were used. The same experiment was repeated in a subsequent attack, with enemas labeled with technetium-99m and checked by scintiscans in five of these patients. We always have observed a volume-dependent spread of enemas but, interestingly, in the patients studied with technetium-99m there was always a wider spread than that which was detected with barium enemas. In all five patients, 100-ml enemas reached the splenic flexure. In two patients with total colitis, a progression of 100-ml technetium-99m enemas was performed in the transverse colon, but the maximum opacity remained in the left side. We can conclude that 4 gm of 5-aminosalicylic acid in 100-ml enemas can be suitable for treating patients with left-sided colitis, and will represent a valid addition for patients with more extensive colitis.

  10. Inhibition of vaccinia mRNA methylation by 2',5'-linked oligo(adenylic acid) triphosphate

    SciTech Connect

    Sharma, O.K.; Goswami, B.B.

    1981-04-01

    Extracts of interferon-treated cells synthesize unique 2',5'-linked oligo(adenylic acid) 5'-phosphates in the presence of ATP and double-stranded RNA. 2',5'-linked oligo(adenylic acid) 5'-triphosphate inhibits protein synthesis at nanomolar concentrations by activating RNase. We have observed that oligo(adenylic acid) 5'-monophosphate and 5'-triphosphate are potent inhibitors of vaccinia mRNA methylation in vitro. Both the methylation of the 5'-terminal guanine at the 7 position and the 2'-O-ribose methylation of the penultimate nucleoside are inhibited. Such inhibition of mRNA methylation is not due to degradation of the mRNA. Inhibition of the requisite modification of the 5' terminus of mRNA by 2',5'-linked oligo(adenylic acids) may be a mechanism of interferon action against both DNA and RNA viruses in which mRNAs derived from them are capped.

  11. Increase of Eicosapentaenoic Acid in Thraustochytrids through Thraustochytrid Ubiquitin Promoter-Driven Expression of a Fatty Acid Δ5 Desaturase Gene▿†

    PubMed Central

    Kobayashi, Takumi; Sakaguchi, Keishi; Matsuda, Takanori; Abe, Eriko; Hama, Yoichiro; Hayashi, Masahiro; Honda, Daiske; Okita, Yuji; Sugimoto, Shinichi; Okino, Nozomu; Ito, Makoto

    2011-01-01

    Thraustochytrids, marine protists known to accumulate polyunsaturated fatty acids (PUFAs) in lipid droplets, are considered an alternative to fish oils as a source of PUFAs. The major fatty acids produced in thraustochytrids are palmitic acid (C16:0), n − 6 docosapentaenoic acid (DPA) (C22:5n − 6), and docosahexaenoic acid (DHA) (C22:6n − 3), with eicosapentaenoic acid (EPA) (C20:5n − 3) and arachidonic acid (AA) (C20:4n − 6) as minor constituents. We attempted here to alter the fatty acid composition of thraustochytrids through the expression of a fatty acid Δ5 desaturase gene driven by the thraustochytrid ubiquitin promoter. The gene was functionally expressed in Aurantiochytrium limacinum mh0186, increasing the amount of EPA converted from eicosatetraenoic acid (ETA) (C20:4n − 3) by the Δ5 desaturase. The levels of EPA and AA were also increased by 4.6- and 13.2-fold in the transgenic thraustochytrids compared to levels in the mock transfectants when ETA and dihomo-γ-linolenic acid (DGLA) (C20:3n − 6) were added to the culture at 0.1 mM. Interestingly, the amount of EPA in the transgenic thraustochytrids increased in proportion to the amount of ETA added to the culture up to 0.4 mM. The rates of conversion and accumulation of EPA were much higher in the thraustochytrids than in baker's yeasts when the desaturase gene was expressed with the respective promoters. This report describes for the first time the finding that an increase of EPA could be accomplished by introducing the Δ5 desaturase gene into thraustochytrids and indicates that molecular breeding of thraustochytrids is a promising strategy for generating beneficial PUFAs. PMID:21478316

  12. Increase of eicosapentaenoic acid in thraustochytrids through thraustochytrid ubiquitin promoter-driven expression of a fatty acid {delta}5 desaturase gene.

    PubMed

    Kobayashi, Takumi; Sakaguchi, Keishi; Matsuda, Takanori; Abe, Eriko; Hama, Yoichiro; Hayashi, Masahiro; Honda, Daiske; Okita, Yuji; Sugimoto, Shinichi; Okino, Nozomu; Ito, Makoto

    2011-06-01

    Thraustochytrids, marine protists known to accumulate polyunsaturated fatty acids (PUFAs) in lipid droplets, are considered an alternative to fish oils as a source of PUFAs. The major fatty acids produced in thraustochytrids are palmitic acid (C(16:0)), n - 6 docosapentaenoic acid (DPA) (C(22:5)(n) (- 6)), and docosahexaenoic acid (DHA) (C(22:6)(n) (- 3)), with eicosapentaenoic acid (EPA) (C(20:5)(n) (- 3)) and arachidonic acid (AA) (C(20:4)(n) (- 6)) as minor constituents. We attempted here to alter the fatty acid composition of thraustochytrids through the expression of a fatty acid Δ5 desaturase gene driven by the thraustochytrid ubiquitin promoter. The gene was functionally expressed in Aurantiochytrium limacinum mh0186, increasing the amount of EPA converted from eicosatetraenoic acid (ETA) (C(20:4)(n) (- 3)) by the Δ5 desaturase. The levels of EPA and AA were also increased by 4.6- and 13.2-fold in the transgenic thraustochytrids compared to levels in the mock transfectants when ETA and dihomo-γ-linolenic acid (DGLA) (C(20:3)(n) (- 6)) were added to the culture at 0.1 mM. Interestingly, the amount of EPA in the transgenic thraustochytrids increased in proportion to the amount of ETA added to the culture up to 0.4 mM. The rates of conversion and accumulation of EPA were much higher in the thraustochytrids than in baker's yeasts when the desaturase gene was expressed with the respective promoters. This report describes for the first time the finding that an increase of EPA could be accomplished by introducing the Δ5 desaturase gene into thraustochytrids and indicates that molecular breeding of thraustochytrids is a promising strategy for generating beneficial PUFAs.

  13. Synthesis of ω-Oxo Amino Acids and trans-5-Substituted Proline Derivatives Using Cross-Metathesis of Unsaturated Amino Acids.

    PubMed

    Salih, Nabaz; Adams, Harry; Jackson, Richard F W

    2016-09-16

    A range of 7-oxo, 8-oxo, and 9-oxo amino acids, analogues of 8-oxo-2-aminodecanoic acid, one of the key components of the cyclic tetrapeptide apicidin, have been prepared by a three-step process involving copper-catalyzed allylation of serine-, aspartic acid-, and glutamic acid-derived organozinc reagents, followed by cross-metathesis of the resulting terminal alkenes with unsaturated ketones and hydrogenation. The intermediate 7-oxo-5-enones underwent a highly diastereoselective (dr ≥96:4) acid-catalyzed aza-Michael reaction to give trans-2,5-disubstituted pyrrolidines, 5-substituted proline derivatives. The aza-Michael reaction was first observed when the starting enones were allowed to stand in solution in deuterochloroform but can be efficiently promoted by catalytic amounts of dry HCl. PMID:27529354

  14. Synthesis of 24-nor-5 beta-cholan-23-oic acid derivatives: a convenient and efficient one-carbon degradation of the side chain of natural bile acids.

    PubMed

    Schteingart, C D; Hofmann, A F

    1988-10-01

    An efficient procedure for obtaining nor-bile acids from natural (C24) bile acids is described. Treatment of formylated bile acids with sodium nitrite in a mixture of trifluoroacetic anhydride with trifluoroacetic acid gives, through a "second order" Beckmann rearrangement, 24-nor-23-nitriles. These compounds, on alkaline hydrolysis, afford the corresponding nor-bile acids in high yields. The sequence was successfully applied to the synthesis of 3 alpha-hydroxy-24-nor-5 beta-cholan-23-oic (norlithocholic) acid, 3 alpha,6 alpha- (norhyodeoxycholic), 3 alpha,7 alpha- (norchenodeoxycholic), 3 alpha,7 beta- (norursodeoxycholic), and 3 alpha,12 alpha-dihydroxy-24-nor-5 beta-cholan-23-oic (nordeoxycholic) acids, as well as 3 alpha,7 alpha,12 alpha-trihydroxy-24-nor-5 beta-cholan-23-oic (norcholic) acid. 13C-NMR spectra of their methyl esters are reported. The procedure provides a more rapid alternative to the Barbier-Wieland degradation for shortening by one methylene group the side chain of natural (C24) bile acids.

  15. Folic Acid Supplementation Adversely Affects Chemosensitivity of Colon Cancer Cells to 5-fluorouracil.

    PubMed

    Ishiguro, Lisa; Yang, Michael; Sohn, Kyoung-Jin; Streutker, Catherine J; Grin, Andrea; Croxford, Ruth; Kim, Young-In

    2016-07-01

    Folic acid (FA) fortification and widespread supplemental use have significantly increased folate status in North America. Furthermore, >50% of colorectal cancer patients use FA supplement. The increased folate status may interfere with cancer chemotherapy. We investigated the effect of FA supplementation on chemosensitivity of human colon cancer cells to 5-fluorouracil (5-FU) using a xenograft model. Mice harboring human HCT116 colon cancer xenografts were randomized to receive the control, or 4× or 12.5× supplemental levels of FA. Within each diet group, mice were randomized to receive 5-FU+leucovorin or saline and xenograft growth and characteristics were determined. The expression of genes involved in folate metabolism and cancer treatment was determined. FA supplementation and 5-FU significantly interacted to influence xenograft growth (P < 0.007). At the control level, 5-FU significantly inhibited the growth of the xenografts (P < 0.0001). However, at the 4× supplemental level, 5-FU-treated xenografts grew faster than untreated xenografts (P = 0.048) while at the 12.5× supplemental level, 5-FU exhibited no effect. Cell proliferation, degree of necrosis, and expression of the selected genes did not significantly differ by the supplemental levels of FA. Our data suggest that FA supplementation may be detrimental to 5-FU chemotherapy of colon cancer and pose public health concern.

  16. The direct conversion of sugars into 2,5-furandicarboxylic acid in a triphasic system.

    PubMed

    Yi, Guangshun; Teong, Siew Ping; Zhang, Yugen

    2015-04-13

    A one-pot conversion of sugars into 2,5-furandicarboxylic acid (FDCA) is demonstrated in a triphasic system: tetraethylammonium bromide (TEAB) or water-methyl isobutyl ketone (MIBK)-water. In this reaction, sugars are first converted into 5-hydroxymethylfurfural (HMF) in TEAB or water (Phase I). The HMF in Phase I is then extracted to MIBK (Phase II) and transferred to water (Phase III), where HMF is converted into FDCA. Phase II plays multiple roles: as a bridge for HMF extraction, transportation and purification. Overall FDCA yields of 78 % and 50 % are achieved from fructose and glucose respectively. PMID:25766123

  17. The direct conversion of sugars into 2,5-furandicarboxylic acid in a triphasic system.

    PubMed

    Yi, Guangshun; Teong, Siew Ping; Zhang, Yugen

    2015-04-13

    A one-pot conversion of sugars into 2,5-furandicarboxylic acid (FDCA) is demonstrated in a triphasic system: tetraethylammonium bromide (TEAB) or water-methyl isobutyl ketone (MIBK)-water. In this reaction, sugars are first converted into 5-hydroxymethylfurfural (HMF) in TEAB or water (Phase I). The HMF in Phase I is then extracted to MIBK (Phase II) and transferred to water (Phase III), where HMF is converted into FDCA. Phase II plays multiple roles: as a bridge for HMF extraction, transportation and purification. Overall FDCA yields of 78 % and 50 % are achieved from fructose and glucose respectively.

  18. Acid Stability of the Hemagglutinin Protein Regulates H5N1 Influenza Virus Pathogenicity

    SciTech Connect

    DuBois, Rebecca M.; Zaraket, Hassan; Reddivari, Muralidhar; Heath, Richard J.; White, Stephen W.; Russell, Charles J.

    2012-12-10

    Highly pathogenic avian influenza viruses of the H5N1 subtype continue to threaten agriculture and human health. Here, we use biochemistry and x-ray crystallography to reveal how amino-acid variations in the hemagglutinin (HA) protein contribute to the pathogenicity of H5N1 influenza virus in chickens. HA proteins from highly pathogenic (HP) A/chicken/Hong Kong/YU562/2001 and moderately pathogenic (MP) A/goose/Hong Kong/437-10/1999 isolates of H5N1 were found to be expressed and cleaved in similar amounts, and both proteins had similar receptor-binding properties. However, amino-acid variations at positions 104 and 115 in the vestigial esterase sub-domain of the HA1 receptor-binding domain (RBD) were found to modulate the pH of HA activation such that the HP and MP HA proteins are activated for membrane fusion at pH 5.7 and 5.3, respectively. In general, an increase in H5N1 pathogenicity in chickens was found to correlate with an increase in the pH of HA activation for mutant and chimeric HA proteins in the observed range of pH 5.2 to 6.0. We determined a crystal structure of the MP HA protein at 2.50 {angstrom} resolution and two structures of HP HA at 2.95 and 3.10 {angstrom} resolution. Residues 104 and 115 that modulate the acid stability of the HA protein are situated at the N- and C-termini of the 110-helix in the vestigial esterase sub-domain, which interacts with the B loop of the HA2 stalk domain. Interactions between the 110-helix and the stalk domain appear to be important in regulating HA protein acid stability, which in turn modulates influenza virus replication and pathogenesis. Overall, an optimal activation pH of the HA protein is found to be necessary for high pathogenicity by H5N1 influenza virus in avian species.

  19. The use of (5Z)-4-bromo-5-(bromomethylene)-2(5H)-furanone for controlling acid mine drainage through the inhibition of Acidithiobacillus ferrooxidans biofilm formation.

    PubMed

    Zhao, Yang; Chen, Peng; Nan, Wenbin; Zhi, Dejuan; Liu, Ronghui; Li, Hongyu

    2015-06-01

    The aim of this study was to determine whether acid mine drainage (AMD) production can be decreased by (5Z)-4-bromo-5-(bromomethylene)-2(5H)-furanone (furanone C-30) in the presence of Acidithiobacillus ferrooxidans (A. ferrooxidans). The effects of furanone C-30 on A. ferrooxidans biofilm production were determined by crystal violet staining and confocal laser scanning microscopy (CLSM). Biofilm-related gene expression was investigated using real-time RT-PCR. Finally, the effects of furanone C-30 on AMD production were evaluated. The results show that furanone C-30 inhibits the production of extracellular polymeric substances (EPS) and biofilm formation and significantly down-regulates the expression of biofilm-related genes. The decreased EPS production led to reduced pentlandite attachment and biofilm formation on pentlandite. Furthermore, the dissolution of both nickel and copper were inhibited by furanone C-30 without new acid formation. This study provides a promising biochemical method to control AMD. PMID:25802048

  20. An Introduction to Multivariate Curve Resolution-Alternating Least Squares: Spectrophotometric Study of the Acid-Base Equilibria of 8-Hydroxyquinoline-5-Sulfonic Acid

    ERIC Educational Resources Information Center

    Rodriguez-Rodriguez, Cristina; Amigo, Jose Manuel; Coello, Jordi; Maspoch, Santiago

    2007-01-01

    A spectrophotometric study of the acid-base equilibria of 8-hydroxyquinoline-5-sulfonic acid to describe the multivariate curve resolution-alternating least squares algorithm (MCR-ALS) is described. The algorithm provides a lot of information and hence is of great importance for the chemometrics research.

  1. [Determination of ellagic acid, flavonoids and goshonoside-F5 in Rubi Fructus by HPLC].

    PubMed

    He, Jian-Ming; Sun, Nan; Wu, Wen-Dan; Fan, Li-Jiao; Guo, Mei-Li

    2013-12-01

    High-performance liquid chromatographic coupled with variable wavelength detection (HPLC-VWD) has been developed for simultaneous determination of 5 analytes including ellagic acid, quercetin, kaempferol-3-O-beta-D-rutinoside, tiliroside and kaempferol, and high-performance liquid chromatographic with an evaporative light scattering detector (HPLC-ELSD) has been established to determine goshonoside-F5 in extract of Rubi Fructus. Chromatographic separations were carried out on an Agilent ZORBAX SB-C18 column (4.6 mm x 250 mm, 5.0 microm). All calibration curves of reference standards revealed good linearity (R2 > 0.999 5) within the concentration ranges tested. The method limits of detection ranged 0.297-90.144 ng and the method limits ofquantitation ranged 0.990-300.480 ng, respectively. Recoveries of 6 analytes were from 97.11% to 101.7%, with RSD less than 2.1%. The result shows that amounts of the 6 analytes in the samples from 16 localities were found to be different. The higher latitude of growing environment, the more ellagic acid in herb. The content of total flavonoids in sample from east localities were higher than that in middle and west localities, and the content of goshonoside-F5 in Bozhou, Anhui province was higher than others. This method was found to be simple, accurate, sensitive with good repeatability. Those results might serve as a sound foundation for further study, quality control and application of Rubi Fructus.

  2. Failure of 5-aminosalicylic acid enemas to improve chronic radiation proctitis

    SciTech Connect

    Baum, C.A.; Biddle, W.L.; Miner, P.B. Jr.

    1989-05-01

    Radiation proctitis is a well-known complication of abdominal and pelvic radiation. Conventional medical and surgical treatment often is disappointing. 5-Aminosalicylic acid (5-ASA) is the active component in sulfasalazine and is effective in the treatment of distal ulcerative colitis. Four patients with radiation proctitis were treated with 4 g 5-ASA by enema nightly for two to six months. Patients were seen monthly, interviewed, and a sigmoidoscopic exam performed. No change was seen in the degree of mucosal inflammation on follow-up sigmoidoscopic exams. Three patients noted no change in their symptoms of bleeding, pain, or tenesmus. One patient noted initial improvement, but this was not sustained. 5-ASA enemas do not appear to be effective in the treatment of radiation proctitis.

  3. Biosynthesis of isoxazolin-5-one and 3-nitropropanoic acid containing glucosides in juvenile Chrysomelina.

    PubMed

    Becker, Tobias; Ploss, Kerstin; Boland, Wilhelm

    2016-07-14

    Stable-isotope-labeled precursors were used to establish the biosynthetic pathway leading from β-alanine towards isoxazolin-5-one glucoside 1 and its 3-nitropropanoate (3-NPA) ester 2 in Chrysomelina larvae. Both structural elements originate from sequestered plant-derived β-alanine or from propanoyl-CoA that is derived from the degradation of some essential amino acids, e.g. valine. β-Alanine is converted into 3-NPA and isoxazolinone 5 by consecutive oxidations of the amino group of β-Ala. Substituting the diphospho group of α-UDP-glucose with 5 generates the isoxazolin-5-one glucoside 1, which serves in the circulating hemolymph of the larva as a platform for esterification with 3-nitropropanoyl-CoA. The pathway was validated with larvae of Phaedon cochleariae, Chrysomela populi as well as Gastrophysa viridula. PMID:27272952

  4. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

    PubMed

    MacKay, R M; Gray, M W; Doolittle, W F

    1980-11-11

    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.

  5. Inhibition of type 1 and type 2 5alpha-reductase activity by free fatty acids, active ingredients of Permixon.

    PubMed

    Raynaud, Jean Pierre; Cousse, Henri; Martin, Pierre Marie

    2002-10-01

    In different cell systems, the lipido-sterolic extract of Serenoa repens (LSESr, Permixon inhibits both type 1 and type 2 5alpha-reductase activity (5alphaR1 and 5alphaR2). LSESr is mainly constituted of fatty acids (90+/-5%) essentially as free fatty acids (80%). Among these free fatty acids, the main components are oleic and lauric acids which represent 65% and linoleic and myristic acids 15%. To evaluate the inhibitory effect of the different components of LSESr on 5alphaR1 or 5alphaR2 activity, the corresponding type 1 and type 2 human genes have been cloned and expressed in the baculovirus-directed insect cell expression system Sf9. The cells were incubated at pH 5.5 (5alphaR2) and pH 7.4 (5alphaR1) with 1 or 3nM testosterone in presence or absence of various concentrations of LSESr or of its different components. Dihydrotestosterone formation was measured with an automatic system combining HPLC and an on-line radiodetector. The inhibition of 5alphaR1 and 5alphaR2 activity was only observed with free fatty acids: esterified fatty acids, alcohols as well as sterols assayed were inactive. A specificity of the fatty acids in 5alphaR1 or 5alphaR2 inhibition has been found. Long unsaturated chains (oleic and linolenic) were active (IC(50)=4+/-2 and 13+/-3 microg/ml, respectively) on 5alphaR1 but to a much lesser extent (IC(50)>100 and 35+/-21 microg/ml, respectively) on 5alphaR2. Palmitic and stearic acids were inactive on the two isoforms. Lauric acid was active on 5alphaR1 (IC(50)=17+/-3 microg/ml) and 5alphaR2 (IC(50)=19+/-9 microg/ml). The inhibitory activity of myristic acid was evaluated on 5alphaR2 only and found active on this isoform (IC(50)=4+/-2 microg/ml). The dual inhibitory activity of LSESr on 5alpha-reductase type 1 and type 2 can be attributed to its high content in free fatty acids.

  6. Mechanism of cytotoxicity of 5,10-dideazatetrahydrofolic acid in human ovarian carcinoma cells in vitro and modulation of the drug activity by folic or folinic acid.

    PubMed Central

    Erba, E.; Sen, S.; Sessa, C.; Vikhanskaya, F. L.; D'Incalci, M.

    1994-01-01

    Inhibition of clonogenic potential by the glycinamideribonucleosyl transformylase inhibitor 5,10-dideazatetrahydrofolic acid (DDATHF, Lometrexol) was evaluated in vitro in a human ovarian carcinoma cell line, SW626. Drug-induced inhibition of clonogenic potential is a function of the dose and time of exposure and is independent of the formation of DNA single-strand breaks or de novo synthesis of protein. Simultaneous treatment with 100 microM hypoxanthine completely prevented the inhibition of clonogenic potential caused by 0.5 microM DDATHF. DDATHF blocked cells in the early-middle S-phases of the cell cycle, and there was a corresponding marked reduction in the rate of DNA synthesis after drug withdrawal. The cytotoxic potential of DDATHF was modulated by the folic acid concentration present in the medium. In a medium containing 0.22 microM folic acid, DDATHF cytotoxicity was at least 100 times that in a regular medium containing 2.22 microM folic acid, levels which, however, are about 100 times those found in human plasma. DDATHF cytotoxicity differed moderately when folic acid concentrations varied between 0.22 and 0 microM, suggesting that folic acid does not necessarily antagonise DDATHF anti-tumour activity. Folinic acid at a concentration as low as 0.1 microM can completely rescue cells when given simultaneously with 0.5 microM DDATHF. When folinic acid was given 24 h after DDATHF, a reversal of cytotoxicity was observed at 0.5 and 1 microM, but to a much lesser extent than simultaneous treatment. When folinic acid was added after 48 or 72 h of DDATHF washout, even at a high concentration and for a long time, no reduction in DDATHF cytotoxicity was found. In conclusion, the study highlights the modulation of DDATHF cytotoxicity by folic acid or by folinic acid and provides further rationale for in vivo clinical investigation with these combinations. PMID:8297715

  7. Human platelets produce 14,15-oxido-5,8,11-eicosatrienoic acid from phosphatidylinositol

    SciTech Connect

    Ballou, L.R.; Lam, B.K.; Wong, P.Y.K.; Cheung, W.Y.

    1987-05-01

    Human platelets contain a soluble enzyme or enzyme system which catalyzes the formation of a compound more polar than arachidonate from 2-arachidonyl-sn-phosphatidylinositol (PtdIns). The C-value and mass spectrum of the compound appears similar to the reported values of 14,15-oxido-5,8,11-eicosatrienoic acid (EET). 2-Arachidonyl-sn-phosphatidylcholine, 2-arachidonyl-sn-phosphatidylethanolamine and arachidonic acid were not substrates for EET production. The reaction was Ca/sup 2 +/-dependent and insensitive to aspirin, mepacrin and indomethacin. EET formation was greatly reduced under nitrogen or carbon monoxide, however, exposure to atmospheric air rapidly restored EET production to a rate comparable to that under air. Further, neither NADPH nor cyanide affected EET formation, suggesting that a cytochrome P-450 system was not involved. Intact platelets prelabeled with (/sup 14/C)arachidonic acid generated at least 0.5 nmole of EET/10/sup 9/ platelets in response to thrombin; other agonists such as collagen, epinephrine, ADP or ionophore A23187 were not effective. Collectively, these data suggest that human platelets possess an enzyme system which appears to catalyze epoxidation of the arachidonyl moiety of PtdIns and its subsequent hydrolysis to yield EET.

  8. The bile acid membrane receptor TGR5 as an emerging target in metabolism and inflammation.

    PubMed

    Pols, Thijs W H; Noriega, Lilia G; Nomura, Mitsunori; Auwerx, Johan; Schoonjans, Kristina

    2011-06-01

    Bile acids (BAs) are amphipathic molecules that facilitate the uptake of lipids, and their levels fluctuate in the intestine as well as in the blood circulation depending on food intake. Besides their role in dietary lipid absorption, bile acids function as signaling molecules capable to activate specific receptors. These BA receptors are not only important in the regulation of bile acid synthesis and their metabolism, but also regulate glucose homeostasis, lipid metabolism, and energy expenditure. These processes are important in diabetes and other facets of the metabolic syndrome, which represents a considerable increasing health burden. In addition to the function of the nuclear receptor FXRα in regulating local effects in the organs of the enterohepatic axis, increasing evidence points to a crucial role of the G-protein coupled receptor (GPCR) TGR5 in mediating systemic actions of BAs. Here we discuss the current knowledge on BA receptors, with a strong focus on the cell membrane receptor TGR5, which emerges as a valuable target for intervention in metabolic diseases. PMID:21145931

  9. (1S,3R,4S,5R)5-O-Caffeoylquinic acid: isolation, stereo-structure characterization and biological activity.

    PubMed

    Forino, Martino; Tenore, Gian Carlo; Tartaglione, Luciana; Carmela, Dell'Aversano; Novellino, Ettore; Ciminiello, Patrizia

    2015-07-01

    Sorbus domestica fruits (sorbs) are commonly harvested and consumed for their nutritious qualities and have long been used as natural remedy against diabetes in the popular medicine. Recently, sorbs have been described as sources of antioxidant compounds including polyphenols. Chemical analyses carried out on sorbs collected in Southern Italy have led to the isolation of a chlorogenic acid isomer as the main antioxidant compound contained in the fruit butanol extract. NMR studies have identified the isolated compound as (1S,3R,4S,5R)5-O-Caffeoylquinic acid. In comparison to chlorogenic acid, the isolated isomer features an inverted configuration at C4. Such configurational inversion causes the chlorogenic acid stereoisomer acid to assume a preferential conformation remarkably different from that of chlorogenic acid. This seems to account for the enhanced potency of (1S,3R,4S,5R)5-O-Caffeoylquinic acid to reduce both the glucose and cholesterol uptakes by the cell line HepG2 when compared to chlorogenic acid.

  10. Biocatalytic ammonolysis of (5S)-4,5-dihydro-1H-pyrrole-1,5-dicarboxylic acid, 1-(1,1-dimethylethyl)-5-ethyl ester: preparation of an intermediate to the dipeptidyl peptidase IV inhibitor Saxagliptin.

    PubMed

    Gill, Iqbal; Patel, Ramesh

    2006-02-01

    An efficient biocatalytic method has been developed for the conversion of (5S)-4,5-dihydro-1H-pyrrole-1,5-dicarboxylic acid, 1-(1,1-dimethylethyl)-5-ethyl ester (1) into the corresponding amide (5S)-5-aminocarbonyl-4,5-dihydro-1H-pyrrole-1-carboxylic acid, 1-(1,1-dimethylethyl)ester (2), which is a critical intermediate in the synthesis of the dipeptidyl peptidase IV (DPP4) inhibitor Saxagliptin (3). Candida antartica lipase B mediates ammonolysis of the ester with ammonium carbamate as ammonia donor to yield up to 71% of the amide. The inclusion of Ascarite and calcium chloride as adsorbents for carbon dioxide and ethanol byproducts, respectively, increases the yield to 98%, thereby offering an efficient and practical alternative to chemical routes which yield 57-64%. PMID:16257208

  11. Biocatalytic ammonolysis of (5S)-4,5-dihydro-1H-pyrrole-1,5-dicarboxylic acid, 1-(1,1-dimethylethyl)-5-ethyl ester: preparation of an intermediate to the dipeptidyl peptidase IV inhibitor Saxagliptin.

    PubMed

    Gill, Iqbal; Patel, Ramesh

    2006-02-01

    An efficient biocatalytic method has been developed for the conversion of (5S)-4,5-dihydro-1H-pyrrole-1,5-dicarboxylic acid, 1-(1,1-dimethylethyl)-5-ethyl ester (1) into the corresponding amide (5S)-5-aminocarbonyl-4,5-dihydro-1H-pyrrole-1-carboxylic acid, 1-(1,1-dimethylethyl)ester (2), which is a critical intermediate in the synthesis of the dipeptidyl peptidase IV (DPP4) inhibitor Saxagliptin (3). Candida antartica lipase B mediates ammonolysis of the ester with ammonium carbamate as ammonia donor to yield up to 71% of the amide. The inclusion of Ascarite and calcium chloride as adsorbents for carbon dioxide and ethanol byproducts, respectively, increases the yield to 98%, thereby offering an efficient and practical alternative to chemical routes which yield 57-64%.

  12. Carboxylic acids in PM 2.5 over Pinus morrisonicola forest and related photoreaction mechanisms identified via Raman spectroscopy

    NASA Astrophysics Data System (ADS)

    Kuo, Su-Ching; Tsai, Ying I.; Tsai, Cheng-Hsien; Hsieh, Li-Ying

    2011-12-01

    The PM 2.5 aerosol from within an area of Pinus morrisonicola Hayata in Taiwan was collected and analyzed for its low molecular weight carboxylic acid (LMWCAs) content. Oxalic acid was the major LMWCA in the aerosol, followed by acetic, tartaric and maleic acids. This differs significantly from the LMWCA composition of PM 2.5 aerosol reported for a southern Taiwan suburban region (oxalic > succinic > malonic) [Atmospheric Environment 42, 6836-6850 (2008)]. P. morrisonicola Hayata emits oxalic, malic and formic acids and yet there was an abundance of maleic and tartaric acids in the PM 2.5 forest aerosol, indicating that tartaric acid is derived from the transformation of other P. morrisonicola Hayata emissions. Raman spectroscopy was applied and 28 species of LMWCAs and inorganic species were identified. The photochemical mechanisms of maleic and tartaric acids were studied and it was found that the abundant tartaric acid in forest aerosol is most probably the photochemical product from reactions of maleic acid. Furthermore, tartaric acid is photochemically transformed into formic acid and ultimately into CO 2.

  13. Enhancement of tumor responsiveness to aminolevulinate-photodynamic therapy (ALA-PDT) using differentiation-promoting agents in mouse models of skin carcinoma

    NASA Astrophysics Data System (ADS)

    Anand, Sanjay; Honari, Golara; Paliwal, Akshat; Hasan, Tayyaba; Maytin, Edward V.

    2009-06-01

    Aminolevulinic acid-mediated photodynamic therapy (ALA-PDT) is an emerging treatment for cancers. ALA, given as a prodrug, selectively accumulates and is metabolized in cancer cells to form protoporphyrin IX (PpIX). Targeted local irradiation with light induces cell death. Since the efficacy of ALA-PDT for large or deep tumors is currently limited, we are developing a new approach that combines differentiation-inducing agents with ALA-PDT to improve the clinical response. Here, we tested this new combination paradigm in the following two models of skin carcinoma in mice: 1) tumors generated by topical application of chemical carcinogens (DMBA-TPA); 2) human SCC cells (A431) implanted subcutaneously. To achieve a differentiated state of the tumors, pretreatment with a low concentration of methotrexate (MTX) or Vitamin D (Vit D) was administered for 72 h prior to exposure to ALA. Confocal images of histological sections were captured and digitally analyzed to determine relative PpIX levels. PpIX in the tumors was also monitored by real-time in vivo fluorescence dosimetry. In both models, a significant increase in levels of PpIX was observed following pretreatment with MTX or Vit D, as compared to no-pretreatment controls. This enhancing effect was observed at very low, non-cytotoxic concentrations, and was highly specific to cancer cells as compared to normal cells. These results suggest that use of differentiating agents such as MTX or Vit D, as a short-term combination therapy given prior to ALA-PDT, can increase the production of PpIX photosensitizer and enhance the therapeutic response of skin cancers.

  14. 5-Aminosalicylic acid attenuates allergen-induced airway inflammation and oxidative stress in asthma.

    PubMed

    Raju, K Rama Satyanarayana; Kumar, M N Sathish; Gupta, Saurabh; Naga, Srinivas T; Shankar, Jaya K; Murthy, Vishakantha; Madhunapanthula, Subba Rao V; Mulukutla, Shashank; Ambhore, Nilesh S; Tummala, Shashank; Vishnuvarthan, V J; Azam, Afzal; Elango, Kannan

    2014-12-01

    Pro-inflammatory cytokines regulate the magnitude of allergic reactions during asthma. Tumor necrosis factor--alpha (TNF-α), interleukin-6 (IL-6) and interleukin-13 (IL-13) play a crucial role in aggravating the inflammatory conditions during allergic asthma. In addition, oxidative stress contributes to the pathogenesis of asthma by altering the physiological condition resulting in the development of status asthmaticus. Anti-inflammatory corticosteroids are being widely used for treating allergic asthma. In the present study 5-aminosalicylic acid (5-ASA), a salicylic acid derivative, was evaluated, in vivo for its potential to suppress TNF-α, IL-6 and IL-13 using ovalbumin (OVA) induced allergic asthma in Balb/C mice. Oral administration of 65, 130 and 195 mg/kg 5-ASA significantly reduced the OVA induced total and differential leucocyte count, TNF-α, IL-6, IL-13, nitrite, nitrate, MDA, MPO and TPL levels in the lung lavage samples. Collectively, these findings suggest that 5-ASA is a potent immunomodulator and suppresses key Th2 cytokines production and oxidative stress in OVA-induced asthma.

  15. Dispersion states and acid properties of SiO2-supported Nb2O5

    NASA Astrophysics Data System (ADS)

    He, Jie; Li, Qing-Jie; Fan, Yi-Ning

    2013-06-01

    Nb2O5/SiO2 samples were prepared by the incipient-wetness impregnation method using niobium oxalate aqueous solution. The microstructure and dispersion process of the niobia species supported on SiO2 were characterized by means of power X-ray diffraction (XRD), laser Raman spectroscopy (LRS), and UV-vis diffuse reflectance spectroscopy (UV-vis DRS). The acid properties were investigated by the method of Hammett indicator and Pyridine adsorption infrared (Py-IR) spectroscopy. The results showed that the dispersion process of Nb2O5 was performed by consuming surface hydroxyl groups of the amorphous SiO2 support. The aggregation of niobia species led to the formation of microcrystalline particles, so that there was no a clear monolayer dispersion capacity for Nb2O5 supported on amorphous SiO2. Furthermore, the catalytic activities of the as-prepared samples were evaluated by the condensation reaction of iso-butene (IB) and iso-butyraldehyde (IBA) to form 2,5-dimethyl-2,4-hexadiene (DMHD). The catalytic activities of the as-prepared samples for the condensation and their acid properties were strongly affected by the dispersion states.

  16. Porosity-Acidity Interplay in Hierarchical ZSM-5 Zeolites for Pyrolysis Oil Valorization to Aromatics.

    PubMed

    Puértolas, Begoña; Veses, Alberto; Callén, Maria Soledad; Mitchell, Sharon; García, Tomás; Pérez-Ramírez, Javier

    2015-10-12

    The properties of crude bio-oils attained by the pyrolysis of lignocellulosic biomass can be greatly enhanced by means of catalytic upgrading. Here, we demonstrate an efficient process concept coupling the production of pyrolysis oil from pine wood with a consecutive catalytic upgrading step over hierarchically structured ZSM-5 zeolites to attain aromatic-rich bio-oils. The selective upgrading of these complex mixtures is shown to be tightly connected to the extent of mesopore development and the density of Brønsted acid sites at the mesopore surface. A full product analysis enables elucidation of the impact of mesopore introduction and the acidic properties on the complex reaction network. The preferential occurrence of decarbonylation reactions in hierarchical zeolites versus dehydration transformations in the bulk counterparts is believed to be decisive in promoting increased aromatics formation.

  17. Fluorimetric sequential injection determination of magnesium using 8-hydroxiquinoline-5-sulfonic acid in a micellar medium.

    PubMed

    de Armas, G; Cladera, A; Becerra, E; Estela, J M; Cerdà, V

    2000-05-31

    A fluorimetric sequential injection method for the determination of magnesium is proposed. The system is based on the complex formation between Mg(II) and 8-hydroxyquinoline-5-sulfonic acid (HQS). The reaction was carried out in the presence of ethylene glycol-bis(beta-aminoethyl ether)-N,N,N',N'-tetraacetic acid (EGTA) as a masking agent. Cetyltrimethylammonium chloride (HTAC) was employed as a fluorescence enhancer. The influence of several variables, such as reagent concentration, volumes and pH has been investigated. The reagent was prepared in a 0.1 M Tris-HCl buffer solution (pH 9). A detection limit of 12 mug l(-1) magnesium was obtained. The proposed method was applied to the determination of magnesium in natural waters.

  18. Porosity-Acidity Interplay in Hierarchical ZSM-5 Zeolites for Pyrolysis Oil Valorization to Aromatics.

    PubMed

    Puértolas, Begoña; Veses, Alberto; Callén, Maria Soledad; Mitchell, Sharon; García, Tomás; Pérez-Ramírez, Javier

    2015-10-12

    The properties of crude bio-oils attained by the pyrolysis of lignocellulosic biomass can be greatly enhanced by means of catalytic upgrading. Here, we demonstrate an efficient process concept coupling the production of pyrolysis oil from pine wood with a consecutive catalytic upgrading step over hierarchically structured ZSM-5 zeolites to attain aromatic-rich bio-oils. The selective upgrading of these complex mixtures is shown to be tightly connected to the extent of mesopore development and the density of Brønsted acid sites at the mesopore surface. A full product analysis enables elucidation of the impact of mesopore introduction and the acidic properties on the complex reaction network. The preferential occurrence of decarbonylation reactions in hierarchical zeolites versus dehydration transformations in the bulk counterparts is believed to be decisive in promoting increased aromatics formation. PMID:26336806

  19. Concentrations of higher dicarboxylic acids C5-C13 in fresh snow samples collected at the High Alpine Research Station Jungfraujoch during CLACE 5 and 6

    NASA Astrophysics Data System (ADS)

    Winterhalter, R.; Kippenberger, M.; Williams, J.; Fries, E.; Sieg, K.; Moortgat, G. K.

    2009-03-01

    Samples of freshly fallen snow were collected at the high alpine research station Jungfraujoch (Switzerland) in February and March 2006 and 2007, during the Cloud and Aerosol Characterization Experiments (CLACE) 5 and 6. In this study a new technique has been developed and demonstrated for the measurement of organic acids in fresh snow. The melted snow samples were subjected to solid phase extraction and resulting solutions analysed for organic acids by HPLC-MS-TOF using negative electrospray ionization. A series of linear dicarboxylic acids from C5 to C13 and phthalic acid, were identified and quantified. In several samples the biogenic acid pinonic acid was also observed. In fresh snow the median concentration of the most abundant acid, adipic acid, was 0.69 μg L-1 in 2006 and 0.70 μg L-1 in 2007. Glutaric acid was the second most abundant dicarboxylic acid found with median values of 0.46 μg L-1 in 2006 and 0.61 μg L-1 in 2007, while the aromatic acid phthalic acid showed a median concentration of 0.34 μg L-1 in 2006 and 0.45 μg L-1 in 2007. The concentrations in the samples from various snowfall events varied significantly, and were found to be dependent on the back trajectory of the air mass arriving at Jungfraujoch. Air masses of marine origin showed the lowest concentrations of acids whereas the highest concentrations were measured when the air mass was strongly influenced by boundary layer air.

  20. Concentrations of higher dicarboxylic acids C5-C13 in fresh snow samples collected at the High Alpine Research Station Jungfraujoch during CLACE 5 and 6

    NASA Astrophysics Data System (ADS)

    Winterhalter, R.; Kippenberger, M.; Williams, J.; Fries, E.; Sieg, K.; Moortgat, G. K.

    2008-10-01

    Samples of freshly fallen snow were collected at the high alpine research station Jungfraujoch (Switzerland) in February and March 2006 and 2007, during the Cloud and Aerosol Characterization Experiments (CLACE) 5 and 6. In this study a new technique has been developed and demonstrated for the measurement of organic acids in fresh snow. The melted snow samples were subjected to solid phase extraction and resulting solution analysed for organic acids by HPLC-MS-TOF using negative electrospray ionization. A series of linear dicarboxylic acids from C5 to C13 and phthalic acid, were identified and quantified. In several samples the biogenic acid pinonic acid was also observed. In fresh snow the median concentration of the most abundant acid, adipic acid, was 0.69 μg L-1 in 2006 and 0.70 μg L-1 in 2007. Glutaric acid was the second most abundant dicarboxylic acid found with median values of 0.46 μg L-1 in 2006 and 0.61 μg L-1 in 2007, while the aromatic acid phthalic acid showed a median concentration of 0.34 μg L-1 in 2006 and 0.45 μg L-1 in 2007. The concentrations in the samples from various snowfall events varied significantly, and were found to be dependent on the back trajectory of the air mass arriving at Jungfraujoch. Air masses of marine origin showed the lowest concentrations of acids whereas the highest concentrations were measured when the air mass was strongly influenced by boundary layer air.

  1. Location of Transported Auxin in Etiolated Maize Shoots Using 5-Azidoindole-3-Acetic Acid 1

    PubMed Central

    Jones, Alan M.

    1990-01-01

    A study was undertaken using the photoaffinity labeling agent, tritiated 5-azidoindole-3-acetic acid ([3H],5-N3IAA), to identify cells in the etiolated maize (Zea mays L.) shoot which transport auxin. Transport of [3H],5-N3IAA was shown to be polar, inhibited by 2,3,5-triiodobenzoic acid (TIBA) and essentially freely mobile. There was no detectable radiodecomposition of [3H],5-N3IAA within tissue kept in darkness for 4 hours. Shoot tissue which had taken up [3H],5-N3IAA was irradiated with ultraviolet light to covalently fix the photoaffinity labeling agent within cells that contained it at the time of photolysis. Subsequent microautoradiography showed that all cells contained radioactivity; however, the amount of radioactivity varied among different cell types. Epidermal cells contained the most radioactivity per area, approximately twofold more than other cells. Parenchyma cells in the mature stelar region contained the next largest amount and cortical cells, sieve tube cells, tracheary cells, and all cells in the leaf base contained the least amount of the radioactive label. Two observations suggest that the auxin within the epidermal cells is transported in a polar manner: (a) the amount of auxin in the epidermal cells is greatly reduced in the presence of TIBA, and (b) auxin accumulates on the apical side of a wound in the epidermis and is absent on the basal side. While these results indicate that auxin in the epidermis is polarly transported, this tissue cannot be the only pathway since the epidermis is only a small fraction of the shoot volume. The greater than twofold difference between the concentration of auxin in the epidermal and subtending cells demonstrates that physiological differences in the concentration of auxin can occur between adjacent cells. Images Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 PMID:16667572

  2. Mutational Characterization of the Bile Acid Receptor TGR5 in Primary Sclerosing Cholangitis

    PubMed Central

    Hov, Johannes R.; Keitel, Verena; Laerdahl, Jon K.; Spomer, Lina; Ellinghaus, Eva; ElSharawy, Abdou; Melum, Espen; Boberg, Kirsten M.; Manke, Thomas; Balschun, Tobias; Schramm, Christoph; Bergquist, Annika; Weismüller, Tobias; Gotthardt, Daniel; Rust, Christian; Henckaerts, Liesbet; Onnie, Clive M.; Weersma, Rinse K.; Sterneck, Martina; Teufel, Andreas; Runz, Heiko; Stiehl, Adolf; Ponsioen, Cyriel Y.; Wijmenga, Cisca; Vatn, Morten H.; Stokkers, Pieter C. F.; Vermeire, Severine; Mathew, Christopher G.; Lie, Benedicte A.; Beuers, Ulrich; Manns, Michael P.; Schreiber, Stefan; Schrumpf, Erik; Häussinger, Dieter; Franke, Andre; Karlsen, Tom H.

    2010-01-01

    Background TGR5, the G protein-coupled bile acid receptor 1 (GPBAR1), has been linked to inflammatory pathways as well as bile homeostasis, and could therefore be involved in primary sclerosing cholangitis (PSC) a chronic inflammatory bile duct disease. We aimed to extensively investigate TGR5 sequence variation in PSC, as well as functionally characterize detected variants. Methodology/Principal Findings Complete resequencing of TGR5 was performed in 267 PSC patients and 274 healthy controls. Six nonsynonymous mutations were identified in addition to 16 other novel single-nucleotide polymorphisms. To investigate the impact from the nonsynonymous variants on TGR5, we created a receptor model, and introduced mutated TGR5 constructs into human epithelial cell lines. By using confocal microscopy, flow cytometry and a cAMP-sensitive luciferase assay, five of the nonsynonymous mutations (W83R, V178M, A217P, S272G and Q296X) were found to reduce or abolish TGR5 function. Fine-mapping of the previously reported PSC and UC associated locus at chromosome 2q35 in large patient panels revealed an overall association between the TGR5 single-nucleotide polymorphism rs11554825 and PSC (odds ratio  = 1.14, 95% confidence interval: 1.03–1.26, p = 0.010) and UC (odds ratio  = 1.19, 95% confidence interval 1.11–1.27, p = 8.5×10−7), but strong linkage disequilibrium precluded demarcation of TGR5 from neighboring genes. Conclusions/Significance Resequencing of TGR5 along with functional investigations of novel variants provided unique insight into an important candidate gene for several inflammatory and metabolic conditions. While significant TGR5 associations were detected in both UC and PSC, further studies are needed to conclusively define the role of TGR5 variation in these diseases. PMID:20811628

  3. Phenyl propenoic side chain degradation of ferulic acid by Pycnoporus cinnabarinus - elucidation of metabolic pathways using [5-2H]-ferulic acid.

    PubMed

    Krings, U; Pilawa, S; Theobald, C; Berger, R G

    2001-02-23

    The white-rot fungus Pycnoporous cinnabarinus (DMS-1184) was submerged cultured for 22 days under controlled conditions in a bioreactor. After 6, 9, and 15 days of culture the growth medium was supplemented with [5-2H]-labelled ferulic acid (I). The major phenolic compounds identified labelled were four lignans, the methyl esters of ferulic (I) and vanillic acid (VIII), (E)-coniferyl aldehyde (II), (E)-coniferyl alcohol (III), vanillic acid (VIII), vanillin (IX) and vanillyl alcohol (X). The detection of considerable amounts of labelled 4-hydroxy-3-methoxyacetophenone (VII) in the late growth phase suggested the increasing formation and decarboxylation of free 4-hydroxy-3-methoxybenzoylacetic acid (VI) and, thus, a beta-oxidation-like degradation of ferulic acid (I) or its methyl ester to vanillic acid (VIII). 4-Hydroxy-3-methoxybenzoylacetic acid methyl ester (VI) and 3-hydroxy-(4-hydroxy-3-methoxyphenyl)-propanoic acid methyl ester (V) were synthesised and then identified as metabolites in the culture medium. The fungal degradation of the phenyl propenoic side chain of ferulic acid (I), a principal key step of lignin decomposition, appeared to proceed analogous to fatty acids. PMID:11173097

  4. Quantification and role of organic acids in cucumber root exudates in Trichoderma harzianum T-E5 colonization.

    PubMed

    Zhang, Fengge; Meng, Xiaohui; Yang, Xingming; Ran, Wei; Shen, Qirong

    2014-10-01

    The ability to colonize on plant roots is recognized as one of the most important characteristics of the beneficial fungi Trichoderma spp. The aim of this study is to prove that the utilization of organic acids is a major trait of Trichoderma harzianum T-E5 for colonization of cucumber roots. A series experiments in split-root hydroponic system and in vitro were designed to demonstrate the association between the utilization of organic acids and T-E5 colonization on cucumber roots. In the split-root hydroponic system, inoculation with T-E5 (T) significantly increased the biomass of cucumber plants compared with CK (non-inoculation with T-E5). The T-E5 hyphae densely covering the cucumber root surface were observed by scanning electron microscopy (SEM). Three organic acids (oxalic acid, malic acid and citric acid) were identified from both the CK and T treatments by HPLC and LC/ESI-MS procedures. The amounts of oxalic acid and malic acid in T were significantly higher than those in CK. All the organic acids exhibited different and significant stimulation effects on the mycelial growth and conidial germination of T-E5 in vitro. An additional hydroponic experiment demonstrated the positive effects of organic acids on the T-E5 colonization of cucumber roots. In conclusion, the present study revealed that certain organic acids could be used as nutritional sources for Trichoderma harzianum T-E5 to reinforce its population on cucumber roots.

  5. Dicarboxylic acids, ketocarboxylic acids, α-dicarbonyls, fatty acids and benzoic acid in PM2.5 aerosol collected during CAREBeijing-2007: an effect of traffic restriction on air quality

    NASA Astrophysics Data System (ADS)

    Ho, K. F.; Huang, R.-J.; Kawamura, K.; Tachibana, E.; Lee, S. C.; Ho, S. S. H.; Zhu, T.; Tian, L.

    2014-06-01

    Thirty water-soluble organic species, including dicarboxylic acids, ketocarboxylic acids, α-dicarbonyls, fatty acids, and benzoic acid were determined as well as organic carbon (OC), elemental carbon (EC) and water-soluble organic carbon (WSOC) in PM2.5 samples collected during the Campaign of Air Quality Research in Beijing 2007 (CAREBeijing-2007) in the urban and suburban areas of Beijing. The objective of this study is to identify the influence of traffic emissions and regional transport to the atmosphere in Beijing during summer. PM2.5 samples collected with or without traffic restriction in Beijing are selected to evaluate the effectiveness of local traffic restriction measure on air pollution reduction. The average concentrations of the total quantified bifunctional organic compounds (TQBOC), total fatty acids and benzoic acid during the entire sampling period were 1184 ± 241 ng m-3, 597 ± 159 ng m-3 and 1496 ± 511ng m-3 in PKU, and 1050 ± 303 ng m-3, 475 ± 114 ng m-3 and 1278 ± 372 ng m-3 in Yufa. Oxalic acid (C2) was found as the most abundant dicarboxylic acid at PKU and Yufa, followed by phthalic acid (Ph). A strong even carbon number predominance with the highest level at palmitic acid (C16:0), followed by stearic acid (C18:0) was found for fatty acids. According to the back trajectories modeling results, the air masses were found to originate mainly from northeast, passing over southeast or south of Beijing (heavily populated, urbanized and industrialized areas), during heavier pollution events, whereas they are mainly from north or northwest sector (mountain areas without serious anthropogenic pollution sources) during cleaner events. The data with wind only from the same sector (minimizing the difference from regional contribution) but with and without traffic restriction in Beijing were analyzed to evaluate the effectiveness of local traffic restriction measure on the reduction of local air pollution in Beijing. The results suggested that the

  6. Dicarboxylic acids, ketocarboxylic acids, α-dicarbonyls, fatty acids and benzoic acid in PM2.5 aerosol collected during CAREBeijing-2007: an effect of traffic restriction on air quality

    NASA Astrophysics Data System (ADS)

    Ho, K. F.; Huang, R.-J.; Kawamura, K.; Tachibana, E.; Lee, S. C.; Ho, S. S. H.; Zhu, T.; Tian, L.

    2015-03-01

    Thirty water-soluble organic species, including dicarboxylic acids, ketocarboxylic acids, α-dicarbonyls, fatty acids and benzoic acid were determined as well as organic carbon (OC), elemental carbon (EC) and water-soluble organic carbon (WSOC) in PM2.5 samples collected during the Campaign of Air Quality Research in Beijing 2007 (CAREBeijing-2007) in the urban and suburban areas of Beijing. The objective of this study is to identify the influence of traffic emissions and regional transport to the atmosphere in Beijing during summer. PM2.5 samples collected with or without traffic restriction in Beijing are selected to evaluate the effectiveness of local traffic restriction measures on air pollution reduction. The average concentrations of the total quantified bifunctional organic compounds (TQBOCs), total fatty acids and benzoic acid during the entire sampling period were 1184±241, 597±159 and 1496±511 ng m-3 in Peking University (PKU), and 1050±303, 475±114 and 1278±372 ng m-3 in Yufa, Beijing. Oxalic acid (C2) was found as the most abundant dicarboxylic acid at PKU and Yufa followed by phthalic acid (Ph). A strong even carbon number predominance with the highest level at stearic acid (C18:0), followed by palmitic acid (C16:0) was found for fatty acids. According to the back trajectories modeling results, the air masses were found to originate mainly from the northeast, passing over the southeast or south of Beijing (heavily populated, urbanized and industrialized areas), during heavier pollution events, whereas they are mainly from the north or northwest sector (mountain areas without serious anthropogenic pollution sources) during less pollution events. The data with wind only from the same sector (minimizing the difference from regional contribution) but with and without traffic restriction in Beijing were analyzed to evaluate the effectiveness of local traffic restriction measures on the reduction of local air pollution in Beijing. The results suggested

  7. Risk factors for suicide among patients with schizophrenia: a cohort study focused on cerebrospinal fluid levels of homovanillic acid and 5-hydroxyindoleacetic acid

    PubMed Central

    Neider, Daniel; Lindström, Leif H; Bodén, Robert

    2016-01-01

    Background The objective of this study was to investigate the association between 5-hydroxyindoleacetic acid (5-HIAA) and homovanillic acid (HVA) in cerebrospinal fluid (CSF), bullying, and later suicide among patients with schizophrenia. Methods Ninety-nine patients with schizophrenia were included. Correlations of clinical factors, 5-HIAA and HVA, and later suicide were investigated. Results Twelve patients committed suicide (12%) during a 28-year follow-up period. Later suicide was correlated to bullying in childhood (P=0.02) and a lower quotient of HVA/5-HIAA in CSF (P<0.05). Conclusion Suicide in schizophrenia is related to childhood exposedness and CSF neurotransmitter levels. PMID:27468235

  8. Extracellular acid block and acid-enhanced inactivation of the Ca2+-activated cation channel TRPM5 involve residues in the S3-S4 and S5-S6 extracellular domains.

    PubMed

    Liu, Dan; Zhang, Zheng; Liman, Emily R

    2005-05-27

    TRPM5, a member of the superfamily of transient receptor potential ion channels, is essential for the detection of bitter, sweet, and amino acid tastes. In heterologous cell types it forms a nonselective cation channel that is activated by intracellular Ca(2+). TRPM5 is likely to be part of the taste transduction cascade, and regulators of TRPM5 are likely to affect taste sensation. In this report we show that TRPM5, but not the related channel TRPM4b, is potently blocked by extracellular acidification. External acidification has two effects, a fast reversible block of the current (IC(50) pH = 6.2) and a slower irreversible enhancement of current inactivation. Mutation of a single Glu residue in the S3-S4 linker and a His residue in the pore region each reduced sensitivity of TRPM5 currents to fast acid block (IC(50) pH = 5.8 for both), and the double mutant was nearly insensitive to acidic pH (IC(50) pH = 5.0). Prolonged exposure to acidic pH enhanced inactivation of TRPM5 currents, and mutant channels that were less sensitive to acid block were also less sensitive to acid-enhanced inactivation, suggesting an intimate association between the two processes. These processes are, however, distinct because the pore mutant H896N, which has normal sensitivity to acid block, shows significant recovery from acid-enhanced inactivation. These data show that extracellular acidification acts through specific residues on TRPM5 to block conduction through two distinct but related mechanisms and suggest a possible interaction between extracellular pH and activation and adaptation of bitter, sweet, and amino acid taste transduction.

  9. Alteration of the phospho- or neutral lipid content and fatty acid composition in Listeria monocytogenes due to acid adaptation mechanisms for hydrochloric, acetic and lactic acids at pH 5.5 or benzoic acid at neutral pH.

    PubMed

    Mastronicolis, Sofia K; Berberi, Anita; Diakogiannis, Ioannis; Petrova, Evanthia; Kiaki, Irene; Baltzi, Triantafillia; Xenikakis, Polydoros

    2010-10-01

    This study provides a first approach to observe the effects on Listeria monocytogenes of cellular exposure to acid stress at low or neutral pH, notably how phospho- or neutral lipids are involved in this mechanism, besides the fatty acid profile alteration. A thorough investigation of the composition of polar and neutral lipids from L. monocytogenes grown at pH 5.5 in presence of hydrochloric, acetic and lactic acids, or at neutral pH 7.3 in presence of benzoic acid, is described relative to cells grown in acid-free medium. The results showed that only low pH values enhance the antimicrobial activity of an acid. We suggest that, irrespective of pH, the acid adaptation response will lead to a similar alteration in fatty acid composition [decreasing the ratio of branched chain/saturated straight fatty acids of total lipids], mainly originating from the neutral lipid class of adapted cultures. Acid adaptation in L. monocytogenes was correlated with a decrease in total lipid phosphorus and, with the exception of cells adapted to benzoic acid, this change in the amount of phosphorus reflected a higher content of the neutral lipid class. Upon acetic or benzoic acid stress the lipid phosphorus proportion was analysed in the main phospholipids present: cardiolipin, phosphatidylglycerol, phosphoaminolipid and phosphatidylinositol. Interestingly only benzoic acid had a dramatic effect on the relative quantities of these four phospholipids.

  10. Oleanolic acid acrylate elicits antidepressant-like effect mediated by 5-HT1A receptor.

    PubMed

    Fajemiroye, James O; Polepally, Prabhakar R; Chaurasiya, Narayan D; Tekwani, Babu L; Zjawiony, Jordan K; Costa, Elson A

    2015-01-01

    The development of new drugs for the treatment of depression is strategic to achieving clinical needs of patients. This study evaluates antidepressant-like effect and neural mechanisms of four oleanolic acid derivatives i.e. acrylate (D1), methacrylate (D2), methyl fumarate (D3) and ethyl fumarate (D4). All derivatives were obtained by simple one-step esterification of oleanolic acid prior to pharmacological screening in the forced swimming (FS) and open field (OF) tests. Pharmacological tools like α-methyl-p-tyrosine (AMPT, catecholamine depletor), p-chlorophenylalanine (serotonin depletor), prazosin (PRAZ, selective α1-receptor antagonist), WAY-100635 (selective serotonin 5-HT1A receptor antagonist) as well as monoamine oxidase (MAO) and functional binding assays were conducted to investigate possible neural mechanisms. In the FS test, D1 showed the most promising antidepressant-like effect without eliciting locomotor incoordination. Unlike group of mice pretreated with AMPT 100 mg/kg, PCPA 100 mg/kg or PRAZ 1 mg/kg, the effect of D1 was attenuated by WAY-100635 0.3 mg/kg pretreatment. D1 demonstrated moderate inhibition of MAO-A (IC50 = 48.848 ± 1.935 μM), potency (pEC50 = 6.1 ± 0.1) and intrinsic activity (E max = 26 ± 2.0%) on 5-HT1A receptor. In conclusion, our findings showed antidepressant-like effect of D1 and possible involvement of 5-HT1A receptor.

  11. Meclofenamic acid selectively inhibits FTO demethylation of m6A over ALKBH5

    PubMed Central

    Huang, Yue; Yan, Jingli; Li, Qi; Li, Jiafei; Gong, Shouzhe; Zhou, Hu; Gan, Jianhua; Jiang, Hualiang; Jia, Gui-Fang; Luo, Cheng; Yang, Cai-Guang

    2015-01-01

    Two human demethylases, the fat mass and obesity-associated (FTO) enzyme and ALKBH5, oxidatively demethylate abundant N6-methyladenosine (m6A) residues in mRNA. Achieving a method for selective inhibition of FTO over ALKBH5 remains a challenge, however. Here, we have identified meclofenamic acid (MA) as a highly selective inhibitor of FTO. MA is a non-steroidal, anti-inflammatory drug that mechanistic studies indicate competes with FTO binding for the m6A-containing nucleic acid. The structure of FTO/MA has revealed much about the inhibitory function of FTO. Our newfound understanding, revealed herein, of the part of the nucleotide recognition lid (NRL) in FTO, for example, has helped elucidate the principles behind the selectivity of FTO over ALKBH5. Treatment of HeLa cells with the ethyl ester form of MA (MA2) has led to elevated levels of m6A modification in mRNA. Our collective results highlight the development of functional probes of the FTO enzyme that will (i) enable future biological studies and (ii) pave the way for the rational design of potent and specific inhibitors of FTO for use in medicine. PMID:25452335

  12. Electrochemiluminescence of tris(8-hydroxyquinoline-5-sulfonic acid)aluminum(III) in aqueous solution.

    PubMed

    Muegge, Brian D; Brooks, Sean; Richter, Mark M

    2003-03-01

    The electrochemiluminescence (ECL) of tris(8-hydroxyquinoline-5-sulfonic acid)aluminum(III) in aqueous solution is reported. ECL is generated by complexing aluminum ions with the chelating agent 8-hydroxyquinoline-5-sulfonic acid (HQS) to form Al(HQS)3, followed by oxidation in the presence of tri-n-propylamine (TPrA). The ECL intensity peaks a potential corresponding to oxidation of both TPrA and Al(HQS)3, and the ECL emission spectrum (lambda(max) = 499 nm) matches the photoluminescence emission spectrum, indicating that the emission is from a Al(HQS)3* excited state. ECL efficiencies (phi(ecl), photons generated per redox event) of 0.002 using Ru(bpy)3(2+) (phi(ecl) = 1) as relative standard. Conditions for ECL emission were optimized and used to generate a calibration curve that was linear over the 7 x 10(-6)-4 x 10(-4) M (5-281 mg/L (ppm)) range with a theoretical limit of detection of 1 ppm. The ECL of several metal ions other than aluminum with HQS and effects on Al(HQS)3 ECL were also examined.

  13. Determination of hepatic uridine 5'-diphosphoglucuronic acid concentration by conjugation with diethylstilbestrol.

    PubMed

    Watkins, J B; Klaassen, C D

    1982-03-01

    A sensitive and reliable assay for uridine 5'-diphosphoglucuronic acid (UDPGA) was developed that involved conjugation of diethylstilbestrol (DES) in vitro. This conjugation reaction is solely dependent upon UDPGA concentration. The assay uses 0.13 M Tris-HCl, pH 7.4, 6.7 mM MgCl2, 0.05% Brig 58, 0.25 mg guinea pig liver microsomal protein, 0.13 mM 3H-DES (0.2 microCi/ml), and 200 microliters of boiled 10% liver homogenate in a total volume of 0.5 ml. After a 60-min incubation at 37 degrees C, unconjugated DES is extracted into 5 ml of chloroform and the residual metabolized 3H-DES in the aqueous phase is determined by liquid scintillation spectrometry. After addition of beta-glucuronidase to the aqueous phase, about 90% of the radioactivity could be extracted into chloroform, demonstrating the DES-glucuronic acid is the primary metabolite. Thus, this method easily permits quantitation of UDPGA in rat liver in the 1-10 nmol range.

  14. Meclofenamic acid selectively inhibits FTO demethylation of m6A over ALKBH5.

    PubMed

    Huang, Yue; Yan, Jingli; Li, Qi; Li, Jiafei; Gong, Shouzhe; Zhou, Hu; Gan, Jianhua; Jiang, Hualiang; Jia, Gui-Fang; Luo, Cheng; Yang, Cai-Guang

    2015-01-01

    Two human demethylases, the fat mass and obesity-associated (FTO) enzyme and ALKBH5, oxidatively demethylate abundant N(6)-methyladenosine (m(6)A) residues in mRNA. Achieving a method for selective inhibition of FTO over ALKBH5 remains a challenge, however. Here, we have identified meclofenamic acid (MA) as a highly selective inhibitor of FTO. MA is a non-steroidal, anti-inflammatory drug that mechanistic studies indicate competes with FTO binding for the m(6)A-containing nucleic acid. The structure of FTO/MA has revealed much about the inhibitory function of FTO. Our newfound understanding, revealed herein, of the part of the nucleotide recognition lid (NRL) in FTO, for example, has helped elucidate the principles behind the selectivity of FTO over ALKBH5. Treatment of HeLa cells with the ethyl ester form of MA (MA2) has led to elevated levels of m(6)A modification in mRNA. Our collective results highlight the development of functional probes of the FTO enzyme that will (i) enable future biological studies and (ii) pave the way for the rational design of potent and specific inhibitors of FTO for use in medicine. PMID:25452335

  15. Structural basis of the inhibition of class C acid phosphatases by adenosine 5;#8242;-phosphorothioate

    SciTech Connect

    Singh, Harkewal; Reilly, Thomas J.; Tanner, John J.

    2012-01-20

    The inhibition of phosphatases by adenosine 5'-phosphorothioate (AMPS) was first reported in the late 1960s; however, the structural basis for the inhibition has remained unknown. Here, it is shown that AMPS is a submicromolar inhibitor of class C acid phosphatases, a group of bacterial outer membrane enzymes belonging to the haloacid dehalogenase structural superfamily. Furthermore, the 1.35-{angstrom} resolution crystal structure of the inhibited recombinant Haemophilus influenzae class C acid phosphatase was determined; this is the first structure of a phosphatase complexed with AMPS. The conformation of AMPS is identical to that of the substrate 5'-AMP, except that steric factors force a rotation of the thiophosphoryl out of the normal phosphoryl-binding pocket. This conformation is catalytically nonproductive, because the P atom is not positioned optimally for nucleophilic attack by Asp64, and the O atom of the scissile O-P bond is too far from the Asp (Asp66) that protonates the leaving group. The structure of 5'-AMP complexed with the Asp64 {yields} Asn mutant enzyme was also determined at 1.35-{angstrom} resolution. This mutation induces the substrate to adopt the same nonproductive binding mode that is observed in the AMPS complex. In this case, electrostatic considerations, rather than steric factors, underlie the movement of the phosphoryl. The structures not only provide an explanation for the inhibition by AMPS, but also highlight the precise steric and electrostatic requirements of phosphoryl recognition by class C acid phosphatases. Moreover, the structure of the Asp64 {yields} Asn mutant illustrates how a seemingly innocuous mutation can cause an unexpected structural change.

  16. Wheat rolls fortified with microencapsulated L-5-methyltetrahydrofolic acid or equimolar folic acid increase blood folate concentrations to a similar extent in healthy men and women.

    PubMed

    Green, Timothy J; Liu, Yazheng; Dadgar, Samira; Li, Wangyang; Böhni, Ruth; Kitts, David D

    2013-06-01

    Mandatory folic acid fortification of grains such as wheat flour has been introduced in several countries to reduce the incidence of neural tube defects. There are concerns, however, that folic acid could mask the hematologic signs of vitamin B-12 deficiency and lead to other adverse health outcomes in the population. Calcium L-5-methyltetrahydrofolic acid (L-5-MTHF), a synthetic form of reduced folate, should not mask vitamin B-12 deficiency and may be safer than folic acid. Unfortunately, L-5-MTHF is not stable in most food matrices such as bread. Microencapsulation of L-5-MTHF with sodium ascorbate and a modified starch is effective at preventing loss of the vitamin during baking and storage. Our aim was to assess the efficacy of wheat rolls fortified with microencapsulated L-5-MTHF or equimolar folic acid compared with wheat rolls containing no added folate (placebo) at increasing blood folate concentrations during 16 wk. Healthy men and women aged 18-45 y (n = 45) were randomly assigned to consume wheat rolls that contained L-5-MTHF (452 μg/d), the molar equivalent of folic acid (400 μg/d), or placebo. At 16 wk, the mean (95% CI) erythrocyte folate was 0.48 (0.27, 0.71) and 0.37 (0.17, 0.57) μmol/L higher in the L-5-MTHF (P < 0.001) and folic acid wheat roll (P = 0.001) groups, respectively, than in the placebo group. Likewise, the mean plasma folate was 23 (12, 34) and 23 (12, 34) nmol/L higher in the L-5-MTHF (P < 0.001) and folic acid wheat roll (P < 0.001) groups, respectively, than in the placebo group. There were no significant differences in blood folate concentrations between the L-5-MTHF and folic acid wheat roll groups. Both microencapsulated L-5-MTHF and folic acid-fortified wheat rolls increased blood folate concentrations compared with placebo.

  17. Photophysical and photosensitizing characters of 2-phenylbenzimidazole-5-sulfonic acid. A theoretical study.

    PubMed

    Shen, Liang

    2015-01-01

    The sunscreen agent 2-phenylbenzimidazole-5-sulfonic acid (PBSA) has been reported to exhibit photosensitizing activity. In the present study, the photophysical and photosensitizing properties of PBSA were investigated by means of quantum chemical calculations with the aim to gain deeper insights into the underlying photosensitizing mechanisms. The results indicate that singlet oxygen may be generated spontaneously through direct energy transfer from triplet excited state PBSA to (3)O2, and superoxide anion radical is formed through electron transfer between the anion of PBSA and (3)O2. This offers some deeper insights into the photosensitizing mechanisms of PBSA.

  18. Mechanochemical approach for selective deactivation of external surface acidity of ZSM-5 zeolite catalyst.

    PubMed

    Inagaki, Satoshi; Sato, Koki; Hayashi, Shunsuke; Tatami, Junichi; Kubota, Yoshihiro; Wakihara, Toru

    2015-03-01

    The acid sites associated with the external surface of zeolite particles are responsible for undesirable consecutive reactions, such as isomerization, alkylation, and oligomerization, resulting in a lower selectivity to a target product; therefore, the selective modification (deactivation) of the external surface of zeolite particles has been an important issue in zeolite science. Here, a new method for surface deactivation of zeolite catalyst was tested via a mechanochemical approach using powder composer. Postsynthetic mechanochemical treatment of ZSM-5 zeolite causes a selective deactivation of catalytically active sites existing only on the external surface, as a potentially useful catalyst for highly selective production of p-xylene.

  19. Synthesis and Anti-HIV Activity of Novel 4'-Trifluoromethylated 5'-Deoxycarbocyclic Nucleoside Phosphonic Acids.

    PubMed

    Jee, Jun-Pil; Kim, Seyeon; Hong, Joon Hee

    2015-01-01

    Efficient synthetic route to novel 4'-trifluoromethylated 5'-deoxycarbocyclic nucleoside phosphonic acids was described from α-trifluoromethyl-α,β-unsaturated ester. Coupling of purine nucleosidic bases with cyclopentanol using a Mitsunobu reaction gave the nucleoside intermediates which were further phosphonated and hydrolyzed to reach desired nucleoside analogs. Synthesized nucleoside analogs were tested for anti-HIV activity as well as cytotoxicity. Adenine analog 22 shows significant anti-HIV activity (EC50 = 8.3 μM) up to 100 μM.

  20. Mitochonic Acid 5 Binds Mitochondria and Ameliorates Renal Tubular and Cardiac Myocyte Damage.

    PubMed

    Suzuki, Takehiro; Yamaguchi, Hiroaki; Kikusato, Motoi; Hashizume, Osamu; Nagatoishi, Satoru; Matsuo, Akihiro; Sato, Takeya; Kudo, Tai; Matsuhashi, Tetsuro; Murayama, Kazutaka; Ohba, Yuki; Watanabe, Shun; Kanno, Shin-Ichiro; Minaki, Daichi; Saigusa, Daisuke; Shinbo, Hiroko; Mori, Nobuyoshi; Yuri, Akinori; Yokoro, Miyuki; Mishima, Eikan; Shima, Hisato; Akiyama, Yasutoshi; Takeuchi, Yoichi; Kikuchi, Koichi; Toyohara, Takafumi; Suzuki, Chitose; Ichimura, Takaharu; Anzai, Jun-Ichi; Kohzuki, Masahiro; Mano, Nariyasu; Kure, Shigeo; Yanagisawa, Teruyuki; Tomioka, Yoshihisa; Toyomizu, Masaaki; Tsumoto, Kohei; Nakada, Kazuto; Bonventre, Joseph V; Ito, Sadayoshi; Osaka, Hitoshi; Hayashi, Ken-Ichi; Abe, Takaaki

    2016-07-01

    Mitochondrial dysfunction causes increased oxidative stress and depletion of ATP, which are involved in the etiology of a variety of renal diseases, such as CKD, AKI, and steroid-resistant nephrotic syndrome. Antioxidant therapies are being investigated, but clinical outcomes have yet to be determined. Recently, we reported that a newly synthesized indole derivative, mitochonic acid 5 (MA-5), increases cellular ATP level and survival of fibroblasts from patients with mitochondrial disease. MA-5 modulates mitochondrial ATP synthesis independently of oxidative phosphorylation and the electron transport chain. Here, we further investigated the mechanism of action for MA-5. Administration of MA-5 to an ischemia-reperfusion injury model and a cisplatin-induced nephropathy model improved renal function. In in vitro bioenergetic studies, MA-5 facilitated ATP production and reduced the level of mitochondrial reactive oxygen species (ROS) without affecting activity of mitochondrial complexes I-IV. Additional assays revealed that MA-5 targets the mitochondrial protein mitofilin at the crista junction of the inner membrane. In Hep3B cells, overexpression of mitofilin increased the basal ATP level, and treatment with MA-5 amplified this effect. In a unique mitochondrial disease model (Mitomice with mitochondrial DNA deletion that mimics typical human mitochondrial disease phenotype), MA-5 improved the reduced cardiac and renal mitochondrial respiration and seemed to prolong survival, alth