Science.gov

Sample records for 56mhz srf cavity

  1. The first operation of 56 MHz SRF cavity in RHIC

    SciTech Connect

    Wu, Q.; Belomestnykh, S.; Ben-Zvi, I.; Blaskiewicz, M.; DeSanto, L.; Goldberg, D.; Harvey, M.; Hayes, T.; McIntyre, G.; Mernick, K.; Orfin, P.; Seberg, S.; Severino, F.; Smith, K.; Than, R.; Zaltsman, A.

    2015-05-03

    A 56 MHz superconducting RF cavity has been designed, fabricated and installed in the Relativistic Heavy Ion Collider (RHIC). The cavity operates at 4.4 K with a “quiet helium source” to isolate the cavity from environmental acoustic noise. The cavity is a beam driven quarter wave resonator. It is detuned and damped during injection and acceleration cycles and is brought to operation only at store energy. For a first test operation, the cavity voltage was stabilized at 300 kV with full beam current. Within both Au + Au and asymmetrical Au + He3 collisions, luminosity improvement was detected from direct measurement, and the hourglass effect was reduced. One higher order mode (HOM) coupler was installed on the cavity. We report in this paper on our measurement of a broadband HOM spectrum excited by the Au beam.

  2. Higher Order Mode Damper Study of the 56 MHz SRF Cavity

    SciTech Connect

    Choi,E.; Hahn, H.

    2008-08-01

    This report summarizes the study on the higher order mode (HOM) damper for the 56 MHz SRF cavity. The Q factors and frequencies of the HOMs with the HOM damper are measured and compared to the simulation. The high pass filter prototype for rejecting the fundamental mode is designed and tested. The filter measurement is also compared to the simulation. Based on the measurement, a new location of the HOM damper is chosen.

  3. 3D simulations of multipacting in the 56 MHz SRF cavity

    SciTech Connect

    Wu Q.; Belomestnykh, S.; Ge, L.; Ko, K.; Li, Z.; Ng, C.; Xiao, L.

    2012-05-20

    The 56 MHz SRF Quarter-Wave Resonator (QWR) is designed for RHIC as a storage cavity to improve the collider performance. 2D multipacting simulation has been done for the cavity alone. Ripples were added to the outer body of the cavity for multipacting suppression based on the simulation findings. During operation, there will be four higher order mode (HOM) couplers. All of these components will be exposed to high RF fields. In this paper we compare 2D and 3D codes simulation results for multipacting in the cavity. We also report 3D simulation results for multipacting simulation at the couplers.

  4. Buffer Chemical Polishing and RF Testing of the 56 MHz SRF Cavity

    SciTech Connect

    Burrill,A.

    2009-01-01

    The 56 MHz cavity presents a unique challenge in preparing it for RF testing prior to construction of the cryomodule. This challenge arises due to the physical dimensions and subsequent weight of the cavity, and is further complicated by the coaxial geometry, and the need to properly chemically etch and high pressure rinse the entire inner surface prior to RF testing. To the best of my knowledge, this is the largest all niobium SRF cavity to be chemically etched and subsequently tested in a vertical dewar at 4K, and these processes will be the topic of this technical note.

  5. The fundamental power coupler and pick-up of the 56 MHz SRF cavity for RHIC

    SciTech Connect

    Wu, Q.; Bellavia, S.; Ben-Zvi, I.; Pai, C.

    2011-03-28

    A fundamental power coupler (FPC) is designed to provide fast tuning the 56MHz SRF cavity in RHIC. The FPC will be inserted from one of the chemical cleaning ports at the rear end of the cavity with magnetic coupling to the RF field. The size and the location of the FPC are decided based on the required operational external Q of the cavity. The cavity is beam driven, and the FPC is designed with variable coupling that would cover a range of power levels. It is thermally isolated from the base temperature of the cavity, which is 4.2K. A 1kW power amplifier will be used to close an amplitude control feedback loop. In this paper, we discuss the coupling factor of the FPC with the chosen design.

  6. IBS and expected luminosity performance for RHIC beams at top energy with 56 MHz SRF cavity

    SciTech Connect

    Fedotov,A.

    2008-10-01

    The purpose of RF system in RHIC is to capture injected bunches, accelerate them to the top energy, and store bunches at the top energy for many hours. The accelerating RF system operates at harmonic number h=360 of the particle revolution frequency f=78.196 kHz, which corresponds to 28.15MHz. The storage RF system accepts the shortened bunches at top energy and provides longitudinal focusing to keep these bunches short during the store time (collision mode). The storage system operates at harmonic number h=7x360=2520, which corresponds to an RF frequency of 197.05 MHz [1]. Recently, an upgrade of storage RF system with a superconducting 56 MHz cavity was proposed [2]. This upgrade will provide significant increase in the acceptance of storage RF bucket. Presently, the short bunch length for collisions is obtained via RF gymnastics with bunch rotation (called re-bucketing), because the length of 197MHz bucket of 5 nsec is too short to accommodate long bunches otherwise. However, due to bucket non-linearity and hardware complications some increase in the longitudinal emittance occurs during re-bucketing. The 56MHz cavity will produce sufficiently short bunches which would allow one to operate without re-bucketing procedure. This Note summarizes simulation of beam evolution due to Intra-beam scattering (IBS) for beam parameters expected with the 56 MHz SRF cavity upgrade. Expected luminosity improvement is shown both for Au ions at 100 GeV/nucleon and for protons at 250 GeV.

  7. Fundamental damper power calculation of the 56MHz SRF cavity for RHIC

    SciTech Connect

    Wu, Q.; Bellavia, S.; Ben-Zvi, I.; Grau, M.; Miglionico, G.; Pai, C.

    2011-03-28

    At each injection period during RHIC's operation, the beam's frequency sweeps across a wide range, and some of its harmonics will cross the frequency of the 56MHz SRF cavity. To avoid excitation of the cavity at these times, we designed a fundamental damper for the quarter-wave resonator to damp the cavity heavily. The power extracted by the fundamental damper should correspond to the power handling ability of the system at all stages. In this paper, we discuss the power output from the fundamental damper when it is fully extracted, inserted, and any intermediate point. A Fundamental Damper (FD) will greatly reduce the cavity's Q factor to {approx}300 during the acceleration phase of the beam. However, when the beam is at store and the FD is removed, the cavity is excited by both the yellow and the blue beams at 2 x 0.3A to attain the required 2MV voltage across its gap. The cavity then is operated to increase the luminosity of the RHIC experiments. Table 1 lists the parameters of the FD. Figure 1 shows the configuration of the FD fully inserted into the 56MHz SRF cavity; this complete insertion is defined as the start location (0cm) of FD simulation, an assumption we make throughout this paper. The power consumed by the cavity while maintaining the beam's energy and its orbit is compensated by the 28MHz accelerating cavities in the storage ring. The power dissipation of the external load is dynamic with respect to the position of the FD during its extraction. As a function of the external Q and the EM field in the cavity, the power should peak with the FD at a certain vertical location. Our calculation of the power extracted is detailed in the following sections. Figure 2 plots the frequency change in the cavity, and the external Q against the changes in position of the FD. The location of the FD is selected carefully such that the frequency will approach the designed working point from the lower side only. The loaded Q of the cavity is 223 when the FD is fully

  8. Higher Order Model Power Calculation of the 56 MHz SRF Cavity

    SciTech Connect

    Choi,E.

    2008-08-01

    In this report, the HOM power dissipated to the load in the 56 MHz RF cavity is calculated. The HOM frequencies and Q factors with the inserted HOM damper are obtained from the simulations by MWS and SLAC codes.

  9. Summary on the Fundamental Mode Damper Experiments of the 56 MHz SRF Cavity

    SciTech Connect

    Choi,E.; Hahn, H.

    2008-07-01

    This report summarizes the experimental results done with the fundamental damper for the 56 MHz prototype Cu cavity. Various measurements were done on the cavity including determination of the position of the fundamental damper and measurement of the frequency and Q factor changes while the damper is withdrawn. Prediction on the dissipated power while the damper is withdrawn was made by experiments.

  10. Cryogenic sub-system for the 56 MHz SRF storage cavity for RHIC

    SciTech Connect

    Huang, Y.; Than, R.; Orfin, P.; Lederle, D.; Tallerico, T.; Masi L.; Talty, P.; Zhang, Y.

    2011-03-28

    A 56 MHz Superconducting RF Storage Cavity is being constructed for the RHIC collider. This cavity is a quarter wave resonator that will be operated in a liquid helium bath at 4.4 K. The cavity requires an extremely quiet environment to maintain its operating frequency. The cavity, besides being engineered for a mechanically quiet system, also requires a quiet cryogenic system. The helium is taken from RHIC's main helium supply header at 3.5 atm, 5.3K at a phase separator tank. The boil-off is sent back to the RHIC refrigeration system to recover the cooling. To acoustically separate the RHIC helium supply and return lines, a condenser/boiler heat exchanger condenses the helium vapor generated in the RF cavity bath. A system description and operating parameters are given about the cryogen delivery system. The 56 MHz superconducting storage RF cavity project is making progress. The cryogenic system design is in its final stage. The helium supply lines have been tapped into the RHIC helium distribution lines. The plate-and-fin heat exchanger design is near completion and specification will be sent out for bid soon. The cold helium vapor heating system design will start soon as well. A booster compressor specification is underway. The first phase separator and transfer line design work is near completion and will be sent out for bid soon.

  11. Simulation of the High-Pass Filter for 56MHz Cavity for RHIC

    SciTech Connect

    Wu, Q.; Ben-Zvi, I.

    2010-05-23

    The 56MHz Superconducting RF (SRF) cavity for RHIC places high demands High Order Mode (HOM) damping, as well as requiring a high field at gap with fundamental mode frequency. The damper of 56MHz cavity is designed to extract all modes to the resistance load outside, including the fundamental mode. Therefore, the circuit must incorporate a high-pass filter to reflect back the fundamental mode into the cavity. In this paper, we show the good frequency response map obtained from our filter's design. We extract a circuit diagram from the microwave elements that simulate well the frequency spectrum of the finalized filter. We also demonstrate that the power dissipation on the filter over its frequency range is small enough for cryogenic cooling.

  12. Operation of the 56 MHz superconducting RF cavity in RHIC during run 14

    SciTech Connect

    Wu, Q.; Belomestnykh, S.; Ben-Zvi, I.; Blaskiewicz, M.; Hayes, T.; Mernick, K.; Severino, F.; Smith, K.; Zaltsman, A.

    2015-09-11

    A 56 MHz superconducting RF cavity was designed and installed in the Relativistic Heavy Ion Collider (RHIC). It is the first superconducting quarter wave resonator (QWR) operating in a high-energy storage ring. We discuss herein the cavity operation with Au+Au collisions, and with asymmetrical Au+He3 collisions. The cavity is a storage cavity, meaning that it becomes active only at the energy of experiment, after the acceleration cycle is completed. With the cavity at 300 kV, an improvement in luminosity was detected from direct measurements, and the bunch length has been reduced. The uniqueness of the QWR demands an innovative design of the higher order mode dampers with high-pass filters, and a distinctive fundamental mode damper that enables the cavity to be bypassed during the acceleration stage.

  13. Quench propagation in the HOM damper of the 56 MHz cavity

    SciTech Connect

    Ben-Zvi,I.

    2009-08-01

    The aim of this report is to summarize a study of the propagation of a quench in a HOM damper probe of the 56 MHz superconducting storage cavity for RHIC and provide guidance for machine protection. The 56 MHz cavity [1] is designed to operate as a beam-driven superconducting quarter-wave resonator in the RHIC ring. Four Higher Order Mode (HOM) dampers [2] are used to prevent beam instabilities [3] in RHIC. These are inserted in the back wall of the cavity (the high magnetic field region) through ports that also serve for rinsing the cavity with high-pressure deionized water as well as the fundamental power coupler and pick-up ports. Figure 1 shows the outline of the cavity [4,5]. The HOM damper probe has a magnetic coupling loop which penetrates the cavity as shown in Figure 2 [5]. The loop is cooled by conduction to the 4.3K helium system, thus any sudden, significant amount of heat dumped on the loop will cause local heating. The peak magnetic field on the loop can reach about 7.4 x 10{sup 4} amperes per meter at a cavity voltage of 2.5 MV [5]. The scenario we present here is that a small region on the loop quenches. We can calculate the current driving the cavity using the RHIC parameters and get the magnetic field as a function of the current, the cavity's intrinsic Q and detuning parameter, however it turns out that within the time relevant for the quench development (a fraction of a second) the cavity field does not change sufficiently to warrant this extra computation. Thus we can assume that the field over the loop is constant. The damper loop dimensions are not so important, however its cross section is. In the following we assume that the loop's cross-section is 2 cm by 0.3 cm. It is actually rounded in cross section (sharp corners avoided) but we will approximate it as square. The material parameters taken for the niobium loop (assuming high RRR of about 200) are given in the following stepwise linear approximations. The surface resistivity in ohms as a

  14. Mechanical design of 56 MHz superconducting RF cavity for RHIC collider

    SciTech Connect

    Pai, C.; Ben-Zvi, I.; Burrill, A.; Chang, X.; McIntyre, G.; Than, Y.; Tuozzolo, J.; Wu, Q.

    2011-03-28

    A 56 MHz Superconducting RF Cavity operating at 4.4K is being constructed for the RHIC collider. This cavity is a quarter wave resonator with beam transmission along the centerline. This cavity will increase collision luminosity by providing a large longitudinal bucket for stored bunches of RHIC ion beam. The major components of this assembly are the niobium cavity with the mechanical tuner, its titanium helium vessel and vacuum cryostat, the support system, and the ports for HOM and fundamental dampers. The cavity and its helium vessel must meet equivalent safety with the ASME pressure vessel code and it must not be sensitive to frequency shift due to pressure fluctuations from the helium supply system. Frequency tuning achieved by a two stage mechanical tuner is required to meet performance parameters. This tuner mechanism pushes and pulls the tuning plate in the gap of niobium cavity. The tuner mechanism has two separate drive systems to provide both coarse and fine tuning capabilities. This paper discusses the design detail and how the design requirements are met.

  15. Beam dynamics and expected RHIC performance with 56MHz RF upgrade

    SciTech Connect

    Fedotov,A.V.; Ben-Zvi, I.

    2009-05-04

    An upgrade of the RHIC storage RF system with a superconducting 56 MHz cavity was recently proposed. This upgrade will provide a significant increase in the acceptance of the RHIC 197 MHz storage RF bucket. This paper summarizes simulations of beam evolution due to intra-beam scattering (IBS) for beam parameters expected with the 56 MHz SRF cavity upgrade. Expected luminosity improvements are shown for Au ions at 100 GeV/nucleon and protons at 250 GeV.

  16. Plasma Treatment of Niobium SRF Cavity Surfaces

    SciTech Connect

    J. Upadhyay, M. Raskovic, L. Vuskovic, S. Popovic, A.-M. Valente-Feliciano, L. Phillips

    2010-05-01

    Plasma based surface modification provides an excellent opportunity to eliminate non- superconductive pollutants in the penetration depth region of the SRF cavity surface and to remove mechanically damaged surface layer improving surface roughness. We have demonstrated on flat samples that plasma etching in Ar / Cl2 of bulk Nb is a viable alternative surface preparation technique to BCP and EP methods, with comparable etching rates. The geometry of SRF cavities made of bulk Nb defines the use of asymmetric RF discharge configuration for plasma etching. In a specially designed single cell cavity with sample holders, discharge parameters are combined with etched surface diagnostics to obtain optimum combination of etching rates, roughness and homogeneity in a variety of discharge types, conditions, and sequences. The optimized experimental conditions will ultimately be applied to single cell SRF cavities.

  17. Resonance control in SRF cavities at FNAL

    SciTech Connect

    Schappert, W.; Pischalnikov, Y.; Scorrano, M.; /INFN, Pisa

    2011-03-01

    The Lorentz force can dynamically detune pulsed Superconducting RF cavities. Considerable additional RF power can be required to maintain the accelerating gradient if no effort is made to compensate for this detuning. Compensation systems using piezo actuators have been used successfully at DESY and elsewhere to control Lorentz Force Detuning (LFD). Recently, Fermilab has developed an adaptive compensation system for cavities in the Horizontal Test Stand, in the SRF Accelerator Test Facility, and for the proposed Project X.

  18. "Fine grain Nb tube for SRF cavities"

    SciTech Connect

    Robert E. Barber

    2012-07-08

    Superconducting radio frequency (SRF) cavities used in charged particle linear accelerators, are currently fabricated by deep drawing niobium sheets and welding the drawn dishes together. The Nb sheet has a non-uniform microstructure, which leads to unpredictable cavity shape and surface roughness, and inconsistent "spring-back" during forming. In addition, weld zones cause hot spots during cavity operation. These factors limit linear accelerator performance and increase cavity manufacturing cost. Equal channel angular extrusion (ECAE) can be used to refine and homogenize the microstructure of Nb tube for subsequent hydroforming into SRF cavities. Careful selection of deformation and heat treatment conditions during the processing steps can give a uniform and consistent microstructure in the tube, leading to improved deformability and lower manufacturing costs. Favorable microstructures were achieved in short test samples of RRR Nb tube, which may be particularly suitable for hydroforming into SRF cavity strings. The approach demonstrated could be applicable to microstructure engineering of other tube materials including tantalum, titanium, and zirconium.

  19. RRR Characteristics for SRF cavities

    NASA Astrophysics Data System (ADS)

    Jung, Yoochul; Hyun, Myungook; Joung, Mijoung

    2015-10-01

    The first heavy ion accelerator is being constructed by the rare isotope science project (RISP) launched by the Institute of Basic Science (IBS) in South Korea. Four different types of superconducting cavities were designed, and prototypes such as a quarter-wave resonator (QWR), a half-wave resonator (HWR) and a single-spoke resonator (SSR) were fabricated. One of the critical factors determining the performances of superconducting cavities is the residual resistance ratio (RRR). The RRR values essentially represent how pure niobium is and how fast niobium can transmit heat. In general, the RRR degrades during electron beam welding due to impurity incorporation. Thus, it is important to maintain the RRR above a certain value at which a niobium cavity shows target performance. In this study, RRR degradation related with electron beam welding conditions, for example, the welding power, welding speed, and vacuum level, will be discussed.

  20. Pump down rate for SRF cavities

    SciTech Connect

    Kuchnir, M.; Knobloch, J.

    1992-02-01

    This note is about calculations aimed at quantifying adequate pumping speeds of evacuation of normally humid clean-room air from typical Superconducting Radiofrequency (SRF) cavities. The subject is of high relevance to the semiconductor industry, where the yield of VLSI (Very Large Scale Integration) chip production is affected by micron size particles which may cause fatal defects to their micron and sub-micron features. The recent availability of particle counters capable of operating in vacuum has stimulated measurements at reduced pressures in this subject.

  1. Plasma Processing of Large Surfaces with Application to SRF Cavity Modification

    SciTech Connect

    Upadhyay, Janardan; Popovic, Svetozar; Vuskovic, Leposova; Im, Do; Valente, Anne-Marie; Phillips, H

    2013-09-01

    Plasma based surface modifications of SRF cavities present promising alternatives to the wet etching technology currently applied. To understand and characterize the plasma properties and chemical kinetics of plasma etching processes inside a single cell cavity, we have built a specially-designed cylindrical cavity with 8 observation ports. These ports can be used for holding niobium samples and diagnostic purposes simultaneously. Two frequencies (13.56 MHz and 2.45 GHz) of power source are used for different pressure, power and gas compositions. The plasma parameters were evaluated by a Langmuir probe and by an optical emission spectroscopy technique based on the relative intensity of two Ar 5p-4s lines at 419.8 and 420.07 nm. Argon 5p-4s transition is chosen to determine electron temperature in order to optimize parameters for plasma processing. Chemical kinetics of the process was observed using real-time mass spectroscopy. The effect of these parameters on niobium surface would be measured, presented at this conference, and used as guidelines for optimal design of SRF etching process.

  2. Commissioning Cornell OSTs for SRF cavity testing at Jlab

    SciTech Connect

    Eremeev, Grigory

    2011-07-01

    Understanding the current quench limitations in SRF cavities is a topic essential for any SRF accelerator that requires high fields. This understanding crucially depends on correct and precise quench identification. Second sound quench detection in superfluid liquid helium with oscillating superleak transducers is a technique recently applied at Cornell University as a fast and versatile method for quench identification in SRF cavities. Having adopted Cornell design, we report in this contribution on our experience with OST for quench identification in different cavities at JLab.

  3. Plasma Parameters of SRF Cavities for Radio-Frequency Discharge Processing

    NASA Astrophysics Data System (ADS)

    Upadhyay, Janardan; Popovic, Svetozar; Vuskovic, Lepsha; Valente-Feliciano, Anne-Marie; Phillips, Larry

    2012-10-01

    Superconducting radio frequency (SRF) cavities of bulk Niobium are accelerating field-generating components of particle accelerators. Cavities are designed to support TM modes at a resonant frequency, which usually serve as their identifier. RF plasma surface modification dry-etching technology as an alternative to the currently existing wet etching technology requires a different RF coupling regime. The choice of power generator frequency greatly affects the field and plasma parameters distribution over the cavity. These are adjusted by a coaxial centerline antenna to provide for optimum level of plasma sheath uniformity. In the search for best etching conditions, we are opting for radio frequency (13.56 MHz, 100 MHz) and microwave frequency plasma (2.45 GHz) in Ar/Cl2 gas mixture. We have developed five optical probes for simultaneous spectroscopic measurements of the plasma properties at five points inside the cavity. The electron temperature and density measurement at the same set of points will be also measured with a Langmuir probe. The measurement of plasma parameters at different pressure and power for the chosen frequency set with varying chlorine content will be presented.

  4. Experiment and Results on Plasma Etching of SRF cavities

    SciTech Connect

    Upadhyay, Janardan; Im, Do; Peshl, J.; Vuskovic, Leposova; Popovic, Svetozar; Valente, Anne-Marie; Phillips, H. Lawrence

    2015-09-01

    The inner surfaces of SRF cavities are currently chemically treated (etched or electropolished) to achieve the state of the art RF performance. We designed an apparatus and developed a method for plasma etching of the inner surface for SRF cavities. The process parameters (pressure, power, gas concentration, diameter and shape of the inner electrode, temperature and positive dc bias at inner electrode) are optimized for cylindrical geometry. The etch rate non-uniformity has been overcome by simultaneous translation of the gas point-of-entry and the inner electrode during the processing. A single cell SRF cavity has been centrifugally barrel polished, chemically etched and RF tested to establish a baseline performance. This cavity is plasma etched and RF tested afterwards. The effect of plasma etching on the RF performance of this cavity will be presented and discussed.

  5. Camera assembly design proposal for SRF cavity image collection

    SciTech Connect

    Tuozzolo, S.

    2011-10-10

    This project seeks to collect images from the inside of a superconducting radio frequency (SRF) large grain niobium cavity during vertical testing. These images will provide information on multipacting and other phenomena occurring in the SRF cavity during these tests. Multipacting, a process that involves an electron buildup in the cavity and concurrent loss of RF power, is thought to be occurring near the cathode in the SRF structure. Images of electron emission in the structure will help diagnose the source of multipacting in the cavity. Multipacting sources may be eliminated with an alteration of geometric or resonant conditions in the SRF structure. Other phenomena, including unexplained light emissions previously discovered at SLAC, may be present in the cavity. In order to effectively capture images of these events during testing, a camera assembly needs to be installed to the bottom of the RF structure. The SRF assembly operates under extreme environmental conditions: it is kept in a dewar in a bath of 2K liquid helium during these tests, is pumped down to ultra-high vacuum, and is subjected to RF voltages. Because of this, the camera needs to exist as a separate assembly attached to the bottom of the cavity. The design of the camera is constrained by a number of factors that are discussed.

  6. JLab SRF Cavity Fabrication Errors, Consequences and Lessons Learned

    SciTech Connect

    Frank Marhauser

    2011-09-01

    Today, elliptical superconducting RF (SRF) cavities are preferably made from deep-drawn niobium sheets as pursued at Jefferson Laboratory (JLab). The fabrication of a cavity incorporates various cavity cell machining, trimming and electron beam welding (EBW) steps as well as surface chemistry that add to forming errors creating geometrical deviations of the cavity shape from its design. An analysis of in-house built cavities over the last years revealed significant errors in cavity production. Past fabrication flaws are described and lessons learned applied successfully to the most recent in-house series production of multi-cell cavities.

  7. Tomographic Analysis of SRF Cavities as Asymmetric Plasma Reactors

    SciTech Connect

    M. Nikolić, A.L. Godunov, S. Popović, A. Samolov, J. Upadhyay, L. Vušković, H.L. Phillips, A-M. Valente-Feliciano

    2010-05-01

    The tomographic reconstruction of local plasma parameters for nonequilibrium plasma sources is a developing approach, which has a great potential in understanding the fundamental processes and phenomena during plasma processing of SRF cavity walls. Any type of SRF cavity presents a plasma rector with limited or distorted symmetry and possible presence of high gradients. Development of the tomographic method for SRF plasma analysis consists of several steps. First, we define the method based on the inversion of the Abel integral equation for a hollow spherical reactor. Second step is application of the method for the actual elliptical cavity shape. Third step consists of study of the effects of various shapes of the driven electrode. Final step consists of testing the observed line-integrated optical emission data. We will show the typical results in each step and the final result will be presented in the form of correlation between local plasma parameter distributions and local etching characteristics.

  8. Tunneling study of SRF cavity-grade niobium.

    SciTech Connect

    Proslier, T.; Zasadzinski, J.; Cooley, L.; Pellin, M.; Norem, J.; Elam, J.; Antonine, C. Z.; Rimmer, R.; Kneisel, P.; Illinois Inst. of Tech.; FNL; Thomas Jefferson Lab.; CEA-Saclay

    2009-06-01

    Niobium, with its very high H{sub C1}, has been used in superconducting radio frequency (SRF) cavities for accelerator systems for 40 years with continual improvement. The quality factor of cavities (Q) is governed by the surface impedance R{sub BCS}, which depends on the quasiparticle gap, delta, and the superfluid density. Both of these parameters are seriously affected by surface imperfections (metallic phases, dissolved oxygen, magnetic impurities). Loss mechanism and surface treatments of Nb cavities found to improve the Q factor are still unsolved mysteries. We present here an overview of the capabilities of the point contact tunneling spectroscopy and Atomic layer deposition methods and how they can help understanding the High field Q-drop and the mild baking effect. Tunneling spectroscopy was performed on Nb pieces from the same processed material used to fabricate SRF cavities. Air exposed, electropolished Nb exhibited a surface superconducting gap Delta = 1.55 meV, characteristic of clean, bulk Nb, however the tunneling density of states (DOS) was broadened significantly. Nb pieces treated with the same mild baking used to improve the Q-slope in SRF cavities revealed a much sharper DOS. Good fits to the DOS are obtained using Shiba theory suggesting that magnetic scattering of quasiparticles is the origin of the degraded surface superconductivity and the Q-slope problem of Nb SRF cavities.

  9. Automated frequency tuning of SRF cavities at CEBAF

    SciTech Connect

    Chowdhary, M.; Doolittle, L.; Lahti, G.; Simrock, S.N.; Terrell, R.

    1995-12-31

    An automated cavity tuning procedure has been implemented in the CEBAF control system to tune the superconducting RF (SRF) cavities to their operating frequency of 1497 MHz. The capture range for coarse tuning algorithm (Burst Mode) is more than 20 cavity bandwidths (5 kHz). The fine tuning algorithm (Sweep Mode) calibrates the phase offset in the detuning angle measurement. This paper describes the implementation of these algorithms and experience of their operation in CEBAF control system. 3 refs., 5 figs.

  10. Recent Developments in SRF Cavity Science and Performance

    SciTech Connect

    G. Ciovati

    2006-08-10

    The performances of SRF cavities made of high purity bulk niobium have been improving in the last few years and surface magnetic fields (Bp) close to the thermodynamic critical field of niobium have been achieved in a few cases. The recommendation made in 2004 in favor of SRF as the technology of choice for the International Linear Collider (ILC), requires improving the reliability of multi-cell cavities operating at accelerating gradients (Eacc) of the order of 35 MV/m. Additionally, a better understanding of the present limitations to cavity performance, such as the high-field Q-drop is needed. This contribution presents some recent developments in SRF cavity science and performance. Among the most significant advances of the last few years, new cavity shapes with lower ratio Bp/Eacc were designed and tested. Cavities made of large-grain niobium became available, promising lower cost at comparable performance to standard fine-grain ones and several tests on single-cell cavities were done to gain a better understanding of high-field losses. In addition, studies to improve the reliability of electropolishing are being carried out by several research groups.

  11. Apparatus and method for plasma processing of SRF cavities

    NASA Astrophysics Data System (ADS)

    Upadhyay, J.; Im, Do; Peshl, J.; Bašović, M.; Popović, S.; Valente-Feliciano, A.-M.; Phillips, L.; Vušković, L.

    2016-05-01

    An apparatus and a method are described for plasma etching of the inner surface of superconducting radio frequency (SRF) cavities. Accelerator SRF cavities are formed into a variable-diameter cylindrical structure made of bulk niobium, for resonant generation of the particle accelerating field. The etch rate non-uniformity due to depletion of the radicals has been overcome by the simultaneous movement of the gas flow inlet and the inner electrode. An effective shape of the inner electrode to reduce the plasma asymmetry for the coaxial cylindrical rf plasma reactor is determined and implemented in the cavity processing method. The processing was accomplished by moving axially the inner electrode and the gas flow inlet in a step-wise way to establish segmented plasma columns. The test structure was a pillbox cavity made of steel of similar dimension to the standard SRF cavity. This was adopted to experimentally verify the plasma surface reaction on cylindrical structures with variable diameter using the segmented plasma generation approach. The pill box cavity is filled with niobium ring- and disk-type samples and the etch rate of these samples was measured.

  12. Recent Progress on High-Current SRF Cavities at Jlab

    SciTech Connect

    Robert Rimmer, William Clemens, James Henry, Peter Kneisel, Kurt Macha, Frank Marhauser, Larry Turlington, Haipeng Wang, Daniel Forehand

    2010-05-01

    JLab has designed and fabricated several prototype SRF cavities with cell shapes optimized for high current beams and with strong damping of unwanted higher order modes. We report on the latest test results of these cavities and on developments of concepts for new variants optimized for particular applications such as light sources and high-power proton accelerators, including betas less than one. We also report on progress towards a first beam test of this design in the recirculation loop of the JLab ERL based FEL. With growing interest worldwide in applications of SRF for high-average power electron and hadron machines, a practical test of these concepts is highly desirable. We plan to package two prototype cavities in a de-mountable cryomodule for temporary installation into the JLab FEL for testing with RF and beam. This will allow verification of all critical design and operational parameters paving the way to a full-scale prototype cryomodule.

  13. Cryogenic vertical test facility for the SRF cavities at BNL

    SciTech Connect

    Than, R.; Liaw, CJ; Porqueddu, R.; Grau, M.; Tuozzolo, J.; Tallerico, T.; McIntyre, G.; Lederle, D.; Ben-Zvi, I.; Burrill, A.; Pate, D.

    2011-03-28

    A vertical test facility has been constructed to test SRF cavities and can be utilized for other applications. The liquid helium volume for the large vertical dewar is approximate 2.1m tall by 1m diameter with a clearance inner diameter of 0.95m after the inner cold magnetic shield installed. For radiation enclosure, the test dewar is located inside a concrete block structure. The structure is above ground, accessible from the top, and equipped with a retractable concrete roof. A second radiation concrete facility, with ground level access via a labyrinth, is also available for testing smaller cavities in 2 smaller dewars. The cryogenic transfer lines installation between the large vertical test dewar and the cryo plant's sub components is currently near completion. Controls and instrumentations wiring are also nearing completion. The Vertical Test Facility will allow onsite testing of SRF cavities with a maximum overall envelope of 0.9 m diameter and 2.1 m height in the large dewar and smaller SRF cavities and assemblies with a maximum overall envelope of 0.66 m diameter and 1.6 m height.

  14. High-current SRF cavity design

    NASA Astrophysics Data System (ADS)

    Meidlinger, D.; Grimm, T. L.; Hartung, W.

    2006-07-01

    For high current applications, it is desirable for the cavity shape to have a low longitudinal loss factor and to have a high beam-breakup threshold current. This paper briefly describes three different cavities designed for this purpose: a six-cell elliptical cavity for particles traveling at the speed of light, a two-cell elliptical cavity for subluminal particle speeds, and a single cell cavity which uses the TM012 mode for acceleration. SUPERFISH simulations predict the peak fields in both of the elliptical cavities will not exceed the TeSLA values by more than 10% but both will have 28.7% larger apertures. The elliptical designs assume the bunch frequency equals the accelerating mode frequency. The beam pipe radius is chosen so that the cutoff frequency is less than twice that of the accelerating mode. Hence all of the monopole and dipole higher-order modes (HOMs) that can be driven by the beam have low loaded Q values. This simplifies the problem of HOM damping. The TM012 cavity is predicted to have much higher peak fields than a π-mode elliptical cavity, but offers potential advantages from its simplified shape; it is essentially a circular waveguide with curved end plates. This basic shape results in easier fabrication and simplified tuning.

  15. Microphonics Measurements in SRF Cavities for RIA

    SciTech Connect

    Kelly, M.P.; Fuerst, Joel; Kedzie, M.; Sharamentov, S.I.; Shepard, Kenneth; Delayen, Jean

    2003-05-01

    Phase stabilization of the RIA drift tube cavities in the presence of microphonics will be a key issue for RIA. Due to the relatively low beam currents (lte 0.5 pmA) required for the RIA driver, microphonics will impact the rf power required to control the cavity fields. Microphonics measurements on the ANL Beta=0.4 single spoke cavity and on the ANL Beta=0.4 two-cell spoke cavity have been performed many at high fields and using a new "cavity resonance monitor" device developed in collaboration with JLAB. Tests on a cold two-cell spoke are the first ever on a multi-cell spoke geometry. The design is essentially a production model with an integral stainless steel housing to hold the liquid helium bath.

  16. SRF Cavity Surface Topography Characterization Using Replica Techniques

    SciTech Connect

    C. Xu, M.J. Kelley, C.E. Reece

    2012-07-01

    To better understand the roll of topography on SRF cavity performance, we seek to obtain detailed topographic information from the curved practical cavity surfaces. Replicas taken from a cavity interior surface provide internal surface molds for fine Atomic Force Microscopy (AFM) and stylus profilometry. In this study, we confirm the replica resolution both on surface local defects such as grain boundary and etching pits and compare the surface uniform roughness with the aid of Power Spectral Density (PSD) where we can statistically obtain roughness parameters at different scales. A series of sampling locations are at the same magnetic field chosen at the same latitude on a single cell cavity to confirm the uniformity. Another series of sampling locations at different magnetic field amplitudes are chosen for this replica on the same cavity for later power loss calculation. We also show that application of the replica followed by rinsing does not adversely affect the cavity performance.

  17. Design of half-reentrant SRF cavities

    NASA Astrophysics Data System (ADS)

    Meidlinger, M.; Grimm, T. L.; Hartung, W.

    2006-07-01

    The shape of a TeSLA inner cell can be improved to lower the peak surface magnetic field at the expense of a higher peak surface electric field by making the cell reentrant. Such a single-cell cavity was designed and tested at Cornell, setting a world record accelerating gradient [V. Shemelin et al., An optimized shape cavity for TESLA: concept and fabrication, 11th Workshop on RF Superconductivity, Travemünde, Germany, September 8-12, 2003; R. Geng, H. Padamsee, Reentrant cavity and first test result, Pushing the Limits of RF Superconductivity Workshop, Argonne National Laboratory, September 22-24, 2004]. However, the disadvantage to a cavity is that liquids become trapped in the reentrant portion when it is vertically hung during high pressure rinsing. While this was overcome for Cornell’s single-cell cavity by flipping it several times between high pressure rinse cycles, this may not be feasible for a multi-cell cavity. One solution to this problem is to make the cavity reentrant on only one side, leaving the opposite wall angle at six degrees for fluid drainage. This idea was first presented in 2004 [T.L. Grimm et al., IEEE Transactions on Applied Superconductivity 15(6) (2005) 2393]. Preliminary designs of two new half-reentrant (HR) inner cells have since been completed, one at a high cell-to-cell coupling of 2.1% (high- kcc HR) and the other at 1.5% (low- kcc HR). The parameters of a HR cavity are comparable to a fully reentrant cavity, with the added benefit that a HR cavity can be easily cleaned with current technology.

  18. BNL 56 MHz HOM damper prototype fabrication at JLAB

    SciTech Connect

    Huque, N.; McIntyre, G.; Daly, E. F.; Clemens, W.; Wu, Q.; Seberg, S.; Bellavia, S.

    2015-05-03

    A prototype Higher-Order Mode (HOM) Damper was fabricated at JLab for the Relativistic Heavy-Ion Collider’s (RHIC) 56 MHz cavity at Brookhaven National Laboratory (BNL). Primarily constructed from high RRR Niobium and Sapphire, the coaxial damper presented significant challenges in electron-beam welding (EBW), brazing and machining via acid etching. The results of the prototype operation brought about changes in the damper design, due to overheating braze alloys and possible multi-pacting. Five production HOM dampers are currently being fabricated at JLab. This paper outlines the challenges faced in the fabrication process, and the solutions put in place.

  19. BNL 56 MHz HOM Damper Prototype Fabrication at JLab

    SciTech Connect

    Huque, Naeem A.; Daly, Edward F.; Clemens, William A.; McIntyre, Gary T.; Wu, Qiong; Seberg, Scott; Bellavia, Steve

    2015-09-01

    A prototype Higher-Order Mode (HOM) Damper was fabricated at JLab for the Relativistic Heavy-Ion Collider's (RHIC) 56 MHz cavity at Brookhaven National Laboratory (BNL). Primarily constructed from high RRR Niobium and Sapphire, the coaxial damper presented significant challenges in electron-beam welding (EBW), brazing and machining via acid etching. The results of the prototype operation brought about changes in the damper design, due to overheating braze alloys and possible multi-pacting. Five production HOM dampers are currently being fabricated at JLab. This paper outlines the challenges faced in the fabrication process, and the solutions put in place.

  20. Atomic Layer Deposition for SRF Cavities

    SciTech Connect

    Proslier, Th.; Ha, Y.; Zasadzinski, J.; Ciovati, G.; Kneissel, P.; Reece, C.; Rimmer, R.; Gurevich, A.; Cooley, L.; Wu, G.; Pellin, M.; /Argonne

    2009-05-01

    We have begun using Atomic Layer Deposition (ALD) to synthesize a variety of surface coatings on coupons and cavities as part of an effort to produce rf structures with significantly better performance and yield than those obtained from bulk niobium, The ALD process offers the possibility of conformally coating complex cavity shapes with precise layered structures with tightly constrained morphology and chemical properties. Our program looks both at the metallurgy and superconducting properties of these coatings, and also their performance in working structures. Initial results include: (1) results from ALD coated cavities and coupons, (2) new evidence from point contact tunneling (PCT) showing magnetic oxides can be a significant limitation to high gradient operation, (3) a study of high pressure rinsing damage on niobium samples.

  1. Optimizing SRF Gun Cavity Profiles in a Genetic Algorithm Framework

    SciTech Connect

    Alicia Hofler, Pavel Evtushenko, Frank Marhauser

    2009-09-01

    Automation of DC photoinjector designs using a genetic algorithm (GA) based optimization is an accepted practice in accelerator physics. Allowing the gun cavity field profile shape to be varied can extend the utility of this optimization methodology to superconducting and normal conducting radio frequency (SRF/RF) gun based injectors. Finding optimal field and cavity geometry configurations can provide guidance for cavity design choices and verify existing designs. We have considered two approaches for varying the electric field profile. The first is to determine the optimal field profile shape that should be used independent of the cavity geometry, and the other is to vary the geometry of the gun cavity structure to produce an optimal field profile. The first method can provide a theoretical optimal and can illuminate where possible gains can be made in field shaping. The second method can produce more realistically achievable designs that can be compared to existing designs. In this paper, we discuss the design and implementation for these two methods for generating field profiles for SRF/RF guns in a GA based injector optimization scheme and provide preliminary results.

  2. Atomic Layer Deposition for SRF Cavities

    SciTech Connect

    Norem, J; Pellin, M J; Antoine, C Z; Ciovati, G; Kneisel, P; Reece, C E; Rimmer, R A; Cooley, L; Gurevich, A V; Ha, Y; Proslier, Th; Zasadzinski, J

    2009-05-01

    We have begun using Atomic Layer Deposition (ALD) to synthesize a variety of surface coatings on coupons and cavities as part of an effort to produce rf structures with significantly better performance and yield than those obtained from bulk niobium, The ALD process offers the possibility of conformally coating complex cavity shapes with precise layered structures with tightly constrained morphology and chemical properties. Our program looks both at the metallurgy and superconducting properties of these coatings, and also their performance in working structures. Initial results include: 1) evidence from point contact tunneling showing magnetic oxides can be a significant limitation to high gradient operation, 2) experimental results showing the production sharp niobium/oxide interfaces from a high temperature bake of ALD coated Al2O3 on niobium surfaces, 3) results from ALD coated structures.

  3. Optimization of the BCP processing of elliptical nb srf cavities

    SciTech Connect

    Boffo, C.; Cooper, C.; Rowe, A.; Galasso, G.; /Udine U.

    2006-06-01

    At present, the electropolishing (EP) process is considered the key technology unleashing the capability to produce Niobium SRF cavities performing at or above 35 MV/m. Nevertheless buffered chemical polishing (BCP) remains a cheap, simple and effective processing technique for single grain high gradient and polycrystalline lower gradient cavities. BCP will be adopted to chemically process the third harmonic 3.9 GHz cavities being fabricated at Fermilab [1]. The dimensions and the shape of these cavities yield a strong nonuniformity in the material removal between iris and equator of the cells. This paper describes the thermal-fluid finite element model adopted to simulate the process, the experimental flow visualization tests performed to verify the simulation and a novel device fabricated to solve the problem.

  4. SRF cavity and HOM damper tests at TRIUMF for ARIEL

    NASA Astrophysics Data System (ADS)

    Kolb, Philipp; Laxdal, Robert; Zvyagintsev, Vladimir

    2012-10-01

    The eLINAC for ARIELfootnotetextAdvanced Rare Isotope Experiment Laboratory consists of 5 superconducting nine cell cavities operating at 1.3 GHz, each cavity with a accelerating voltage of 10 MV. The design requires a quality factor of 1 .10^10 or higher at the operating temperature of 2 K for 10 W dissipated power in the cavity walls. Latest SRFfootnotetextSuperconducting Radio Frequency tests of a 1.3 GHz niobium single cell cavity will show that procedures at TRIUMF are capable of exceeding the RF requirements of ARIEL. Future upgrade plans for the eLINAC include a recirculating arc to either increase the energy of the 10 mA electron beam or drive an FELfootnotetextFree Electron Laser in ERLfootnotetextEnergy Recovery LINAC mode. BBUfootnotetextBeam Break-Up is a limitation in recirculating LINACs. Its strength depends on a number of parameters including the shunt impedance RSh of HOM,footnotetextHigher Order Modes especially dipole modes, of the SRF cavity. Using beam line absorbers made out of a low electric conductive material reduces the QL of the cavity and therefore reduces the RSh. Qualification of such a material is essential and measurements of the electrical conductivity of a candidate material will be presented in addition to the cavity tests.

  5. Damping of unwanted modes in SRF deflecting/crabbing cavities

    SciTech Connect

    Burt, Graeme; Wang, Haipeng

    2014-01-01

    As deflecting and crab cavities do not use the fundamental acceleration mode for their operation, the spectrum of unwanted modes is significantly different from that of accelerating cavities. The fundamental acceleration mode is now unwanted and can cause energy spread in the beam; in addition this mode frequency is often close to or lower than that of the deflecting mode, making it difficult to damp. This is made more complex in some of the compact crab cavities as there small beampipes often attenuate the fields very sharply. In addition in some crab cavities there can be an orthogonal transverse mode similar to the deflecting mode, known as the same order mode. The degeneracy of these modes must be split by polarising the cavity and if the polarisation is not large enough, dampers should be placed at either an electric or magnetic field null of the crabbing mode to effectively damp the unwanted polarisation. Various concepts for dealing with unwanted modes in various SRF deflecting cavities will be reviewed.

  6. Study of etching rate uniformity in SRF cavities

    SciTech Connect

    Janardan Upadhyay, Svetozar Popovic, Leposova Vuskovic, H. Phillips, Anne-Marie Valente

    2012-07-01

    Plasma based surface modification is a promising alternative to wet etching of superconducting radio frequency (SRF) cavities. The crucial aspect of the technology development is dependence of the etching rate and surface roughness on the frequency of the power supply, pressure, power level, driven electrode shape and chlorine concentration in the gas mixture during plasma processing. To optimize the plasma parameters, we are using a single cell cavity with 20 sample holders symmetrically distributed over the cell. These holders are used as diagnostic ports for the measurement of the plasma parameters and as holders for the samples to be etched. The plasma properties are highly correlated with the shape of the driven electrode and chlorine concentration in the Argon/Chlorine gas mixtures.

  7. Development of high purity niobium used in SRF accelerating cavity

    NASA Astrophysics Data System (ADS)

    Chen, Lin; Xie, Wei-Ping; Li, Ming-Yang; He, Ji-Lin; Fan, Hui-Ru; Zhang, Bao-Cheng; He, Fei-Si; Zhao, Kui; Chen, Jia-Er; Liu, Ke-Xin

    2008-12-01

    Niobium is widely used in SRF (Superconducting Radio Frequency) cavities due to its excellent superconductivity and workability. With the continuous development of technology, higher demands of material are raised. One of the key issues is that RRR (Residual Resistance Ratio) of the Nb material should be more than 300, which requires that the Nb ingot have even higher RRR. This article introduces the development and the experimental results of high purity niobium in OTIC in Ningxia (Ningxia Orient Tantalum Industry Co. Ltd.), and the test results of the single cell TESLA (Tera Electron volt energy Superconducting Linear Accelerator) shaped cavity manufactured by Peking University using Nb material from OTIC. Supported by National Basic Research Program of China (2002CB713600)

  8. Eddy current scanning of niobium for SRF cavities at Fermilab

    SciTech Connect

    Boffo, C.; Bauer, P.; Foley, M.; Antoine, C.; Cooper, C.; Brinkmann, A.; /DESY

    2006-08-01

    In the framework of SRF cavity development, Fermilab is creating the infrastructure needed for the characterization of the material used in the cavity fabrication. An important step in the characterization of ''as received'' niobium sheets is eddy current scanning. Eddy current scanning is a non-destructive technique first adopted and further developed by DESY with the purpose of checking the cavity material for subsurface defects and inclusions. Fermilab has received and further upgraded a commercial eddy current scanner previously used for the SNS project. This scanner is now used daily to scan the niobium sheets for the Fermilab third harmonic, the ILC, and the Proton Driver cavities. After optical inspection, more than 400 squares and disks have been scanned and when necessary checked at the optical and electron microscopes, anodized, or measured with profilometers looking for surface imperfections that might limit the performance of the cavities. This paper gives a status report on the scanning results obtained so far, including a discussion of the classification of signals being detected.

  9. Characterization of ingot material for SRF cavity production

    SciTech Connect

    Mondal, Jayanta; Ciovati, Gianluigi; Kneisel, Peter K.; Myneni, Ganapati Rao; Mittal, K. C.

    2009-11-01

    In recent years, large-grain/single-crystal niobium has become a viable alternative to the standard fine grain (ASTM grain size>6), high purity (RRR ) niobium for the fabrication of high-performance SRF cavities for particle accelerators. In this contribution we present the results of a systematic study of the superconducting properties of samples obtained from four Niobium ingots (from CBMM, Brazil) of different purity. Measurements of bulk magnetization, surface pinning, critical temperature and thermal conductivity have been carried out on the samples subjected to different surface treatments such as buffered chemical polishing (BCP), 6000C heat treatment, and low temperature baking (LTB). A correlation has been established between the LTB and the ratio . In addition, the phonon peak in the thermal conductivity data is suppressed by the presence of trapped magnetic vortices in the samples.

  10. Field Emission Studies From Nb Surfaces Relevant to SRF Cavities

    SciTech Connect

    Tong Wang; Charles Reece; Ronald Sundelin

    2003-05-01

    Enhanced field emission (EFE) presents the main impediment to higher acceleration gradients in superconducting rf (SRF) niobium (Nb) cavities for particle accelerators. A scanning field emission microscope was built at Jefferson Lab with the main objective of systematically investigating the sources of EFE from Nb surfaces. Various surface preparation techniques and procedures, including chemical etching, electropolishing, ultrasonic water rinse, high pressure water rinse, air-dry after methanol rinse, air-dry after water rinse in Class 10 cleanroom, were investigated. The capability and process variables for broad-area Nb surfaces to consistently reach field emission free or near field emission free performance at {approx}140 MV/m have been experimentally demonstrated using the above techniques/procedures.

  11. Performance of 3.9 GHz SRF Cavities at Fermilab's ILCTA_MDB Horizontal Test Stand

    SciTech Connect

    Harms, E.; Hocker, A.; /Fermilab

    2009-01-01

    Fermilab is building a cryomodule containing four 3.9 GHz superconducting radio frequency (SRF) cavities for the Free electron LASer in Hamburg (FLASH) facility at the Deutsches Elektronen-SYnchrotron (DESY) laboratory. Before assembling the cavities into the cryomodule, each individual cavity is tested at Fermilab's Horizontal Test Stand (HTS). The HTS provides the capability to test fully-dressed SRF cavities at 1.8 K with high-power pulsed RF in order to verify that the cavities achieve performance requirements under these conditions. The performance at the HTS of the 3.9 GHz cavities built for FLASH is presented here.

  12. Performance of 3.9 GHz SRF cavities at Fermilab's ILCTA_MDB nhorizontal test stand

    SciTech Connect

    Harms, Elvin; Hocker, Andy; /Fermilab

    2008-08-01

    Fermilab is building a cryomodule containing four 3.9 GHz superconducting radio frequency (SRF) cavities for the Free electron LASer in Hamburg (FLASH) facility at the Deutsches Elektronen-SYnchrotron (DESY) laboratory. Before assembling the cavities into the cryomodule, each individual cavity is tested at Fermilab's Horizontal Test Stand (HTS). The HTS provides the capability to test fully-dressed SRF cavities at 1.8 K with high-power pulsed RF in order to verify that the cavities achieve performance requirements under these conditions. The performance at the HTS of the 3.9 GHz cavities built for FLASH is presented here.

  13. Guidelines for the Design, Fabrication, Testing, Installation and Operation of Srf Cavities

    NASA Astrophysics Data System (ADS)

    Theilacker, J.; Carter, H.; Foley, M.; Hurh, P.; Klebaner, A.; Krempetz, K.; Nicol, T.; Olis, D.; Page, T.; Peterson, T.; Pfund, P.; Pushka, D.; Schmitt, R.; Wands, R.

    2010-04-01

    Superconducting Radio-Frequency (SRF) cavities containing cryogens under pressure pose a potential rupture hazard to equipment and personnel. Generally, pressure vessels fall within the scope of the ASME Boiler and Pressure Vessel Code however, the use of niobium as a material for the SRF cavities is beyond the applicability of the Code. Fermilab developed a guideline to ensure sound engineering practices governing the design, fabrication, testing, installation and operation of SRF cavities. The objective of the guideline is to reduce hazards and to achieve an equivalent level of safety afforded by the ASME Code. The guideline addresses concerns specific to SRF cavities in the areas of materials, design and analysis, welding and brazing, pressure relieving requirements, pressure testing and quality control.

  14. GUIDELINES FOR THE DESIGN, FABRICATION, TESTING, INSTALLATION AND OPERATION OF SRF CAVITIES

    SciTech Connect

    Theilacker, J.; Carter, H.; Foley, M.; Hurh, P.; Klebaner, A.; Krempetz, K.; Nicol, T.; Olis, D.; Page, T.; Peterson, T.; Pfund, P.; Pushka, D.; Schmitt, R.; Wands, R.

    2010-04-09

    Superconducting Radio-Frequency (SRF) cavities containing cryogens under pressure pose a potential rupture hazard to equipment and personnel. Generally, pressure vessels fall within the scope of the ASME Boiler and Pressure Vessel Code however, the use of niobium as a material for the SRF cavities is beyond the applicability of the Code. Fermilab developed a guideline to ensure sound engineering practices governing the design, fabrication, testing, installation and operation of SRF cavities. The objective of the guideline is to reduce hazards and to achieve an equivalent level of safety afforded by the ASME Code. The guideline addresses concerns specific to SRF cavities in the areas of materials, design and analysis, welding and brazing, pressure relieving requirements, pressure testing and quality control.

  15. Plasma Processing of SRF Cavities for the next Generation Of Particle Accelerators

    SciTech Connect

    Vuskovic, Leposava

    2015-11-23

    The cost-effective production of high frequency accelerating fields are the foundation for the next generation of particle accelerators. The Ar/Cl2 plasma etching technology holds the promise to yield a major reduction in cavity preparation costs. Plasma-based dry niobium surface treatment provides an excellent opportunity to remove bulk niobium, eliminate surface imperfections, increase cavity quality factor, and bring accelerating fields to higher levels. At the same time, the developed technology will be more environmentally friendly than the hydrogen fluoride-based wet etching technology. Plasma etching of inner surfaces of standard multi-cell SRF cavities is the main goal of this research in order to eliminate contaminants, including niobium oxides, in the penetration depth region. Successful plasma processing of multi-cell cavities will establish this method as a viable technique in the quest for more efficient components of next generation particle accelerators. In this project the single-cell pill box cavity plasma etching system is developed and etching conditions are determined. An actual single cell SRF cavity (1497 MHz) is plasma etched based on the pill box cavity results. The first RF test of this plasma etched cavity at cryogenic temperature is obtained. The system can also be used for other surface modifications, including tailoring niobium surface properties, surface passivation or nitriding for better performance of SRF cavities. The results of this plasma processing technology may be applied to most of the current SRF cavity fabrication projects. In the course of this project it has been demonstrated that a capacitively coupled radio-frequency discharge can be successfully used for etching curved niobium surfaces, in particular the inner walls of SRF cavities. The results could also be applicable to the inner or concave surfaces of any 3D structure other than an SRF cavity.

  16. Cryogenic controls for Fermilab's SRF cavities and test facility

    SciTech Connect

    Norris, B.; Bossert, R.; Klebaner, A.; Lackey, S.; Martinez, A.; Pei, L.; Soyars, W.; Sirotenko, V.; /Fermilab

    2007-07-01

    A new superconducting radio frequency (SRF) cavities test facility is now operational at Fermilab's Meson Detector Building (MDB). The facility is supplied cryogens from the Cryogenic Test Facility (CTF) located in a separate building 500-m away. The design incorporates ambient temperature pumping for super-fluid helium production, as well as three 0.6-kW at 4.5-K refrigerators, five screw compressors, a helium purifier, helium and nitrogen inventory, cryogenic distribution system, and a variety of test cryostats. To control and monitor the vastly distributed cryogenic system, a flexible scheme has been developed. Both commercial and experimental physics tools are used. APACS+{trademark}, a process automation control system from Siemens-Moore, is at the heart of the design. APACS+{trademark} allows engineers to configure an ever evolving test facility while maintaining control over the plant and distribution system. APACS+{trademark} nodes at CTF and MDB are coupled by a fiber optic network. DirectLogic205 PLC's by KOYO{reg_sign} are used as the field level interface to most I/O. The top layer of this system uses EPICS (Experimental Physics and Industrial Control System) as a SCADA/HMI. Utilities for graphical display, control loop setting, real time/historical plotting and alarming have been implemented by using the world-wide library of applications for EPICS. OPC client/server technology is used to bridge across each different platform. This paper presents this design and its successful implementation.

  17. Cryogenic Controls for Fermilab's Srf Cavities and Test Facility

    NASA Astrophysics Data System (ADS)

    Norris, B.; Bossert, R.; Klebaner, A.; Lackey, S.; Martinez, A.; Pei, L.; Soyars, W.; Sirotenko, V.

    2008-03-01

    A new superconducting radio frequency (SRF) cavities test facility is now operational at Fermilab's Meson Detector Building (MDB). The Cryogenic Test Facility (CTF), located in a separate building 500 m away, supplies the facility with cryogens. The design incorporates ambient temperature pumping for superfluid helium production, as well as three 0.6 kW at 4.5 K refrigerators, five screw compressors, a helium purifier, helium and nitrogen inventory, cryogenic distribution system, and a variety of test cryostats. To control and monitor the vastly distributed cryogenic system, a flexible scheme has been developed. Both commercial and experimental physics tools are used. APACS+™, a process automation control system from Siemens-Moore, is at the heart of the design. APACS+™ allows engineers to configure an ever evolving test facility while maintaining control over the plant and distribution system. APACS+™ nodes at CTF and MDB are coupled by a fiber optic network. DirectLogic205 PLCs by KOYO® are used as the field level interface to most I/O. The top layer of this system uses EPICS (Experimental Physics and Industrial Control System) as a SCADA/HMI. Utilities for graphical display, control loop setting, real time/historical plotting and alarming have been implemented by using the world-wide library of applications for EPICS. OPC client/server technology is used to bridge across each different platform. This paper presents this design and its successful implementation.

  18. Multipacting Simulation Study for 56 MHz Quarter Wave Resonator using 2D Code

    SciTech Connect

    Naik,D.; Ben-Zvi, I.

    2009-01-02

    A beam excited 56 MHz Radio Frequency (RF) Niobium Quarter Wave Resonator (QWR) has been proposed to enhance RHIC beam luminosity and bunching. Being a RF cavity, multipacting is expected; therefore an extensive study was carried out with the Multipac 2.1 2D simulation code. The study revealed that multipacting occurs in various bands up to peak surface electric field 50 kV/m and is concentrated mostly above the beam gap and on the outer conductor. To suppress multipacting, a ripple structure was introduced to the outer conductor and the phenomenon was successfully eliminated from the cavity.

  19. Processing and Testing of the SRF Photoinjector Cavity for BERLinPro

    SciTech Connect

    Burrill, Andrew; Anders, W; Frahm, A; Knobloch, Jens; Neumann, Axel; Ciovati, Gianluigi; Clemens, William; Kneisel, Peter; Turlington, Larry; Zaplatin, Evgeny

    2014-07-01

    The BERLinPro project is a compact, c.w. SRF energy recovery linac (ERL) that is being built to develop the accelerator physics and technology required to operate the next generation of high current ERLs. The machine is designed to produce a 50 MeV 100 mA beam, with better than 1 mm-mrad emittance. The electron source for the ERL will be a SRF photoinjector equipped with a multi-alkali photocathode. In order to produce a SRF photoinjector to operate reliably at this beam current HZB has undertaken a 3 stage photoinjector development program to study the operation of SRF photoinjectors in detail. The 1.4 cell cavity being reported on here is the second stage of this development, and represents the first cavity designed by HZB for use with a high quantum efficiency multi-alkali photocathode. This paper will describe the work done to prepare the cavity for RF testing in the vertical testing dewar at Jefferson Laboratory as well as the results of these RF tests.

  20. EVALUATION OF SILICON DIODES AS IN-SITU CRYOGENIC FIELD EMISSION DETECTORS FOR SRF CAVITY DEVELOPMENT

    SciTech Connect

    Ari Palczewski, Rongli Geng

    2012-07-01

    We performed in-situ cryogenic testing of four silicon diodes as possible candidates for field emission (FE) monitors of superconducting radio frequency (SRF) cavities during qualification testing and in accelerator cryo-modules. We evaluated diodes from 2 companies - from Hamamatsu corporation model S1223-01; and from OSI Optoelectronics models OSD35-LR-A, XUV-50C, and FIL-UV20. The measurements were done by placing the diodes in superfluid liquid helium near the top of a field emitting 9-cell cavity during its vertical test. For each diode, we will discuss their viability as a 2K cryogenic detector for FE mapping of SRF cavities and the directionality of S1223-01 in such environments. We will also present calibration curves between the diodes and JLab's standard radiation detector placed above the Dewar's top plate.

  1. Materials Analysis of CED Nb Films Being Coated on Bulk Nb Single Cell SRF Cavities

    SciTech Connect

    Zhao, Xin; Reece, Charles; Palczewski, Ari; Ciovati, Gianluigi; Krishnan, Mahadevan; James, Colt; Irfan, Irfan

    2013-09-01

    This study is an on-going research on depositing a Nb film on the internal wall of bulk Nb single cell SRF cavities, via a cathodic arc Nb plasma ions source, an coaxial energetic condensation (CED) facility at AASC company. The motivation is to firstly create a homoepitaxy-like Nb/Nb film in a scale of a ~1.5GHz RF single cell cavity. Next, through SRF measurement and materials analysis, it might reveal the baseline properties of the CED-type homoepitaxy Nb films. Literally, a top-surface layer of Nb films which sustains SRF function, always grows up in homo-epitaxy mode, on top of a Nb nucleation layer. Homo-epitaxy growth of Nb must be the final stage (a crystal thickening process) of any coatings of Nb film on alternative cavity structure materials. Such knowledge of Nb-Nb homo-epitaxy is useful to create future realistic SRF cavity film coatings, such as hetero-epitaxy Nb/Cu Films, or template-layer-mitigated Nb films. One large-grain, and three fine grain bulk Nb cavities were coated. They went through cryogenic RF measurement. Preliminary results show that the Q0 of a Nb film could be as same as the pre-coated bulk Nb surface (which received a chemically-buffered polishing plus a light electro-polishing); but quality factor of two tested cavities dropped quickly. We are investigating if the severe Q-slope is caused by hydrogen incorporation before deposition, or is determined by some structural defects during Nb film growth.

  2. R&D ERL: 5 Cell 704 MHz SRF Cavity

    SciTech Connect

    Burrill, A.

    2010-01-01

    One of the key components for the superconducting RF Energy Recovery Linac, (ERL) under development in the Collider Accelerator Department at Brookhaven National Laboratory, is the Linac cavity and cryomodule. The cavity is a 5 cell accelerating cavity designed to operate at 703.75 MHz, and to accelerate 2 MeV electrons from the photoinjector up to 15-20 MeV, allow them to make a single pass around the ERL loop and then decelerate them back down to 2 MeV prior to sending them to the beam dump. This cavity was designed by Rama Calaga and Ilan Ben-Zvi at BNL and fabricated by Advanced Energy Systems in Medford, NY. The cavity was then delivered to Thomas Jefferson Laboratory in VA for chemical processing, testing and assembly of the hermetic string assembly suitable for shipment back to BNL. Once at BNL it was built into a complete cryomodule, installed in the ERL test facility and commissioned. This paper will review the key components of the cavity and cryomodule and discuss the present status of the cryomodule commissioning. The BNL 5 cell accelerating cavity has been designed for use in our high average current Energy Recovery Linac, a proof of principle machine to demonstrate key components necessary for the future upgrades to RHIC as well as applications for future ampere class high current, high brightness ERL programs. The cavity has been tested at greater than 20 MV/m with a Q{sub 0} of 1e{sup 10}, meeting the design specifications for use at full energy in the ERL. This paper will review the cavity design and specifications as well as the RF measurements that have been made both in the VTA at Jefferson Lab as well as during the commissioning in the ERL test cave at BNL. Finally the future plan for cavity testing and measurements prior to its use in ERL operations will be reviewed. The general physics parameters for the cavity can be found in table 1, and the reader is referred to Rama Calaga's Thesis for a much more detailed review of the cavity geometry

  3. RF and data acquisition systems for Fermilab's ILC SRF cavity vertical test stand

    SciTech Connect

    Ozelis, Joseph P.; Nehring, Roger; Grenoble, Christiana; Powers, Thomas J.; /Jefferson Lab

    2007-06-01

    Fermilab is developing a facility for vertical testing of SRF cavities as part of its ILC program. The RF system for this facility is based on the proven production cavity test systems used at Jefferson Lab for CEBAF and SNS cavity testing. The design approach is modular in nature, using commercial-off-the-shelf (COTS) components. This yields a system that can be easily debugged and modified, and with ready availability of spares. Comprehensive data acquisition and control is provided by a PXI-based hardware platform in conjunction with software developed in the LabView programming environment.

  4. Exploration of Quench Initiation Due to Intentional Geometrical Defects in a High Magnetic Field Region of an SRF Cavity

    SciTech Connect

    J. Dai, K. Zhao, G.V. Eremeev, R.L. Geng, A.D. Palczewski; Dai, J.; Palczewski, A. D.; Eremeev, G. V.; Geng, R. L.; Zhao, K.

    2011-07-01

    A computer program which was used to simulate and analyze the thermal behaviors of SRF cavities has been developed at Jefferson Lab using C++ code. This code was also used to verify the quench initiation due to geometrical defects in high magnetic field region of SRF cavities. We built a CEBAF single cell cavity with 4 artificial defects near equator, and this cavity has been tested with T-mapping. The preheating behavior and quench initiation analysis of this cavity will be presented here using the computer program.

  5. Apparatus and process for passivating an SRF cavity

    DOEpatents

    Myneni, Ganapati Rao; Wallace, John P

    2014-12-02

    An apparatus and process for the production of a niobium cavity exhibiting high quality factors at high gradients is provided. The apparatus comprises a first chamber positioned within a second chamber, an RF generator and vacuum pumping systems. The process comprises placing the niobium cavity in a first chamber of the apparatus; thermally treating the cavity by high temperature in the first chamber while maintaining high vacuum in the first and second chambers; and applying a passivating thin film layer to a surface of the cavity in the presence of a gaseous mixture and an RF field. Further a niobium cavity exhibiting high quality factors at high gradients produced by the method of the invention is provided.

  6. Progress of ILC High Gradient SRF Cavity R&D at Jefferson Lab

    SciTech Connect

    R.L. Geng, J. Dai, G.V. Eremeev, A.D. Palczewski

    2011-09-01

    Latest progress of ILC high gradient SRF cavity R&D at Jefferson Lab will be presented. 9 out of 10 real 9-cell cavities reached an accelerating gradient of more than 38 MV/m at a unloaded quality factor of more than 8 {center_dot} 109. New understandings of quench limitation in 9-cell cavities are obtained through instrumented studies of cavities at cryogenic temperatures. Our data have shown that present limit reached in 9-cell cavities is predominantly due to localized defects, suggesting that the fundamental material limit of niobium is not yet reached in 9-cell cavities and further gradient improvement is still possible. Some examples of quench-causing defects will be given. Possible solutions to pushing toward the fundamental limit will be described.

  7. Plasma Discharge Effect on Secondary Electron Yield of Various Surface Locations on SRF Cavities

    NASA Astrophysics Data System (ADS)

    Basovic, Milos; Samolov, Ana; Cuckov, Filip; Tomovic, Mileta; Popovic, Svetozar; Vuskovic, Leposava

    2015-09-01

    Electron activity (field emission and multipacting) has been identified as the main limiting factor of Superconducting Radiofrequency (SRF) cavity performance. Secondary Electron Yield (SEY) is highly dependent on the state of the cavity's surface, which is investigated before and after plasma exposure. Current methods for simulating the electron activity in SRF cavity consider it as a uniform surface. Due to fabricating procedure there are three distinct areas of the cavity's microstructure: weld zone, heat affected zone, and base metal zone. Each zone has a characteristic microstructure even after the treatments that are currently used to clean the surface of the cavities. Improvement of existing surface treatment techniques, or use of a new is required in order to increase the limit of Q factor towards the theoretical limit of Nb. RF discharge is a promising technique for this purpose. In order to test the effect of the plasma on the SEY of the various cavity surface zones we have developed the experimental setup to measure the energy distribution of the SEY from coupon-like samples. Samples are made in a way that all three zones of cavity surface will be included in the examination. We will present the SEY changes in these three zones before and after plasma treatment.

  8. Evidence of Magnetic Breakdown on the Defects With Thermally Suppressed Critical Field in High Gradient SRF Cavities

    SciTech Connect

    Eremeev, Grigory; Palczewski, Ari

    2013-09-01

    At SRF 2011 we presented the study of quenches in high gradient SRF cavities with dual mode excitation technique. The data differed from measurements done in 80's that indicated thermal breakdown nature of quenches in SRF cavities. In this contribution we present analysis of the data that indicates that our recent data for high gradient quenches is consistent with the magnetic breakdown on the defects with thermally suppressed critical field. From the parametric fits derived within the model we estimate the critical breakdown fields.

  9. Plasma Treatment of Single-Cell Niobium SRF Cavities

    SciTech Connect

    J. Upadhyay, M. Nikolić, S. Popović, L. Vušković, H.L. Phillips, A-M. Valente-Feliciano

    2011-03-01

    Superconducting radio frequency cavities of bulk Niobium are integral components of particle accelerators based on superconducting technology. Wet chemical processing is the commonly used procedure for impurities and surface defects removal and surface roughness improvement , both required to improve the RF performance of the cavity. We are studying plasma etching as an alternate technique to process these cavities. The uniformity of the plasma sheath at the inner wall of the cavity is one prerequisite for its uniform etching. We are developing electro-optic diagnostic techniques to assess the plasma uniformity. Multiple electro-optical probes are placed at different locations of the single cell cavity to diagnose the electrical and optical properties of the plasma. The electrical parameters are required to understand the kinetic nature of the plasma and the optical emission spectroscopy provides the spatial distribution of radicals in the plasma. The spatial variation of the plasma parameters inside the cavity and their effect on the etching of niobium samples placed at different locations in the cavity will be presented.

  10. A top loading 2 Kelvin test cryostat for SRF cavities.

    SciTech Connect

    Kedzie, M.; Kelly, M. P.; Gerbick, S. M.; Fuerst, J. D.; Shepard, K. W.; Physics

    2009-01-01

    A new large 2 Kelvin test cryostat is being commissioned at Argonne National Laboratory. This system will have a full time connection to the 4.5 Kelvin ATLAS refrigerator and, with integrated J-T heat exchanger, will allow continuous 2 Kelvin operation. The large diameter was chosen to accommodate essentially all of today's superconducting cavities and the top loading design facilitates clean room assembly. The commissioning run will be with a coaxial half wave cavity to be followed by testing with 1.3 GHz single-cell elliptical cavities. Details of the initial engineering cool down on the cryostat are presented.

  11. SRF cavities for CW option of Project X Linac

    SciTech Connect

    Solyak, N.; Gonin, I.; Khabiboulline, T.; Lunin, A.; Perunov, N.; Yakovlev, V.; /Fermilab

    2009-09-01

    Alternative option of Project X is based on the CW SC 2GeV Linac with the average current 1mA. Possible option of the CW Linac considered in the paper includes low energy part consisted of a few families SC Spoke cavities (from 2.5 MeV to 466 MeV) and high energy part consisted of 2 types of elliptical cavities (v/c=0.81 and v/c=1). Requirements and designed parameters of cavities are considered.

  12. Transverse Field Perturbation For PIP-II SRF Cavities

    SciTech Connect

    Berrutti, Paolo; Khabiboulline, Timergali N.; Lebedev, Valeri; Yakovlev, Vyacheslav P.

    2015-06-01

    Proton Improvement Plan II (PIP-II) consists in a plan for upgrading the Fermilab proton accelerator complex to a beam power capability of at least 1 MW delivered to the neutrino production target. A room temperature section accelerates H⁻ ions to 2.1 MeV and creates the desired bunch structure for injection into the superconducting (SC) linac. Five cavity types, operating at three different frequencies 162.5, 325 and 650 MHz, provide acceleration to 800 MeV. This paper presents the studies on transverse field perturbation on particle dynamic for all the superconducting cavities in the linac. The effects studied include quadrupole defocusing for coaxial resonators, and dipole kick due to couplers for elliptical cavities. A multipole expansion has been performed for each of the cavity designs including effects up to octupole.

  13. Ultra-Gradient Test Cavity for Testing SRF Wafer Samples

    SciTech Connect

    N.J. Pogue, P.M. McIntyre, A.I. Sattarov, C. Reece

    2010-11-01

    A 1.3 GHz test cavity has been designed to test wafer samples of superconducting materials. This mushroom shaped cavity, operating in TE01 mode, creates a unique distribution of surface fields. The surface magnetic field on the sample wafer is 3.75 times greater than elsewhere on the Niobium cavity surface. This field design is made possible through dielectrically loading the cavity by locating a hemisphere of ultra-pure sapphire just above the sample wafer. The sapphire pulls the fields away from the walls so the maximum field the Nb surface sees is 25% of the surface field on the sample. In this manner, it should be possible to drive the sample wafer well beyond the BCS limit for Niobium while still maintaining a respectable Q. The sapphire's purity must be tested for its loss tangent and dielectric constant to finalize the design of the mushroom test cavity. A sapphire loaded CEBAF cavity has been constructed and tested. The results on the dielectric constant and loss tangent will be presented

  14. Quench dynamics in SRF cavities: can we locate the quench origin with 2nd sound?

    SciTech Connect

    Maximenko, Yulia; Segatskov, Dmitri A.; /Fermilab

    2011-03-01

    A newly developed method of locating quenches in SRF cavities by detecting second-sound waves has been gaining popularity in SRF laboratories. The technique is based on measurements of time delays between the quench as determined by the RF system and arrival of the second-sound wave to the multiple detectors placed around the cavity in superfluid helium. Unlike multi-channel temperature mapping, this approach requires only a few sensors and simple readout electronics; it can be used with SRF cavities of almost arbitrary shape. One of its drawbacks is that being an indirect method it requires one to solve an inverse problem to find the location of a quench. We tried to solve this inverse problem by using a parametric forward model. By analyzing the data we found that the approximation where the second-sound emitter is a near-singular source does not describe the physical system well enough. A time-dependent analysis of the quench process can help us to put forward a more adequate model. We present here our current algorithm to solve the inverse problem and discuss the experimental results.

  15. Effect of cathode shape on vertical buffered electropolishing for niobium SRF cavities

    NASA Astrophysics Data System (ADS)

    Jin, S.; Wu, A. T.; Lu, X. Y.; Rimmer, R. A.; Lin, L.; Zhao, K.; Mammosser, J.; Gao, J.

    2013-09-01

    This paper reports the research results of the effect of cathode shape during vertical buffered electropolishing (BEP) by employing a demountable single cell niobium (Nb) superconducting radio frequency (SRF) cavity. Several different cathode shapes such as, for instance, bar, ball, ellipsoid, and wheels of different diameters have been tested. Detailed electropolishing parameters including I-V characteristic, removal rate, surface roughness, and polishing uniformity at different locations inside the demountable cavity are measured. Similar studies are also done on conventional electropolishing (EP) for comparison. It is revealed that cathode shape has dominant effects for BEP especially on the obtaining of a suitable polishing condition and a uniform polishing rate in an Nb SRF single cell cavity. EP appears to have the same tendency. This paper demonstrates that a more homogeneous polishing result can be obtained by optimizing the electric field distribution inside the cavity through the modification of the cathode shape given the conditions that temperature and electrolyte flow are kept constant. Electric field distribution and electrolyte flow patterns inside the cavity are simulated via Poisson-Superfish and Solidworks respectively. With the optimal cathode shape, BEP shows a much faster polishing rate of ∼2.5 μm/min and is able to produce a smoother surface finish in the treatments of single cell cavities in comparison with EP.

  16. Effect of cathode shape on vertical buffered electropolishing for niobium SRF cavities

    SciTech Connect

    Jin, Song; Wu, Andy T.; Lu, Xiangyang; Rimmer, Robert A.; Lin, Lin; Zhao, K.; Mammosser, John D.; Gao, Jie

    2013-09-01

    This paper reports the research results of the effect of cathode shape during vertical buffered electropolishing (BEP) by employing a demountable single cell niobium (Nb) superconducting radio frequency (SRF) cavity. Several different cathode shapes such as, for instance, bar, ball, ellipsoid, and wheels of different diameters have been tested. Detailed electropolishing parameters including I–V characteristic, removal rate, surface roughness, and polishing uniformity at different locations inside the demountable cavity are measured. Similar studies are also done on conventional electropolishing (EP) for comparison. It is revealed that cathode shape has dominant effects for BEP especially on the obtaining of a suitable polishing condition and a uniform polishing rate in an Nb SRF single cell cavity. EP appears to have the same tendency. This paper demonstrates that a more homogeneous polishing result can be obtained by optimizing the electric field distribution inside the cavity through the modification of the cathode shape given the conditions that temperature and electrolyte flow are kept constant. Electric field distribution and electrolyte flow patterns inside the cavity are simulated via Poisson–Superfish and Solidworks respectively. With the optimal cathode shape, BEP shows a much faster polishing rate of ∼2.5 μm/min and is able to produce a smoother surface finish in the treatments of single cell cavities in comparison with EP.

  17. Optimization of the Low Loss SRF Cavity for the ILC

    SciTech Connect

    Sekutowicz, J.S.; Kneisel, P.; Higo, T.; Morozumi, Y.; Saito, K.; Ge, L.; Ko, Yong-kyu; Lee, L.; Li, Z.; Ng, C.K.; Schussman, G.L.; Xiao, L.; /SLAC

    2008-01-18

    The Low-Loss shape cavity design has been proposed as a possible alternative to the baseline TESLA cavity design for the ILC main linacs. The advantages of this design over the TESLA cavity are its lower cryogenic loss, and higher achievable gradient due to lower surface fields. High gradient prototypes for such designs have been tested at KEK (ICHIRO) and TJNAF (LL). However, issues related to HOM damping and multipacting still need to be addressed. Preliminary numerical studies of the prototype cavities have shown unacceptable damping factors for some higher-order dipole modes if the typical TESLA HOM couplers are directly adapted to the design. The resulting wakefield will dilute the beam emittance thus reducing the machine luminosity. Furthermore, high gradient tests on a 9-cell prototype at KEK have experienced multipacting barriers although a single LL cell had achieved a high gradient. From simulations, multipacting activities are found to occur in the end-groups of the cavity. In this paper, we will present the optimization results of the end-groups for the Low-Loss designs for effective HOM damping and alleviation of multipacting.

  18. New HOM coupler design for high current SRF cavity

    SciTech Connect

    Xu, W.; Ben-Zvi, I.; Belomestnykh, S.; Hahn, H.; Johnson, E.

    2011-03-28

    Damping higher order modes (HOMs) significantly to avoid beam instability is a challenge for the high current Energy Recovery Linac-based eRHIC at BNL. To avoid the overheating effect and high tuning sensitivity, current, a new band-stop HOM coupler is being designed at BNL. The new HOM coupler has a bandwidth of tens of MHz to reject the fundamental mode, which will avoid overheating due to fundamental frequency shifting because of cooling down. In addition, the S21 parameter of the band-pass filter is nearly flat from first higher order mode to 5 times the fundamental frequency. The simulation results showed that the new couplers effectively damp HOMs for the eRHIC cavity with enlarged beam tube diameter and 2 120{sup o} HOM couplers at each side of cavity. This paper presents the design of HOM coupler, HOM damping capacity for eRHIC cavity and prototype test results.

  19. Tensile tests of niobium material for SRF cavities

    SciTech Connect

    Wu, G.; Dhanaraj, N.; Cooley, L.; Hicks, D.; Hahn, E.; Burk, D.; Muranyi, W.; Foley, N.; Edwards, H.; Harms, E.; Champion, M.; /Fermilab /Michigan State U.

    2009-06-01

    Mechanical tests of cavity-grade niobium samples were conducted to provide engineering information for the certification of 3rd-harmonic superconducting radio-frequency cavities and cryomodules. Large changes of mechanical properties occur throughout the cavity fabrication process due to the cold work introduced by forming, the heating introduced by electron beam welding, and the recovery of cold work during the anneal used to degas hydrogen after chemical processing. Data is provided here to show the different properties at various stages of fabrication, including both weld regions and samples from the bulk niobium far away from the weld. Measurements of RRR were used to assure that any contamination during annealing was negligible.

  20. Tensile Tests of Niobium Material for Srf Cavities

    NASA Astrophysics Data System (ADS)

    Wu, G.; Dhanaraj, N.; Cooley, L.; Hicks, D.; Hahn, E.; Burk, D.; Muranyi, W.; Foley, M.; Edwards, H.; Harms, E.; Champion, M.; Baars, D.; Compton, C.

    2010-04-01

    Mechanical tests of cavity-grade niobium samples were conducted to provide engineering information for the certification of 3rd-harmonic superconducting radio-frequency cavities and cryomodules. Large changes of mechanical properties occur throughout the cavity fabrication process due to the cold work introduced by forming, the heating introduced by electron beam welding, and the recovery of cold work during the anneal used to degas hydrogen after chemical processing. Data is provided here to show the different properties at various stages of fabrication, including both weld regions and samples from the bulk niobium far away from the weld. Measurements of RRR were used to assure that any contamination during annealing was negligible.

  1. Testing of the new tuner design for the CEBAF 12 GeV upgrade SRF cavities

    SciTech Connect

    Edward Daly; G. Davis; William Hicks

    2005-05-01

    The new tuner design for the 12 GeV Upgrade SRF cavities consists of a coarse mechanical tuner and a fine piezoelectric tuner. The mechanism provides a 30:1 mechanical advantage, is pre-loaded at room temperature and tunes the cavities in tension only. All of the components are located in the insulating vacuum space and attached to the helium vessel, including the motor, harmonic drive and piezoelectric actuators. The requirements and detailed design are presented. Measurements of range and resolution of the coarse tuner are presented and discussed.

  2. RF and Data Acquisition Systems for Fermilab's ILC SRF Cavity Vertical Test Stand

    SciTech Connect

    Joseph P. Ozelis; Roger Nehring; Christiana Grenoble; Thomas J. Powers

    2007-06-01

    Fermilab is developing a facility for vertical testing of SRF cavities as part of a program to improve cavity performance reproducibility for the ILC. The RF system for this facility, using the classic combination of oscillator, phase detector/mixer, and loop amplifier to detect the resonant cavity frequency and lock onto the cavity, is based on the proven production cavity test systems used at Jefferson Lab for CEBAF and SNS cavity testing. The design approach is modular in nature, using commercial-off-the-shelf (COTS) components. This yields a system that can be easily debugged and modified, and with ready availability of spares. Data acquisition and control is provided by a PXI-based hardware platform in conjunction with software developed in the LabView programming environment. This software provides for amplitude and phase adjustment of incident RF power, and measures all relevant cavity power levels, cavity thermal environment parameters, as well as field emission-produced radiation. It also calculates the various cavity performance parameters and their associated errors. Performance during system commissioning and initial cavity tests will be presented.

  3. Plasma Treatment of Bulk Niobium Surface for SRF Cavities

    SciTech Connect

    Marija Raskovic; H. Phillips; Anne-Marie Valente

    2006-08-16

    Pulsed electric discharges were used to demonstrate the validity of plasma surface treatment of superconducting radio-frequency cavities. The experiments were performed on disc-shaped Nb samples and compared with identical samples treated with buffer chemical polishing techniques. The results of several standard surface analytical techniques indicate that plasma-treated samples have comparable or superior properties regarding the surface roughness and composition.

  4. Exploiting new electrochemical understanding of niobium electropolishing for improved performance of SRF cavities for CEBAF

    SciTech Connect

    Reece, Charles E.; Tian, Hui

    2010-09-01

    Recent incorporation of analytic electrochemistry into the development of protocols for electropolishing niobium SRF cavities has yielded new insights for optimizing this process for consistent, high-performance results. Use of reference electrodes in the electrolyte, electrochemical impedance spectroscopy (EIS), rotating disk electrodes (RDE), and controlled sample temperatures has greatly clarified the process dynamics over the empirical understanding developed via years of practice. Minimizing RF losses at high operational gradients is very valuable for CW linacs. Jefferson Lab is applying these new insights to the low-loss 7-cell cavity design developed for the CEBAF 12 GeV Upgrade. Together with controlled cleaning and assembly techniques to guard against field-emission-causing particulates, the resulting process is yielding consistent cavity performance that exceeds project requirements. Cavity tests show BCS-limited Q well above 30 MV/m. Detailed process data, interpretation, and resulting rf performance data will be presented.

  5. Hydrogen Degassing Study During the Heat Treatment of 1.3-GHZ SRF Cavities

    SciTech Connect

    Joung, Mijoung; Kim, H. J.; Rowe, A.; Wong, M.

    2013-10-02

    Superconducting radio frequency (SRF) cavities undergo a number of processes as part of its manufacturing procedure in order to optimize their performance. Among these processes is a high temperature hydrogen degas heat treatment used to prevent 'Q' decrease. The heat treatment occurs in the processing sequence after either chemically or mechanically polishing the cavity. This paper summarizes the hydrogen measurements during the heat treatment of a sample of chemically and mechanically polished single-cell and nine-cell 1.3-GHz cavities. The hydrogen measurements are analyzed according the polishing method, the polishing history, the amount of time that the cavity was baked at 800°C, and the temperature ramp rate.

  6. OPTIMIZING CENTRIFUGAL BARREL POLISHING FOR MIRROR FINISH SRF CAVITY AND RF TESTS AT JEFFERSON LAB

    SciTech Connect

    Ari Palczewski, Rongli Geng, Hui Tian

    2012-07-01

    We performed Centrifugal Barrel Polishing (CBP) on a 1.3 GHz fine grain TESLA single cell cavity and 1.5 GHz fine grain CEBAF high gradient superconducting radio frequency (SRF) single cell cavity following a modified recipe originally developed at Fermi National Accelerator Lab (FNAL). We were able to obtain a mirror like surface similar to that obtained at FNAL, while reducing the number of CBP steps and total processing time. This paper will discuss the change in surface and subsequent cavity performance post CBP, after a 800 C bake (no pre-bake chemistry) and minimal controlled electro-polishing (10 micron). In addition to Q vs. E{sub ACC} thermometry mapping with preheating characteristics and optical inspection of the cavity after CBP will also be shown.

  7. A Family of L-band SRF Cavities for High Power Proton Driver Applications

    SciTech Connect

    Robert Rimmer, Frank Marhauser

    2009-05-01

    Recent global interest in high duty factor or CW superconducting linacs with high average beam power highlights the need for robust and reliable SRF structures capable of delivering high average RF power to the beam with moderate HOM damping, low interception of halo and good efficiency. Potential applications include proton or H- drivers for spallation neutron sources, neutrino physics, waste transmutation, subcritical reactors, and high-intensity high-energy physics experiments. We describe a family of SRF cavities with a range of Betas capable of transporting beam currents in excess of 10 mA CW with large irises for minimal interception of halo and HOM and power couplers capable of supporting high average power operation. Goals include an efficient cell shape, high packing factor for efficient real-estate gradient and strong HOM damping to ensure stable beam operation,

  8. SQUID-based Nondestructive Testing Instrument of Dished Niobium Sheets for SRF Cavities

    SciTech Connect

    Q. S. Shu; I. Ben-Zvi; G. Cheng; I. M. Phipps; J. T. Susta; P. Kneisel; G. Myneni; J. Mast; R. Selim

    2007-08-01

    Currently available technology can only inspect flat sheets and allow the elimination of defective flat sheets before the expensive forming and machining of the SRF cavity half-cells, but it does not eliminate the problem of remaining or uncovered surface impurities after partial chemical etching of the half-cells, nor does it detect any defects that may have been added during the fabrication of the half-cells. AMAC has developed a SQUID scanning system based on eddy current technique that allows the scanning of curved Nb samples that are welded to make superconducting RF cavity half-cells. AMAC SQUID scanning system successfully located the defects (Ta macro particles about 100 mm diameter) in a flat Nb sample (top side) and was able to also locate the defects in a cylindrical surface sample (top side). It is more significant that the system successfully located the defects on the backside of the flat sample and curved sample or 3-mm from the top surface. The 3-D SQUID-based Nondestructive instrument will be further optimized and improved in making SRF cavities and allow inspection and detection during cavity manufacturing for achieving highest accelarating fields.

  9. Design, Fabrication and Testing of Medium-Beta 650 MHz SRF Cavity Prototypes for Project-X

    SciTech Connect

    F. Marhauser, W.A. Clemens, J. Henry, P. Kneisel, R. Martin, R.A. Rimmer, G. Slack, L. Turlington, R.S. Williams

    2011-09-01

    A new type of superconducting radio frequency (SRF) cavity shape with a shallow equator dome to reduce electron impact energies for suppressing multipacting barriers has been proposed. The shape is in consideration for the first time in the framework of Project-X to design a potential multi-cell cavity candidate for the medium-beta section of the SRF proton CW linac operating at 650 MHz. Rationales covering the design of the multi-cell cavity, the manufacture, post-processing and high power testing of two single-cell prototypes are presented.

  10. Large-Volume Resonant Microwave Discharge for Plasma Cleaning of a CEBAF 5-Cell SRF Cavity

    SciTech Connect

    J. Mammosser, S. Ahmed, K. Macha, J. Upadhyay, M. Nikoli, S. Popovi, L. Vuakovi

    2012-07-01

    We report the preliminary results on plasma generation in a 5-cell CEBAF superconducting radio-frequency (SRF) cavity for the application of cavity interior surface cleaning. CEBAF currently has {approx}300 of these five cell cavities installed in the Jefferson Lab accelerator which are mostly limited by cavity surface contamination. The development of an in-situ cavity surface cleaning method utilizing a resonant microwave discharge could lead to significant CEBAF accelerator performance improvement. This microwave discharge is currently being used for the development of a set of plasma cleaning procedures targeted to the removal of various organic, metal and metal oxide impurities. These contaminants are responsible for the increase of surface resistance and the reduction of RF performance in installed cavities. The CEBAF five cell cavity volume is {approx} 0.5 m2, which places the discharge in the category of large-volume plasmas. CEBAF cavity has a cylindrical symmetry, but its elliptical shape and transversal power coupling makes it an unusual plasma application, which requires special consideration of microwave breakdown. Our preliminary study includes microwave breakdown and optical spectroscopy, which was used to define the operating pressure range and the rate of removal of organic impurities.

  11. RECENT DEVELOPMENTS IN SRF CAVITY SCIENCE AND PERFORMANCE

    SciTech Connect

    Gianluigi Ciovati

    2006-08-21

    A recipe based on centrifugal barrel polishing (CBP) and electropolishing (EP), applied on newly designed single-cells, led to the achievement of B{sub p} values close to the thermodynamic critical field of Nb and to new records in terms of accelerating gradients The fabrication of cavities made of large-grain Nb is emerging as a viable option to reduce the material cost without sacrificing the performance. The Q-drop is not caused exclusively by losses at grain boundaries in Nb. Baking is the only known remedy against the Q-drop and its effect seems to be related to a change of the properties of the Nb up to a depth of about 20 nm. 120 C is the optimum temperature and the baking time can be reduced to 12 h. Cleaning techniques such as high-pressure rinse (HPR) are being studied in detail in order to be optimized for mass-production. Dry-ice cleaning may become a complementary cleaning method. Work is being done to better understand and to improve the EP process.

  12. Proof of Concept Thin Films and Multilayers Toward Enhanced Field Gradients in SRF Cavities

    SciTech Connect

    Lukaszew, R A; Beringer, D; Roach, W M; Eremeev, G V; Valente-Feliciano, A-M; Reece, C E; Xi, X

    2013-09-01

    Due to the very shallow penetration depth of the RF fields, SRF properties are inherently a surface phenomenon involving a material thickness of less than 1 micron thus opening up the possibility of using thin film coatings to achieve a desired performance. The challenge has been to understand the dependence of the SRF properties on the detailed characteristics of real surfaces and then to employ appropriate techniques to tailor these surface properties for greatest benefit. Our aim is to achieve gradients >100 MV/m and no simple material is known to be capable of sustaining this performance. A theoretical framework has been proposed which could yield such behavior [1] and it requires creation of thin film layered structures. I will present our systematic studies on such proof-of-principle samples. Our overarching goal has been to build a basic understanding of key nano-scale film growth parameters for materials that show promise for SRF cavity multilayer coatings and to demonstrate the ability to elevate the barrier for vortex entry in such layered structures above the bulk value of Hc1 for type-II superconductors and thus to sustain higher accelerating fields.

  13. Routine characterization of 3-D profiles of SRF cavity defects using replica techniques

    SciTech Connect

    Ge, M.; Wu, G.; Burk, D.; Ozelis, J.; Harms, E.; Sergatskov, D.; Hicks, D.; Cooley, L.D.; /Fermilab

    2010-09-01

    Recent coordination of thermometry with optical images has shown that obvious defects at specific locations produce heat or even quench superconducting radio frequency (SRF) cavities, imposing a significant limit on the overall accelerating gradient produced by the cavity. Characterization of the topography at such locations provides clues about how the defects originated, from which schemes for their prevention might be devised. Topographic analyses also provide understanding of the electromagnetic mechanism by which defects limit cavity performance, from which viability of repair techniques might be assessed. In this article we discuss how a variety of two-component silicone-based room-temperature vulcanizing agents can be routinely used to make replicas of the cavity surface and extract topographic details of cavity defects. Previously, this level of detail could only be obtained by cutting suspect regions from the cavity, thus destroying the cavity. We show 3-D profiles extracted from several different 1.3 GHz cavities. The defect locations, which were all near cavity welds, compelled us to develop extraction techniques for both equator and iris welds as well as from deep inside long 9-cell cavities. Profilometry scans of the replicas yield micrometer-scale information, and we describe various curious features, such as small peaks at the bottom of pits, which were not apparent in previous optical inspections. We also discuss contour information in terms of electromagnetic mechanisms proposed by others for local cavity heating. We show that production of the replica followed by high-pressure rinsing dose not adversely affect the cavity RF performance.

  14. Thermal Analysis of SRF Cavity Couplers Using Parallel Multiphysics Tool TEM3P

    SciTech Connect

    Akcelik, V; Lee, L.-Q.; Li, Z.; Ng, C.-K.; Ko, K.; Cheng, G.; Rimmer, R.; Wang, H.; /Jefferson Lab

    2009-05-20

    SLAC has developed a multi-physics simulation code TEM3P for simulating integrated effects of electromagnetic, thermal and structural loads. TEM3P shares the same software infrastructure with SLAC's parallel finite element electromagnetic codes, thus enabling all physics simulations within a single framework. The finite-element approach allows high-fidelity, high-accuracy simulations and the parallel implementation facilitates large-scale computation with fast turnaround times. In this paper, TEM3P is used to analyze thermal loading at coupler end of the JLAB SRF cavity.

  15. Thermal Analysis of SRF Cavity Couplers Using Parallel Multiphysics Tool TEM3P

    SciTech Connect

    Akcelik, V, Lee, L.-Q., Li, Z., Ng, C.-K., Ko, K.,Cheng, G., Rimmer, R., Wang, H.

    2009-05-01

    SLAC has developed a multi-physics simulation code TEM3P for simulating integrated effects of electromagnetic, thermal and structural loads. TEM3P shares the same software infrastructure with SLAC’s paralell finite element electromagnetic codes, thus enabling all physics simulations within a single framework. The finite-element approach allows high fidelity, high-accuracy simulations and the parallel implementation facilitates large-scale computation with fast turnaround times. In this paper, TEM3P is used to analyze thermal loading at coupler end of the JLAB SRF cavity.

  16. WAFER TEST CAVITY -Linking Surface Microstructure to RF Performance: a ‘Short-­Sample Test Facility’ for characterizing superconducting materials for SRF cavities.

    SciTech Connect

    Pogue, Nathaniel; Comeaux, Justin; McIntyre, Peter

    2014-05-30

    The Wafer Test cavity was designed to create a short sample test system to determine the properties of the superconducting materials and S-I-S hetero-structures. The project, funded by ARRA, was successful in accomplishing several goals to achieving a high gradient test system for SRF research and development. The project led to the design and construction of the two unique cavities that each severed unique purposes: the Wafer test Cavity and the Sapphire Test cavity. The Sapphire Cavity was constructed first to determine the properties of large single crystal sapphires in an SRF environment. The data obtained from the cavity greatly altered the design of the Wafer Cavity and provided the necessary information to ascertain the Wafer Test cavity’s performance.

  17. Where Next with SRF?

    SciTech Connect

    Ciovati, Gianluigi

    2013-06-01

    RF superconductivity (SRF) has become, over the last ~20 years, the technology of choice to produce RF cavities for particle accelerators. This occurred because of improvements in material and processing techniques as well as the understanding and remediation of practical limitations in SRF cavities. This development effort span ~40 years and Nb has been the material of choice for SRF cavity production. As the performances of SRF Nb cavities are approaching what are considered to be theoretical limits of the material, it is legitimate to ask what will be the future of SRF. In this article we will attempt to answer this question on the basis of near-future demands for SRF-based accelerators and the basic SRF properties of the available materials. Clearly, Nb will continue to play a major role in SRF cavities in the coming years but the use of superconductors with higher critical temperature than Nb is also likely to occur.

  18. Impact of forming, welding, and electropolishing on pitting and the surface finish of SRF cavity niobium

    SciTech Connect

    Cooley, L.D.; Burk, D.; Cooper, C.; Dhanaraj, N.; Foley, M.; Ford, D.; Gould, K.; Hicks, D.; Novitski, R.; Romanenko, A.; Schuessler, R.; /Fermilab

    2010-07-01

    A broad range of coupon electropolishing experiments are described to ascertain the mechanism(s) by which large defects are formed near superconducting radiofrequency (SRF) cavity welds. Cold-worked vs. annealed metal, the presence of a weld, and several variations of electropolishing (EP) parameters were considered. Pitting is strongly promoted by cold work and agitation of the EP solution. Welding also promotes pitting, but less so compared with the other factors above. Temperature increase during EP did not strongly affect glossiness or pitting, but the reduced viscosity made the electrolyte more susceptible to agitation. The experiments suggest that several factors that are rather benign alone are combined by the cavity forming, welding, and processing sequence to promote the formation of defects such as pits. Process changes to mitigate these risks are discussed.

  19. Field Emission in CEBAF's SRF Cavities and Implications for Future Accelerators

    SciTech Connect

    Jay Benesch

    2006-02-15

    Field emission is one of the key issues in superconducting RF for particle accelerators. When present, it limits operating gradient directly or via induced heat load at 2K. In order to minimize particulate contamination of and thus field emission in the CEBAF SRF cavities during assembly, a cold ceramic RF window was placed very close to the accelerating cavity proper. As an unintended consequence of this, the window is charged by field-emitted electrons, making it possible to monitor and model field emission in the CEBAF cavities since in-tunnel operation began. From January 30, 1995, through February 10, 2003, there were 64 instances of spontaneous onset or change in cavity field emission with a drop in usable gradient averaging 1.4 ({sigma} 0.8) MV/m at each event. Fractional loss averaged 0.18 ({sigma} 0.12) of pre-event gradient. This event count corresponds to 2.4 events per century per cavity, or 8 per year in CEBAF. It is hypothesized that changes in field emission are due to adsorbed gas accumulation. The possible implications of this and other observations for the International Linear Collider (ILC) and other future accelerators will be discussed.

  20. Exploration of material removal rate of srf elliptical cavities as a function of media type and cavity shape on niobium and copper using centrifugal barrel polishing (cbp)

    SciTech Connect

    Palczewski, Ari; Ciovati, Gianluigi; Li, Yongming; Geng, Rongli

    2013-09-01

    Centrifugal barrel polishing (cbp) for SRF application is becoming more wide spread as the technique for cavity surface preparation. CBP is now being used in some form at SRF laboratories around the world including in the US, Europe and Asia. Before the process can become as mature as wet chemistry like eletro-polishing (EP) and buffered chemical polishing (BCP) there are many questions which remain unanswered. One of these topics includes the uniformity of removal as a function of cavity shape and material type. In this presentation we show CBP removal rates for various media types on 1.3 GHz TESLA and 1.5 GHz CEBAF large/fine grain niobium cavities, and 1.3GHz low surface field copper cavity. The data will also include calculated RF frequency shift modeling non-uniform removal as a function of cavity position and comparing them with CBP results.

  1. A novel approach to characterizing the surface topography of niobium superconducting radio frequency (SRF) accelerator cavities

    SciTech Connect

    Hui Tian, Guilhem Ribeill, Chen Xu, Charles E. Reece, Michael J. Kelley

    2011-03-01

    As superconducting niobium radio-frequency (SRF) cavities approach fundamental material limits, there is increased interest in understanding the details of topographical influences on realized performance limitations. Micro- and nano-roughness are implicated in both direct geometrical field enhancements as well as complications of the composition of the 50 nm surface layer in which the super-currents typically flow. Interior surface chemical treatments such as buffered chemical polishing (BCP) and electropolishing (EP) used to remove mechanical damage leave surface topography, including pits and protrusions of varying sharpness. These may promote RF magnetic field entry, locally quenching superconductivity, so as to degrade cavity performance. A more incisive analysis of surface topography than the widely used average roughness is needed. In this study, a power spectral density (PSD) approach based on Fourier analysis of surface topography data acquired by both stylus profilometry and atomic force microscopy (AFM) is introduced to distinguish the scale-dependent smoothing effects, resulting in a novel qualitative and quantitative description of Nb surface topography. The topographical evolution of the Nb surface as a function of different steps of well-controlled EP is discussed. This study will greatly help to identify optimum EP parameter sets for controlled and reproducible surface levelling of Nb for cavity production.

  2. Surface polishing of niobium for superconducting radio frequency (SRF) cavity applications

    SciTech Connect

    Zhao, Liang

    2014-08-01

    Niobium cavities are important components in modern particle accelerators based on superconducting radio frequency (SRF) technology. The interior of SRF cavities are cleaned and polished in order to produce high accelerating field and low power dissipation on the cavity wall. Current polishing methods, buffered chemical polishing (BCP) and electro-polishing (EP), have their advantages and limitations. We seek to improve current methods and explore laser polishing (LP) as a greener alternative of chemical methods. The topography and removal rate of BCP at different conditions (duration, temperature, sample orientation, flow rate) was studied with optical microscopy, scanning electron microscopy (SEM), and electron backscatter diffraction (EBSD). Differential etching on different crystal orientations is the main contributor to fine grain niobium BCP topography, with gas evolution playing a secondary role. The surface of single crystal and bi-crystal niobium is smooth even after heavy BCP. The topography of fine grain niobium depends on total removal. The removal rate increases with temperature and surface acid flow rate within the rage of 0~20 °C, with chemical reaction being the possible dominate rate control mechanism. Surface flow helps to regulate temperature and avoid gas accumulation on the surface. The effect of surface flow rate on niobium EP was studied with optical microscopy, atomic force microscopy (AFM), and power spectral density (PSD) analysis. Within the range of 0~3.7 cm/s, no significant difference was found on the removal rate and the macro roughness. Possible improvement on the micro roughness with increased surface flow rate was observed. The effect of fluence and pulse accumulation on niobium topography during LP was studied with optical microscopy, SEM, AFM, and PSD analysis. Polishing on micro scale was achieved within fluence range of 0.57~0.90 J/cm2, with pulse accumulation adjusted accordingly. Larger area treatment was proved possible by

  3. Surface Topography of 'Hotspot' Regions from a Single Cell SRF Cavity

    SciTech Connect

    Xin Zhao, Gianluigi Ciovati, Charles Reece, Andy Wu

    2009-05-01

    Performance of SRF cavities are limited by non-linear localized effects. The variation of local material characters between "hot" and "cold" spots is thus of intense interest. Such locations were identified in a BCP-etched large-grain single-cell cavity and removed for examination by high resolution electron microscopy (SEM), electron-back scattering diffraction microscopy (EBSD), optical microscopy, and 3D profilometry. Pits with clearly discernable crystal facets were observed in both "hotspot" and "coldspot" specimens. The pits were found in-grain, at bi-crystal boundaries, and on tri-crystal junctions. They are interpreted as etch pits induced by surface crystal defects (e.g. dislocations). All "coldspots" examined had qualitatively low density of etching pits or very shallow tri-crystal boundary junction. EBSD revealed the crystal structure surrounding the pits via crystal phase orientation mapping, while 3D profilometry gave information on the depth and size of the pits. In addition, a survey of the samples by energy dispersive X-ray analysis (EDX) did not show any significant contamination of the samples surface.

  4. An update on the study of high-gradient elliptical SRF cavities at 805 MHz for proton and other applications

    SciTech Connect

    Tajima, Tsuyoshi; Haynes, Brian; Krawczyk, Frank; Madrid, Mike; Roybal, Ray; Simakov, Evgenya; Clemens, Bob; Macha, Jurt; Manus, Bob; Rimmer, Bob; Rimmer, Bob; Turlington, Larry

    2010-09-09

    An update on the study of 805 MHz elliptical SRF cavities that have been optimized for high gradient will be presented. An optimized cell shape, which is still appropriate for easy high pressure water rinsing, has been designed with the ratios of peak magnetic and electric fields to accelerating gradient being 3.75 mT/(MV/m) and 1.82, respectively. A total of 3 single-cell cavities have been fabricated. Two of the 3 cavities have been tested so far. The second cavity achieved an E{sub acc} of {approx}50 MV/m at Q{sub 0} of 1.4 x 10{sup 10}. This result demonstrates that 805 MHz cavities can, in principle, achieve as high as, or could even be better than, 1.3 GHz high-gradient cavities.

  5. Investigations of Residual Stresses and Mechanical Properties of Single Crystal Niobium for SRF Cavities

    SciTech Connect

    Thomas Gnäupel-Herold; Ganapati Rao Myneni; Richard E. Ricker

    2007-06-01

    This work investigates properties of large grained, high purity niobium with respect to the forming of superconducting radio frequency (SRF) cavities from such large grained sheets. The yield stresses were examined using tensile specimens that were essentially single crystals in orientations evenly distributed in the standard projection triangle. No distinct yield anisotropy was found, however, vacuum annealing increased the yield strength by a factor 2..3. The deep drawing forming operation of the half cells raises the issues of elastic shape changes after the release of the forming tool (springback) and residual stresses, both of which are indicated to be negligible. This is a consequence of the low yield stress (< 100 MPa) and the large thickness (compared to typical thicknesses in sheet metal forming). However, the significant anisotropy of the transversal plastic strains after uniaxial deformation points to potentially critical thickness variations for large grained / single crystal half cells, thus raising the issue of controlling grain orientation or using single crystal sheet material.

  6. HIGH RESOLUTION AND FAST SCANNING SQUID BASED NON-DESTRUCTIVE INSPECTION SYSTEM OF NIOBIUM SHEETS FOR SRF CAVITIES

    SciTech Connect

    SHU, QUAN-SHENG

    2008-06-08

    Applications in high energy physics accelerators and other fields require the use of thousands of superconducting RF (SRF) cavities that are made of high purity Nb material and the purity of niobium is critical for these cavities to reach the highest accelerating fields. Tantalum is the most prolific of metal inclusions, which can cause thermal breakdown and prevent the cavities from reaching their theoretical performance limits of 45-50 MV/m, and DOE Labs are searching for a technology that could detect small impurities in superconducting Nb sheets reaching the highest possible accelerating fields. The proposed innovative SQUID-based Nondestructive system can scan Niobium sheets used in the manufacturing of SRF cavities with both high speed and high resolution. A highly sensitive SQUID system with a gradiometer probe, non-magnetic dewar, data acquisition system, and a scanning system will be developed for fast detection of impurities in planar Nb sheets. In phase I, we will modify our existing SQUID-based eddy current system to detect 100 micron size Ta defects and a great effort will focus on achieving fast scanning of a large number of niobium sheets in a shorter time and with reasonable resolution. An older system operated by moving the sample 1 mm, stopping and waiting for 1-2 seconds, then activating a measurement by the SQUID after the short settle time is modified. A preliminary designed and implemented a SQUID scanning system that is fast and is capable of scanning a 30 cm x 30 cm Nb sheet in 15 minutes by continuously moving the table at speeds up to 10 mm/s while activating the SQUID at 1mm interval is modified and reached the Phase I goal of 100mm resolution. We have successfully demonstrated the feasibility that a fast speed SQUID scanner without sacrificing the resolution of detection can be done, and a data acquisition and analysis system is also preliminary developed. The SQUID based scanner will help reach the highest accelerating field in SRF

  7. Basic Electropolishing Process Research and Development in Support of Improved Reliable Performance SRF Cavities for the Future Accelerator

    SciTech Connect

    H. Tian, C.E. Reece,M.J. Kelley

    2009-05-01

    Future accelerators require unprecedented cavity performance, which is strongly influenced by interior surface nanosmoothness. Electropolishing is the technique of choice to be developed for high-field superconducting radiofrequency cavities. Electrochemical impedance spectroscopy (EIS) and related techniques point to the electropolishing mechanism of Nb in a sulfuric and hydrofluoric acid electrolyte of controlled by a compact surface salt film under F- diffusion-limited mass transport control. These and other findings are currently guiding a systematic characterization to form the basis for cavity process optimization, such as flowrate, electrolyte composition and temperature. This integrated analysis is expected to provide optimum EP parameter sets for a controlled, reproducible and uniform surface leveling for Nb SRF cavities.

  8. Film Deposition, Cryogenic RF Testing and Materials Analysis of a Nb/Cu Single Cell SRF Cavity

    SciTech Connect

    Zhao, Xin; Geng, Rongli; Palczerski, Ari; Li, Yongming

    2013-09-01

    In this study, we present preliminary results on using a cathodic-arc-discharge Nb plasma ion source to establish a Nb film-coated single-cell Cu cavity for SRF research. The polycrystalline Cu cavity was fabricated and mirror-surface-finished by a centrifugal barrel polishing (CBP) process at Jefferson Lab. Special pre-coating processes were conducted, in order to create a template-layer for follow-on Nb grain thickening. A sequence of cryogenic RF testing demonstrated that the Nb film does show superconductivity. But the quality factor of this Nb/Cu cavity is low as a result of high residual surface resistance. We are conducting a thorough materials characterization to explore if some microstructural defects or hydrogen impurities, led to such a low quality factor.

  9. Improvement of the operational performance of SRF cavities via in situ helium processing and waveguide vacuum processing

    SciTech Connect

    Reece, C.E.; Drury, M.; Rao, M.G.; Nguyen-Tuong, V.

    1997-06-01

    The useful performance range of the superconducting rf (SRF) cavities in the CEBAF accelerator at Jefferson Lab is frequently limited by electron field emission and derived phenomena. Improvements are required to support future operation of the accelerator at higher than 5 GeV. Twelve operational cryomodules have been successfully processed to higher useful operating gradients via rf-helium processing. Progress against field emission was evidenced by improved high-field Q, reduced x-ray production and greatly reduced incidence of arcing at the cold ceramic window. There was no difficulty reestablishing beamline vacuum following the processing. Cavities previously limited to 4-6 MV/m are now operating stably at 6-9 MV/m. By applying a pulsed-rf processing technique, we have also improved the pressure stability of the thermal transition region of the input waveguide for several cavities.

  10. R&D Status for In-Situ Plasma Surface Cleaning of SRF Cavities at Spallation Neutron Source

    SciTech Connect

    S.-H. Kim, M.T. Crofford, M. Doleans, J.D. Mammosser, J. Saunders

    2011-03-01

    The SNS SCL is reliably operating at 0.93 GeV output energy with an energy reserve of 10MeV with high availability. Most of the cavities exhibit field emission, which directly or indirectly (through heating of end groups) limits the gradients achievable in the high beta cavities in normal operation with the beam. One of the field emission sources would be surface contaminations during surface processing for which mild surface cleaning, if any, will help in reducing field emission. An R&D effort is in progress to develop in-situ surface processing for the cryomodules in the tunnel without disassembly. As the first attempt, in-situ plasma processing has been applied to the CM12 in the SNS SRF facility after the repair work with a promising result. This paper will report the R&D status of plasma processing in the SNS.

  11. Design, Construction, and Initial Test of High Spatial Resolution Thermometry Arrays for Detection of Surface Temperature Profiles on SRF Cavities in Super Fluid Helium

    SciTech Connect

    Ari Palczewski, Rongli Geng, Grigory Eremeev

    2011-07-01

    We designed and built two high resolution (0.6-0.55mm special resolution [1.1-1.2mm separation]) thermometry arrays prototypes out of the Allen Bradley 90-120 ohm 1/8 watt resistor to measure surface temperature profiles on SRF cavities. One array was designed to be physically flexible and conform to any location on a SRF cavity; the other was modeled after the common G-10/stycast 2850 thermometer and designed to fit on the equator of an ILC (Tesla 1.3GHz) SRF cavity. We will discuss the advantages and disadvantages of each array and their construction. In addition we will present a case study of the arrays performance on a real SRF cavity TB9NR001. TB9NR001 presented a unique opportunity to test the performance of each array as it contained a dual (4mm separation) cat eye defect which conventional methods such as OST (Oscillating Superleak second-sound Transducers) and full coverage thermometry mapping were unable to distinguish between. We will discuss the new arrays ability to distinguish between the two defects and their preheating performance.

  12. Overview of high gradient SRF R&D for ILC cavities at Jefferson Lab

    SciTech Connect

    Geng, Rongli

    2009-11-01

    We report the progress on high gradient R&D of ILC cavities at Jefferson Lab (JLab) since the Beijing workshop. Routine 9-cell cavity electropolishing (EP) processing and RF testing has been enhanced with added surface mapping and T-mapping instrumentations. 12 new 9-cell cavities (10 of them are baseline fine-grain TESLA-shape cavities: 5 built by ACCEL/Research Instruments, 4 by AES and 1 by JLab; 2 of them are alternative cavities: 1 fine-grain ICHIRO-shape cavity built by KEK/Japan industry and 1 large-grain TESLA-shape cavity built by JLab) are EP processed and tested. 76 EP cycles are accumulated, corresponding to more than 200 hours of active EP time. Field emission (FE) and quench behaviors of electropolished 9-cell cavities are studied. EP process continues to be optimized, resulting in advanced procedures and hence improved cavity performance. Several 9-cell cavities reached 35 MV/m after the first light EP processing. FE-free performance has been demonstrated in 9-cell cavities in 35-40 MV/m range. 1-cell cavity studies explore new techniques for defect removal as well as advanced integrated cavity processing. Surface studies of niobium samples electropolished together with real cavities provide new insight into the nature of field emitters. Close cooperation with the US cavity fabrication industry has been undertaking with the successful achievement of 41 MV/m for the first time in a 9-cell ILC cavity built by AES. As the size of the data set grows, it is now possible to construct gradient yield curves, from which one can see that significant progress has been made in raising the high gradient yield.

  13. Buffered Electropolishing – A New Way for Achieving Extremely Smooth Surface Finish on Nb SRF Cavities to be Used in Particle Accelerators

    SciTech Connect

    Hui Tian, Charles Reece, Michael Kelley

    2009-05-01

    Future accelerators require unprecedented cavity performance, which is strongly influenced by interior surface nano-smoothness. Electropolishing (EP) is the technique of choice to be developed for high-field superconducting radio frequency (SRF) cavities. Electrochemical impedance spectroscopy (EIS) and related techniques point to the electropolishing mechanism of Nb in a sulphuric and hydrofluoric acid electrolyte controlled by a compact surface salt film under F- diffusion-limited mass transport control. These and other findings are guiding a systematic characterization to form the basis for cavities process optimization.

  14. Preparation and Testing of the SRF Cavities for the CEBAF 12 GeV Upgrade

    SciTech Connect

    Reilly, A. V.; Bass, T.; Burrill, A.; Davis, G. K.; Marhauser, F.; Reece, C. E.; Stirbet, M.

    2011-07-01

    Eighty new 7-cell, low-loss cell-shaped cavities are required for the CEBAF 12 GeV Upgrade project. In addition to ten pre-production units fabricated at JLab, the full set of commercially-produced cavities have been delivered. An efficient processing routine, which includes a controlled 30 micron electropolish, has been established to transform these cavities into qualified 8-cavity strings. This work began in 2010 and will run through the end of 2011. The realized cavity performance consistently exceeds project requirements and also the maximum useful gradient in CEBAF: 25 MV/m. We will describe the cavity processing and preparation protocols and summarize test results obtained to date.

  15. MgB2 Coated Ellipsoids as an Approach to Investigate the Possible Enhancement of the Vortex Penetrating Field of SRF Cavities

    NASA Astrophysics Data System (ADS)

    Tan, Teng; Wolak, Matthaeus; Tajima, Tsuyoshi; Xi, Xiaoxing; Civale, Leonardo

    2015-03-01

    Superconducting rf (SRF) cavities fabricated from bulk niobium (Nb) are a key component for modern particle accelerators. The magnetic field distribution on the inner wall of an SRF cavity is inversely similar to the field distribution on top of a superconducting ellipsoid when we put it in a magnetic field parallel to its axis. By measuring the vortex penetration into the magnetized superconducting ellipsoids, we can deduct the behavior of SRF cavities. Magnesium diboride (MgB2) has potential to replace Nb as it has a higher Tc of 39 K, a lower residual resistivity of ~ 0.1 μΩ cm (at 42 K), and a higher thermodynamic critical field Hc value compared to Nb. In this work, we successfully coated uniform MgB2 layers on top of molybdenum and niobium ellipsoids. SQUID magnetometer measurements showed that the coated MgB2 layer has a Tc above 38.5 K, and can provide a perfect magnetic shielding up to ~ 500 Oe at 1.8K. By coating MgB2 on Nb ellipsoids, we increased the vortex penetration field (the maximum field at which a cavity can be operated) by ~ 500 Oe at 2 K.

  16. In-situ plasma processing to increase the accelerating gradients of SRF cavities

    SciTech Connect

    Doleans, Marc; Afanador, Ralph; Barnhart, Debra L.; Degraff, Brian D.; Gold, Steven W.; Hannah, Brian S.; Howell, Matthew P.; Kim, Sang-Ho; Mammosser, John; McMahan, Christopher J.; Neustadt, Thomas S.; Saunders, Jeffrey W.; Tyagi, Puneet V.; Vandygriff, Daniel J.; Vandygriff, David M.; Ball, Jeffrey Allen; Blokland, Willem; Crofford, Mark T.; Lee, Sung-Woo; Stewart, Stephen; Strong, William Herb

    2015-12-31

    A new in-situ plasma processing technique is being developed at the Spallation Neutron Source (SNS) to improve the performance of the cavities in operation. The technique utilizes a low-density reactive oxygen plasma at room temperature to remove top surface hydrocarbons. The plasma processing technique increases the work function of the cavity surface and reduces the overall amount of vacuum and electron activity during cavity operation; in particular it increases the field emission onset, which enables cavity operation at higher accelerating gradients. Experimental evidence also suggests that the SEY of the Nb surface decreases after plasma processing which helps mitigating multipacting issues. This article discusses the main developments and results from the plasma processing R&D are presented and experimental results for in-situ plasma processing of dressed cavities in the SNS horizontal test apparatus.

  17. In-situ plasma processing to increase the accelerating gradients of SRF cavities

    DOE PAGESBeta

    Doleans, Marc; Afanador, Ralph; Barnhart, Debra L.; Degraff, Brian D.; Gold, Steven W.; Hannah, Brian S.; Howell, Matthew P.; Kim, Sang-Ho; Mammosser, John; McMahan, Christopher J.; et al

    2015-12-31

    A new in-situ plasma processing technique is being developed at the Spallation Neutron Source (SNS) to improve the performance of the cavities in operation. The technique utilizes a low-density reactive oxygen plasma at room temperature to remove top surface hydrocarbons. The plasma processing technique increases the work function of the cavity surface and reduces the overall amount of vacuum and electron activity during cavity operation; in particular it increases the field emission onset, which enables cavity operation at higher accelerating gradients. Experimental evidence also suggests that the SEY of the Nb surface decreases after plasma processing which helps mitigating multipactingmore » issues. This article discusses the main developments and results from the plasma processing R&D are presented and experimental results for in-situ plasma processing of dressed cavities in the SNS horizontal test apparatus.« less

  18. SIMULATIONS AND MEASUREMENTS OF A HEAVILY HOM-DAMPED MULTI-CELL SRF CAVITY

    SciTech Connect

    Haipeng Wang; Robert Rimmer; Frank Marhauser

    2007-07-02

    After an initial cavity shape optimization [1] and cryomodule development [2] for an Ampere-class FEL ERL, we have simulated a complete 5-cell high-current (HC) cavity structure with six waveguide (WG) couplers for Higher Order Mode (HOM) damping and fundamental power coupling. The time-domain wakefield simulations of the MAFIA codes have been used to calculate the cavities broadband HOM impedance spectrum. Microwave Studio (MWS) has also been used to evaluate the external Q of the fundamental power coupler (FPC) and the R/Qs of the HOMs. A half scale 1497MHz single-cell model cavity and a 5-cell copper cavity including dummy HOM WG loads were fabricated to bench measure and confirm the design performance. Details of the multi-beam wakefield simulations, the HOM damping measurements and multi-peak data fitting analysis techniques are presented.

  19. First Results of the SRF Wafer Test Cavity for the Characterization of Superconductors

    SciTech Connect

    Pogue, Nathaniel J.; Comeaux, Justin; McIntyre, Peter; Palczewski, Ari D.; Reece, Charles E.

    2015-06-01

    The wafer test cavity was designed as a short sample test system that could create a reproducible environment for the testing of superconducting materials above the Bardeen-Cooper- Schrieffer limit of niobium. The results of the sapphire test cavity showed that the dielectric was too lossy, and thus, the original design had to be altered to make operation feasible with current hardware and achieve ~200 mT. The new design was fabricated at Thomas Jefferson National Accelerator Facility and was cryogenically tested. After four tests, the cavity was able to produce a 6.6-mT field with a Q of 3.96 * 108. Although lower than anticipated, in comparison to other TE01 cavities, this result is quite encouraging. Multipacting and coupling were limitations, but current work is pursuing the elimination of these complications. This document will expound upon the new design, mathematical simulations, testing of the cavity, complications, results, and future work.

  20. Combined effects of cold work and chemical polishing on the absorption and release of hydrogen from SRF cavities inferred from resistance measurements of cavity-grade niobium bars

    NASA Astrophysics Data System (ADS)

    Dzyuba, A.; Cooley, L. D.

    2014-03-01

    A series of small fine-grained and single-crystal bars, with strain from 0% (recrystallized) to 50%, were given different amounts of chemical polishing. Four-point resistivity (ρ) data was used to characterize the electron scattering from dislocations, hydrogen, and any other trace contaminants. As noted by previous studies, annealed Nb displayed a weak linear increase of ρ (11 K) with polishing time due to hydrogen absorption, and bulk hydrogen concentration did not exceed 15% for 200 μm metal removed. Cold-worked samples displayed steeper slopes with polishing time (after subtracting resistivity due to strain alone), suggesting that dislocations assist the absorption of hydrogen during polishing. Absorption accelerated above 30% strain and 100 μm material removal, with room-temperature hydrogen concentration rising rapidly from 2% up to 5%. This threshold is significant, since superconducting radio-frequency (SRF) cavities are usually polished as-formed, with >35% strain, and polishing removes >150 μm of metal. Resistance jumps between 40 and 150 K, which signal the formation of hydride precipitates, were stronger in cold-worked samples, suggesting that dislocations also assist precipitate nucleation. High-vacuum anneals at 800 °C for 2 h, which are known to fully recrystallize cavity-grade niobium and de-gas hydrogen, removed the 40-150 K jumps and recovered the resistivity increase due to chemical polishing entirely. But, about 30% of the resistivity increase due to cold work remained, possibly due to residual dislocation clusters. Continued annealing only facilitated the diffusion of surface impurities into the bulk and did not recover the initial 0% state. Strain, polishing, and annealing thus appear to combine as irreversible paths that change the material. Bearing this in mind, the significant difference in hydrogen uptake between annealed and cold-worked samples suggests that annealing SRF cavities prior to chemical polishing could greatly reduce

  1. A clean pumping and venting system for SRF cavities and cryomodules.

    SciTech Connect

    Gerbick, S. M.; Kelly, M. P.; Physics

    2009-01-01

    A system based on a pair of mass flow controllers has been used to evacuate and vent a clean cavity rf space. The mass-flow system is used in both single cavity testing and with the ATLAS upgrade cryomodule at Argonne. It is similar schematically to that already in use at DESY, however, it is very compact and maintains the capability to precisely control both the pump out and venting rates. Initial tests of the system with both the ATLAS single cavity test cryostat and the ATLAS upgrade cryomodule show that pump down and venting cycles may be performed without introducing substantial particulates into the cavity rf space. The system, together with the ANL top loading cryomodule design with easy access to individual cavities, will allow an individual cavity to be removed and replaced in a cryomodule string without the need to re-clean the entire string. This capability would also remove the need to test every cavity individually before installation into the string, constituting a major savings for large projects.

  2. Enhancement in Quality Factor of SRF Niobium Cavities by Material Diffusion

    SciTech Connect

    Dhakal, Pashupati; Ciovati, Gianluigi; Kneisel, Peter K.; Myneni, Ganapati Rao

    2015-06-01

    An increase in the quality factor of superconducting radiofrequency cavities is achieved by minimizing the surface resistance during processing steps. The surface resistance is the sum of temperature independent residual resistance and temperature/material dependent Bardeen-Cooper-Schrieffer (BCS) resistance. High temperature heat treatment usually reduces the impurities concentration from the bulk niobium, lowering the residual resistance. The BCS part can be reduced by selectively doping non-magnetic impurities. The increase in quality factor, termed as Q-rise, was observed in cavities when titanium or nitrogen thermally diffused in the inner cavity surface.

  3. DIAGNOSIS, ANALYSIS, AND RESOLUTION OF THERMAL STABILITY ISSUES WITH HOM COUPLERS ON PROTOTYPE CEBAF SRF CAVITIES

    SciTech Connect

    Charles Reece; Edward Daly; G. Davis; William Hicks; Timothy Rothgeb; H. Phillips; Joseph Preble; Haipeng Wang; Genfa Wu

    2008-02-12

    During initial testing of the prototype cavities incorporated into the developmental cryomodule Renascence severe thermal stability issues were encountered during CW operation. Additional diagnostic instrumentation was added. This enabled identification of an unanticipated thermal impedance between the HOM coupler probe feedthrough assembly and the cavity beamtube. Subsequent detailed FE analysis successfully modeled the situation and indicated the need for alternate cooling path for the couplers on those cavities. HOM damping was measured to be adequate employing only two of the four HOM couplers. The two pickup probes on the couplers at the input power coupler side of each cavity were removed, the remaining HOM probe feedthroughs were heat stationed to two-phase helium supply piping, and a novel heat sink was added to station both the inner and outer conductors of the remaining HOM rf cables. The characterization measurements, analysis, modifications, and resulting performance are presented.

  4. Reproducibility of High-Q SRF Cavities by High Temperature Heat Treatment

    SciTech Connect

    Dhakal, Pashupati; Ciovati, Gianluigi; Kneisel, Peter; Myneni, Ganapati Rao

    2014-07-01

    Recent work on high-temperature (> 600 °C) heat treatment of ingot Nb cavities in a customized vacuum furnace for several hours showed the possibility of achieving Q0-values of up to ~5×1010 at 2.0 K, 1.5 GHz and accelerating gradients of ~20 MV/m. This contribution presents results on further studies of the heat treatment process to produce cavities with high Q0 values for continuous-wave accelerator application. Single-cell cavities of different Nb purity have been processed through few cycles of heat-treatments and chemical etching. Measurements of Q0 as a function of temperature at low RF field and of Q0 as a function of the RF field at or below 2.0 K have been made after each treatment. Measurements by TOF-SIMS of the impurities depth profiles were made on samples heat treated with the cavities.

  5. Design And Commissioning Status Of New Cylindrical HiPIMS Nb Coating System for SRF Cavities

    SciTech Connect

    Phillips, H. Lawrence; Macha, Kurt M.; Valente-Feliciano, Anne-Marie

    2014-02-01

    For the past 19 years Jefferson Lab has sustained a program studying niobium films deposited on small samples in order to develop an understanding of the correlation between deposition parameters, film micro-structure, and RF performance. A new cavity deposition system employing a cylindrical cathode using the HiPIMS technique has been developed to apply this work to cylindrical cavities. The status of this system will be presented.

  6. 1500 MHZ Passive SRF Cavity for Bunch Lengthening in the NSLS-II Storage Ring

    SciTech Connect

    Yanagisawa,T.; Rose, J.; Grimm, T.; Bogle, A.

    2009-05-04

    NSLS-II is a new ultra-bright 3 GeV 3rd generation synchrotron radiation light source. The performance goals require operation with a beam current of 500mA and a bunch current of at least 0.5mA. Ion clearing gaps are required to suppress ion effects on the beam. The natural bunch length of 3mm is planned to be lengthened by means of a third harmonic cavity in order to increase the Touschek limited lifetime. After an extensive investigation of different cavity geometries, a passive, superconducting two-cell cavity has been selected for prototyping. The cavity is HOM damped with ferrite absorbers on the beam pipes. The two-cell cavity simplifies the tuner design, compared to having two independent cells. Tradeoffs between the damping of the higher order modes, thermal isolation associated with the large beam tubes, and overall cavity length are described. A copper prototype has been constructed, and measurements of fundamental and higher order modes will be compared to calculated values.

  7. Optimization of the Low-Loss SRF Cavity for the ILC

    SciTech Connect

    Z. Li; L. Ge; K. Ko; L. Lee; C.-K. Ng; G. L. Schussman; L. Xiao; T. Higo; Y. Morozumi; K. Saito; P. Kneisel; J. S. Sekutowicz

    2007-08-01

    The Low-Loss shape cavity design has been proposed as a possible alternative to the baseline TESLA cavity design for the ILC. The advantages of this design over the TESLA cavity are its lower cryogenic loss, and higher achievable gradient due to lower surface fields. High gradient prototypes for such designs have been tested at KEK (ICHIRO) and JLab (LL). However, issues related to HOM damping and multipacting (MP) still need to be addressed. Preliminary numerical studies of the prototype cavities have shown unacceptable damping for some higher-order dipole modes if the typical TESLA HOM couplers are directly adapted to the design. The resulting wakefield will dilute the beam emittance thus reduces the machine luminosity. Furthermore, high gradient tests on a 9-cell prototype at KEK have experienced MP barriers although a single LL cell had achieved a high gradient. From simulations, MP activities are found to occur in the end-groups of the cavity. In this paper, we will present the optimization results of the end-groups for the Low-Loss shape for effective HOM damping and alleviation of multipacting. Comparisons of simulation results with measurements will also be presented.

  8. STATUS AND TEST RESULTS OF HIGH CURRENT 5-CELL SRF CAVITIES DEVELOPED AT JLAB

    SciTech Connect

    Marhauser, Frank; Clemens, William; Cheng, Guangfeng; Ciovati, Gianluigi; Daly, Edward; Forehand, Daniel; Henry, James; Kneisel, Peter; Manning, Stephen; Manus, Robert; Rimmer, Robert; Tennant, Christopher; Wang, Haipeng

    2008-07-01

    The development of a new compact CW cryomodule for use in future Energy Recovery Linacs (ERLs) and Free Electron Lasers (FELs) is underway at JLab with the objective of transporting beam current up to Ampere-levels. Design goals include broadband cavity Higher Order Mode (HOM) damping, HOMs tuned to safe frequencies to minimize the power extracted from the beam, good real-estate gradient and cryogenic efficiency and consideration of cost and maintainability. Two 1497 MHz high current niobium five-cell cavities with waveguide end groups have been manufactured recently. We report on the latest results including high field tests in a vertical Dewar at 2K and a detailed assessment of the impedance budget for beam breakup (BBU) instability. The general cryomodule and cavity concept is described as well.

  9. Design and development of a new SRF cavity cryomodule for the ATLAS intensity upgrade

    NASA Astrophysics Data System (ADS)

    Kedzie, Mark; Conway, Zachary; Fuerst, Joel; Gerbick, Scott; Kelly, Michael; Morgan, James; Ostroumov, Peter; O'Toole, Michael; Shepard, Kenneth

    2012-06-01

    The ATLAS heavy ion linac at Argonne National Laboratory is undergoing an intensity upgrade that includes the development and implementation of a new cryomodule containing four superconducting solenoids and seven quarter-wave drift-tube-loaded superconducting rf cavities. The rf cavities extend the state of the art for this class of structure and feature ASME code stamped stainless steel liquid helium containment vessels. The cryomodule design is a further evolution of techniques recently implemented in a previous upgrade [1]. We provide a status report on the construction effort and describe the vacuum vessel, thermal shield, cold mass support and alignment, and other subsystems including couplers and tuners. Cavity mechanical design is also reviewed.

  10. Annealing to Mitigate Pitting in Electropolished Niobium Coupons and SRF Cavities

    SciTech Connect

    Cooley, L.D.; Hahn, E.; Hicks, D.; Romanenko, A.; Schuessler, R.; Thompson, C.; /Fermilab

    2011-06-08

    Ongoing studies at Fermilab investigate whether dislocations and other factors instigate pitting during cavity electropolishing (EP), despite careful processing controls and the inherent leveling mechanism of EP itself. Here, cold-worked niobium coupons, which exhibited increased tendencies for pitting in our past study, were annealed in a high vacuum furnace and subsequently processed by EP. Laser confocal scanning microscopy and special defect counting algorithms were used to assess the population of pits formed. Hardness measurements indicated that annealing for 2 hours at 800 C produced recovery, whereas annealing for 12 hours at 600 C did not, as is consistent with known changes for cavities annealed in a similar way. The 800 C anneal was effective in some cases but not others, and we discuss reasons why tendencies for pitting remain. We discuss implications for cavities and continued work to understand pitting.

  11. Improving the work function of the niobium surface of SRF cavities by plasma processing

    DOE PAGESBeta

    Tyagi, P. V.; Doleans, M.; Hannah, B.; Afanador, R.; McMahan, C.; Stewart, S.; Mammosser, J.; Howell, M.; Saunders, J.; Degraff, B.; et al

    2016-01-01

    An in situ plasma processing technique using chemically reactive oxygen plasma to remove hydrocarbons from superconducting radio frequency cavity surfaces at room temperature was developed at the spallation neutron source, at Oak Ridge National Laboratory. To understand better the interaction between the plasma and niobium surface, surface studies on small samples were performed. In this article, we report the results from those surface studies. The results show that plasma processing removes hydrocarbons from top surface and improves the surface work function by 0.5₋1.0 eV. Improving the work function of RF surface of cavities can help to improve their operational performance.

  12. Improving the work function of the niobium surface of SRF cavities by plasma processing

    NASA Astrophysics Data System (ADS)

    Tyagi, P. V.; Doleans, M.; Hannah, B.; Afanador, R.; McMahan, C.; Stewart, S.; Mammosser, J.; Howell, M.; Saunders, J.; Degraff, B.; Kim, S.-H.

    2016-04-01

    An in situ plasma processing technique using chemically reactive oxygen plasma to remove hydrocarbons from superconducting radio frequency cavity surfaces at room temperature has been developed at the spallation neutron source, at Oak Ridge National Laboratory. To understand better the interaction between the plasma and niobium surface, surface studies on small samples were performed. In this article, we report the results from those surface studies. The results show that plasma processing removes hydrocarbons from top surface and improves the surface work function by 0.5-1.0 eV. Improving the work function of RF surface of cavities can help to improve their operational performance.

  13. OPTIMIZATION OF THE SRF CAVITY DESIGN FOR THE CEBAF 12 GEV UPGRADE

    SciTech Connect

    Charles Reece; Edward Daly; James Henry; William Hicks; Joseph Preble; Haipeng Wang; Genfa Wu

    2008-02-12

    Based on initial testing of the “HG” and “LL” 7-cell cavities in the prototype cryomodule Renascence, several opportunities for improved optimization were identified. The HOM damping configuration was refined so as to meet the requirements for damping key dipole modes while simultaneously dramatically reducing risk of HOM pickup probe heating and also creating beamline clearance for mounting the tuner to stainless steel helium vessel endplates (rather than NbTi/Ti transitions to a titanium helium vessel). Code modeling and bench measurements were performed. The new design maintains the 7-cell LL cells and incorporates a brazed transition between Nb and the SS helium vessel. The resulting configuration is now called the “C100” design. Cavity design details as well as vertical dewar and horizontal test bed performance are presented.

  14. RHIC performance with 56 MHz RF and gold ion beams pre-cooled at lower energy

    SciTech Connect

    Fedotov,A.

    2008-10-01

    Presently there is an R&D ERL under construction at Collider-Accelerator Department (CAD) at BNL with its commissioning scheduled for FY09-10 [1]. The use of this full energy 21 MeV ERL in RHIC tunnel was recently proposed for a Proof-of-Principle demonstration of Coherent Electron Cooling of gold ions at 40 GeV/nucleon [2]. The purpose of this Note is to summarize numerical studies aimed at understanding the potential improvement of RHIC luminosity by using this R&D ERL for pre-cooling of Au ion beams with conventional electron cooling system at 40 GeV/nucleon. The constraints were such that electron beam parameters should be close to those expected from R&D ERL. Additionally, the cooling section in RHIC should not require major RHIC modification. As a result of these studies it was found that pre-cooling of gold ion at about 40 GeV/nucleon approximately doubles the average store luminosity of RHIC at top energy of 100 GeV/nucleon compared to the expected luminosity improvement with 56MHz RF upgrade [3, 4]. Significant luminosity improvement may be also gained on top of future expected luminosity performance with combined upgrades of 56MHz RF and all-plane stochastic cooling system with present beam parameters [5]. The electron beam parameters needed for such pre-cooling (see Table 1) are close to those expected from the R&D ERL which is presently under construction at BNL. With electron beam parameters from Table 1 it takes about 20 minutes to cool the transverse emittance of gold ions by a factor of two at 40 GeV/nucleon. Similar studies were done for protons as well. However, it was found that the electron beam parameters needed for pre-cooling of protons would require a significant upgrade of the present injector of the R&D ERL. Thus, discussion about protons is omitted from the present Note.

  15. Plastic circuits and tags for 13.56 MHz radio-frequency communication

    NASA Astrophysics Data System (ADS)

    Myny, Kris; Steudel, Soeren; Vicca, Peter; Beenhakkers, Monique J.; van Aerle, Nick A. J. M.; Gelinck, Gerwin H.; Genoe, Jan; Dehaene, Wim; Heremans, Paul

    2009-12-01

    We discuss the design and implementation of 64-bit and 128-bit plastic transponder chips for radio-frequency identification tags. The 64-bit chips, comprising 414 organic thin-film transistors, are integrated into fully functional plastic radio-frequency identification tags with 13.56 MHz communication. The required supply voltage on the tag is generated from the AC input signal detected by the antenna, using a plastic double half-wave rectifier circuit. The tag is fully functional at a magnetic field strength of 1.26 A/m, which is below the minimum required radio-frequency magnetic field stated in the standards. We discuss the reading distance that can be achieved with our plastic rectifiers, and show that this reading distance is not limited by the performance of the plastic rectifier or transponder chip. The 128-bit transponder chip includes further features such as Manchester data encoding and a basic ALOHA anti-collision protocol. It employs 1286 organic thin-film transistors and generates the 128 bit sequence at 24 V supply voltage at a data rate of 1.5 kb/s. Data rates up to 2 kb/s could be achieved on chips with an 8-bit transponder chip.

  16. FAST TRACK COMMUNICATION: Asymmetric surface barrier discharge plasma driven by pulsed 13.56 MHz power in atmospheric pressure air

    NASA Astrophysics Data System (ADS)

    Dedrick, J.; Boswell, R. W.; Charles, C.

    2010-09-01

    Barrier discharges are a proven method of generating plasmas at high pressures, having applications in industrial processing, materials science and aerodynamics. In this paper, we present new measurements of an asymmetric surface barrier discharge plasma driven by pulsed radio frequency (rf 13.56 MHz) power in atmospheric pressure air. The voltage, current and optical emission of the discharge are measured temporally using 2.4 kVp-p (peak to peak) 13.56 MHz rf pulses, 20 µs in duration. The results exhibit different characteristics to plasma actuators, which have similar discharge geometry but are typically driven at frequencies of up to about 10 kHz. However, the electrical measurements are similar to some other atmospheric pressure, rf capacitively coupled discharge systems with symmetric electrode configurations and different feed gases.

  17. Survey of SRF guns

    SciTech Connect

    Belomestnykh, S.

    2011-07-25

    Developing Superconducting RF (SRF) electron guns is an active field with several laboratories working on different gun designs. While the first guns were based on elliptic cavity geometries, Quarter Wave Resonator (QWR) option is gaining popularity. QWRs are especially well suited for producing beams with high charge per bunch. In this talk we will describe recent progress in developing both types of SRF guns. SRF guns made excellent progress in the last two years. Several guns generated beams and one, at HZDR, injected beam into an accelerator. By accomplishing this, HZDR/ELBE gun demonstrated feasibility of the SRF gun concept with a normal-conducting Cs{sub 2}Te cathode. The cathode demonstrated very good performance with the lifetime of {approx}1 year. However, for high average current/high bunch charge operation CsK{sub 2}Sb is preferred as it needs green lasers, unlike UV laser for the Cs{sub 2}Te, which makes it easier to build laser/optics systems. Other high QE photocathodes are being developed for SRF guns, most notably diamond-amplified photocathode. Several QWR guns are under development with one producing beam already. They are very promising for high bunch charge operation. The field is very active and we should expect more good results soon.

  18. An Analysis of the Temperature and Field Dependence of the RF Surface Resistance of Nitrogen-Doped Niobium SRF Cavities with Respect to Existing Theoretical Models

    SciTech Connect

    Reece, Charles E.; Palczewski, Ari D.; Xiao, Binping

    2015-09-01

    Recent progress with the reduction of rf surface resistance (Rs) of niobium SRF cavities via the use of high temperature surface doping by nitrogen has opened a new regime for energy efficient accelerator applications. For particular doping conditions one observes dramatic decreases in Rs with increasing surface magnetic fields. The observed variations as a function of temperature may be analyzed in the context of recent theoretical treatments in hopes of gaining insight into the underlying beneficial mechanism of the nitrogen treatment. Systematic data sets of Q0 vs. Eacc vs. temperature acquired during the high Q0 R&D work of the past year will be compared with theoretical model predictions..

  19. Additive manufacturing method for SRF components of various geometries

    DOEpatents

    Rimmer, Robert; Frigola, Pedro E; Murokh, Alex Y

    2015-05-05

    An additive manufacturing method for forming nearly monolithic SRF niobium cavities and end group components of arbitrary shape with features such as optimized wall thickness and integral stiffeners, greatly reducing the cost and technical variability of conventional cavity construction. The additive manufacturing method for forming an SRF cavity, includes atomizing niobium to form a niobium powder, feeding the niobium powder into an electron beam melter under a vacuum, melting the niobium powder under a vacuum in the electron beam melter to form an SRF cavity; and polishing the inside surface of the SRF cavity.

  20. Fully Roll-to-Roll Gravure Printable Wireless (13.56 MHz) Sensor-Signage Tags for Smart Packaging

    NASA Astrophysics Data System (ADS)

    Kang, Hwiwon; Park, Hyejin; Park, Yongsu; Jung, Minhoon; Kim, Byung Chul; Wallace, Gordon; Cho, Gyoujin

    2014-06-01

    Integration of sensing capabilities with an interactive signage through wireless communication is enabling the development of smart packaging wherein wireless (13.56 MHz) power transmission is used to interlock the smart packaging with a wireless (13.56 MHz) reader or a smart phone. Assembly of the necessary componentry for smart packaging on plastic or paper foils is limited by the manufacturing costs involved with Si based technologies. Here, the issue of manufacturing cost for smart packaging has been obviated by materials that allow R2R (roll-to-roll) gravure in combination with R2R coating processes to be employed. R2R gravure was used to print the wireless power transmission device, called rectenna (antenna, diode and capacitor), and humidity sensor on poly(ethylene terephtalate) (PET) films while electrochromic signage units were fabricated by R2R coating. The signage units were laminated with the R2R gravure printed rectenna and sensor to complete the prototype smart packaging.

  1. Fully roll-to-roll gravure printed rectenna on plastic foils for wireless power transmission at 13.56 MHz.

    PubMed

    Park, Hyejin; Kang, Hwiwon; Lee, Yonggil; Park, Yongsu; Noh, Jinsoo; Cho, Gyoujin

    2012-08-31

    Wireless power transmission to inexpensive and disposable smart electronic devices is one of the key issues for the realization of a ubiquitous society where sensor networks such as RFID tags, price tags, smart logos, signage and sensors could be fully interconnected and utilized by DC power of less than 0.3 W. This DC power can be provided by inductively coupled AC from a 13.56 MHz power transmitter through a rectenna, consisting of an antenna, a diode and a capacitor, which would be cheap to integrate with inexpensive smart electronic devices. To integrate the rectenna with a minimum cost, a roll-to-roll (R2R) gravure printing process has been considered to print the rectenna on plastic foils. In this paper, R2R gravure printing systems including printing condition and four different nanoparticle based inks will be reported to print the rectenna (antenna, diode and capacitor) on plastic foils at a printing speed of 8 m min(-1) and more than 90% device yield for a wireless power transmission of 0.3 W using a standard 13.56 MHz power transmitter. PMID:22885995

  2. Fully roll-to-roll gravure printable wireless (13.56 MHz) sensor-signage tags for smart packaging.

    PubMed

    Kang, Hwiwon; Park, Hyejin; Park, Yongsu; Jung, Minhoon; Kim, Byung Chul; Wallace, Gordon; Cho, Gyoujin

    2014-01-01

    Integration of sensing capabilities with an interactive signage through wireless communication is enabling the development of smart packaging wherein wireless (13.56 MHz) power transmission is used to interlock the smart packaging with a wireless (13.56 MHz) reader or a smart phone. Assembly of the necessary componentry for smart packaging on plastic or paper foils is limited by the manufacturing costs involved with Si based technologies. Here, the issue of manufacturing cost for smart packaging has been obviated by materials that allow R2R (roll-to-roll) gravure in combination with R2R coating processes to be employed. R2R gravure was used to print the wireless power transmission device, called rectenna (antenna, diode and capacitor), and humidity sensor on poly(ethylene terephtalate) (PET) films while electrochromic signage units were fabricated by R2R coating. The signage units were laminated with the R2R gravure printed rectenna and sensor to complete the prototype smart packaging. PMID:24953037

  3. SRF MATERIALS OTHER THAN NIOBIUM

    SciTech Connect

    Valente, Anne-Marie

    2008-02-12

    For the past three decades, bulk niobium has been the material of choice for SRF cavity applications. Alternative materials, mainly Nb compounds and A15 compounds have been investigated with moderate effort in the past. In the recent years, RF cavity performance has approached the theoretical limit for bulk niobium. For further improvement of RF cavity performance for future accelerator projects, research interest is renewed towards alternative materials to niobium. A few laboratories around the world are now investigating superconductors with higher transition temperature Tc for application to SRF cavities. This paper gives an overview of the results obtained and challenges encountered for Nb compounds and A15 compounds, as well as for MgB2, for SRF cavity applications. An interesting alternative has been recently proposed by Alex Gurevich with the Superconductor-Insulator-Superconductor multilayer approach. This could potentially lead to further improvement in RF cavity performance using the benefit of the higher critical field Hc of higher-Tc superconductors without being limited with their lower Hc1.

  4. Analysis of New High-Q0 SRF Cavity Tests by Nitrogen Gas Doping at Jefferson Lab

    SciTech Connect

    Palczewski, Ari D.; Geng, Rongli; Reece, Charles E.

    2014-12-01

    In order to refine systematic understanding and establish confident process control, Jefferson Lab has joined with partners to investigate and thoroughly characterize the dramatically higher Q0 of 1.3 GHz niobium cavities first reported by FNAL in 2013[1]. With partial support from the LCLS-II project, JLab has undertaken a parametric study of nitrogen doping in vacuum furnace at 800 °C followed by variable depth surface removal in the 5 - 20 μm range. Q0 above 3×1010 are typical at 2.0 K and 16 MV/m accelerating field. We report observations from the single cell study and current interpretations. In addition to the parametric single cell study, we also report on the ongoing serial testing of six nitrogen-doped 9-cell cavities as baseline prototypes for LCLS-II.

  5. Fabrication and Testing of the SRF cavities for the CEBAF 12 GeV Upgrade Prototype Cryomodule Renascence

    SciTech Connect

    C. E. Reece; E. F. Daly; S. Manning; R. Manus; S. Morgan; J. P. Ozelis; L. Turlington

    2005-05-01

    Twelve seven-cell niobium cavities for the CEBAF 12 GeV upgrade prototype cryomodule Renascence have been fabricated at JLab and tested individually. This set includes four of the ''Low Loss'' (LL) design and eight of the ''High Gradient'' (HG) design. The fabrication strategy was an efficient mix of batch job-shop component machining and in-house EBW, chemistry, and final-step machining to meet mechanical tolerances. Process highlights will be presented. The cavities have been tested at 2.07 K, the intended CEBAF operating temperature. Performance exceeded the tentative design requirement of 19.2 MV/m CW with less than 29 W dynamic heat dissipation. These results, as well as the HOM damping performance are presented.

  6. Fabrication and Testing of the SRF Cavities for the CEBAF 12 GeV Upgrade Prototype Cryomodule Renascence

    SciTech Connect

    Charles Reece; Edward Daly; Stephen Manning; Robert Manus; Samuel Morgan; Joseph Ozelis; Larry Turlington

    2005-05-01

    Twelve seven-cell niobium cavities for the CEBAF 12 GeV upgrade prototype cryomodule Renascence have been fabricated at JLab and tested individually. This set includes four of the ''Low Loss'' (LL) design and eight of the ''High Gradient'' (HG) design. The fabrication strategy was an efficient mix of batch job-shop component machining and in-house EBW, chemistry, and final-step machining to meet mechanical tolerances. Process highlights will be presented. The cavities have been tested at 2.07 K, the intended CEBAF operating temperature. Performance exceeded the tentative design requirement of 19.2 MV/m cw with less than 29 W dynamic heat dissipation. These results, as well as the HOM damping performance will be presented.

  7. A Simple Ion Flux Estimation in a Low Pressure R.F. Plasma (13.56MHz)

    NASA Astrophysics Data System (ADS)

    Grenier, I.; Massereau, V.; Celerier, A.; Machet, J.

    1997-04-01

    A new application of the sputtering rate measurement is given in this paper. In fact, by measuring the sputtering rate of different materials fixed on the radio frequency (r.f.) biased electrode, it is possible to determine easily ion flux that falls onto this biased electrode. This study is realized in a low pressure (0.4 Pa) argon planar r.f. discharge system (13.56 MHz). This sputtering method is interesting to have informations about the deposition process in physical vapour deposition. In order to demonstrate the validity of this method, experiments have been carried out in two reactors, each one with different geometrical parameters and the results obtained have been compared and confirmed using the Child-Langmuir law. The ion flux increases as a function of the incident r.f power (0 300 W). The values obtained range from 10^{18} to 10^{19} ions m^{-2} s^{-1}. These results in an argon plasma are applied to estimate incident ion flux in a nitrogen atmosphere. Finally, we show that it is possible to evaluate the incident ion flux by measuring the sputtering rate when the plasma is densified using either an auxiliary hot cathode discharge or an additional magnetic field. These experimental cases correspond respectively to r.f. triode ion plating or r.f. magnetron sputtering.

  8. Diagnostics of low-pressure hydrogen discharge created in a 13.56 MHz RF plasma reactor

    NASA Astrophysics Data System (ADS)

    Krištof, J.; Annušová, A.; Anguš, M.; Veis, P.; Yang, X.; Angot, T.; Roubin, P.; Cartry, G.

    2016-07-01

    A 13.56 MHz RF discharge in hydrogen was studied within the pressure range of 1–10 Pa, and at a power range of 400–1000 W. The electron energy distribution function and electron density were measured by a Langmuir probe. The gas temperature was determined by the Fulcher-α system in pure H2, and by the second positive system of nitrogen using N2 as the probing gas. The gas temperature was constant and equal to 450 ± 50 K in the capacitively coupled plasma (CCP) mode, and it increased with pressure and power in the inductively coupled plasma (ICP) mode. Also, the vibrational temperature of the ground state of hydrogen molecules was determined to be around 3100 and 2000 ± 500 K in the ICP and CCP mode, respectively. The concentration of atomic hydrogen was determined by means of actinometry, either by using Ar (5%) as the probing gas, or by using H2 as the actinometer in pure hydrogen (Q1 rotational line of Fulcher-α system). The concentration of hydrogen density increased with pressure in both modes, but with a dissociation degree slightly higher in the ICP mode (a factor 2).

  9. Wisconsin SRF Electron Gun Commissioning

    SciTech Connect

    Bisognano, Joseph J.; Bissen, M.; Bosch, R.; Efremov, M.; Eisert, D.; Fisher, M.; Green, M.; Jacobs, K.; Keil, R.; Kleman, K.; Rogers, G.; Severson, M.; Yavuz, D. D.; Legg, Robert A.; Bachimanchi, Ramakrishna; Hovater, J. Curtis; Plawski, Tomasz; Powers, Thomas J.

    2013-12-01

    The University of Wisconsin has completed fabrication and commissioning of a low frequency (199.6 MHz) superconducting electron gun based on a quarter wave resonator (QWR) cavity. Its concept was optimized to be the source for a CW free electron laser facility. The gun design includes active tuning and a high temperature superconducting solenoid. We will report on the status of the Wisconsin SRF electron gun program, including commissioning experience and first beam measurements.

  10. Proton in SRF Niobium

    NASA Astrophysics Data System (ADS)

    Wallace, John Paul

    2011-03-01

    Hydrogen is a difficult impurity to physically deal with in superconducting radio frequency (SRF) niobium, therefore, its properties in the metals should be well understood to allow the metal's superconducting properties to be optimized for minimum loss in the construction of resonant accelerator cavities. It is known that hydrogen is a paramagnetic impurity in niobium from NMR studies. This paramagnetism and its effect on superconducting properties are important to understand. To that end analytical induction measurements aimed at isolating the magnetic properties of hydrogen in SRF niobium are introduced along with optical reflection spectroscopy which is also sensitive to the presence of hydrogen. From the variety, magnitude and rapid kinetics found in the optical and magnetic properties of niobium contaminated with hydrogen forced a search for an atomic model. This yielded quantum mechanical description that correctly generates the activation energy for diffusion of the proton and its isotopes not only in niobium but the remaining metals for which data is available. This interpretation provides a frame work for understanding the individual and collective behavior of protons in metals.

  11. Proton in SRF Niobium

    SciTech Connect

    Wallace, John Paul

    2011-03-31

    Hydrogen is a difficult impurity to physically deal with in superconducting radio frequency (SRF) niobium, therefore, its properties in the metals should be well understood to allow the metal's superconducting properties to be optimized for minimum loss in the construction of resonant accelerator cavities. It is known that hydrogen is a paramagnetic impurity in niobium from NMR studies. This paramagnetism and its effect on superconducting properties are important to understand. To that end analytical induction measurements aimed at isolating the magnetic properties of hydrogen in SRF niobium are introduced along with optical reflection spectroscopy which is also sensitive to the presence of hydrogen. From the variety, magnitude and rapid kinetics found in the optical and magnetic properties of niobium contaminated with hydrogen forced a search for an atomic model. This yielded quantum mechanical description that correctly generates the activation energy for diffusion of the proton and its isotopes not only in niobium but the remaining metals for which data is available. This interpretation provides a frame work for understanding the individual and collective behavior of protons in metals.

  12. First beam commissioning at BNL ERL SRF Gun

    SciTech Connect

    Xu, W.; Altinbas, Z.; Belomestnykh, S.; Ben-Zvi, I.; Deonarine, S.; DeSanto, L.; Gassner, D.; Gupta, R. C.; Hahn, H.; Hammons, L.; Ho, C.; Jamilkoski, J.; Kankiya, P.; Kayran, D.; Kellerman, R.; Laloudakis, N.; Lambiase, R.; Liaw, C.; Litvinenko, V.; Mahler, G.; Masi, L.; McIntyre, G.; Miller, T.; Philips, D.; Ptitsyn, V.; Seda, T.; Sheehy, B.; Smith, K.; Rao, T.; Steszyn, A.; Tallerico, T.; Than, R.; Tuozollo, J.; Wang, E.; Weiss, D.; Wiliniski, M.; Zaltsman, A.

    2015-05-03

    The 704 MHz SRF gun successfully generated the first photoemission beam in November of 2014. The configurations of the test and the sub-systems are described.The latest results of SRF commissioning, including the cavity performance, cathode QE measurements, beam current/energy measurements, are presented in the paper.

  13. SRF and RF systems for LEReC Linac

    SciTech Connect

    Belomestnykh, S.; Ben-Zvi, I.; Brutus, J. C.; Fedotov, A.; McIntyre, G.; Polizzo, S.; Smith, K.; Than, R.; Tuozzolo, J.; Veshcherevich, V.; Wu, Q.; Xiao, B.; Xu, W.; Zaltsman, A.

    2015-05-03

    The Low Energy RHIC electron Cooling (LEReC) is under development at BNL to improve RHIC luminosity at low energies. It will consist of a short electron linac and two cooling sections, one for blue and one for yellow rings. For the first stage of the project, LEReC-I, we will install a 704 MHz superconducting RF cavity and three normal conducting cavities operating at 9 MHz, 704 MHz and 2.1 GHz. The SRF cavity will boost the electron beam energy up to 2 MeV. The warm cavities will be used to correct the energy spread introduced in the SRF cavity. The paper describes layouts of the SRF and RF systems, their parameters and status.

  14. Construction of a transversely excited slow axial flow radio-frequency CO2 laser at 13.56 MHz

    NASA Astrophysics Data System (ADS)

    Al-Hawat, Sharif; Shihada, Sami

    2015-06-01

    We have built a radio frequency (RF) excited CO2 laser and characterized it. The output power versus the gas mixture pressure and the RF input power are studied experimentally at different ratios of gas mixture CO2:N2:He. The discharge cavity is constructed by four copper electrodes in two coaxially ceramic tubes. Operational characteristics of this laser are described along with the experimental findings. Three sets of resonators with different reflectivities of mirrors were used, and a maximum laser output power of 30 W was obtained at 72 mbar pressure of gas mixture with the ratio of CO2:N2:He=1:3:5, and 500 W as an input power. An explanation of our particular results and supporting experimental evidence are given. The measured and calculated laser output powers versus the input RF power at 84 mbar pressure of gas mixture with ratio of CO2:N2:He=1:8:5 were compared and a good agreement was observed. Also, the measured output power versus rms RF current at these conditions was compared with the results of RF CO2 laser of other works; the general behavior was almost similar.

  15. The effects of neutral gas heating on H mode transition and maintenance currents in a 13.56 MHz planar coil inductively coupled plasma reactor

    SciTech Connect

    Jayapalan, Kanesh K.; Chin, Oi-Hoong

    2012-09-15

    The H mode transition and maintenance currents in a 13.56 MHz laboratory 6 turn planar coil inductively coupled plasma (ICP) reactor are simulated for low pressure argon discharge range of 0.02-0.3 mbar with neutral gas heating and at ambient temperature. An experimentally fitted 3D power evolution plot for 0.02 mbar argon pressure is also shown to visualize the effects of hysteresis in the system. Comparisons between simulation and experimental measurements show good agreement in the pressure range of 0.02-0.3 mbar for transition currents and 0.02-0.1 mbar for maintenance currents only when neutral gas heating is considered. This suggests that neutral gas heating plays a non-negligible role in determining the mode transition points of a rf ICP system.

  16. Operational Experience with the Nb/Pb SRF Photoelectron Gun

    SciTech Connect

    Kamps, T; Barday, R; Jankowiak, A; Knoblock, J; Kugeler, O; Matveenko, A N; Neumann, A; Quast, T; Rudolph, J; Schubert, S G; Volker, J; Kneisel, P; Nietubyc, R; Sekutowicz, J K; Smedley, J; Teichert, J; Volkov, V; Will, I

    2012-07-01

    SRF photoelectron guns offer the promise of high brightness, high average current beam production for the next generation of accelerator driven light sources such as free electron lasers, THz radiation sources or energy-recovery linac driven synchrotron radiation sources. In a first step a fully superconducting RF (SRF) photoelectron gun is under development by a collaboration between HZB, DESY, JLAB, BNL and NCBJ. The aim of the experiment is to understand and improve the performance of a Nb SRF gun cavity coated with a small metallic Pb cathode film on the cavity backplane. This paper describes the highlights from the commissioning and beam parameter measurements. The main focus is on lessons learned from operation of the SRF gun.

  17. Quench studies of ILC cavities

    SciTech Connect

    Eremeev, Grigory; Geng, Rongli; Palczewski, Ari; Dai, Jin

    2011-07-01

    Quench limits accelerating gradient in SRF cavities to a gradient lower than theoretically expected for superconducting niobium. Identification of the quenching site with thermometry and OST, optical inspection, and replica of the culprit is an ongoing effort at Jefferson Lab aimed at better understanding of this limiting phenomenon. In this contribution we present our finding with several SRF cavities that were limited by quench.

  18. Overview of SRF-related Activities at Jefferson Lab

    SciTech Connect

    Charles Reece

    2001-09-01

    SRF-related activities at JLab are varied and increasing. Operation of CEBAF at 5.7 GeV for nuclear physics is now routine. There has been significant progress in the development and testing of components and subsystems for a new cryomodule design for coming upgrades of the JLab CEBAF and FEL. Construction of the first such module has begun, and further optimization studies continue. Jefferson Lab joined the collaboration to build the Spallation Neutron Source (SNS). JLab will contribute 81 cavities in 23 SNS cryomodules. Prototyping of the beta. 0.61 and 0.81 cavities is nearing completion. Development and testing of the high-power coaxial input coupler for SNS is underway. Fresh efforts have been initiated to pursue improved understanding and control of SRF surfaces. JLab has led discussions and development of modern low-level rf controls tailored for power-efficient operation of high-gradient SRF cavities in lightly-beamloaded, cw applications. To support these efforts, major upgrades and renovations to the JLab SRF facilities and information infrastructures are underway. The lab has recognized the importance of SRF to future developments in the accelerator community by the creation of the new Institute for SRF Science and Technology.

  19. Commissioning of the 112 MHz SRF Gun and 500 MHz bunching cavities for the CeC PoP Linac

    SciTech Connect

    Belomestnykh, S.; Ben-Zvi, I.; Brutus, J. C.; Litvinenko, V.; McIntosh, P.; Moss, A.; Narayan, G.; Orfin, P.; Pinayev, I.; Rao, T.; Skaritka, J.; Smith, K.; Than, R.; Tuozzolo, J.; Wang, E.; Wheelhouse, A.; Wu, Q.; Xiao, B.; Xin, T.; Xu, W.; Zaltsman, A.

    2015-05-03

    The Coherent electron Cooling Proof-of-Principle (CeC PoP) experiment at BNL includes a short electron linac. During Phase 1, a 112 MHz superconducting RF photo-emission gun and two 500 MHz normal conducting bunching cavities were installed and are under commissioning. The paper describes the Phase1 linac layout and presents commissioning results for the cavities and associated RF, cryogenic and other sub-systems

  20. Preparation and characterization of ferrite with Co substituted NiCuZn sheets application for 13.56 MHz radio frequency identification communication

    NASA Astrophysics Data System (ADS)

    Yan, Shuoqing; Liu, Weihu; Chen, Zhongyan; Nie, Yan; Wang, Xian; Feng, Zekun

    2014-05-01

    The electromagnetic (EM) shielding sheets could be an effective solution to increase the detection distance of the RFID (Radio Frequency Identification) tags attached on metal. The eddy current induced on the metal surface can be reduced when a ferrite sheet sandwiched between RFID tag and metal. The magnetic spectra of Ni0.36Cu0.19Zn0.45Fe1.92O3.88 ferrite added with BiBSi-glass and CoO were investigated. It shows that the real part of permeability could reach above 150 while the imaginary part maintains below 2 at 13.56 MHz with 0.2 wt. % CoO and 0.4 wt. % BiBSi-glass doping content. The ferrites could be fabricated as EM shielding sheets by laminate process. The experimental results show that the doped ferrites could be a good candidate for EM shielding sheet. The final sheet size could be as large as 135 mm × 135 mm while the thickness is 0.1 mm and the density is above 5.0 g/cm3. By inserting the EM shielding sheet between the RFID antenna and metal surface, the improved communication performances are characterized and corresponding explanation is given.

  1. Design, fabrication, and test of an SRF cryomodule prototype at Fermilab

    SciTech Connect

    Soyars, W.; Darve, C.; Nicol, T.; Rowe, A.; /Fermilab

    2006-01-01

    In support of the Charged Kaons at the Main Injector (CKM) experiment [1], an SRF cryomodule was designed, assembled, and tested at Fermilab. The cryomodule prototype consists of a single niobium 13-cell 3.9 GHz superconducting RF cavity installed in its horizontal cryostat. The prototype was simplified to hold an additional dummy cavity in place of a second 13-cell SRF cavity. Although this cryomodule was originally intended for beamline deflection in the CKM experiment, this first preliminary test aims to compliment existing vertical 3-cell 3.9 GHz SRF cavity testing and also to gain expertise in the field of SRF testing. The cryomodule's thermal and mechanical design is reported. The test process and instrumentation is described. The first operational cooldown with RF powering is discussed and some cryogenic results are given.

  2. The polarized SRF gun experiment.

    SciTech Connect

    Kewisch,J.; Ben-Zvi, I.; Rao, T.; Burrill, A.; Pate, D.; Grover, R.; Todd, R.; Bluem, H.; Holmes, D.; Schultheiss, T.

    2007-09-10

    RF electron guns are capable of producing electron bunches with high brightness, which outperform DC electron guns and may even be able to provide electron beams for the ILC without the need for a damping ring. However, all successful existing guns for polarized electrons are DC guns because the environment inside an RF gun is hostile to the GaAs cathode material necessary for polarization. While the typical vacuum pressure in a DC gun is better than 10{sup -11} torr the vacuum in an RF gun is in the order of 10{sup -9} torr. Experiments at BINP Novosibirsk show that this leads to strong ion back-bombardment and generation of dark currents, which destroy the GaAs cathode in a short time. The situation might be much more favorable in a (super-conducting) SRF gun. The cryogenic pumping of the gun cavity walls may make it possible to maintain a vacuum close to 10{sup -12} torr, solving the problem of ion bombardment and dark currents. Of concern would be contamination of the gun cavity by evaporating cathode material. This report describes an experiment that Brookhaven National Laboratory (BNL) in collaboration with Advanced Energy Systems (AES) is conducting to answer these questions.

  3. BNL 703 MHz SRF cryomodule demonstration

    SciTech Connect

    Burrill,A.; Ben-Zvi, I.; Calaga, R.; Dalesio, L.; Dottavio, T.; Gassner, D.; Hahn, H.; Hoff, L.; Kayran, D.; Kewisch, J.; Lambiase, R.; Lederle, d.; Litvinenko, v.; Mahler, G.; McIntyre, G.; et al.

    2009-05-04

    This paper will present the preliminary results of the testing of the 703 MHz SRF cryomodule designed for use in the ampere class ERL under construction at Brookhaven National Laboratory. The preliminary cavity tests, carried out at Thomas Jefferson Laboratory, demonstrated cavity performance of 20 MV/m with a Qo of 1 x 10{sup 10}, results we expect to reproduce in the horizontal configuration. This test of the entire string assembly will allow us to evaluate all of the additional cryomodule components not previously tested in the VTA and will prepare us for our next milestone test which will be delivery of electrons from our injector through the cryomodule to the beam dump. This will also be the first demonstration of an accelerating cavity designed for use in an ampere class ERL, a key development which holds great promise for future machines.

  4. High Power Co-Axial SRF Coupler

    SciTech Connect

    M.L. Neubauer, R.A. Rimmer

    2009-05-01

    There are over 35 coupler designs for SRF cavities ranging in frequency from 325 to 1500 MHz. Two-thirds of these designs are coaxial couplers using disk or cylindrical ceramics in various combinations and configurations. While it is well known that dielectric losses go down by several orders of magnitude at cryogenic temperatures, it not well known that the thermal conductivity also goes down, and it is the ratio of thermal conductivity to loss tangent (SRF ceramic Quality Factor) and ceramic volume which will determine the heat load of any given design. We describe a novel robust co-axial SRF coupler design which uses compressed window technology. This technology will allow the use of highly thermally conductive materials for cryogenic windows. The mechanical designs will fit into standard-sized ConFlat® flanges for ease of assembly. Two windows will be used in a coaxial line. The distance between the windows is adjusted to cancel their reflections so that the same window can be used in many different applications at various frequencies.

  5. Laser polishing of niobium for SRF applications

    SciTech Connect

    Zhao, Liang; Klopf, J. Michael; Reece, Charles E.; Kelley, Michael

    2013-09-01

    Smooth interior surfaces are desired for niobium SRF cavities, now obtained by buffered chemical polish (BCP) and/or electropolish (EP). Laser polishing is a potential alternative, having advantages of speed, freedom from chemistry and in-process inspection. Here we show that laser polishing can produce smooth topography with Power Spectral Density (PSD) measurements similar to that obtained by EP. We studied the influence of the laser power density and laser beam raster rate on the surface topography. These two factors need to be combined carefully to smooth the surface without damaging it. Computational modeling was used to simulate the surface temperature and explain the mechanism of laser polishing.

  6. Multipacting simulation and test results of BNL 704 MHz SRF gun

    SciTech Connect

    Xu W.; Belomestnykh, S.; Ben-Zvi, I.; Cullen, C. et al

    2012-05-20

    The BNL 704MHz SRF gun has a grooved choke joint to support the photo-cathode. Due to the distortion of grooves at the choke joint during the BCP for the choke joint, several multipacting barriers showed up when it was tested with Nb cathode stalk at JLab. We built a setup to use the spare large grain SRF cavity to test and condition the multipacting at BNL with various power sources up to 50kW. The test is carried out in three stages: testing the cavity performance without cathode, testing the cavity with the Nb cathode stalk that was used at Jlab, and testing the cavity with a copper cathode stalk that is based on the design for the SRF gun. This paper summarizes the results of multipacting simulation, and presents the large grain cavity test setup and the test results.

  7. Cavities

    MedlinePlus

    ... The tooth may hurt even without stimulation (spontaneous toothache). If irreversible damage to the pulp occurs and ... To detect cavities early, a dentist inquires about pain, examines the teeth, probes the teeth with dental instruments, and may take x-rays. People should ...

  8. SRF photoinjector for proof-of-principle experiment of coherent electron cooling at RHIC

    SciTech Connect

    Kayran D.; Belomestnykh, S.; Ben-Zvi, I.; Brutus, J.C.; et al

    2012-05-20

    Coherent Electron Cooling (CEC) based on Free Electron Laser (FEL) amplifier promises to be a very good way to cool protons and ions at high energies. A proof of principle experiment to demonstrate cooling at 40 GeV/u is under construction at BNL. One of possible sources to provide sufficient quality electron beam for this experiment is a SRF photoinjector. In this paper we discuss design and simulated performance of the photoinjector based on existing 112 MHz SRF gun and newly designed single-cavity SRF linac operating at 704 MHz.

  9. Effects Of Pressure And Power On The Ionic Saturation Current And Self-Bias Voltage In A RF Discharge 13.56 MHz Of (SF{sub 6}, O{sub 2}) At Low Pressure

    SciTech Connect

    Alim, M. M.; Zekara, M.; Henni, L.; Tadjine, R.; Lahmar, E.; Henda, K.

    2008-09-23

    In the present work, we are interested in RF plasma discharge for surface texturing in solar cells application. We then present the results of the electrical characterization of plasma reactor at low pressure (<1 Torr) in (SF{sub 6},O{sub 2}) gases mixtures at 13.56 MHz. We've particularly followed the self-bias voltage (V{sub DC}) and the density of ionic current saturation (J{sub s}) depending in various parameters of the discharge as pressure and power.

  10. World-Wide Experience with SRF Facilities

    SciTech Connect

    Andrew Hutton, Adam Carpenter

    2011-03-01

    The speaker will review and analyze the performance of existing SRF facilities in the world, addressing issues of usage and availability for different customers (HEP research, material sciences, ADS). Lessons learned should be summarized for proposed future facilities (ILC, Project X, Muon Collider). The first use of superconducting cavities for accelerating beams was at HEPL, Stanford University in the early sixties. Rather quickly, other laboratories followed suit, notably the University of Illinois at Champagne, Urbana and Cornell University. There were two main uses, which still persist today. The first is to provide accelerated particles as an injector or for fixed target experiments. The second is to maintain circulating beams, either for synchrotron light sources or for colliding beam experiments. Given the differing requirements, these two uses led to rather different implementations and, in particular, different average operating gradients. A second difference in the implementation is the speed of the particle being accelerated. Electrons are sufficiently relativistic at low beam energies (> {approx} 5 MeV) that cavities designed for relativistic beams can also function acceptably at low energy. This is not the case for protons or ion accelerators so, until recently, copper cavities were used to cover the first {approx} 100 MeV. Superconducting cavities are now also being proposed to cover this energy range as well using a series of superconducting cavities, each of which is matched to the particle velocity.

  11. Superconducting Storage Cavity for RHIC

    SciTech Connect

    Ben-Zvi,I.

    2009-01-02

    This document provides a top-level description of a superconducting cavity designed to store hadron beams in the Relativistic Heavy Ion Collider (RHIC) at Brookhaven National Laboratory. It refers to more detailed documents covering the various issues in designing, constructing and operating this cavity. The superconducting storage cavity is designed to operate at a harmonic of the bunch frequency of RHIC at a relatively low frequency of 56 MHz. The current storage cavities of RHIC operate at 197 MHz and are normal-conducting. The use of a superconducting cavity allows for a high gap voltage, over 2 MV. The combination of a high voltage and low frequency provides various advantages stemming from the resulting large longitudinal acceptance bucket.

  12. Thermodynamic Evaluation of Hydrogen Absorption by Niobium During SRF Fabrication

    SciTech Connect

    Ricker, R. E.; Myneni, G. R.

    2011-03-31

    The properties and performance of the ultra high purity Nb used to fabricate superconducting radio frequency (SRF) particle accelerator cavities have been found to vary with processing conditions. One hypothesis for these variations is that hydrogen, absorbed during processing, is responsible for this behavior. The key assumption behind this hypothesis is that niobium can absorb hydrogen from one or more of the processing environments. This paper reviews work examining the validity of this assumption. It was determined that Nb will spontaneously react with water producing adsorbed atomic hydrogen that is readily absorbed into the metal. The passivating oxide film normally prevents this reaction, but this film is frequently removed during processing and it is attacked by the fluoride ion used in the polishing solutions for SRF cavities. However, during electropolishing that cathodic reduction of hydrogen is transferred to the auxiliary electrode and this should suppress hydrogen absorption.

  13. Thermodynamic Evaluation of Hydrogen Absorption by Niobium During SRF Fabrication

    SciTech Connect

    R.E. Ricker, G.R. Myneni

    2011-03-01

    The properties and performance of the ultra high purity Nb used to fabricate superconducting radio frequency (SRF) particle accelerator cavities have been found to vary with processing conditions. One hypothesis for these variations is that hydrogen, absorbed during processing, is responsible for this behavior. The key assumption behind this hypothesis is that niobium can absorb hydrogen from one or more of the processing environments. This paper reviews work examining the validity of this assumption. It was determined that Nb will spontaneously react with water producing adsorbed atomic hydrogen that is readily absorbed into the metal. The passivating oxide film normally prevents this reaction, but this film is frequently removed during processing and it is attacked by the fluoride ion used in the polishing solutions for SRF cavities. However, during electropolishing that cathodic reduction of hydrogen is transferred to the auxiliary electrode and this should suppress hydrogen absorption.

  14. Parameter Optimization for Laser Polishing of Niobium for SRF Applications

    SciTech Connect

    Zhao, Liang; Klopf, John Michael; Reece, Charles E.; Kelley, Michael J.

    2013-06-01

    Surface smoothness is critical to the performance of SRF cavities. As laser technology has been widely applied to metal machining and surface treatment, we are encouraged to use it on niobium as an alternative to the traditional wet polishing process where aggressive chemicals are involved. In this study, we describe progress toward smoothing by optimizing laser parameters on BCP treated niobium surfaces. Results shows that microsmoothing of the surface without ablation is achievable.

  15. RF Input Power Couplers for High Current SRF Applications

    SciTech Connect

    Khan, V. F.; Anders, W.; Burrill, Andrew; Knobloch, Jens; Kugeler, Oliver; Neumann, Axel; Wang, Haipeng

    2014-12-01

    High current SRF technology is being explored in present day accelerator science. The bERLinPro project is presently being built at HZB to address the challenges involved in high current SRF machines with the goal of generating and accelerating a 100 mA electron beam to 50 MeV in continuous wave (cw) mode at 1.3 GHz. One of the main challenges in this project is that of handling the high input RF power required for the photo-injector as well as booster cavities where there is no energy recovery process. A high power co-axial input power coupler is being developed to be used for the photo-injector and booster cavities at the nominal beam current. The coupler is based on the KEK–cERL design and has been modified to minimise the penetration of the coupler tip in the beam pipe without compromising on beam-power coupling (Qext ~105). Herein we report on the RF design of the high power (115 kW per coupler, dual couplers per cavity) bERLinPro (BP) coupler along with initial results on thermal calculations. We summarise the RF conditioning of the TTF-III couplers (modified for cw operation) performed in the past at BESSY/HZB. A similar conditioning is envisaged in the near future for the low current SRF photo-injector and the bERLinPro main linac cryomodule.

  16. Optimization of SRF Linacs

    SciTech Connect

    Powers, Tom

    2013-09-01

    This work describes preliminary results of a new software tool that allows one to vary parameters and understand the effects on the optimized costs of construction plus 10 year operations of an SRF linac, the associated cryogenic facility, and controls, where operations includes the cost of the electrical utilities but not the labor or other costs. It derives from collaborative work done with staff from Accelerator Science and Technology Centre, Daresbury, UK several years ago while they were in the process of developing a conceptual design for the New Light Source project.[1] The initial goal was to convert a spread sheet format to a graphical interface to allow the ability to sweep different parameter sets. The tools also allow one to compare the cost of the different facets of the machine design and operations so as to better understand the tradeoffs. The work was first published in an ICFA Beam Dynamics News Letter.[2] More recent additions to the software include the ability to save and restore input parameters as well as to adjust the Qo versus E parameters in order to explore the potential costs savings associated with doing so. Additionally, program changes now allow one to model the costs associated with a linac that makes use of energy recovery mode of operation.

  17. The New 2nd-Generation SRF R&D Facility at Jefferson Lab: TEDF

    SciTech Connect

    Reece, Charles E.; Reilly, Anthony V.

    2012-09-01

    The US Department of Energy has funded a near-complete renovation of the SRF-based accelerator research and development facilities at Jefferson Lab. The project to accomplish this, the Technical and Engineering Development Facility (TEDF) Project has completed the first of two phases. An entirely new 3,100 m{sup 2} purpose-built SRF technical work facility has been constructed and was occupied in summer of 2012. All SRF work processes with the exception of cryogenic testing have been relocated into the new building. All cavity fabrication, processing, thermal treatment, chemistry, cleaning, and assembly work is collected conveniently into a new LEED-certified building. An innovatively designed 800 m2 cleanroom/chemroom suite provides long-term flexibility for support of multiple R&D and construction projects as well as continued process evolution. The characteristics of this first 2nd-generation SRF facility are described.

  18. A high-brightness SRF photoelectron injector for FEL light sources

    NASA Astrophysics Data System (ADS)

    Arnold, A.; Büttig, H.; Janssen, D.; Kamps, T.; Klemz, G.; Lehmann, W. D.; Lehnert, U.; Lipka, D.; Marhauser, F.; Michel, P.; Möller, K.; Murcek, P.; Schneider, Ch.; Schurig, R.; Staufenbiel, F.; Stephan, J.; Teichert, J.; Volkov, V.; Will, I.; Xiang, R.

    2008-08-01

    Most of the proposed electron accelerator projects for future FELs, ERLs or 4th generation light sources require electron beams with an unprecedented combination of high brightness, low emittance, and high average current. In all projects photoguns will be applied: DC-photoguns, normal conducting RF-photoguns (NC-guns), and superconducting RF photoguns (SRF-guns). While the concepts of DC- and NC-guns are well proofed, the SRF-gun development still possesses a high risk. Challenges are the design of the superconducting cavity, the choice of the photocathode type, its life time, a possible cavity contamination, the difficulty of coupling high average power into the gun, and, finally, the risk of beam excitation of higher-order cavity modes. In combination with SRF linacs, the SRF-guns seem to be the best solution for high average currents. Several R&D projects of SRF-gun have been launched. In this paper, we will give an overview of the progress of the SRF photoinjector development. In detail, the technical concept, the performance and the status of the Dresden Rossendorf SRF-gun project, a collaboration of BESSY, DESY, MBI and FZD, will be presented. The main design parameters of this SRF-gun are the final electron energy of 9.5 MeV, 1 mA average current, and transverse normalized emittances (rms) of 1 mm mrad at 77 pC and 2.5 mm mrad at 1 nC bunch charge. The 1.3 GHz cavity consists of three TESLA-shaped cells, a specially designed half-cell where the photocathode is placed and a choke filter in order to prevent RF losses at the cathode side. The normal-conducting photocathode with a Cs 2Te photoemission layer is cooled by liquid nitrogen. The SRF-gun cryostat consists of a stainless steel vacuum vessel, a warm magnetic shield, a liquid nitrogen-cooled thermal shield and a titanium He tank with a two-phase supply tube. The 10 kW fundamental power coupler is adopted from the ELBE cryomodule. In a first commissioning and test period the gun will be operated in

  19. Fundamental Research in Superconducting RF Cavity Design

    SciTech Connect

    Georg Hoffstaetter

    2012-11-13

    This is a 3-year SRF R&D proposal with two main goals: 1) to benefit near term high gradient SRF applications by understanding the causes of quench at high fields in present-day niobium cavities 2) to open the long-range prospects for SRF applications by experimentally verifying the recent exciting theoretical predication for new cavity materials such as Nb3Sn and MgB2. These predictions shwo that ultimately gradients of 100Mv/m to 200MV/m may become possible as material imperfections are overcome.

  20. SRF niobium characterization using SIMS and FIB-TEM

    NASA Astrophysics Data System (ADS)

    Stevie, F. A.

    2015-12-01

    Our understanding of superconducting radio frequency (SRF) accelerator cavities has been improved by elemental analysis at high depth resolution and by high magnification microscopy. This paper summarizes the technique development and the results obtained on poly-crystalline, large grain, and single crystal SRF niobium. Focused ion beam made possible sample preparation using transmission electron microscopy and the images obtained showed a very uniform oxide layer for all samples analyzed. Secondary ion mass spectrometry indicated the presence of a high concentration of hydrogen and the hydrogen content exhibited a relationship with improvement in performance. Depth profiles of carbon, nitrogen, and oxygen did not show major differences with heat treatment. Niobium oxide less than 10 nm thick was shown to be an effective hydrogen barrier. Niobium with titanium contamination showed unexpected performance improvement.

  1. SRF niobium characterization using SIMS and FIB-TEM

    SciTech Connect

    Stevie, F. A.

    2015-12-04

    Our understanding of superconducting radio frequency (SRF) accelerator cavities has been improved by elemental analysis at high depth resolution and by high magnification microscopy. This paper summarizes the technique development and the results obtained on poly-crystalline, large grain, and single crystal SRF niobium. Focused ion beam made possible sample preparation using transmission electron microscopy and the images obtained showed a very uniform oxide layer for all samples analyzed. Secondary ion mass spectrometry indicated the presence of a high concentration of hydrogen and the hydrogen content exhibited a relationship with improvement in performance. Depth profiles of carbon, nitrogen, and oxygen did not show major differences with heat treatment. Niobium oxide less than 10 nm thick was shown to be an effective hydrogen barrier. Niobium with titanium contamination showed unexpected performance improvement.

  2. R&D ERL: SRF Electron Gun

    SciTech Connect

    Burrill, A.

    2010-01-01

    When the BNL high current ERL was first envisioned the choice of injector went through several iterations before concluding that an SRF injector was the appropriate choice for the task at hand. The design requirements were quite stringent as the injector had to be designed to reach currents never before achieved in any injector. The overall goal was to design an injector capable of delivering up to 0.5 Ampere at 703.75 MHz. This criteria was set based on the need to demonstrate high average current energy recovery at the ERL so that future machines could be designed and built with confidence in the injector. For the ERL the injector needs to be capable of accelerating electrons to 2-2.5 MeV with charges ranging from 0.7 to 5 nC per bunch depending on the operational parameters being studied. These criteria led to a 1/2 cell photoinjector designed to accommodate a demountable photocathode utilizing a novel quarter wave choke joint for the cathode insertion mechanism. The cavity requires a total of 1 MW of power coupled to the beam in order to meet the high current application, necessitating two 500 kW RF power couplers. This AP note will review the overall physics design and analysis, the fabrication sequence, and the testing plan for this cavity.

  3. 1.3 GHz superconducting RF cavity program at Fermilab

    SciTech Connect

    Ginsburg, C.M.; Arkan, T.; Barbanotti, S.; Carter, H.; Champion, M.; Cooley, L.; Cooper, C.; Foley, M.; Ge, M.; Grimm, C.; Harms, E.; /Fermilab

    2011-03-01

    At Fermilab, 9-cell 1.3 GHz superconducting RF (SRF) cavities are prepared, qualified, and assembled into cryomodules (CMs) for Project X, an International Linear Collider (ILC), or other future projects. The 1.3 GHz SRF cavity program includes targeted R&D on 1-cell 1.3 GHz cavities for cavity performance improvement. Production cavity qualification includes cavity inspection, surface processing, clean assembly, and one or more cryogenic low-power CW qualification tests which typically include performance diagnostics. Qualified cavities are welded into helium vessels and are cryogenically tested with pulsed high-power. Well performing cavities are assembled into cryomodules for pulsed high-power testing in a cryomodule test facility, and possible installation into a beamline. The overall goals of the 1.3 GHz SRF cavity program, supporting facilities, and accomplishments are described.

  4. Multipacting-free quarter-wavelength choke joint design for BNL SRF

    SciTech Connect

    Xu, W.; Belomestnykh, S.; Ben-Zvi, I.; Liaw, C. J.; Smith, K.; Than, R.; Tuozzolo, J.; Wang, E.; Weiss, D.; Zaltsman, A.

    2015-05-03

    The BNL SRF gun cavity operated well in CW mode up to 2 MV. However, its performance suffered due to multipacting in the quarter-wavelength choke joint. A new multipacting-free cathode stalk was designed and conditioned. This paper describes RF and thermal design of the new cathode stalk and its conditioning results.

  5. Fast thermometry for superconducting rf cavity testing

    SciTech Connect

    Orris, Darryl; Bellantoni, Leo; Carcagno, Ruben H.; Edwards, Helen; Harms, Elvin Robert; Khabiboulline, Timergali N.; Kotelnikov, Sergey; Makulski, Andrzej; Nehring, Roger; Pischalnikov, Yuriy; /Fermilab

    2007-06-01

    Fast readout of strategically placed low heat capacity thermometry can provide valuable information of Superconducting RF (SRF) cavity performance. Such a system has proven very effective for the development and testing of new cavity designs. Recently, several resistance temperature detectors (RTDs) were installed in key regions of interest on a new 9 cell 3.9 GHz SRF cavity with integrated HOM design at FNAL. A data acquisition system was developed to read out these sensors with enough time and temperature resolution to measure temperature changes on the cavity due to heat generated from multipacting or quenching within power pulses. The design and performance of the fast thermometry system will be discussed along with results from tests of the 9 cell 3.9GHz SRF cavity.

  6. Effects of liquid helium bubble formation in a superconducting cavity cryogenic system

    SciTech Connect

    Chang, X.; Wang, E.; Xin, T.

    2011-03-01

    We constructed a simple prototype model based on the geometry of the 56 MHz superconducting cavity for RHIC. We studied the formation, in this prototype, of bubbles of liquid helium and their thermal effects on the cavity. We found that due to the low viscosity of the liquid helium, and its small surface tension, no large bubbles formed. The tiny bubbles, generated from most of the area, behaved like light gas travelling in a free space and escaped from the trapping region. The bubbles that were generated in the trapping area, due to its descending geometry, are much bigger than the other bubbles, but due to the liquid flow generated by heating, they still are negligible compared to the size of the trapping region. We expected that the effects of bubbles in our 56 MHz cavity during operation might well be negligible.

  7. Ingot Nb based SRF technology for the International Linear Collider

    NASA Astrophysics Data System (ADS)

    Yamamoto, Akira; Yamanaka, Masashi; Myneni, Ganapati

    2015-12-01

    The International Linear Collider (ILC) is anticipated to be built as the next energy-frontier electron-positron colliding accelerator with a global effort in particle physics. Niobium based Superconducting Radio-Frequency (SRF) technology is required to provide beam-accelerating structure with elliptical cavity strings to linearly accelerate the electron and positron beams up to 250 GeV and to realize a center-of-mass energy of 500 GeV in collisions. The accelerator design and R&D efforts progressed, and the ILC Technical Design Report (ILC-TDR) was published in 2013. Niobium will take a critical role to generate electric field gradient with a frequency of 1.3 GHz, for accelerating the beam with the best efficiency, in energy balance, using RF superconductivity. This paper discusses a technical approach to provide Nb material (ingot) and thin disks for producing the elliptical cavity structure, with direct slicing from Nb ingot having sufficiently optimized purity and residual resistance ration (RRR) necessary for the ILC SRF cavities.

  8. Ingot Nb based SRF technology for the International Linear Collider

    SciTech Connect

    Yamamoto, Akira; Yamanaka, Masashi; Myneni, Ganapati

    2015-12-04

    The International Linear Collider (ILC) is anticipated to be built as the next energy-frontier electron-positron colliding accelerator with a global effort in particle physics. Niobium based Superconducting Radio-Frequency (SRF) technology is required to provide beam-accelerating structure with elliptical cavity strings to linearly accelerate the electron and positron beams up to 250 GeV and to realize a center-of-mass energy of 500 GeV in collisions. The accelerator design and R&D efforts progressed, and the ILC Technical Design Report (ILC-TDR) was published in 2013. Niobium will take a critical role to generate electric field gradient with a frequency of 1.3 GHz, for accelerating the beam with the best efficiency, in energy balance, using RF superconductivity. This paper discusses a technical approach to provide Nb material (ingot) and thin disks for producing the elliptical cavity structure, with direct slicing from Nb ingot having sufficiently optimized purity and residual resistance ration (RRR) necessary for the ILC SRF cavities.

  9. LLRF design for the HINS-SRF test facility at Fermilab

    SciTech Connect

    Branlanrd, J.; Chase, B.; Cullerton, E.; Joireman, P.; Tupikov, V.; /Fermilab

    2010-09-01

    The High Intensity Neutrino Source (HINS) R&D program requires super conducting single spoke resonators operating at 325 MHz (SSR1). After coupler installation, these cavities are tested at the HINS-SRF facility at Fermilab. The LLRF requirements for these tests include support for continuous wave and pulsed mode operations, with the ability to track the resonance frequency of the tested cavity. Real-time measurement of the cavity loaded Q and Q{sub 0} are implemented using gradient decay techniques, allowing for Q{sub 0} versus E{sub acc} plots. A real time cavity simulator was also developed to test the LLRF system and verify its functionality.

  10. SRF Performance of CEBAF After Thermal Cycle to Ambient Temperature

    SciTech Connect

    Robert Rimmer; Jay Benesch; Joseph Preble; Charles Reece

    2005-05-01

    In September 2003, in the wake of Hurricane Isabel, JLab was without power for four days after a tree fell on the main power lines feeding the site. This was long enough to lose insulating vacuum in the cryomodules and cryogenic systems resulting in the whole accelerator warming up and the total loss of the liquid helium inventory. This thermal cycle stressed many of the cryomodule components causing several cavities to become inoperable due to helium to vacuum leaks. At the same time the thermal cycle released years of adsorbed gas from the cold surfaces. Over the next days and weeks this gas was pumped away, the insulating vacuum was restored and the machine was cooled back down and re-commissioned. In a testament to the robustness of SRF technology, only a small loss in energy capability was apparent, although individual cavities had quite different field-emission characteristics compared to before the event. In Summer 2004 a section of the machine was again cycled to room temperature during the long maintenance shutdown. We report on the overall SRF performance of the machine after these major disturbances and on efforts to characterize and optimize the new behavior for high-energy running.

  11. Vibrational measurement for commissioning SRF Accelerator Test Facility at Fermilab

    SciTech Connect

    McGee, M.W.; Leibfritz, J.; Martinez, A.; Pischalnikov, Y.; Schappert, W.; /Fermilab

    2011-03-01

    The commissioning of two cryomodule components is underway at Fermilab's Superconducting Radio Frequency (SRF) Accelerator Test Facility. The research at this facility supports the next generation high intensity linear accelerators such as the International Linear Collider (ILC), a new high intensity injector (Project X) and other future machines. These components, Cryomodule No.1 (CM1) and Capture Cavity II (CC2), which contain 1.3 GHz cavities are connected in series in the beamline and through cryogenic plumbing. Studies regarding characterization of ground motion, technical and cultural noise continue. Mechanical transfer functions between the foundation and critical beamline components have been measured and overall system displacement characterized. Baseline motion measurements given initial operation of cryogenic, vacuum systems and other utilities are considered.

  12. R&D progress in SRF surface preparation with centrifugal barrel polishing (cbp) for both Nb and Cu

    SciTech Connect

    Palczewski, Ari

    2013-09-01

    Centrifugal Barrel polishing (CBP) is becoming a common R&D tool for SRF cavity preparation around the world. During the CBP process a cylindrically symmetric SRF cavity is filled with relatively cheap and environmentally friendly abrasive and sealed. The cavity is then spun around a cylindrically symmetric axis at high speeds uniformly conditioning the inner surface. This uniformity is especially relevant for SRF application because many times a single manufacturing defects limits cavity?s performance well below it?s theoretical limit. In addition CBP has created surfaces with roughness?s on the order of 10?s of nm which create a unique surface for wet chemistry or thin film deposition. CBP is now being utilized at Jefferson Laboratory, Fermi Laboratory and Cornell University in the US, Deutsches Elektronen-Synchrotron in Germany, Laboratori Nazionali di Legnaro in Italy, and Raja Ramanna Centre for Advanced Technology in India. In this talk we will present current CBP research from each lab including equipment, baseline recipes, cavity removal rates and subsequent cryogenic cavity tests on niobium as well as copper cavities where available.

  13. Defect Detection in Superconducting Radiofrequency Cavity Surface Using C + + and OpenCV

    NASA Astrophysics Data System (ADS)

    Oswald, Samantha; Thomas Jefferson National Accelerator Facility Collaboration

    2014-03-01

    Thomas Jefferson National Accelerator Facility (TJNAF) uses superconducting radiofrequency (SRF) cavities to accelerate an electron beam. If theses cavities have a small particle or defect, it can degrade the performance of the cavity. The problem at hand is inspecting the cavity for defects, little bubbles of niobium on the surface of the cavity. Thousands of pictures have to be taken of a single cavity and then looked through to see how many defects were found. A C + + program with Open Source Computer Vision (OpenCV) was constructed to reduce the number of hours searching through the images and finds all the defects. Using this code, the SRF group is now able to use the code to identify defects in on-going tests of SRF cavities. Real time detection is the next step so that instead of taking pictures when looking at the cavity, the camera will detect all the defects.

  14. Surface Impedance of Superconducting Radio Frequency (SRF) Materials

    NASA Astrophysics Data System (ADS)

    Xiao, Binping

    Superconducting radio frequency (SRF) technology is widely adopted in particle accelerators. There remain many open questions, however, in developing a systematic understanding of the fundamental behavior of SRF materials, including niobium treated in different ways and various other bulk/thin film materials that are fabricated with different methods under assorted conditions. A facility that can measure the SRF properties of small samples in a range of 2˜40 K temperature is needed in order to fully answer these questions. The Jefferson Lab surface impedance characterization (SIC) system has been designed to attempt to meet this requirement. It consists of a sapphire-loaded cylindrical Nb TE011 cavity at 7.4 GHz with a 50 mm diameter flat sample placed on a non-contacting end plate and uses a calorimetric technique to measure the radio frequency (RF) induced heat on the sample. Driving the resonance to a known field on this surface enables one to derive the surface resistance of a relatively small localized area. TE011 mode identification has been done at room temperature and 4 K, and has been compared with Microwave Studio® and SuperFish simulation results. RF loss mechanisms in the SIC system are under investigation. A VCO phase lock loop system has been used in both CW and pulsed mode. Two calorimeters, with stainless steel and Cu as the thermal path material for high precision and high power versions, respectively, have been designed and commissioned for the SIC system to provide low temperature control and measurement. A power compensation method has been developed to measure the RF induced power on the sample. Simulation and experimental results show that with these two calorimeters, the whole thermal range of interest for SRF materials has been covered, The power measurement error in the interested power range is within 1.2% and 2.7% for the high precision and high power versions, respectively. Temperature distributions on the sample surface for both

  15. RF and structural characterization of new SRF films

    SciTech Connect

    A.-M. Valente-Feliciano,H. L. Phillips,C. E. Reece,X. Zhao,D. Gu,R. Lukaszew,B. Xiao,K. Seo

    2009-09-01

    In the past years, energetic vacuum deposition methods have been developed in different laboratories to improve Nb/Cu technology for superconducting cavities. Jefferson Lab is pursuing energetic condensation deposition via Electron Cyclotron Resonance. As part of this study, the influence of the deposition energy on the material and RF properties of the Nb thin film is investigated. The film surface and structure analyses are conducted with various techniques like X-ray diffraction, Transmission Electron Microscopy, Auger Electron Spectroscopy and RHEED. The microwave properties of the films are characterized on 50 mm disk samples with a 7.5 GHz surface impedance characterization system. This paper presents surface impedance measurements in correlation with surface and material characterization for Nb films produced on copper substrates with different bias voltages and also highlights emerging opportunities for developing multilayer SRF films with a new deposition system.

  16. 40 CFR 35.3115 - Eligible activities of the SRF.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 1 2011-07-01 2011-07-01 false Eligible activities of the SRF. 35.3115 Section 35.3115 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GRANTS AND OTHER FEDERAL ASSISTANCE STATE AND LOCAL ASSISTANCE State Water Pollution Control Revolving Funds § 35.3115 Eligible activities of the SRF. Funds in the SRF...

  17. Implications of incomplete energy recovery in SRF-based energy recovery linacs

    SciTech Connect

    Tom Powers; Chris Tennant

    2007-05-21

    The choice of the loaded quality factor (QL) of a superconducting cavity is driven by many factors, including beam loading effects and microphonics. In accelerators with minimal beam loading, use of SRF cavities with relatively high loaded-Q allows one to employ lower power RF sources. Many individuals are therefore considering energy recovered linac designs making use of SRF cavities with loaded-Q values that are primarily limited by microphonic effects. While this is valid for machines which have near-ideal energy recovery, many applications do not necessarily fit this model. In some applications the second pass, energy recovered beam experiences a phase shift between one state of machine operation and a second state. One complication in this process is that the cavity resonance control algorithms are influenced by this phase shift. With respect to RF power requirements, this is a positive interaction inasmuch as the tuner partially compensates for the phase shift of the recovered beam. This work will go through the implications of partial energy recovery on the selection of the loaded-Q for cavity fundamental power couplers.

  18. Some experiences with BEPCII SRF system operation

    NASA Astrophysics Data System (ADS)

    Huang, Tong-ming; Lin, Hai-ying; Sun, Yi; Dai, Jian-ping; Wang, Guang-wei; Pan, Wei-min Li, Zhong-quan; Ma, Qiang; Wang, Qun-yao; Zhao, Guang-yuan; Mi, Zheng-hui; Sha, Peng

    2016-06-01

    The Superconducting Radio Frequency (SRF) system of the upgrade project of the Beijing Electron Positron Collider (BEPCII) has been in operation for almost 8 years. During operation, many problems have been encountered, such as excessive heating of the power couplers, frequent beam trips during high intensity colliding, false arc interlock trigger and so on. Among them, some has been solved successfully, some have been alleviated. This paper will describe some experiences with BEPCII SRF system operation, including the symptoms, causes and solutions of problems.

  19. Identification of New SRF Binding Sites in Genes Modulated by SRF Over-Expression in Mouse Hearts

    PubMed Central

    Zhang, Xiaomin; Azhar, Gohar; Helms, Scott; Burton, Brian; Huang, Chris; Zhong, Ying; Gu, Xuesong; Fang, Hong; Tong, Weida; Wei, Jeanne Y.

    2011-01-01

    Background: To identify in vivo new cardiac binding sites of serum response factor (SRF) in genes and to study the response of these genes to mild over-expression of SRF, we employed a cardiac-specific, transgenic mouse model, with mild over-expression of SRF (Mild-O SRF Tg). Methodology: Microarray experiments were performed on hearts of Mild-O-SRF Tg at 6 months of age. We identified 207 genes that are important for cardiac function that were differentially expressed in vivo. Among them the promoter region of 192 genes had SRF binding motifs, the classic CArG or CArG-like (CArG-L) elements. Fifty-one of the 56 genes with classic SRF binding sites had not been previously reported. These SRF-modulated genes were grouped into 12 categories based on their function. It was observed that genes associated with cardiac energy metabolism shifted toward that of carbohydrate metabolism and away from that of fatty acid metabolism. The expression of genes that are involved in transcription and ion regulation were decreased, but expression of cytoskeletal genes was significantly increased. Using public databases of mouse models of hemodynamic stress (GEO database), we also found that similar altered expression of the SRF-modulated genes occurred in these hearts with cardiac ischemia or aortic constriction as well. Conclusion and significance: SRF-modulated genes are actively regulated under various physiological and pathological conditions. We have discovered that a large number of cardiac genes have classic SRF binding sites and were significantly modulated in the Mild-O-SRF Tg mouse hearts. Hence, the mild elevation of SRF protein in the heart that is observed during typical adult aging may have a major impact on many SRF-modulated genes, thereby affecting cardiac structure and performance. The results from our study could help to enhance our understanding of SRF regulation of cellular processes in the aged heart. PMID:21792293

  20. Chemical pathways in ultracold reactions of SrF molecules

    SciTech Connect

    Meyer, Edmund R.; Bohn, John L.

    2011-03-15

    We present a theoretical investigation of the chemical reaction SrF + SrF {yields} products, focusing on reactions at ultralow temperatures. We find that bond swapping SrF + SrF {yields} Sr{sub 2} + F{sub 2} is energetically forbidden at these temperatures. Rather, the only energetically allowed reaction is SrF + SrF {yields} SrF{sub 2} + Sr, and even then only singlet states of the SrF{sub 2} trimer can form. A calculation along a reduced reaction path demonstrates that this abstraction reaction is barrierless and proceeds by one SrF molecule ''handing off'' a fluorine atom to the other molecule.

  1. Tests of a tuner for a 325 MHz SRF spoke resonator

    SciTech Connect

    Pishchalnikov, Y.; Borissov, E.; Khabiboulline, T.; Madrak, R.; Pilipenko, R.; Ristori, L.; Schappert, W.; /Fermilab

    2011-03-01

    Fermilab is developing 325 MHz SRF spoke cavities for the proposed Project X. A compact fast/slow tuner has been developed for final tuning of the resonance frequency of the cavity after cooling down to operating temperature and to compensate microphonics and Lorentz force detuning [2]. The modified tuner design and results of 4.5K tests of the first prototype are presented. The performance of lever tuners for the SSR1 spoke resonator prototype has been measured during recent CW and pulsed tests in the Fermilab SCTF. The tuner met or exceeded all design goals and has been used to successfully: (1) Bring the cold cavity to the operating frequency; (2) Compensate for dynamic Lorentz force detuning; and (3) Compensate for frequency detuning of the cavity due to changes in the He bath pressure.

  2. Exploration of very high gradient cavities

    SciTech Connect

    Eremeev, Grigory

    2011-07-01

    Several of the 9-cell ILC cavities processed at Jlab within ongoing ILC R&D program have shown interesting behavior at high fields, such as mode mixing and sudden field emission turn-on during quench. Equipped with thermometry and oscillating superleak transducer (OST) system for quench detection, we couple our RF measurements with local dissipation measurements. In this contribution we report on our findings with high gradient SRF cavities.

  3. Analysis Of Post-Wet-Chemistry Heat Treatment Effects On Nb SRF Surface Resistance

    SciTech Connect

    Dhakal, Pashupati; Ciovati, Gianluigi; Kneisel, Peter K.; Myneni, Ganapati Rao

    2014-02-01

    Most of the current research in superconducting radio frequency (SRF) cavities is focused on ways to reduce the construction and operating cost of SRF-based accelerators as well as on the development of new or improved cavity processing techniques. The increase in quality factors is the result of the reduction of the surface resistance of the materials. A recent test on a 1.5 GHz single cell cavity made from ingot niobium of medium purity and heat treated at 1400 deg C in a ultra-high vacuum induction furnace resulted in a residual resistance of ~ 1n{Omega} and a quality factor at 2.0 K increasing with field up to ~ 5×10{sup 10} at a peak magnetic field of 90 mT. In this contribution, we present some results on the investigation of the origin of the extended Q{sub 0}-increase, obtained by multiple HF rinses, oxypolishing and heat treatment of all Nb cavities.

  4. SRF is required for neutrophil migration in response to inflammation

    PubMed Central

    Taylor, Ashley; Tang, Wenwen; Bruscia, Emanuela M.; Zhang, Ping-Xia; Lin, Aiping; Gaines, Peter; Wu, Dianqing

    2014-01-01

    Serum response factor (SRF) is a ubiquitously expressed transcription factor and master regulator of the actin cytoskeleton. We have previously shown that SRF is essential for megakaryocyte maturation and platelet formation and function. Here we elucidate the role of SRF in neutrophils, the primary defense against infections. To study the effect of SRF loss in neutrophils, we crossed Srffl/fl mice with select Cre-expressing mice and studied neutrophil function in vitro and in vivo. Despite normal neutrophil numbers, neutrophil function is severely impaired in Srf knockout (KO) neutrophils. Srf KO neutrophils fail to polymerize globular actin to filamentous actin in response to N-formyl-methionine-leucine-phenylalanine, resulting in significantly disrupted cytoskeletal remodeling. Srf KO neutrophils fail to migrate to sites of inflammation in vivo and along chemokine gradients in vitro. Polarization in response to cytokine stimuli is absent and Srf KO neutrophils show markedly reduced adhesion. Integrins play an essential role in cellular adhesion, and although integrin expression levels are maintained with loss of SRF, integrin activation and trafficking are disrupted. Migration and cellular adhesion are essential for normal cell function, but also for malignant processes such as metastasis, underscoring an essential function for SRF and its pathway in health and disease. PMID:24574460

  5. Mechanical Properties of Ingot Nb Cavities

    SciTech Connect

    Ciovati, Gianluigi; Dhakal, Pashupati; Kneisel, Peter; Mammosser, John; Matalevich, Joseph; Rao Myneni, Ganapati

    2014-07-01

    This contribution presents the results of measurements of the resonant frequency and of strain along the contour of a single-cell cavity made of ingot Nb subjected to increasing uniform differential pressure, up to 6 atm. The data were used to infer mechanical properties of this material after cavity fabrication, by comparison with the results from simulation calculations done with ANSYS. The objective is to provide useful information about the mechanical properties of ingot Nb cavities which can be used in the design phase of SRF cavities intended to be built with this material.

  6. Injector Cavities Fabrication, Vertical Test Performance and Primary Cryomodule Design

    SciTech Connect

    Wang, Haipeng; Cheng, Guangfeng; Clemens, William; Davis, G; Macha, Kurt; Overton, Roland; Spell, D.

    2015-09-01

    After the electromagnetic design and the mechanical design of a β=0.6, 2-cell elliptical SRF cavity, the cavity has been fabricated. Then both 2-cell and 7-cell cavities have been bench tuned to the target values of frequency, coupling external Q and field flatness. After buffer chemistry polishing (BCP) and high pressure rinses (HPR), Vertical 2K cavity test results have been satisfied the specifications and ready for the string assembly. We will report the cavity performance including Lorenz Force Detuning (LFD) and Higher Order Modes (HOM) damping data. Its integration with cavity tuners to the cryomodule design will be reported.

  7. NbTiN Based SIS Multilayer Structures for SRF Applications

    SciTech Connect

    Valente, Anne-marie; Eremeev, Grigory; Phillips, H; Reece, Charles; Spradlin, Joshua; Yang, Qiguang; Lukaszew, Rosa

    2013-09-01

    For the past three decades, bulk niobium has been the material of choice for SRF cavities applications. RF cavity performance is now approaching the theoretical limit for bulk niobium. For further improvement of RF cavity performance for future accelerator projects, Superconductor Insulator - Superconductor (SIS) multilayer structures (as recently proposed by Alex Gurevich) present the theoretical prospect to reach RF performance beyond bulk Nb, using thinly layered higher-Tc superconductors with enhanced Hc1. Jefferson Lab (JLab) is pursuing this approach with the development of NbTiN and AlN based multilayer SIS structures. This paper presents the results on the characteristics of NbTiN films and the first RF measurements on NbTiN-based multilayer structure on thick Nb films.

  8. Simulation Study Using an Injection Phase-locked Magnetron as an Alternative Source for SRF Accelerators

    SciTech Connect

    Wang, Haipeng; Plawski, Tomasz E.; Rimmer, Robert A.

    2015-09-01

    As a drop-in replacement for the CEBAF CW klystron system, a 1497 MHz, CW-type high-efficiency magnetron using injection phase lock and amplitude variation is attractive. Amplitude control using magnetic field trimming and anode voltage modulation has been studied using analytical models and MATLAB/Simulink simulations. Since the 1497 MHz magnetron has not been built yet, previously measured characteristics of a 2.45GHz cooker magnetron are used as reference. The results of linear responses to the amplitude and phase control of a superconducting RF (SRF) cavity, and the expected overall benefit for the current CEBAF and future MEIC RF systems are presented in this paper.

  9. Research on Field Emission and Dark Current in ILC Cavities

    SciTech Connect

    Liu, Kexin; Li, Yongming; Palczewski, Ari; Geng, Rongli

    2013-09-01

    Field emission and dark current are issues of concern for SRF cavity performance and SRF linac operation. Complete understanding and reliable control of the issue are still needed, especially in full-scale multi-cell cavities. Our work aims at developing a generic procedure for finding an active field emitter in a multi-cell cavity and benchmarking the procedure through cavity vertical test. Our ultimate goal is to provide feedback to cavity preparation and cavity string assembly in order to reduce or eliminate filed emission in SRF cavities. Systematic analysis of behaviors of field emitted electrons is obtained by ACE3P developed by SLAC. Experimental benchmark of the procedure was carried out in a 9-cell cavity vertical test at JLab. The energy spectrum of Bremsstrahlung X-rays is measured using a NaI(Tl) detector. The end-point energy in the X-ray energy spectrum is taken as the highest kinetic electron energy to predict longitudinal position of the active field emitter. Angular location of the field emitter is determined by an array of silicon diodes around irises of the cavity. High-resolution optical inspection was conducted at the predicted field emitter location.

  10. Magnetic flux studies in horizontally cooled elliptical superconducting cavities

    SciTech Connect

    Martinello, M. Checchin, M.; Grassellino, A. Crawford, A. C.; Melnychuk, O.; Romanenko, A.; Sergatskov, D. A.

    2015-07-28

    Previous studies on magnetic flux expulsion as a function of cooldown procedures for elliptical superconducting radio frequency (SRF) niobium cavities showed that when the cavity beam axis is placed parallel to the helium cooling flow and sufficiently large thermal gradients are achieved, all magnetic flux could be expelled and very low residual resistance could be achieved. In this paper, we investigate flux trapping for the case of resonators positioned perpendicularly to the helium cooling flow, which is more representative of how SRF cavities are cooled in accelerators and for different directions of the applied magnetic field surrounding the resonator. We show that different field components have a different impact on the surface resistance, and several parameters have to be considered to fully understand the flux dynamics. A newly discovered phenomenon of concentration of flux lines at the cavity top leading to temperature rise at the cavity equator is presented.

  11. Recent improvements to software used for optimization of SRF linacs

    SciTech Connect

    Powers, Tom J.

    2014-12-01

    This work describes a software tool that allows one to vary parameters and understand the effects on the optimized costs of construction plus 10 year operations of an SRF linac, where operation costs includes the cost of the electrical utilities but not the labor or other costs. The program includes estimates for the associated cryogenic facility, and controls hardware. The software interface provides the ability to vary the cost of the different aspects of the machine as well as to change the cryomodule and cavity types. Additionally, this work will describe the recent improvements to the software that allow one to estimate the costs of energy-recovery based linacs and to enter arbitrary values of the low field Q0 and Q0 slope. The initial goal when developing the software was to convert a spreadsheet format to a graphical interface and to allow the ability to sweep different parameter sets. The tools also allow one to compare the cost of the different facets of the machine design and operations so as to better understand tradeoffs. An example of how it was used to independently investigate cost optimization tradeoffs for the LCLS-II linac will also be presented.

  12. 40 CFR 35.3125 - Limitations on SRF assistance.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 1 2011-07-01 2011-07-01 false Limitations on SRF assistance. 35.3125 Section 35.3125 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GRANTS AND OTHER FEDERAL ASSISTANCE STATE AND LOCAL ASSISTANCE State Water Pollution Control Revolving Funds § 35.3125 Limitations on SRF assistance. (a) Prevention of...

  13. Plasma processing of superconducting radio frequency cavities

    NASA Astrophysics Data System (ADS)

    Upadhyay, Janardan

    The development of plasma processing technology of superconducting radio frequency (SRF) cavities not only provides a chemical free and less expensive processing method, but also opens up the possibility for controlled modification of the inner surfaces of the cavity for better superconducting properties. The research was focused on the transition of plasma etching from two dimensional flat surfaces to inner surfaces of three dimensional (3D) structures. The results could be applicable to a variety of inner surfaces of 3D structures other than SRF cavities. Understanding the Ar/Cl2 plasma etching mechanism is crucial for achieving the desired modification of Nb SRF cavities. In the process of developing plasma etching technology, an apparatus was built and a method was developed to plasma etch a single cell Pill Box cavity. The plasma characterization was done with the help of optical emission spectroscopy. The Nb etch rate at various points of this cavity was measured before processing the SRF cavity. Cylindrical ring-type samples of Nb placed on the inner surface of the outer wall were used to measure the dependence of the process parameters on plasma etching. The measured etch rate dependence on the pressure, rf power, dc bias, temperature, Cl2 concentration and diameter of the inner electrode was determined. The etch rate mechanism was studied by varying the temperature of the outer wall, the dc bias on the inner electrode and gas conditions. In a coaxial plasma reactor, uniform plasma etching along the cylindrical structure is a challenging task due to depletion of the active radicals along the gas flow direction. The dependence of etch rate uniformity along the cylindrical axis was determined as a function of process parameters. The formation of dc self-biases due to surface area asymmetry in this type of plasma and its variation on the pressure, rf power and gas composition was measured. Enhancing the surface area of the inner electrode to reduce the

  14. Comparison of Deformation in High-Purity Single/Large Grain and Polycrystalline Niobium Superconducting Cavities

    SciTech Connect

    Ganapati Rao Myneni; Peter Kneisel

    2005-07-10

    The current approach for the fabrication of superconducting radio frequency (SRF) cavities is to roll and deep draw sheets of polycrystalline high-purity niobium. Recently, a new technique was developed at Jefferson Laboratory that enables the fabrication of single-crystal high-purity Nb SRF cavities. To better understand the differences between SRF cavities fabricated out of fine-grained polycrystalline sheet in the standard manner and single crystal cavities fabricated by the new technique, two half-cells were produced according to the two different procedures and compared using a variety of analytical techniques including optical microscopy, scanning laser confocal microscopy, profilometry, and X-ray diffraction. Crystallographic orientations, texture, and residual stresses were determined in the samples before and after forming and this poster presents the results of this ongoing study.

  15. Three-dimensional self-consistent simulations of multipacting in superconducting radio frequency cavities

    SciTech Connect

    Chet Nieter

    2010-12-01

    Superconducting radio frequency (SRF) cavities are a popular choice among researchers designing new accelerators because of the reduced power losses due to surface resistance. However, SRF cavities still have unresolved problems, including the loss of power to stray electrons. Sources of these electrons are field emission from the walls and ionization of background gas, but the predominant source is secondary emission yield (SEY) from electron impact. When the electron motion is in resonance with the cavity fields the electrons strike the cavity surface repeatedly creating a resonant build up of electrons referred to as multipacting. Cavity shaping has successfully reduced multipacting for cavities used in very high energy accelerators. However, multipacting is still a concern for the cavity power couplers, where shaping is not possible, and for cavities used to accelerate particles at moderate velocities. This Phase II project built upon existing models in the VORPAL simulation framework to allow for simulations of multipacting behavior in SRF cavities and their associated structures. The technical work involved allowed existing models of secondary electron generation to work with the complex boundary conditions needed to model the cavity structures. The types of data produced by VORPAL were also expanded to include data common used by cavity designers to evaluate cavity performance. Post-processing tools were also modified to provide information directly related to the conditions that produce multipacting. These new methods were demonstrated by running simulations of a cavity design being developed by researchers at Jefferson National Laboratory to attempt to identify the multipacting that would be an issue for the cavity design being considered. These simulations demonstrate that VORPAL now has the capabilities to assist researchers working with SRF cavities to understand and identify possible multipacting issues with their cavity designs.

  16. RF Test Results from Cryomodule 1 at the Fermilab SRF Beam Test Facility

    SciTech Connect

    Harms, E.; Carlson, K.; Chase, B.; Cullerton, E.; Hocker, A.; Jensen, C.; Joireman, P.; Klebaner, A.; Kubicki, T.; Kucera, M.; Legan, A.; /Fermilab /DESY

    2011-07-26

    Powered operation of Cryomodule 1 (CM-1) at the Fermilab SRF Beam Test Facility began in late 2010. Since then a series of tests first on the eight individual cavities and then the full cryomodule have been performed. We report on the results of these tests and lessons learned which will have an impact on future module testing at Fermilab. Since November 2010 Cryomodule 1 has been operating at 2 Kelvin. After evaluating each of the eight cavities while individually powered, the entire module has recently been powered and peak operation determined as shown in Figure 4. Several more weeks of measurements are planned before the module is warmed up, removed and replaced with Cryomodule 2 now under assembly at Fermilab.

  17. Diagnostics Beamline for the SRF Gun Project

    SciTech Connect

    T. Kamps; V. Durr; K. Goldammer; D. Kramer; P. Kuske; J. Kuszynski; D. Lipka; F. Marhauser; T. Quast; D. Richter; U. Lehnert; P. Michel; J. Teichert; P. Evtushenko; I. Will

    2005-08-22

    A superconducting radio-frequency photo electron injector (SRF gun) is currently under construction by a collaboration of BESSY, DESY, FZR and MBI. The project aims at the design and setup of a CW SRF gun including a diagnostics beamline for the ELBE FEL and to address R&D issues on low emittance injectors for future light sources such as the BESSY FEL. Of critical importance for the injector performance is the control of the electron beam parameters. For this reason a compact diagnostics beamline is under development serving a multitude of operation settings ranging from low-charge (77pC), low-emittance (1 mm mrad) mode to high-charge (2.5nC) operation of the gun. For these operation modes beam dynamics simulations are resulting in boundary conditions for the beam instrumentation. Proven and mature technology is projected wherever possible, for example for current and beam position monitoring. The layout of the beam profile and emittance measurement systems is described. For the bunch length, which varies between 5 ps and 50 ps, two schemes using electro-optical sampling and Cherenkov radiation are detailed. The beam energy and energy spread is measured with a 180-degree spectrometer.

  18. Ion Exchange Temperature Testing with SRF Resin

    SciTech Connect

    Russell, Renee L.; Rinehart, Donald E.; Brown, Garrett N.; Peterson, Reid A.

    2012-03-01

    Ion exchange using the Spherical Resorcinol-Formaldehyde (SRF) resin has been selected by the U.S. Department of Energy’s Office of River Protection for use in the Pretreatment Facility of the Hanford Tank Waste Treatment and Immobilization Plant (WTP) and for potential application in an at-tank deployment for removing 137Cs. Recent proposed changes to the WTP ion exchange process baseline indicate that higher temperatures (50°C) to alleviate post-filtration precipitation issues prior to reaching the ion exchange columns may be required. Therefore, it is important to understand the behavior of SRF resin performance under the conditions expected with the new equipment and process changes. This research examined the impact of elevated temperature on resin loading and resin degradation during extended solution flow using elevated temperature (45°, 50°, 55°, 60°, 65°, 75°C). Testing for extended times at elevated temperatures showed that the resin does degrade and loading capacity is reduced at and above 45°C. Above 60°C the resin appears to not load at all.

  19. Higher order mode damping in a five-cell superconducting rf cavity with a photonic band gap coupler cell

    NASA Astrophysics Data System (ADS)

    Arsenyev, Sergey A.; Temkin, Richard J.; Shchegolkov, Dmitry Yu.; Simakov, Evgenya I.; Boulware, Chase H.; Grimm, Terry L.; Rogacki, Adam R.

    2016-08-01

    We present a study of higher order mode (HOM) damping in the first multicell superconducting radio-frequency (SRF) cavity with a photonic band gap (PBG) coupler cell. Achieving higher average beam currents is particularly desirable for future light sources and particle colliders based on SRF energy-recovery linacs (ERLs). Beam current in ERLs is limited by the beam breakup instability, caused by parasitic HOMs interacting with the beam in accelerating cavities. A PBG cell incorporated in an accelerating cavity can reduce the negative effect of HOMs by providing a frequency selective damping mechanism, thus allowing significantly higher beam currents. The five-cell cavity with a PBG cell was designed and optimized for HOM damping. Monopole and dipole HOMs were simulated. The SRF cavity was fabricated and tuned. External quality factors for some HOMs were measured in a cold test. The measurements agreed well with the simulations.

  20. Physical and mechanical metallurgy of high purity Nb accelerator cavities.

    SciTech Connect

    Wright, N. T.; Bieler, T. R.; Pourgoghart , F.; Compton, C.; Hartwig, K. T.; Baars, D.; Zamiri, A.; Chandrasekaran, S.; Darbandi, P.; Jiang, H.; Skoug, E.; Balachandran, S.; Ice, G. E.; Liu, W.; Michigan State Univ.; Texas A & M Univ.; ORNL

    2010-01-01

    In the past decade, high Q values have been achieved in high purity Nb superconducting radio frequency (SRF) cavities. Fundamental understanding of the physical metallurgy of Nb that enables these achievements is beginning to reveal what challenges remain to establish reproducible and cost-effective production of high performance SRF cavities. Recent studies of dislocation substructure development and effects of recrystallization arising from welding and heat treatments and their correlations with cavity performance are considered. With better fundamental understanding of the effects of dislocation substructure evolution and recrystallization on electron and phonon conduction, as well as the interior and surface states, it will be possible to design optimal processing paths for cost-effective performance using approaches such as hydroforming, which minimizes or eliminates welds in a cavity.

  1. High-gradient SRF R&D for ILC at Jefferson Lab

    SciTech Connect

    Geng, Rongli; Crawford, Anthony; Ciovati, Gianluigi; Champion, Mark; Sergatskov, Dmitri; Furuta, Fumio; Saito, Kenji

    2008-10-01

    Jefferson Lab plays an active role in high-gradient SRF R&D in the frame work of the internationally coordinated ILC S0 program. The S0 aim is to push the yield at 35 MV/m in 9-cell cavities. So far, twelve cavities have been electropolishing (EP) processed and RF tested by using the state-of-the-art recipes at JLab, in close collaboration with FNAL and KEK. Seven of them reached a best gradient of over 31.5 MV/m. Understanding gradient limiting mechanisms in real 9-cell cavities is an important component of our studies. Thermometry and high-resolution optical inspection are used to locate and understand the source of gradient limits. Experimenting with selective cavities is still a necessary method for process optimization. One example is the first demonstration of 35 MV/m without detectable Bremsstrahlung X-ray after a light EP is applied to a previously heavy BCP etched 7-cell cavity. Some new understanding has been gained with regard to quench behaviors, field emission behaviors as

  2. Mass, energy and material balances of SRF production process. Part 1: SRF produced from commercial and industrial waste.

    PubMed

    Nasrullah, Muhammad; Vainikka, Pasi; Hannula, Janne; Hurme, Markku; Kärki, Janne

    2014-08-01

    This paper presents the mass, energy and material balances of a solid recovered fuel (SRF) production process. The SRF is produced from commercial and industrial waste (C&IW) through mechanical treatment (MT). In this work various streams of material produced in SRF production process are analyzed for their proximate and ultimate analysis. Based on this analysis and composition of process streams their mass, energy and material balances are established for SRF production process. Here mass balance describes the overall mass flow of input waste material in the various output streams, whereas material balance describes the mass flow of components of input waste stream (such as paper and cardboard, wood, plastic (soft), plastic (hard), textile and rubber) in the various output streams of SRF production process. A commercial scale experimental campaign was conducted on an MT waste sorting plant to produce SRF from C&IW. All the process streams (input and output) produced in this MT plant were sampled and treated according to the CEN standard methods for SRF: EN 15442 and EN 15443. The results from the mass balance of SRF production process showed that of the total input C&IW material to MT waste sorting plant, 62% was recovered in the form of SRF, 4% as ferrous metal, 1% as non-ferrous metal and 21% was sorted out as reject material, 11.6% as fine fraction, and 0.4% as heavy fraction. The energy flow balance in various process streams of this SRF production process showed that of the total input energy content of C&IW to MT plant, 75% energy was recovered in the form of SRF, 20% belonged to the reject material stream and rest 5% belonged with the streams of fine fraction and heavy fraction. In the material balances, mass fractions of plastic (soft), plastic (hard), paper and cardboard and wood recovered in the SRF stream were 88%, 70%, 72% and 60% respectively of their input masses to MT plant. A high mass fraction of plastic (PVC), rubber material and non

  3. Hybrid Physical Chemical Vapor Deposition of Superconducting Magnesium Diboride Coatings for Large Scale Radio Frequency Cavities

    NASA Astrophysics Data System (ADS)

    Lee, Namhoon; Withanage, Wenura; Tan, Teng; Wolak, Matthaeus; Xi, Xiaoxing

    2016-03-01

    Magnesium diboride (MgB2) is considered to be a great candidate for next generation superconducting radio frequency (SRF) cavities due to its higher critical temperature Tc (40 K) and increased thermodynamic critical field Hc compared to other conventional superconductors. These properties significantly reduce the BCS surface resistance (RsBCS)and residual resistance (Rres) according to theoretical studies and suggest the possibility of an enhanced accelerating field (Eacc) . We have investigated the possibility of coating the inner surface of a 3 GHz SRF cavity with MgB2 by using a hybrid physical-vapor deposition (HPCVD) system which was modified for this purpose. To simulate a real 3 GHz SRF cavity, a stainless steel mock cavity has been employed for the study. The film quality was characterized on small substrates that were placed at selected locations within the cavity. MgB2 films on stainless steel foils, niobium pieces and SiC substrates showed transition temperatures of above 36 K. Dielectric resonance measurements resulted in promising Q values as obtained for the MgB2 films grown on the various substrates. By employing the HPCVD technique, a uniform film was achieved across the cavity interior, demonstrating the feasibility of HPCVD for MgB2 coatings for SRF cavities.

  4. A Program for Optimizing SRF Linac Costs

    SciTech Connect

    Powers, Thomas J.

    2013-04-01

    Every well-designed machine goes through the process of cost optimization several times during its design, production and operation. The initial optimizations are done during the early proposal stage of the project when none of the systems have been engineered. When a superconducting radio frequency (SRF) linac is implemented as part of the design, it is often a difficult decision as to the frequency and gradient that will be used. Frequently, such choices are made based on existing designs, which invariably necessitate moderate to substantial modifications so that they can be used in the new accelerator. Thus the fallacy of using existing designs is that they will frequently provide a higher cost machine or a machine with sub-optimal beam physics parameters. This paper describes preliminary results of a new software tool that allows one to vary parameters and understand the effects on the optimized costs of construction plus 10 year operations of an SRF linac, the associated cryogenic facility, and controls, where operations includes the cost of the electrical utilities but not the labor or other costs. It derives from collaborative work done with staff from Accelerator Science and Technology Centre, Daresbury, UK [1] several years ago while they were in the process of developing a conceptual design for the New Light Source project. The initial goal was to convert a spread sheet format to a graphical interface to allow the ability to sweep different parameter sets. The tools also allow one to compare the cost of the different facets of the machine design and operations so as to better understand the tradeoffs.

  5. 40 CFR 35.3125 - Limitations on SRF assistance.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... ASSISTANCE STATE AND LOCAL ASSISTANCE State Water Pollution Control Revolving Funds § 35.3125 Limitations on... financing. (e) Water quality management planning. The SRF may provide assistance only to projects that...

  6. 40 CFR 35.3125 - Limitations on SRF assistance.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... ASSISTANCE STATE AND LOCAL ASSISTANCE State Water Pollution Control Revolving Funds § 35.3125 Limitations on... financing. (e) Water quality management planning. The SRF may provide assistance only to projects that...

  7. 40 CFR 35.3125 - Limitations on SRF assistance.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... ASSISTANCE STATE AND LOCAL ASSISTANCE State Water Pollution Control Revolving Funds § 35.3125 Limitations on... financing. (e) Water quality management planning. The SRF may provide assistance only to projects that...

  8. 40 CFR 35.3125 - Limitations on SRF assistance.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... ASSISTANCE STATE AND LOCAL ASSISTANCE State Water Pollution Control Revolving Funds § 35.3125 Limitations on... financing. (e) Water quality management planning. The SRF may provide assistance only to projects that...

  9. HOM Survey of the First CEBAF Upgrade Style Cavity Pair

    SciTech Connect

    Marhauser, Frank; Davis, G; Drury, Michael; Grenoble, Christiana; Hogan, John; Manus, Robert; Preble, Joseph; Reece, Charles; Rimmer, Robert; Tian, Kai; Wang, Haipeng

    2009-05-01

    The planned upgrade of the Continuous Electron Beam Accelerator Facility (CEBAF) at the Thomas Jefferson National Accelerator Laboratory (JLab) requires ten new superconducting rf (SRF) cavity cryomodules to double the beam energy to the envisaged 12 GeV. Adequate cavity Higher Order Mode (HOM) suppression is essential to avoid multipass, multibunch beam break-up (BBU) instabilities of the recirculating beam. We report on detailed HOM surveys performed for the first two upgrade style cavities tested in a dedicated cavity pair cryomodule at 2K. The safety margin to the BBU threshold budget at 12 GeV has been assessed.

  10. Control System Design for Automatic Cavity Tuning Machines

    SciTech Connect

    Carcagno, R.; Khabiboulline, T.; Kotelnikov, S.; Makulski, A.; Nehring, R.; Nogiec, J.; Ross, M.; Schappert, W.; Goessel, A.; Iversen, J.; Klinke, D.; /DESY

    2009-05-01

    A series of four automatic tuning machines for 9-cell TESLA-type cavities are being developed and fabricated in a collaborative effort among DESY, FNAL, and KEK. These machines are intended to support high-throughput cavity fabrication for construction of large SRF-based accelerator projects. Two of these machines will be delivered to cavity vendors for the tuning of XFEL cavities. The control system for these machines must support a high level of automation adequate for industrial use by non-experts operators. This paper describes the control system hardware and software design for these machines.

  11. Tunneling study of cavity grade Nb : possible magnetic scattering at the surface.

    SciTech Connect

    Prolier, T.; Zasadzinski, J. F.; Cooley, L.; Antoine, C.; Moore, J.; Pellin, M.; Norem, J.; Gray, K. E.; Materials Science Division; Illinois Inst. Tech.; FNAL; Centre d'etude de Saclay

    2008-01-01

    Tunneling spectroscopy was performed on Nb pieces prepared by the same processes used to etch and clean superconducting radio frequency (SRF) cavities. Air exposed, electropolished Nb exhibited a surface superconducting gap {Delta} = 1.55 meV, which is characteristic of a clean, bulk Nb. However, the tunneling density of states (DOS) was significantly broadened. The Nb pieces, which were treated with the same mild baking used to improve the Q slope in SRF cavities, reveal a sharper DOS. Good fits to the DOS were obtained by using the Shiba theory, suggesting that magnetic scattering of quasiparticles is the origin of the gapless surface superconductivity and a heretofore unrecognized contributor to the Q-slope problem of Nb SRF cavities.

  12. Potential SRF generation from a closed landfill in northern Italy.

    PubMed

    Passamani, Giorgia; Ragazzi, Marco; Torretta, Vincenzo

    2016-01-01

    The aim of this work is to assess the possibility of producing solid recovered fuel (SRF) and "combustible SRF" from a landfill located in the north of Italy, where the waste is placed in cylindrical wrapped bales. Since the use of landfills for the disposal of municipal solid waste has many technical limitations and is subject to strict regulations and given that landfill post-closure care is very expensive, an interesting solution is to recover the bales that are stored in the landfill. The contents of the bales can then be used for energy recovery after specific treatments. Currently the landfill is closed and the local municipal council together with an environmental agency are considering constructing a mechanical biological treatment (MBT) plant for SRF production. The municipal solid waste that is stored in the landfill, the bio-dried material produced by the hypothetically treated waste in a plant for bio-drying, and the SRF obtained after the post-extraction of inert materials, metals and glass from the bio-dried material were characterized according to the quality and classification criteria of regulations in Italy. The analysis highlighted the need to treat the excavated waste in a bio-drying plant and later to remove the inert waste, metals and glass. Thus in compliance with Italian law, the material has a high enough LHV to be considered as "combustible SRF", (i.e. an SRF with enhanced characteristics). PMID:26209342

  13. Mass, energy and material balances of SRF production process. Part 2: SRF produced from construction and demolition waste.

    PubMed

    Nasrullah, Muhammad; Vainikka, Pasi; Hannula, Janne; Hurme, Markku; Kärki, Janne

    2014-11-01

    In this work, the fraction of construction and demolition waste (C&D waste) complicated and economically not feasible to sort out for recycling purposes is used to produce solid recovered fuel (SRF) through mechanical treatment (MT). The paper presents the mass, energy and material balances of this SRF production process. All the process streams (input and output) produced in MT waste sorting plant to produce SRF from C&D waste are sampled and treated according to CEN standard methods for SRF. Proximate and ultimate analysis of these streams is performed and their composition is determined. Based on this analysis and composition of process streams their mass, energy and material balances are established for SRF production process. By mass balance means the overall mass flow of input waste material stream in the various output streams and material balances mean the mass flow of components of input waste material stream (such as paper and cardboard, wood, plastic (soft), plastic (hard), textile and rubber) in the various output streams of SRF production process. The results from mass balance of SRF production process showed that of the total input C&D waste material to MT waste sorting plant, 44% was recovered in the form of SRF, 5% as ferrous metal, 1% as non-ferrous metal, and 28% was sorted out as fine fraction, 18% as reject material and 4% as heavy fraction. The energy balance of this SRF production process showed that of the total input energy content of C&D waste material to MT waste sorting plant, 74% was recovered in the form of SRF, 16% belonged to the reject material and rest 10% belonged to the streams of fine fraction and heavy fraction. From the material balances of this process, mass fractions of plastic (soft), paper and cardboard, wood and plastic (hard) recovered in the SRF stream were 84%, 82%, 72% and 68% respectively of their input masses to MT plant. A high mass fraction of plastic (PVC) and rubber material was found in the reject material

  14. Review of ingot niobium as a material for superconducting radiofrequency accelerating cavities

    SciTech Connect

    Kneisel, P.; Ciovati, G.; Dhakal, P.; Saito, K.; Singer, W.; Singer, X.; Myneni, G. R.

    2014-12-01

    As a result of collaboration between Jefferson Lab and niobium manufacturer Companhia Brasileira de Metalurgia e Mineração (CBMM), ingot niobium was explored as a possible material for superconducting radiofrequency (SRF) cavity fabrication. The first single cell cavity from large-grain high purity niobium was fabricated and successfully tested at Jefferson Lab in 2004. This work triggered research activities in other SRF laboratories around the world. The large-grain (LG) niobium became not only an interesting alternative material for cavity builders, but also material scientists and surface scientists were eager to participate in the development of this technology. Many single cell cavities made from material of different suppliers have been tested successfully and several multi-cell cavities have shown performances comparable to the best cavities made from standard fine-grain niobium. Several 9-cell cavities fabricated by Research Instruments and tested at DESY exceeded the best performing fine grain cavities with a record accelerating gradient of Eacc=45.6 MV/m. The quality factor of those cavities was also higher than that of fine-grain (FG) cavities processed with the same methods. Such performance levels push the state-of-the art of SRF technology and are of great interest for future accelerators. This contribution reviews the development of ingot niobium technology and highlights some of the differences compared to standard FG material and opportunities for further developments.

  15. Review of ingot niobium as a material for superconducting radiofrequency accelerating cavities

    DOE PAGESBeta

    Kneisel, P.; Ciovati, G.; Dhakal, P.; Saito, K.; Singer, W.; Singer, X.; Myneni, G. R.

    2014-12-01

    As a result of collaboration between Jefferson Lab and niobium manufacturer Companhia Brasileira de Metalurgia e Mineração (CBMM), ingot niobium was explored as a possible material for superconducting radiofrequency (SRF) cavity fabrication. The first single cell cavity from large-grain high purity niobium was fabricated and successfully tested at Jefferson Lab in 2004. This work triggered research activities in other SRF laboratories around the world. The large-grain (LG) niobium became not only an interesting alternative material for cavity builders, but also material scientists and surface scientists were eager to participate in the development of this technology. Many single cell cavities mademore » from material of different suppliers have been tested successfully and several multi-cell cavities have shown performances comparable to the best cavities made from standard fine-grain niobium. Several 9-cell cavities fabricated by Research Instruments and tested at DESY exceeded the best performing fine grain cavities with a record accelerating gradient of Eacc=45.6 MV/m. The quality factor of those cavities was also higher than that of fine-grain (FG) cavities processed with the same methods. Such performance levels push the state-of-the art of SRF technology and are of great interest for future accelerators. This contribution reviews the development of ingot niobium technology and highlights some of the differences compared to standard FG material and opportunities for further developments.« less

  16. Review of ingot niobium as a material for superconducting radiofrequency accelerating cavities

    NASA Astrophysics Data System (ADS)

    Kneisel, P.; Ciovati, G.; Dhakal, P.; Saito, K.; Singer, W.; Singer, X.; Myneni, G. R.

    2015-02-01

    As a result of collaboration between Jefferson Lab and niobium manufacturer Companhia Brasileira de Metalurgia e Mineração (CBMM), ingot niobium was explored as a possible material for superconducting radiofrequency (SRF) cavity fabrication. The first single cell cavity from large-grain high purity niobium was fabricated and successfully tested at Jefferson Lab in 2004. This work triggered research activities in other SRF laboratories around the world. Large-grain (LG) niobium became not only an interesting alternative material for cavity builders, but also material scientists and surface scientists were eager to participate in the development of this technology. Many single cell cavities made from material of different suppliers have been tested successfully and several multi-cell cavities have shown performances comparable to the best cavities made from standard fine-grain niobium. Several 9-cell cavities fabricated by Research Instruments and tested at DESY exceeded the best performing fine grain cavities with a record accelerating gradient of Eacc=45.6 MV/m. The quality factor of those cavities was also higher than that of fine-grain (FG) cavities processed with the same methods. Such performance levels push the state-of-the art of SRF technology and are of great interest for future accelerators. This contribution reviews the development of ingot niobium technology and highlights some of the differences compared to standard FG material and opportunities for further developments.

  17. First Demonstration of Electron Beam Generation and Characterization with an All Superconducting Radio-frequency (SRF) Photoinjector

    SciTech Connect

    Kamps, T; Barday, R; Jankowiak, A; Knobloch, J; Kugeler, O; Matveenko, A N; Neumann, A; Quast, T; Rudolph, J; Schubert, S G; Volker, J; Kneisel, P; Nietubyc, R; Sekutowicz, J K; Smedley, J; Volkov, V; Weinberg, G; Will, I

    2011-09-01

    In preparation for a high brightness, high average current electron source for the energy-recovery linac BERLinPro an all superconducting radio-frequency photoinjector is now in operation at Helmholtz-Zentrum Berlin. The aim of this experiment is beam demonstration with a high brightness electron source able to generate sub-ps pulse length electron bunches from a superconducting (SC) cathode film made of Pb coated on the backwall of a Nb SRF cavity. This paper describes the setup of the experiment and first results from beam measurements.

  18. JLAMP: AN AMPLIFIER-BASED FEL IN THE JLAB SRF ERL DRIVER

    SciTech Connect

    Kevin Jordan; Stephen V. Benson; David Douglas; Pavel Evtushenko; Carlos Hernandez-Garcia; George R. Neil

    2007-06-13

    Notional designs for energy-recovering linac (“ERL”) -driven high average power free electron lasers (“FEL”s) often invoke amplifier-based architectures. To date, however, amplifier FELs have been limited in average power output to values several orders of magnitude lower than those demonstrated in optical-resonator based systems; this is due at least in part to the limited electron beam powers available from their driver accelerators. In order to directly contrast the performance available from amplifiers to that provided by high-power cavity-based resonators, we have developed a scheme to test an amplifier FEL in the JLab SRF ERL driver. We describe an accelerator system design that can seamlessly and non-invasively integrate a 10 m wiggler into the existing system and which provides, at least in principle, performance that would support high-efficiency lasing in an amplifier configuration. Details of the design and an accelerator performance analysis will be presented

  19. ANALYSIS OF HIGH FIELD NON-LINEAR LOSSES ON SRF SURFACES DUE TO SPECIFIC TOPOGRAPHIC ROUGHNESS

    SciTech Connect

    Chen Xu,Charles Reece,Michael Kelley

    2012-07-01

    The high-field performance of SRF cavities will eventually be limited by the realization of fundamental material limits, whether it is Hc1 or Hsh, or some derivative thereof, at which the superconductivity is lost. Before reaching this fundamental field limit at the macro level, it must be encountered at localized, perhaps microscopic, sites of field enhancement due to local topography. If such sites are small enough, they may produce thermally stabilized normal-conducting regions which contribute non-linear losses when viewed from the macro resonant field perspective, and thus produce degradation in Q0. We have undertaken a calculation of local surface magnetic field enhancement from specific fine topographic structure by conformal mapping method and numerically. A solution of the resulting normal conducting volume has been derived and the corresponding RF Ohmic loss simulated.

  20. RF Surface Impedance Characterization of Potential New Materials for SRF-based Accelerators

    SciTech Connect

    Xiao, Binping; Eremeev, Grigory V.; Reece, Charles E.; Phillips, H. Lawrence; Kelley, Michael J.

    2012-09-01

    In the development of new superconducting materials for possible use in SRF-based accelerators, it is useful to work with small candidate samples rather than complete resonant cavities. The recently commissioned Jefferson Lab RF Surface Impedance Characterization (SIC) system can presently characterize the central region of 50 mm diameter disk samples of various materials from 2 to 40 K exposed to RF magnetic fields up to 14 mT at 7.4 GHz. We report the recent measurement results of bulk Nb, thin film Nb on Cu and sapphire substrates, Nb{sub 3}Sn sample, and thin film MgB{sub 2} on sapphire substrate provided by colleagues at JLab and Temple University.

  1. Design, simulation and conditioning of the fundamental power couplers for BNL SRF gun

    SciTech Connect

    Xu W.; Altinbas, Z.; Belomestnykh, S.; Ben-Zvi, I. et al

    2012-05-20

    The 704 MHz SRF gun for the BNL Energy Recovery Linac (ERL) prototype uses two fundamental power couplers (FPCs) to deliver up to 1 MW of CW RF power to the half-cell cavity. To prepare the couplers for high-power RF service and process multipacting, the FPCs should be conditioned prior to installation into the gun cryomodule. A room-temperature test stand was configured for conditioning FPCs in full reflection regime with varied phase of the reflecting wave. The FPCs have been conditioned up to 250 kW in pulse mode and 125 kW in CW mode. The multipacting simulations were carried out with Track3P code developed at SLAC. The simulations matched the experimental results very well. This paper presents the FPC RF and thermal design, multipacting simulations and conditioning of the BNL gun FPCs.

  2. QE Tests with Nb-Pb SRF Photoinjector and Arc Deposited Cathodes

    SciTech Connect

    J.K. Sekutowicz, P. Kneisel, R. Nietubyc, T. Rao, J. Smedley

    2010-05-01

    In this contribution, we report Quantum Efficiency (QE) test results with a hybrid lead/niobium superconducting RF (SRF) photoinjector at 2K and new Pb arc deposited cathodes at 300K. The ultimate goal of our effort is to build a Nb injector with the superconducting cathode made of lead, which, as reported in the past, demonstrated superior QE compared to other metallic superconducting elements. At first, we present the test results obtained with a 1.6-cell high purity Nb cavity with the emitting lead spot in the center of the back plate. The QE test results at room temperature and the SEM surface analysis of eight Pb cathodes, deposited recently under various conditions, are discussed in the second part of this contribution.

  3. Application of superconducting magnesium diboride (MGB2) in superconducting radio frequency cavities

    NASA Astrophysics Data System (ADS)

    Tan, Teng

    The superconductivity in magnesium diboride (MgB2) was discovered in 2001. As a BCS superconductor, MgB2 has a record-high Tc of 39 K, high Jc of > 107 A/cm2 and no weak link behavior across the grain boundary. All these superior properties endorsed that MgB2 would have great potential in both power applications and electronic devices. In the past 15 years, MgB2 based power cables, microwave devices, and commercial MRI machines emerged and the next frontier are superconducting radio frequency (SRF) cavities. SRF cavities are one of the leading accelerator technologies. In SRF cavities, applied microwave power generates electrical fields that accelerate particle beams. Compared with other accelerator techniques, SRF cavity accelerators feature low loss, high acceleration gradients and the ability to accelerate continuous particle beams. However, current SRF cavities are made from high-purity bulk niobium and work at 2 K in superfluid helium. The construction and operational cost of SRF cavity accelerators are very expensive. The demand for SRF cavity accelerators has been growing rapidly in the past decade. Therefore, a lot of effort has been devoted to the enhancement of the performance and the reduction of cost of SRF cavities. In 2010, an acceleration gradient of over 50 MV/m has been reported for a Nb-based SRF cavity. The magnetic field at the inner surface of such a cavity is ~ 1700 Oe, which is close to the thermodynamic critical field of Nb. Therefore, new materials and technologies are required to raise the acceleration gradient of future SRF cavity accelerators. Among all the proposed approaches, using MgB2 thin films to coat the inner surface of SRF cavities is one of the promising tactics with the potential to raise both the acceleration gradient and the operation temperature of SRF cavity accelerators. In this work, I present my study on MgB2 thin films for their application in SRF cavities. C-epitaxial MgB2 thin films grown on SiC(0001) substrates

  4. Recent Progress of RF Cavity Study at Mucool Test Area

    SciTech Connect

    Yonehara, Katsuya; /Fermilab

    2011-12-02

    Summar of presentation is: (1) MTA is a multi task working space to investigate RF cavities for R&D of muon beam cooling channel - (a) Intense 400 MeV H{sup -} beam, (b) Handle hydrogen (flammable) gas, (c) 5 Tesla SC solenoid magnet, (d) He cryogenic/recycling system; (2) Pillbox cavity has been refurbished to search better RF material - Beryllium button test will be happened soon; (3) E x B effect has been tested in a box cavity - Under study (result seems not to be desirable); (4) 201 MHz RF cavity with SRF cavity treatment has been tested at low magnetic field - (a) Observed some B field effect on maximum field gradient and (b) Further study is needed (large bore SC magnet will be delivered end of 2011); and (5) HPRF cavity beam test has started - (a) No RF breakdown observed and (b) Design a new HPRF cavity to investigate more plasma loading effect.

  5. Status of the ILC Crab Cavity Development

    SciTech Connect

    Burt, G.; Dexter, A.; Beard, C.; Goudket, P.; McIntosh, P.; Bellantoni, L.; Grimm, T.; Li, Z.; Xiao, L.; /SLAC

    2011-10-20

    The International Linear Collider (ILC) will require two dipole cavities to 'crab' the electron and positron bunches prior to their collision. It is proposed to use two 9 cell SCRF dipole cavities operating at a frequency of 3.9 GHz, with a transverse gradient of 3.8MV/m in order to provide the required transverse kick. Extensive numerical modelling of this cavity and its couplers has been performed. Aluminium prototypes have been manufactured and tested to measure the RF properties of the cavity and couplers. In addition single cell niobium prototypes have been manufactured and tested in a vertical cryostat. The International Collider (ILC) [1] collides bunches of electrons and positrons at a crossing angle of 14 mrad. The angle between these bunches causes a loss in luminosity due to geometric effects [2]. The luminosity lost from this geometric effect can be recovered by rotating the bunches into alignment prior to collision. One possible method of rotating the bunches is to use a crab cavity [3]. A crab cavity is a transverse defecting cavity, where the phase of the cavity is such that the head and tail of the bunch receive equal and opposite kicks. As the bunches are only 500 nm wide in the horizontal plane, the cavity phase must be strictly controlled to avoid the bunch centre being deflected too much. In order to keep the phase stability within the required limits it is required that the cavity be superconducting to avoid thermal effects in both the cavity and its RF source. At the location of the crab cavity in the ILC there is only 23 cm separation between the centre of the cavity and the extraction line, hence the cavity must be small enough to fit in this space. This, along with the difficulty of making high frequency SRF components, set the frequency of the cavity to 3.9 GHz.

  6. Mirror smooth superconducting RF cavities by mechanical polishing with minimal acid use

    SciTech Connect

    Cooper, C.A.; Cooley, L.D.; /Fermilab

    2011-02-01

    A new mechanical technique for polishing the inside surface of niobium superconducting RF (SRF) cavities has been developed. Mirror-like finishes, the smoothest observed in cavities so far, were produced after fine polishing, with < 15 nm RMS roughness over 1 mm{sup 2} scan area. This is an order of magnitude less than the typical roughness produced by electropolishing. The processing equipment has advantages of modest installed and operating costs, simple associated technology, and no large quantities of acutely toxic chemicals or special handling procedures. Cavity quality factors above 10{sup 10} were maintained well above the 35 MV m{sup -1} benchmark for electropolished cavities, and this was achieved with an intermediate finish not as smooth as the final polish. Repair of a weld defect, which is intrinsic to this process, was also demonstrated. These transformational aspects could enable a new SRF cavity processing paradigm for future large scale particle accelerators such as the International Linear Collider.

  7. Development of Ultra High Gradient and High Q{sub 0} Superconducting Radio Frequency Cavities

    SciTech Connect

    Geng, Rongli; Clemens, William A.; Follkie, James E.; Harris, Teena M.; Kushnick, Peter W.; Machie, Danny; Martin, Robert E.; Palczewski, Ari D.; Perry, Era A.; Slack, Gary L.; Williams, R. S.; Adolphsen, C.; Li, Z.; Hao, J. K.; Li, Y. M.; Liu, K. X.

    2013-06-01

    We report on the recent progress at Jefferson Lab in developing ultra high gradient and high Q{sub 0} superconducting radio frequency (SRF) cavities for future SRF based machines. A new 1300 MHz 9-cell prototype cavity is being fabricated. This cavity has an optimized shape in terms of the ratio of the peak surface field (both magnetic and electric) to the acceleration gradient, hence the name low surface field (LSF) shape. The goal of the effort is to demonstrate an acceleration gradient of 50 MV/m with Q{sub 0} of 10{sup 10} at 2 K in a 9-cell SRF cavity. Fine-grain niobium material is used. Conventional forming, machining and electron beam welding method are used for cavity fabrication. New techniques are adopted to ensure repeatable, accurate and inexpensive fabrication of components and the full assembly. The completed cavity is to be first mechanically polished to a mirror-finish, a newly acquired in-house capability at JLab, followed by the proven ILC-style processing recipe established already at JLab. In parallel, new single-cell cavities made from large-grain niobium material are made to further advance the cavity treatment and processing procedures, aiming for the demonstration of an acceleration gradient of 50 MV/m with Q{sub 0} of 2�10{sup 10} at 2K.

  8. High intensity SRF proton linac workshop (vugraphs)

    SciTech Connect

    Rusnak, B.A.

    1995-11-01

    The meeting is divided into four sections. The first section is the general introduction and included opening remarks and an overview of APT (accelerator product of tritium). The second section contains vugraphs from the cavity-structures working group. The third section is comprised of vugraphs from the couplers and rf working group. And the fourth section contains vugraphs of the system integration group.

  9. Laser performance of diode-pumped Nd, Y-codoped CaF 2-SrF 2 mixed crystal

    NASA Astrophysics Data System (ADS)

    Liu, J.; Fan, M. W.; Su, L. B.; Jiang, D. P.; Ma, F. K.; Zhang, Q.; Xu, J.

    2014-03-01

    A disordered Nd, Y-codoped CaF2-SrF2 mixed crystal was obtained by the temperature gradient technique (TGT). The absorption and fluorescence spectra of the crystal were measured at room temperature. Diode-pumped continuous-wave (CW) and Q-switched laser operations were demonstrated at 1056 nm with a 0.65 at.% Nd, 10 at.% Y-codoped crystal, for the first time to our knowledge. The CW output power of 724 mW was obtained in a compact linear cavity. Also the Q-switched pulse characteristics of Nd, Y:CaF2-SrF2 laser crystal were reported based on Cr4+:YAG saturable absorbers in a folded cavity. The shortest pulse width of 110 ns and the highest peak power of 383 W were obtained when the initial transmission of the Cr4+:YAG crystals was 90%. The dependence of the operational parameters on the pump power was also investigated experimentally.

  10. Mechanical design and engineering of the 3.9 GHZ, 3rd harmonic SRF system at Fermilab

    SciTech Connect

    Don Mitchell et al.

    2004-08-05

    The mechanical development of the 3.9 GHz, 3rd Harmonic SRF System is summarized to include: the development of a full scale copper prototype cavity structure; the design of the niobium 3 cell and niobium 9 cell structures; the design of the helium vessel and cryostat; the HOM coupler design; and a preliminary look at the main coupler design. The manufacturing processes for forming, rolling, and e-beam welding the HOM coupler, cavity cells, and end tubes are also described. Due to the exotic materials and manufacturing processes used in this type of device, a cost estimate for the material and fabrication is provided. The 3rd harmonic design is organized via a web-based data management approach.

  11. Reactive RF Tuning For Compensation of a Detuned Accelerating Cavity

    SciTech Connect

    Yoon Kang; Michael Tiefenback; Pavel Chevtsov

    2002-08-01

    The resonant frequency of an accelerating RF cavity is detuned from the desired frequency by certain physical disturbances, such as thermal and other mechanical wall distortions. Cavity wall distortions due to microphonics (acoustic vibrations) and the Lorentz force (radiation pressure) can be serious problems in pulsed RF operation of superconducting (SRF) cavities with thin cavity walls and a high quality factor. The resulting detuning results a change of input reactance. The offset reactance at the cavity input may be tuned out properly with a reactive element in the input transmission line, so that the generator RF power can be delivered efficiently to the cavity. A fast response electrical tuner may be built for compensating high frequency detuning without any mechanical coupling.

  12. SRF regulates craniofacial development through selective recruitment of MRTF cofactors by PDGF signaling

    PubMed Central

    Vasudevan, Harish N.; Soriano, Philippe

    2014-01-01

    Summary Receptor tyrosine kinase signaling is critical for mammalian craniofacial development, but the key downstream transcriptional effectors remain unknown. We demonstrate that SRF is induced by both PDGF and FGF signaling in mouse embryonic palatal mesenchyme cells, and Srf neural crest conditional mutants exhibit facial clefting accompanied by proliferation and migration defects. Srf and Pdgfra mutants interact genetically in craniofacial development, but Srf and Fgfr1 mutants do not. This signal specificity is recapitulated at the level of cofactor activation: while both PDGF and FGF target gene promoters show enriched genome-wide overlap with SRF ChIP-seq peaks, PDGF selectively activates a network of MRTF-dependent cytoskeletal genes. Collectively, our results identify a novel role for SRF in proliferation and migration during craniofacial development and delineate a mechanism of receptor tyrosine kinase specificity mediated through differential cofactor usage, leading to a unique PDGF-responsive SRF-driven transcriptional program in the midface. PMID:25453829

  13. First-principles calculations of niobium hydride formation in superconducting radio-frequency cavities

    SciTech Connect

    Ford, Denise C.; Cooley, Lance D.; Seidman, David N.

    2013-09-01

    Niobium hydride is suspected to be a major contributor to degradation of the quality factor of niobium superconducting radio-frequency (SRF) cavities. In this study, we connect the fundamental properties of hydrogen in niobium to SRF cavity performance and processing. We modeled several of the niobium hydride phases relevant to SRF cavities and present their thermodynamic, electronic, and geometric properties determined from calculations based on density-functional theory. We find that the absorption of hydrogen from the gas phase into niobium is exothermic and hydrogen becomes somewhat anionic. The absorption of hydrogen by niobium lattice vacancies is strongly preferred over absorption into interstitial sites. A single vacancy can accommodate six hydrogen atoms in the symmetrically equivalent lowest-energy sites and additional hydrogen in the nearby interstitial sites affected by the strain field: this indicates that a vacancy can serve as a nucleation center for hydride phase formation. Small hydride precipitates may then occur near lattice vacancies upon cooling. Vacancy clusters and extended defects should also be enriched in hydrogen, potentially resulting in extended hydride phase regions upon cooling. We also assess the phase changes in the niobium-hydrogen system based on charge transfer between niobium and hydrogen, the strain field associated with interstitial hydrogen, and the geometry of the hydride phases. The results of this study stress the importance of not only the hydrogen content in niobium, but also the recovery state of niobium for the performance of SRF cavities.

  14. First Test Results of the bERLinPro 2-cell Booster Cavities

    SciTech Connect

    Burrill, Andrew; Anders, W.; Frahm, A.; Knobloch, Jens; Neumann, Axel; Ciovati, Gianluigi; Clemens, William; Kneisel, Peter; Turlington, Larry

    2015-09-01

    The bERLinPro Energy Recovery Linac (ERL) is currently being built at Helmholtz-Zentrum Berlin in order to study the physics of operating a high-current, a 100 mA, 50 MeV ERL utilizing all SRF cavity technology. This machine will utilize three unique SRF cryomodules for the photoinjector, booster and linac cryomodules respectively. The focus of this paper will be on the cavities contained within the booster cryomodule. Here there will be three 2-cell SRF cavities, based on the original design by Cornell University, but optimized to meet the needs of the project. All of the cavity fabrication, processing and testing was carried out at Jefferson Laboratory, where 4 cavities were produced, and the 3 cavities with the best RF performance were fitted with helium vessels for installation in the cryomodule. This paper will report on the test results of the cavities as measured in the vertical testing dewar at JLab after fabrication and again after outfitting with the helium vessels.

  15. A Study of Thermocurrent Induced Magnetic Fields in ILC Cavities

    SciTech Connect

    Crawford, Anthony C.; Cooley, Victoria

    2014-03-31

    The case of axisymmetric ILC type cavities with titanium helium vessels is investigated. A first order estimate for magnetic field within the SRF current layer is presented. The induced magnetic field is found to be not more than 1.4x10-8 Tesla = 0.14 milligauss for the case of axial symmetry. Magnetic fields due to symmetry breaking effects are discussed.

  16. Flux pinning characteristics in cylindrical ingot niobium used in superconducting radio frequency cavity fabrication

    SciTech Connect

    Dhavale Ashavai, Pashupati Dhakal, Anatolii A Polyanskii, Gianluigi Ciovati

    2012-04-01

    We present the results of from DC magnetization and penetration depth measurements of cylindrical bulk large-grain (LG) and fine-grain (FG) niobium samples used for the fabrication of superconducting radio frequency (SRF) cavities. The surface treatment consisted of electropolishing and low temperature baking as they are typically applied to SRF cavities. The magnetization data were fitted using a modified critical state model. The critical current density Jc and pinning force Fp are calculated from the magnetization data and their temperature dependence and field dependence are presented. The LG samples have lower critical current density and pinning force density compared to FG samples which implies a lower flux trapping efficiency. This effect may explain the lower values of residual resistance often observed in LG cavities than FG cavities.

  17. Physical and mechanical metallurgy of high purity Nb for accelerator cavities

    SciTech Connect

    Bieler, T. R.; Wright, N. T.; Pourboghrat, F.; Compton, C.; Hartwig, K. T.; Baars, D.; Zamiri, A.; Chandrasekaran, S.; Darbandi, P.; Jiang, H.; Skoug, E.; Balachandran, S.; Ice, Gene E; Liu, W.

    2010-01-01

    In the past decade, high Q values have been achieved in high purity Nb superconducting radio frequency (SRF) cavities. Fundamental understanding of the physical metallurgy of Nb that enables these achievements is beginning to reveal what challenges remain to establish reproducible and cost-effective production of high performance SRF cavities. Recent studies of dislocation substructure development and effects of recrystallization arising from welding and heat treatments and their correlations with cavity performance are considered. With better fundamental understanding of the effects of dislocation substructure evolution and recrystallization on electron and phonon conduction, as well as the interior and surface states, it will be possible to design optimal processing paths for cost-effective performance using approaches such as hydroforming, which minimizes or eliminates welds in a cavity.

  18. BERLinPro Booster Cavity Design, Fabrication and Test Plans

    SciTech Connect

    Burrill, Andrew; Anders, W; Frahm, A.; Knobloch, Jens; Neumann, Axel; Ciovati, Gianluigi; Kneisel, Peter K.; Turlington, Larry D.

    2014-12-01

    The bERLinPro project, a 100 mA, 50 MeV superconducting RF (SRF) Energy Recovery Linac (ERL) is under construction at Helmholtz-Zentrum Berlin for the purpose of studying the technical challenges and physics of operating a high current, c.w., 1.3 GHz ERL. This machine will utilize three unique SRF cryomodules for the injector, booster and linac module respectively. The booster cryomodule will contain three 2-cell SRF cavities, based on the original design by Cornell University, and will be equipped with twin 115 kW RF power couplers in order to provide the appropriate acceleration to the high current electron beam. This paper will review the status of the fabrication of the 4 booster cavities that have been built for this project by Jefferson Laboratory and look at the challenges presented by the incorporation of fundamental power couplers capable of delivering 115 kW. The test plan for the cavities and couplers will be given along with a brief overview of the cryomodule design.

  19. Investigation of Microscopic Materials Limitations of Superconducting RF Cavities

    SciTech Connect

    Anlage, Steven

    2014-07-23

    The high-field performance of SRF cavities is often limited by breakdown events below the intrinsic limiting surface fields of Nb, and there is abundant evidence that these breakdown events are localized in space inside the cavity. Also, there is a lack of detailed understanding of the causal links between surface treatments and ultimate RF performance at low temperatures. An understanding of these links would provide a clear roadmap for improvement of SRF cavity performance, and establish a cause-and-effect ‘RF materials science’ of Nb. We propose two specific microscopic approaches to addressing these issues. First is a spatially-resolved local microwave-microscope probe that operates at SRF frequencies and temperatures to discover the microscopic origins of breakdown, and produce quantitative measurements of RF critical fields of coatings and films. Second, RF Laser Scanning Microscopy (LSM) has allowed visualization of RF current flow and sources of nonlinear RF response in superconducting devices with micro-meter spatial resolution. The LSM will be used in conjunction with surface preparation and characterization techniques to create definitive links between physical and chemical processing steps and ultimate cryogenic microwave performance. We propose to develop RF laser scanning microscopy of small-sample Nb pieces to establish surface-processing / RF performance relations through measurement of RF current distributions on micron-length scales and low temperatures.

  20. Thermoluminescence dosimetry features of DY and Cu doped SrF2 nanoparticles under gamma irradiation.

    PubMed

    Zahedifar, M; Sadeghi, E; Kashefi biroon, M; Harooni, S; Almasifard, F

    2015-11-01

    Dy and Cu-doped SrF2 nanoparticles (NPs) were synthesized by using co-precipitation method and their possible application to solid state dosimetry were studied and compared to that of pure SrF2 NPs. X-ray diffraction (XRD), scanning electron microscopy (SEM) and energy dispersive spectrometer (EDS) were used for sample characterization. The highest thermoluminescence (TL) response of SrF2:Dy and SrF2:Cu NPs were found respectively at 0.5 and 0.7mol% of Dy and Cu impurities. Seven overlapping glow peaks at 384, 406, 421, 449, 569, 495, 508K and three component glow peaks at 381, 421 and 467K were identified respectively for SrF2:Dy and SrF2:Cu NPs employing Tm-Tstop and computerized glow curve deconvolution (CGCD) methods. The TL sensitivity of SrF2:Dy is approximately the same as that of LiF:Mg,Ti (TLD-100) cheeps. Linear dose response were observed for the SrF2:Dy and SrF2:Cu NPs up to the absorbed doses of 1kGy and 10kGy correspondingly. Regarding other dosimetry characteristics of the produced NPs such as fading, reproducibility and thermal treatment, Dy and Cu doped SrF2 NPs recommend for high dose TL dosimetry applications. PMID:26319090

  1. A selection of high gradient cavity experiments

    SciTech Connect

    Peter Kneisel

    1998-01-01

    In the two years since the 7th SRF workshop, a variety of cavity tests have been carried out with the objective to reproducibly achieve surface electric rf fields above 40 MV/m with no or only very little electron loading. This paper reports about a collection of tests on single cell and multi-cell cavities, which received standard surface treatments such as buffered chemical polishing and high pressure ultrapure water rinsing, but no heat treatments. Often the cavities were limited by quenches, posting a limit of 700 to 1,000 Oersted on achievable peak magnetic fields of high purity niobium RRR values between 200 and 250. In a seamless single cell cavity fabricated by V. Palmieri of INFN Legnaro by spinning, a very promising gradient of E{sub acc}=25 MV/m was measured. In collaboration with CERN, several tests on sputtering niobium prepared at CERN were also carried out, and accelerating gradients up to 25 MV/m were achieved. A single cell cavity, electron beam welded after electrochemical buffing, showed only good performance--E{sub p} > 50 MV/m--after the removal of more than 100 {micro}m of material. However, this cavity showed rather heavy Q disease even when cooled down rapidly; the Q degradation could be partially reversed by diffusing the oxygen from an anodized Nb{sub 2}O{sub 5} layer into the niobium by heating the cavity in-situ at T=250 C.

  2. Lorentz Force Detuning Analysis of the SNS Accelerating Cavities

    SciTech Connect

    R. Mitchell; K. Matsumoto; G. Ciovati; K. Davis; K. Macha; R. Sundelin

    2001-09-01

    The Spallation Neutron Source (SNS) project incorporates a superconducting radio-frequency (SRF) accelerator for the final section of the pulsed mode linac Cavities with geometrical {beta} values of {beta} = 0.61 and {beta} = 0.81 are utilized in the SRF section, and are constructed out of thin-walled niobium with stiffener rings welded between the cells near the iris. The welded titanium helium vessel and tuner assembly restrains the cavity beam tubes Cavities with {beta} values less than one have relatively steep and flat side-walls making the cavities susceptible to Ised RF induces cyclic Lorentz pressures that mechanically excite the cavities, producing a dynamic Lorentz force detuning different from a continuous RF system. The amplitude of the dynamic detuning for a given cavity design is a function of the mechanical damping, stiffness of the tuner/helium vessel assembly, RF pulse profile, and the RF pulse rate. This paper presents analysis and testing results to date, and indicates areas where more investigation is required.

  3. A path to higher Q0 with large grain niobium cavities

    SciTech Connect

    Pashupati Dhakal, Gianluigi Ciovati, Ganapati Rao Myneni

    2012-07-01

    The improvement of the quality factor Q{sub 0} of superconducting radio-frequency (SRF) cavities at medium accelerating gradients ({approx} 20 MV/m) is important in order to reduce the cryogenic losses in continuous wave accelerators for a variety of applications. In recent years, SRF cavities fabricated from ingot niobium have become a viable alternative to standard high-purity fine-grain Nb for the fabrication of high-performing SRF cavities with the possibility of significant cost reduction. Initial studies demonstrated the improvement of Q{sub 0} at medium field in cavities heat treated at 800-1000 C without subsequent chemical etching. To further explore this treatment procedure, a new induction furnace with an all-niobium hot-zone was commissioned. A single-cell 1.5 GHz cavity fabricated from ingot material from CBMM, Brazil, with RRR {approx} 200, was heat treated with the new furnace in the temperature range 600-1200 C for several hours. Residual resistance values 1-5 nano-ohm have been consistently achieved on this cavity as well as Q{sub 0} values above {approx} 2 x 10{sup 11} at 2 K and 100 mT peak surface magnetic field. Q{sub 0}-values of the order of 10{sup 11} have been measured at 1.5 K.

  4. R&D of BEPCII 500 MHz superconducting cavity

    NASA Astrophysics Data System (ADS)

    Liu, YaPing; Wang, GuangWei; Pan, WeiMin; Li, JiZhen; Liu, DeGui; Sun, Yi; Li, ZhongQuan; Dai, JianPing; Li, ShaoPeng; He, Kun; Wang, GuoPing; Zhao, GuangYuan; Ma, Qiang; Lin, HaiYing; Sha, Peng; Wang, QunYao; Qiu, Feng; Meng, FanBo; Li, Han

    2011-12-01

    Beijing Electron-Positron Collider Upgrade (BEPCII) adopts two 500 MHz superconducting cavities (SCCs) in each ring for higher accelerated gradient, higher Q and lower impedance (Wang et al. The proceedings of SRF'07). There's no spare cavity due to the limited time and funding during BEPCII construction. If any serious trouble happened on either one of the two cavities and could not be recovered in a short time, the operation of BEPCII facility will be affected. Therefore, since 2009 three spare cavities have been fabricated in China to ensure reliable operation, and two of them have been successfully vertically tested in January and July 2011. This paper will briefly present the manufacture, post-process and vertical test performance of the 500 MHz spare cavities.

  5. Temperature Mapping of Nitrogen-doped Niobium Superconducting Radiofrequency Cavities

    SciTech Connect

    Makita, Junki; Ciovati, Gianluigi; Dhakal, Pashupati

    2015-09-01

    It was recently shown that diffusing nitrogen on the inner surface of superconducting radiofrequency (SRF) cavities at high temperature can improve the quality factor of the niobium cavity. However, a reduction of the quench field is also typically found. To better understand the location of rf losses and quench, we used a thermometry system to map the temperature of the outer surface of ingot Nb cavities after nitrogen doping and electropolishing. Surface temperature of the cavities was recorded while increasing the rf power and also during the quenching. The results of thermal mapping showed no precursor heating on the cavities and quenching to be ignited near the equator where the surface magnetic field is maximum. Hot-spots at the equator area during multipacting were also detected by thermal mapping.

  6. Fabrication and Testing of Deflecting Cavities for APS

    SciTech Connect

    Mammosser, John; Wang, Haipeng; Rimmer, Robert; Jim, Henry; Katherine, Wilson; Dhakal, Pashupati; Ali, Nassiri; Jim, Kerby; Jeremiah, Holzbauer; Genfa, Wu; Joel, Fuerst; Yawei, Yang; Zenghai, Li

    2013-09-01

    Jefferson Lab (Newport News, Virginia) in collaboration with Argonne National Laboratory (Argonne, IL) has fabricated and tested four first article, 2.8 GHz, deflecting SRF cavities, for Argonne's Short-Pulse X-ray (SPX) project. These cavities are unique in many ways including the fabrication techniques in which the cavity cell and waveguides were fabricated. These cavity subcomponents were milled from bulk large grain niobium ingot material directly from 3D CAD files. No forming of sub components was used with the exception of the beam-pipes. The challenging cavity and helium vessel design and fabrication results from the stringent RF performance requirements required by the project and operation in the APS ring. Production challenges and fabrication techniques as well as testing results will be discussed in this paper.

  7. Fundamental Study of Micro-Defects in Electropolished EB-Welded and Hydroformed SRF Accelerating Structures

    SciTech Connect

    Sumption, Mike

    2014-08-29

    In the area of niobium elecropolishing fundamentals, we focused on understanding the influence of the surface topology, and geometry (with effects from gravity included. The formation of a viscous film is essential for the electropolishing process to take place. The exact nature and composition of the film formed on niobium is still unknown because of its solubility in the electrolyte. Extensive pitting may take place at surface where a stable film cannot form. This has to be taken into consideration while determining the speed with which the SRF cavities are rotated while EP. Hydrodynamic aspects must be taken into consideration while optimizing the polishing parameters. There is improvement in surface finish with polishing time. There is a huge change in surface quality when the EP time is increased from 2 hours to 4 hours but not much change takes place when the time is further increased to 6 hours. So keeping the economic points in view, about 100 um defect layer removal may be sufficient to get the desired performance. In the area of Electropolishing of untreated and treated niobium with Weld Joints we studied untreated and treated Nb, especially for the heat affected areas next to welded bumps, electropolished for different durations. The electropolishing of the untreated Nb caused the formation of pits on the surface at about 15 min but they disappeared when the electropolishing duration was more than 15 min. Electropolishing for 120 min smoothened the surface of untreated Nb by levelling the surface, but the severe formation of pits on the whole surface was found after 240 min. The treatment of Nb significantly changed the Nb surface morphology which was covered by grains of different size that looked light or dark in the optical microscope. The treated Nb was susceptible to pitting during the entire electropolishing starting from 15 min and the dark grains had more susceptibility to pitting than the light grains. In addition, electropolishing for 240 min

  8. The 300 mA SRF ERL

    SciTech Connect

    Ben-Zvi, Ilan

    2013-11-07

    Energy Recovery Linacs (ERL) are important for a variety of applications, from high-power Free-Electron Lasers (FEL) to polarized-electron polarized-proton colliders. The ERL current is arguably the most important characteristic of ERLs for such applications. With that in mind, the Collider-Accelerator Department at Brookhaven National Laboratory embarked on the development of a 300 mA ERL to serve as an R and D test-bed for high-current ERL technologies. These include high-current, extremely well damped superconducting accelerating cavities, high-current superconducting laser-photocathode electron guns and high quantum-efficiency photocathodes. In this presentation I will cover these ERL related developments.

  9. Effect of Modified Mechanical Treatment Facilities on SRF Yield in Korea

    NASA Astrophysics Data System (ADS)

    Jo, Mi-Hyun; Lee, Byung-Jin; Lee, Jai-Young

    2013-12-01

    An SRF plant which can produce 100 ton/month of SRF, one of the largest manufacturing plants in Korea, was investigated in this study. The actual operated SRF yield at 21.7 % that showed a lower yield than expected; originally designed value was 25.0%. The cause of these results was the difference between characteristics of MSW applied to this plant originally and that which was actual incoming. The MSW led to decrease the separation efficiency of the mechanical treatment process. Thus, each element of the facility was modified. After modification, the SRF yield increased to 30.9%, whereas the physico-chemical properties of SRF were satisfied with domestic standard of SRF regardless of modifying MT facilities.

  10. Update on the CeC PoP 704 MHz 5-cell cavity cryomodule design and fabrication

    SciTech Connect

    Brutus, J. C.; Belomestnykh, S.; Ben-Zvi, I.; Grimm, T.; Huang, Y.; Jecks, R.; Kelly, M.; Litvinenko, V.; Pinayev, I.; Reid, T.; Skaritka, J.; Snydstrup, L.; Than, R.; Tuozzolo, J.; Xu, W.; Yancey, J.; Gerbick, S.

    2015-05-03

    A 5-cell SRF cavity operating at 704 MHz will be used for the Coherent Electron Cooling Proof of Principle (CeC PoP) system under development for the Relativistic Heavy Ion Collider (RHIC) at Brookhaven National Laboratory. The CeC PoP experiment will demonstrate the new technique of cooling proton and ion beams that may increase the beam luminosity in certain cases, by as much as tenfold. The 704 MHz cavity will accelerate 2 MeV electrons from a 112 MHz SRF gun up to 22MeV. This paper provides an overview of the design, the project status and schedule of the 704 MHz 5-cell SRF for CeC PoP experiment.

  11. Performance characteristics of Jefferson Lab's new SRF infrastructure

    SciTech Connect

    Reece, Charles E.; Denny, Philip; Reilly, Anthony

    2013-09-01

    In the past two years, Jefferson Lab has reconfigured and renovated its SRF support infrastructure as part of the Technology and Engineering Development Facility project, TEDF. The most significant changes are in the cleanroom and chemistry facilities. We report the initial characterization data on the new ultra-pure water systems, cleanroom facilities, describe the reconfiguration of existing facilities and also opportunities for flexible growth presented by the new arrangement.

  12. Elemental balance of SRF production process: solid recovered fuel produced from municipal solid waste.

    PubMed

    Nasrullah, Muhammad; Vainikka, Pasi; Hannula, Janne; Hurme, Markku; Oinas, Pekka

    2016-01-01

    In the production of solid recovered fuel (SRF), certain waste components have excessive influence on the quality of product. The proportion of rubber, plastic (hard) and certain textiles was found to be critical as to the elemental quality of SRF. The mass flow of rubber, plastic (hard) and textiles (to certain extent, especially synthetic textile) components from input waste stream into the output streams of SRF production was found to play the decisive role in defining the elemental quality of SRF. This paper presents the mass flow of polluting and potentially toxic elements (PTEs) in SRF production. The SRF was produced from municipal solid waste (MSW) through mechanical treatment (MT). The results showed that of the total input chlorine content to process, 55% was found in the SRF and 30% in reject material. Of the total input arsenic content, 30% was found in the SRF and 45% in fine fraction. In case of cadmium, lead and mercury, of their total input content to the process, 62%, 38% and 30%, respectively, was found in the SRF. Among the components of MSW, rubber material was identified as potential source of chlorine, containing 8.0 wt.% of chlorine. Plastic (hard) and textile components contained 1.6 and 1.1. wt.% of chlorine, respectively. Plastic (hard) contained higher lead and cadmium content compared with other waste components, i.e. 500 mg kg(-1) and 9.0 mg kg(-1), respectively. PMID:26608898

  13. Superconducting cavity tuner performance at CEBAF

    SciTech Connect

    Marshall, J.; Preble, J.; Schneider, W.

    1993-06-01

    At the Continuous Electron Beam Accelerator Facility (CEBAF), a 4 GeV, multipass CW electron beam is to be accelerated by 338 SRF, 5-cell niobium cavities operating at a resonant frequency of 1497 MHz. Eight cavities arranged as four pairs comprise a cyromodule, a croygenically isolated linac subdivision. The frequency is controlled by a mechanical tune attached to the first and fifth cell of the cavity which elastically deforms the cavity and thereby alters its resonant frequency. The tuner is driven by a stepper motor mounted external to the cryomodule that transfers torque through two rotary feedthroughs. A linear variable differential transducer (LVDT) mounted on the tuner monitors the displacement, and two limit switches interlock the movement beyond a 400 kHz bandwidth. Since the cavity has a loaded Q of 6.6 {center_dot} 10{sup 6}, the control system must maintain the frequency of the cavity to within {plus_minus} 50 Hz of the drive frequency for efficient coupling. This requirement is somewhat difficult to achieve since the difference in thermal contractions of the cavity and the tuner creates a frequency hystersis of approximately 10 kHz. The cavity is also subject to frequency shifts due to pressure fluctuations of the helium bath as well as radiation pressure. This requires that each cavity be characterized in terms of frequency change as a function of applied motor steps to allow proper tuning operations. This paper describes the electrical and mechanical performance of the cavity tuner during the commissioning and operation of the cryomodulus manufactured to date.

  14. Surface characterization of niobium for superconducting RF cavities

    NASA Astrophysics Data System (ADS)

    Cao, Chaoyue

    Surface characterization techniques including point contact tunneling (PCT) spectroscopy and Raman spectroscopy have been employed to study the surface of niobium (Nb) superconducting radio frequency (SRF) cavities. PCT spectroscopy provides a direct means of measuring the surface superconductivity, which is closely correlated with the cavity's performance characterized by the quality factor Q. Cavities with remarkably high Q show near ideal tunneling spectra with sharp coherent peaks and low zero bias conductance, consistent with the Bardeen-Cooper-Schrieffer (BCS) density of stats (DOS), and bulk gap parameter, Delta = 1.55-1.6 meV. Cavities with Q-drop often exhibit strong non-uniform heating during RF operations, with high loss regions identified as hot spots. PCT spectra on hot spots reveal suppressed superconductivity, broadened DOS and Kondo tunneling, consistent with magnetic impurities on the surface. Raman spectra on hot spots indicate the presence of various impurities on the surface including amorphous carbon, C-H chain compounds and NbC, providing insights into the formation of hot spots. The origin of the impurities is unclear at present but it is suggested that particular processing steps in SRF cavity fabrication may be responsible.

  15. Testing a GaAs cathode in SRF gun

    SciTech Connect

    Wang, E.; Kewisch, J.; Ben-Zvi, I.; Burrill, A.; Rao, T.; Wu, Q.; Holmes, D.

    2011-03-28

    RF electron guns with a strained superlattice GaAs cathode are expected to generate polarized electron beams of higher brightness and lower emittance than do DC guns, due to their higher field gradient at the cathode's surface and lower cathode temperature. We plan to install a bulk GaAs:Cs in a SRF gun to evaluate the performance of both the gun and the cathode in this environment. The status of this project is: In our 1.3 GHz 1/2 cell SRF gun, the vacuum can be maintained at nearly 10{sup -12} Torr because of cryo-pumping at 2K. With conventional activation of bulk GaAs, we obtained a QE of 10% at 532 nm, with lifetime of more than 3 days in the preparation chamber and have shown that it can survive in transport from the preparation chamber to the gun. The beam line has been assembled and we are exploring the best conditions for baking the cathode under vacuum. We report here the progress of our test of the GaAs cathode in the SRF gun. Future particle accelerators, such as eRHIC and the ILC require high-brightness, high-current polarized electrons. Strained superlattice GaAs:Cs has been shown to be an efficient cathode for producing polarized electrons. Activation of GaAs with Cs,O(F) lowers the electron affinity and makes it energetically possible for all the electrons, excited into the conduction band that drift or diffuse to the emission surface, to escape into the vacuum. Presently, all operating polarized electron sources, such as the CEBAF, are DC guns. In these devices, the excellent ultra-high vacuum extends the lifetime of the cathode. However, the low field gradient on the photocathode's emission surface of the DC guns limits the beam quality. The higher accelerating gradients, possible in the RF guns, generate a far better beam. Until recently, most RF guns operated at room temperature, limiting the vacuum to {approx}10{sup -9} Torr. This destroys the GaAs's NEA surface. The SRF guns combine the excellent vacuum conditions of DC guns and the high

  16. Magnetic shielding for the Fermilab Vertical Cavity Test Facility

    SciTech Connect

    Ginsburg, Camille M.; Reid, Clark; Sergatskov, Dmitri A.; /Fermilab

    2008-09-01

    A superconducting RF cavity has to be shielded from magnetic fields present during cool down below the critical temperature to avoid freezing in the magnetic flux at localized impurities, thereby degrading the cavity intrinsic quality factor Q{sub 0}. The magnetic shielding designed for the Fermilab vertical cavity test facility (VCTF), a facility for CW RF vertical testing of bare ILC 1.3 GHz 9-cell SRF cavities, was recently completed. For the magnetic shielding design, we used two cylindrical layers: a room temperature 'outer' shield of Amumetal (80% Ni alloy), and a 2K 'inner' shield of Cryoperm 10. The magnetic and mechanical design of the magnetic shielding and measurement of the remanent magnetic field inside the shielding are described.

  17. First Characterization of a Fully Superconducting RF Photoinjector Cavity

    SciTech Connect

    Neumann, A; Barday, R; Jankowiak, A; Kamps, T; Knobloch, J; Kugeler, O; Matveenko, A N; Quast, T; Rudolph, J; Schubert, S G; Volker, J; Kneisel, P; Nietubyc, R; Sekutowicz, J K; Smedley, J; Volkov, V; Weinberg, G; Will, I

    2011-09-01

    As a first step towards a high brightness, high average current electron source for the BERLinPro ERL a fully superconducting photo-injector was developed by HZB in collaboration with JLab, DESY and the A. Soltan Institute. This cavity-injector ensemble is made up of a 1.6-cell superconducting cavity with a superconducting lead cathode deposited on the half-cell backwall. A superconducting solenoid is used for emittance compensation. This system, including a diagnostics beamline, has been installed in the HoBiCaT facility to serve as a testbed for beam dynamics studies and to test the combination SRF cavity and superconducting solenoid. This paper summarizes the characterization of the cavity in this configuration including Q measurements, dark current tests and field-stability analyses.

  18. SRF test facility for the superconducting LINAC ``RAON'' — RRR property and e-beam welding

    NASA Astrophysics Data System (ADS)

    Jung, Yoochul; Hyun, Myungook; Joo, Jongdae; Joung, Mijoung

    2015-02-01

    Equipment, such as a vacuum furnace, high pressure rinse (HPR), eddy current test (ECT) and buffered chemical polishing (BCP), are installed in the superconducting radio frequency (SRF) test facility. Three different sizes of cryostats (diameters of 600 mm for a quarter wave resonator (QWR), 900 mm for a half wave resonator (HWR), and 1200 mm for single spoke resonator 1&2 (SSR 1&2)) for vertical RF tests are installed for testing cavities. We confirmed that as-received niobium sheets (ASTM B393, RRR300) good electrical properties because they showed average residual resistance ratio (RRR) values higher than 300. However, serious RRR degradation occurred after joining two pieces of Nb by e-beam welding because the average RRR values of the samples were ˜179, which was only ˜60% of as-received RRR value. From various e-beam welding experiments in which the welding current and a speed at a fixed welding voltage were changed, we confirmed that good welding results were obtained at a 53 mA welding current and a 20-mm/s welding speed at a fixed welding voltage of 150 kV.

  19. Characterization of an SRF gun: a 3D full wave simulation

    SciTech Connect

    Wang, E.; Ben-Zvi, I.; Wang, J.

    2011-03-28

    We characterized a BNL 1.3GHz half-cell SRF gun is tested for GaAs photocathode. The gun already was simulated several years ago via two-dimensional (2D) numerical codes (i.e., Superfish and Parmela) with and without the beam. In this paper, we discuss our investigation of its characteristics using a three dimensional (3D) full-wave code (CST STUDIO SUITE{trademark}).The input/pickup couplers are sited symmetrically on the same side of the gun at an angle of 180{sup o}. In particular, the inner conductor of the pickup coupler is considerably shorter than that of the input coupler. We evaluated the cross-talk between the beam (trajectory) and the signal on the input coupler compared our findings with published results based on analytical models. The CST STUDIO SUITE{trademark} also was used to predict the field within the cavity; particularly, a combination of transient/eigenmode solvers was employed to accurately construct the RF field for the particles, which also includes the effects of the couplers. Finally, we explored the beam's dynamics with a particle in cell (PIC) simulation, validated the results and compare them with 2D code result.

  20. SMYD1, an SRF-Interacting Partner, Is Involved in Angiogenesis.

    PubMed

    Ye, Xiangli; Qian, Yu; Wang, Qian; Yuan, Wuzhou; Mo, Xiaoyang; Li, Yongqing; Jiang, Zhigang; Xu, Wei; Deng, Yun; Wan, Yongqi; Fan, Xiongwei; Wu, Xiushan; Wang, Yuequn

    2016-01-01

    Previous studies have demonstrated that Smyd1 plays a critical role in cardiomyocyte differentiation, cardiac morphogenesis and myofibril organization. In this study, we uncovered a novel function of Smyd1 in the regulation of endothelial cells (ECs). Our data showed that Smyd1 is expressed in vascular endothelial cells, and knockdown of SMYD1 in endothelial cells impairs EC migration and tube formation. Furthermore, Co-IP and GST pull-down assays demonstrated that SMYD1 is associated with the Serum Response Factor (SRF). EMSA assays further showed that SMYD1 forms a complex with SRF and enhances SRF DNA binding activity. Our studies indicate that SMYD1 serves as an SRF-interacting protein, enhances SRF DNA binding activity, and is required for EC migration and tube formation to regulate angiogenesis. PMID:26799706

  1. Ion Exchange Testing with SRF Resin FY2012

    SciTech Connect

    Russell, Renee L.; Rinehart, Donald E.; Peterson, Reid A.

    2013-06-11

    Ion exchange using spherical resorcinol-formaldehyde (SRF) resin has been selected by the U.S. Department of Energy’s Office of River Protection (DOE-ORP) for use in the Pretreatment Facility (PTF) of the Hanford Tank Waste Treatment and Immobilization Plant (WTP) and for potential application in at-tank deployment. Numerous studies have shown SRF resin to be effective for removing 137Cs from a wide variety of actual and simulated tank waste supernatants (Adamson et al. 2006; Blanchard et al. 2008; Burgeson et al. 2004; Duignan and Nash 2009; Fiskum et al. 2006a; Fiskum et al. 2006b; Fiskum et al. 2006c; Fiskum et al. 2007; Hassan and Adu-Wusu 2003; King et al. 2004; Nash et al. 2006). Prior work at the Pacific Northwest National Laboratory (PNNL) has focused primarily on the loading behavior for 4 to 6 M Na solutions at 25 to 45°C. Recent proposed changes to the WTP ion exchange process baseline indicate that loading may include a broader range of sodium molarities (0.1 to 8 M) and higher temperatures (50°C) to alleviate post-filtration precipitation issues. This report discusses ion exchange loading kinetics testing activities performed in accordance with Test Plan TP-WTPSP-002, Rev. 3.0 , which was prepared and approved in response to the Test Specification 24590 PTF-TSP-RT-09-002, Rev. 0 (Lehrman 2010) and Test Exception 24590 PTF TEF RT-11-00003, Rev. 0 (Meehan 2011). This testing focused on column tests evaluating the impact of elevated temperature on resin degradation over an extended period of time and batch contacts evaluating the impact on Cs loading over a broad range of sodium concentrations (0.1 to 5 M). These changes may be required to alleviate post-filtration precipitation issues and broaden the data range of SRF resin loading under the conditions expected with the new equipment and process changes.

  2. Cesium Ion Exchange Loading Kinetics Testing with SRF Resin

    SciTech Connect

    Russell, Renee L.; Rinehart, Donald E.; Brown, Garrett N.; Peterson, Reid A.

    2012-11-02

    Ion exchange using the Spherical Resorcinol-Formaldehyde (SRF) resin has been selected by the U.S. Department of Energy’s Office of River Protection for use in the Pretreatment Facility of the Hanford Tank Waste Treatment and Immobilization Plant (WTP) and for potential application in an at-tank deployment for removing 137Cs. Recent proposed changes to the WTP ion exchange process baseline indicate that loading may include a broader range of sodium molarities (2 to 8 M) due to caustic leaching and higher temperatures (50°C) to alleviate post-filtration precipitation issues prior to reaching the ion exchange columns. Therefore, it is important to understand the behavior of SRF resin performance under the conditions expected with the new equipment and process changes. This research examined the impact of linear load velocity (4, 6, 8 cm/min), initial sodium concentration (2, 5, 8 M), initial sodium-to-cesium ratio (1.4E+05, 2.1E+05, 2.8E+05 mol/mol), initial sodium-to-hydroxide ratio (2.0, 3.0, 4.0 mol/mol), and resin degradation during extended solution flow using elevated temperature (45°, 50°, 55°, 60°, 65°, 75°C). Testing was performed using a~2mL column packed with SRF resin with feed flowing through it in an up-flow pattern. Samples were taken at set intervals and the data analyzed to help understand the impact of these conditions on the SRF resin performance. It was found that the loading kinetics were not significantly impacted by the sodium concentration over the range tested. However, the loading kinetics were impacted by the linear load velocity. These results indicated that at the test temperature, the adsorption of cesium is strongly dependent on mass transfer through the film and not significantly impacted by interparticle diffusion. Testing for extended times at elevated temperatures showed that the resin does degrade and loading capacity is reduced at and above 45°C. Above 60°C the resin appears to not load at all.

  3. SRF binding to SRE in the rat heart: influence of age.

    PubMed

    Lu, X G; Azhar, G; Liu, L; Tsou, H; Wei, J Y

    1998-01-01

    One important promoter element at the 5' end of the c-fos gene is the serum response element (SRE). SRE is the site of attachment of the 67-kDa protein serum response factor (SRF) and several accessory proteins (Elk1, SAP1, SAP2/NET), termed the ternary complex factors. The binding of SRF to SRE plays an integral role in c-fos transcription and may occur independently of the association of the ternary complex factors. In the current study, we found that SRF protein expression was increased in the hearts of the old vs young adult rats in the basal condition. The hearts of old rats may have posttranslationally modified SRF proteins that are different compared to that of the young adults. The SRF increase was present both in the cytoplasm as well as in the nucleus in the old hearts. To test whether SRF protein levels in response to acute stress might be altered with age, we studied hearts of young adult and old rats during myocardial infarction. The young adult rat hearts responded to acute ischemic stress with an increase in both p62 and p67 SRF. The hearts of the old rats, however, did not exhibit a significant change in SRF protein expression. These findings demonstrate qualitative as well as quantitative age differences in SRF protein levels, both at baseline and following stimulation. The reduced SRF expression in response to acute cardiac ischemic stress in the old rats might contribute to the observed age-related decrease in the induction of immediate early genes such as c-fos in the heart. PMID:9467416

  4. The ESS Superconducting RF Cavity and Cryomodule Cryogenic Processes

    NASA Astrophysics Data System (ADS)

    Darve, C.; Elias, N.; Molloy, S.; Bosland, P.; Renard, B.; Bousson, S.; Olivier, G.; Reynet, D.; Thermeau, J. P.

    The European Spallation Source (ESS) is one of Europe's largest research infrastructures, tobring new insights to the grand challenges of science and innovation in fields as diverse as material and life sciences, energy, environmental technology, cultural heritage,solid-state and fundamental physics by the end of the decade. The collaborative project is funded by a collaboration of 17 European countries and is under design and construction in Lund, Sweden. A 5 MW, long pulse proton accelerator is used to reach this goal. The pulsed length is 2.86 ms and the repetition frequency is 14 Hz (4% duty cycle). The choice of SRF technology is a key element in the development of the ESS linear accelerator (linac). The superconducting linacis composed of one section of spoke cavity cryomodules(352.21 MHz) and two sections of elliptical cavity cryomodules (704.42 MHz). These cryomodules contain niobium SRF cavities operating at 2 K, cooled by the accelerator cryoplantthrough the cryogenic distribution system. This paper presents the superconducting RF cavity and cryomodule cryogenic processes, which are developed for the technology demonstrators and to be ultimately integrated for the ESS tunnel operation.

  5. Large grain CBMM Nb ingot slices: An ideal test bed for exploring the microstructure-electromagnetic property relationships relevant to SRF

    SciTech Connect

    Sung, Zu-Hawn; Lee, Peter J. Polyanskii, Anatolii Balachandran, Shreyas Chetri, Santosh; Larbalestier, David C.

    2015-12-04

    High purity (RRR > 200), large grain (> 5-10 cm) niobium ingot slices have been successfully used to fabricate radio frequency (RF) cavities for particle accelerators. They offer significantly reduced fabrication cost by eliminating processing steps and furthermore they provide the opportunity to study the influence of individual grain boundaries in SRF Nb. Here we summarize our measurements of grain boundary (GB) effects on the superconducting properties of large grain high purity niobium sheet manufactured by CBMM. We show by magneto-optical (MO) imaging that GBs allow premature flux penetration, but only when they are oriented close to the direction of the magnetic field. However, even low angle GBs produced by minor deformations commensurate with half-cell forming produce localized flux penetration. The transport properties of grain boundaries were investigated by direct transport across them and evidence for preferential vortex flow along the GBs of SRF Nb was observed for the first time. Using transmission electron microscopy (TEM) and micro crystallographic analysis with electron backscattered diffraction (EBSD), we were able to quantitatively characterize surface substructures that can lead to localized thermal breakdown of superconductivity. Important to these studies was the development of sample preparation techniques that made the cutout single, bi-crystal and tri-crystal Nb coupons as representative as possible of the surface properties of cavities manufactured by standard techniques.

  6. Large grain CBMM Nb ingot slices: An ideal test bed for exploring the microstructure-electromagnetic property relationships relevant to SRF

    DOE PAGESBeta

    Sung, Zu -Hawn; Lee, Peter J.; Polyanskii, Anatolii; Balachandran, Shreyas; Chetri, Santosh; Larbalestier, David C.; Wang, Mingmin; Compton, Christopher; Bieler, Thomas R.

    2015-12-04

    High purity (RRR > 200), large grain (> 5-10 cm) niobium ingot slices have been successfully used to fabricate radio frequency (RF) cavities for particle accelerators. In addition, they offer significantly reduced fabrication cost by eliminating processing steps and furthermore they provide the opportunity to study the influence of individual grain boundaries in SRF Nb. Here we summarize our measurements of grain boundary (GB) effects on the superconducting properties of large grain high purity niobium sheet manufactured by CBMM. We show by magneto-optical (MO) imaging that GBs allow premature flux penetration, but only when they are oriented close to themore » direction of the magnetic field. However, even low angle GBs produced by minor deformations commensurate with half-cell forming produce localized flux penetration. The transport properties of grain boundaries were investigated by direct transport across them and evidence for preferential vortex flow along the GBs of SRF Nb was observed for the first time. Using transmission electron microscopy (TEM) and micro crystallographic analysis with electron backscattered diffraction (EBSD), we were able to quantitatively characterize surface substructures that can lead to localized thermal breakdown of superconductivity. Important to these studies was the development of sample preparation techniques that made the cut-out single, bi-crystal and tri-crystal Nb coupons as representative as possible of the surface properties of cavities manufactured by standard techniques.« less

  7. Large grain CBMM Nb ingot slices: An ideal test bed for exploring the microstructure-electromagnetic property relationships relevant to SRF

    SciTech Connect

    Sung, Zu -Hawn; Lee, Peter J.; Polyanskii, Anatolii; Balachandran, Shreyas; Chetri, Santosh; Larbalestier, David C.; Wang, Mingmin; Compton, Christopher; Bieler, Thomas R.

    2015-12-04

    High purity (RRR > 200), large grain (> 5-10 cm) niobium ingot slices have been successfully used to fabricate radio frequency (RF) cavities for particle accelerators. In addition, they offer significantly reduced fabrication cost by eliminating processing steps and furthermore they provide the opportunity to study the influence of individual grain boundaries in SRF Nb. Here we summarize our measurements of grain boundary (GB) effects on the superconducting properties of large grain high purity niobium sheet manufactured by CBMM. We show by magneto-optical (MO) imaging that GBs allow premature flux penetration, but only when they are oriented close to the direction of the magnetic field. However, even low angle GBs produced by minor deformations commensurate with half-cell forming produce localized flux penetration. The transport properties of grain boundaries were investigated by direct transport across them and evidence for preferential vortex flow along the GBs of SRF Nb was observed for the first time. Using transmission electron microscopy (TEM) and micro crystallographic analysis with electron backscattered diffraction (EBSD), we were able to quantitatively characterize surface substructures that can lead to localized thermal breakdown of superconductivity. Important to these studies was the development of sample preparation techniques that made the cut-out single, bi-crystal and tri-crystal Nb coupons as representative as possible of the surface properties of cavities manufactured by standard techniques.

  8. Large grain CBMM Nb ingot slices: An ideal test bed for exploring the microstructure-electromagnetic property relationships relevant to SRF

    NASA Astrophysics Data System (ADS)

    Sung, Zu-Hawn; Lee, Peter J.; Polyanskii, Anatolii; Balachandran, Shreyas; Chetri, Santosh; Larbalestier, David C.; Wang, Mingmin; Compton, Christopher; Bieler, Thomas R.

    2015-12-01

    High purity (RRR > 200), large grain (> 5-10 cm) niobium ingot slices have been successfully used to fabricate radio frequency (RF) cavities for particle accelerators. They offer significantly reduced fabrication cost by eliminating processing steps and furthermore they provide the opportunity to study the influence of individual grain boundaries in SRF Nb. Here we summarize our measurements of grain boundary (GB) effects on the superconducting properties of large grain high purity niobium sheet manufactured by CBMM. We show by magneto-optical (MO) imaging that GBs allow premature flux penetration, but only when they are oriented close to the direction of the magnetic field. However, even low angle GBs produced by minor deformations commensurate with half-cell forming produce localized flux penetration. The transport properties of grain boundaries were investigated by direct transport across them and evidence for preferential vortex flow along the GBs of SRF Nb was observed for the first time. Using transmission electron microscopy (TEM) and micro crystallographic analysis with electron backscattered diffraction (EBSD), we were able to quantitatively characterize surface substructures that can lead to localized thermal breakdown of superconductivity. Important to these studies was the development of sample preparation techniques that made the cutout single, bi-crystal and tri-crystal Nb coupons as representative as possible of the surface properties of cavities manufactured by standard techniques.

  9. Laser nitriding for niobium superconducting radio-frequency accelerator cavities

    SciTech Connect

    Senthilraja Singaravelu, John Klopf, Gwyn Williams, Michael Kelley

    2010-10-01

    Particle accelerators are a key tool for scientific research ranging from fundamental studies of matter to analytical studies at light sources. Cost-forperformance is critical, both in terms of initial capital outlay and ongoing operating expense, especially for electricity. It depends on the niobium superconducting radiofrequency (SRF) accelerator cavities at the heart of most of these machines. Presently Nb SRF cavities operate near 1.9 K, well (and expensively) below the 4.2 K atmospheric boiling point of liquid He. Transforming the 40 nm thick active interior surface layer from Nb to delta NbN (Tc = 17 K instead of 9.2 K) appears to be a promising approach. Traditional furnace nitriding appears to have not been successful for this. Further, exposing a complete SRF cavity to the time-temperature history required for nitriding risks mechanical distortion. Gas laser nitriding instead has been applied successfully to other metals [P.Schaaf, Prog. Mat. Sci. 47 (2002) 1]. The beam dimensions and thermal diffusion length permit modeling in one dimension to predict the time course of the surface temperature for a range of per-pulse energy densities. As with the earlier work, we chose conditions just sufficient for boiling as a reference point. We used a Spectra Physics HIPPO nanosecond laser (l = 1064 nm, Emax= 0.392 mJ, beam spot@ 34 microns, PRF =15 – 30 kHz) to obtain an incident fluence of 1.73 - 2.15 J/cm2 for each laser pulse at the target. The target was a 50 mm diameter SRF-grade Nb disk maintained in a nitrogen atmosphere at a pressure of 550 – 625 torr and rotated at a constant speed of 9 rpm. The materials were examined by scanning electron microscopy (SEM), electron probe microanalysis (EPMA) and x-ray diffraction (XRD). The SEM images show a sharp transition with fluence from a smooth, undulating topography to significant roughening, interpreted here as the onset of ablation. EPMA measurements of N/Nb atom ratio as a function of depth found a constant

  10. Nuclear PTEN functions as an essential regulator of SRF-dependent transcription to control smooth muscle differentiation.

    PubMed

    Horita, Henrick; Wysoczynski, Christina L; Walker, Lori A; Moulton, Karen S; Li, Marcella; Ostriker, Allison; Tucker, Rebecca; McKinsey, Timothy A; Churchill, Mair E A; Nemenoff, Raphael A; Weiser-Evans, Mary C M

    2016-01-01

    Vascular disease progression is associated with marked changes in vascular smooth muscle cell (SMC) phenotype and function. SMC contractile gene expression and, thus differentiation, is under direct transcriptional control by the transcription factor, serum response factor (SRF); however, the mechanisms dynamically regulating SMC phenotype are not fully defined. Here we report that the lipid and protein phosphatase, PTEN, has a novel role in the nucleus by functioning as an indispensible regulator with SRF to maintain the differentiated SM phenotype. PTEN interacts with the N-terminal domain of SRF and PTEN-SRF interaction promotes SRF binding to essential promoter elements in SM-specific genes. Factors inducing phenotypic switching promote loss of nuclear PTEN through nucleo-cytoplasmic translocation resulting in reduced myogenically active SRF, but enhanced SRF activity on target genes involved in proliferation. Overall decreased expression of PTEN was observed in intimal SMCs of human atherosclerotic lesions underlying the potential clinical importance of these findings. PMID:26940659

  11. Cavity magnomechanics.

    PubMed

    Zhang, Xufeng; Zou, Chang-Ling; Jiang, Liang; Tang, Hong X

    2016-03-01

    A dielectric body couples with electromagnetic fields through radiation pressure and electrostrictive forces, which mediate phonon-photon coupling in cavity optomechanics. In a magnetic medium, according to the Korteweg-Helmholtz formula, which describes the electromagnetic force density acting on a medium, magneostrictive forces should arise and lead to phonon-magnon interaction. We report such a coupled phonon-magnon system based on ferrimagnetic spheres, which we term as cavity magnomechanics, by analogy to cavity optomechanics. Coherent phonon-magnon interactions, including electromagnetically induced transparency and absorption, are demonstrated. Because of the strong hybridization of magnon and microwave photon modes and their high tunability, our platform exhibits new features including parametric amplification of magnons and phonons, triple-resonant photon-magnon-phonon coupling, and phonon lasing. Our work demonstrates the fundamental principle of cavity magnomechanics and its application as a new information transduction platform based on coherent coupling between photons, phonons, and magnons. PMID:27034983

  12. Cavity magnomechanics

    PubMed Central

    Zhang, Xufeng; Zou, Chang-Ling; Jiang, Liang; Tang, Hong X.

    2016-01-01

    A dielectric body couples with electromagnetic fields through radiation pressure and electrostrictive forces, which mediate phonon-photon coupling in cavity optomechanics. In a magnetic medium, according to the Korteweg-Helmholtz formula, which describes the electromagnetic force density acting on a medium, magneostrictive forces should arise and lead to phonon-magnon interaction. We report such a coupled phonon-magnon system based on ferrimagnetic spheres, which we term as cavity magnomechanics, by analogy to cavity optomechanics. Coherent phonon-magnon interactions, including electromagnetically induced transparency and absorption, are demonstrated. Because of the strong hybridization of magnon and microwave photon modes and their high tunability, our platform exhibits new features including parametric amplification of magnons and phonons, triple-resonant photon-magnon-phonon coupling, and phonon lasing. Our work demonstrates the fundamental principle of cavity magnomechanics and its application as a new information transduction platform based on coherent coupling between photons, phonons, and magnons. PMID:27034983

  13. Endothelial depletion of murine SRF/MRTF provokes intracerebral hemorrhagic stroke

    PubMed Central

    Weinl, Christine; Castaneda Vega, Salvador; Riehle, Heidemarie; Stritt, Christine; Calaminus, Carsten; Wolburg, Hartwig; Mauel, Susanne; Breithaupt, Angele; Gruber, Achim D.; Wasylyk, Bohdan; Olson, Eric N.; Adams, Ralf H.; Pichler, Bernd J.; Nordheim, Alfred

    2015-01-01

    Intracerebral hemorrhagic stroke and vascular dementia are age- and hypertension-associated manifestations of human cerebral small vessel disease (SVD). Cerebral microvessels are formed by endothelial cells (ECs), which are connected through tight junctions, adherens junctions, and stabilizing basement membrane structures. These endothelial connections ensure both vessel stability and blood–brain barrier (BBB) functions, the latter enabling selective exchange of ions, bioactive molecules, and cells between the bloodstream and brain tissue. SrfiECKO mice, permitting conditional EC-specific depletion of the transcription factor Serum Response Factor (SRF), suffer from loss of BBB integrity and intracerebral hemorrhaging. Cerebral microbleeds and larger hemorrhages developed upon postnatal and adult depletion of either SRF or its cofactors Myocardin Related Transcription Factor (MRTF-A/-B), revealing essential requirements of ongoing SRF/MRTF activity for maintenance of cerebral small vessel integrity. In vivo magnetic resonance imaging allowed detection, localization, and time-resolved quantification of BBB permeability and hemorrhage formation in SrfiECKO brains. At the molecular level, direct and indirect SRF/MRTF target genes, encoding structural components of tight junctions (Claudins and ZO proteins), adherens junctions (VE-cadherin, α-Actinin), and the basement membrane (Collagen IV), were down-regulated upon SRF depletion. These results identify SRF and its MRTF cofactors as major transcriptional regulators of EC junctional stability, guaranteeing physiological functions of the cerebral microvasculature. We hypothesize that impairments in SRF/MRTF activity contribute to human SVD pathology. PMID:26221020

  14. HIGH POWER RF DISTRIBUTION AND CONTROL FOR MULTI-CAVITY CRYOMODULE TESTING

    SciTech Connect

    Kang, Yoon W; Broyles, Michael R; Crofford, Mark T; Geng, Xiaosong; Kim, Sang-Ho; Lee, Sung-Woo; Phibbs, Curtis L; Shin, Ki; Strong, William Herb

    2011-01-01

    Qualification of the superconducting radio-frequency (SRF) cavities in the cryomodules for the accelerating performance needs to be done through high power processing. A four-way waveguide power distribution system with independent control of power outputs has been being developed for testing the multi-cavity cryomodules for the SNS linac. SNS is employing two types of cryomodules: one type with three medium beta six-cell cavities and the other with four high beta six-cell cavities. The cryomodule that is being manufactured as a spare and the new crymodules for the future power upgrade project (PUP) of SNS will be high beta types. The four-way power distribution with independently controlled power outputs was considered useful for powering all cavities at the same time with a klystron amplifier since the SNS test facility was configured for a single klystron operation. Since certain interaction between the cavities under severe field emission was suspected in existing cryomodules, this type of high power test can be valuable for characterization of SRF cavities. By implementing a vector modulator at each arm of the splitting system, the amplitudes and the phases of RF outputs can be controlled independently. This paper discusses the present status of the development.

  15. Precision vector control of a superconducting RF cavity driven by an injection locked magnetron

    SciTech Connect

    Chase, Brian; Pasquinelli, Ralph; Cullerton, Ed; Varghese, Philip

    2015-03-01

    The technique presented in this paper enables the regulation of both radio frequency amplitude and phase in narrow band devices such as a Superconducting RF (SRF) cavity driven by constant power output devices i.e. magnetrons [1]. The ability to use low cost high efficiency magnetrons for accelerator RF power systems, with tight vector regulation, presents a substantial cost savings in both construction and operating costs - compared to current RF power system technology. An operating CW system at 2.45 GHz has been experimentally developed. Vector control of an injection locked magnetron has been extensively tested and characterized with a SRF cavity as the load. Amplitude dynamic range of 30 dB, amplitude stability of 0.3% r.m.s, and phase stability of 0.26 degrees r.m.s. has been demonstrated.

  16. Surface Science Laboratory for Studying the Surfaces of Superconducting Radio Frequency Cavities

    SciTech Connect

    Andy Wu

    2003-09-01

    A Surface Science Laboratory (SSL) has been established at JLab to study surfaces relevant to superconducting radio frequency (SRF) cavities. Current operational facilities include a scanning electron microscope equipped with energy dispersive x-ray analysis, a secondary ion mass spectrometry, a metallographic optical microscope, a transmission electron microscope, a high precision and large scan area 3-D profilometer, a scanning field emission microscope, and a fully equipped sample preparation room. A scanning Auger microscope is being commissioned, and will be available for routine usage soon. Results from typical examples of the R&D projects on SRF cavities that were supported in the past through the use of the facilities in the SSL will be briefly reported.

  17. Silodosin Inhibits Noradrenaline-Activated Transcription Factors Elk1 and SRF in Human Prostate Smooth Muscle

    PubMed Central

    Hennenberg, Martin; Strittmatter, Frank; Beckmann, Christer; Rutz, Beata; Füllhase, Claudius; Waidelich, Raphaela; Montorsi, Francesco; Hedlund, Petter; Andersson, Karl-Erik; Stief, Christian G.; Gratzke, Christian

    2012-01-01

    Background The transcription factors Elk1 and serum response factor (SRF) are central regulators of cell cycle and phenotype in various cell types. Elk1 is activated by phosphorylation (serine-383), while activation of SRF requires its co-factor, myocardin. Activation of Elk1 and SRF results in binding to specific DNA sequences in promoter regions, and may be induced by adrenergic receptor activation in different organs. Objective To examine the effects of adrenergic stimulation on Elk1 and SRF in the human prostate and the ability of the highly selective α1A-adrenoceptor antagonist, silodosin, on transcription factor activation. Methods Prostate tissue was obtained from patients undergoing radical prostatectomy. Expression of Elk1, SRF, and myocardin was estimated by Western blot and immunohistochemistry. Colocalizations were studied by double immunofluorescence staining. Noradrenaline- (NA-) and phenylephrine- (PE-) induced phosphorylation of Elk1 was assessed by Western blot analysis using a phospho-specific antibody. NA-induced activation of Elk1 and SRF was investigated by electrophoretic mobility shift assay (EMSA). Results Immunoreactivity for Elk1, SRF, and myocardin was observed in stromal cells of tissues from each patient. In fluorescence stainings, SRF colocalized with myocardin and α-smooth muscle actin (αSMA). Stimulation of prostate tissues with PE (10 µM) or NA (30 µM) increased the phosphorylation of Elk1 at serine-383. NA-induced Elk1 activation was confirmed by EMSA, where a NA-induced binding of Elk1 to the DNA sequence TTTGCAAAATGCAGGAATTGTTTTCACAGT was observed. Similarly, NA caused SRF binding to the SRF-specific DNA sequence CCATATTAGGCCATATTAGG. Application of silodosin (3 µM) to prostate tissues reduced the activity of Elk1 and SRF in NA-stimulated tissues. Conclusions Silodosin blocks the activation of the two transcription factors, Elk1 and SRF, which is induced by noradrenaline in the human prostate. A role of α1-adrenoceptors

  18. Nd3+, Y3+-codoped SrF2 laser ceramics

    NASA Astrophysics Data System (ADS)

    Li, Weiwei; Mei, Bingchu; Song, Jinghong

    2015-09-01

    0.15 at.% Nd3+, 5 at.% Y3+-codoped SrF2 laser ceramic based on single crystal was prepared by extensive plastic deformation. Microstructure, optical and laser properties of the Nd3+, Y3+:SrF2 ceramic were investigated. The lasing of Nd3+, Y3+-codoped SrF2 ceramics with diode pumping have been observed and true CW laser operation around 1057 nm and 1050 nm was obtained with a slope efficiency of 31.9%. In particular, the fracture toughness of the ceramic is 0.98 MPa m1/2, which is approximately two times higher than that of single crystal.

  19. Ion Exchange Testing with SRF Resin FY 2012

    SciTech Connect

    Russell, Renee L.; Rinehart, Donald E.; Peterson, Reid A.

    2014-07-02

    Ion exchange using spherical resorcinol-formaldehyde (SRF) resin has been selected by the U.S. Department of Energy’s Office of River Protection (DOE-ORP) for use in the Pretreatment Facility (PTF) of the Hanford Tank Waste Treatment and Immobilization Plant (WTP) and for potential application in at-tank deployment. Numerous studies have shown SRF resin to be effective for removing 137Cs from a wide variety of actual and simulated tank waste supernatants (Adamson et al. 2006; Blanchard et al. 2008; Burgeson et al. 2004; Duignan and Nash 2009; Fiskum et al. 2006a; Fiskum et al. 2006b; Fiskum et al. 2006c; Fiskum et al. 2007; Hassan and Adu-Wusu 2003; King et al. 2004; Nash et al. 2006). Prior work at the Pacific Northwest National Laboratory (PNNL) has focused primarily on the loading behavior for 4 to 6 M Na solutions at 25 to 45°C. Recent proposed changes to the WTP ion exchange process baseline indicate that loading may include a broader range of sodium molarities (0.1 to 8 M) and higher temperatures (50°C) to alleviate post-filtration precipitation issues. This report discusses ion exchange loading kinetics testing activities performed in accordance with Test Plan TP-WTPSP-002, Rev. 3.01, which was prepared and approved in response to the Test Specification 24590-PTF-TSP-RT-09-002, Rev. 0 (Lehrman 2010) and Test Exception 24590-PTF-TEF-RT-11-00003, Rev. 0 (Meehan 2011). This testing focused on column tests evaluating the impact of elevated temperature on resin degradation over an extended period of time and batch contacts evaluating the impact on Cs loading over a broad range of sodium concentrations (0.1 to 5 M). These changes may be required to alleviate post-filtration precipitation issues and broaden the data range of SRF resin loading under the conditions expected with the new equipment and process changes.

  20. Elliptical Cavity Shape Optimization for Acceleration and HOM Damping

    SciTech Connect

    Haipeng Wang; Robert Rimmer; Genfa Wu

    2005-05-01

    We report a survey of center cell shapes developed for Superconducting Radio Frequency (SRF) multi-cell cavities for different projects. Using a set of normalized parameters, we compare the designs for different frequencies and particle velocities for the fundamental mode. Using dispersion curves of High Order Modes (HOM) (frequency verse phase advance) calculated by MAFIA for a single cell, we further optimize the cavity shape to avoid a light cone line crossing at the dangerous resonance frequencies determined by the beam bunch structure and eliminate the trapped (or high R/Q) modes with a low group velocity. We developed this formulation to optimize a 5-cell, 750MHz cavity shape, with good real-estate accelerating gradient and a strong HOM damping waveguide structure for the JLab 1MW ERL-FEL project.

  1. Springback in Deep Drawn High Purity Niobium for Superconductor Cavities

    SciTech Connect

    Ganapati Rao Myneni; Peter Kneisel

    2005-09-01

    Superconducting radio frequency (SRF) cavities made from deep drawn high-purity niobium have become a popular approach for the design of particle accelerators. A number of current accelerators use this technology and it is a leading candidate for future designs. The development of this technology has required significant advances in many scientific fields including metallurgy, high vacuum physics, surface science, and forming. Recently proposed modifications to the current process for fabrication of these cavities has resulted in increased concern about the distribution of deformation, residual stress patterns, and springback. This presentation will report on the findings of a recently initiated program to study plastic flow and springback in the fabrication of these cavities and the influence of metallurgical variables including grain size and impurity content.

  2. COOL-IT: A HEAT EXCHANGER SYSTEM TO PROVIDE GASEOUS HELIUM AT INTERMEDIATE TEMPERATURES FOR SRF LINAC

    SciTech Connect

    Pattalwar, S. M.; Bate, R.

    2010-04-09

    ALICE, a prototype accelerator developed at the Daresbury laboratory UK, has successfully demonstrated the energy-recovery technique by circulating the electron beam to more than 20 MeV. At the heart of ALICE is a superconducting linac operating at 2 K. At high average-current operation the performance of Superconducting RF (SRF) cavities suffer from instabilities due to the generation of higher-order modes (HOM) as well as microphonics. HOMs are extracted out of the cavities using HOM absorbers operating at 80 K. This, however, increases the demand for cooling power at intermediate temperatures, i.e. at 80 K and 5 K, by more than an order of magnitude.In order to provide this extra cooling capacity with gaseous helium a new cryogenic system, 'COOL-IT,'(System for cooling to intermediate temperatures) is being developed. It will provide two streams of helium gases at 80 K and 5 K. COOL-IT uses a set of heat exchangers cooled by liquid helium and liquid nitrogen to generate two cold streams. It will be integrated into the existing cryo-system for ALICE for automatic operation. This paper describes the COOL-IT system in detail.

  3. Cryogenic testing of the 2.1 GHz five-cell superconducting RF cavity with a photonic band gap coupler cell

    NASA Astrophysics Data System (ADS)

    Arsenyev, Sergey A.; Temkin, Richard J.; Haynes, W. Brian; Shchegolkov, Dmitry Yu.; Simakov, Evgenya I.; Tajima, Tsuyoshi; Boulware, Chase H.; Grimm, Terrence L.; Rogacki, Adam R.

    2016-05-01

    We present results from cryogenic tests of the multi-cell superconducting radio frequency (SRF) cavity with a photonic band gap (PBG) coupler cell. Achieving high average beam currents is particularly desirable for future light sources and particle colliders based on SRF energy-recovery-linacs (ERLs). Beam current in ERLs is limited by the beam break-up instability, caused by parasitic higher order modes (HOMs) interacting with the beam in accelerating cavities. A PBG cell incorporated in an accelerating cavity can reduce the negative effect of HOMs by providing a frequency selective damping mechanism, thus allowing significantly higher beam currents. The multi-cell cavity was designed and fabricated of niobium. Two cryogenic (vertical) tests were conducted. The high unloaded Q-factor was demonstrated at a temperature of 4.2 K at accelerating gradients up to 3 MV/m. The measured value of the unloaded Q-factor was 1.55 × 108, in agreement with prediction.

  4. Fiber Optic Based Thermometry System for Superconducting RF Cavities

    SciTech Connect

    Kochergin, Vladimir

    2013-05-06

    Thermometry is recognized as the best technique to identify and characterize losses in SRF cavities. The most widely used and reliable apparatus for temperature mapping at cryogenic temperatures is based on carbon resistors (RTDs). The use of this technology on multi-cell cavities is inconvenient due to the very large number of sensors required to obtain sufficient spatial resolution. Recent developments make feasible the use of multiplexible fiber optic sensors for highly distributed temperature measurements. However, sensitivity of multiplexible cryogenic temperature sensors was found extending only to 12K at best and thus was not sufficient for SRF cavity thermometry. During the course of the project the team of MicroXact, JLab and Virginia Tech developed and demonstrated the multiplexible fiber optic sensor with adequate response below 20K. The demonstrated temperature resolution is by at least a factor of 60 better than that of the best multiplexible fiber optic temperature sensors reported to date. The clear path toward at least 10times better temperature resolution is shown. The first to date temperature distribution measurements with ~2.5mm spatial resolution was done with fiber optic sensors at 2K to4K temperatures. The repeatability and accuracy of the sensors were verified only at 183K, but at this temperature both parameters significantly exceeded the state of the art. The results of this work are expected to find a wide range of applications, since the results are enabling the whole new testing capabilities, not accessible before.

  5. Project-X Srf, and Very Large Power Stations

    NASA Astrophysics Data System (ADS)

    Ankenbrandt, Charles M.; Johnson, Rolland P.; Popovic, Milorad

    2010-06-01

    We seek to develop accelerator-driven subcritical (ADS) nuclear power stations operating at more than 5 to 10 GW in an inherently safe region below criticality, generating no greenhouse gases, producing minimal nuclear waste and no byproducts that are useful to rogue nations or terrorists, incinerating waste from conventional nuclear reactors, and efficiently using abundant thorium fuel that does not need enrichment. First, the feasibility of the accelerator technology must be demonstrated. Fermilab is developing concepts for Project X, which would use a superconducting RF (SRF) linear proton accelerator to provide beams for particle physics at the intensity and energy frontiers. We propose to extend this linac design to serve as a prototype for a practical accelerator that can drive several ADS reactors at once and also provide beams for reactor development.

  6. PROSPECTS FOR A VERY HIGH POWER CW SRF LINAC

    SciTech Connect

    Robert Rimmer

    2010-06-01

    Steady development in SRF accelerator technology combined with the success of large scale installations such as CEBAF at Jefferson Laboratory and the SNS Linac at ORNL gives credibility to the concept of very high average power CW machines for light sources or Proton drivers. Such machines would be powerful tools for discovery science in themselves but could also pave the way to reliable cost effective drivers for such applications as neutrino factories, an energy-frontier muon collider, nuclear waste transmutation or accelerator driven subcritical reactors for energy production. In contrast to machines such as ILC that need maximum accelerating gradient, the challenges in these machines are mainly in efficiency, reliability, beam stability, beam loss and of course cost. In this paper the present state of the art is briefly reviewed and options for a multi-GeV, multi-MW CW linac are discussed.

  7. Vibrational Stability of SRF Accelerator Test Facility at Fermilab

    SciTech Connect

    McGee, M.W.; Volk, J.T.; /Fermilab

    2009-05-01

    Recently developed, the Superconducting Radio Frequency (SRF) Accelerator Test Facilities at Fermilab support the International Linear Collider (ILC), High Intensity Neutrino Source (HINS), a new high intensity injector (Project X) and other future machines. These facilities; Meson Detector Building (MDB) and New Muon Lab (NML) have very different foundations, structures, relative elevations with respect to grade level and surrounding soil composition. Also, there are differences in the operating equipment and their proximity to the primary machine. All the future machines have stringent operational stability requirements. The present study examines both near-field and ambient vibration in order to develop an understanding of the potential contribution of near-field sources (e.g. compressors, ultra-high and standard vacuum equipment, klystrons, modulators, utility fans and pumps) and distant noise sources to the overall system displacements. Facility vibration measurement results and methods of possible isolation from noise sources are presented and discussed.

  8. Study of AC/RF properties of SRF ingot niobium

    SciTech Connect

    Dhakal, Pashupati; Tsindlekht, Menachem I; Genkin, Valery M; Ciovati, Gianluigi; Myneni, Ganapati Rao

    2013-09-01

    In an attempt to correlate the performance of superconducting radiofrequency cavities made of niobium with the superconducting properties, we present the results of the magnetization and ac susceptibility of the niobium used in the superconducting radiofrequency cavity fabrication. The samples were subjected to buffer chemical polishing (BCP) surface and high temperature heat treatments, typically applied to the cavities fabrications. The analysis of the results show the different surface and bulk ac conductivity for the samples subjected to BCP and heat treatment. Furthermore, the RF surface impedance is measured on the sample using a TE011 microwave cavity for a comparison to the low frequency measurements.

  9. Low and Intermediate Beta Cavity Design - A Tutorial

    SciTech Connect

    Jean Delayen

    2003-09-01

    The design of low-velocity superconducting structures has been an active area of the superconducting rf (srf) technology for more than 3 decades. More recently, with the growing interest in medium-energy ion and proton accelerators, a sustained world-wide effort has been directed toward the development of the superconducting structures for the intermediate velocity region. In this tutorial we address the design issues that are specific to low- and medium-velocity superconducting cavities. Simple electrostatic and electrodynamic models based on transmission lines are presented, and scaling laws are derived.

  10. Physical and Mechanical Properties of Niobium for SRF Science and Technology

    SciTech Connect

    Ganapati Rao Myneni

    2006-10-31

    Optimized mechanical and physical properties of high purity niobium are crucial for obtaining high performance SRF particle beam accelerator structures consistently. This paper summarizes these important material properties for both high purity polycrystalline and single crystal niobium.

  11. Thermal design studies in superconducting rf cavities: Phonon peak and Kapitza conductance

    NASA Astrophysics Data System (ADS)

    Aizaz, A.; Grimm, T. L.; Wright, N. T.

    2010-09-01

    Thermal design studies of superconducting radio frequency (SRF) cavities involve two thermal parameters, namely the temperature dependent thermal conductivity of Nb at low temperatures and the heat transfer coefficient at the Nb-He II interface, commonly known as the Kapitza conductance. During the fabrication process of the SRF cavities, Nb sheet is plastically deformed through a deep drawing process to obtain the desired shape. The effect of plastic deformation on low temperature thermal conductivity as well as Kapitza conductance has been studied experimentally. Strain induced during the plastic deformation process reduces the thermal conductivity in its phonon transmission regime (disappearance of phonon peak) by 80%, which may explain the performance limitations of the defect-free SRF cavities during their high field operations. Low temperature annealing of the deformed Nb sample could not recover the phonon peak. However, moderate temperature annealing during the titanification process recovered the phonon peak in the thermal conductivity curve. Kapitza conductance measurements for the Nb-He II interface for various surface topologies have also been carried out before and after the annealing. These measurements reveal consistently increased Kapitza conductance after the annealing process was carried out in the two temperature regimes.

  12. Microwave induced plasma discharge in multi-cell superconducting radio-frequency cavity

    SciTech Connect

    Ahmed, Shahid; Mammosser, John D.

    2015-07-15

    A R&D effort for in situ cleaning of 1.5 GHz Superconducting Radio Frequency (SRF) cavities at room temperature using the plasma processing technique has been initiated at Jefferson Lab. This is a step toward the cleaning of cryomodules installed in the Continuous Electron Beam Accelerator Facility (CEBAF). For this purpose, we have developed an understanding of plasma discharge in a 5-cell CEBAF-type SRF cavity having configurations similar to those in the main accelerator. The focus of this study involves the detailed investigations of developing a plasma discharge inside the cavity volume and avoids the breakdown condition in the vicinity of the ceramic RF window. A plasma discharge of the gas mixture Ar–O{sub 2} (90%:10%) can be established inside the cavity volume by the excitation of a resonant 4π/5 TM{sub 010}-mode driven by a klystron. The absence of any external magnetic field for generating the plasma is suitable for cleaning cavities installed in a complex cryomodule assembly. The procedures developed in these experimental investigations can be applied to any complex cavity structure. Details of these experimental measurements and the observations are discussed in the paper.

  13. Microwave induced plasma discharge in multi-cell superconducting radio-frequency cavity

    NASA Astrophysics Data System (ADS)

    Ahmed, Shahid; Mammosser, John D.

    2015-07-01

    A R&D effort for in situ cleaning of 1.5 GHz Superconducting Radio Frequency (SRF) cavities at room temperature using the plasma processing technique has been initiated at Jefferson Lab. This is a step toward the cleaning of cryomodules installed in the Continuous Electron Beam Accelerator Facility (CEBAF). For this purpose, we have developed an understanding of plasma discharge in a 5-cell CEBAF-type SRF cavity having configurations similar to those in the main accelerator. The focus of this study involves the detailed investigations of developing a plasma discharge inside the cavity volume and avoids the breakdown condition in the vicinity of the ceramic RF window. A plasma discharge of the gas mixture Ar-O2 (90%:10%) can be established inside the cavity volume by the excitation of a resonant 4π/5 TM010-mode driven by a klystron. The absence of any external magnetic field for generating the plasma is suitable for cleaning cavities installed in a complex cryomodule assembly. The procedures developed in these experimental investigations can be applied to any complex cavity structure. Details of these experimental measurements and the observations are discussed in the paper.

  14. Microwave induced plasma discharge in multi-cell superconducting radio-frequency cavity.

    PubMed

    Ahmed, Shahid; Mammosser, John D

    2015-07-01

    A R&D effort for in situ cleaning of 1.5 GHz Superconducting Radio Frequency (SRF) cavities at room temperature using the plasma processing technique has been initiated at Jefferson Lab. This is a step toward the cleaning of cryomodules installed in the Continuous Electron Beam Accelerator Facility (CEBAF). For this purpose, we have developed an understanding of plasma discharge in a 5-cell CEBAF-type SRF cavity having configurations similar to those in the main accelerator. The focus of this study involves the detailed investigations of developing a plasma discharge inside the cavity volume and avoids the breakdown condition in the vicinity of the ceramic RF window. A plasma discharge of the gas mixture Ar-O2 (90%:10%) can be established inside the cavity volume by the excitation of a resonant 4π/5 TM010-mode driven by a klystron. The absence of any external magnetic field for generating the plasma is suitable for cleaning cavities installed in a complex cryomodule assembly. The procedures developed in these experimental investigations can be applied to any complex cavity structure. Details of these experimental measurements and the observations are discussed in the paper. PMID:26233368

  15. Design and performance of a new induction furnace for heat treatment of superconducting radiofrequency niobium cavities

    SciTech Connect

    Dhakal, Pashupati; Ciovati, Gianluigi; Myneni, Ganapati Rao; Rigby, Wayne; Wallace, John

    2012-06-15

    Superconducting radio frequency (SRF) cavities made of high purity niobium (Nb) are the building blocks of many modern particle accelerators. The fabrication process includes several cycles of chemical and heat treatment at low ({approx}120 Degree-Sign C) and high ({approx}800 Degree-Sign C) temperatures. In this contribution, we describe the design and performance of an ultra-high-vacuum furnace which uses an induction heating system to heat treat SRF cavities. Cavities are heated by radiation from the Nb susceptor. By using an all-niobium hot zone, contamination of the Nb cavity by foreign elements during heat treatment is minimized and allows avoiding subsequent chemical etching. The furnace was operated up to 1400 Degree-Sign C with a maximum pressure of {approx}1 Multiplication-Sign 10{sup -5} Torr and the maximum achievable temperature is estimated to be higher than 2000 Degree-Sign C. Initial results on the performance of a single cell 1.5 GHz cavity made of ingot Nb heat treated at 1200 Degree-Sign C using this new induction furnace and without subsequent chemical etching showed a reduction of the RF losses by a factor of {approx}2 compared to cavities made of fine-grain Nb which underwent standard chemical and heat treatments.

  16. Design and performance of a new induction furnace for heat treatment of superconducting radiofrequency niobium cavities

    SciTech Connect

    Pashupati Dhakal, Gianluigi Ciovati, Wayne Rigby, John Wallace, Ganapati Rao Myneni

    2012-06-01

    Superconducting radio frequency (SRF) cavities made of high purity niobium (Nb) are the building blocks of many modern particle accelerators. The fabrication process includes several cycles of chemical and heat treatment at low ({approx}120 deg C) and high ({approx}800 deg C) temperatures. In this contribution, we describe the design and performance of an ultra-high-vacuum furnace which uses an induction heating system to heat treat SRF cavities. Cavities are heated by radiation from the Nb susceptor. By using an all-niobium hot zone, contamination of the Nb cavity by foreign elements during heat treatment is minimized and allows avoiding subsequent chemical etching. The furnace was operated up to 1400 deg C with a maximum pressure of {approx}1 x 10{sup -5} Torr and the maximum achievable temperature is estimated to be higher than 2000 deg C. Initial results on the performance of a single cell 1.5 GHz cavity made of ingot Nb heat treated at 1200 deg C using this new induction furnace and without subsequent chemical etching showed a reduction of the RF losses by a factor of {approx}2 compared to cavities made of fine-grain Nb which underwent standard chemical and heat treatments.

  17. Lorentz force detuning analysis of the Spallation Neutron Source (SNS) accelerating cavities.

    SciTech Connect

    Mitchell, R.R.; Matsumoto, K. Y.; Ciovati, G.; Davis, K.; Macha, K.; Sundelin, R. M.

    2001-01-01

    The Spallation Neutron Source (SNS) project incorporates a superconducting radio-frequency (SRF) accelerator for the final section of the pulsed mode linac. Cavities with geometrical {beta} values of {beta}=0.61 and {beta}=0.81 are utilized in the SRF section, and are constructed out of thin-walled niobium with stiffener rings welded between the cells near the iris. The welded titanium helium vessel and tuner assembly restrains the cavity beam tubes. Cavities with {beta} values less than one have relatively steep and flat side-walls making the cavities susceptible to Lorentz force detuning. In addition, the pulsed RF induces cyclic Lorentz pressures that mechanically excite the cavities, producing a dynamic Lorentz force detuning different from a continuous RF system. The amplitude of the dynamic detuning for a given cavity design is a function of the mechanical damping, stiffness of the tuner/helium vessel assembly, RF pulse profile, and the RF pulse rate. This paper presents analysis and testing results to date, and indicates areas where more investigation is required.

  18. An equivalent circuit model and power calculations for the APS SPX crab cavities.

    SciTech Connect

    Berenc, T. )

    2012-03-21

    An equivalent parallel resistor-inductor-capacitor (RLC) circuit with beam loading for a polarized TM110 dipole-mode cavity is developed and minimum radio-frequency (rf) generator requirements are calculated for the Advanced Photon Source (APS) short-pulse x-ray (SPX) superconducting rf (SRF) crab cavities. A beam-loaded circuit model for polarized TM110 mode crab cavities was derived. The single-cavity minimum steady-state required generator power has been determined for the APS SPX crab cavities for a storage ring current of 200mA DC current as a function of external Q for various vertical offsets including beam tilt and uncontrollable detuning. Calculations to aid machine protection considerations were given.

  19. Ion Exchange Temperature Testing with SRF Resin - 12088

    SciTech Connect

    Russell, R.L.; Rinehart, D.E.; Brown, G.N.; Peterson, R.A.

    2012-07-01

    Ion exchange using the Spherical Resorcinol-Formaldehyde (SRF) resin has been selected by the U.S. Department of Energy's Office of River Protection for use in the Pretreatment Facility of the Hanford Tank Waste Treatment and Immobilization Plant (WTP) and for potential application in an at-tank deployment for removing Cs-137. Recent proposed changes to the WTP ion exchange process baseline indicate that higher temperatures (50 deg. C) to alleviate post-filtration precipitation issues prior to reaching the ion exchange columns may be required. Therefore, it is important to understand the behavior of SRF resin performance under the conditions expected with the new equipment and process changes. This research examined the impact of elevated temperature on resin loading and resin degradation during extended solution flow at elevated temperature (45 deg., 50 deg., 55 deg., 60 deg., 65 deg., 75 deg. C). Testing for extended times at elevated temperatures showed that the resin does degrade and loading capacity is reduced at and above 45 deg. C. Above 60 deg. C the resin appears to not load at all. It was observed that the resin disintegrated at 75 deg. C until not much was left and partially disintegrated at 65 deg. C, which caused the column to plug in both tests after ∼336 hours. The results indicate that WTP will lose resin loading capacity if the ion exchange process is performed above 25 deg. C, and the resin will disintegrate above 65 deg. C. Therefore, WTP will have a restricted operating range of temperatures to perform the ion exchange process with this resin. PNNL and WTP are currently evaluating the operating limits of the resin in further detail. Aging in 0.5 M HNO{sub 3} also caused the resin to lose capacity above 25 deg. C and to completely dissolve at 55 deg. C. Again, WTP will have a restricted operating range of temperatures when eluting the resin with nitric acid in order to maintain resin loading capacity and avoid disintegration of the resin

  20. Expression of Human Frataxin Is Regulated by Transcription Factors SRF and TFAP2

    PubMed Central

    Li, Kuanyu; Singh, Anamika; Crooks, Daniel R.; Dai, Xiaoman; Cong, Zhuangzhuang; Pan, Liang; Ha, Dung; Rouault, Tracey A.

    2010-01-01

    Background Friedreich ataxia is an autosomal recessive neurodegenerative disease caused by reduced expression levels of the frataxin gene (FXN) due to expansion of triplet nucleotide GAA repeats in the first intron of FXN. Augmentation of frataxin expression levels in affected Friedreich ataxia patient tissues might substantially slow disease progression. Methodology/Principal Findings We utilized bioinformatic tools in conjunction with chromatin immunoprecipitation and electrophoretic mobility shift assays to identify transcription factors that influence transcription of the FXN gene. We found that the transcription factors SRF and TFAP2 bind directly to FXN promoter sequences. SRF and TFAP2 binding sequences in the FXN promoter enhanced transcription from luciferase constructs, while mutagenesis of the predicted SRF or TFAP2 binding sites significantly decreased FXN promoter activity. Further analysis demonstrated that robust SRF- and TFAP2-mediated transcriptional activity was dependent on a regulatory element, located immediately downstream of the first FXN exon. Finally, over-expression of either SRF or TFAP2 significantly increased frataxin mRNA and protein levels in HEK293 cells, and frataxin mRNA levels were also elevated in SH-SY5Y cells and in Friedreich ataxia patient lymphoblasts transfected with SRF or TFAP2. Conclusions/Significance We identified two transcription factors, SRF and TFAP2, as well as an intronic element encompassing EGR3-like sequence, that work together to regulate expression of the FXN gene. By providing new mechanistic insights into the molecular factors influencing frataxin expression, our results should aid in the discovery of new therapeutic targets for the treatment of Friedreich ataxia. PMID:20808827

  1. Experimental Investigation on Electromagnetic Attenuation by Low Pressure Radio-Frequency Plasma for Cavity Structure

    NASA Astrophysics Data System (ADS)

    He, Xiang; Zhang, Yachun; Chen, Jianping; Chen, Yudong; Zeng, Xiaojun; Yao, Hong; Tang, Chunmei

    2016-01-01

    This paper reports on an experiment designed to test electromagnetic (EM) attenuation by radio-frequency (RF) plasma for cavity structures. A plasma reactor, in the shape of a hollow cylinder, filled with argon gas at low pressure, driven by a RF power source, was produced by wave-transmitting material. The detailed attenuations of EM waves were investigated under different conditions: the incident frequency is 1-4 GHz, the RF power supply is 13.56 MHz and 1.6-3 kW, and the argon pressure is 75-200 Pa. The experimental results indicate that 5-15 dB return loss can be obtained. From a first estimation, the electron density in the experiment is approximately (1.5-2.2) × 1016 m-3 and the collision frequency is about 11-30 GHz. The return loss of EM waves was calculated using a finite-difference time-domain (FDTD) method and it was found that it has a similar development with measurement. It can be confirmed that RF plasma is useful in the stealth of cavity structures such as jet-engine inlet. supported by National Natural Science Foundation of China (No. 51107033) and the Fundamental Research Funds for the Central Universities of China (No. 2013B33614)

  2. Dysbindin is a potent inducer of RhoA–SRF-mediated cardiomyocyte hypertrophy

    PubMed Central

    Rangrez, Ashraf Yusuf; Bernt, Alexander; Poyanmehr, Reza; Harazin, Violetta; Boomgaarden, Inka; Kuhn, Christian; Rohrbeck, Astrid

    2013-01-01

    Dysbindin is an established schizophrenia susceptibility gene thoroughly studied in the context of the brain. We have previously shown through a yeast two-hybrid screen that it is also a cardiac binding partner of the intercalated disc protein Myozap. Because Dysbindin is highly expressed in the heart, we aimed here at deciphering its cardiac function. Using a serum response factor (SRF) response element reporter-driven luciferase assay, we identified a robust activation of SRF signaling by Dysbindin overexpression that was associated with significant up-regulation of SRF gene targets, such as Acta1 and Actc1. Concurrently, we identified RhoA as a novel binding partner of Dysbindin. Further phenotypic and mechanistic characterization revealed that Dysbindin induced cardiac hypertrophy via RhoA–SRF and MEK1–ERK1 signaling pathways. In conclusion, we show a novel cardiac role of Dysbindin in the activation of RhoA–SRF and MEK1–ERK1 signaling pathways and in the induction of cardiac hypertrophy. Future in vivo studies should examine the significance of Dysbindin in cardiomyopathy. PMID:24385487

  3. REVIEW OF HIGH FIELD Q SLOPE, CAVITY MEASUREMENTS

    SciTech Connect

    Gianluigi Ciovati

    2008-01-23

    One of the most interesting phenomenon occurring in superconducting radio-frequency (SRF) cavities made of bulk niobium is represented by a sharp decrease of the quality factor above peak surface magnetic field of about 90 mT and is referred to as "high field Q-slope" or "Q-drop". This phenomenon was observed first in 1997 and since then some effort was devoted to the understanding of the causes behind it. Still, no clear physical interpretation of the Q-drop has emerged, despite several attempts. In this contribution, I will review the experimental results for various cavities measured in many laboratories and I will try to identify common features and differences related to the Q-drop.

  4. Cavity magnomechanics

    NASA Astrophysics Data System (ADS)

    Zou, Chang-Ling; Zhang, Xufeng; Jiang, Liang; Tang, Hong

    2016-05-01

    Recently, cavity magnonics has attracted much attention for potential applications of coherent information transduction and hybrid quantum devices. The magnon is a collective spin wave excitation in ferromagnetic material. It is magnetically tunability, with long coherence time and non-reciprocical interaction with electro-magnetic fields. We report the coherent coupling between magnon, microwave photon and phonon. First, we demonstrate strong coupling and ultrastrong coupling between the magnon in YIG sphere and microwave photon in three-dimensional cavity. Then, based on the hybridized magnon-photon modes, we observe the triply resonant magnon-mcirowave photon-phonon coupling, where the ultrahigh-Q mechanical vibration of YIG sphere is dispersively coupled with the magnon via magnetostrictive interaction. We observe interesting phenomena, including electromagnetically induced transparency/absorption and parametric amplification. In particular, benefit from the large tunability of the magnon, we demonstrate a tunable microwave amplifier with gain as high as 30 dB. The single crystal YIG also has excellent optical properties, and thus provide a unique platform bridging MHz, GHz and THz information carriers. Finally, we present the latest progress towards coherent magnon to optical photon conversion.

  5. CEBAF SRF Performance during Initial 12 GeV Commissioning

    SciTech Connect

    Bachimanchi, Ramakrishna; Allison, Trent; Daly, Edward; Drury, Michael; Hovater, J; Lahti, George; Mounts, Clyde; Nelson, Richard; Plawski, Tomasz

    2015-09-01

    The Continuous Electron Beam Accelerator Facility (CEBAF) energy upgrade from 6 GeV to 12 GeV includes the installation of eleven new 100 MV cryomodules (88 cavities). The superconducting RF cavities are designed to operate CW at an accelerating gradient of 19.3 MV/m with a QL of 3×107. Not all the cavities were operated at the minimum gradient of 19.3 MV/m with the beam. Though the initial 12 GeV milestones were achieved during the initial commissioning of CEBAF, there are still some issues to be addressed for long term reliable operation of these modules. This paper reports the operational experiences during the initial commissioning and the path forward to improve the performance of C100 (100 MV) modules.

  6. Luminescence study in Ce3+ doped SrF2 nanocrystals

    NASA Astrophysics Data System (ADS)

    Patle, Anita; Patil, R. R.; Moharil, S. V.

    2016-05-01

    In this work enhancement of SrF2:Ce nanophosphor which was synthesized by co-precipitation method is presented. Synthesized phosphor was characterized by SEM and PL measurements. Average particle size is found to be in the range 150nm-200 nm and PL studies showed emission peaks at 330nm,360nm,380nm when samples were excited by 254nm.The observed double humped emission is characteristic emission of Ce3+ similar to that observed in bulk SrF2. However under identical condition it is observed that intensity of emission get enhanced and is about nearly 1.75 times in Ce3+ doped SrF2 nanocrystals than the bulk.

  7. Organization of the MADS box from human SRF revealed by tyrosine perturbation.

    PubMed

    Profantová, Barbora; Coïc, Yves-Marie; Profant, Václav; Štěpánek, Josef; Kopecký, Vladimír; Turpin, Pierre-Yves; Alpert, Bernard; Zentz, Christian

    2015-02-01

    MADS box family transcription factors are involved in signal transduction and development control through DNA specific sequence recognition. The DNA binding domain of these proteins contains a conservative 55-60 amino acid sequence which defines the membership of this large family. Here we present a thorough study of the MADS segment of serum response factor (MADS(SRF)). Fluorescence, UV-absorption, and Raman spectroscopy studies were performed in order to disclose its behavior and basic functional properties in an aqueous environment. The secondary structure of MADS(SRF) estimated by analysis of Raman spectra and supported by CD has revealed only the C-terminal part as homologous with those of free core-SRF, while the N-terminal part has lost the stable α-helical structure found in both the free core-SRF and its specific complex with DNA. The three tyrosine residues of the MADS(SRF) were used as spectroscopic inner probes. The effect of environmental conditions, especially pH variations and addition of variously charged quenchers, on their spectra was examined. Two-component fluorescence quenching was revealed using factor analysis and corresponding Stern-Volmer constants determined. Factor analysis of absorbance and fluorescence pH titration led to determination of three dissociation constants pKa1 = 6.4 ± 0.2, pKa2 = 7.3 ± 0.2, and pKa3 = 9.6 ± 0.6. Critical comparison of all experiments identified the deprotonation of His193 hydrogen bonded to Tyr195 as a candidate for pKa1 (and that of Tyr158 as a candidate for pKa2). Within MADS(SRF), His193 is a key intermediary between the N-terminal primary DNA binding element and the hydrophobic C-terminal protein dimerization element. PMID:25558766

  8. First attempt of at-cavity cryogenic X-ray detection in a CEBAF cryomodule for field emission monitoring

    SciTech Connect

    Geng, Rongli; Daly, Edward; Drury, Michael; Palczewski, Ari

    2015-09-01

    We report on the first result of at-cavity X-ray detection in a CEBAF cryomodule for field emission monitoring. In the 8-cavity cryomodule F100, two silicon diodes were installed near the end flange of each cavity. Each cavity was individually tested during the cryomodule test in JLab’s cryomodule test facility. The behaviors of these at-cavity cryogenic X-ray detectors were compared with those of the standard ‘in air’ Geiger-Muller (G-M) tubes. Our initial experiments establish correlation between X-ray response of near diodes and the field emission source cavity in the 8-cavity string. For two out of these eight cavities, we also carried out at-cavity X-ray detection experiment during their vertical testing. The aim is to track field emission behavior uniquely from vertical cavity testing to horizontal cavity testing in the cryomodule. These preliminary results confirmed our expectation and warrant further effort toward the establishment of permanent at-cavity cryogenic X-ray detection for SRF development and operation.

  9. Proof-of-principle demonstration of Nb3Sn superconducting radiofrequency cavities for high Q0 applications

    NASA Astrophysics Data System (ADS)

    Posen, S.; Liepe, M.; Hall, D. L.

    2015-02-01

    Many future particle accelerators require hundreds of superconducting radiofrequency (SRF) cavities operating with high duty factor. The large dynamic heat load of the cavities causes the cryogenic plant to make up a significant part of the overall cost of the facility. This contribution can be reduced by replacing standard niobium cavities with ones coated with a low-dissipation superconductor such as Nb3Sn. In this paper, we present results for single cell cavities coated with Nb3Sn at Cornell. Five coatings were carried out, showing that at 4.2 K, high Q0 out to medium fields was reproducible, resulting in an average quench field of 14 MV/m and an average 4.2 K Q0 at quench of 8 × 109. In each case, the peak surface magnetic field at quench was well above Hc1, showing that it is not a limiting field in these cavities. The coating with the best performance had a quench field of 17 MV/m, exceeding gradient requirements for state-of-the-art high duty factor SRF accelerators. It is also shown that—taking into account the thermodynamic efficiency of the cryogenic plant—the 4.2 K Q0 values obtained meet the AC power consumption requirements of state-of-the-art high duty factor accelerators, making this a proof-of-principle demonstration for Nb3Sn cavities in future applications.

  10. Commissioning Results of the 2nd 3.5 Cell SRF Gun for ELBE

    SciTech Connect

    Arnold, A; Freitag, M; Murcek, Petr; Teichert, Jochen; Vennekate, H; Xiang, R; Ciovati, Gianluigi; Kneisel, Peter K.; Turlington, Larry D,

    2014-12-01

    As in 2007 the first 3.5 cell superconducting radio frequency (SRF) gun was taken into operation, it turned out that the specified performance has not been achieved. However, to demonstrate the full potential of this new type of electron source, a second and slightly modified SRF gun II was built in collaboration with Thomas Jefferson National Accelerator Facility (TJNAF). We will report on commissioning and first results of the new gun, which includes in particular the characterization of the most important RF properties as well as their comparison with previous vertical test results.

  11. Qualification of the Second Batch Production 9-Cell Cavities Manufactured by AES and Validation of the First US Industrial Cavity Vendor for ILC

    SciTech Connect

    Geng, R. L.; Golden, B. A.; Kushnick, P.; Overton, R. B.; Calderaro, M.; Peterson, E.; Rathke, J.; Champion, M. S.; Follkie, J.; Crawford, A. C.; Forehand, D.

    2011-07-01

    One of the major goals of ILC SRF cavity R&D is to develop industrial capabilities of cavity manufacture and processing in all three regions. In the past several years, Jefferson Lab, in collaboration with Fermi National Accelerator Laboratory, has processed and tested all the 9-cell cavities of the first batch (4 cavities) and second batch (6 cavities) production cavities manufactured by Advanced Energy Systems Inc. (AES). Over the course, close information feedback was maintained, resulting in changes in fabrication and processing procedures. A light buffered chemical polishing was introduced, removing the weld splatters that could not be effectively removed by heavy EP alone. An 800 Celsius 2 hour vacuum furnace heat treatment procedure replaced the original 600 Celsius 10 hour procedure. Four out of the six 9-cell cavities of the second production bath achieved a gradient of 36-41 MV/m at a Q0 of more than 8E9 at 35 MV/m. This result validated AES as the first ''ILC certified'' industrial vendor in the US for ILC cavity manufacture.

  12. State of the art of multicell SC cavities and perspectives

    SciTech Connect

    Peter Kneisel

    2002-08-01

    Superconducting cavity technology has made major progresses in the last decade with the introduction of high purity niobium on an industrial scale and, at the same time, by an improved understanding of the limiting processes in cavity performance, such as multipacting, field emission loading and thermal break-down. Multicell niobium cavities for beta = 1 particle acceleration, e.g. for the TESLA project, are routinely exceeding gradients of Eacc = 20 MV/m after the application of surface preparation techniques such as buffered chemical polishing or electropolishing, high pressure ultrapure water rinsing, UHV heat treatment and clean room assembly. The successes of the technology for beta = 1 accelerators has triggered a whole set of possible future applications for beta < 1 particle acceleration such as spallation neutron sources (SNS, ESS), transmutation of nuclear waste (TRASCO, ASH) or rare isotopes (RIA). The most advanced of these projects is SNS now under construction at Oak Ridge National Laboratory. This paper will review the technical solutions adopted to advance SRF technology and their impact on cavity performance, based on the SNS prototyping efforts. 2K at these high gradients are no longer out of reach. For the accelerator builder the challenge remains to come up with a good and reasonable design, which takes into account the status of the technology and does not over-estimate the achievable cavity performances in a large assembly such as, e.g., a multi-cavity cryo-module. In the following the criteria for multi-cell sc cavity design are reviewed and it is attempted to give a snapshot of the present status of multi-cell cavity performances.

  13. Cavity magnomechanics

    NASA Astrophysics Data System (ADS)

    Zhang, Xufeng; Zou, Changling; Jiang, Liang; Tang, Hong X.

    Mechanical oscillators have been recently widely utilized to couple with optical and microwave photons in a variety of hybrid quantum systems, but they all lack the tunability. The magnetostrictive force provides an alternative mechanism to allow phonon to couple with a different type of information carrier-magnon, the collective excitation of magnetization whose frequency can be tuned by a bias magnetic field. Here, we demonstrate an intriguing hybrid system that consists of a magnonic, a mechanical, and a microwave resonator. The magnon-phonon interaction results in hallmark coherent phenomena such as magnomechanically induced transparency/absorption and magnomechanical parametric amplification. The magnetic field dependence of magnon provides our system with unprecedented tunability. Moreover, the great flexibility of our system allows us to achieve triple resonance among magnon, phonon and photon, which drastically enhances the magnomechanical interaction. Our work demonstrates the fundamental principle of cavity magnetomechanics, opening up great opportunities in various applications, such as tunable microwave filter and amplifier, long-lifetime quantum memories, microwave-to-optics conversion.

  14. Measurement of neutral gas temperature in a 13.56 MHz inductively coupled plasma

    SciTech Connect

    Jayapalan, Kanesh K.; Chin, Oi Hoong

    2015-04-24

    Measuring the temperature of neutrals in inductively coupled plasmas (ICP) is important as heating of neutral particles will influence plasma characteristics such as the spatial distributions of plasma density and electron temperature. Neutral gas temperatures were deduced using a non-invasive technique that combines gas actinometry, optical emission spectroscopy and simulation which is described here. Argon gas temperature in a 13.56 MHz ICP were found to fall within the range of 500 − 800 K for input power of 140 − 200 W and pressure of 0.05 − 0.2 mbar. Comparing spectrometers with 0.2 nm and 0.5 nm resolution, improved fitting sensitivity was observed for the 0.2 nm resolution.

  15. Phase and Frequency Locked Magnetrons for SRF Sources

    SciTech Connect

    Neubauer, Michael; Johnson, Rolland

    2014-09-12

    There is great potential for a magnetron power source that can be controlled both in phase and frequency. Such a power source could revolutionize many particle accelerator systems that require lower capital cost and/or higher power efficiency. Beyond the accelerator community, phase and frequency locked magnetons could improve radar systems around the world and make affordable phased arrays for wireless power transmission for solar powered satellites. This joint project of Muons, Inc., Fermilab, and L-3 CTL was supported by an STTR grant monitored by the Nuclear Physics Office of the DOE Office of Science. The object of the program was to incorporate ferrite materials into the anode of a magnetron and, with appropriate biasing of the ferrites, to maintain frequency lock and to allow for frequency adjustment of the magnetron without mechanical tuners. If successful, this device would have a dual use both as a source for SRF linacs and for military applications where fast tuning of the frequency is a requirement. In order to place the materials in the proper location, several attributes needed to be modeled. First the impact of the magnetron’s magnetic field needed to be shielded from the ferrites so that they were not saturated. And second, the magnetic field required to change the frequency of the magnetron at the ferrites needed to be shielded from the region containing the circulating electrons. ANSYS calculations of the magnetic field were used to optimize both of these parameters. Once the design for these elements was concluded, parts were fabricated and a complete test assembly built to confirm the predictions of the computer models. The ferrite material was also tested to determine its compatibility with magnetron tube processing temperatures. This required a vacuum bake out of the chosen material to determine the cleanliness of the material in terms of outgassing characteristics, and a subsequent room temperature test to verify that the characteristics of

  16. Results from the first single cell Nb3Sn cavity coatings at JLab

    SciTech Connect

    Eremeev, Grigory

    2015-09-01

    Nb3Sn is a promising superconducting material for SRF applications and has the potential to exceed the limitations of niobium. We have used the recently commissioned Nb3Sn coating system to investigate Nb3Sn coatings on several single cell cavities by applying the same coating procedure on several different single cells with different history and pre-coating surface preparation. We report on our findings with four 1.5 GHz CEBAF-shape single cell and one 1.3 GHz ILC-shape single cavities that were coated, inspected, and tested.

  17. Probing the fundamental limit of niobium in high radiofrequency fields by dual mode excitation in superconducting radiofrequency cavities

    SciTech Connect

    Eremeev, Grigory; Geng, Rongli; Palczewski, Ari

    2011-07-01

    We have studied thermal breakdown in several multicell superconducting radiofrequency cavity by simultaneous excitation of two TM{sub 010} passband modes. Unlike measurements done in the past, which indicated a clear thermal nature of the breakdown, our measurements present a more complex picture with interplay of both thermal and magnetic effects. JLab LG-1 that we studied was limited at 40.5 MV/m, corresponding to B{sub peak} = 173 mT, in 8{pi}/9 mode. Dual mode measurements on this quench indicate that this quench is not purely magnetic, and so we conclude that this field is not the fundamental limit in SRF cavities.

  18. MKL1/2 and ELK4 co-regulate distinct serum response factor (SRF) transcription programs in macrophages

    PubMed Central

    2014-01-01

    Background Serum response factor (SRF) is a widely expressed transcription factor involved in multiple regulatory programs. It is believed that SRF can toggle between disparate programs of gene expression through association with different cofactors. However, the direct evidence as to how these factors function on a genome-wide level is still lacking. Results In the present study, I explored the functions of SRF and its representative cofactors, megakaryoblastic leukemia 1/2 (MKL1/2) and ETS-domain protein 4 (ELK4), during fungal infection challenge in macrophages. The knockdown study, combined with gene expression array analysis, revealed that MKL1/2 regulated SRF-dependent genes were related to actin cytoskeleton organization, while ELK4 regulated SRF-dependent genes were related to external stimulus responses. Subsequent chromatin immunoprecipitation coupled with massively parallel sequencing (ChIP-seq) suggested that many of these regulations were mediated directly in cis. Conclusions I conclude that SRF utilizes MKL1/2 to fulfill steady state cellular functions, including cytoskeletal organization, and utilizes ELK4 to facilitate acute responses to external infection. Together, these findings indicate that SRF, along with its two cofactors, are important players in both cellular homeostasis and stress responses in macrophages. PMID:24758171

  19. Optical properties of bismuth-doped KCl and SrF2 crystals

    NASA Astrophysics Data System (ADS)

    Firstov, S. V.; Zhao, M.; Su, L.; Yang, Q.; Iskhakova, L. D.; Firstova, E. G.; Alyshev, S. V.; Riumkin, K. E.; Dianov, E. M.

    2016-09-01

    Structural and spectroscopic properties of the pristine and γ-irradiated Bi-doped KCl and SrF2 crystals grown by the Bridgman technique were studied. New emission bands in the visible and near IR regions from the irradiated crystals were observed. An origin of optical centers responsible for near IR luminescence is discussed.

  20. SRF Vs. Rapeseed: Insights from soil respiration and combustion heat per area

    NASA Astrophysics Data System (ADS)

    Zurba, Kamal; Matschullat, Jörg

    2015-04-01

    Bioenergy crops may be important to mitigate global warming risks. They are a renewable energy source and have the potential to offset CO2 emissions by storing C in soils. In this study, a comparison between willow and poplar short rotation forestry (SRF) with rapeseed cultivation was made to estimate the ratio between the emitted quantities of carbon dioxide from soil (soil respiration) and the combustion heat obtained from the extracted products per hectare. This ratio is valuable because it delivers a three dimensional information: soil respiration (kg CO2), combustion heat values (GJ) and area of used land (ha). A manual static closed chamber (SEMACH-FG) was applied to measure CO2 emissions at the SRF and rapeseed sites during the growing season 2014 (April-October). Our results showed that poplar and willow SRF has a very low ratio comparing to rapeseed (157.78±12.03, 199.91±31.3 and 1128.14 kg CO2 GJ-1, respectively). We thus recommend poplar and willow SRF as renewable sources for bioenergy over the currently prevalent rapeseed production.

  1. MRTF/SRF dependent transcriptional regulation of TAZ in breast cancer cells

    PubMed Central

    Liu, Chen-Ying; Chan, Siew Wee; Guo, Fusheng; Toloczko, Aleksandra; Cui, Long; Hong, Wanjin

    2016-01-01

    Dysregulation of Hippo pathway results in activation of transcriptional co-activators YAP/TAZ in breast cancer. Previously, we showed that overexpression of TAZ in breast cancer promotes cell migration, invasion and tumorigenesis. Here, we show that upregulation of TAZ in breast cancers could also be due to dysregulation of TAZ transcription. Heregulin β1 (HRG1) increases TAZ mRNA level in breast cancer cells. TAZ is a direct target of MRTF/SRF transcriptional factors which are activated by HRG1. Both MRTF/SRF and TAZ are the important downstream effectors enhancing cell migration induced by HRG1. TAZ mRNA level is correlated with nuclear localization of MRTF in breast cancer cells and the mRNA level of MRTF/SRF direct target genes in breast cancers, indicating the correlation between MRTF/SRF activity and TAZ expression. Our results provide new insights into the transcriptional regulation of TAZ and dysregulation mechanism of TAZ in breast cancer, which could be a new therapeutic strategy for breast cancer. PMID:26885614

  2. Repression of SRF target genes is critical for Myc-dependent apoptosis of epithelial cells

    PubMed Central

    Wiese, Katrin E; Haikala, Heidi M; von Eyss, Björn; Wolf, Elmar; Esnault, Cyril; Rosenwald, Andreas; Treisman, Richard; Klefström, Juha; Eilers, Martin

    2015-01-01

    Oncogenic levels of Myc expression sensitize cells to multiple apoptotic stimuli, and this protects long-lived organisms from cancer development. How cells discriminate physiological from supraphysiological levels of Myc is largely unknown. Here, we show that induction of apoptosis by Myc in breast epithelial cells requires association of Myc with Miz1. Gene expression and ChIP-Sequencing experiments show that high levels of Myc invade target sites that lack consensus E-boxes in a complex with Miz1 and repress transcription. Myc/Miz1-repressed genes encode proteins involved in cell adhesion and migration and include several integrins. Promoters of repressed genes are enriched for binding sites of the serum-response factor (SRF). Restoring SRF activity antagonizes Myc repression of SRF target genes, attenuates Myc-induced apoptosis, and reverts a Myc-dependent decrease in Akt phosphorylation and activity, a well-characterized suppressor of Myc-induced apoptosis. We propose that high levels of Myc engage Miz1 in repressive DNA binding complexes and suppress an SRF-dependent transcriptional program that supports survival of epithelial cells. PMID:25896507

  3. Simulation of ELBE SRF gun II for high-bunch-charge applications

    NASA Astrophysics Data System (ADS)

    Lu, P.; Arnold, A.; Teichert, J.; Vennekate, H.; Xiang, R.

    2016-09-01

    The SRF gun at ELBE will benefit most of the local user beamlines for future high-bunch-charge operations. Parallel to its development, simulation-based investigations have been performed to improve the beam quality for THz experiments and Compton backscattering experiments. These two applications have the most challenging requirements: THz experiments benefit significantly from short bunch lengths at the sub-ps level, while Compton backscattering experiments demand small transverse beam sizes of about 30 μm. The beam dynamics of the SRF gun are simulated with ASTRA and the beam transport is optimized using Elegant. Important physical effects included in simulations are introduced first, where the interesting phenomenon of "slice mismatch" is generally quantified and numerically studied. Afterwards, beam transport strategies and optimization methods are proposed which are based on the specific settings of ELBE but also applicable to similar accelerator setups. Finally, optimizations of the SRF gun and the beam transport in ELBE are presented. Results show that the SRF gun is capable of providing 500 pC bunches for both applications with better beam qualities than the currently 100 pC bunches supplied by the existing thermionic DC source.

  4. The B-box dominates SAP-1-SRF interactions in the structure of the ternary complex.

    PubMed

    Hassler, M; Richmond, T J

    2001-06-15

    The serum response element (SRE) is found in several immediate-early gene promoters. This DNA sequence is necessary and sufficient for rapid transcriptional induction of the human c-fos proto-oncogene in response to stimuli external to the cell. Full activation of the SRE requires the cooperative binding of a ternary complex factor (TCF) and serum response factor (SRF) to their specific DNA sites. The X-ray structure of the human SAP-1-SRF-SRE DNA ternary complex was determined (Protein Data Bank code 1hbx). It shows SAP-1 TCF bound to SRF through interactions between the SAP-1 B-box and SRF MADS domain in addition to contacts between their respective DNA-binding motifs. The SAP-1 B-box is part of a flexible linker of which 21 amino acids become ordered upon ternary complex formation. Comparison with a similar region from the yeast MATalpha2-MCM1-DNA complex suggests a common binding motif through which MADS-box proteins may interact with additional factors such as Fli-1. PMID:11406578

  5. Road Map for Studies to Produce Consistent and High Performance SRF Accelerator Structures

    SciTech Connect

    Ganapati Rao Myneni; John F. O’Hanlon

    2007-06-20

    Superconducting Radio Frequency (SRF) accelerator structures made from high purity niobium are becoming the technological choice for a large number of future accelerators and energy recovery LINAC’s (ERL). Most of the presently planned accelerators and ERL requirements will be met with some effort by the current SRF technology where accelerating gradients of about 20 MV/m can be produced on a routine basis with an acceptable yield. However, the XFEL at DESY and the planned ILC require acceleration gradients more than 28 MV/m and 35 MV/m respectively. At the recent ILC meeting at Snowmass (2005) concern was expressed regarding the wide spread in the achieved accelerator gradients and the relatively low yields. For obtaining accelerating gradients of 35 MV/m in SRF accelerator structures consistently, a deeper understanding of the causes for the spread has to be gained and advances have to be made in many scientific and high technology fields, including materials, surface and vacuum sciences, application of reliable processes and procedures, which provide contamination –free surfaces and avoid recontamination and cryogenics related technologies. In this contribution a road map for studies needed to produce consistent and high performance SRF accelerator structures from the needed materials development to clean and non-recontaminating processes and procedures will be presented.

  6. Dual frequency optical cavity

    DOEpatents

    George, E.V.; Schipper, J.F.

    Method and apparatus for generating two distinct laser frequencies in an optical cavity, using a T configuration laser cavity and means for intermittently increasing or decreasing the index of refraction n of an associated transmission medium in one arm of the optical cavity to enhance laser action in one arm or the second arm of the cavity.

  7. Dual frequency optical cavity

    DOEpatents

    George, E. Victor; Schipper, John F.

    1985-01-01

    Method and apparatus for generating two distinct laser frequencies in an optical cavity, using a "T" configuration laser cavity and means for intermittently increasing or decreasing the index of refraction n of an associated transmission medium in one arm of the optical cavity to enhance laser action in one arm or the second arm of the cavity.

  8. RESONANT CAVITY EXCITATION SYSTEM

    DOEpatents

    Baker, W.R.

    1959-08-01

    A cavity excitation circuit is described for rapidly building up and maintaining high-level oscillations in a resonant cavity. The circuit overcomes oscillation buildup slowing effects such as ion locking in the cavity by providing for the selective application of an amplified accelerating drive signal to the main cavity exciting oscillator during oscillation buildup and a direct drive signal to the oscillator thereafter.

  9. Cryogenic Infrastructure for Fermilab's Ilc Vertical Cavity Test Facility

    NASA Astrophysics Data System (ADS)

    Carcagno, R.; Ginsburg, C.; Huang, Y.; Norris, B.; Ozelis, J.; Peterson, T.; Poloubotko, V.; Rabehl, R.; Sylvester, C.; Wong, M.

    2008-03-01

    Fermilab is building a Vertical Cavity Test Facility (VCTF) to provide for R&D and pre-production testing of bare 9-cell, 1.3-GHz superconducting RF (SRF) cavities for the International Linear Collider (ILC) program. This facility is located in the existing Industrial Building 1 (IB1) where the Magnet Test Facility (MTF) also resides. Helium and nitrogen cryogenics are shared between the VCTF and MTF including the existing 1500-W at 4.5-K helium refrigerator with vacuum pumping for super-fluid operation (125-W capacity at 2-K). The VCTF is being constructed in multiple phases. The first phase is scheduled for completion in mid 2007, and includes modifications to the IB1 cryogenic infrastructure to allow helium cooling to be directed to either the VCTF or MTF as scheduling demands require. At this stage, the VCTF consists of one Vertical Test Stand (VTS) cryostat for the testing of one cavity in a 2-K helium bath. Planning is underway to provide a total of three Vertical Test Stands at VCTF, each capable of accommodating two cavities. Cryogenic infrastructure improvements necessary to support these additional VCTF test stands include a dedicated ambient temperature vacuum pump, a new helium purification skid, and the addition of helium gas storage. This paper describes the system design and initial cryogenic operation results for the first VCTF phase, and outlines future cryogenic infrastructure upgrade plans for expanding to three Vertical Test Stands.

  10. CRYOGENIC INFRASTRUCTURE FOR FERMILAB'S ILC VERTICAL CAVITY TEST FACILITY

    SciTech Connect

    Carcagno, R.; Ginsburg, C.; Huang, Y.; Norris, B.; Ozelis, J.; Peterson, T.; Poloubotko, V.; Rabehl, R.; Sylvester, C.; Wong, M.

    2008-03-16

    Fermilab is building a Vertical Cavity Test Facility (VCTF) to provide for R and D and pre-production testing of bare 9-cell, 1.3-GHz superconducting RF (SRF) cavities for the International Linear Collider (ILC) program. This facility is located in the existing Industrial Building 1 (IB1) where the Magnet Test Facility (MTF) also resides. Helium and nitrogen cryogenics are shared between the VCTF and MTF including the existing 1500-W at 4.5-K helium refrigerator with vacuum pumping for super-fluid operation (125-W capacity at 2-K). The VCTF is being constructed in multiple phases. The first phase is scheduled for completion in mid 2007, and includes modifications to the IB1 cryogenic infrastructure to allow helium cooling to be directed to either the VCTF or MTF as scheduling demands require. At this stage, the VCTF consists of one Vertical Test Stand (VTS) cryostat for the testing of one cavity in a 2-K helium bath. Planning is underway to provide a total of three Vertical Test Stands at VCTF, each capable of accommodating two cavities. Cryogenic infrastructure improvements necessary to support these additional VCTF test stands include a dedicated ambient temperature vacuum pump, a new helium purification skid, and the addition of helium gas storage. This paper describes the system design and initial cryogenic operation results for the first VCTF phase, and outlines future cryogenic infrastructure upgrade plans for expanding to three Vertical Test Stands.

  11. Cryogenic infrastructure for Fermilab's ILC vertical cavity test facility

    SciTech Connect

    Carcagno, R.; Ginsburg, C.; Huang, Y.; Norris, B.; Ozelis, J.; Peterson, T.; Poloubotko, V.; Rabehl, R.; Sylvester, C.; Wong, M.; /Fermilab

    2006-06-01

    Fermilab is building a Vertical Cavity Test Facility (VCTF) to provide for R&D and pre-production testing of bare 9-cell, 1.3-GHz superconducting RF (SRF) cavities for the International Linear Collider (ILC) program. This facility is located in the existing Industrial Building 1 (IB1) where the Magnet Test Facility (MTF) also resides. Helium and nitrogen cryogenics are shared between the VCTF and MTF including the existing 1500-W at 4.5-K helium refrigerator with vacuum pumping for super-fluid operation (125-W capacity at 2-K). The VCTF is being constructed in multiple phases. The first phase is scheduled for completion in mid 2007, and includes modifications to the IB1 cryogenic infrastructure to allow helium cooling to be directed to either the VCTF or MTF as scheduling demands require. At this stage, the VCTF consists of one Vertical Test Stand (VTS) cryostat for the testing of one cavity in a 2-K helium bath. Planning is underway to provide a total of three Vertical Test Stands at VCTF, each capable of accommodating two cavities. Cryogenic infrastructure improvements necessary to support these additional VCTF test stands include a dedicated ambient temperature vacuum pump, a new helium purification skid, and the addition of helium gas storage. This paper describes the system design and initial cryogenic operation results for the first VCTF phase, and outlines future cryogenic infrastructure upgrade plans for expanding to three Vertical Test Stands.

  12. Photon storage cavities

    SciTech Connect

    Kim, K.J.; Sessler, A.M.

    1991-08-01

    A general analysis is presented of a photon storage cavity, coupled to free-electron laser (FEL) cavity. It is shown that if the coupling between the FEL cavity and the storage cavity is unidirectional (for example, a ring resonator storage cavity) then storage is possible, but that if the coupling is bi-directional then storage is not possible. Parameters are presented for an infra-red FEL storage cavity giving an order of magnitude increase in the instantaneous photon power within the storage cavity. 4 refs., 3 figs.

  13. Segmented trapped vortex cavity

    NASA Technical Reports Server (NTRS)

    Grammel, Jr., Leonard Paul (Inventor); Pennekamp, David Lance (Inventor); Winslow, Jr., Ralph Henry (Inventor)

    2010-01-01

    An annular trapped vortex cavity assembly segment comprising includes a cavity forward wall, a cavity aft wall, and a cavity radially outer wall there between defining a cavity segment therein. A cavity opening extends between the forward and aft walls at a radially inner end of the assembly segment. Radially spaced apart pluralities of air injection first and second holes extend through the forward and aft walls respectively. The segment may include first and second expansion joint features at distal first and second ends respectively of the segment. The segment may include a forward subcomponent including the cavity forward wall attached to an aft subcomponent including the cavity aft wall. The forward and aft subcomponents include forward and aft portions of the cavity radially outer wall respectively. A ring of the segments may be circumferentially disposed about an axis to form an annular segmented vortex cavity assembly.

  14. Determination of bulk and surface superconducting properties of N2-doped cold worked, heat treated and electro-polished SRF grade niobium

    SciTech Connect

    Chetri, Santosh; Larbalestier, David C.; Lee, Peter J.; Dhakal, Pashupati; Sung, Zu -Hawn

    2015-12-01

    In this study, nitrogen-doped cavities show significant performance improvement in the medium accelerating field regime due to a lowered RF surface resistivity. However, the mechanism of enhancement has not been clearly explained. Our experiments explore how N2-doping influences Nb bulk and surface superconducting properties, and compare the N2-doped properties with those obtained previously with conventionally treated samples. High purity Nb-rod was mechanically deformed and post treated based on a typical SRF cavity treatment recipe. The onset of flux penetration at Hc1, and the upper and the surface critical fields, Hc2 and Hc3, were characterized by magnetic hysteresis and AC susceptibility techniques. The surface depth profile responsible for superconductivity was examined by changing AC amplitude in AC susceptibility, and the microstructure was directly observed with EBSD-OIM. We are also investigating surface chemistry for detailed composition using XPS. We have found that N2-doping at 800 °C significantly reduces the Hc3/Hc2 ratio towards the ideal value of ~1.7, and conclude that AC susceptibility is capable of following changes to the surface properties induced by N2-doping.

  15. Determination of bulk and surface superconducting properties of N2-doped cold worked, heat treated and electro-polished SRF grade niobium

    DOE PAGESBeta

    Chetri, Santosh; Larbalestier, David C.; Lee, Peter J.; Dhakal, Pashupati; Sung, Zu -Hawn

    2015-12-01

    In this study, nitrogen-doped cavities show significant performance improvement in the medium accelerating field regime due to a lowered RF surface resistivity. However, the mechanism of enhancement has not been clearly explained. Our experiments explore how N2-doping influences Nb bulk and surface superconducting properties, and compare the N2-doped properties with those obtained previously with conventionally treated samples. High purity Nb-rod was mechanically deformed and post treated based on a typical SRF cavity treatment recipe. The onset of flux penetration at Hc1, and the upper and the surface critical fields, Hc2 and Hc3, were characterized by magnetic hysteresis and AC susceptibilitymore » techniques. The surface depth profile responsible for superconductivity was examined by changing AC amplitude in AC susceptibility, and the microstructure was directly observed with EBSD-OIM. We are also investigating surface chemistry for detailed composition using XPS. We have found that N2-doping at 800 °C significantly reduces the Hc3/Hc2 ratio towards the ideal value of ~1.7, and conclude that AC susceptibility is capable of following changes to the surface properties induced by N2-doping.« less

  16. Phase and Frequency Locked Magnetrons for SRF Sources

    SciTech Connect

    Neubauer, M.; Johnson, R.P.; Popovic, M.; Moretti, A.; /Fermilab

    2009-05-01

    Magnetrons are low-cost highly-efficient microwave sources, but they have several limitations, primarily centered about the phase and frequency stability of their output. When the stability requirements are low, such as for medical accelerators or kitchen ovens, magnetrons are the very efficient power source of choice. But for high energy accelerators, because of the need for frequency and phase stability - proton accelerators need 1-2 degrees source phase stability, and electron accelerators need .1-.2 degrees of phase stability - they have rarely been used. We describe a novel variable frequency cavity technique which will be utilized to phase and frequency lock magnetrons.

  17. Design and Fabrication of the RHIC Electron-Cooling Experiment High Beta Cavity and Cryomodule

    SciTech Connect

    Holmes,D.; Calderaro, M.; Cole, M.; Falletta, M.; Peterson, E.; Rathke, J.; Schultheiss, T.; Wong, R.; Ben-Zvi, I.; Burrill, A.; Calaga, R.; McIntyre, G.

    2008-11-17

    The summary of this report is: (1) A high-current SRF cavity for an Energy Recovery Linac (ERL) has been designed by BNL and AES and fabricated by AES; (2) The cavity was cleaned and tested by JLAB with BNL personnel support; (3) Cavity performance exceeded goal of 20 MV/m at Q{sub 0} > 1 x 10{sup 10} and far exceeded requirement of 15 MV/m at Q{sub 0} > 1 x 10{sup 10}; (4) Hermetic String assembled at JLAB with BNL personnel support and shipped to BNL; and (5) BNL has recently completed Cryomodule assembly and unit is ready for installation in the ERL vault.

  18. Coupling interaction between the power coupler and the third harmonic superconducting cavity

    SciTech Connect

    Li, Jianjian; Solyak, Nikolay; Wong, Thomas; /IIT, Chicago

    2007-06-01

    Fermilab has developed a third harmonic superconducting cavity operating at the frequency of 3.9 GHz to improve the beam performance for the FLASH user facility at DESY. It is interesting to investigate the coupling interaction between the SRF cavity and the power coupler with or without beam loading. The coupling of the power coupler to the cavity needs to be determined to minimize the power consumption and guarantee the best performance for a given beam current. In this paper, we build and analyze an equivalent circuit model containing a series of lumped elements to represent the resonant system. An analytic solution of the required power from the generator as a function of the system parameters has also been given based on a vector diagram.

  19. Optimizing RF gun cavity geometry within an automated injector design system

    SciTech Connect

    Alicia Hofler ,Pavel Evtushenko

    2011-03-28

    RF guns play an integral role in the success of several light sources around the world, and properly designed and optimized cw superconducting RF (SRF) guns can provide a path to higher average brightness. As the need for these guns grows, it is important to have automated optimization software tools that vary the geometry of the gun cavity as part of the injector design process. This will allow designers to improve existing designs for present installations, extend the utility of these guns to other applications, and develop new designs. An evolutionary algorithm (EA) based system can provide this capability because EAs can search in parallel a large parameter space (often non-linear) and in a relatively short time identify promising regions of the space for more careful consideration. The injector designer can then evaluate more cavity design parameters during the injector optimization process against the beam performance requirements of the injector. This paper will describe an extension to the APISA software that allows the cavity geometry to be modified as part of the injector optimization and provide examples of its application to existing RF and SRF gun designs.

  20. Physical Properties of Niobium and Specifications for Fabrication of Superconducting Cavities

    SciTech Connect

    Antoine, C.; Foley, M.; Dhanaraj, N.; /Fermilab

    2011-07-01

    It is important to distinguish among the properties of niobium, the ones that are related to the cavity's SRF performances, the formability of the material, and the mechanical behavior of the formed cavity. In general, the properties that dictate each of the above mentioned characteristics have a detrimental effect on one another and in order to preserve the superconducting properties without subduing the mechanical behavior, a balance has to be established. Depending on the applications, some parameters become less important and an understanding of the physical origin of the requirements might help in this optimization. SRF applications require high purity niobium (high RRR), but pure niobium is very soft from fabrication viewpoint. Moreover conventional fabrication techniques tend to override the effects of any metallurgical process meant to strengthen it. As those treatments dramatically affect the forming of the material they should be avoided. These unfavorable mechanical properties have to be accounted for in the design of the cavities rather than in the material specification. The aim of this paper is to review the significance of the important mechanical properties used to characterize niobium and to present the optimal range of values. Most of the following information deals with the specification of sheets for cell forming unless otherwise noted.

  1. Laser Processing on the Surface of Niobium Superconducting Radio-Frequency Accelerator Cavities

    NASA Astrophysics Data System (ADS)

    Singaravelu, Senthilraja; Klopf, Michael; Krafft, Geoffrey; Kelley, Michael

    2011-03-01

    Superconducting Radio frequency (SRF) niobium cavities are at the heart of an increasing number of particle accelerators.~ Their performance is dominated by a several nm thick layer at the interior surface. ~Maximizing its smoothness is found to be critical and aggressive chemical treatments are employed to this end.~ We describe laser-induced surface melting as an alternative ``greener'' approach.~ Modeling guided selection of parameters for irradiation with a Q-switched Nd:YAG laser.~ The resulting topography was examined by SEM, AFM and Stylus Profilometry.

  2. Insights to Superconducting Radio-Frequency Cavity Processing from First Principles Calculations and Spectroscopic Techniques

    SciTech Connect

    Ford, Denise Christine

    2013-03-01

    Insights to the fundamental processes that occur during the manufacturing of niobium superconducting radio-frequency (SRF) cavities are provided via analyses of density functional theory calculations and Raman, infrared, and nuclear magnetic resonance (NMR) spectra. I show that during electropolishing fluorine is bound and released by the reaction of the acid components in the solution: HF + H2SO4 <-> HFSO3 + H2O. This result implies that new recipes can possibly be developed on the principle of controlled release of fluorine by a chemical reaction. I also show that NMR or Raman spectroscopy can be used to monitor the free fluorine when polishing with the standard electropolishing recipe. Density functional theory was applied to calculate the properties of common processing impurities – hydrogen, oxygen, nitrogen, and carbon – in the niobium. These impurities lower the superconducting transition temperature of niobium, and hydride precipitates are at best weakly superconducting. I modeled several of the niobium hydride phases relevant to SRF cavities, and explain the phase changes in the niobium hydrogen system based on the charge transfer between niobium and hydrogen and the strain field inside of the niobium. I also present evidence for a niobium lattice vacancy serving as a nucleation center for hydride phase formation. In considering the other chemical impurities in niobium, I show that the absorption of oxygen into a niobium lattice vacancy is preferred over the absorption of hydrogen, which indicates that oxygen can block these phase nucleation centers. I also show that dissolved oxygen atoms can trap dissolved hydrogen atoms to prevent niobium hydride phase formation. Nitrogen and carbon were studied in less depth, but behaved similarly to oxygen. Based on these results and a literature survey, I propose a mechanism for the success of the low-temperature anneal applied to niobium SRF cavities. Finally, I

  3. Insights to Superconducting Radio-Frequency Cavity Processing from First Principles Calculations and Spectroscopic Techniques

    NASA Astrophysics Data System (ADS)

    Ford, Denise Christine

    Insights to the fundamental processes that occur during the manufacturing of niobium superconducting radio-frequency (SRF) cavities are provided via analyses of density functional theory calculations and Raman, infrared, and nuclear magnetic resonance (NMR) spectra. I show that during electropolishing fluorine is bound and released by the reaction of the acid components in the solution: HF + H2SO4 <-> HFSO3 + H2O. This result implies that new recipes can possibly be developed on the principle of controlled release of fluorine by a chemical reaction. I also show that NMR or Raman spectroscopy can be used to monitor the free fluorine when polishing with the standard electropolishing recipe. Density functional theory was applied to calculate the properties of common processing impurities---hydrogen, oxygen, nitrogen, and carbon---in the niobium. These impurities lower the superconducting transition temperature of niobium, and hydride precipitates are at best weakly superconducting. I modeled several of the niobium hydride phases relevant to SRF cavities, and explain the phase changes in the niobium hydrogen system based on the charge transfer between niobium and hydrogen and the strain field inside of the niobium. I also present evidence for a niobium lattice vacancy serving as a nucleation center for hydride phase formation. In considering the other chemical impurities in niobium, I show that the absorption of oxygen into a niobium lattice vacancy is preferred over the absorption of hydrogen, which indicates that oxygen can block these phase nucleation centers. I also show that dissolved oxygen atoms can trap dissolved hydrogen atoms to prevent niobium hydride phase formation. Nitrogen and carbon were studied in less depth, but behaved similarly to oxygen. Based on these results and a literature survey, I propose a mechanism for the success of the low-temperature anneal applied to niobium SRF cavities. Finally, I present the beginning of a model to describe magnetic

  4. Sample preparation and biomass determination of SRF model mixture using cryogenic milling and the adapted balance method

    SciTech Connect

    Schnöller, Johannes Aschenbrenner, Philipp; Hahn, Manuel; Fellner, Johann; Rechberger, Helmut

    2014-11-15

    Highlights: • An alternative sample comminution procedure for SRF is tested. • Proof of principle is shown on a SRF model mixture. • The biogenic content of the SRF is analyzed with the adapted balance method. • The novel method combines combustion analysis and a data reconciliation algorithm. • Factors for the variance of the analysis results are statistically quantified. - Abstract: The biogenic fraction of a simple solid recovered fuel (SRF) mixture (80 wt% printer paper/20 wt% high density polyethylene) is analyzed with the in-house developed adapted balance method (aBM). This fairly new approach is a combination of combustion elemental analysis (CHNS) and a data reconciliation algorithm based on successive linearisation for evaluation of the analysis results. This method shows a great potential as an alternative way to determine the biomass content in SRF. However, the employed analytical technique (CHNS elemental analysis) restricts the probed sample mass to low amounts in the range of a few hundred milligrams. This requires sample comminution to small grain sizes (<200 μm) to generate representative SRF specimen. This is not easily accomplished for certain material mixtures (e.g. SRF with rubber content) by conventional means of sample size reduction. This paper presents a proof of principle investigation of the sample preparation and analysis of an SRF model mixture with the use of cryogenic impact milling (final sample comminution) and the adapted balance method (determination of biomass content). The so derived sample preparation methodology (cutting mills and cryogenic impact milling) shows a better performance in accuracy and precision for the determination of the biomass content than one solely based on cutting mills. The results for the determination of the biogenic fraction are within 1–5% of the data obtained by the reference methods, selective dissolution method (SDM) and {sup 14}C-method ({sup 14}C-M)

  5. The external Q factor of a dual-feed coupling for superconducting radio frequency cavities: theoretical and experimental studies.

    PubMed

    Dai, J; Belomestnykh, S; Ben-Zvi, I; Xu, Wencan

    2013-11-01

    We propose a theoretical model based on network analysis to study the external quality factor (Q factor) of dual-feed coupling for superconducting radio-frequency (SRF) cavities. Specifically, we apply our model to the dual-feed 704 MHz half-cell SRF gun for Brookhaven National Laboratory's prototype Energy Recovery Linac (ERL). The calculations show that the external Q factor of this dual-feed system is adjustable from 10(4) to 10(9) provided that the adjustment range of a phase shifter covers 0°-360°. With a period of 360°, the external Q factor of the coupling system changes periodically with the phase difference between the two coupling arms. When the RF phase of both coupling arms is adjusted simultaneously in the same direction, the external Q factor of the system also changes periodically, but with a period of 180°. PMID:24289393

  6. Fine-tuned SRF activity controls asymmetrical neuronal outgrowth: implications for cortical migration, neural tissue lamination and circuit assembly.

    PubMed

    Scandaglia, Marilyn; Benito, Eva; Morenilla-Palao, Cruz; Fiorenza, Anna; Del Blanco, Beatriz; Coca, Yaiza; Herrera, Eloísa; Barco, Angel

    2015-01-01

    The stimulus-regulated transcription factor Serum Response Factor (SRF) plays an important role in diverse neurodevelopmental processes related to structural plasticity and motile functions, although its precise mechanism of action has not yet been established. To further define the role of SRF in neural development and distinguish between cell-autonomous and non cell-autonomous effects, we bidirectionally manipulated SRF activity through gene transduction assays that allow the visualization of individual neurons and their comparison with neighboring control cells. In vitro assays showed that SRF promotes survival and filopodia formation and is required for normal asymmetric neurite outgrowth, indicating that its activation favors dendrite enlargement versus branching. In turn, in vivo experiments demonstrated that SRF-dependent regulation of neuronal morphology has important consequences in the developing cortex and retina, affecting neuronal migration, dendritic and axonal arborization and cell positioning in these laminated tissues. Overall, our results show that the controlled and timely activation of SRF is essential for the coordinated growth of neuronal processes, suggesting that this event regulates the switch between neuronal growth and branching during developmental processes. PMID:26638868

  7. Fine-tuned SRF activity controls asymmetrical neuronal outgrowth: implications for cortical migration, neural tissue lamination and circuit assembly

    PubMed Central

    Scandaglia, Marilyn; Benito, Eva; Morenilla-Palao, Cruz; Fiorenza, Anna; del Blanco, Beatriz; Coca, Yaiza; Herrera, Eloísa; Barco, Angel

    2015-01-01

    The stimulus-regulated transcription factor Serum Response Factor (SRF) plays an important role in diverse neurodevelopmental processes related to structural plasticity and motile functions, although its precise mechanism of action has not yet been established. To further define the role of SRF in neural development and distinguish between cell-autonomous and non cell-autonomous effects, we bidirectionally manipulated SRF activity through gene transduction assays that allow the visualization of individual neurons and their comparison with neighboring control cells. In vitro assays showed that SRF promotes survival and filopodia formation and is required for normal asymmetric neurite outgrowth, indicating that its activation favors dendrite enlargement versus branching. In turn, in vivo experiments demonstrated that SRF-dependent regulation of neuronal morphology has important consequences in the developing cortex and retina, affecting neuronal migration, dendritic and axonal arborization and cell positioning in these laminated tissues. Overall, our results show that the controlled and timely activation of SRF is essential for the coordinated growth of neuronal processes, suggesting that this event regulates the switch between neuronal growth and branching during developmental processes. PMID:26638868

  8. SRF Test Areas Cryogenic System Controls Graphical User Interface

    SciTech Connect

    DeGraff, B.D.; Ganster, G.; Klebaner, A.; Petrov, A.D.; Soyars, W.M.; /Fermilab

    2011-06-09

    Fermi National Accelerator Laboratory has constructed a superconducting 1.3 GHz cavity test facility at Meson Detector Building (MDB) and a superconducting 1.3 GHz cryomodule test facility located at the New Muon Lab Building (NML). The control of these 2K cryogenic systems is accomplished by using a Synoptic graphical user interface (GUI) to interact with the underlying Fermilab Accelerator Control System. The design, testing and operational experience of employing the Synoptic client-server system for graphical representation will be discussed. Details on the Synoptic deployment to the MDB and NML cryogenic sub-systems will also be discussed. The implementation of the Synoptic as the GUI for both NML and MDB has been a success. Both facilities are currently fulfilling their individual roles in SCRF testing as a result of successful availability of the cryogenic systems. The tools available for creating Synoptic pages will continue to be developed to serve the evolving needs of users.

  9. RECENT XPS STUDIES OF THE EFFECT OF PROCESSING ON NB SRF SURFACES

    SciTech Connect

    Hui Tian; Binping Xiao; Michael Kelley; Charles Reece; A. Demasi; L. Pipe; Kevin Smith

    2008-02-12

    XPS studies have consistently shown that Nb surfaces for SRF chiefly comprise of a few nm of Nb2O5 on top of Nb metal, with minor amounts of Nb sub-oxides. Nb samples after BCP/EP treatment with post-baking at the various conditions have been examined by using synchrotron based XPS. Despite the confounding influence of surface roughness, certain outcomes are clear. Lower-valence Nb species are always and only associated with the metal/oxide interface, but evidence for an explicit layer structure or discrete phases is lacking. Post-baking without air exposure shows decreased oxide layer thickness and increased contribution from lower valence species, but spectra obtained after subsequent air exposure cannot be distinguished from those obtained prior to baking, though the SRF performance improvement remains.

  10. HiPIMS: a New Generation of Film Deposition Techniques for SRF Applications

    SciTech Connect

    Valente-Feliciano, Anne-Marie

    2013-09-01

    Over the years, Nb/Cu technology, despite its shortcomings due to the commonly used magnetron sputtering, has positioned itself as an alternative route for the future of accelerator superconducting structures. Avenues for the production of thin films tailored for Superconducting RF (SRF) applications are showing promise with recent developments in ionized PVD coating techniques, i.e. vacuum deposition techniques using energetic ions. Among these techniques, High power impulse magnetron sputtering (HiPIMS) is a promising emerging technique which combines magnetron sputtering with a pulsed power approach. This contribution describes the benefits of energetic condensation for SRF films and the characteristics of the HiPIMS technology. It describes the on-going efforts pursued in different institutions to exploit the potential of this technology to produce bulk-like Nb films and go beyond Nb performance with the development of film systems, based on other superconducting materials and multilayer structures.

  11. Status and Plans for an SRF Accelerator Test Facility at Fermilab

    SciTech Connect

    Church, M.; Leibfritz, J.; Nagaitsev, S.; /Fermilab

    2011-07-29

    A superconducting RF accelerator test facility is currently under construction at Fermilab. The accelerator will consist of an electron gun, 40 MeV injector, beam acceleration section consisting of 3 TTF-type or ILC-type cryomodules, and multiple downstream beam lines for testing diagnostics and performing beam experiments. With 3 cryomodules installed this facility will initially be capable of generating an 810 MeV electron beam with ILC beam intensity. The facility can accommodate up to 6 cryomodules for a total beam energy of 1.5 GeV. This facility will be used to test SRF cryomodules under high intensity beam conditions, RF power equipment, instrumentation, and LLRF and controls systems for future SRF accelerators such as the ILC and Project-X. This paper describes the current status and overall plans for this facility.

  12. Secondary electron emission from plasma processed accelerating cavity grade niobium

    NASA Astrophysics Data System (ADS)

    Basovic, Milos

    by different techniques. Specifically, this work provides the results of SEY from the plasma cleaned cavity grade niobium (Nb) samples. Pure niobium is currently the material of choice for the fabrication of Superconducting Radio Frequency (SRF) cavities. The effect of plasma processing with two different gases will be examined in two groups of samples. The first group of samples is made from cavity grade niobium. The second group of samples is made from the same material, but include a welded joint made by electron beam welding, since in niobium SRF cavities the peak electric and magnetic field are seen in close proximity to the welded joints. Both groups of samples will be exposed to nitrogen (N2) and a mixture of argon with oxygen (Ar/O2) plasma. It is the goal of this research to determine the SEY on these two groups of samples before and after plasma processing as a function of the energy of primary electrons. The SEY as a function of the angle of incidence of the primary electrons is tested on the samples treated with Ar/O2 plasma.

  13. Longitudinal Space Charge Effects in the JLAB IR FEL SRF LINAC

    SciTech Connect

    C. Hernandez-Garcia; K. Beard; C. Behre; S. Benson; G. Biallas; J. Boyce; D. Douglas; H. F. Dylla; R. Evans; A. Grippo; J. Gubeli; D. Hardy; K. Jordan; L. Merminga; G. Neil; J. Preble; Michelle D. Shinn; T. Siggins; R. Walker; G. P. Williams; B. Yunn; S. Zhang

    2004-09-01

    Observations of energy spread asymmetry when operating the Linac on either side of crest and longitudinal emittance growth have been confirmed by extending PARMELA simulations from the injector to the end of the first SRF Linac module. The asymmetry can be explained by the interaction of the accelerating electric field with that from longitudinal space charge effects within the electron bunch. This can be a major limitation to performance in FEL accelerators.

  14. Gas cluster ion beam surface treatments for reducing field emission and breakdown of electrodes and SRF cavities.

    SciTech Connect

    Swenson, D. R.; Wu, A. T.; Degenkolb, E.; Insepov, Z.; Mathematics and Computer Science; Epion Corp.; Jefferson National Lab.

    2007-01-01

    Sub-micron-scale surface roughness and contamination cause field emission that can lead to high-voltage breakdown of electrodes, and these are limiting factors in the development of high gradient RF technology. We are studying various Gas Cluster Ion Beam (GCIB) treatments to smooth, clean, etch and/or chemically alter electrode surfaces to allow higher fields and accelerating gradients, and to reduce the time and cost of conditioning high-voltage electrodes. For this paper, we have processed Nb, stainless steel and Ti electrode materials using beams of Ar, O{sub 2}, or NF{sub 3} + O{sub 2} clusters with accelerating potentials up to 35 kV. Using a scanning field emission microscope (SFEM), we have repeatedly seen a dramatic reduction in the number of field emission sites on Nb coupons treated with GCIB. Smoothing effects on stainless steel and Ti substrates, evaluated using SEM and AFM imaging, show that 200-nm-wide polishing scratch marks are greatly attenuated. A 150-mm diameter GCIB-treated stainless steel electrode has shown virtually no DC field emission current at gradients over 20 MV/m.

  15. Performance of a reentrant cavity beam position monitor

    NASA Astrophysics Data System (ADS)

    Simon, Claire; Luong, Michel; Chel, Stéphane; Napoly, Olivier; Novo, Jorge; Roudier, Dominique; Rouvière, Nelly; Baboi, Nicoleta; Mildner, Nils; Nölle, Dirk

    2008-08-01

    The beam-based alignment and feedback systems, essential operations for the future colliders, require high resolution beam position monitors (BPMs). In the framework of the European CARE/SRF program, a reentrant cavity BPM with its associated electronics was developed by the CEA/DSM/Irfu in collaboration with DESY. The design, the fabrication, and the beam test of this monitor are detailed within this paper. This BPM is designed to be inserted in a cryomodule, work at cryogenic temperature in a clean environment. It has achieved a resolution better than 10μm and has the possibility to perform bunch to bunch measurements for the x-ray free electron laser (X-FEL) and the International Linear Collider (ILC). Its other features are a small size of the rf cavity, a large aperture (78 mm), and an excellent linearity. A first prototype of a reentrant cavity BPM was installed in the free electron laser in Hamburg (FLASH), at Deutsches Elektronen-Synchrotron (DESY) and demonstrated its operation at cryogenic temperature inside a cryomodule. The second, installed, also, in the FLASH linac to be tested with beam, measured a resolution of approximately 4μm over a dynamic range ±5mm in single bunch.

  16. Effect of low temperature baking on the RF properties of niobium superconducting cavities for particle accelerators

    SciTech Connect

    Gianluigi Ciovati

    2004-03-01

    Radio-frequency superconducting (SRF) cavities are widely used to accelerate a charged particle beam in particle accelerators. The performance of SRF cavities made of bulk niobium has significantly improved over the last ten years and is approaching the theoretical limit for niobium. Nevertheless, RF tests of niobium cavities are still showing some ''anomalous'' losses that require a better understanding in order to reliably obtain better performance. These losses are characterized by a marked dependence of the surface resistance on the surface electromagnetic field and can be detected by measuring the quality factor of the resonator as a function of the peak surface field. A low temperature (100 C-150 C) ''in situ'' bake under ultra-high vacuum has been successfully applied as final preparation of niobium RF cavities by several laboratories over the last few years. The benefits reported consist mainly of an improvement of the cavity quality factor at low field and a recovery from ''anomalous'' losses (so-called ''Q-drop'') without field emission at higher field. A series of experiments with a CEBAF single-cell cavity have been carried out at Jefferson Lab to carefully investigate the effect of baking at progressively higher temperatures for a fixed time on all the relevant material parameters. Measurements of the cavity quality factor in the temperature range 1.37 K-280 K and resonant frequency shift between 6 K-9.3 K provide information about the surface resistance, energy gap, penetration depth and mean free path. The experimental data have been analyzed with the complete BCS theory of superconductivity. The hydrogen content of small niobium samples inserted in the cavity during its surface preparation was analyzed with Nuclear Reaction Analysis (NRA). The single-cell cavity has been tested at three different temperatures before and after baking to gain some insight on thermal conductivity and Kapitza resistance and the data are compared with different models

  17. Production of Seamless Superconducting Radio Frequency Cavities from Ultra-fine Grained Niobium, Phase II Final Report

    SciTech Connect

    Roy Crooks, Ph.D., P.E.

    2009-10-31

    The positron and electron linacs of the International Linear Collider (ILC) will require over 14,000, nine-cell, one meter length, superconducting radio frequency (SRF) cavities [ILC Reference Design Report, 2007]. Manufacturing on this scale will benefit from more efficient fabrication methods. The current methods of fabricating SRF cavities involve deep drawing of the halves of each of the elliptical cells and joining them by high-vacuum, electron beam welding, with at least 19 circumferential welds per cavity. The welding is costly and has undesirable effects on the cavity surfaces, including grain-scale surface roughening at the weld seams. Hydroforming of seamless tubes avoids welding, but hydroforming of coarse-grained seamless tubes results in strain-induced surface roughening. Surface roughness limits accelerating fields, because asperities prematurely exceed the critical magnetic field and become normal conducting. This project explored the technical and economic feasibility of an improved processing method for seamless tubes for hydroforming. Severe deformation of bulk material was first used to produce a fine structure, followed by extrusion and flow-forming methods of tube making. Extrusion of the randomly oriented, fine-grained bulk material proceeded under largely steady-state conditions, and resulted in a uniform structure, which was found to be finer and more crystallographically random than standard (high purity) RRR niobium sheet metal. A 165 mm diameter billet of RRR grade niobium was processed into five, 150 mm I.D. tubes, each over 1.8 m in length, to meet the dimensions used by the DESY ILC hydroforming machine. Mechanical properties met specifications. Costs of prototype tube production were approximately twice the price of RRR niobium sheet, and are expected to be comparable with economies of scale. Hydroforming and superconducting testing will be pursued in subsequent collaborations with DESY and Fermilab. SRF Cavities are used to construct

  18. Cavity turnover and equilibrium cavity densities in a cottonwood bottomland

    USGS Publications Warehouse

    Sedgwick, James A.; Knopf, Fritz L.

    1992-01-01

    A fundamental factor regulating the numbers of secondary cavity nesting (SCN) birds is the number of extant cavities available for nesting. The number of available cavities may be thought of as being in an approximate equilibrium maintained by a very rough balance between recruitment and loss of cavities. Based on estimates of cavity recruitment and loss, we ascertained equilibrium cavity densities in a mature plains cottonwood (Populus sargentii) bottomland along the South Platte River in northeastern Colorado. Annual cavity recruitment, derived from density estimates of primary cavity nesting (PCN) birds and cavity excavation rates, was estimated to be 71-86 new cavities excavated/100 ha. Of 180 active cavities of 11 species of cavity-nesting birds found in 1985 and 1986, 83 were no longer usable by 1990, giving an average instantaneous rate of cavity loss of r = -0.230. From these values of cavity recruitment and cavity loss, equilibrium cavity density along the South Platte is 238-289 cavities/100 ha. This range of equilibrium cavity density is only slightly above the minimum of 205 cavities/100 ha required by SCN's and suggests that cavity availability may be limiting SCN densities along the South Platte River. We submit that snag management alone does not adequately address SCN habitat needs, and that cavity management, expressed in terms of cavity turnover and cavity densities, may be more useful.

  19. DESIGN AND PRELIMINARY TEST OF THE 1500 MHZ NSLS-II PASSIVE SUPERCONDUCTING RF CAVITY

    SciTech Connect

    Rose, J.; Gash, W.; Kosciuk, B.; Ravindranath, V.; Sikora, B.; Sharma, S.; Towne, N.; Grimm, T.L.; Boulware, C.H.; Krizmanich, C.; Kuhlman, B.; Miller, N.; Siegel, B.; Winowski, M.

    2011-03-28

    NSLS-II is a new ultra-bright 3 GeV 3rd generation synchrotron radiation light source. The performance goals require operation with a beam current of 500mA and a bunch current of at least 0.5mA. Ion clearing gaps are required to suppress ion effects on the beam. The natural bunch length of 3mm is planned to be lengthened by means of a third harmonic cavity in order to increase the Touschek limited lifetime. Earlier work described the design alternatives and the geometry selected for a copper prototype. We subsequently have iterated the design to lower the R/Q of the cavity and to increase the diameter of the beam pipe ferrite HOM dampers to reduce the wakefield heating. A niobium cavity and full cryomodule including LN2 shield, magnetic shield and insulating vacuum vessel have been fabricated and installed. A passive SRF 3rd harmonic cavity consisting of two tightly coupled cells has been designed and fabricated for NSLS-II. Initial cold tests of this cavity are very promising. These tests have verified that the cavity frequency and mode separation between the 0 and {pi}-modes can be set at manufacture. Further, the frequency separation can be maintained over wide tuning ranges necessary for operation. Future work includes HOM damper and motorized tuner development.

  20. Wastes as co-fuels: the policy framework for solid recovered fuel (SRF) in Europe, with UK implications.

    PubMed

    Garg, Anurag; Smith, Richard; Hill, Daryl; Simms, Nigel; Pollard, Simon

    2007-07-15

    European Union (EU) member states are adopting the mechanical-biological treatment (MBT) of municipal solid waste (MSW) to comply with EU Landfill Directive (LD) targets on landfill diversion. We review the policy framework for MSW-derived solid recovered fuel (SRF), composed of paper, plastic, and textiles, in the energy-intensive industries. A comparatively high calorific value (15-18 MJ/ kg) fuel, SRF has the potential to partially replace fossil fuel in energy-intensive industries, alongside MSW in dedicated combustion facilities. Attempts by the European standards organization (CEN) to classify fuel properties consider net calorific value (CV) and chlorine and mercury content. However, the particle size, moisture content, and fuel composition also require attention and future studies must address these parameters. We critically review the implications of using SRF as a co-fuel in thermal processes. A thermodynamic analysis provides insight into the technical and environmental feasibility of co-combusting SRF in coal-fired power plants and cement kilns. Results indicate the use of SRF as co-fuel can reduce global warming and acidification potential significantly. This policy analysis is of value to waste managers, policy specialists, regulators, and the waste management research community. PMID:17711195

  1. A basal-like breast cancer-specific role for SRF-IL6 in YAP-induced cancer stemness.

    PubMed

    Kim, Tackhoon; Yang, Suk-Jin; Hwang, Daehee; Song, Jinhoi; Kim, Minchul; Kyum Kim, Sang; Kang, Keunsoo; Ahn, Jaebum; Lee, Daeyoup; Kim, Mi-Young; Kim, Seyun; Seung Koo, Ja; Seok Koh, Sang; Kim, Seon-Young; Lim, Dae-Sik

    2015-01-01

    The switch between stem/progenitor cell expansion and differentiation is critical for organ homeostasis. The mammalian Hippo pathway effector and oncoprotein YAP expands undifferentiated stem/progenitor cells in various tissues. However, the YAP-associated transcription factors and downstream targets underlying this stemness-promoting activity are poorly understood. Here we show that the SRF-IL6 axis is the critical mediator of YAP-induced stemness in mammary epithelial cells and breast cancer. Specifically, serum response factor (SRF)-mediated binding and recruitment of YAP to mammary stem cell (MaSC) signature-gene promoters induce numerous MaSC signature genes, among which the target interleukin (IL)-6 is critical for YAP-induced stemness. High SRF-YAP/TAZ expression is correlated with IL6-enriched MaSC/basal-like breast cancer (BLBC). Finally, we show that this high SRF expression enables YAP to more efficiently induce IL6 and stemness in BLBC compared with luminal-type breast cancer. Collectively, our results establish the importance of SRF-YAP-IL6 signalling in promoting MaSC-like properties in a BLBC-specific manner. PMID:26671411

  2. Comparison of coal/solid recovered fuel (SRF) with coal/refuse derived fuel (RDF) in a fluidized bed reactor.

    PubMed

    Wagland, S T; Kilgallon, P; Coveney, R; Garg, A; Smith, R; Longhurst, P J; Pollard, S J T; Simms, N

    2011-06-01

    An experimental study was undertaken to compare the differences between municipal solid waste (MSW) derived solid recovered fuel (SRF) (complying with CEN standards) and refuse derived fuel (RDF). Both fuels were co-combusted with coal in a 50 kW fluidized bed combustor and the metal emissions were compared. Synthetic SRF was prepared in the laboratory by grinding major constituents of MSW such as paper, plastic, textile and wood. RDF was obtained from a local mechanical treatment plant. Heavy metal emissions in flue gas and ash samples from the (coal+10% SRF) fuel mixture were found to be within the acceptable range and were generally lower than that obtained for coal+10% RDF fuel mixture. The relative distribution of heavy metals in ash components and the flue gas stream shows the presence of a large fraction (up to 98%) of most of the metals in the ash (except Hg and As). Thermo-gravimetric (TG) analysis of SRF constituents was performed to understand the behaviour of fuel mixtures in the absence and presence of air. The results obtained from the experimental study will enhance the confidence of fuel users towards using MSW-derived SRF as an alternative fuel. PMID:21288710

  3. Sample preparation and biomass determination of SRF model mixture using cryogenic milling and the adapted balance method.

    PubMed

    Schnöller, Johannes; Aschenbrenner, Philipp; Hahn, Manuel; Fellner, Johann; Rechberger, Helmut

    2014-11-01

    The biogenic fraction of a simple solid recovered fuel (SRF) mixture (80 wt% printer paper/20 wt% high density polyethylene) is analyzed with the in-house developed adapted balance method (aBM). This fairly new approach is a combination of combustion elemental analysis (CHNS) and a data reconciliation algorithm based on successive linearisation for evaluation of the analysis results. This method shows a great potential as an alternative way to determine the biomass content in SRF. However, the employed analytical technique (CHNS elemental analysis) restricts the probed sample mass to low amounts in the range of a few hundred milligrams. This requires sample comminution to small grain sizes (<200 μm) to generate representative SRF specimen. This is not easily accomplished for certain material mixtures (e.g. SRF with rubber content) by conventional means of sample size reduction. This paper presents a proof of principle investigation of the sample preparation and analysis of an SRF model mixture with the use of cryogenic impact milling (final sample comminution) and the adapted balance method (determination of biomass content). The so derived sample preparation methodology (cutting mills and cryogenic impact milling) shows a better performance in accuracy and precision for the determination of the biomass content than one solely based on cutting mills. The results for the determination of the biogenic fraction are within 1-5% of the data obtained by the reference methods, selective dissolution method (SDM) and (14)C-method ((14)C-M). PMID:25060675

  4. Wastes as co-fuels: the policy framework for solid recovered fuel (SRF) in Europe, with UK implications

    SciTech Connect

    Anurag Garg; Richard Smith; Daryl Hill; Nigel Simms; Simon Pollard

    2007-07-15

    European Union (EU) member states are adopting the mechanical-biological treatment (MBT) of municipal solid waste (MSW) to comply with EU Landfill Directive (LD) targets on landfill diversion. We review the policy framework for MSW-derived solid recovered fuel (SRF), composed of paper, plastic, and textiles, in the energy-intensive industries. A comparatively high calorific value (15-18 MJ/kg) fuel, SRF has the potential to partially replace fossil fuel in energy-intensive industries, alongside MSW in dedicated combustion facilities. Attempts by the European standards organization (CEN) to classify fuel properties consider net calorific value (CV) and chlorine and mercury content. However, the particle size, moisture content, and fuel composition also require attention and future studies must address these parameters. We critically review the implications of using SRF as a co-fuel in thermal processes. A thermodynamic analysis provides insight into the technical and environmental feasibility of co-combusting SRF in coal-fired power plants and cement kilns. Results indicate the use of SRF as co-fuel can reduce global warming and acidification potential significantly. This policy analysis is of value to waste managers, policy specialists, regulators, and the waste management research community. 63 refs., 3 figs., 3 tabs.

  5. Comparison of coal/solid recovered fuel (SRF) with coal/refuse derived fuel (RDF) in a fluidised bed reactor

    SciTech Connect

    Wagland, S.T.; Kilgallon, P.; Coveney, R.; Garg, A.; Smith, R.; Longhurst, P.J.; Pollard, S.J.T.; Simms, N.

    2011-06-15

    An experimental study was undertaken to compare the differences between municipal solid waste (MSW) derived solid recovered fuel (SRF) (complying with CEN standards) and refuse derived fuel (RDF). Both fuels were co-combusted with coal in a 50 kW fluidised bed combustor and the metal emissions were compared. Synthetic SRF was prepared in the laboratory by grinding major constituents of MSW such as paper, plastic, textile and wood. RDF was obtained from a local mechanical treatment plant. Heavy metal emissions in flue gas and ash samples from the (coal + 10% SRF) fuel mixture were found to be within the acceptable range and were generally lower than that obtained for coal + 10% RDF fuel mixture. The relative distribution of heavy metals in ash components and the flue gas stream shows the presence of a large fraction (up to 98%) of most of the metals in the ash (except Hg and As). Thermo-gravimetric (TG) analysis of SRF constituents was performed to understand the behaviour of fuel mixtures in the absence and presence of air. The results obtained from the experimental study will enhance the confidence of fuel users towards using MSW-derived SRF as an alternative fuel.

  6. Modifications of Superconducting Properties of Niobium Caused by Nitrogen Doping Recipes for High Q Cavities

    SciTech Connect

    Vostrikov, Alexander; Checchin, Mattia; Grassellino, Anna; Kim, Young-Kee; Romanenko, Alexander

    2015-06-01

    A study is presented on the superconducting properties of niobium used for the fabrication of the SRF cavities after treating by recently discovered nitrogen doping methods. Cylindrical niobium samples have been subjected to the standard surface treatments applied to the cavities (electro-polishing, l 20°C bake) and compared with samples treated by additional nitrogen doping recipes routinely used to reach ultra-high quality factor values (>3· 1010 at 2 K, 16 MV/m). The DC magnetization curves and the complex magnetic AC susceptibility have been measured. Evidence for the lowered field of first flux penetration after nitrogen doping is found suggesting a correlation with the lowered quench fields. Superconducting critical temperatures Tc = 9.25 K are found to be in agreement with previous measurements, and no strong effect on the critical surface field (Bd) from nitrogen doping was found.

  7. Precision vector control of a superconducting RF cavity driven by an injection locked magnetron

    DOE PAGESBeta

    Chase, Brian; Pasquinelli, Ralph; Cullerton, Ed; Varghese, Philip

    2015-03-01

    The technique presented in this paper enables the regulation of both radio frequency amplitude and phase in narrow band devices such as a Superconducting RF (SRF) cavity driven by constant power output devices i.e. magnetrons [1]. The ability to use low cost high efficiency magnetrons for accelerator RF power systems, with tight vector regulation, presents a substantial cost savings in both construction and operating costs - compared to current RF power system technology. An operating CW system at 2.45 GHz has been experimentally developed. Vector control of an injection locked magnetron has been extensively tested and characterized with a SRFmore » cavity as the load. Amplitude dynamic range of 30 dB, amplitude stability of 0.3% r.m.s, and phase stability of 0.26 degrees r.m.s. has been demonstrated.« less

  8. Etching of Niobium Sample Placed on Superconducting Radio Frequency Cavity Surface in Ar/CL2 Plasma

    SciTech Connect

    Janardan Upadhyay, Larry Phillips, Anne-Marie Valente

    2011-09-01

    Plasma based surface modification is a promising alternative to wet etching of superconducting radio frequency (SRF) cavities. It has been proven with flat samples that the bulk Niobium (Nb) removal rate and the surface roughness after the plasma etchings are equal to or better than wet etching processes. To optimize the plasma parameters, we are using a single cell cavity with 20 sample holders symmetrically distributed over the cell. These holders serve the purpose of diagnostic ports for the measurement of the plasma parameters and for the holding of the Nb sample to be etched. The plasma properties at RF (100 MHz) and MW (2.45 GHz) frequencies are being measured with the help of electrical and optical probes at different pressures and RF power levels inside of this cavity. The niobium coupons placed on several holders around the cell are being etched simultaneously. The etching results will be presented at this conference.

  9. Design approach for the development of a cryomodule for compact crab cavities for Hi-Lumi LHC

    SciTech Connect

    Pattalwar, Shrikant; Goudket, Philippe; McIntosh, Peter; Wheelhouse, Alan; Jones, Thomas; Templeton, Niklas; Burt, Graeme; Hall, Ben; Wright, Loren; Peterson, Tom

    2014-01-29

    A prototype Superconducting RF (SRF) cryomodule, comprising multiple compact crab cavities is foreseen to realise a local crab crossing scheme for the “Hi-Lumi LHC”, a project launched by CERN to increase the luminosity performance of LHC. A cryomodule with two cavities will be initially installed and tested on the SPS drive accelerator at CERN to evaluate performance with high-intensity proton beams. A series of boundary conditions influence the design of the cryomodule prototype, arising from; the complexity of the cavity design, the requirement for multiple RF couplers, the close proximity to the second LHC beam pipe and the tight space constraints in the SPS and LHC tunnels. As a result, the design of the helium vessel and the cryomodule has become extremely challenging. This paper assesses some of the critical cryogenic and engineering design requirements and describes an optimised cryomodule solution for the evaluation tests on SPS.

  10. Foundations for quantitative microstructural models to track evolution of the metallurgical state during high purity Nb cavity fabrication

    SciTech Connect

    Bieler, Thomas R; Wright, Neil T; Compton, Chris C

    2014-03-15

    The goal of the Materials Science SRF Cavity Group of Michigan State University and the National Superconducting Cyclotron has been (and continues to be) to understand quantitatively the effects of process history on functional properties. These relationships were assessed via studies on Nb samples and cavity parts, which had various combinations of forming processes, welding, heat treatments, and surface preparation. A primary focus was on large-grain cavity building strategies. Effects of processing operations and exposure to hydrogen on the thermal conductivity has been identified in single and bi-crystal samples, showing that the thermal conductivity can be altered by a factor of 5 depending on process history. Characterization of single crystal tensile samples show a strong effect of crystal orientation on deformation resistance and shape changes. Large grain half cells were examined to characterize defect content and surface damage effects, which provided quantitative information about the depth damage layers from forming.

  11. Electromagnetic SCRF Cavity Tuner

    SciTech Connect

    Kashikhin, V.; Borissov, E.; Foster, G.W.; Makulski, A.; Pischalnikov, Y.; Khabiboulline, T.; /Fermilab

    2009-05-01

    A novel prototype of SCRF cavity tuner is being designed and tested at Fermilab. This is a superconducting C-type iron dominated magnet having a 10 mm gap, axial symmetry, and a 1 Tesla field. Inside the gap is mounted a superconducting coil capable of moving {+-} 1 mm and producing a longitudinal force up to {+-} 1.5 kN. The static force applied to the RF cavity flanges provides a long-term cavity geometry tuning to a nominal frequency. The same coil powered by fast AC current pulse delivers mechanical perturbation for fast cavity tuning. This fast mechanical perturbation could be used to compensate a dynamic RF cavity detuning caused by cavity Lorentz forces and microphonics. A special configuration of magnet system was designed and tested.

  12. Degenerate astigmatic cavities

    NASA Astrophysics Data System (ADS)

    Courtois, Jérémie; Mohamed, Ajmal; Romanini, Daniele

    2013-10-01

    At the output of a high-finesse cavity a succession of Lissajous patterns may be observed as the cavity length is finely tuned inside a “degenerate region” around a reentrant spherical configuration. This behavior is ascribed to a small parasitic astigmatism of the cavity mirrors. Simple geometrical optics modeling confirms this hypothesis, and then a more realistic analysis using transverse Gaussian modes reveals that the Lissajous patterns correspond to an organization of the astigmatism-split modes into a finer substructure of degenerate modes relative to that of a reentrant spherical cavity. This provides a thorough understanding of the field patterns observed in the degenerate region, including an intriguing spatial symmetry of the patterns corresponding to opposite displacements with respect to a specific central cavity length. This investigation represents a generalization of the theory of reentrant spherical cavities to the astigmatic case.

  13. Cavity enhanced terahertz modulation

    SciTech Connect

    Born, N.; Scheller, M.; Moloney, J. V.; Koch, M.

    2014-03-10

    We present a versatile concept for all optical terahertz (THz) amplitude modulators based on a Fabry-Pérot semiconductor cavity design. Employing the high reflectivity of two parallel meta-surfaces allows for trapping selected THz photons within the cavity and thus only a weak optical modulation of the semiconductor absorbance is required to significantly damp the field within the cavity. The optical switching yields to modulation depths of more than 90% with insertion efficiencies of 80%.

  14. Design, Project Execution, and Commissioning of the 1.8 K Superfluid Helium Refrigeration System for SRF Cryomodule Testing

    SciTech Connect

    Treite, P.; Nuesslein, U.; Jia, Yi; Klebaner, A.; Theilacker, J.

    2015-07-15

    The Fermilab Cryomodule Test Facility (CMTF) provides a test bed to measure the performance of superconducting radiofrequency (SRF) cryomodules (CM). These SRF components form the basic building blocks of future high intensity accelerators such as the International Linear Collider (ILC) and a Muon Collider. Linde Kryotechnik AG and Linde Cryogenics have designed, constructed and commissioned the superfluid helium refrigerator needed to support SRF component testing at the CMTF Facility. The hybrid refrigerator is designed to operate in a variety of modes and under a wide range of boundary conditions down to 1.8 Kelvin set by CM design. Special features of the refrigerator include the use of warm and cold compression and high efficiency turbo expanders.This paper gives an overview on the wide range of the challenging cooling requirements, the design, fabrication and the commissioning of the installed cryogenic system.

  15. Design, Project Execution, and Commissioning of the 1.8 K Superfluid Helium Refrigeration System for SRF Cryomodule Testing

    NASA Astrophysics Data System (ADS)

    Treite, P.; Nuesslein, U.; Jia, Yi; Klebaner, A.; Theilacker, J.

    The Fermilab Cryomodule Test Facility (CMTF) provides a test bed to measure the performance of superconducting radiofrequency (SRF) cryomodules (CM). These SRF components form the basic building blocks of future high intensity accelerators such as the International Linear Collider (ILC) and a Muon Collider. Linde Kryotechnik AG and Linde Cryogenics have designed, constructed and commissioned the superfluid helium refrigerator needed to support SRF component testing at the CMTF Facility. The hybrid refrigerator is designed to operate in a variety of modes and under a wide range of boundary conditions down to 1.8 Kelvin set by CM design. Special features of the refrigerator include the use of warm and cold compression and high efficiency turbo expanders.This paper gives an overview on the wide range of the challenging cooling requirements, the design, fabrication and the commissioning of the installed cryogenic system.

  16. Design, Project Execution, and Commissioning of the 1.8 K Superfluid Helium Refrigeration System for SRF Cryomodule Testing

    DOE PAGESBeta

    Treite, P.; Nuesslein, U.; Jia, Yi; Klebaner, A.; Theilacker, J.

    2015-07-15

    The Fermilab Cryomodule Test Facility (CMTF) provides a test bed to measure the performance of superconducting radiofrequency (SRF) cryomodules (CM). These SRF components form the basic building blocks of future high intensity accelerators such as the International Linear Collider (ILC) and a Muon Collider. Linde Kryotechnik AG and Linde Cryogenics have designed, constructed and commissioned the superfluid helium refrigerator needed to support SRF component testing at the CMTF Facility. The hybrid refrigerator is designed to operate in a variety of modes and under a wide range of boundary conditions down to 1.8 Kelvin set by CM design. Special features ofmore » the refrigerator include the use of warm and cold compression and high efficiency turbo expanders.This paper gives an overview on the wide range of the challenging cooling requirements, the design, fabrication and the commissioning of the installed cryogenic system.« less

  17. Characterization of cavity wakes

    NASA Astrophysics Data System (ADS)

    Kidd, James A.

    Scope and Method of Study. This research focused on flow over deep cavities at subsonic speeds with emphasis on the wake downstream of the cavity. Cavity wake behaviors have not been studied in detail and are a major concern for air vehicles with cavities and in particular for optical sensor systems installed in cavities. Other key behaviors for sensor survival and performance are cavity resonance and turbulence scales in the shear layer. A wind tunnel test apparatus was developed to explore cavity and wake characteristics. It consisted of a test section insert for the OSU Indraft Wind Tunnel with an additional contraction cone for significantly increased speed. The test section included a variable depth cavity in a boundary layer splitter plate/fairing assembly, a Y-Z traverse and pitot rake with in-situ pressure transducers for high frequency response. Flows were measured over clean cavities with length to depth (L/D) ratios of 4 to 1/2 and on cavities with a porous fence for resonance suppression. Measurements were taken in streamwise and cross-stream sections to three cavity lengths downstream of the cavity trailing edge. Flow visualization using laser sheet and smoke injection was also used. Findings and Conclusions. The high speed insert demonstrated a significant new capability for the OSU wind tunnel, reaching speeds of 0.35 Mach (390 feet/second) in a 14"x14" test section. Inlet room flow was found to be quite unsteady and recommendations are made for improved flow and quantitative visualization. Key findings for cavity wake flow include its highly three dimensional nature with asymmetric peaks in cross section with boundary layer thicknesses and integral length scales several times that of a normal flat plate turbulent boundary layer (TBL). Turbulent intensities (TI) of 35% to 55% of freestream speeds were measured for the clean configuration. Fence configuration TI's were 20% to 35% of free stream and, in both configurations, TI's decayed to

  18. Optically measuring interior cavities

    DOEpatents

    Stone, Gary Franklin

    2009-11-03

    A method of measuring the three-dimensional volume or perimeter shape of an interior cavity includes the steps of collecting a first optical slice of data that represents a partial volume or perimeter shape of the interior cavity, collecting additional optical slices of data that represents a partial volume or perimeter shape of the interior cavity, and combining the first optical slice of data and the additional optical slices of data to calculate of the three-dimensional volume or perimeter shape of the interior cavity.

  19. Optically measuring interior cavities

    DOEpatents

    Stone, Gary Franklin

    2008-12-21

    A method of measuring the three-dimensional volume or perimeter shape of an interior cavity includes the steps of collecting a first optical slice of data that represents a partial volume or perimeter shape of the interior cavity, collecting additional optical slices of data that represents a partial volume or perimeter shape of the interior cavity, and combining the first optical slice of data and the additional optical slices of data to calculate of the three-dimensional volume or perimeter shape of the interior cavity.

  20. Effect of RF Gradient upon the Performance of the Wisconsin SRF Electron Gun

    SciTech Connect

    Bosch, Robert; Legg, Robert A.

    2013-12-01

    The performance of the Wisconsin 200-MHz SRF electron gun is simulated for several values of the RF gradient. Bunches with charge of 200 pC are modeled for the case where emittance compensation is completed during post-acceleration to 85 MeV in a TESLA module. We first perform simulations in which the initial bunch radius is optimal for the design gradient of 41 MV/m. We then optimize the radius as a function of RF gradient to improve the performance for low gradients.

  1. Liquid laser cavities

    NASA Technical Reports Server (NTRS)

    Bjorklund, S.; Filipescu, N.; Kellermeyer, G. L.; Mc Avoy, N.

    1969-01-01

    Liquid laser cavities have plenum chambers at the ends of the capillary cell which are terminated in transparent optical flats. By use of these cavities, several new europium chelates and a terbium chelate can provide laser action in solution at room temperature.

  2. Resonant-frequency discharge in a multi-cell radio frequency cavity

    SciTech Connect

    Popovic, S; Upadhyay, J; Mammosser, J; Nikolic, M; Vuskovic, L

    2014-11-07

    We are reporting experimental results on microwave discharge operating at resonant frequency in a multi-cell radio frequency (RF) accelerator cavity. Although the discharge operated at room temperature, the setup was constructed so that it could be used for plasma generation and processing in fully assembled active superconducting radio-frequency (SRF) cryomodule (in situ operation). This discharge offers an efficient mechanism for removal of a variety of contaminants, organic or oxide layers, and residual particulates from the interior surface of RF cavities through the interaction of plasma-generated radicals with the cavity walls. We describe resonant RF breakdown conditions and address the problems related to generation and sustaining the multi-cell cavity plasma, which are breakdown and resonant detuning. We have determined breakdown conditions in the cavity, which was acting as a plasma vessel with distorted cylindrical geometry. We discuss the spectroscopic data taken during plasma removal of contaminants and use them to evaluate plasma parameters, characterize the process, and estimate the volatile contaminant product removal.

  3. New results of development on high efficiency high gradient superconducting rf cavities

    SciTech Connect

    Geng, Rongli; Li, Z. K.; Hao, Z. K.; Liu, K. X.; Zhao, H. Y.; Adolphsen, C.

    2015-09-01

    We report on the latest results of development on high-efficiency high-gradient superconducting radio frequency (SRF) cavities. Several 1-cell cavities made of large-grain niobium (Nb) were built, processed and tested. Two of these cavities are of the Low Surface Field (LSF) shape. Series of tests were carried out following controlled thermal cycling. Experiments toward zero-field cooling were carried out. The best experimentally achieved results are Eacc = 41 MV/m at Q0 = 6.5×1010 at 1.4 K by a 1-cell 1.3 GHz large-grain Nb TTF shape cavity and Eacc = 49 MV/m at Q0 = 1.5×1010 at 1.8 K by a 1-cell 1.5 GHz large-grain Nb CEBAF upgrade low-loss shape cavity.

  4. Passivated niobium cavities

    DOEpatents

    Myneni, Ganapati Rao; Hjorvarsson, Bjorgvin; Ciovati, Gianluigi

    2006-12-19

    A niobium cavity exhibiting high quality factors at high gradients is provided by treating a niobium cavity through a process comprising: 1) removing surface oxides by plasma etching or a similar process; 2) removing hydrogen or other gases absorbed in the bulk niobium by high temperature treatment of the cavity under ultra high vacuum to achieve hydrogen outgassing; and 3) assuring the long term chemical stability of the niobium cavity by applying a passivating layer of a superconducting material having a superconducting transition temperature higher than niobium thereby reducing losses from electron (cooper pair) scattering in the near surface region of the interior of the niobium cavity. According to a preferred embodiment, the passivating layer comprises niobium nitride (NbN) applied by reactive sputtering.

  5. CAVITY EXCITATION CIRCUIT

    DOEpatents

    Franck, J.V.

    1959-10-20

    An electronic oscillator is described for energizing a resonant cavity and to a system for stabilizing the operatin g frequency of the oscillator at the particular frequency necessary to establish a particular preferred field configuration or mode in the cavity, in this instance a linear accelerator. A freely rnnning oscillator has an output coupled to a resonant cavity wherein a field may be built up at any one of several adjacent frequencies. A pickup loop in the cavity is suitably shielded and positioned in the cavity so that only energy at the panticular desired frequency is fed back to stabilize the oscillator. A phase and gain control is in cluded in the feedback line.

  6. Use of Multipass Recirculation and Energy Recovery In CW SRF X-FEL Driver Accelerators

    SciTech Connect

    Douglas, David; Akers, Walt; Benson, Stephen V.; Biallas, George; Blackburn, Keith; Boyce, James; Bullard, Donald; Coleman, James; Dickover, Cody; Ellingsworth, Forrest; Evtushenko, Pavel; Fisk, Sally; Gould, Christopher; Gubeli, Joseph; Hannon, Fay; Hardy, David; Hernandez-Garcia, Carlos; Jordan, Kevin; Klopf, John; Kortze, J.; Legg, Robert; Li, Rui; Marchlik, Matthew; Moore, Steven W.; Neil, George; Powers, Thomas; Sexton, Daniel; Shin, Ilkyoung; Shinn, Michelle D.; Tennant, Christopher; Terzic, Balsa; Walker, Richard; Williams, Gwyn P.; Wilson, G.; Zhang, Shukui

    2010-08-01

    We discuss the use of multipass recirculation and energy recovery in CW SRF drivers for short wavelength FELs. Benefits include cost management (through reduced system footprint, required RF and SRF hardware, and associated infrastructure - including high power beam dumps and cryogenic systems), ease in radiation control (low drive beam exhaust energy), ability to accelerate and deliver multiple beams of differing energy to multiple FELs, and opportunity for seamless integration of multistage bunch length compression into the longitudinal matching scenario. Issues include all those associated with ERLs compounded by the challenge of generating and preserving the CW electron drive beam brightness required by short wavelength FELs. We thus consider the impact of space charge, BBU and other environmental wakes and impedances, ISR and CSR, potential for microbunching, intra-beam and beam-residual gas scattering, ion effects, RF transients, and halo, as well as the effect of traditional design, fabrication, installation and operational errors (lattice aberrations, alignment, powering, field quality). Context for the discussion is provided by JLAMP, the proposed VUV/X-ray upgrade to the existing Jefferson Lab FEL.

  7. Drive laser system for the DC-SRF photoinjector at Peking University

    NASA Astrophysics Data System (ADS)

    Wang, Zhi-Wen; Huang, Sen-Lin; Lin, Lin; Zhao, Gang; Quan, Sheng-Wen; Liu, Ke-Xin; Chen, Jia-Er

    2016-01-01

    Photoinjectors are widely used for linear accelerators as electron sources to generate high-brightness electron beams. The drive laser, which determines the timing structure and quality of the electron beam, is a crucial component of a photoinjector. A new drive laser system has been designed and constructed for the upgraded 3.5-cell DC-SRF photoinjector at Peking University. The drive laser system consists of a 1064 nm laser oscillator, a four-stage amplifier, second and fourth harmonic generators, an optical system to transfer the UV pulses to the photocathode, and a synchronization system. The drive laser system has been successfully applied during stable operation of the DC-SRF photoinjector and its performance meets requirements. A 266 nm laser with an average power close to 1 W can be delivered to illuminate the Cs2Te photocathode and the instability is less than 5% for long time operation. The design considerations for improving the UV laser quality, a detailed description of the laser system, and its performance are presented in this paper. Supported by National Basic Research Project (973) (2011CB808302, 2011CB808304)

  8. Optical constants of SrF2 thin films in the 25-780-eV spectral range

    DOE PAGESBeta

    Rodriguez-de Marcos, Luis; Larraguert, Juan I.; Aznarez, Jose A.; Fernandez-Perea, Monica; Soufli, Regina; Mendez, Jose A.; Baker, Sherry L.; Gullikson, Eric M.

    2013-04-08

    The transmittance and the optical constants of SrF2 thin films, a candidate material for multilayer coatings operating in the extreme ultraviolet and soft x-rays, have been determined in the spectral range of 25–780 eV, in most of which no experimental data were previously available. SrF2 films of various thicknesses were deposited by evaporation onto room-temperature, thin Al support films, and their transmittance was measured with synchrotron radiation. The transmittance as a function of film thickness was used to calculate the extinction coefficient k at each photon energy. A decrease in density with increasing SrF2 film thickness was observed. In themore » calculation of k, this effect was circumvented by fitting the transmittance versus the product of thickness and density. The real part of the refractive index of SrF2 films was calculated from k with Kramers-Krönig analysis, for which the measured spectral range was extended both to lower and to higher photon energies with data in the literature combined with interpolations and extrapolations. In conclusion, with the application of f- and inertial sum rules, the consistency of the compiled data was found to be excellent.« less

  9. Hydroforming of elliptical cavities

    DOE PAGESBeta

    Singer, W.; Singer, X.; Jelezov, I.; Kneisel, Peter

    2015-02-27

    Activities of the past several years in developing the technique of forming seamless (weldless) cavity cells by hydroforming are summarized. An overview of the technique developed at DESY for the fabrication of single cells and multicells of the TESLA cavity shape is given and the major rf results are presented. The forming is performed by expanding a seamless tube with internal water pressure while simultaneously swaging it axially. Prior to the expansion the tube is necked at the iris area and at the ends. Tube radii and axial displacements are computer controlled during the forming process in accordance with resultsmore » of finite element method simulations for necking and expansion using the experimentally obtained strain-stress relationship of tube material. In cooperation with industry different methods of niobium seamless tube production have been explored. The most appropriate and successful method is a combination of spinning or deep drawing with flow forming. Several single-cell niobium cavities of the 1.3 GHz TESLA shape were produced by hydroforming. They reached accelerating gradients Eacc up to 35 MV/m after buffered chemical polishing (BCP) and up to 42 MV/m after electropolishing (EP). More recent work concentrated on fabrication and testing of multicell and nine-cell cavities. Several seamless two- and three-cell units were explored. Accelerating gradients Eacc of 30–35 MV/m were measured after BCP and Eacc up to 40 MV/m were reached after EP. Nine-cell niobium cavities combining three three-cell units were completed at the company E. Zanon. These cavities reached accelerating gradients of Eacc = 30–35 MV/m. One cavity is successfully integrated in an XFEL cryomodule and is used in the operation of the FLASH linear accelerator at DESY. Additionally the fabrication of bimetallic single-cell and multicell NbCu cavities by hydroforming was successfully developed. Several NbCu clad single-cell and double-cell cavities of the TESLA shape have

  10. Hydroforming of elliptical cavities

    NASA Astrophysics Data System (ADS)

    Singer, W.; Singer, X.; Jelezov, I.; Kneisel, P.

    2015-02-01

    Activities of the past several years in developing the technique of forming seamless (weldless) cavity cells by hydroforming are summarized. An overview of the technique developed at DESY for the fabrication of single cells and multicells of the TESLA cavity shape is given and the major rf results are presented. The forming is performed by expanding a seamless tube with internal water pressure while simultaneously swaging it axially. Prior to the expansion the tube is necked at the iris area and at the ends. Tube radii and axial displacements are computer controlled during the forming process in accordance with results of finite element method simulations for necking and expansion using the experimentally obtained strain-stress relationship of tube material. In cooperation with industry different methods of niobium seamless tube production have been explored. The most appropriate and successful method is a combination of spinning or deep drawing with flow forming. Several single-cell niobium cavities of the 1.3 GHz TESLA shape were produced by hydroforming. They reached accelerating gradients Eacc up to 35 MV /m after buffered chemical polishing (BCP) and up to 42 MV /m after electropolishing (EP). More recent work concentrated on fabrication and testing of multicell and nine-cell cavities. Several seamless two- and three-cell units were explored. Accelerating gradients Eacc of 30 - 35 MV /m were measured after BCP and Eacc up to 40 MV /m were reached after EP. Nine-cell niobium cavities combining three three-cell units were completed at the company E. Zanon. These cavities reached accelerating gradients of Eacc=30 - 35 MV /m . One cavity is successfully integrated in an XFEL cryomodule and is used in the operation of the FLASH linear accelerator at DESY. Additionally the fabrication of bimetallic single-cell and multicell NbCu cavities by hydroforming was successfully developed. Several NbCu clad single-cell and double-cell cavities of the TESLA shape have been

  11. Tuned optical cavity magnetometer

    DOEpatents

    Okandan, Murat; Schwindt, Peter

    2010-11-02

    An atomic magnetometer is disclosed which utilizes an optical cavity formed from a grating and a mirror, with a vapor cell containing an alkali metal vapor located inside the optical cavity. Lasers are used to magnetically polarize the alkali metal vapor and to probe the vapor and generate a diffracted laser beam which can be used to sense a magnetic field. Electrostatic actuators can be used in the magnetometer for positioning of the mirror, or for modulation thereof. Another optical cavity can also be formed from the mirror and a second grating for sensing, adjusting, or stabilizing the position of the mirror.

  12. Hydroforming of elliptical cavities

    SciTech Connect

    Singer, W.; Singer, X.; Jelezov, I.; Kneisel, Peter

    2015-02-27

    Activities of the past several years in developing the technique of forming seamless (weldless) cavity cells by hydroforming are summarized. An overview of the technique developed at DESY for the fabrication of single cells and multicells of the TESLA cavity shape is given and the major rf results are presented. The forming is performed by expanding a seamless tube with internal water pressure while simultaneously swaging it axially. Prior to the expansion the tube is necked at the iris area and at the ends. Tube radii and axial displacements are computer controlled during the forming process in accordance with results of finite element method simulations for necking and expansion using the experimentally obtained strain-stress relationship of tube material. In cooperation with industry different methods of niobium seamless tube production have been explored. The most appropriate and successful method is a combination of spinning or deep drawing with flow forming. Several single-cell niobium cavities of the 1.3 GHz TESLA shape were produced by hydroforming. They reached accelerating gradients Eacc up to 35 MV/m after buffered chemical polishing (BCP) and up to 42 MV/m after electropolishing (EP). More recent work concentrated on fabrication and testing of multicell and nine-cell cavities. Several seamless two- and three-cell units were explored. Accelerating gradients Eacc of 30–35 MV/m were measured after BCP and Eacc up to 40 MV/m were reached after EP. Nine-cell niobium cavities combining three three-cell units were completed at the company E. Zanon. These cavities reached accelerating gradients of Eacc = 30–35 MV/m. One cavity is successfully integrated in an XFEL cryomodule and is used in the operation of the FLASH linear accelerator at DESY. Additionally the fabrication of bimetallic single-cell and multicell NbCu cavities by hydroforming was successfully developed. Several NbCu clad single-cell and double

  13. Filamin A interacts with the coactivator MKL1 to promote the activity of the transcription factor SRF and cell migration.

    PubMed

    Kircher, Philipp; Hermanns, Constanze; Nossek, Maximilian; Drexler, Maria Katharina; Grosse, Robert; Fischer, Maximilian; Sarikas, Antonio; Penkava, Josef; Lewis, Thera; Prywes, Ron; Gudermann, Thomas; Muehlich, Susanne

    2015-11-10

    Megakaryoblastic leukemia 1 (MKL1) is a coactivator of serum response factor (SRF) that promotes the expression of genes associated with cell proliferation, motility, adhesion, and differentiation-processes that also involve dynamic cytoskeletal changes in the cell. MKL1 is inactive when bound to monomeric globular actin (G-actin), but signals that activate the small guanosine triphosphatase RhoA cause actin polymerization and MKL1 dissociation from G-actin. We found a new mechanism of MKL1 activation that is mediated through its binding to filamin A (FLNA), a protein that binds filamentous actin (F-actin). The interaction of FLNA and MKL1 was required for the expression of MKL1 target genes in primary fibroblasts, melanoma, mammary and hepatocellular carcinoma cells. We identified the regions of interaction between MKL1 and FLNA, and cells expressing an MKL1 mutant that was unable to bind FLNA exhibited impaired cell migration and reduced expression of MKL1-SRF target genes. Induction and repression of MKL1-SRF target genes correlated with increased or decreased MKL1-FLNA interaction, respectively. Lysophosphatidic acid-induced RhoA activation in primary human fibroblasts promoted the association of endogenous MKL1 with FLNA, whereas exposure to an actin polymerization inhibitor dissociated MKL1 from FLNA and decreased MKL1-SRF target gene expression in melanoma cells. Thus, FLNA functions as a positive cellular transducer linking actin polymerization to MKL1-SRF activity, counteracting the known repressive complex of MKL1 and monomeric G-actin. PMID:26554816

  14. CIRCULAR CAVITY SLOT ANTENNA

    DOEpatents

    Kerley, P.L.

    1959-01-01

    A small-size antenna having a doughnut-shaped field pattern and which can act both as an antenna and a resonant circuit is described. The antenna is of the slotted type and comprises a resonant cavity with a center hole. A circular slot is provided in one wall of the cavity concentric with the hole and a radio frequency source is connected across the slot. The pattern and loading of the antenna are adjusted by varying the position and shape of a center element slidably disposed within the hole and projecting from the slotted side of the resonant cavity. The disclosed structure may also be used to propagate the oscillator signal down a transniission line by replacing the center element with one leg of the transmission line in a spaced relation from the walls of the cavity.

  15. OPERATION AND COMMISSIONING OF THE JEFFERSON LAB UV FEL USING AN SRF DRIVER ERL

    SciTech Connect

    R. Legg; S. Benson; G. Biallas; K. Blackburn; J. Boyce; D. Bullard; J. Coleman; C. Dickover; D. Douglas; F. Ellingsworth; P. Evtushenko; F. Hannon; C. Hernandez-Garcia; C. Gould; J. Gubeli; D. Hardy; K. Jordan; M. Klopf; J. Kortze; M. Marchlik; W. Moore; G. Neil; T. Powers; D. Sexton; Michelle D. Shinn; C. Tennant; R. Walker; G. Wilson

    2011-03-01

    We describe the operation and commissioning of the Jefferson Lab UV FEL using a CW SRF ERL driver. Based on the same 135 MeV linear accelerator as the Jefferson Lab 10 kW IR Upgrade FEL, the UV driver ERL uses a bypass geometry to provide transverse phase space control, bunch length compression, and nonlinear aberration compensation necessitating a unique set of commissioning and operational procedures. Additionally, a novel technique to initiate lasing is described. To meet these constraints and accommodate a challenging installation schedule, we adopted a staged commissioning plan with alternating installation and operation periods. This report addresses these issues and presents operational results from on-going beam operations.

  16. Ring resonant cavities for spectroscopy

    DOEpatents

    Zare, Richard N.; Martin, Juergen; Paldus, Barbara A.; Xie, Jinchun

    1999-01-01

    Ring-shaped resonant cavities for spectroscopy allow a reduction in optical feedback to the light source, and provide information on the interaction of both s- and p-polarized light with samples. A laser light source is locked to a single cavity mode. An intracavity acousto-optic modulator may be used to couple light into the cavity. The cavity geometry is particularly useful for Cavity Ring-Down Spectroscopy (CRDS).

  17. Ring resonant cavities for spectroscopy

    DOEpatents

    Zare, R.N.; Martin, J.; Paldus, B.A.; Xie, J.

    1999-06-15

    Ring-shaped resonant cavities for spectroscopy allow a reduction in optical feedback to the light source, and provide information on the interaction of both s- and p-polarized light with samples. A laser light source is locked to a single cavity mode. An intracavity acousto-optic modulator may be used to couple light into the cavity. The cavity geometry is particularly useful for Cavity Ring-Down Spectroscopy (CRDS). 6 figs.

  18. Proof-of-principle demonstration of Nb{sub 3}Sn superconducting radiofrequency cavities for high Q{sub 0} applications

    SciTech Connect

    Posen, S. Liepe, M.; Hall, D. L.

    2015-02-23

    Many future particle accelerators require hundreds of superconducting radiofrequency (SRF) cavities operating with high duty factor. The large dynamic heat load of the cavities causes the cryogenic plant to make up a significant part of the overall cost of the facility. This contribution can be reduced by replacing standard niobium cavities with ones coated with a low-dissipation superconductor such as Nb{sub 3}Sn. In this paper, we present results for single cell cavities coated with Nb{sub 3}Sn at Cornell. Five coatings were carried out, showing that at 4.2 K, high Q{sub 0} out to medium fields was reproducible, resulting in an average quench field of 14 MV/m and an average 4.2 K Q{sub 0} at quench of 8 × 10{sup 9}. In each case, the peak surface magnetic field at quench was well above H{sub c1}, showing that it is not a limiting field in these cavities. The coating with the best performance had a quench field of 17 MV/m, exceeding gradient requirements for state-of-the-art high duty factor SRF accelerators. It is also shown that—taking into account the thermodynamic efficiency of the cryogenic plant—the 4.2 K Q{sub 0} values obtained meet the AC power consumption requirements of state-of-the-art high duty factor accelerators, making this a proof-of-principle demonstration for Nb{sub 3}Sn cavities in future applications.

  19. Video Toroid Cavity Imager

    SciTech Connect

    Gerald, Rex E. II; Sanchez, Jairo; Rathke, Jerome W.

    2004-08-10

    A video toroid cavity imager for in situ measurement of electrochemical properties of an electrolytic material sample includes a cylindrical toroid cavity resonator containing the sample and employs NMR and video imaging for providing high-resolution spectral and visual information of molecular characteristics of the sample on a real-time basis. A large magnetic field is applied to the sample under controlled temperature and pressure conditions to simultaneously provide NMR spectroscopy and video imaging capabilities for investigating electrochemical transformations of materials or the evolution of long-range molecular aggregation during cooling of hydrocarbon melts. The video toroid cavity imager includes a miniature commercial video camera with an adjustable lens, a modified compression coin cell imager with a fiat circular principal detector element, and a sample mounted on a transparent circular glass disk, and provides NMR information as well as a video image of a sample, such as a polymer film, with micrometer resolution.

  20. Metasurface external cavity laser

    SciTech Connect

    Xu, Luyao Curwen, Christopher A.; Williams, Benjamin S.; Hon, Philip W. C.; Itoh, Tatsuo; Chen, Qi-Sheng

    2015-11-30

    A vertical-external-cavity surface-emitting-laser is demonstrated in the terahertz range, which is based upon an amplifying metasurface reflector composed of a sub-wavelength array of antenna-coupled quantum-cascade sub-cavities. Lasing is possible when the metasurface reflector is placed into a low-loss external cavity such that the external cavity—not the sub-cavities—determines the beam properties. A near-Gaussian beam of 4.3° × 5.1° divergence is observed and an output power level >5 mW is achieved. The polarized response of the metasurface allows the use of a wire-grid polarizer as an output coupler that is continuously tunable.

  1. Metasurface external cavity laser

    NASA Astrophysics Data System (ADS)

    Xu, Luyao; Curwen, Christopher A.; Hon, Philip W. C.; Chen, Qi-Sheng; Itoh, Tatsuo; Williams, Benjamin S.

    2015-11-01

    A vertical-external-cavity surface-emitting-laser is demonstrated in the terahertz range, which is based upon an amplifying metasurface reflector composed of a sub-wavelength array of antenna-coupled quantum-cascade sub-cavities. Lasing is possible when the metasurface reflector is placed into a low-loss external cavity such that the external cavity—not the sub-cavities—determines the beam properties. A near-Gaussian beam of 4.3° × 5.1° divergence is observed and an output power level >5 mW is achieved. The polarized response of the metasurface allows the use of a wire-grid polarizer as an output coupler that is continuously tunable.

  2. Multicolor cavity soliton.

    PubMed

    Luo, Rui; Liang, Hanxiao; Lin, Qiang

    2016-07-25

    We show a new class of complex solitary wave that exists in a nonlinear optical cavity with appropriate dispersion characteristics. The cavity soliton consists of multiple soliton-like spectro-temporal components that exhibit distinctive colors but coincide in time and share a common phase, formed together via strong inter-soliton four-wave mixing and Cherenkov radiation. The multicolor cavity soliton shows intriguing spectral locking characteristics and remarkable capability of spectrum management to tailor soliton frequencies, which would be very useful for versatile generation and manipulation of multi-octave spanning phase-locked Kerr frequency combs, with great potential for applications in frequency metrology, optical frequency synthesis, and spectroscopy. PMID:27464131

  3. The auroral plasma cavity

    NASA Technical Reports Server (NTRS)

    Calvert, W.

    1981-01-01

    A region of diminished plasma density has been found to occur at the source of auroral kilometric radiation (AKR). The density within this auroral plasma cavity, determined from limited Hawkeye wave data, was less than 1/cu cm from 1.8 to 3 earth radii geocentric, at 70 deg + or - 3 deg invariant magnetic latitude. The altitude variation of the magnetic field produces a minimum in the ratio of plasma frequency to cyclotron frequency within the cavity which accounts for the observed spectrum of AKR.

  4. Trace-Rare-Gas Optical Emission Spectroscopy of Nitrogen Plasma Generated at a Frequency of 13.56 MHz

    NASA Astrophysics Data System (ADS)

    U. Rehman, N.; U. Khan, F.; Naseer, S.; Murtaza, G.; S. Hussain, S.; I., Ahmad; Zakaullah, M.

    2011-04-01

    Optical emission spectroscopic measurement of trace rare gas is carried out to determine the density of nitrogen (N) atom, in a nitrogen plasma, as a function of filling pressure and RF power applied. 2% of argon, used as an actinometer, is mixed with nitrogen. In order to normalize the changes in the excitation cross section and electron energy distribution function at different operational conditions, the Ar-I emission line at 419.83 nm is used, which is of nearly the same excitation efficiency coefficient as that of the nitrogen emission line at 493.51 nm. It is observed that the emission intensity of the selected argon and atomic nitrogen lines increases with both pressure and RF power, as does the nitrogen atomic density.

  5. Tailoring surface properties of polyethylene separator by low pressure 13.56 MHz RF oxygen plasma glow discharge

    NASA Astrophysics Data System (ADS)

    Li, Chun; Liang, Chia-Han; Huang, Chun

    2016-01-01

    Low-pressure plasma surface modification in a radio-frequency capacitively coupled glow discharge of oxygen gas was carried out to induce polar functional groups onto polyethylene membrane separator surfaces to enhance its hydrophilicity. The surface changes in surface free energy were monitored by static contact angle measurement. A significant increase in the surface energy of polyethylene membrane separators caused by the oxygen gas plasma modifications was observed. The static water contact angle of the plasma-modified membrane separator significantly decreased with the increase in treatment duration and plasma power. An obvious increase in the surface energy of the membrane separators owing to the oxidative effect of oxygen-gas-plasma modifications was also observed. Optical emission spectroscopy was carried out to analyze the chemical species generated by oxygen gas plasma surface modification. The variations in the surface morphology and chemical structure of the separators were confirmed by scanning electron microscopy, Fourier transform infrared spectroscopy, and X-ray photoelectron spectroscopy (XPS). XPS showed significantly higher surface concentrations of oxygen functional groups in the oxygen-gas-plasma-modified polymeric separator surfaces than in the unmodified polymeric separator surface. The experimental results show the important role of chemical species in the interaction between oxygen gas plasmas and the separator surface, which can be controlled by surface modification to tailor the hydrophilicity of the separator.

  6. A sapphire loaded TE011 cavity for surface impedance measurements: design, construction, and commissioning status

    SciTech Connect

    L. Phillips; G. K. Davis; J. R. Delayen; J. P. Ozelis; T. Plawski; H. Wang; G. Wu

    2005-07-10

    In order to measure the superconducting surface properties of niobium that are of interest to SRF applications, a facility which utilizes a Nb cavity operating in the TE011 mode at 7.65 GHz which provides a well-defined RF field on a disk shaped sample has been designed and fabricated. The RF losses due to the sample's surface impedance are determined by using a calorimetric technique. The system has the capability to measure such properties as Rs,(T), and penetration depth, which can then be correlated with surface properties and preparation processes. The design, fabrication, and results from initial commissioning operations will be discussed, along with the near term sample evaluation program.

  7. Reclamation of niobium compounds from ionic liquid electrochemical polishing of superconducting radio frequency cavities

    SciTech Connect

    Wixtrom, Alex I.; Buhler, Jessica E.; Reece, Charles E.; Abdel-Fattah, Tarek M.

    2013-06-01

    Recent research has shown that choline chloride (vitamin B4)-based solutions can be used as a greener alternative to acid-based electrochemical polishing solutions. This study demonstrated a successful method for electrochemical deposition of niobium compounds onto the surface of copper substrates using a novel choline chloride-based ionic liquid. Niobium ions present in the ionic liquid solution were dissolved into the solution prior to deposition via electrochemical polishing of solid niobium. A black coating was clearly visible on the surface of the Cu following deposition. This coating was analyzed using scanning electron microscopy (SEM), electron dispersive X-ray spectroscopy (EDX), atomic force microscopy (AFM), and X-ray fluorescence spectroscopy (XRF). This ionic liquid-based electrochemical deposition method effectively recycles previously dissolved niobium from electrochemical polishing of superconducting radio frequency (SRF) cavities.

  8. Commissioning results of Nb3Sn cavity vapor diffusion deposition system at JLab

    SciTech Connect

    Eremeev, Grigory; Clemens, William A.; Macha, Kurt M.; Park, HyeKyoung; Williams, R.

    2015-09-01

    Nb3Sn as a BCS superconductor with a superconducting critical temperature higher than that of niobium offers potential benefit for SRF cavities via a lower-than-niobium surface resistance at the same temperature and frequency. A Nb3Sn vapor diffusion deposition system designed for coating of 1.5 and 1.3 GHz single-cell cavities was built and commissioned at JLab. As the part of the commissioning, RF performance at 2.0 K of a single-cell 1.5 GHz CEBAF-shaped cavity was measured before and after coating in the system. Before Nb3Sn coating the cavity had a Q0 of about 1010 and was limited by the high field Q-slope at Eacc ≅ 27 MV/m. Coated cavity exhibited the superconducting transition at about 17.9 K. The low-field quality factor was about 5∙109 at 4.3 K and 7∙109 at 2.0 K decreasing with field to about 1∙109 at Eacc ≅ 8 MV/m at both temperatures. The highest field was limited by the available RF power.

  9. Melatonin and Oral Cavity

    PubMed Central

    Cengiz, Murat İnanç; Cengiz, Seda; Wang, Hom-Lay

    2012-01-01

    While initially the oral cavity was considered to be mainly a source of various bacteria, their toxins and antigens, recent studies showed that it may also be a location of oxidative stress and periodontal inflammation. Accordingly, this paper focuses on the involvement of melatonin in oxidative stress diseases of oral cavity as well as on potential therapeutic implications of melatonin in dental disorders. Melatonin has immunomodulatory and antioxidant activities, stimulates the proliferation of collagen and osseous tissue, and acts as a protector against cellular degeneration associated with aging and toxin exposure. Arising out of its antioxidant actions, melatonin protects against inflammatory processes and cellular damage caused by the toxic derivates of oxygen. As a result of these actions, melatonin may be useful as a coadjuvant in the treatment of certain conditions of the oral cavity. However, the most important effect of melatonin seems to result from its potent antioxidant, immunomodulatory, protective, and anticancer properties. Thus, melatonin could be used therapeutically for instance, locally, in the oral cavity damage of mechanical, bacterial, fungal, or viral origin, in postsurgical wounds caused by tooth extractions and other oral surgeries. Additionally, it can help bone formation in various autoimmunological disorders such as Sjorgen syndrome, in periodontal diseases, in toxic effects of dental materials, in dental implants, and in oral cancers. PMID:22792106

  10. Spoke cavity power coupler conceptual design work for the HEL-JTO beam exp.

    SciTech Connect

    Rusnak, B

    2007-10-09

    The objective of this report was to create a low-cost, modest-power RF coupler for a SRF spoke cavity beam test of electrons test to be done at LANL. Developing the design for this magnetically-coupled SRF spoke cavity testing coupler was basically straightforward since the cavity coupling port needed to be one of the 1.22-inch ID ports, and the power level was limited by the available RF to less than 400 W TW power. In addition, the coupler would be immersed in bath cryostat filled with liquid helium, and ultimately used in a pulsed mode to accelerate beam, thereby significantly relaxing the thermal loads on the coupler. Combining the above considerations with the level of resources available for this task, emphasis was placed on rapidly developing a robust, reliable design that would use commercially-available components as available to save design, engineering, and fabrication costs. Analysis was also kept to a minimum. As such, the design incorporates the following features: (1) Use of a commercially-available Type-N ceramic feedthrough. For the power and frequency range of the test, with the feedthrough immersed in LHe, it was felt the Type-N feedthrough would provide a robust, low-cost vacuum window solution. (2) The coupler outer conductors would be solid OFE copper that is brazed into two 2.75-inch CFF, with the cavity-sde flange being rotatable to allow minor Qx adjustments by rotating the coupler. The braze joint shown has the copper brazed into a groove in the SST to ensure maximum strength for successive thermal cyclings. The outer wall of the copper between the two flanges serves as the heat sink for depositing coupler heat to the liquid helium. (3) The inner conductor would be solid OFE copper brazed to the outer conductor at the top to ensure maximum thermal conductivity from the outer thermal sink area to the base of the feedthrough. A mass-reducing hole is placed down the center of the inner conductor to decrease thermal mass and weight. (4) This

  11. Linear beam dynamics and ampere class superconducting RF cavities at RHIC

    NASA Astrophysics Data System (ADS)

    Calaga, Rama R.

    The Relativistic Heavy Ion Collider (RHIC) is a hadron collider designed to collide a range of ions from protons to gold. RHIC operations began in 2000 and has successfully completed five physics runs with several species including gold, deuteron, copper, and polarized protons. Linear optics and coupling are fundamental issues affecting the collider performance. Measurement and correction of optics and coupling are important to maximize the luminosity and sustain stable operation. A numerical approach, first developed at SLAC, was implemented to measure linear optics from coherent betatron oscillations generated by ac dipoles and recorded at multiple beam position monitors (BPMs) distributed around the collider. The approach is extended to a fully coupled 2D case and equivalence relationships between Hamiltonian and matrix formalisms are derived. Detailed measurements of the transverse coupling terms are carried out at RHIC and correction strategies are applied to compensate coupling both locally and globally. A statistical approach to determine BPM reliability and performance over the past three runs and future improvements also discussed. Aiming at a ten-fold increase in the average heavy-ion luminosity, electron cooling is the enabling technology for the next luminosity upgrade (RHIC II). Cooling gold ion beams at 100 GeV/nucleon requires an electron beam of approximately 54 MeV and a high average current in the range of 50-200 mA. All existing e-Coolers are based on low energy DC accelerators. The only viable option to generate high current, high energy, low emittance CW electron beam is through a superconducting energy-recovery linac (SC-ERL). In this option, an electron beam from a superconducting injector gun is accelerated using a high gradient (˜ 20 MV/m) superconducting RF (SRF) cavity. The electrons are returned back to the cavity with a 180° phase shift to recover the energy back into the cavity before being dumped. A design and development of a half

  12. The application of SRF vs. RDF classification and specifications to the material flows of two mechanical-biological treatment plants of Rome: Comparison and implications.

    PubMed

    Di Lonardo, Maria Chiara; Franzese, Maurizio; Costa, Giulia; Gavasci, Renato; Lombardi, Francesco

    2016-01-01

    This work assessed the quality in terms of solid recovered fuel (SRF) definitions of the dry light flow (until now indicated as refuse derived fuel, RDF), heavy rejects and stabilisation rejects, produced by two mechanical biological treatment plants of Rome (Italy). SRF classification and specifications were evaluated first on the basis of RDF historical characterisation methods and data and then applying the sampling and analytical methods laid down by the recently issued SRF standards. The results showed that the dry light flow presented a worst SRF class in terms of net calorific value applying the new methods compared to that obtained from RDF historical data (4 instead of 3). This lead to incompliance with end of waste criteria established by Italian legislation for SRF use as co-fuel in cement kilns and power plants. Furthermore, the metal contents of the dry light flow obtained applying SRF current methods proved to be considerably higher (although still meeting SRF specifications) compared to those resulting from historical data retrieved with RDF standard methods. These differences were not related to a decrease in the quality of the dry light flow produced in the mechanical-biological treatment plants but rather to the different sampling procedures set by the former RDF and current SRF standards. In particular, the shredding of the sample before quartering established by the latter methods ensures that also the finest waste fractions, characterised by higher moisture and metal contents, are included in the sample to be analysed, therefore affecting the composition and net calorific value of the waste. As for the reject flows, on the basis of their SRF classification and specification parameters, it was found that combined with the dry light flow they may present similar if not the same class codes as the latter alone, thus indicating that these material flows could be also treated in combustion plants instead of landfilled. In conclusion, the

  13. Concentration quenching, surface and spectral analyses of SrF2:Pr3+ prepared by different synthesis techniques

    NASA Astrophysics Data System (ADS)

    Yagoub, M. Y. A.; Swart, H. C.; Coetsee, E.

    2015-04-01

    Pr3+ doped strontium fluoride (SrF2) was prepared by hydrothermal and combustion methods. The phosphors were characterized by X-ray diffraction (XRD), scanning electron microscope (SEM), X-ray photoelectron spectroscopy (XPS) and Photoluminescence (PL) spectroscopy. XRD patterns indicated that the samples were completely crystallized with a pure face-centred cubic (space group: Fm3m) structure. SEM images showed different morphologies which is an indication that the morphology of the SrF2:Pr3+ phosphor strongly depends on the synthesis procedure. Both the SrF2:Pr3+ samples exhibit blue-red emission centred at 488 nm under a 439 nm excitation wavelength (λexc) at room temperature. The emission intensity of Pr3+ was also found to be dependent on the synthesis procedure. The blue-red emission has decreased with an increase in the Pr3+ concentration. The optimum Pr3+ doping level for maximum emission intensity was 0.4 and 0.2 mol% for the hydrothermal and combustion samples, respectively. The reduction in the intensity for higher concentrations was found to be due to dipole-dipole interaction induced concentration quenching effects.

  14. Broadband cavity electromagnetically induced transparency

    SciTech Connect

    Wei Xiaogang; Wang Yanhua; Zhang Jiepeng; Zhu Yifu

    2011-10-15

    Cavity electromagnetically induced transparency (EIT) is created in a three-level atomic system confined in a cavity and coupled to a free-space control laser and is manifested as a narrow transmission peak of a probe laser coupled into the cavity mode and tuned to the two-photon Raman resonance with the control laser. Cavity EIT can be observed with a control laser detuned from the atomic transition frequency in a range limited by the vacuum Rabi splitting of two cavity-atom normal modes. This leads to the broadband cavity EIT obtained in the coupled-cavity-atom system with a free-space, broadband control laser. We report an experimental observation of broadband cavity EIT in cold Rb atoms with a frequency-modulated control laser and discuss its application in multichannel and multifrequency light memory.

  15. Seamless/bonded niobium cavities

    NASA Astrophysics Data System (ADS)

    Singer, W.

    2006-07-01

    Technological aspects and performance of seamless cavities produced by hydroforming are presented. Problems related to the fabrication of seamless cavities from bulk niobium are mainly solved thanks to the progress of the last years. The highest achieved accelerating gradients are comparable for both seamless and welded versions (ca. 40 MV/m) Nevertheless further development of seamless cavities is desirable in order to avoid the careful preparation of parts for welding and get reliable statistic. Fabrication of NbCu clad cavities from bimetallic tubes is an interesting option that gives new opportunity to the seamless technique. On the one hand it allows reducing the niobium costs contribution; on the other hand it increases the thermal stability of the cavity. The highest accelerating gradient achieved on seamless NbCu clad single cell cavities (ca. 40 MV/m) is comparable to the one reached on bulk Nb cavities. Fabrication of multi-cell NbCu cavities by hydroforming was recently proven.

  16. Effective Cavity Length of Gyrotrons

    NASA Astrophysics Data System (ADS)

    Thumm, Manfred

    2014-12-01

    Megawatt-class gyrotron oscillators for electron cyclotron heating and non-inductive current drive (ECH&CD) in magnetically confined thermonuclear fusion plasmas have relatively low cavity quality factors in the range of 1000 to 2000. The effective length of their cavities cannot be simply deduced from the cavity electric field profile, since this has by far not a Gaussian shape. The present paper presents a novel method to estimate the effective length of a gyrotron cavity just from the eigenvalue of the operating TEm,n mode, the cavity radius and the exact oscillation frequency which may be numerically computed or precisely measured. This effective cavity length then can be taken to calculate the Fresnel parameter in order to confirm that the cavity is not too short so that the transverse structure of any mode in the cavity is the same as that of the corresponding mode in a long circular waveguide with the same diameter.

  17. Impact of nitrogen doping of niobium superconducting cavities on the sensitivity of surface resistance to trapped magnetic flux

    NASA Astrophysics Data System (ADS)

    Gonnella, Dan; Kaufman, John; Liepe, Matthias

    2016-02-01

    Future particle accelerators such as the SLAC "Linac Coherent Light Source-II" (LCLS-II) and the proposed Cornell Energy Recovery Linac require hundreds of superconducting radio-frequency (SRF) niobium cavities operating in continuous wave mode. In order to achieve economic feasibility of projects such as these, the cavities must achieve a very high intrinsic quality factor (Q0) to keep cryogenic losses within feasible limits. To reach these high Q0's in the case of LCLS-II, nitrogen-doping of niobium cavities has been selected as the cavity preparation technique. When dealing with Q0's greater than 1 × 1010, the effects of ambient magnetic field on Q0 become significant. Here, we show that the sensitivity to RF losses from trapped magnetic field in a cavity's walls is strongly dependent on the cavity preparation. Specifically, standard electropolished and 120 °C baked cavities show a sensitivity of residual resistance from trapped magnetic flux of ˜0.6 and ˜0.8 nΩ/mG trapped, respectively, while nitrogen-doped cavities show a higher sensitivity of residual resistance from trapped magnetic flux of ˜1 to 5 nΩ/mG trapped. We show that this difference in sensitivities is directly related to the mean free path of the RF surface layer of the niobium: shorter mean free paths lead to less sensitivity of residual resistance to trapped magnetic flux in the dirty limit (ℓ ≪ ξ0), while longer mean free paths lead to lower sensitivity of residual resistance to trapped magnetic flux in the clean limit (ℓ ≫ ξ0). These experimental results are also shown to have good agreement with recent theoretical predictions for pinned vortex lines oscillating in RF fields.

  18. Quantum efficiency temporal response and lifetime of a GaAs cathode in SRF electron gun

    SciTech Connect

    Wang, E.; Ben-Zvi, I.; Kewisch, J.; Burrill, A.; Rao, T.; Wu, Q.; Holmes, D.

    2010-05-23

    RF electron guns with a strained super lattice GaAs cathode can generate polarized electron beam of higher brightness and lower emittance than do DC guns, due to their higher field gradient at the cathode's surface. In a normal conducting RF gun, the extremely high vaccum required by these cathodes can not be met. We report on an experiment with a superconducting SRF gun, which can maintain a vacuum of nearly 10-12 torr because of cryo-pumping at the temperature of 4.2K. With conventional activation, we obtained a QE of 3% at 532 nm, with lifetime of nearly 3 days in the preparation chamber. We plan to use this cathode in a 1.3 GHz 1/2 cell SRF gun to study its performance. In addition, we studied the multipacting at the location of cathode. A new model based on the Forkker-Planck equation which can estimate the bunch length of the electron beam is discussed in this paper. Future particle accelerators such as eRHIC and ILC require high brightness, high current polarized electrons Recently, using a superlattice crystal, the maximum polarization of 95% was reached. Activation with Cs,O lowers the electron affinity and makes it energetically possible for all the electrons excited in to the conduction band and reach the surface to escape into the vacuum. Presently the polarized electron sources are based on DC gun, such as that at the CEBAF at Jlab. In these devices, the life time of the cathode is extended due to the reduced back bombardment in their UHV conditions. However, the low accelerating gradient of the DC guns lead to poor longitudinal emittance. The higher accelerating gradient of the RF gun generates low emittance beams. Superconducting RF guns combine the excellent vacuum conditions of the DC guns with the higher accelerating gradients of the RF guns and provide potentially a long lived cathode with very low transverse and longitudinal emittance. In our work at BNL, we successfully activated the GaAs. The quantum efficient is 3% at 532 nm and is expected

  19. Hollow waveguide cavity ringdown spectroscopy

    NASA Technical Reports Server (NTRS)

    Dreyer, Chris (Inventor); Mungas, Greg S. (Inventor)

    2012-01-01

    Laser light is confined in a hollow waveguide between two highly reflective mirrors. This waveguide cavity is used to conduct Cavity Ringdown Absorption Spectroscopy of loss mechanisms in the cavity including absorption or scattering by gases, liquid, solids, and/or optical elements.

  20. Er(3+)-doped transparent glass ceramics containing micron-sized SrF2 crystals for 2.7 μm emissions.

    PubMed

    Jiang, Yiguang; Fan, Jintai; Jiang, Benxue; Mao, Xiaojian; Tang, Junzhou; Xu, Yinsheng; Dai, Shixun; Zhang, Long

    2016-01-01

    Er(3+)-doped transparent glass ceramics containing micron-sized SrF2 crystals were obtained by direct liquid-phase sintering of a mixture of SrF2 powders and precursor glass powders at 820 °C for 15 min. The appearance and microstructural evolution of the SrF2 crystals in the resulting glass ceramics were investigated using X-ray diffraction, field-emission scanning electron microscopy and transmission microscopy. The SrF2 crystals are ~15 μm in size and are uniformly distributed throughout the fluorophosphate glass matrix. The glass ceramics achieve an average transmittance of 75% in the visible region and more than 85% in the near-IR region. The high transmittance of the glass ceramics results from matching the refractive index of the SrF2 with that of the precursor glass. Energy dispersive spectroscopy, photoluminescence spectra, and photoluminescence lifetimes verified the incorporation of Er(3+) into the micron-sized SrF2 crystals. Intense 2.7 μm emissions due to the (4)I11/2 → (4)I13/2 transition were observed upon excitation at 980 nm using a laser diode. The maximum value of the emission cross section of Er(3+) around 2.7 μm is more than 1.2 × 10(-20) cm(2), which indicates the potential of using transparent glass ceramics containing micron-sized SrF2 crystals for efficient 2.7 μm lasers and amplifiers. PMID:27430595

  1. Er3+-doped transparent glass ceramics containing micron-sized SrF2 crystals for 2.7 μm emissions

    PubMed Central

    Jiang, Yiguang; Fan, Jintai; Jiang, Benxue; Mao, Xiaojian; Tang, Junzhou; Xu, Yinsheng; Dai, Shixun; Zhang, Long

    2016-01-01

    Er3+-doped transparent glass ceramics containing micron-sized SrF2 crystals were obtained by direct liquid-phase sintering of a mixture of SrF2 powders and precursor glass powders at 820 °C for 15 min. The appearance and microstructural evolution of the SrF2 crystals in the resulting glass ceramics were investigated using X-ray diffraction, field-emission scanning electron microscopy and transmission microscopy. The SrF2 crystals are ~15 μm in size and are uniformly distributed throughout the fluorophosphate glass matrix. The glass ceramics achieve an average transmittance of 75% in the visible region and more than 85% in the near-IR region. The high transmittance of the glass ceramics results from matching the refractive index of the SrF2 with that of the precursor glass. Energy dispersive spectroscopy, photoluminescence spectra, and photoluminescence lifetimes verified the incorporation of Er3+ into the micron-sized SrF2 crystals. Intense 2.7 μm emissions due to the 4I11/2 → 4I13/2 transition were observed upon excitation at 980 nm using a laser diode. The maximum value of the emission cross section of Er3+ around 2.7 μm is more than 1.2 × 10−20 cm2, which indicates the potential of using transparent glass ceramics containing micron-sized SrF2 crystals for efficient 2.7 μm lasers and amplifiers. PMID:27430595

  2. Er3+-doped transparent glass ceramics containing micron-sized SrF2 crystals for 2.7 μm emissions

    NASA Astrophysics Data System (ADS)

    Jiang, Yiguang; Fan, Jintai; Jiang, Benxue; Mao, Xiaojian; Tang, Junzhou; Xu, Yinsheng; Dai, Shixun; Zhang, Long

    2016-07-01

    Er3+-doped transparent glass ceramics containing micron-sized SrF2 crystals were obtained by direct liquid-phase sintering of a mixture of SrF2 powders and precursor glass powders at 820 °C for 15 min. The appearance and microstructural evolution of the SrF2 crystals in the resulting glass ceramics were investigated using X-ray diffraction, field-emission scanning electron microscopy and transmission microscopy. The SrF2 crystals are ~15 μm in size and are uniformly distributed throughout the fluorophosphate glass matrix. The glass ceramics achieve an average transmittance of 75% in the visible region and more than 85% in the near-IR region. The high transmittance of the glass ceramics results from matching the refractive index of the SrF2 with that of the precursor glass. Energy dispersive spectroscopy, photoluminescence spectra, and photoluminescence lifetimes verified the incorporation of Er3+ into the micron-sized SrF2 crystals. Intense 2.7 μm emissions due to the 4I11/2 → 4I13/2 transition were observed upon excitation at 980 nm using a laser diode. The maximum value of the emission cross section of Er3+ around 2.7 μm is more than 1.2 × 10‑20 cm2, which indicates the potential of using transparent glass ceramics containing micron-sized SrF2 crystals for efficient 2.7 μm lasers and amplifiers.

  3. Challenges Encountered during the Processing of the BNL ERL 5 Cell Accelerating Cavity

    SciTech Connect

    A. Burrill; I. Ben-Zvi; R. Calaga; H. Hahn; V. Litvinenko; G. T. McIntyre; P. Kneisel; J. Mammosser; J. P. Preble; C. E. Reece; R. A. Rimmer; J. Saunders

    2007-08-01

    One of the key components for the Energy Recovery Linac being built by the Electron cooling group in the Collider Accelerator Department is the 5 cell accelerating cavity which is designed to accelerate 2 MeV electrons from the gun up to 15-20 MeV, allow them to make one pass through the ring and then decelerate them back down to 2 MeV prior to sending them to the dump. This cavity was designed by BNL and fabricated by AES in Medford, NY. Following fabrication it was sent to Thomas Jefferson Lab in VA for chemical processing, testing and assembly into a string assembly suitable for shipment back to BNL and integration into the ERL. The steps involved in this processing sequence will be reviewed and the deviations from processing of similar SRF cavities will be discussed. The lessons learned from this process are documented to help future projects where the scope is different from that normally encountered.

  4. Impurity-free quantum well intermixing for large optical cavity high-power laser diode structures

    NASA Astrophysics Data System (ADS)

    Kahraman, Abdullah; Gür, Emre; Aydınlı, Atilla

    2016-08-01

    We report on the correlation of atomic concentration profiles of diffusing species with the blueshift of the quantum well luminescence from both as-grown and impurity free quantum wells intermixed on actual large optical cavity high power laser diode structures. Because it is critical to suppress catastrophic optical mirror damage, sputtered SiO2 and thermally evaporated SrF2 were used both to enhance and suppress quantum well intermixing, respectively, in these (Al)GaAs large optical cavity structures. A luminescence blueshift of 55 nm (130 meV) was obtained for samples with 400 nm thick sputtered SiO2. These layers were used to generate point defects by annealing the samples at 950 °C for 3 min. The ensuing Ga diffusion observed as a shifting front towards the surface at the interface of the GaAs cap and AlGaAs cladding, as well as Al diffusion into the GaAs cap layer, correlates well with the observed luminescence blue shift, as determined by x-ray photoelectron spectroscopy. Although this technique is well-known, the correlation between the photoluminescence peak blue shift and diffusion of Ga and Al during impurity free quantum well intermixing on actual large optical cavity laser diode structures was demonstrated with both x ray photoelectron and photoluminescence spectroscopy, for the first time.

  5. Niobium Thin Film Characterization for Thin Film Technology Used in Superconducting Radiofrequency Cavities

    NASA Astrophysics Data System (ADS)

    Dai, Yishu; Valente-Feliciano, Anne-Marie

    2015-10-01

    Superconducting RadioFrequency (SRF) penetrates about 40-100 nm of the top surface, making thin film technology possible in producing superconducting cavities. Thin film is based on the deposition of a thin Nb layer on top of a good thermal conducting material such as Al or Cu. Thin film allows for better control of the surface and has negligible response to the Earth's magnetic field, eliminating the need for magnetic shielding of the cavities. Thin film superconductivity depends heavily on coating process conditions, involving controllable parameters such as crystal plane orientation, coating temperature, and ion energy. MgO and Al2O3 substrates are used because they offer very smooth surfaces, ideal for studying film growth. Atomic Force Microscopy is used to characterize surface's morphology. It is evident that a lower nucleation energy and a long coating time increases the film quality in the r-plane sapphire crystal orientation. The quality of the film increases with thickness. Nb films coated on r-plane, grow along the (001) plane and yield a much higher RRR compared to the films grown on a- and c-planes. This information allows for further improvement on the research process for thin film technology used in superconducting cavities for the particle accelerators. National Science Foundation, Department of Energy, Jefferson Lab, Old Dominion University.

  6. CHALLENGES ENCOUNTERED DURING THE PROCESSING OF THE BNL ERL 5 CELL ACCELERATING CAVITY

    SciTech Connect

    BURRILL,A.

    2007-06-25

    One of the key components for the Energy Recovery Linac being built by the Electron cooling group in the Collider Accelerator Department is the 5 cell accelerating cavity which is designed to accelerate 2 MeV electrons from the gun up to 15-20 MeV, allow them to make one pass through the ring and then decelerate them back down to 2 MeV prior to sending them to the dump. This cavity was designed by BNL and fabricated by AES in Medford, NY. Following fabrication it was sent to Thomas Jefferson Lab in VA for chemical processing, testing and assembly into a string assembly suitable for shipment back to BNL for integration into the ERL. The steps involved in this processing sequence will be reviewed and the deviations from processing of similar SRF cavities will be discussed. The lessons learned from this process are documented to help future projects where the scope is different from that normally encountered.

  7. Digital Cavity Resonance Monitor, alternative method of measuring cavity microphonics

    SciTech Connect

    Tomasz Plawski; G. Davis; Hai Dong; J. Hovater; John Musson; Thomas Powers

    2005-09-20

    As is well known, mechanical vibration or microphonics in a cryomodule causes the cavity resonance frequency to change at the vibration frequency. One way to measure the cavity microphonics is to drive the cavity with a Phase Locked Loop. Measurement of the instantaneous frequency or PLL error signal provides information about the cavity microphonic frequencies. Although the PLL error signal is available directly, precision frequency measurements require additional instrumentation, a Cavity Resonance Monitor (CRM). The analog version of such a device has been successfully used for several cavity tests [1]. In this paper we present a prototype of a Digital Cavity Resonance Monitor designed and built in the last year. The hardware of this instrument consists of an RF downconverter, digital quadrature demodulator and digital processor motherboard (Altera FPGA). The motherboard processes received data and computes frequency changes with a resolution of 0.2 Hz, with a 3 kHz output bandwidth.

  8. CAVITY CONTROL ALGORITHM

    SciTech Connect

    Tomasz Plawski, J. Hovater

    2010-09-01

    A digital low level radio frequency (RF) system typically incorporates either a heterodyne or direct sampling technique, followed by fast ADCs, then an FPGA, and finally a transmitting DAC. This universal platform opens up the possibilities for a variety of control algorithm implementations. The foremost concern for an RF control system is cavity field stability, and to meet the required quality of regulation, the chosen control system needs to have sufficient feedback gain. In this paper we will investigate the effectiveness of the regulation for three basic control system algorithms: I&Q (In-phase and Quadrature), Amplitude & Phase and digital SEL (Self Exciting Loop) along with the example of the Jefferson Lab 12 GeV cavity field control system.

  9. Cavity enhanced atomic magnetometry

    PubMed Central

    Crepaz, Herbert; Ley, Li Yuan; Dumke, Rainer

    2015-01-01

    Atom sensing based on Faraday rotation is an indispensable method for precision measurements, universally suitable for both hot and cold atomic systems. Here we demonstrate an all-optical magnetometer where the optical cell for Faraday rotation spectroscopy is augmented with a low finesse cavity. Unlike in previous experiments, where specifically designed multipass cells had been employed, our scheme allows to use conventional, spherical vapour cells. Spherical shaped cells have the advantage that they can be effectively coated inside with a spin relaxation suppressing layer providing long spin coherence times without addition of a buffer gas. Cavity enhancement shows in an increase in optical polarization rotation and sensitivity compared to single-pass configurations. PMID:26481853

  10. Cavity enhanced atomic magnetometry.

    PubMed

    Crepaz, Herbert; Ley, Li Yuan; Dumke, Rainer

    2015-01-01

    Atom sensing based on Faraday rotation is an indispensable method for precision measurements, universally suitable for both hot and cold atomic systems. Here we demonstrate an all-optical magnetometer where the optical cell for Faraday rotation spectroscopy is augmented with a low finesse cavity. Unlike in previous experiments, where specifically designed multipass cells had been employed, our scheme allows to use conventional, spherical vapour cells. Spherical shaped cells have the advantage that they can be effectively coated inside with a spin relaxation suppressing layer providing long spin coherence times without addition of a buffer gas. Cavity enhancement shows in an increase in optical polarization rotation and sensitivity compared to single-pass configurations. PMID:26481853

  11. Cavity enhanced atomic magnetometry

    NASA Astrophysics Data System (ADS)

    Crepaz, Herbert; Ley, Li Yuan; Dumke, Rainer

    2015-10-01

    Atom sensing based on Faraday rotation is an indispensable method for precision measurements, universally suitable for both hot and cold atomic systems. Here we demonstrate an all-optical magnetometer where the optical cell for Faraday rotation spectroscopy is augmented with a low finesse cavity. Unlike in previous experiments, where specifically designed multipass cells had been employed, our scheme allows to use conventional, spherical vapour cells. Spherical shaped cells have the advantage that they can be effectively coated inside with a spin relaxation suppressing layer providing long spin coherence times without addition of a buffer gas. Cavity enhancement shows in an increase in optical polarization rotation and sensitivity compared to single-pass configurations.

  12. What Are Oral Cavity and Oropharyngeal Cancers?

    MedlinePlus

    ... about oral cavity and oropharyngeal cancers? What are oral cavity and oropharyngeal cancers? Cancer starts when cells in ... the parts of the mouth and throat. The oral cavity (mouth) and oropharynx (throat) The oral cavity includes ...

  13. Gyromultiplier with sectioned cavity

    SciTech Connect

    Bandurkin, I. V.; Mishakin, S. V.

    2010-11-15

    A novel scheme of a self-exciting single-cavity terahertz gyromultiplier is proposed and theoretically investigated. Simulations predict a possibility to obtain a power of 75 W at the frequency of 1.3 THz from the 80 kV/0.7 A electron beam when operating at the fourth cyclotron harmonic at the relatively low magnetic field of 14 T.

  14. Single mode cavity laser

    SciTech Connect

    Martin, D.W.; Levy, J.L.

    1984-01-17

    This external cavity laser utilizes an unstable resonator in conjuction with a high reflectivity stripe end mirror which is oriented substantially parallel to the plane of the maximum divergence of the laser diode output beam and whose axis is substantially parallel to the plane of the junction of the laser diode. This configuration operates with high efficiency to select only the fundamental mode of the laser diode with a minimal divergence in the output beam.

  15. Dasatinib inhibits TGFβ-induced myofibroblast differentiation through Src-SRF Pathway.

    PubMed

    Abdalla, Maha; Thompson, LeeAnn; Gurley, Erin; Burke, Samantha; Ujjin, Jessica; Newsome, Robert; Somanath, Payaningal R

    2015-12-15

    Persistent myofibroblast differentiation is a hallmark of fibrotic diseases. Myofibroblasts are characterized by de novo expression of alpha smooth muscle actin (αSMA) and excess fibronectin assembly. Recent studies provide conflicting reports on the effects of tyrosine kinase inhibitor dasatinib on myofibroblast differentiation and fibrosis. Also, it is not fully understood whether dasatinib modulates myofibroblast differentiation by targeting Src kinase. Herein, we investigated the effect of dasatinib on cSrc and transforming growth factor-β (TGFβ)-induced myofibroblast differentiation in vitro. Our results indicated that selective Src kinase inhibition using PP2 mimicked the effect of dasatinib in attenuating myofibroblast differentiation as evident by blunted αSMA expression and modest, but significant inhibition of fibronectin assembly in both NIH 3T3 and fibrotic human lung fibroblasts. Mechanistically, our data showed that dasatinib modulates αSMA synthesis through Src kinase-mediated modulation of serum response factor expression. Collectively, our results demonstrate that dasatinib modulates myofibroblast differentiation through Src-SRF pathway. Thus, dasatinib could potentially be a therapeutic option in fibrotic diseases. PMID:26548624

  16. Design of the SRF Driver ERL for the Jefferson Lab UV FEL

    SciTech Connect

    Douglas, David R; Benson, Stephen; Biallas, George; Blackburn, Keith; Boyce, James; Bullard, Donald; Coleman, James; Dickover, Cody; Ellingsworth, Forrest; Evtushenko, Pavel; Gould, Christopher; Gubeli, Joseph; Hannon, Fay; Hardy, David; Hernandez-Garcia, Carlos; Jordan, Kevin; Klopf, Michael; Kortze, James; Marchlik, Matthew; Moore, Steven; Neil, George; Powers, Thomas; Sexton, Daniel; Shinn, Michelle D; Tennant, Christopher; Walker, Richard; Wilson, Frederick; Zhang, Shukui

    2011-03-01

    We describe the design of the SRF Energy-Recovering Linac (ERL) providing the CW electron drive beam at the Jefferson Lab UV FEL. Based on the same 135 MeV linear accelerator as and sharing portions of the recirculator with the Jefferson Lab 10 kW IR Upgrade FEL, the UV driver ERL uses a novel bypass geometry to provide transverse phase space control, bunch length compression, and nonlinear aberration compensation (including correction of RF curvature effects) without the use of magnetic chicanes or harmonic RF. Stringent phase space requirements at the wiggler, low beam energy, high beam current, and use of a pre-existing facility and legacy hardware subject the design to numerous constraints. These are imposed not only by the need for both transverse and longitudinal phase space management, but also by the potential impact of collective phenomena (space charge, wakefields, beam break-up (BBU), and coherent synchrotron radiation (CSR)), and by interactions between the FEL and the accelerator RF system. This report addresses these issues and presents the accelerator design solution that is now in operation.

  17. REVIEW OF VARIOUS APPROACHES TO ADDRESS HIGH CURRENTS IN SRF ELECTRON LINACS.

    SciTech Connect

    BEN-ZVI, I.

    2005-07-10

    The combination of high-brightness electron sources and high-current SRF Energy Recovery Linacs (ERL) leads to a new emerging technology: High-power, high-brightness electron beams. This technology enables extremely high average power Free-Electron Lasers, a new generation of extreme brightness light sources, electron coolers of high-energy hadron storage rings, polarized electron-hadron colliders of very high luminosity, compact Thomson scattering X-ray sources, terahertz radiation generators and much more. What is typical for many of these applications is the need for very high current, defined here as over 100 mA average current, and high brightness, which is charge dependant, but needs to be in the range of between sub micron up to perhaps 50 microns, usually the lower--the better. Suffice it to say that while there are a number of projects aiming at this level of performance, none is anywhere near it. This work will review the problems associated with the achievement of such performance and the various approaches taken in a number of laboratories around the world to address the issues.

  18. Heat load of a P-doped GaAs photocathode in SRF electron gun

    SciTech Connect

    Wang, E.; Ben-Zvi, I.; Kewisch, J.; Burrill, A.; Rao, T.; Wu, Q.; Jain, A.; Gupta, R.; Holmes, D.

    2010-05-23

    Many efforts were made over the last decades to develop a better polarized electron source for the high energy physics. Several laboratories operate DC guns with the Gallium-Arsenide photo-cathode, which yield a highly polarized electron beam. However, the beam's emittance might well be improved using a Superconducting RF electron gun, which delivers beams of higher brightness than DC guns does, because the field gradient at the cathode is higher. SRF guns with metal cathodes and CsTe cathodes have been tested successfully. To produce polarized electrons, a Gallium-Arsenide photo-cathode must be used: an experiment to do so in a superconducting RF gun is under way at BNL. Since the cathode will be normal conducting, the problem about the heat load stemming from the cathode arises. We present our measurements of the electrical resistance of GaAs at cryogenic temperatures, a prediction of the heat load and the verification by measuring the quality factor of the gun with and without cathode.

  19. RNA export factor Ddx19 is required for nuclear import of the SRF coactivator MKL1

    PubMed Central

    Rajakylä, Eeva Kaisa; Viita, Tiina; Kyheröinen, Salla; Huet, Guillaume; Treisman, Richard; Vartiainen, Maria K.

    2015-01-01

    Controlled transport of macromolecules between the cytoplasm and nucleus is essential for homeostatic regulation of cellular functions. For instance, gene expression entails coordinated nuclear import of transcriptional regulators to activate transcription and nuclear export of the resulting messenger RNAs for cytoplasmic translation. Here we link these two processes by reporting a novel role for the mRNA export factor Ddx19/Dbp5 in nuclear import of MKL1, the signal-responsive transcriptional activator of SRF. We show that Ddx19 is not a general nuclear import factor, and that its specific effect on MKL1 nuclear import is separate from its role in mRNA export. Both helicase and nuclear pore-binding activities of Ddx19 are dispensable for MKL1 nuclear import, but RNA binding is required. Mechanistically, Ddx19 operates by modulating the conformation of MKL1, which affects its interaction with Importin-β for efficient nuclear import. Thus, Ddx19 participates in mRNA export, translation and nuclear import of a key transcriptional regulator. PMID:25585691

  20. RNA export factor Ddx19 is required for nuclear import of the SRF coactivator MKL1.

    PubMed

    Rajakylä, Eeva Kaisa; Viita, Tiina; Kyheröinen, Salla; Huet, Guillaume; Treisman, Richard; Vartiainen, Maria K

    2015-01-01

    Controlled transport of macromolecules between the cytoplasm and nucleus is essential for homeostatic regulation of cellular functions. For instance, gene expression entails coordinated nuclear import of transcriptional regulators to activate transcription and nuclear export of the resulting messenger RNAs for cytoplasmic translation. Here we link these two processes by reporting a novel role for the mRNA export factor Ddx19/Dbp5 in nuclear import of MKL1, the signal-responsive transcriptional activator of SRF. We show that Ddx19 is not a general nuclear import factor, and that its specific effect on MKL1 nuclear import is separate from its role in mRNA export. Both helicase and nuclear pore-binding activities of Ddx19 are dispensable for MKL1 nuclear import, but RNA binding is required. Mechanistically, Ddx19 operates by modulating the conformation of MKL1, which affects its interaction with Importin-β for efficient nuclear import. Thus, Ddx19 participates in mRNA export, translation and nuclear import of a key transcriptional regulator. PMID:25585691

  1. Development of Nb and Alternative Material Thin Films Tailored for SRF Applications

    SciTech Connect

    Valente-Feliciano, A -M; Reece, C E; Spradlin, J K; Xiao, B; Zhao, X; Gu, Diefeng; Baumgart, Helmut; Beringer, Douglas; Lukaszew, Rosa

    2011-09-01

    Over the years, Nb/Cu technology, despite its shortcomings due to the commonly used magnetron sputtering, has positioned itself as an alternative route for the future of superconducting structures used in accelerators. Recently, significant progress has been made in the development of energetic vacuum deposition techniques, showing promise for the production of thin films tailored for SRF applications. JLab is pursuing energetic condensation deposition via techniques such as Electron Cyclotron Resonance and High Power Impulse Magnetron Sputtering. As part of this project, the influence of the deposition energy on the material and RF properties of the Nb thin film is investigated with the characterization of their surface, structure, superconducting properties and RF response. It has been shown that the film RRR can be tuned from single digits to values greater than 400. This paper presents results on surface impedance measurements correlated with surface and material characterization for Nb films produced on various substrates, monocrystalline and polycrystalline as well as amorphous. A progress report on work on NbTiN and AlN based multilayer structures will also be presented.

  2. RF Cavity Characterization with VORPAL

    SciTech Connect

    C. Nieter, C. Roark, P. Stoltz, C.D. Zhou, F. Marhauser

    2011-03-01

    When designing a radio frequency (RF) accelerating cavity structure various figures of merit are considered before coming to a final cavity design. These figures of merit include specific field and geometry based quantities such as the ratio of the shunt impedance to the quality factor (R/Q) or the normalized peak fields in the cavity. Other important measures of cavity performance include the peak surface fields as well as possible multipacting resonances in the cavity. High fidelity simulations of these structures can provide a good estimate of these important quantities before any cavity prototypes are built. We will present VORPAL simulations of a simple pillbox structure where these quantities can be calculated analytically and compare them to the results from the VORPAL simulations. We will then use VORPAL to calculate these figures of merit and potential multipacting resonances for two cavity designs under development at Jefferson National Lab for Project X.

  3. Crab Cavities for Linear Colliders

    SciTech Connect

    Burt, G.; Ambattu, P.; Carter, R.; Dexter, A.; Tahir, I.; Beard, C.; Dykes, M.; Goudket, P.; Kalinin, A.; Ma, L.; McIntosh, P.; Shulte, D.; Jones, Roger M.; Bellantoni, L.; Chase, B.; Church, M.; Khabouline, T.; Latina, A.; Adolphsen, C.; Li, Z.; Seryi, Andrei; /SLAC

    2011-11-08

    Crab cavities have been proposed for a wide number of accelerators and interest in crab cavities has recently increased after the successful operation of a pair of crab cavities in KEK-B. In particular crab cavities are required for both the ILC and CLIC linear colliders for bunch alignment. Consideration of bunch structure and size constraints favour a 3.9 GHz superconducting, multi-cell cavity as the solution for ILC, whilst bunch structure and beam-loading considerations suggest an X-band copper travelling wave structure for CLIC. These two cavity solutions are very different in design but share complex design issues. Phase stabilisation, beam loading, wakefields and mode damping are fundamental issues for these crab cavities. Requirements and potential design solutions will be discussed for both colliders.

  4. Spectroscopy of laser properties of Nd(3+)-doped CaF2, SrF2, and BaF2

    NASA Astrophysics Data System (ADS)

    Payne, Stephen A.; Caird, John A.; Chase, L. L.; Smith, L. K.; Nielsen, N. D.; Krupke, William F.

    1990-03-01

    The optical properties of Nd(3+) in CaF2, SrF2, and BaF2 were investigated in order to determine if these materials are useful as laser-pumped amplifier media. The CaF2:Nd crystal was found to not be useful because the impurities tend to cluster at very low concentration, leading to the formation of nonluminescent centers. On the other hand, the Nd(3+) centers in BaF2 exhibit unacceptably low transition strengths. SrF2:Nd appears to have adequate absorption strength, and, in addition, to have a remarkably long emission lifetime of 1280 microns. A maximum doping of 0.20 atomic percent Nd(3+) can be tolerated in SrF2 without the occurrence of detrimental clustering. The peak emission cross section of SrF2:Nd is 1.7 x 10(exp -20) sq cm at 1036.5 nm. Direct measurement of the gain spectrum of SrF2:Nd(3+) reveals the presence of the F-4(sub 3/2) yields G-2(sub 9/2) excited state absorption lines, although the impact on the emission cross section is minor.

  5. Characterization of Nb Superconducting Radio Frequency Cavities Based On In-Situ STEM And EELS

    NASA Astrophysics Data System (ADS)

    Tao, Runzhe

    Niobium, a 4d transition metal, has the highest superconducting transition temperature (Tc=9.2K) of any elemental superconductor as type II superconductor with coherent length, sigma approximately that of the penetration length, lambda. Pure niobium is grey in color and very soft, which makes this metal easily fabricable into different shapes for superconducting radio- frequency (SRF) cavities. Such cavities are used in some modern accelerators (SNS, CEBAF, XFEL), and are intended for usage in the next generation of particle accelerators, such as ILC. Since the crucial part of the cavities is top 100 nm of Nb near the inner cavity surface, considering the penetration depth is around 40 nm, it has attracted more and more attention in improving the surface process for optimizing the performance of the cavities. Nowadays, the main treatment of the Nb surface includes electro polishing (EP), buffered chemical polishing (BCP), high temperature baking (800 °C, 1000 °C and 1200 °C) and mild baking (120 °C). Firstly, the two half cells are welded together and the weld line is quite rough; there exists a lot of visible pits and defects on the inner shell of cavities. In this Ph.D. thesis, novel techniques in a scanning transmission electron microscope (STEM) that can be used to analyze the atomic scale structure-property relationship, both at room tem- perature and high/LN 2 temperature, are explored. Specifically, by using correlated Z-contrast imaging and electron energy loss spectrum (EELS), the structure, composition and bonding can be characterized directly on the atomic scale, also, light atoms, like H, O and C, are visible in ABF images. For the examining the defect behavior on the cavity surface, heating and cold stages are involved to simulate the baking treatment and low-temperature environments. These studies will serve as an important reference for qualifying different surface treatments to further improve SRF cavities' performance. The experimental results

  6. Superconducting cavities and modulated RF

    SciTech Connect

    Farkas, Z.D.

    1981-02-01

    If a cavity has an infinite Q/sub o/, 81.5% of the energy contained in a pulse incident upon the cavity is transferred into the cavity by the end of the pulse if the cavity Q/sub e/ is chosen so that the cavity time constant is 0.796 pulse width (T/sub a/). As Q/sug o/ decreases, the energy in the cavity at the end of the pulse decreases very slowly as long as T/sub a/ is much less than the unloaded cavity time constant, T/sub co/. SC cavities with very high Q/sub o/ enable one to obtain very high gradients with a low power cw source. At high gradients, however, one often does not attain the high Q/sub o/ predicted by theory. Therefore, if one is inteerested in attaining maximum energy in the cavity, as is the case for RF processing and diagnostics, for a given available source energy there is no point in keeping the power on for longer than 0.1 T/sub co/ because the energy expended after 0.1 T/sub co/ is wasted. Therefore, to attain high fields at moderate Q/sub o/, pulsed operation is indicated. This note derives the fields and energy stored and dissipated in the cavity when Q/sub e/ is optimized for a given T/sub a/. It shows how to use this data to measure Q/sub o/ of an SC cavity as a function of field level, how to process the cavity with high RF fields, how to operate SC cavities in the pulsed mode to obtain higher efficiencies and gradients. Experimental results are also reported.

  7. Model for initiation of quality factor degradation at high accelerating fields in superconducting radio-frequency cavities

    NASA Astrophysics Data System (ADS)

    Dzyuba, A.; Romanenko, A.; Cooley, L. D.

    2010-12-01

    A model for the onset of the reduction in superconducting radio-frequency (SRF) cavity quality factor, the so-called Q-drop, at high accelerating electric fields is presented. Since magnetic fields at the cavity equator are tied to accelerating electric fields by a simple geometric factor, the onset of magnetic flux penetration determines the onset of Q-drop. We consider breakdown of the surface barrier at triangular grooves to predict the magnetic field of first flux penetration Hpen. Such defects were argued to be the worst case by Buzdin and Daumens (1998 Physica C 294 257), whose approach, moreover, incorporates both the geometry of the groove and local contamination via the Ginzburg-Landau parameter κ. Since previous Q-drop models focused on either topography or contamination alone, the proposed model allows new comparisons of one effect in relation to the other. The model predicts equivalent reduction of Hpen when either roughness or contamination were varied alone, so smooth but dirty surfaces limit cavity performance about as much as rough but clean surfaces do. Still lower Hpen was predicted when both effects were combined, i.e. contamination should exacerbate the negative effects of roughness and vice versa. To test the model with actual data, coupons were prepared by buffered chemical polishing and electropolishing, and stylus profilometry was used to obtain distributions of angles. From these data, curves for surface resistance generated by simple flux flow as a function of magnetic field were generated by integrating over the distribution of angles for reasonable values of κ. This showed that combined effects of roughness and contamination indeed reduce the Q-drop onset field by ~ 20%, and that contamination contributes to Q-drop as much as roughness. The latter point may be overlooked by SRF cavity research, since access to the cavity interior by spectroscopy tools is very difficult, whereas optical images have become commonplace. The model was

  8. Intravital imaging of SRF and Notch signalling identifies a key role for EZH2 in invasive melanoma cells

    PubMed Central

    Manning, Cerys S; Hooper, Steven; Sahai, Erik A

    2014-01-01

    The acquisition of cell motility is an early step in melanoma metastasis. Here we use intravital imaging of signalling reporter cell-lines combined with genome-wide transcriptional analysis to define signalling pathways and genes associated with melanoma metastasis. Intravital imaging revealed heterogeneous cell behaviour in vivo: less than 10% of cells were motile and both singly moving cells and streams of cells were observed. Motile melanoma cells had increased Notch- and SRF-dependent transcription. Subsequent genome-wide analysis identified an overlapping set of genes associated with high Notch and SRF activity. We identified EZH2, a histone methyltransferase in the Polycomb Repressor Complex 2, as a regulator of these genes. Heterogeneity of EZH2 levels is observed in melanoma models and co-ordinated up-regulation of genes positively regulated by EZH2 is associated with melanoma metastasis. EZH2 was also identified as regulating the amelanotic phenotype of motile cells in vivo by suppressing expression of the P-glycoprotein Oca2. Analysis of patient samples confirmed an inverse relationship between EZH2 levels and pigment. EZH2 targeting with siRNA and chemical inhibition reduced invasion in mouse and human melanoma cell lines. The EZH2 regulated SRF target genes KIF2C and KIF22 are required for melanoma cell invasion and important for lung colonisation. We propose that heterogeneity in EZH2 levels leads to heterogeneous expression of a cohort of genes associated with motile behaviour including KIF2C and KIF22. EZH2 dependent increased expression of these genes promotes melanoma cell motility and early steps in metastasis. PMID:25381824

  9. Applications of cavity optomechanics

    SciTech Connect

    Metcalfe, Michael

    2014-09-15

    Cavity-optomechanics” aims to study the quantum properties of mechanical systems. A common strategy implemented in order to achieve this goal couples a high finesse photonic cavity to a high quality factor mechanical resonator. Then, using feedback forces such as radiation pressure, one can cool the mechanical mode of interest into the quantum ground state and create non-classical states of mechanical motion. On the path towards achieving these goals, many near-term applications of this field have emerged. After briefly introducing optomechanical systems and describing the current state-of-the-art experimental results, this article summarizes some of the more exciting practical applications such as ultra-sensitive, high bandwidth accelerometers and force sensors, low phase noise x-band integrated microwave oscillators and optical signal processing such as optical delay-lines, wavelength converters, and tunable optical filters. In this rapidly evolving field, new applications are emerging at a fast pace, but this article concentrates on the aforementioned lab-based applications as these are the most promising avenues for near-term real-world applications. New basic science applications are also becoming apparent such as the generation of squeezed light, testing gravitational theories and for providing a link between disparate quantum systems.

  10. Multicolor cavity metrology.

    PubMed

    Izumi, Kiwamu; Arai, Koji; Barr, Bryan; Betzwieser, Joseph; Brooks, Aidan; Dahl, Katrin; Doravari, Suresh; Driggers, Jennifer C; Korth, W Zach; Miao, Haixing; Rollins, Jameson; Vass, Stephen; Yeaton-Massey, David; Adhikari, Rana X

    2012-10-01

    Long-baseline laser interferometers used for gravitational-wave detection have proven to be very complicated to control. In order to have sufficient sensitivity to astrophysical gravitational waves, a set of multiple coupled optical cavities comprising the interferometer must be brought into resonance with the laser field. A set of multi-input, multi-output servos then lock these cavities into place via feedback control. This procedure, known as lock acquisition, has proven to be a vexing problem and has reduced greatly the reliability and duty factor of the past generation of laser interferometers. In this article, we describe a technique for bringing the interferometer from an uncontrolled state into resonance by using harmonically related external fields to provide a deterministic hierarchical control. This technique reduces the effect of the external seismic disturbances by 4 orders of magnitude and promises to greatly enhance the stability and reliability of the current generation of gravitational-wave detectors. The possibility for using multicolor techniques to overcome current quantum and thermal noise limits is also discussed. PMID:23201656

  11. Observation of Cavity Rydberg Polaritons

    NASA Astrophysics Data System (ADS)

    Georgakopoulos, Alexandros; Jia, Ningyuan; Ryou, Albert; Schine, Nathan; Sommer, Ariel; Simon, Jonathan

    2016-05-01

    We demonstrate hybridization of optical cavity photons with atomic Rydberg excitations using electromagnetically induced transparency (EIT). The resulting dark state Rydberg polaritons exhibit a compressed frequency spectrum and enhanced lifetime indicating strong light-matter mixing. We study the coherence properties of cavity Rydberg polaritons and identify the generalized EIT linewidth for optical cavities. Strong collective coupling suppresses polariton losses due to inhomogeneous broadening, which we demonstrate by using different Rydberg levels with a range of polarizabilities. Our results point the way towards using cavity Rydberg polaritons as a platform for creating photonic quantum materials.

  12. Cavity coalescence in superplastic deformation

    SciTech Connect

    Stowell, M.J.; Livesey, D.W.; Ridley, N.

    1984-01-01

    An analysis of the probability distribution function of particles randomly dispersed in a solid has been applied to cavitation during superplastic deformation and a method of predicting cavity coalescence developed. Cavity size distribution data were obtained from two microduplex nickel-silver alloys deformed superplastically to various extents at elevated temperature, and compared to theoretical predictions. Excellent agreement occurred for small void sizes but the model underestimated the number of voids in the largest size groups. It is argued that the discrepancy results from a combination of effects due to non-random cavity distributions and to enhanced growth rates and incomplete spheroidization of the largest cavities.

  13. Nanofriction in Cavity Quantum Electrodynamics.

    PubMed

    Fogarty, T; Cormick, C; Landa, H; Stojanović, Vladimir M; Demler, E; Morigi, Giovanna

    2015-12-01

    The dynamics of cold trapped ions in a high-finesse resonator results from the interplay between the long-range Coulomb repulsion and the cavity-induced interactions. The latter are due to multiple scatterings of laser photons inside the cavity and become relevant when the laser pump is sufficiently strong to overcome photon decay. We study the stationary states of ions coupled with a mode of a standing-wave cavity as a function of the cavity and laser parameters, when the typical length scales of the two self-organizing processes, Coulomb crystallization and photon-mediated interactions, are incommensurate. The dynamics are frustrated and in specific limiting cases can be cast in terms of the Frenkel-Kontorova model, which reproduces features of friction in one dimension. We numerically recover the sliding and pinned phases. For strong cavity nonlinearities, they are in general separated by bistable regions where superlubric and stick-slip dynamics coexist. The cavity, moreover, acts as a thermal reservoir and can cool the chain vibrations to temperatures controlled by the cavity parameters and by the ions' phase. These features are imprinted in the radiation emitted by the cavity, which is readily measurable in state-of-the-art setups of cavity quantum electrodynamics. PMID:26684118

  14. Extremely Large Cusp Diamagnetic Cavities

    NASA Astrophysics Data System (ADS)

    Chen, J.; Fritz, T. A.

    2002-05-01

    Extremely large diamagnetic cavities with a size of as large as 6 Re have been observed in the dayside high-altitude cusp regions. Some of the diamagnetic cavities were independent of the IMF directions, which is unexpected by the current MHD (or ISM) models, suggesting that the cusp diamagnetic cavities are different from the magnetospheric sash, which provides a challenge to the existing MHD (or ISM) models. Associated with these cavities are ions with energies from 40 keV up to 8 MeV. The charge state distribution of these cusp cavity ions was indicative of their seed populations being a mixture of the ionospheric and the solar wind particles. The intensities of the cusp cavity energetic ions were observed to increase by as large as four orders of the magnitudes. During high solar wind pressure period on April 21, 1999, the POLAR spacecraft observed lower ion flux in the dayside high-latitude magnetosheath than that in the neighbouring cusp cavities. These observations indicate that the dayside high-altitude cusp diamagnetic cavity is a key region for transferring the solar wind energy, mass, and momentum into the Earth's magnetosphere. These energetic particles in the cusp diamagnetic cavity together with the cusp's connectivity have significant global impacts on the geospace environment research and will be shedding light on the long-standing unsolved fundamental issue about the origins of the energetic particles in the ring current and in upstream ion events.

  15. Extremely large cusp diamagnetic cavities

    NASA Astrophysics Data System (ADS)

    Chen, J.; Fritz, T.; Siscoe, G.

    Extremely large diamagnetic cavities with a size of as large as 6 Re have been observed in the dayside high-altitude cusp regions. These diamagnetic cavities are always there day by day. Some of the diamagnetic cavities have been observed in the morningside during intervals when the IMF By component was positive (duskward), suggesting that the cusp diamagnetic cavities are different from the magnetospheric sash predicted by MHD simulations. Associated with these cavities are ions with energies from 40 keV up to 8 MeV. The charge state distribution of these cusp cavity ions was indicative of their seed populations being a mixture of the ionospheric and the solar wind particles. The intensities of the cusp cavity energetic ions were observed to increase by as large as four orders of the magnitudes. These observations indicate that the dayside high-altitude cusp diamagnetic cavity is a key region for transferring the solar wind energy, mass, and momentum into the Earth's magnetosphere. These energetic particles in the cusp diamagnetic cavity together with the cusp's connectivity to the entire magnetopause may have significant global impacts on the geospace environment. They will possibly be shedding light on the long-standing unsolved fundamental issue about the origins of the energetic particles in the ring current and in the regions upstream of the subsolar magnetopause where energetic ion events frequently are observed.

  16. Nanofriction in Cavity Quantum Electrodynamics

    NASA Astrophysics Data System (ADS)

    Fogarty, T.; Cormick, C.; Landa, H.; Stojanović, Vladimir M.; Demler, E.; Morigi, Giovanna

    2015-12-01

    The dynamics of cold trapped ions in a high-finesse resonator results from the interplay between the long-range Coulomb repulsion and the cavity-induced interactions. The latter are due to multiple scatterings of laser photons inside the cavity and become relevant when the laser pump is sufficiently strong to overcome photon decay. We study the stationary states of ions coupled with a mode of a standing-wave cavity as a function of the cavity and laser parameters, when the typical length scales of the two self-organizing processes, Coulomb crystallization and photon-mediated interactions, are incommensurate. The dynamics are frustrated and in specific limiting cases can be cast in terms of the Frenkel-Kontorova model, which reproduces features of friction in one dimension. We numerically recover the sliding and pinned phases. For strong cavity nonlinearities, they are in general separated by bistable regions where superlubric and stick-slip dynamics coexist. The cavity, moreover, acts as a thermal reservoir and can cool the chain vibrations to temperatures controlled by the cavity parameters and by the ions' phase. These features are imprinted in the radiation emitted by the cavity, which is readily measurable in state-of-the-art setups of cavity quantum electrodynamics.

  17. A scanning cavity microscope.

    PubMed

    Mader, Matthias; Reichel, Jakob; Hänsch, Theodor W; Hunger, David

    2015-01-01

    Imaging the optical properties of individual nanosystems beyond fluorescence can provide a wealth of information. However, the minute signals for absorption and dispersion are challenging to observe, and only specialized techniques requiring sophisticated noise rejection are available. Here we use signal enhancement in a high-finesse scanning optical microcavity to demonstrate ultra-sensitive imaging. Harnessing multiple interactions of probe light with a sample within an optical resonator, we achieve a 1,700-fold signal enhancement compared with diffraction-limited microscopy. We demonstrate quantitative imaging of the extinction cross-section of gold nanoparticles with a sensitivity less than 1 nm(2); we show a method to improve the spatial resolution potentially below the diffraction limit by using higher order cavity modes, and we present measurements of the birefringence and extinction contrast of gold nanorods. The demonstrated simultaneous enhancement of absorptive and dispersive signals promises intriguing potential for optical studies of nanomaterials, molecules and biological nanosystems. PMID:26105690

  18. Accessory oral cavity

    PubMed Central

    Gnaneswaran, Manica Ramamoorthy; Varadarajan, Usha; Srinivasan, Ramesh; Kamatchi, Sangeetha

    2012-01-01

    This is a rare case report of a patient around 11 years with the complaint of extra mouth who reported to the hospital for removal of that extra mouth. On examination there was accessory oral cavity with small upper and lower lips, seven teeth and saliva was drooling out. Under general anesthesia crevicular incision from 32 to 43 was put and labial gingiva with alveolar mucosa was reflected completely and bone exposed to lower border of mandible. There were seven teeth resembling lower permanent anterior teeth in the accessory mouth, which was excised with the accessory lips. 41 extracted and osteotomy carried out extending the incision from the extracted site and osteotomy carried out. Dermoid cyst both below and above the mylohyoid muscle and rudimentary tongue found and excised and the specimen sent for histopathological examination. The wound was closed and uneventful healing noted to the satisfaction of the patient. This is a rare and interesting case which has been documented. PMID:23833508

  19. A scanning cavity microscope

    PubMed Central

    Mader, Matthias; Reichel, Jakob; Hänsch, Theodor W.; Hunger, David

    2015-01-01

    Imaging the optical properties of individual nanosystems beyond fluorescence can provide a wealth of information. However, the minute signals for absorption and dispersion are challenging to observe, and only specialized techniques requiring sophisticated noise rejection are available. Here we use signal enhancement in a high-finesse scanning optical microcavity to demonstrate ultra-sensitive imaging. Harnessing multiple interactions of probe light with a sample within an optical resonator, we achieve a 1,700-fold signal enhancement compared with diffraction-limited microscopy. We demonstrate quantitative imaging of the extinction cross-section of gold nanoparticles with a sensitivity less than 1 nm2; we show a method to improve the spatial resolution potentially below the diffraction limit by using higher order cavity modes, and we present measurements of the birefringence and extinction contrast of gold nanorods. The demonstrated simultaneous enhancement of absorptive and dispersive signals promises intriguing potential for optical studies of nanomaterials, molecules and biological nanosystems. PMID:26105690

  20. Altered srf expression in Bacillus subtilis resulting from changes in culture pH is dependent on the Spo0K oligopeptide permease and the ComQX system of extracellular control.

    PubMed

    Cosby, W M; Vollenbroich, D; Lee, O H; Zuber, P

    1998-03-01

    The expression of the srf operon of Bacillus subtilis, encoding surfactin synthetase and the competence regulatory protein ComS, was observed to be reduced when cells were grown in a rich glucose- and glutamine-containing medium in which late-growth culture pH was 5.0 or lower. The production of the surfactin synthetase subunits and of surfactin itself was also reduced. Raising the pH to near neutrality resulted in dramatic increases in srf expression and surfactin production. This apparent pH-dependent induction of srf expression required spo0K, which encodes the oligopeptide permease that functions in cell-density-dependent control of sporulation and competence, but not CSF, the competence-inducing pheromone that regulates srf expression in a Spo0K-dependent manner. Both ComP and ComA, the two-component regulatory pair that stimulates cell-density-dependent srf transcription, were required for optimal expression of srf at low and high pHs, but ComP was not required for pH-dependent srf induction. The known negative regulators of srf, RapC and CodY, were found not to function significantly in pH-dependent srf expression. Late-growth culture supernatants at low pH were not active in inducing srf expression in cells of low-density cultures but were rendered active when their pH was raised to near neutrality. ComQ (and very likely the srf-inducing pheromone ComX) and Spo0K were found to be required for the extracellular induction of srf-lacZ at neutral pH. The results suggest that srf expression, in response to changes in culture pH, requires Spo0K and another, as yet unidentified, extracellular factor. The study also provides evidence consistent with the hypothesis that ComP acts both positively and negatively in the regulation of ComA and that both activities are controlled by the ComX pheromone. PMID:9515911

  1. Trislot-cavity microstrip antenna

    NASA Technical Reports Server (NTRS)

    Ellis, H., Jr.

    1981-01-01

    Flush-mountable assembly composed of disk radiator sandwiched between planes of metal-clad dielectric board has greater bandwidths and beamwidths than simple disk antenna. Conducting planes connect so that disk is enclosed in cavity with Y-shaped slot in top plane. Cavity is excited by microwave energy from disk and radiates from trislot aperature.

  2. Study of Etching Pits in a Large-grain Single Cell Bulk Niobium Cavity

    SciTech Connect

    Zhao, Xin; Ciovati, Gianluigi; Reece, Charles E.; Wu, Andy T.

    2009-11-01

    Performance of SRF cavities are limited by non-linear localized effects. The variation of local material characters between "hot" and "cold" spots is thus of intense interest. Such locations were identified in a BCP-etched large-grain single-cell cavity and removed for examination by high resolution electron microscopy (SEM), electron-back scattering diffraction microscopy (EBSD), optical microscopy, and 3D profilometry. Pits with clearly discernable crystal facets were observed in both "hotspot" and "coldspot" specimens. The pits were found in-grain, at bi-crystal boundaries, and on tri-crystal junctions. They are interpreted as etch pits induced by surface crystal defects (e.g. dislocations). All "coldspots" examined had qualitatively low density of etching pits or very shallow tri-crystal boundary junction. EBSD revealed crystal structure surrounding the pits via crystal phase orientation mapping, while 3D profilometry gave information on the depth and size of the pits. In addition, a survey of the samples by energy dispersive X-ray analysis (EDX) did not show any significant contamination of the samples surface.

  3. Mechanical Properties of Niobium Cavities

    SciTech Connect

    Ciovati, Gianluigi; Dhakal, Pashupati; Matalevich, Joseph R.; Myneni, Ganapati Rao

    2015-09-01

    The mechanical stability of bulk Nb cavity is an important aspect to be considered in relation to cavity material, geometry and treatments. Mechanical properties of Nb are typically obtained from uniaxial tensile tests of small samples. In this contribution we report the results of measurements of the resonant frequency and local strain along the contour of single-cell cavities made of ingot and fine-grain Nb of different purity subjected to increasing uniform differential pressure, up to 6 atm. Measurements have been done on cavities subjected to different heat treatments. Good agreement between finite element analysis simulations and experimental data in the elastic regime was obtained with a single set of values of Young’s modulus and Poisson’s ratio. The experimental results indicate that the yield strength of medium-purity ingot Nb cavities is higher than that of fine-grain, high-purity Nb.

  4. Monochromatic radio frequency accelerating cavity

    DOEpatents

    Giordano, Salvatore

    1985-01-01

    A radio frequency resonant cavity having a fundamental resonant frequency and characterized by being free of spurious modes. A plurality of spaced electrically conductive bars are arranged in a generally cylindrical array within the cavity to define a chamber between the bars and an outer solid cylindrically shaped wall of the cavity. A first and second plurality of mode perturbing rods are mounted in two groups at determined random locations to extend radially and axially into the cavity thereby to perturb spurious modes and cause their fields to extend through passageways between the bars and into the chamber. At least one body of lossy material is disposed within the chamber to damp all spurious modes that do extend into the chamber thereby enabling the cavity to operate free of undesired spurious modes.

  5. Monochromatic radio frequency accelerating cavity

    DOEpatents

    Giordano, S.

    1984-02-09

    A radio frequency resonant cavity having a fundamental resonant frequency and characterized by being free of spurious modes. A plurality of spaced electrically conductive bars are arranged in a generally cylindrical array within the cavity to define a chamber between the bars and an outer solid cylindrically shaped wall of the cavity. A first and second plurality of mode perturbing rods are mounted in two groups at determined random locations to extend radially and axially into the cavity thereby to perturb spurious modes and cause their fields to extend through passageways between the bars and into the chamber. At least one body of lossy material is disposed within the chamber to damp all spurious modes that do extend into the chamber thereby enabling the cavity to operate free of undesired spurious modes.

  6. Changeability of Oral Cavity Environment

    PubMed Central

    Surdacka, Anna; Strzyka³a, Krystyna; Rydzewska, Anna

    2007-01-01

    Objectives In dentistry, the results of in vivo studies on drugs, dental fillings or prostheses are routinely evaluated based on selected oral cavity environment parameters at specific time points. Such evaluation may be confounded by ongoing changes in the oral cavity environment induced by diet, drug use, stress and other factors. The study aimed to confirm oral cavity environment changeability. Methods 24 healthy individuals aged 20–30 had their oral cavity environment prepared by having professional hygiene procedures performed and caries lesions filled. Baseline examination and the examination two years afterwards, evaluated clinical and laboratory parameters of oral cavity environment. Caries incidence was determined based on DMFT and DMFS values, oral cavity hygiene on Plaque Index (acc. Silness & Loe) and Hygiene Index (acc. O’Leary), and the gingival status on Gingival Index (acc. Loe & Silness) and Gingival Bleeding Index (acc. Ainamo & Bay). Saliva osmolarity, pH and concentrations of Ca2+, Pi, Na+, Cl−, total protein, albumins, F− and Sr2+ were determined. Results The results confirmed ongoing changeability of the oral cavity environment. After 2 years of the study reduction in oral cavity hygiene parameters PLI and HI (P<0.1), and gingival indices as well as lower saliva concentration of Ca2+ (P<.001), Pi (P<.06), K+ (P<.04), Sr2+ (P<.03), Na+ (P<.1), against the baseline values, were observed. Total protein and albumin saliva concentrations were also significantly lower. Conclusion Physiological oral cavity environment is subject to constant, individually different, changes which should be considered when analysing studies that employ oral cavity environment parameters. PMID:19212491

  7. Stages of Lip and Oral Cavity Cancer

    MedlinePlus

    ... Cavity and Oropharyngeal Cancer Screening Research Lip and Oral Cavity Cancer Treatment (PDQ®)–Patient Version General Information About Lip and Oral Cavity Cancer Go to Health Professional Version Key Points ...

  8. Upconversion-luminescent/magnetic dual-functional sub-20 nm core-shell SrF2:Yb,Tm@CaF2:Gd heteronanoparticles.

    PubMed

    Li, Ai-Hua; Lü, Mengyun; Yang, Jun; Chen, Lin; Cui, Xiaohong; Sun, Zhijun

    2016-04-01

    Sub-20 nm core-shell and water-soluble SrF2:Yb,Tm@CaF2:Gd heteronanoparticles with both upconversion luminescence (UCL) and magnetic resonance imaging (MRI) capabilities were designed and synthesized via a two-step hydrothermal method. In the design of the heteronanoparticles, SrF2:Yb,Tm nanoparticles with high UCL efficiency are chosen as the core material for strong UCL output; and by epitaxially coating the SrF2:Yb,Tm core particles with inert and biocompatible shells of CaF2:Gd, the core-shell heteronanoparticles are endowed with a magnetic capability (longitudinal relaxivity of 2.4 mM(-1) s(-1)) for MRI, as well as an enhancement of the near infrared (NIR) UCL by 9.2 times. The aqueous dispersion of SrF2:Yb,Tm@CaF2:Gd heteronanoparticles with a concentration of 2.6 wt% can emit NIR UCL so as to be easily detected with a fiber optical spectrometer under illumination of a 975 nm laser diode with a power density of 8.8 W cm(-2). Such a dispersion with a Gd(3+) concentration of 0.0143 mM in the shell region of the heteronanoparticles can also generate the detectable quickening of longitudinal relaxation. The results promise the strong potential of this nanomaterial for applications in bioimaging as a dual-functional probe. PMID:26934836

  9. Frequency-feedback cavity enhanced spectrometer

    DOEpatents

    Hovde, David Christian; Gomez, Anthony

    2015-08-18

    A spectrometer comprising an optical cavity, a light source capable of producing light at one or more wavelengths transmitted by the cavity and with the light directed at the cavity, a detector and optics positioned to collect light transmitted by the cavity, feedback electronics causing oscillation of amplitude of the optical signal on the detector at a frequency that depends on cavity losses, and a sensor measuring the oscillation frequency to determine the cavity losses.

  10. Superconducting Cavities for Proton and Ion Linacs

    SciTech Connect

    Jean Delayen

    2005-05-22

    In the last decade, one of the most active areas in the applications of the superconducting rf (SRF) technology has been for the acceleration of ions to medium energy ({approx}1 GeV/amu) and high power. One such accelerator is under construction in the US while others are being proposed in the US, Japan, and Europe. These new facilities require SRF accelerating structures operating in a velocity region that has until recently been unexplored, and new types of structures optimized for the velocity range from {approx}0.2 to {approx}0.8 c have been developed. We will review the requirements imposed by such applications, the properties of the low- and intermediate-velocity structures which have been developed for them and the status of their development.

  11. Composite resonator vertical cavity laser diode

    SciTech Connect

    Choquette, K.D.; Hou, H.Q.; Chow, W.W.; Geib, K.M.; Hammons, B.E.

    1998-05-01

    The use of two coupled laser cavities has been employed in edge emitting semiconductor lasers for mode suppression and frequency stabilization. The incorporation of coupled resonators within a vertical cavity laser opens up new possibilities due to the unique ability to tailor the interaction between the cavities. Composite resonators can be utilized to control spectral and temporal properties within the laser; previous studies of coupled cavity vertical cavity lasers have employed photopumped structures. The authors report the first composite resonator vertical cavity laser diode consisting of two optical cavities and three monolithic distributed Bragg reflectors. Cavity coupling effects and two techniques for external modulation of the laser are described.

  12. Characterization of etch pits found on a large-grain bulk niobium superconducting radio-frequency resonant cavity

    DOE PAGESBeta

    Zhao, Xin; Ciovati, G.; Bieler, T. R.

    2010-12-15

    The performance of superconducting radio-frequency (SRF) resonant cavities made of bulk niobium is limited by nonlinear localized effects. Surface analysis of regions of higher power dissipation is thus of intense interest. Such areas (referred to as “hotspots”) were identified in a large-grain single-cell cavity that had been buffered-chemical polished and dissected for examination by high resolution electron microscopy, electron backscattered diffraction microscopy (EBSD), and optical microscopy. Pits with clearly discernible crystal facets were observed in both “hotspot” and “coldspot” specimens. The pits were found in-grain, at bicrystal boundaries, and on tricrystal junctions. They are interpreted as etch pits induced bymore » crystal defects (e.g. dislocations). All coldspots examined had a qualitatively lower density of etch pits or relatively smooth tricrystal boundary junctions. EBSD mapping revealed the crystal orientation surrounding the pits. Locations with high pit density are correlated with higher mean values of the local average misorientation angle distributions, indicating a higher geometrically necessary dislocation content. In addition, a survey of the samples by energy dispersive x-ray analysis did not show any significant contamination of the samples’ surface. In conclusion, the local magnetic field enhancement produced by the sharp-edge features observed on the samples is not sufficient to explain the observed degradation of the cavity quality factor, which starts at peak surface magnetic field as low as 20 mT.« less

  13. Characterization of etch pits found on a large-grain bulk niobium superconducting radio-frequency resonant cavity

    SciTech Connect

    Zhao, Xin; Ciovati, G.; Bieler, T. R.

    2010-12-15

    The performance of superconducting radio-frequency (SRF) resonant cavities made of bulk niobium is limited by nonlinear localized effects. Surface analysis of regions of higher power dissipation is thus of intense interest. Such areas (referred to as “hotspots”) were identified in a large-grain single-cell cavity that had been buffered-chemical polished and dissected for examination by high resolution electron microscopy, electron backscattered diffraction microscopy (EBSD), and optical microscopy. Pits with clearly discernible crystal facets were observed in both “hotspot” and “coldspot” specimens. The pits were found in-grain, at bicrystal boundaries, and on tricrystal junctions. They are interpreted as etch pits induced by crystal defects (e.g. dislocations). All coldspots examined had a qualitatively lower density of etch pits or relatively smooth tricrystal boundary junctions. EBSD mapping revealed the crystal orientation surrounding the pits. Locations with high pit density are correlated with higher mean values of the local average misorientation angle distributions, indicating a higher geometrically necessary dislocation content. In addition, a survey of the samples by energy dispersive x-ray analysis did not show any significant contamination of the samples’ surface. In conclusion, the local magnetic field enhancement produced by the sharp-edge features observed on the samples is not sufficient to explain the observed degradation of the cavity quality factor, which starts at peak surface magnetic field as low as 20 mT.

  14. Progressive cavity pump

    SciTech Connect

    Mueller, J.W.

    1989-04-04

    A progressive cavity pump is described, comprising: a first housing portion defining an inlet; a second housing portion attachable to the first housing portion and defining an outlet; a substantially elastomeric stator comprising an outer portion removably attached to the first and second housing portions, having a first end and a second end spaced from the first end, an inner portion defining a pumping chamber and spaced an annular end portion interconnecting the first ends of the outer and inner portions; a rotor disposed in the inner portion of the stator and extending through the pumping chamber for pumping fluid from the inlet to the outlet in response to rotation of the rotor; and an elongated member disposed in the housing portions and generally annularly between the inner and outer portions of the stator and longitudinally between the annular end portion of the stator and a portion of the second housing portion, the member being removable from the housing portions and separable from the stator.

  15. Nonlocal Intracranial Cavity Extraction

    PubMed Central

    Manjón, José V.; Eskildsen, Simon F.; Coupé, Pierrick; Romero, José E.; Collins, D. Louis; Robles, Montserrat

    2014-01-01

    Automatic and accurate methods to estimate normalized regional brain volumes from MRI data are valuable tools which may help to obtain an objective diagnosis and followup of many neurological diseases. To estimate such regional brain volumes, the intracranial cavity volume (ICV) is often used for normalization. However, the high variability of brain shape and size due to normal intersubject variability, normal changes occurring over the lifespan, and abnormal changes due to disease makes the ICV estimation problem challenging. In this paper, we present a new approach to perform ICV extraction based on the use of a library of prelabeled brain images to capture the large variability of brain shapes. To this end, an improved nonlocal label fusion scheme based on BEaST technique is proposed to increase the accuracy of the ICV estimation. The proposed method is compared with recent state-of-the-art methods and the results demonstrate an improved performance both in terms of accuracy and reproducibility while maintaining a reduced computational burden. PMID:25328511

  16. Novel Crab Cavity RF Design

    SciTech Connect

    Dudas, A.; Neubauer, M. L.; Sah, R.; Rimmer, B.; Wang, H.

    2011-03-01

    A 20-50 MV integrated transverse voltage is required for the Electron-Ion Collider. The most promising of the crab cavity designs that have been proposed in the last five years are the TEM type crab cavities because of the higher transverse impedance. The TEM design approach is extended here to a hybrid crab cavity that includes the input power coupler as an integral part of the design. A prototype was built with Phase I monies and tested at JLAB. The results reported on, and a system for achieving 20-50 MV is proposed.

  17. Call for Papers: Cavity QED

    NASA Astrophysics Data System (ADS)

    Lange, W.; Gerard, J.-M.

    2003-06-01

    Cavity QED interactions of light and matter have been investigated in a wide range of systems covering the spectrum from microwaves to optical frequencies, using media as diverse as single atoms and semiconductors. Impressive progress has been achieved technologically as well as conceptually. This topical issue of Journal of Optics B: Quantum and Semiclassical Optics is intended to provide a comprehensive account of the current state of the art of cavity QED by uniting contributions from researchers active across this field. As Guest Editors of this topical issue, we invite manuscripts on current theoretical and experimental work on any aspects of cavity QED. The topics to be covered will include, but are not limited to: bulletCavity QED in optical microcavities bulletSemiconductor cavity QED bulletQuantum dot cavity QED bulletRydberg atoms in microwave cavities bulletPhotonic crystal cavity QED bulletMicrosphere resonators bulletMicrolasers and micromasers bulletMicrodroplets bulletDielectric cavity QED bulletCavity QED-based quantum information processing bulletQuantum state engineering in cavities The DEADLINE for submission of contributions is 31 July 2003 to allow the topical issue to appear in about February 2004. All papers will be peer-reviewed in accordance with the normal refereeing procedures and standards of Journal of Optics B: Quantum and Semiclassical Optics. Advice on publishing your work in the journal may be found at www.iop.org/journals/authors/jopb. Submissions should ideally be in either standard LaTeX form or Microsoft Word. There are no page charges for publication. In addition to the usual 50 free reprints, the corresponding author of each paper published will receive a complimentary copy of the topical issue. Contributions to the topical issue should if possible be submitted electronically at www.iop.org/journals/jopb. or by e-mail to jopb@iop.org. Authors unable to submit online or by e-mail may send hard copy contributions (enclosing the

  18. The Cardiac Transcription Network Modulated by Gata4, Mef2a, Nkx2.5, Srf, Histone Modifications, and MicroRNAs

    PubMed Central

    Zhang, Qin; Krueger, Tammo; Lange, Martin; Tönjes, Martje; Dunkel, Ilona; Sperling, Silke R.

    2011-01-01

    The transcriptome, as the pool of all transcribed elements in a given cell, is regulated by the interaction between different molecular levels, involving epigenetic, transcriptional, and post-transcriptional mechanisms. However, many previous studies investigated each of these levels individually, and little is known about their interdependency. We present a systems biology study integrating mRNA profiles with DNA–binding events of key cardiac transcription factors (Gata4, Mef2a, Nkx2.5, and Srf), activating histone modifications (H3ac, H4ac, H3K4me2, and H3K4me3), and microRNA profiles obtained in wild-type and RNAi–mediated knockdown. Finally, we confirmed conclusions primarily obtained in cardiomyocyte cell culture in a time-course of cardiac maturation in mouse around birth. We provide insights into the combinatorial regulation by cardiac transcription factors and show that they can partially compensate each other's function. Genes regulated by multiple transcription factors are less likely differentially expressed in RNAi knockdown of one respective factor. In addition to the analysis of the individual transcription factors, we found that histone 3 acetylation correlates with Srf- and Gata4-dependent gene expression and is complementarily reduced in cardiac Srf knockdown. Further, we found that altered microRNA expression in Srf knockdown potentially explains up to 45% of indirect mRNA targets. Considering all three levels of regulation, we present an Srf-centered transcription network providing on a single-gene level insights into the regulatory circuits establishing respective mRNA profiles. In summary, we show the combinatorial contribution of four DNA–binding transcription factors in regulating the cardiac transcriptome and provide evidence that histone modifications and microRNAs modulate their functional consequence. This opens a new perspective to understand heart development and the complexity cardiovascular disorders. PMID:21379568

  19. Structural and Functional Characterization of DUF1471 Domains of Salmonella Proteins SrfN, YdgH/SssB, and YahO

    PubMed Central

    Eletsky, Alexander; Michalska, Karolina; Houliston, Scott; Zhang, Qi; Daily, Michael D.; Xu, Xiaohui; Cui, Hong; Yee, Adelinda; Lemak, Alexander; Wu, Bin; Garcia, Maite; Burnet, Meagan C.; Meyer, Kristen M.; Aryal, Uma K.; Sanchez, Octavio; Ansong, Charles; Xiao, Rong; Acton, Thomas B.; Adkins, Joshua N.; Montelione, Gaetano T.; Joachimiak, Andrzej; Arrowsmith, Cheryl H.; Savchenko, Alexei; Szyperski, Thomas; Cort, John R.

    2014-01-01

    Bacterial species in the Enterobacteriaceae typically contain multiple paralogues of a small domain of unknown function (DUF1471) from a family of conserved proteins also known as YhcN or BhsA/McbA. Proteins containing DUF1471 may have a single or three copies of this domain. Representatives of this family have been demonstrated to play roles in several cellular processes including stress response, biofilm formation, and pathogenesis. We have conducted NMR and X-ray crystallographic studies of four DUF1471 domains from Salmonella representing three different paralogous DUF1471 subfamilies: SrfN, YahO, and SssB/YdgH (two of its three DUF1471 domains: the N-terminal domain I (residues 21–91), and the C-terminal domain III (residues 244–314)). Notably, SrfN has been shown to have a role in intracellular infection by Salmonella Typhimurium. These domains share less than 35% pairwise sequence identity. Structures of all four domains show a mixed α+β fold that is most similar to that of bacterial lipoprotein RcsF. However, all four DUF1471 sequences lack the redox sensitive cysteine residues essential for RcsF activity in a phospho-relay pathway, suggesting that DUF1471 domains perform a different function(s). SrfN forms a dimer in contrast to YahO and SssB domains I and III, which are monomers in solution. A putative binding site for oxyanions such as phosphate and sulfate was identified in SrfN, and an interaction between the SrfN dimer and sulfated polysaccharides was demonstrated, suggesting a direct role for this DUF1471 domain at the host-pathogen interface. PMID:25010333

  20. Novel Rho/MRTF/SRF Inhibitors Block Matrix-stiffness and TGF-β–Induced Fibrogenesis in Human Colonic Myofibroblasts

    PubMed Central

    Johnson, Laura A.; Rodansky, Eva S.; Haak, Andrew J.; Larsen, Scott D.; Neubig, Richard R.; Higgins, Peter D. R.

    2016-01-01

    Background Ras homolog gene family, member A (RhoA)/Rho-associated coiled-coil forming protein kinase signaling is a key pathway in multiple types of solid organ fibrosis, including intestinal fibrosis. However, the pleiotropic effects of RhoA/Rho-associated coiled-coil forming protein kinase signaling have frustrated targeted drug discovery efforts. Recent recognition of the role of Rho-regulated gene transcription by serum response factor (SRF) and its transcriptional cofactor myocardin-related transcription factor A (MRTF-A) suggest a novel locus for pharmacological intervention. Methods Because RhoA signaling is mediated by both physical and biochemical stimuli, we examined whether pharmacological inhibition of RhoA or the downstream transcription pathway of MRTF-A/SRF could block intestinal fibrogenesis in 2 in vitro models. Results In this study, we demonstrate that inhibition of RhoA signaling blocks both matrix-stiffness and transforming growth factor beta–induced fibrogenesis in human colonic myofibroblasts. Repression of alpha-smooth muscle actin and collagen expression was associated with the inhibition of MRTF-A nuclear localization. CCG-1423, a first-generation Rho/MRTF/SRF pathway inhibitor, repressed fibrogenesis in both models, yet has unacceptable cytotoxicity. Novel second-generation inhibitors (CCG-100602 and CCG-203971) repressed both matrix-stiffness and transforming growth factor beta–mediated fibrogenesis as determined by protein and gene expression in a dose-dependent manner. Conclusions Targeting the Rho/MRTF/SRF mechanism with second-generation Rho/MRTF/SRF inhibitors may represent a novel approach to antifibrotic therapeutics. PMID:24280883