Science.gov

Sample records for 5s clavam biosynthesis

  1. 5S Clavam Biosynthesis Is Controlled by an Atypical Two-Component Regulatory System in Streptomyces clavuligerus

    PubMed Central

    Kwong, Thomas; Zelyas, Nathan J.; Cai, Hui; Tahlan, Kapil; Wong, Annie

    2012-01-01

    Streptomyces clavuligerus produces a collection of five clavam metabolites, including the clinically important β-lactamase inhibitor clavulanic acid, as well as four structurally related metabolites called 5S clavams. The paralogue gene cluster of S. clavuligerus is one of three clusters of genes for the production of these clavam metabolites. A region downstream of the cluster was analyzed, and snk, res1, and res2, encoding elements of an atypical two-component regulatory system, were located. Mutation of any one of the three genes had no effect on clavulanic acid production, but snk and res2 mutants produced no 5S clavams, whereas res1 mutants overproduced 5S clavams. Reverse transcriptase PCR analyses showed that transcription of cvm7p (which encodes a transcriptional activator of 5S clavam biosynthesis) and 5S clavam biosynthetic genes was eliminated in snk and in res2 mutants but that snk and res2 transcription was unaffected in a cvm7p mutant. Both snk and res2 mutants could be complemented by introduction of cvm7p under the control of an independently regulated promoter. In vitro assays showed that Snk can autophosphorylate and transfer its phosphate group to both Res1 and Res2, and Snk-H365, Res1-D52, and Res2-D52 were identified as the phosphorylation sites for the system. Dephosphorylation assays indicated that Res1 stimulates dephosphorylation of Res2∼P. These results suggest a regulatory cascade in which Snk and Res2 form a two-component system controlling cvm7p transcription, with Res1 serving as a checkpoint to modulate phosphorylation levels. Cvm7P then activates transcription of 5S clavam biosynthetic genes. PMID:22751548

  2. Inversion of the stereochemical configuration (3S, 5S)-clavaminic acid into (3R, 5R)-clavulanic acid: A computationally-assisted approach based on experimental evidence.

    PubMed

    Ramirez-Malule, Howard; Restrepo, Albeiro; Cardona, Wilson; Junne, Stefan; Neubauer, Peter; Rios-Estepa, Rigoberto

    2016-04-21

    Clavulanic acid (CA), a potent inhibitor of β-lactamase enzymes, is produced by Streptomyces clavuligerus (Sc) cultivation processes, for which low yields are commonly obtained. Improved knowledge of the clavam biosynthetic pathway, especially the steps involved in the inversion of 3S-5S into 3R-5R stereochemical configuration, would help to eventually identify bottlenecks in the pathway. In this work, we studied the role of acetate in CA biosynthesis by a combined continuous culture and computational simulation approach. From this we derived a new model for the synthesis of N-acetyl-glycyl-clavaminic acid (NAG-clavam) by Sc. Acetylated compounds, such as NAG-clavam and N-acetyl-clavaminic acid, have been reported in the clavam pathway. Although the acetyl group is present in the β-lactam intermediate NAG-clavam, it is unknown how this group is incorporated. Hence, under the consideration of the experimentally proven accumulation of acetate during CA biosynthesis, and the fact that an acetyl group is present in the NAG-clavam structure, a computational evaluation of the tentative formation of NAG-clavam was performed for the purpose of providing further understanding. The proposed reaction mechanism consists of two steps: first, acetate reacts with ATP to produce a reactive acylphosphate intermediate; second, a direct nucleophilic attack of the terminal amino group of N-glycyl-clavaminic on the carbonyl carbon of the acylphosphate intermediate leads to a tetrahydral intermediate, which collapses and produces ADP and N-acetyl-glycyl-clavaminic acid. The calculations suggest that for the proposed reaction mechanism, the reaction proceeds until completion of the first step, without the direct action of an enzyme, where acetate and ATP are involved. For this step, the computed activation energy was ≅2.82kcal/mol while the reaction energy was ≅2.38kcal/mol. As this is an endothermic chemical process with a relatively small activation energy, the reaction rate

  3. Chaperoning 5S RNA assembly

    PubMed Central

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-01-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998

  4. β-Lactam formation by a non-ribosomal peptide synthetase during antibiotic biosynthesis

    PubMed Central

    Gaudelli, Nicole M.; Long, Darcie H.; Townsend, Craig A.

    2014-01-01

    Non-ribosomal peptide synthetases (NRPSs) are giant enzymes comprised of modules that house repeated sets of functional domains, which select, activate and couple amino acids drawn from a pool of nearly 500 potential building blocks.1 The structurally and stereochemically diverse peptides generated in this manner underlie the biosynthesis of a large sector of natural products. Many of their derived metabolites are bioactive such as the antibiotics vancomycin, bacitracin, daptomycin and the β-lactam-containing penicillins, cephalosporins and nocardicins. Although penicillins and cephalosporins are synthesised from a classically derived NRPS tripeptide (from ACVS, δ-(L-α-aminoadipyl)–L-cysteinyl–D-valine synthetase)2, we now report an unprecedented NRPS activity to both assemble a serine-containing peptide and mediate its cyclisation to the critical β-lactam ring of the nocardicin family of antibiotics. A histidine-rich condensation (C) domain, which typically carries out peptide bond formation during product assembly, was found to also synthesise the embedded 4-membered ring. Here, a mechanism is proposed and supporting experiments are described, which is distinct from the pathways that have evolved to the three other β-lactam antibiotic families: penicillin/cephalosporins, clavams and carbapenems. These findings raise the possibility that β-lactam rings can be regio- and stereospecifically integrated into engineered peptides for application as, for example, targeted protease inactivators.3,4 PMID:25624104

  5. Auxin biosynthesis.

    PubMed

    Zhao, Yunde

    2014-01-01

    lndole-3-acetic acid (IAA), the most important natural auxin in plants, is mainly synthesized from the amino acid tryptophan (Trp). Recent genetic and biochemical studies in Arabidopsis have unambiguously established the first complete Trp-dependent auxin biosynthesis pathway. The first chemical step of auxin biosynthesis is the removal of the amino group from Trp by the TRYPTOPHAN AMINOTRANSFERASE OF ARABIDOPSIS (TAA) family of transaminases to generate indole-3-pyruvate (IPA). IPA then undergoes oxidative decarboxylation catalyzed by the YUCCA (YUC) family of flavin monooxygenases to produce IAA. This two-step auxin biosynthesis pathway is highly conserved throughout the plant kingdom and is essential for almost all of the major developmental processes. The successful elucidation of a complete auxin biosynthesis pathway provides the necessary tools for effectively modulating auxin concentrations in plants with temporal and spatial precision. The progress in auxin biosynthesis also lays a foundation for understanding polar auxin transport and for dissecting auxin signaling mechanisms during plant development. PMID:24955076

  6. Auxin Biosynthesis

    PubMed Central

    Zhao, Yunde

    2014-01-01

    lndole-3-acetic acid (IAA), the most important natural auxin in plants, is mainly synthesized from the amino acid tryptophan (Trp). Recent genetic and biochemical studies in Arabidopsis have unambiguously established the first complete Trp-dependent auxin biosynthesis pathway. The first chemical step of auxin biosynthesis is the removal of the amino group from Trp by the TRYPTOPHAN AMINOTRANSFERASE OF ARABIDOPSIS (TAA) family of transaminases to generate indole-3-pyruvate (IPA). IPA then undergoes oxidative decarboxylation catalyzed by the YUCCA (YUC) family of flavin monooxygenases to produce IAA. This two-step auxin biosynthesis pathway is highly conserved throughout the plant kingdom and is essential for almost all of the major developmental processes. The successful elucidation of a complete auxin biosynthesis pathway provides the necessary tools for effectively modulating auxin concentrations in plants with temporal and spatial precision. The progress in auxin biosynthesis also lays a foundation for understanding polar auxin transport and for dissecting auxin signaling mechanisms during plant development. PMID:24955076

  7. Oligomeric structure of proclavaminic acid amidino hydrolase: evolution of a hydrolytic enzyme in clavulanic acid biosynthesis.

    PubMed Central

    Elkins, Jonathan M; Clifton, Ian J; Hernández, Helena; Doan, Linh X; Robinson, Carol V; Schofield, Christopher J; Hewitson, Kirsty S

    2002-01-01

    During biosynthesis of the clinically used beta-lactamase inhibitor clavulanic acid, one of the three steps catalysed by clavaminic acid synthase is separated from the other two by a step catalysed by proclavaminic acid amidino hydrolase (PAH), in which the guanidino group of an intermediate is hydrolysed to give proclavaminic acid and urea. PAH shows considerable sequence homology with the primary metabolic arginases, which hydrolyse arginine to ornithine and urea, but does not accept arginine as a substrate. Like other members of the bacterial sub-family of arginases, PAH is hexameric in solution and requires Mn2+ ions for activity. Other metal ions, including Co2+, can substitute for Mn2+. Two new substrates for PAH were identified, N-acetyl-(L)-arginine and (3R)-hydroxy-N-acetyl-(L)-arginine. Crystal structures of PAH from Streptomyces clavuligerus (at 1.75 A and 2.45 A resolution, where 1 A=0.1 nm) imply how it binds beta-lactams rather than the amino acid substrate of the arginases from which it evolved. The structures also suggest how PAH selects for a particular alcohol intermediate in the clavam biosynthesis pathway. As observed for the arginases, each PAH monomer consists of a core of beta-strands surrounded by alpha-helices, and its active site contains a di-Mn2+ centre with a bridging water molecule responsible for hydrolytic attack on to the guanidino group of the substrate. Comparison of structures obtained under different conditions reveals different conformations of a flexible loop, which must move to allow substrate binding. PMID:12020346

  8. Oxytetracycline Biosynthesis*

    PubMed Central

    Pickens, Lauren B.; Tang, Yi

    2010-01-01

    Oxytetracycline (OTC) is a broad-spectrum antibiotic that acts by inhibiting protein synthesis in bacteria. It is an important member of the bacterial aromatic polyketide family, which is a structurally diverse class of natural products. OTC is synthesized by a type II polyketide synthase that generates the poly-β-ketone backbone through successive decarboxylative condensation of malonyl-CoA extender units, followed by modifications by cyclases, oxygenases, transferases, and additional tailoring enzymes. Genetic and biochemical studies have illuminated most of the steps involved in the biosynthesis of OTC, which is detailed here as a representative case study in type II polyketide biosynthesis. PMID:20522541

  9. Two thraustochytrid 5S ribosomal RNAs.

    PubMed Central

    MacKay, R M; Doolittle, W F

    1982-01-01

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  10. Two thraustochytrid 5S ribosomal RNAs.

    PubMed

    MacKay, R M; Doolittle, W F

    1982-12-20

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  11. The 5S genes of Drosophila melanogaster.

    PubMed

    Artavanis-Tsakonas, S; Schedl, P; Tschudi, C; Pirrotta, V; Steward, R; Gehring, W J

    1977-12-01

    We have cloned embryonic Drosophila DNA using the poly (dA-DT) connector method (Lobban and Kaiser, 1973) and the ampicillin-resistant plasmid pSF2124 (So, Gill and Falkow, 1975) as a cloning vehicle. Two clones, containing hybrid plasmids with sequences complementary to a 5S RNA probe isolated from Drosophila tissue culture cells, were identified by the Grunstein and Hogness (1975) colony hybridization procedure. One hybrid plasmid has a Drosophila insert which is comprised solely of tandem repeats of the 5S gene plus spacer sequences. The other plasmid contains an insert which has about 20 tandem 5S repeat units plus an additional 4 kilobases of adjacent sequences. The size of the 5S repeat unit was determined by gel electrophoresis and was found to be approximately 375 base pairs. We present a restriction map of both plasmids, and a detailed map of of the5S repeat unit. The 5S repat unit shows slight length and sequence heterogeneity. We present evidence suggesting that the 5S genes in Drosophila melanogaster may be arranged in a single continuous cluster. PMID:413625

  12. Analysis of the 5S RNA pool in Arabidopsis thaliana: RNAs are heterogeneous and only two of the genomic 5S loci produce mature 5S RNA.

    PubMed

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5'- and 3'-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array. PMID:11779838

  13. Analysis of the 5S RNA Pool in Arabidopsis thaliana: RNAs Are Heterogeneous and Only Two of the Genomic 5S Loci Produce Mature 5S RNA

    PubMed Central

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5′- and 3′-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array. [EMBL accession nos: AF330825-AF331032; AF335777-AF335873.] PMID:11779838

  14. Compilation of 5S rRNA and 5S rRNA gene sequences

    PubMed Central

    Specht, Thomas; Wolters, Jörn; Erdmann, Volker A.

    1990-01-01

    The BERLIN RNA DATABANK as of Dezember 31, 1989, contains a total of 667 sequences of 5S rRNAs or their genes, which is an increase of 114 new sequence entries over the last compilation (1). It covers sequences from 44 archaebacteria, 267 eubacteria, 20 plastids, 6 mitochondria, 319 eukaryotes and 11 eukaryotic pseudogenes. The hardcopy shows only the list (Table 1) of those organisms whose sequences have been determined. The BERLIN RNA DATABANK uses the format of the EMBL Nucleotide Sequence Data Library complemented by a Sequence Alignment (SA) field including secondary structure information. PMID:1692116

  15. Regulation of Arabidopsis thaliana 5S rRNA Genes.

    PubMed

    Vaillant, Isabelle; Tutois, Sylvie; Cuvillier, Claudine; Schubert, Ingo; Tourmente, Sylvette

    2007-05-01

    The Arabidopsis thaliana genome comprises around 1,000 copies of 5S rRNA genes encoding both major and minor 5S rRNAs. In mature wild-type leaves, the minor 5S rRNA genes are silent. Using different mutants of DNA methyltransferases (met1, cmt3 and met1 cmt3), components of the RNAi pathway (ago4) or post-translational histone modifier (hda6/sil1), we show that the corresponding proteins are needed to maintain proper methylation patterns at heterochromatic 5S rDNA repeats. Using reverse transcription-PCR and cytological analyses, we report that a decrease of 5S rDNA methylation at CG or CNG sites in these mutants leads to the release of 5S rRNA gene silencing which occurred without detectable changes of the 5S rDNA chromatin structure. In spite of severely reduced DNA methylation, the met1 cmt3 double mutant revealed no increase in minor 5S rRNA transcripts. Furthermore, the release of silencing of minor 5S rDNAs can be achieved without increased formation of euchromatic loops by 5S rDNA, and is independent from the global heterochromatin content. Additionally, fluorescence in situ hybridization with centromeric 180 bp repeats confirmed that these highly repetitive sequences, in spite of their elevated transcriptional activity in the DNA methyltransferase mutants (met1, cmt3 and met1 cmt3), remain within chromocenters of the mutant nuclei. PMID:17412735

  16. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    NASA Technical Reports Server (NTRS)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  17. Mouse Oocytes Transcribe Injected Xenopus 5S RNA Gene

    PubMed Central

    Brinster, Ralph L.; Chen, Howard Y.; Trumbauer, Myrna E.

    2016-01-01

    Transcripts produced after injection of the Xenopus 5S RNA gene into oocyte germinal vesicles of mice migrate electrophoretically with the 5S RNA marker, an indication that the gene is transcribed and processed with considerable accuracy, Approximately two 5S RNA molecules are transcribed per gene per hour. This system may be useful in studying DNA processing and gene regulation by the mammalian ovum and might be modified to allow permanent incorporation of specific genes into mice. PMID:7194505

  18. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  19. 5SRNAdb: an information resource for 5S ribosomal RNAs

    PubMed Central

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A.; Karlowski, Wojciech M.

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA–protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  20. Keratan Sulfate Biosynthesis

    PubMed Central

    Funderburgh, James L.

    2010-01-01

    Summary Keratan sulfate was originally identified as the major glycosaminoglycan of cornea but is now known to modify at least a dozen different proteins in a wide variety of tissues. Despite a large body of research documenting keratan sulfate structure, and an increasing interest in the biological functions of keratan sulfate, until recently little was known of the specific enzymes involved in keratan sulfate biosynthesis or of the molecular mechanisms that control keratan sulfate expression. In the last 2 years, however, marked progress has been achieved in identification of genes involved in keratan sulfate biosynthesis and in development of experimental conditions to study keratan sulfate secretion and control in vitro. This review summarizes current understanding of keratan sulfate structure and recent developments in understanding keratan sulfate biosynthesis. PMID:12512857

  1. Mammalian cardiolipin biosynthesis.

    PubMed

    Mejia, Edgard M; Nguyen, Hieu; Hatch, Grant M

    2014-04-01

    Cardiolipin is a major phospholipid in mitochondria and is involved in the generation of cellular energy in the form of ATP. In mammalian and eukaryotic cells it is synthesized via the cytidine-5'-diphosphate-1,2-diacyl-sn-glycerol phosphate pathway. This brief review will describe some of the more recent studies on mammalian cardiolipin biosynthesis and provide an overview of regulation of cardiolipin biosynthesis. In addition, the important role that this key phospholipid plays in disease processes including heart failure, diabetes, thyroid hormone disease and the genetic disease Barth Syndrome will be discussed. PMID:24144810

  2. 5S RNA sequence from the Philosamia silkworm: evidence for variable evolutionary rates in insect 5S RNA.

    PubMed Central

    Xian-Rong, G; Nicoghosian, K; Cedergren, R J

    1982-01-01

    The primary structure of 5S RNA isolated from the posterior silkgland of Philosamia cynthia ricini was determined using three in vitro labelling techniques. The derived sequence consists of 119 nucleotides and can be folded into the secondary structure model proposed for eukaryotic 5S RNAs. This 5S RNA differs from the Bombyx mori molecule in 9 positions and from the Drosophila melanogaster sequence in 14 positions. The comparison of evolutionary rates in insect 5S RNA with inferred rates in other eukaryotic phyla leads to the conclusion that 5S RNA evolution is not constant in different eukaryotic branches, a condition which must be taken into account in phylogenetic tree constructions. Images PMID:7145713

  3. [Organization of 5S ribosomal DNA of Melitaea trivia].

    PubMed

    Cherevatov, O V; Volkov, R A

    2011-01-01

    Two length variants of 5S rDNA repeated units were detected in the genome of East European butterfly Melitaea trivia. Both repeat variants contain the 5S rRNA coding region of the same length of 120 bp, but possess the intergenic spacer region (IGS) of different size, 78 and 125 bp, respectively. The level of sequence similarity between the two 5S rDNA variants amounts to 43.9-45.5% in the IGS, whereas the coding region appears to be more conservative. In the IGS, microsatellite sequence motives were found; amplification of these motives could be involved in the evolution of the 5S rDNA. PMID:21574431

  4. Biosynthesis of Polyisoprenoids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The invention is a process for synthesis of a polymer with the same chemical structure as Natural Rubber (NR) obtained from Hevea brasiliensis and other plant species. The research collaborators recently proposed that NR biosynthesis proceeds via a carbocationic polymerization. Based on this theory...

  5. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  6. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  7. Analyzing Digital Library Initiatives: 5S Theory Perspective

    ERIC Educational Resources Information Center

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko

    2015-01-01

    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  8. Carnitine biosynthesis in mammals.

    PubMed Central

    Vaz, Frédéric M; Wanders, Ronald J A

    2002-01-01

    Carnitine is indispensable for energy metabolism, since it enables activated fatty acids to enter the mitochondria, where they are broken down via beta-oxidation. Carnitine is probably present in all animal species, and in numerous micro-organisms and plants. In mammals, carnitine homoeostasis is maintained by endogenous synthesis, absorption from dietary sources and efficient tubular reabsorption by the kidney. This review aims to cover the current knowledge of the enzymological, molecular, metabolic and regulatory aspects of mammalian carnitine biosynthesis, with an emphasis on the human and rat. PMID:11802770

  9. Physical studies of 5S RNA variants at position 66.

    PubMed Central

    Zhang, P; Popieniek, P; Moore, P B

    1989-01-01

    Two variants of the 5S RNA of E. coli have been examined by imino proton NMR spectroscopy, one of them a deletion of A66 (Christiansen, J., Douthwaite, S.R., Christensen, A. and Garrett, R.A. (1985) EMBO J. 4, 1019-1024) and the other a replacement of A66 with a C (Goringer, H.U. and Wagner, R. (1986) Biol. Chem. Hoppe-Seyler 367, 769-780). Both are of interest because the role the bulged A in helix II of 5S RNA is supposed to play in interactions with ribosomal protein L18. The data show that the structural perturbations that result from these mutations are minimal, and assign the resonances of some of the imino protons around position 66. Some mutations at or near position 66 greatly reduce the L18-dependent increase in the circular dichroism of 5S RNA at 267 nm first observed by Bear and coworkers (Bear, D.G., Schleich, T., Noller, H.F. and Garrett, R.A. (1977) Nucl. Acids Res. 4, 2511-2526). PMID:2479908

  10. Terpene Biosynthesis: Modularity Rules

    PubMed Central

    Oldfield, Eric; Lin, Fu-Yang

    2013-01-01

    Terpenes are the largest class of small molecule natural products on Earth, and the most abundant by mass. Here, we summarize recent developments in elucidating the structure and function of the proteins involved in their biosynthesis. There are 6 main building blocks or modules (α,β,γ,δ,ε and ζ) that make up the structures of these enzymes: the αα and αδ head-to-tail trans-prenyl transferases that produce trans-isoprenoid diphosphates from C5 precursors; the ε head-to-head prenyl transferases that convert these diphosphates into the tri-and tetra-terpene precursors of sterols, hopanoids and carotenoids; the βγ di- and tri-terpene synthases; the ζ head-to-tail cis-prenyl transferases that produce the cis-isoprenoid diphosphates involved in bacterial cell wall biosynthesis, and finally the α, αβ and αβγ terpene synthases that produce plant terpenes, with many of these modular enzymes having originated from ancestral α and β domain proteins. We also review progress in determining the structure and function of the two 4Fe-4S reductases involved in formation of the C5 diphosphates in many bacteria, where again, highly modular structures are found. PMID:22105807

  11. Taxol biosynthesis: an update.

    PubMed

    Hezari, M; Croteau, R

    1997-08-01

    The novel diterpenoid taxol (paclitaxel) is now well-established as a potent chemotherapeutic agent. Total synthesis of the drug is not commercially feasible and, in the foreseeable future, the supply of taxol and its synthetically useful progenitors must rely on biological methods of production. The first three steps of taxol biosynthesis have been defined and the responsible enzymes described. These are the cyclization of the universal diterpenoid precursor geranylgeranyl diphosphate to taxa-4(5),11(12)-diene, the cytochrome P450-catalyzed hydroxylation of this olefin to taxa-4(20), 11(12)-dien-5 alpha-ol, and the acetyl CoA-dependent conversion of the alcohol to the corresponding acetate ester. Demonstration of these early steps of taxol biosynthesis suggests that the complete pathway can be defined by a systematic, stepwise approach at the cell-free enzyme level. When combined with in vivo studies to determine contribution to pathway flux, slow steps can be targeted for gene isolation and subsequent overexpression in Taxus to improve the yield of taxol and related compounds. PMID:9270370

  12. Biosynthesis of cylindrospermopsin.

    PubMed

    Burgoyne, D L; Hemscheidt, T K; Moore, R E; Runnegar, M T

    2000-01-14

    Studies on the biosynthesis of cylindrospermopsin (1), a potent hepatotoxin associated with the cyanobacterium Cylindrospermopsis raciborskii, indicate that 1 is an acetogenin with guanidinoacetic acid serving as the starter unit of the polyketide chain. Feeding experiments show that C14 and C15 of 1 are derived from C1 and C2 of glycine, respectively, and C4 through C13 arise from five contiguous acetate units attached head to tail. The methyl carbon on C13 originates from the C(1) pool. The starter unit, established by the incorporation of [guanidino-(13)C,alpha-(15)N]-guanidinoacetic acid into N16 and C17 of 1, does not appear to be formed from glycine by known amidination pathways. The origin of the NH-CO-NH segment in the uracil ring is also unknown. PMID:10813909

  13. Biosynthesis of plant sulfolipids

    SciTech Connect

    Kleppinger-Sparace, K.; Mudd, J.B.; Sparace, S. )

    1989-04-01

    The complete biosynthesis of sulfoquinovosyldiacylglycerol (SQDG) remains undetermined although dark synthesis of SQDG by chloroplasts supplied with AP{sup 35}S, PAP{sup 35}S or {sup 35}SO{sub 4} plus ATP suggests the sulfur moiety arises from either APS or sulfite (1). Sulfate incorporation into sulfolipids in isolated chloroplasts and in intact roots is reported here and compared to lipids labelled by {sup 14}C-acetate or {sup 14}C-glycerol. Several unknown {sup 35}S-labelled chloroform-soluble compounds were isolated from sterile roots. These {sup 35}S-labelled compounds differ from those of the chloroplast, identified as elemental sulfur forms. Identification of the unknown root compounds is in progress. Unlike chloroplast, isolated root plastids do not synthesis SQDG from sulfate plus ATP suggesting a requirement for an activated form of sulfate, such as APS or PAPS.

  14. Designer microbes for biosynthesis

    PubMed Central

    Quin, Maureen B.; Schmidt-Dannert, Claudia

    2014-01-01

    Microbes have long been adapted for the biosynthetic production of useful compounds. There is increasing demand for the rapid and cheap microbial production of diverse molecules in an industrial setting. Microbes can now be designed and engineered for a particular biosynthetic purpose, thanks to recent developments in genome sequencing, metabolic engineering, and synthetic biology. Advanced tools exist for the genetic manipulation of microbes to create novel metabolic circuits, making new products accessible. Metabolic processes can be optimized to increase yield and balance pathway flux. Progress is being made towards the design and creation of fully synthetic microbes for biosynthetic purposes. Together, these emerging technologies will facilitate the production of designer microbes for biosynthesis. PMID:24646570

  15. Serine biosynthesis and transport defects.

    PubMed

    El-Hattab, Ayman W

    2016-07-01

    l-serine is a non-essential amino acid that is biosynthesized via the enzymes phosphoglycerate dehydrogenase (PGDH), phosphoserine aminotransferase (PSAT), and phosphoserine phosphatase (PSP). Besides its role in protein synthesis, l-serine is a potent neurotrophic factor and a precursor of a number of essential compounds including phosphatidylserine, sphingomyelin, glycine, and d-serine. Serine biosynthesis defects result from impairments of PGDH, PSAT, or PSP leading to systemic serine deficiency. Serine biosynthesis defects present in a broad phenotypic spectrum that includes, at the severe end, Neu-Laxova syndrome, a lethal multiple congenital anomaly disease, intermediately, infantile serine biosynthesis defects with severe neurological manifestations and growth deficiency, and at the mild end, the childhood disease with intellectual disability. A serine transport defect resulting from deficiency of the ASCT1, the main transporter for serine in the central nervous system, has been recently described in children with neurological manifestations that overlap with those observed in serine biosynthesis defects. l-serine therapy may be beneficial in preventing or ameliorating symptoms in serine biosynthesis and transport defects, if started before neurological damage occurs. Herein, we review serine metabolism and transport, the clinical, biochemical, and molecular aspects of serine biosynthesis and transport defects, the mechanisms of these diseases, and the potential role of serine therapy. PMID:27161889

  16. BIOSYNTHESIS OF STRESS ETHYLENE IN SOYBEAN SEEDLINGS: SIMILARITIES TO ENDOGENOUS ETHYLENE BIOSYNTHESIS

    EPA Science Inventory

    The similarity of stress ethylene biosynthesis in whole plants to endogenous ethylene biosynthesis was investigated using two inhibitors of ethylene biosynthesis, amino-ethoxyvinylglycine (AVG) and cobalt chloride (Co2+); and the intermediates, methionine, S-adenosylmethionine (S...

  17. Stereoselectivity in Polyphenol Biosynthesis

    NASA Technical Reports Server (NTRS)

    Lewis, Norman G.; Davin, Laurence B.

    1992-01-01

    Stereoselectivity plays an important role in the late stages of phenyl-propanoid metabolism, affording lignins, lignans, and neolignans. Stereoselectivity is manifested during monolignol (glucoside) synthesis, e.g., where the geometry (E or Z) of the pendant double bond affects the specificity of UDPG:coniferyl alcohol glucosyltransferases in different species. Such findings are viewed to have important ramifications in monolignol transport and storage processes, with roles for both E- and Z-monolignols and their glucosides in lignin/lignan biosynthesis being envisaged. Stereoselectivity is also of great importance in enantiose-lective enzymatic processes affording optically active lignans. Thus, cell-free extracts from Forsythia species were demonstrated to synthesize the enantiomerically pure lignans, (-)-secoisolariciresinol, and (-)-pinoresinol, when NAD(P)H, H2O2 and E-coniferyl alcohol were added. Progress toward elucidating the enzymatic steps involved in such highly stereoselective processes is discussed. Also described are preliminary studies aimed at developing methodologies to determine the subcellular location of late-stage phenylpropanoid metabolites (e.g., coniferyl alcohol) and key enzymes thereof, in intact tissue or cells. This knowledge is essential if questions regarding lignin and lignan tissue specificity and regulation of these processes are to be deciphered.

  18. Biosynthesis of Dolichyl Phosphate

    PubMed Central

    Hopp, H. Esteban; Daleo, Gustavo R.; Romero, Pedro A.; Lezica, Rafael Pont

    1978-01-01

    This is the first report not only on the presence of polyprenyl phosphates and their site of synthesis in algae, but also on the formation of their sugar derivatives in this system. A glucose acceptor lipid was isolated from the nonphotosynthetic alga Prototheca zopfii. The lipid was acidic and resistant to mild acid and alkaline treatments. The glucosylated lipid was labile to mild acid hydrolysis and resistant to phenol treatment and catalytic hydrogenation, as dolichyl phosphate glucose is. These results are consistent with the properties of an α-saturated polyprenyl phosphate. The polyprenylic nature of the lipid was confirmed by biosynthesis from radioactive mevalonate. The [14C]lipid had the same chromatographic properties as dolichyl phosphate in DEAE-cellulose and Sephadex LH-20. Strong alkaline treatment and enzymic hydrolysis liberated free alcohols with chain lengths ranging from C90 to C105, C95 and C100 being the most abundant molecular forms. The glucose acceptor activity of the biosynthesized polyprenyl phosphate was confirmed. The ability of different subcellular fractions to synthesize dolichyl phosphate was studied. Mitochondria and the Golgi apparatus were the sites of dolichyl phosphate synthesis from mevalonate. PMID:16660269

  19. Auxin biosynthesis and storage forms

    PubMed Central

    Strader, Lucia C.

    2013-01-01

    The plant hormone auxin drives plant growth and morphogenesis. The levels and distribution of the active auxin indole-3-acetic acid (IAA) are tightly controlled through synthesis, inactivation, and transport. Many auxin precursors and modified auxin forms, used to regulate auxin homeostasis, have been identified; however, very little is known about the integration of multiple auxin biosynthesis and inactivation pathways. This review discusses the many ways auxin levels are regulated through biosynthesis, storage forms, and inactivation, and the potential roles modified auxins play in regulating the bioactive pool of auxin to affect plant growth and development. PMID:23580748

  20. Alternate biosynthesis of valerenadiene and related sesquiterpenes.

    PubMed

    Paknikar, Shashikumar K; Kadam, Shahuraj H; Ehrlich, April L; Bates, Robert B

    2013-09-01

    It is proposed that the biosynthesis of the sesquiterpene valerenadiene, a key intermediate in the biosynthesis of a sedative in valerian, involves cyclopropane and not cyclobutane intermediates and includes as a key step a cyclopropylcarbinylcation-cyclopropylcarbinylcation rearrangement analogous to the one observed in the conversion of presqualene to squalene in triterpene and steroid biosynthesis. Similar mechanisms are proposed for the biosynthesis of the related sesquiterpenes pacifigorgiol, tamariscene and (+)-pacifigorgia-1,10-diene. PMID:24273843

  1. The Evolution of Aflatoxin Biosynthesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The biosynthesis of aflatoxin (AF) involves over 20 enzymatic reactions in a complex polyketide pathway that converts acetate and malonate to the intermediates sterigmatocystin (ST) and O-methylsterigmatocysin (OMST), the respective penultimate and ultimate precursors of AF. Although ST, OMST, and ...

  2. (-)-Menthol biosynthesis and molecular genetics.

    PubMed

    Croteau, Rodney B; Davis, Edward M; Ringer, Kerry L; Wildung, Mark R

    2005-12-01

    (-)-Menthol is the most familiar of the monoterpenes as both a pure natural product and as the principal and characteristic constituent of the essential oil of peppermint (Mentha x piperita). In this paper, we review the biosynthesis and molecular genetics of (-)-menthol production in peppermint. In Mentha species, essential oil biosynthesis and storage is restricted to the peltate glandular trichomes (oil glands) on the aerial surfaces of the plant. A mechanical method for the isolation of metabolically functional oil glands, has provided a system for precursor feeding studies to elucidate pathway steps, as well as a highly enriched source of the relevant biosynthetic enzymes and of their corresponding transcripts with which cDNA libraries have been constructed to permit cloning and characterization of key structural genes. The biosynthesis of (-)-menthol from primary metabolism requires eight enzymatic steps, and involves the formation and subsequent cyclization of the universal monoterpene precursor geranyl diphosphate to the parent olefin (-)-(4S)-limonene as the first committed reaction of the sequence. Following hydroxylation at C3, a series of four redox transformations and an isomerization occur in a general "allylic oxidation-conjugate reduction" scheme that installs three chiral centers on the substituted cyclohexanoid ring to yield (-)-(1R, 3R, 4S)-menthol. The properties of each enzyme and gene of menthol biosynthesis are described, as are their probable evolutionary origins in primary metabolism. The organization of menthol biosynthesis is complex in involving four subcellular compartments, and regulation of the pathway appears to reside largely at the level of gene expression. Genetic engineering to up-regulate a flux-limiting step and down-regulate a side route reaction has led to improvement in the composition and yield of peppermint oil. PMID:16292524

  3. (-)-Menthol biosynthesis and molecular genetics

    NASA Astrophysics Data System (ADS)

    Croteau, Rodney B.; Davis, Edward M.; Ringer, Kerry L.; Wildung, Mark R.

    2005-12-01

    (-)-Menthol is the most familiar of the monoterpenes as both a pure natural product and as the principal and characteristic constituent of the essential oil of peppermint ( Mentha x piperita). In this paper, we review the biosynthesis and molecular genetics of (-)-menthol production in peppermint. In Mentha species, essential oil biosynthesis and storage is restricted to the peltate glandular trichomes (oil glands) on the aerial surfaces of the plant. A mechanical method for the isolation of metabolically functional oil glands, has provided a system for precursor feeding studies to elucidate pathway steps, as well as a highly enriched source of the relevant biosynthetic enzymes and of their corresponding transcripts with which cDNA libraries have been constructed to permit cloning and characterization of key structural genes. The biosynthesis of (-)-menthol from primary metabolism requires eight enzymatic steps, and involves the formation and subsequent cyclization of the universal monoterpene precursor geranyl diphosphate to the parent olefin (-)-(4 S)-limonene as the first committed reaction of the sequence. Following hydroxylation at C3, a series of four redox transformations and an isomerization occur in a general “allylic oxidation-conjugate reduction” scheme that installs three chiral centers on the substituted cyclohexanoid ring to yield (-)-(1 R, 3 R, 4 S)-menthol. The properties of each enzyme and gene of menthol biosynthesis are described, as are their probable evolutionary origins in primary metabolism. The organization of menthol biosynthesis is complex in involving four subcellular compartments, and regulation of the pathway appears to reside largely at the level of gene expression. Genetic engineering to up-regulate a flux-limiting step and down-regulate a side route reaction has led to improvement in the composition and yield of peppermint oil.

  4. D5S351 and D5S1414 located at the spinal muscular atrophy critical region represent novel informative markers in the Iranian population

    PubMed Central

    Sedghi, Maryam; Vallian, Sadeq

    2015-01-01

    Spinal muscular atrophy (SMA) is a degenerative neuromuscular disease associated with progressive symmetric weakness and atrophy of the limb muscles. In view of the involvement of numerous point mutations and deletions associated with the disease, the application of polymorphic markers flanking the SMA critical region could be valuable in molecular diagnosis of the disease. In the present study, D5S351 and D5S1414 polymorphic markers located at the SMA critical region in the Iranian populations were characterized. Genotyping of the markers indicated the presence of six and nine different alleles for D5S351 and D5S1414, respectively. Haplotype frequency estimation in 25 trios families and 75 unrelated individuals indicated the presence of six informative haplotypes with frequency higher than 0.05 in the studied population. Furthermore, the D′ coefficient and the χ2 value for D5S351 and D5S1414 markers revealed the presence of linkage disequilibrium between the two markers in the Iranians. These data suggested that D5S351 and D5S1414 could be suggested as informative markers for linkage analysis and molecular diagnosis of SMA in the Iranian population. PMID:26693404

  5. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.

    PubMed

    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto

    2006-05-01

    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes. PMID:16612546

  6. Gibberellin biosynthesis in Gibberlla fujikuroi

    SciTech Connect

    Johnson, S.W.; Coolbaugh, R.C. )

    1989-04-01

    Gibberellins (GAs) are a group of plant growth hormones which were first isolated from the fungus Gibberella fujikuori. We have examined the biosynthesis of GAs in this fungus in liquid cultures using HPLC followed by GC-MS. Furthermore we have used cell-free enzyme extracts with {sup 14}C-labeled intermediates to examine the regulation of specific parts of the biosynthetic pathway. GA{sub 3} is the predominant GA in well aerated cultures. GA{sub 4} and GA{sub 7}, intermediates in GA{sub 3} biosynthesis, accumulate in cultures with low levels of dissolved oxygen, but are not detectable in more aerated cultures. Light stimulates GA production in G. fujikuroi cultures grown from young stock. Cell-free enzyme studies indicate that light has no effect on incorporation of mevalonic acid into kaurene, but does significantly stimulate the oxidation of kaurenoic acid.

  7. Benzodiazepine biosynthesis in Streptomyces refuineus.

    PubMed

    Hu, Yunfeng; Phelan, Vanessa; Ntai, Ioanna; Farnet, Chris M; Zazopoulos, Emmanuel; Bachmann, Brian O

    2007-06-01

    Anthramycin is a benzodiazepine alkaloid with potent antitumor and antibiotic activity produced by the thermophilic actinomycete Streptomyces refuineus sbsp. thermotolerans. In this study, the complete 32.5 kb gene cluster for the biosynthesis of anthramycin was identified by using a genome-scanning approach, and cluster boundaries were estimated via comparative genomics. A lambda-RED-mediated gene-replacement system was developed to provide supporting evidence for critical biosynthetic genes and to validate the boundaries of the proposed anthramycin gene cluster. Sequence analysis reveals that the 25 open reading frame anthramycin cluster contains genes consistent with the biosynthesis of the two halves of anthramycin: 4 methyl-3-hydroxyanthranilic acid and a "dehydroproline acrylamide" moiety. These nonproteinogenic amino acid precursors are condensed by a two-module nonribosomal peptide synthetase (NRPS) terminated by a reductase domain, consistent with the final hemiaminal oxidation state of anthramycin. PMID:17584616

  8. Lignification: Flexibility, Biosynthesis and Regulation.

    PubMed

    Zhao, Qiao

    2016-08-01

    Lignin is a complex phenolic polymer that is deposited in the secondary cell wall of all vascular plants. The evolution of lignin is considered to be a critical event during vascular plant development, because lignin provides mechanical strength, rigidity, and hydrophobicity to secondary cell walls to allow plants to grow tall and transport water and nutrients over a long distance. In recent years, great research efforts have been made to genetically alter lignin biosynthesis to improve biomass degradability for the production of second-generation biofuels. This global focus on lignin research has significantly advanced our understanding of the lignification process. Based on these advances, here I provide an overview of lignin composition, the biosynthesis pathway and its regulation. PMID:27131502

  9. Biosynthesis of enediyne antitumor antibiotics.

    PubMed

    Van Lanen, Steven G; Shen, Ben

    2008-01-01

    The enediyne polyketides are secondary metabolites isolated from a variety of Actinomycetes. All members share very potent anticancer and antibiotic activity, and prospects for the clinical application of the enediynes has been validated with the recent marketing of two enediyne derivatives as anticancer agents. The biosynthesis of these compounds is of interest because of the numerous structural features that are unique to the enediyne family. The gene cluster for five enediynes has now been cloned and sequenced, providing the foundation to understand natures' means to biosynthesize such complex, exotic molecules. Presented here is a review of the current progress in delineating the biosynthesis of the enediynes with an emphasis on the model enediyne, C-1027. PMID:18397168

  10. Biosynthesis of Ochratoxin A1

    PubMed Central

    Searcy, J. W.; Davis, N. D.; Diener, U. L.

    1969-01-01

    Biosynthesis of ochratoxin A by Aspergillus ochraceus Wilh. was investigated by radiolabeling experiments in which phenylalanine-1-14C and sodium acetate-2-14C were supplied to the fungus in sucrose-yeast extract medium. Results showed that phenylalanine was incorporated unaltered into the phenylalanine moiety of ochratoxin A, whereas the isocoumarin moiety of ochratoxin A was mostly derived via acetate condensation. PMID:5369298

  11. Biosynthesis of Fungal Indole Alkaloids

    PubMed Central

    Xu, Wei; Gavia, Diego J.; Tang, Yi

    2014-01-01

    This review provides a summary of recent research advances in elucidating the biosynthesis of fungal indole alkaloids. Different strategies used to incorporate and derivatize the indole/indoline moieties in various families of fungal indole alkaloids will be discussed, including tryptophan-containing nonribosomal peptides and polyketide-nonribosomal peptide hybrids; and alkaloids derived from other indole building blocks. This review also includes discussion regarding the downstream modifications that generate chemical and structural diversity among indole alkaloids. PMID:25180619

  12. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

    2005-01-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  13. Strain identification and 5S rRNA gene characterization of the hyperthermophilic archaebacterium Sulfolobus acidocaldarius.

    PubMed Central

    Durovic, P; Kutay, U; Schleper, C; Dennis, P P

    1994-01-01

    A commonly used laboratory Sulfolobus strain has been unambiguously identified as Sulfolobus acidocaldarius DSM639. The 5S rRNA gene from this strain was cloned and sequenced. It differs at 17 of 124 positions from the identical 5S rRNA sequences from Sulfolobus solfataricus and a strain apparently misidentified as S. acidocaldarius. Analysis of the transcripts from the 5S rRNA gene failed to identify any precursor extending a significant distance beyond the 5' or 3' boundary of the 5S rRNA-coding sequence. This result suggests that the primary transcript of the 5S rRNA gene corresponds in length (within 1 or 2 nucleotides) to the mature 5S rRNA sequence found in 50S ribosomal subunits. Images PMID:8288546

  14. Tetrahydrobiopterin biosynthesis, regeneration and functions.

    PubMed Central

    Thöny, B; Auerbach, G; Blau, N

    2000-01-01

    Tetrahydrobiopterin (BH(4)) cofactor is essential for various processes, and is present in probably every cell or tissue of higher organisms. BH(4) is required for various enzyme activities, and for less defined functions at the cellular level. The pathway for the de novo biosynthesis of BH(4) from GTP involves GTP cyclohydrolase I, 6-pyruvoyl-tetrahydropterin synthase and sepiapterin reductase. Cofactor regeneration requires pterin-4a-carbinolamine dehydratase and dihydropteridine reductase. Based on gene cloning, recombinant expression, mutagenesis studies, structural analysis of crystals and NMR studies, reaction mechanisms for the biosynthetic and recycling enzymes were proposed. With regard to the regulation of cofactor biosynthesis, the major controlling point is GTP cyclohydrolase I, the expression of which may be under the control of cytokine induction. In the liver at least, activity is inhibited by BH(4), but stimulated by phenylalanine through the GTP cyclohydrolase I feedback regulatory protein. The enzymes that depend on BH(4) are the phenylalanine, tyrosine and tryptophan hydroxylases, the latter two being the rate-limiting enzymes for catecholamine and 5-hydroxytryptamine (serotonin) biosynthesis, all NO synthase isoforms and the glyceryl-ether mono-oxygenase. On a cellular level, BH(4) has been found to be a growth or proliferation factor for Crithidia fasciculata, haemopoietic cells and various mammalian cell lines. In the nervous system, BH(4) is a self-protecting factor for NO, or a general neuroprotecting factor via the NO synthase pathway, and has neurotransmitter-releasing function. With regard to human disease, BH(4) deficiency due to autosomal recessive mutations in all enzymes (except sepiapterin reductase) have been described as a cause of hyperphenylalaninaemia. Furthermore, several neurological diseases, including Dopa-responsive dystonia, but also Alzheimer's disease, Parkinson's disease, autism and depression, have been suggested to be

  15. Evolution of rosmarinic acid biosynthesis.

    PubMed

    Petersen, Maike; Abdullah, Yana; Benner, Johannes; Eberle, David; Gehlen, Katja; Hücherig, Stephanie; Janiak, Verena; Kim, Kyung Hee; Sander, Marion; Weitzel, Corinna; Wolters, Stefan

    2009-01-01

    Rosmarinic acid and chlorogenic acid are caffeic acid esters widely found in the plant kingdom and presumably accumulated as defense compounds. In a survey, more than 240 plant species have been screened for the presence of rosmarinic and chlorogenic acids. Several rosmarinic acid-containing species have been detected. The rosmarinic acid accumulation in species of the Marantaceae has not been known before. Rosmarinic acid is found in hornworts, in the fern family Blechnaceae and in species of several orders of mono- and dicotyledonous angiosperms. The biosyntheses of caffeoylshikimate, chlorogenic acid and rosmarinic acid use 4-coumaroyl-CoA from the general phenylpropanoid pathway as hydroxycinnamoyl donor. The hydroxycinnamoyl acceptor substrate comes from the shikimate pathway: shikimic acid, quinic acid and hydroxyphenyllactic acid derived from l-tyrosine. Similar steps are involved in the biosyntheses of rosmarinic, chlorogenic and caffeoylshikimic acids: the transfer of the 4-coumaroyl moiety to an acceptor molecule by a hydroxycinnamoyltransferase from the BAHD acyltransferase family and the meta-hydroxylation of the 4-coumaroyl moiety in the ester by a cytochrome P450 monooxygenase from the CYP98A family. The hydroxycinnamoyltransferases as well as the meta-hydroxylases show high sequence similarities and thus seem to be closely related. The hydroxycinnamoyltransferase and CYP98A14 from Coleus blumei (Lamiaceae) are nevertheless specific for substrates involved in RA biosynthesis showing an evolutionary diversification in phenolic ester metabolism. Our current view is that only a few enzymes had to be "invented" for rosmarinic acid biosynthesis probably on the basis of genes needed for the formation of chlorogenic and caffeoylshikimic acid while further biosynthetic steps might have been recruited from phenylpropanoid metabolism, tocopherol/plastoquinone biosynthesis and photorespiration. PMID:19560175

  16. Cellulose biosynthesis inhibitors - a multifunctional toolbox.

    PubMed

    Tateno, Mizuki; Brabham, Chad; DeBolt, Seth

    2016-01-01

    In the current review, we examine the growing number of existing Cellulose Biosynthesis Inhibitors (CBIs) and based on those that have been studied with live cell imaging we group their mechanism of action. Attention is paid to the use of CBIs as tools to ask fundamental questions about cellulose biosynthesis. PMID:26590309

  17. BIOSYNTHESIS OF NITRO COMPOUNDS I.

    PubMed Central

    Shaw, Paul D.; Wang, Nancy

    1964-01-01

    Shaw, Paul D. (University of Illinois, Urbana), and Nancy Wang. Biosynthesis of nitro compounds. I. Nitrogen and carbon requirements for the biosynthesis of β-nitropropionic acid by Penicillium atrovenetum. J. Bacteriol. 88:1629–1635. 1964.—β-Nitropropionic acid was produced by Penicillium atrovenetum when this fungus was grown on a Raulin-Thom medium in shake flasks. The nitro compound was formed in the early stages of growth, and the total amount in the medium decreased when the fungus reached the end of the log phase. When increasing amounts of nitrate were substituted for the ammonia in the growth medium, production of β-nitropropionic acid decreased. Aspartic acid did not promote the synthesis of the nitro compound unless either ammonium chloride or sodium tartrate was also added to the medium. The addition of small amounts of hydroxylamine or sodium nitrite to the Raulin-Thom medium stimulated β-nitropropionic acid production to a greater degree on a molar basis than the amount of hydroxylamine or nitrite added. The nature of possible precursors to the nitro group of β-nitropropionic acid is discussed. PMID:14240949

  18. Oleic acid biosynthesis in cyanobacteria

    SciTech Connect

    VanDusen, W.J.; Jaworski, J.G.

    1986-05-01

    The biosynthesis of fatty acids in cyanobacteria is very similar to the well characterized system found in green plants. However, the initial desaturation of stearic acid in cyanobacteria appears to represent a significant departure from plant systems in which stearoyl-ACP is the exclusive substrate for desaturation. In Anabaena variabilis, the substrate appears to be monoglucosyldiacylglycerol, a lipid not found in plants. The authors examined five different cyanobacteria to determine if the pathway in A. variabilis was generally present in other cyanobacteria. The cyanobacteria studied were A. variabilis, Chlorogloeopsis sp., Schizothrix calcicola, Anacystis marina, and Anacystis nidulans. Each were grown in liquid culture, harvested, and examined for stearoyl-ACP desaturase activity or incubated with /sup 14/CO/sub 2/. None of the cyanobacteria contained any stearoyl-ACP desaturase activity in whole homogenates or 105,000g supernatants. All were capable of incorporating /sup 14/CO/sub 2/ into monoglucosyldiacylglycerol and results from incubations of 20 min, 1 hr, 1 hr + 10 hr chase were consistent with monoglucosyldiacylglycerol serving as precursor for monogalctosyldiacylglycerol. Thus, initial evidence is consistent with oleic acid biosynthesis occurring by desaturation of stearoyl-monoglucosyldiacylglycerol in all cyanobacteria.

  19. Current aspects of auxin biosynthesis in plants.

    PubMed

    Kasahara, Hiroyuki

    2015-01-01

    Auxin is an important plant hormone essential for many aspects of plant growth and development. Indole-3-acetic acid (IAA) is the most studied auxin in plants, and its biosynthesis pathway has been investigated for over 70 years. Although the complete picture of auxin biosynthesis remains to be elucidated, remarkable progress has been made recently in understanding the mechanism of IAA biosynthesis. Genetic and biochemical studies demonstrate that IAA is mainly synthesized from l-tryptophan (Trp) via indole-3-pyruvate by two-step reactions in Arabidopsis. While IAA is also produced from Trp via indole-3-acetaldoxime in Arabidopsis, this pathway likely plays an auxiliary role in plants of the family Brassicaceae. Recent studies suggest that the Trp-independent pathway is not a major route for IAA biosynthesis, but they reveal an important role for a cytosolic indole synthase in this pathway. In this review, I summarize current views and future prospects of IAA biosynthesis research in plants. PMID:26364770

  20. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  1. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  2. A search for the Bs meson in Υ(5S) decays

    NASA Astrophysics Data System (ADS)

    Shipsey, Ian

    2004-05-01

    The CLEO III detector has recorded approximately 0.5 fb-1 of e^+ e^- annihilation data at the Υ(5S) resonance. Using this data sample, we have searched for fully reconstructed Bs mesons in the reaction Υ(5S) arrow B_s^(*) barB_s^(*)

  3. Regulation of cardiolipin biosynthesis in the heart.

    PubMed

    Hatch, G M

    1996-06-21

    Cardiolipin is one of the principle phospholipids in the mammalian heart comprising as much as 15-20% of the entire phospholipid phosphorus mass of that organ. Cardiolipin is localized primarily in the mitochondria and appears to be essential for the function of several enzymes of oxidative phosphorylation. Thus, cardiolipin is essential for production of energy for the heart to beat. Cardiac cardiolipin is synthesized via the cytidine-5'-diphosphate-1,2-diacyl-sn-glycerol pathway. The properties of the four enzymes of the cytidine-5'-diphosphate-1,2-diacyl-sn-glycerol pathway have been characterized in the heart. The rate-limiting step of this pathway is catalyzed by the phosphatidic acid: cytidine-5'-triphosphate cytidylyltransferase. Several regulatory mechanisms that govern cardiolipin biosynthesis in the heart have been uncovered. Current evidence suggests that cardiolipin biosynthesis is regulated by the energy status (adenosine-5'-triphosphate and cytidine-5'-triphosphate level) of the heart. Thyroid hormone and unsaturated fatty acids may regulate cardiolipin biosynthesis at the level of three key enzymes of the cytidine-5'-diphosphate-1,2-diacyl-sn-glycerol pathway, phosphatidylglycerol phosphate synthase, phosphatidyl-glycerolphosphate phosphatase and cardiolipin synthase. Newly synthesized phosphatidic acid and phosphatidylglycerol may be preferentially utilized for cardiolipin biosynthesis in the heart. In addition, separate pools of phosphatidylglycerol, including an exogenous (extra-mitochondrial) pool not derived from de novo phosphatidylglycerol biosynthesis, may be utilized for cardiac cardiolipin biosynthesis. In several mammalian tissues a significant number of studies on polyglycerophospholipid biosynthesis have been documented, including detailed studies in the lung and liver. However, in spite of the important role of cardiolipin in the maintenance of mitochondrial function and membrane integrity, studies on the control of cardiolipin

  4. Evidence for the presence of 5S rRNA in mammalian mitochondria.

    PubMed

    Magalhães, P J; Andreu, A L; Schon, E A

    1998-09-01

    Mammalian mitochondrial ribosomes contain two prokaryotic-like rRNAs, 12S and 16S, both encoded by mitochondrial DNA. As opposed to cytosolic ribosomes, however, these ribosomes are not thought to contain 5S rRNA. For this reason, it has been unclear whether 5S rRNA, which can be detected in mitochondrial preparations, is an authentic organellar species imported from the cytosol or is merely a copurifying cytosol-derived contaminant. We now show that 5S rRNA is tightly associated with highly purified mitochondrial fractions of human and rat cells and that 5S rRNA transcripts derived from a synthetic gene transfected transiently into human cells are both expressed in vivo and present in highly purified mitochondria and mitoplasts. We conclude that 5S rRNA is imported into mammalian mitochondria, but its function there still remains to be clarified. PMID:9725900

  5. Sequence and organization of 5S ribosomal RNA-encoding genes of Arabidopsis thaliana.

    PubMed

    Campell, B R; Song, Y; Posch, T E; Cullis, C A; Town, C D

    1992-03-15

    We have isolated a genomic clone containing Arabidopsis thaliana 5S ribosomal RNA (rRNA)-encoding genes (rDNA) by screening an A. thaliana library with a 5S rDNA probe from flax. The clone isolated contains seven repeat units of 497 bp, plus 11 kb of flanking genomic sequence at one border. Sequencing of individual subcloned repeat units shows that the sequence of the 5S rRNA coding region is very similar to that reported for other flowering plants. Four A. thaliana ecotypes were found to contain approx. 1000 copies of 5S rDNA per haploid genome. Southern-blot analysis of genomic DNA indicates that 5S rDNA occurs in long tandem arrays, and shows the presence of numerous restriction-site polymorphisms among the six ecotypes studied. PMID:1348233

  6. The 5S lean method as a tool of industrial management performances

    NASA Astrophysics Data System (ADS)

    Filip, F. C.; Marascu-Klein, V.

    2015-11-01

    Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

  7. Mitochondrial Enzyme Rhodanese Is Essential for 5 S Ribosomal RNA Import into Human Mitochondria*

    PubMed Central

    Smirnov, Alexandre; Comte, Caroline; Mager-Heckel, Anne-Marie; Addis, Vanessa; Krasheninnikov, Igor A.; Martin, Robert P.; Entelis, Nina; Tarassov, Ivan

    2010-01-01

    5 S rRNA is an essential component of ribosomes. In eukaryotic cells, it is distinguished by particularly complex intracellular traffic, including nuclear export and re-import. The finding that in mammalian cells 5 S rRNA can eventually escape its usual circuit toward nascent ribosomes to get imported into mitochondria has made the scheme more complex, and it has raised questions about both the mechanism of 5 S rRNA mitochondrial targeting and its function inside the organelle. Previously, we showed that import of 5 S rRNA into mitochondria requires unknown cytosolic proteins. Here, one of them was identified as mitochondrial thiosulfate sulfurtransferase, rhodanese. Rhodanese in its misfolded form was found to possess a strong and specific 5 S rRNA binding activity, exploiting sites found earlier to function as signals of 5 S rRNA mitochondrial localization. The interaction with 5 S rRNA occurs cotranslationally and results in formation of a stable complex in which rhodanese is preserved in a compact enzymatically inactive conformation. Human 5 S rRNA in a branched Mg2+-free form, upon its interaction with misfolded rhodanese, demonstrates characteristic functional traits of Hsp40 cochaperones implicated in mitochondrial precursor protein targeting, suggesting that it may use this mechanism to ensure its own mitochondrial localization. Finally, silencing of the rhodanese gene caused not only a proportional decrease of 5 S rRNA import but also a general inhibition of mitochondrial translation, indicating the functional importance of the imported 5 S rRNA inside the organelle. PMID:20663881

  8. Isoprenoid Biosynthesis in Plasmodium falciparum

    PubMed Central

    Guggisberg, Ann M.; Amthor, Rachel E.

    2014-01-01

    Malaria kills nearly 1 million people each year, and the protozoan parasite Plasmodium falciparum has become increasingly resistant to current therapies. Isoprenoid synthesis via the methylerythritol phosphate (MEP) pathway represents an attractive target for the development of new antimalarials. The phosphonic acid antibiotic fosmidomycin is a specific inhibitor of isoprenoid synthesis and has been a helpful tool to outline the essential functions of isoprenoid biosynthesis in P. falciparum. Isoprenoids are a large, diverse class of hydrocarbons that function in a variety of essential cellular processes in eukaryotes. In P. falciparum, isoprenoids are used for tRNA isopentenylation and protein prenylation, as well as the synthesis of vitamin E, carotenoids, ubiquinone, and dolichols. Recently, isoprenoid synthesis in P. falciparum has been shown to be regulated by a sugar phosphatase. We outline what is known about isoprenoid function and the regulation of isoprenoid synthesis in P. falciparum, in order to identify valuable directions for future research. PMID:25217461

  9. Biosynthesis of mycobacterial phosphatidylinositol mannosides.

    PubMed Central

    Morita, Yasu S; Patterson, John H; Billman-Jacobe, Helen; McConville, Malcolm J

    2004-01-01

    All mycobacterial species, including pathogenic Mycobacterium tuberculosis, synthesize an abundant class of phosphatidylinositol mannosides (PIMs) that are essential for normal growth and viability. These glycolipids are important cell-wall and/or plasma-membrane components in their own right and can also be hyperglycosylated to form other wall components, such as lipomannan and lipoarabinomannan. We have investigated the steps involved in the biosynthesis of the major PIM species in a new M. smegmatis cell-free system. A number of apolar and polar PIM intermediates were labelled when this system was continuously labelled or pulse-chase-labelled with GDP-[3H]Man, and the glycan head groups and the acylation states of these species were determined by chemical and enzymic treatments and octyl-Sepharose chromatography respectively. These analyses showed that (1) the major apolar PIM species, acyl-PIM2, can be synthesized by at least two pathways that differ in the timing of the first acylation step, (2) early PIM intermediates containing a single mannose residue can be modified with two fatty acid residues, (3) formation of polar PIM species from acyl-PIM2 is amphomycin-sensitive, indicating that polyprenol phosphate-Man, rather than GDP-Man, is the donor for these reactions, (4) modification of acylated PIM4 with alpha1-2- or alpha1-6-linked mannose residues is probably the branch point in the biosyntheses of polar PIM and lipoarabinomannan respectively and (5) GDP strongly inhibits the synthesis of early PIM intermediates and increases the turnover of polyprenol phosphate-Man. These findings are incorporated into a revised pathway for mycobacterial PIM biosynthesis. PMID:14627436

  10. Acylphloroglucinol Biosynthesis in Strawberry Fruit.

    PubMed

    Song, Chuankui; Ring, Ludwig; Hoffmann, Thomas; Huang, Fong-Chin; Slovin, Janet; Schwab, Wilfried

    2015-11-01

    Phenolics have health-promoting properties and are a major group of metabolites in fruit crops. Through reverse genetic analysis of the functions of four ripening-related genes in the octoploid strawberry (Fragaria × ananassa), we discovered four acylphloroglucinol (APG)-glucosides as native Fragaria spp. fruit metabolites whose levels were differently regulated in the transgenic fruits. The biosynthesis of the APG aglycones was investigated by examination of the enzymatic properties of three recombinant Fragaria vesca chalcone synthase (FvCHS) proteins. CHS is involved in anthocyanin biosynthesis during ripening. The F. vesca enzymes readily catalyzed the condensation of two intermediates in branched-chain amino acid metabolism, isovaleryl-Coenzyme A (CoA) and isobutyryl-CoA, with three molecules of malonyl-CoA to form phlorisovalerophenone and phlorisobutyrophenone, respectively, and formed naringenin chalcone when 4-coumaroyl-CoA was used as starter molecule. Isovaleryl-CoA was the preferred starter substrate of FvCHS2-1. Suppression of CHS activity in both transient and stable CHS-silenced fruit resulted in a substantial decrease of APG glucosides and anthocyanins and enhanced levels of volatiles derived from branched-chain amino acids. The proposed APG pathway was confirmed by feeding isotopically labeled amino acids. Thus, Fragaria spp. plants have the capacity to synthesize pharmaceutically important APGs using dual functional CHS/(phloriso)valerophenone synthases that are expressed during fruit ripening. Duplication and adaptive evolution of CHS is the most probable scenario and might be generally applicable to other plants. The results highlight that important promiscuous gene function may be missed when annotation relies solely on in silico analysis. PMID:26169681

  11. Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

    PubMed Central

    Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B

    1978-01-01

    A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

  12. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    SciTech Connect

    Hirose, Yutaka Harada, Fumio

    2008-01-04

    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus.

  13. Mouse nucleolin binds to 4.5S RNAh, a small noncoding RNA.

    PubMed

    Hirose, Yutaka; Harada, Fumio

    2008-01-01

    4.5S RNAh is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAh is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAh-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAhin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAh-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAh recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAh was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus. PMID:17971306

  14. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  15. [Effect of Bryonia cucurbitacins on the biosynthesis of eicosanoids in human leukocytes].

    PubMed

    Panosian, A G

    1985-02-01

    2 beta,25-di (beta-D-glucopyranosyl)-16 alpha,20-dihydroxy-3,11,22- trioxocucurbit-5-en and 2 beta-(beta-D-glucopyranosyl)-16 alpha,20,25-trihydroxy-3,11,22-trioxocucurbit-5-en isolated from bryonia (Bryonia alba L.) roots have been demonstrated to inhibit in vitro the [1-14C]arachidonic acid release from neutrophils. Aglicon 2 beta,16 alpha,20,25-tetrahydroxy-3,11,22-trioxocucurbit-5-en is much less active. When the cells are stimulated by calcium ionophore A23187, the aglycon potentiates the release of arachidonic acid. In these conditions the glucosides show little activity. Both the glucosides and their aglycon suppress the biosynthesis of 5S,12R-dihydroxy-6,8,10,14(Z, E, E, Z)-eicosatetraenoic acid (LTB4) and 5S,12S-dihydroxy-6,8,10,14(E, Z, E, Z)-eicosatetraenoic acid (5S,12S-DHETE). Inhibition of the biosynthesis of these compounds by 2 beta,16 alpha,20,25-tetrahydroxy-3,11,22-trioxocucurbit-5-en also takes place on incubation of human neutrophils with exogenous arachidonic acid. The formation of other products of cycloxygenase and lipoxygenase oxidation pathways remains practically unchanged. PMID:2986654

  16. 104. JOB NO. 1347F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    104. JOB NO. 1347-F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD MOTOR COMPANY; LONGITUDINAL SECTION AND TRUSS DETAILS - Ford Motor Company Long Beach Assembly Plant, Assembly Building, 700 Henry Ford Avenue, Long Beach, Los Angeles County, CA

  17. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  18. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    NASA Technical Reports Server (NTRS)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  19. Nucleotide sequence of 5S ribosomal RNA from Aspergillus nidulans and Neurospora crassa.

    PubMed Central

    Piechulla, B; Hahn, U; McLaughlin, L W; Küntzel, H

    1981-01-01

    The nucleotide sequences of 5S rRNA molecules isolated from the cytosol and the mitochondria of the ascomycetes A. nidulans and N. crassa were determined by partial chemical cleavage of 3'-terminally labelled RNA. The sequence identity of the cytosolic and mitochondrial RNA preparations confirms the absence of mitochondrion-specific 5S rRNA in these fungi. The sequences of the two organisms differ in 35 positions, and each sequence differs from yeast 5S rRNA in 44 positions. Both molecules contain the sequence GCUC in place of GAAC or GAUY found in all other 5S rRNAs, indicating that this region is not universally involved in base-pairing to the invariant GTpsiC sequence of tRNAs. Images PMID:6453331

  20. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    PubMed

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p< 0.001). After the implementation of 5S it was observed and determined that facilitating the job and setting up a safe environment created

  1. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  2. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  3. Advances in Understanding the Biosynthesis of Fumonisins

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fumonisins are a group of economically important mycotoxins that are derived polyketides. Since the cloning of the fumonisin polyketide synthase (PKS) gene from Fusarium verticillioides in 1999, significant advances have been made in understanding the molecular mechanisms for fumonisin biosynthesis...

  4. Sterols of the fungi - Distribution and biosynthesis.

    NASA Technical Reports Server (NTRS)

    Weete, J. D.

    1973-01-01

    The importance of sterols in the growth and reproduction in fungi is becoming increasingly apparent. This article concerns the composition and biosynthesis of ergosterol in these organisms. Comparison to plant and animal sterol formation are made.

  5. Sterols of the fungi - Distribution and biosynthesis

    NASA Technical Reports Server (NTRS)

    Weete, J. D.

    1973-01-01

    The importance of sterols in the growth and reproduction in fungi is becoming increasingly apparent. This article concerns the composition and biosynthesis of ergosterol in these organisms. Comparison to plant and animal sterol formation are made.

  6. 5 S Rrna Is Involved in Fidelity of Translational Reading Frame

    PubMed Central

    Dinman, J. D.; Wickner, R. B.

    1995-01-01

    Chromosomal mutants (maintenance of frame = mof) in which the efficiency of -1 ribosomal frame-shifting is increased can be isolated using constructs in which lacZ expression is dependent upon a -1 shift of reading frame. We isolate a new mof mutation, mof9, in Saccharomyces cerevisiae and show that it is complemented by both single and multi-copy 5 S rDNA clones. Two independent insertion mutations in the rDNA locus (rDNA::LEU2 and rDNA::URA3) also display the Mof(-) phenotype and are also complemented by single and multi-copy 5 S rDNA clones. Mutant 5 S rRNAs expressed from a plasmid as 20-50% of total 5 S rRNA in a wild-type host also induced the Mof(-) phenotype. The increase in frameshifting is greatest when the lacZ reporter gene is expressed on a high copy, episomal vector. No differences were found in 5 S rRNA copy number or electrophoretic mobilities in mof9 strains. Both mof9 and rDNA::LEU2 increase the efficiency of +1 frameshifting as well but have no effect on readthrough of UAG or UAA termination codons, indicating that not all translational specificity is affected. These data suggest a role for 5 S rRNA in the maintenance of frame in translation. PMID:8536994

  7. Genomic organization and evolution of the 5S ribosomal DNA in Tilapiini fishes.

    PubMed

    Alves-Costa, F A; Wasko, A P; Oliveira, C; Foresti, F; Martins, C

    2006-05-01

    5S rDNA sequences present an intense dynamism and have proved to be valuable as genetic markers to distinguish closed related species and also in the understanding of the evolutionary dynamic of repetitive sequences in the genomes. In order to identify patterns of 5S rDNA organization and their evolution in the genome of fish species, such genomic segment was investigated in the tilapias Oreochromis niloticus and Tilapia rendalli, and in the hybrid O. urolepis hornorum x O. mossambicus. A dual 5S rDNA system was identified in the three analyzed tilapia samples. Although each 5S rDNA class was conserved among the three samples, a distinct 5S rDNA genome organization pattern could be evidenced for each sample. The presence of a dual 5S rDNA system seems to be a general trait among non-related teleost fish orders, suggesting that evolutionary events of duplication have occurred before the divergence of the main groups of teleost fishes. PMID:16850228

  8. One-stage surgery through posterior approach-for L5-S1 spondyloptosis

    PubMed Central

    Suslu, Hikmet Turan; Celikoglu, Erhan; Borekcı, Ali; Hıcdonmez, Tufan; Suslu, Hüsnü

    2011-01-01

    Grade 5 spondylolisthesis or spondyloptosis is a rare condition. Generally, the surgical management of spondyloptosis includes multi-staged procedures instead of one-staged procedures. One-stage treatment for spondyloptosis is very rare. A 15-year-old girl with L5-S1 spondyloptosis was admitted with severe low back pain. There was no history of trauma. The patient underwent L5 laminectomy, L5-S1 discectomy, resection of sacral dome, reduction, L3-L4-L5-S1 pedicular screw fixation, and interbody-posterolateral fusion through the posterior approach. The reduction was maintained with bilateral L5-S1 discectomy, resection of the sacral dome, and transpedicular instrumentation from L3 to S1. In this particular case, one-staged approach was adequate for the treatment of L5-S1 spondyloptosis. One-staged surgery using the posterior approach may be adequate for the treatment of L5-S1 spondyloptosis while avoiding the risks inherent in anterior approaches. PMID:23125496

  9. Direct 5S rRNA Assay for Monitoring Mixed-Culture Bioprocesses

    PubMed Central

    Stoner, D. L.; Browning, C. K.; Bulmer, D. K.; Ward, T. E.; MacDonell, M. T.

    1996-01-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species extracted from collected biomass. Separation is based on the unique migration behavior of each 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the genera Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. PMID:16535333

  10. Carotenoid Biosynthesis in Daucus carota.

    PubMed

    Simpson, Kevin; Cerda, Ariel; Stange, Claudia

    2016-01-01

    Carrot (Daucus carota) is one of the most important vegetable cultivated worldwide and the main source of dietary provitamin A. Contrary to other plants, almost all carrot varieties accumulate massive amounts of carotenoids in the root, resulting in a wide variety of colors, including those with purple, yellow, white, red and orange roots. During the first weeks of development the root, grown in darkness, is thin and pale and devoid of carotenoids. At the second month, the thickening of the root and the accumulation of carotenoids begins, and it reaches its highest level at 3 months of development. This normal root thickening and carotenoid accumulation can be completely altered when roots are grown in light, in which chromoplasts differentiation is redirected to chloroplasts development in accordance with an altered carotenoid profile. Here we discuss the current evidence on the biosynthesis of carotenoid in carrot roots in response to environmental cues that has contributed to our understanding of the mechanism that regulates the accumulation of carotenoids, as well as the carotenogenic gene expression and root development in D. carota. PMID:27485223

  11. Biosynthesis of trichothecenes and apotrichothecenes.

    PubMed

    Zamir, L O; Nikolakakis, A; Sauriol, F; Mamer, O

    1999-05-01

    Fusarium culmorum produces two major trichothecenes, 3-acetyldeoxynivalenol and sambucinol, and some minor apotrichothecenes. It was desired to investigate if during their biosynthesis a C-11-keto intermediate was involved. To verify this postulate, trichodiene, a known precursor to trichothecenes, was synthesized with two deuteriums at C-11 and one at C-15. It was then fed to F. culmorum cultures, and the derived metabolites were purified and analyzed. The results ruled out the involvement of an 11-keto intermediate but revealed two novel apotrichothecenes. The characterization of their structures suggested that one of the 2-hydroxy-11alpha-apotrichothecene stereoisomers (2alpha or 2beta) could be converted to sambucinol. These apotrichothecenes were therefore synthesized labeled specifically with two deuteriums at C-4 and C-15 and fed to F. culmorum cultures. Indeed, the result established for the first time that 2alpha-hydroxy-11alpha-apotrichothecene was a precursor to sambucinol. A biosynthetic scheme for the production of trichothecenes and apotrichothecenes is described. PMID:10552458

  12. Salicylic Acid Biosynthesis and Metabolism

    PubMed Central

    Dempsey, D'Maris Amick; Vlot, A. Corina; Wildermuth, Mary C.; Klessig, Daniel F.

    2011-01-01

    Salicylic acid (SA) has been shown to regulate various aspects of growth and development; it also serves as a critical signal for activating disease resistance in Arabidopsis thaliana and other plant species. This review surveys the mechanisms involved in the biosynthesis and metabolism of this critical plant hormone. While a complete biosynthetic route has yet to be established, stressed Arabidopsis appear to synthesize SA primarily via an isochorismate-utilizing pathway in the chloroplast. A distinct pathway utilizing phenylalanine as the substrate also may contribute to SA accumulation, although to a much lesser extent. Once synthesized, free SA levels can be regulated by a variety of chemical modifications. Many of these modifications inactivate SA; however, some confer novel properties that may aid in long distance SA transport or the activation of stress responses complementary to those induced by free SA. In addition, a number of factors that directly or indirectly regulate the expression of SA biosynthetic genes or that influence the rate of SA catabolism have been identified. An integrated model, encompassing current knowledge of SA metabolism in Arabidopsis, as well as the influence other plant hormones exert on SA metabolism, is presented. PMID:22303280

  13. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  14. Chromosomal localization and sequence variation of 5S rRNA gene in five Capsicum species.

    PubMed

    Park, Y K; Park, K C; Park, C H; Kim, N S

    2000-02-29

    Chromosomal localization and sequence analysis of the 5S rRNA gene were carried out in five Capsicum species. Fluorescence in situ hybridization revealed that chromosomal location of the 5S rRNA gene was conserved in a single locus at a chromosome which was assigned to chromosome 1 by the synteny relationship with tomato. In sequence analysis, the repeating units of the 5S rRNA genes in the Capsicum species were variable in size from 278 bp to 300 bp. In sequence comparison of our results to the results with other Solanaceae plants as published by others, the coding region was highly conserved, but the spacer regions varied in size and sequence. T stretch regions, just after the end of the coding sequences, were more prominant in the Capsicum species than in two other plants. High G x C rich regions, which might have similar functions as that of the GC islands in the genes transcribed by RNA PolII, were observed after the T stretch region. Although we could not observe the TATA like sequences, an AT rich segment at -27 to -18 was detected in the 5S rRNA genes of the Capsicum species. Species relationship among the Capsicum species was also studied by the sequence comparison of the 5S rRNA genes. While C. chinense, C. frutescens, and C. annuum formed one lineage, C. baccatum was revealed to be an intermediate species between the former three species and C. pubescens. PMID:10774742

  15. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    PubMed

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit. PMID:27106499

  16. Affinity chromatography of Drosophila melanogaster ribosomal proteins to 5S rRNA.

    PubMed

    Stark, B C; Chooi, W Y

    1985-02-20

    The binding of Drosophila melanogaster ribosomal proteins to D. melanogaster 5S rRNA was studied using affinity chromatography of total ribosomal proteins (TP80) on 5S rRNA linked via adipic acid dihydrazide to Sepharose 4B. Ribosomal proteins which bound 5S rRNA at 0.3 M potassium chloride and were eluted at 1 M potassium chloride were identified as proteins 1, L4, 2/3, L14/L16, and S1, S2, S3, S4, S5, by two-dimensional polyacrylamide gel electrophoresis. Using poly A-Sepharose 4B columns as a model of non-specific binding, we found that a subset of TP80 proteins is also bound. This subset, while containing some of the proteins bound by 5S rRNA columns, was distinctly different from the latter subset, indicating that the binding to 5S rRNA was specific for that RNA species. PMID:3923010

  17. Photoionization study of Xe 5s: ionization cross sections and photoelectron angular distributions

    NASA Astrophysics Data System (ADS)

    Aarthi, G.; Jose, J.; Deshmukh, S.; Radojevic, V.; Deshmukh, P. C.; Manson, S. T.

    2014-01-01

    We report studies of photoelectron angular distribution and cross-section for photoionization of xenon 5s electrons using the relativistic multiconfiguration Tamm-Dancoff (MCTD) approximation. We find that MCTD provides a significantly improved agreement with experiment, compared to some of the other relativistic many body approximations such as the relativistic random phase approximation and the relativistic random phase approximation with relaxation, over the entire photon energy region bracketing the near-threshold 5s Cooper minimum, from the 5s threshold up to about 70 eV. The MCTD results in the length form are in much better agreement with the experiment than those in the velocity form, suggesting residual correlations that must be of importance.

  18. 4.5S ribonucleic acid, a novel ribosome component in the chloroplasts of flowering plants.

    PubMed Central

    Bowman, C M; Dyer, T A

    1979-01-01

    A species of low-molecular-weight ribosomal RNA, referred to as '4.5S rRNA', was found in addition to 5S rRNA in the large subunit of chloroplast ribosomes of a wide range of flowering plants. It was shown by sequence analysis that several variants of this RNA may occur in a plant. Furthermore, although in most flowering plants the predominant variant contains about 100 nucleotides, in the broad bean it has less than 80. It seems, therefore, to be much more diverse in size and sequence than the other ribosomal RNA species. Like 5S rRNA , it does not contain modified nucleotides and it is also unusual in having an unphosphorylated 5'-end. It is apparently neither a homologue of cytosol 5.8S rRNA nor a fragment of 23S rRNA. Images Fig. 1. Fig. 3. Fig. 4. PMID:540035

  19. Diversity of 5S rRNA genes within individual prokaryotic genomes

    PubMed Central

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V.; Parsons, Tamasha; Yang, Liying; Gerz, Erika A.; Lee, Peng; Xiang, Charlie; Nossa, Carlos W.; Pei, Zhiheng

    2012-01-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1168 genomes from 779 unique species, 96 species exhibited >3% diversity. Twenty seven species with >10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there were tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level. There is supplementary material. PMID:22765222

  20. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    NASA Technical Reports Server (NTRS)

    Luehrsen, K. R.; Fox, G. E.

    1981-01-01

    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  1. Veratrole biosynthesis in white campion.

    PubMed

    Akhtar, Tariq A; Pichersky, Eran

    2013-05-01

    White campion (Silene latifolia) is a dioecious plant that emits 1,2-dimethoxybenzene (veratrole), a potent pollinator attractant to the nocturnal moth Hadena bicruris. Little is known about veratrole biosynthesis, although methylation of 2-methoxyphenol (guaiacol), another volatile emitted from white campion flowers, has been proposed. Here, we explore the biosynthetic route to veratrole. Feeding white campion flowers with [(13)C9]l-phenylalanine increased guaiacol and veratrole emission, and a significant portion of these volatile molecules contained the stable isotope. When white campion flowers were treated with the phenylalanine ammonia lyase inhibitor 2-aminoindan-2-phosphonic acid, guaiacol and veratrole levels were reduced by 50% and 63%, respectively. Feeding with benzoic acid (BA) or salicylic acid (SA) increased veratrole emission 2-fold, while [(2)H5]BA and [(2)H6]SA feeding indicated that the benzene ring of both guaiacol and veratrole is derived from BA via SA. We further report guaiacol O-methyltransferase (GOMT) activity in the flowers of white campion. The enzyme was purified to apparent homogeneity, and the peptide sequence matched that encoded by a recently identified complementary DNA (SlGOMT1) from a white campion flower expressed sequence tag database. Screening of a small population of North American white campion plants for floral volatile emission revealed that not all plants emitted veratrole or possessed GOMT activity, and SlGOMT1 expression was only observed in veratrole emitters. Collectively these data suggest that veratrole is derived by the methylation of guaiacol, which itself originates from phenylalanine via BA and SA, and therefore implies a novel branch point of the general phenylpropanoid pathway. PMID:23547102

  2. Characterization of the L4-L5-S1 motion segment using the stepwise reduction method.

    PubMed

    Jaramillo, Héctor Enrique; Puttlitz, Christian M; McGilvray, Kirk; García, José J

    2016-05-01

    The two aims of this study were to generate data for a more accurate calibration of finite element models including the L5-S1 segment, and to find mechanical differences between the L4-L5 and L5-S1 segments. Then, the range of motion (ROM) and facet forces for the L4-S1 segment were measured using the stepwise reduction method. This consists of sequentially testing and reducing each segment in nine stages by cutting the ligaments, facet capsules, and removing the nucleus. Five L4-S1 human segments (median: 65 years, range: 53-84 years, SD=11.0 years) were loaded under a maximum pure moment of 8Nm. The ROM was measured using stereo-photogrammetry via tracking of three markers and the facet contact forces (CF) were measured using a Tekscan system. The ROM for the L4-L5 segment and all stages showed good agreement with published data. The major differences in ROM between the L4-L5 and L5-S1 segments were found for lateral bending and all stages, for which the L4-L5 ROM was about 1.5-3 times higher than that of the L5-S1 segment, consistent with L5-S1 facet CF about 1.3 to 4 times higher than those measured for the L4-L5 segment. For the other movements and few stages, the L4-L5 ROM was significantly lower that of the L5-S1 segment. ROM and CF provide important baseline data for more accurate calibration of FE models and to understand the role that their structures play in lower lumbar spine mechanics. PMID:27017302

  3. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    NASA Technical Reports Server (NTRS)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  4. Biosynthesis of gold nanoparticles: A green approach.

    PubMed

    Ahmed, Shakeel; Annu; Ikram, Saiqa; Yudha S, Salprima

    2016-08-01

    Nanotechnology is an immensely developing field due to its extensive range of applications in different areas of technology and science. Different types of methods are employed for synthesis of nanoparticles due to their wide applications. The conventional chemical methods have certain limitations with them either in the form of chemical contaminations during their syntheses procedures or in later applications and use of higher energy. During the last decade research have been focussed on developing simple, clean, non-toxic, cost effective and eco-friendly protocols for synthesis of nanoparticles. In order to get this objective, biosynthesis methods have been developed in order to fill this gap. The biosynthesis of nanoparticles is simple, single step, eco-friendly and a green approach. The biochemical processes in biological agents reduce the dissolved metal ions into nano metals. The various biological agents like plant tissues, fungi, bacteria, etc. are used for biosynthesis for metal nanoparticles. In this review article, we summarised recent literature on biosynthesis of gold nanoparticles which have revolutionised technique of synthesis for their applications in different fields. Due to biocompatibility of gold nanoparticles, it has find its applications in biomedical applications. The protocol and mechanism of biosynthesis of gold nanoparticles along with various applications have also been discussed. PMID:27236049

  5. Light-controlled flavonoid biosynthesis in fruits

    PubMed Central

    Zoratti, Laura; Karppinen, Katja; Luengo Escobar, Ana; Häggman, Hely; Jaakola, Laura

    2014-01-01

    Light is one of the most important environmental factors affecting flavonoid biosynthesis in plants. The absolute dependency of light to the plant development has driven evolvement of sophisticated mechanisms to sense and transduce multiple aspects of the light signal. Light effects can be categorized in photoperiod (duration), intensity (quantity), direction and quality (wavelength) including UV-light. Recently, new information has been achieved on the regulation of light-controlled flavonoid biosynthesis in fruits, in which flavonoids have a major contribution on quality. This review focuses on the effects of the different light conditions on the control of flavonoid biosynthesis in fruit producing plants. An overview of the currently known mechanisms of the light-controlled flavonoid accumulation is provided. R2R3 MYB transcription factors are known to regulate by differential expression the biosynthesis of distinct flavonoids in response to specific light wavelengths. Despite recent advances, many gaps remain to be understood in the mechanisms of the transduction pathway of light-controlled flavonoid biosynthesis. A better knowledge on these regulatory mechanisms is likely to be useful for breeding programs aiming to modify fruit flavonoid pattern. PMID:25346743

  6. Biosynthesis and metabolism of salicylic acid

    SciTech Connect

    Lee, H.; Leon, J.; Raskin, I.

    1995-05-09

    Pathways of salicylic acid (SA) biosynthesis and metabolism in tobacco have been recently identified. SA, an endogenous regulator of disease resistance, is a product of phenylpropanoid metabolism formed via decarboxylation of trans-cinnamic acid to benzoic acid and its subsequent 2-hydroxylation to SA. In tobacco mosaic virus-inoculated tobacco leaves, newly synthesized SA is rapidly metabolized to SA O-{beta}-D-glucoside and methyl salicylate. Two key enzymes involved in SA biosynthesis and metabolism: benzoic acid 2-hydroxylase, which converts benzoic acid to SA, and UDPglucose:SA glucosyltransferase (EC 2.4.1.35), which catalyzes conversion of SA to SA glucoside have been partially purified and characterized. Progress in enzymology and molecular biology of SA biosynthesis and metabolism will provide a better understanding of signal transduction pathway involved in plant disease resistance. 62 refs., 1 fig.

  7. Bacterial exopolysaccharides: biosynthesis pathways and engineering strategies

    PubMed Central

    Schmid, Jochen; Sieber, Volker; Rehm, Bernd

    2015-01-01

    Bacteria produce a wide range of exopolysaccharides which are synthesized via different biosynthesis pathways. The genes responsible for synthesis are often clustered within the genome of the respective production organism. A better understanding of the fundamental processes involved in exopolysaccharide biosynthesis and the regulation of these processes is critical toward genetic, metabolic and protein-engineering approaches to produce tailor-made polymers. These designer polymers will exhibit superior material properties targeting medical and industrial applications. Exploiting the natural design space for production of a variety of biopolymer will open up a range of new applications. Here, we summarize the key aspects of microbial exopolysaccharide biosynthesis and highlight the latest engineering approaches toward the production of tailor-made variants with the potential to be used as valuable renewable and high-performance products for medical and industrial applications. PMID:26074894

  8. Flavonoids: biosynthesis, biological functions, and biotechnological applications

    PubMed Central

    Falcone Ferreyra, María L.; Rius, Sebastián P.; Casati, Paula

    2012-01-01

    Flavonoids are widely distributed secondary metabolites with different metabolic functions in plants. The elucidation of the biosynthetic pathways, as well as their regulation by MYB, basic helix-loop-helix (bHLH), and WD40-type transcription factors, has allowed metabolic engineering of plants through the manipulation of the different final products with valuable applications. The present review describes the regulation of flavonoid biosynthesis, as well as the biological functions of flavonoids in plants, such as in defense against UV-B radiation and pathogen infection, nodulation, and pollen fertility. In addition, we discuss different strategies and achievements through the genetic engineering of flavonoid biosynthesis with implication in the industry and the combinatorial biosynthesis in microorganisms by the reconstruction of the pathway to obtain high amounts of specific compounds. PMID:23060891

  9. The Terpenoid Biosynthesis Toolkit of Trichoderma.

    PubMed

    Bansal, Ravindra; Mukherjee, Prasun Kumar

    2016-04-01

    The widely used biotechnologically important fungi belonging to the genus Trichoderma are rich sources of secondary metabolites. Even though the genomes of several Trichoderma spp. have been published, and data are available on the genes involved in biosynthesis of non-ribosomal peptide synthetases and polyketide synthases, no genome-wide data are available for the terpenoid biosynthesis machinery in these organisms. In the present study, we have identified the genes involved in terpene biosynthesis in the genomes of three Trichoderma spp., viz., T. virens, T. atroviride and T. reesei. While the genes involved in the condensation steps are highly conserved across the three species, these fungi differed in the number and organization of terpene cyclases. T. virens genome harbours eleven terpene cyclases, while T. atroviride harbours seven, and T. reeseisix in their genomes; seven, three and two being part of putative secondary metabolism related gene clusters. PMID:27396184

  10. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON QSAR

    EPA Science Inventory

    Dyer, S.D., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to predict HC5's Based on QSARs (Abstract). To be presented at the SETAC Europe 14th Annual Meeting: Environmental Science Solution: A Pan-European Perspective, 18-...

  11. Sacrum fracture following L5-S1 stand-alone interbody fusion for isthmic spondylolisthesis.

    PubMed

    Phan, Kevin; Mobbs, Ralph J

    2015-11-01

    We report a 72-year-old man with a rare sacral fracture following stand-alone L5-S1 anterior lumbar interbody fusion for isthmic spondylolisthesis. The man underwent a minimally invasive management strategy using posterior percutaneous pedicle fixation and partial reduction of the deformity. We also discuss the current literature on fusion procedures for isthmic spondylolisthesis. PMID:26100158

  12. 5. S U.S. HIGHWAY 34 AND EAST (ILLINOIS) APPROACH TO ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. S U.S. HIGHWAY 34 AND EAST (ILLINOIS) APPROACH TO BRIDGE WITH EAST BRIDGE HOUSE IN RIGHT FOREGROUND. VIEW TO WEST. - MacArthur Bridge, Spanning Mississippi River on Highway 34 between IA & IL, Burlington, Des Moines County, IA

  13. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON MINIMAL DATA

    EPA Science Inventory

    Dyer, S., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to Predict HC5's Based on Minimal Data (Abstract). To be presented at the SETAC Fourth World Congress, 14-18 November 2004, Portland, OR. 1 p. (ERL,GB R1013).

  14. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    PubMed

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-04-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS. PMID:26488198

  15. [Analysis of 5S rDNA changes in synthetic allopolyploids Triticum x Aegilops].

    PubMed

    Shcherban', A B; Sergeeva, E M; Badaeva, E D; Salina, E A

    2008-01-01

    By the example of three synthetic allopolyploids: Aegilops sharonensis x Ae. umbellulata (2n =28), Triticum urartu x Ae. tauschii (2n =28), T. dicoccoides x Ae. tauschii (2n =42) the 5S rDNA changes at the early stage of allopolyploidization were investigated. Using fluorescent in situ hybridization (FISH), the quantitative changes affecting the separate loci of one of the parental genomes were revealed in plants of S3 generation of each hybrid combination. Souther hybridization with genomic DNA of allopolyploid T. urartu x Ae. tauschii (TMU38 x TQ27) revealed lower intensity of the fragments from Ae. tauschii compared with the T. urartu fragments. It may be confirmation of the reduction of signal on 1D chromosome that was revealed in this hybrid using FISH. Both appearance of a new 5S rDNA fragments and full disappearance of fragments from parental species were not showed by Southern hybridization, as well as PCR-analysis of 5-15 plants of S2-S3 generations. The changes were not found under comparison of primary structure of nine 5S rDNA sequences of allopolyploid TMU38 x TQ27 with analogous sequences from parental species genomes. The observable similarity by FISH results of one of the studied synthetic allopolyploids with natural allopolyploid of similar genome composition indicates the early formation of unique for each allopolyploid 5S rDNA organization. PMID:18856060

  16. Nucleotide sequences of 5S rRNAs from four jellyfishes.

    PubMed

    Hori, H; Ohama, T; Kumazaki, T; Osawa, S

    1982-11-25

    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica. PMID:6130512

  17. Adaptation of the S-5-S pendulum seismometer for measurement of rotational ground motion

    NASA Astrophysics Data System (ADS)

    Knejzlík, Jaromír; Kaláb, Zdeněk; Rambouský, Zdeněk

    2012-10-01

    The Russian electrodynamic seismometer model S-5-S has been adapted for the measurement of rotational ground motion. The mechanical system of the original S-5-S seismometer consists of electrodynamic sensing and damping transducer coils mounted on an asymmetrical double-arm pendulum. This pendulum is suspended on a footing using two pairs of crossed flat springs, which operate as the axis of rotation. The pendulum is stabilised by an additional spring. The S-5-S can be used either as a vertical or as a horizontal sensor. The adaptation of the S-5-S seismometer described below involves removal of the additional spring and installation of an additional mass on the damping arm. Strain gauge angle sensors are installed on one pair of the crossed flat springs. The main dynamic parameters of the rotational seismometer created in this way, i.e. the natural period and damping, are controlled electronically by feedback currents proportional to the angular displacement and angular velocity, both fed to the damping transducer coil. This new seismometer, named the S-5-SR, enables measurement of the rotational component of ground motion around the horizontal or the vertical axes. The output signal from this S-5-SR seismometer can be proportional either to rotational displacement or rotational velocity.

  18. Triterpenoid biosynthesis in Euphorbia lathyris latex

    SciTech Connect

    Hawkins, D.R.

    1987-11-01

    The structures of triterpenols, not previously been known, from Euphorbia lathyris latex are reported. A method for quantifying very small amounts of these compounds was developed. Concerning the biochemistry of the latex, no exogenous cofactors were required for the biosynthesis and the addition of compounds such as NADPAH and ATP do not stimulate the biosynthesis. The addition of DTE or a similar anti-oxidant was found to help reduce the oxidation of the latex, thus increasing the length of time that the latex remains active. The requirement of a divalent cation and the preference for Mn in the pellet was observed. The effect of several inhibitors on the biosynthesis of the triterpenoids was examined. Mevinolin was found to inhibit the biosynthesis of the triterpenoids from acetate, but not mevalonate. A dixon plot of the inhibition of acetate incorporation showed an I/sub 50/ concentration of 3.2 ..mu..M. Fenpropimorph was found to have little or no effect on the biosynthesis. Tridemorph was found to inhibit the biosynthesis of all of the triterpenoids with an I/sub 50/ of 4 ..mu..M. It was also observed that the cyclopropyl containing triterpenols, cycloartenol and 24-methylenecycloartenol were inhibited much more strongly than those containing an 8-9 double bond, lanosterol and 24-methylenelanosterol. The evidence indicates, but does not definetely prove, that lanosterol and 24-methylenelanosterol are not made from cycloartenol and 24-methylenecycloartenol via a ring-opening enzyme such as cycloeucalenol-obtusifoliol isomerase. The possibilty that cycloartenol is made via lanosterol was investigated by synthesizing 4-R-4-/sup 3/H-mevalonic acid and incubating latex with a mixture of this and /sup 14/C-mevalonic acid. From the /sup 3/H//sup 14/C ratio it was shown that cycloartenol and 24-methylenecycloartenol are not made via an intermediate containing as 8-9 double bond. 88 refs., 15 figs., 30 tabs.

  19. The structural biology of phenazine biosynthesis

    PubMed Central

    Blankenfeldt, Wulf; Parsons, James F.

    2014-01-01

    The phenazines are a class of over 150 nitrogen-containing aromatic compounds of bacterial and archeal origin. Their redox properties not only explain their activity as broad-specificity antibiotics and virulence factors but also enable them to function as respiratory pigments, thus extending their importance to the primary metabolism of phenazine-producing species. Despite their discovery in the mid-19th century, the molecular mechanisms behind their biosynthesis have only been unraveled in the last decade. Here, we review the contribution of structural biology that has led to our current understanding of phenazine biosynthesis. PMID:25215885

  20. The structural biology of phenazine biosynthesis.

    PubMed

    Blankenfeldt, Wulf; Parsons, James F

    2014-12-01

    The phenazines are a class of over 150 nitrogen-containing aromatic compounds of bacterial and archeal origin. Their redox properties not only explain their activity as broad-specificity antibiotics and virulence factors but also enable them to function as respiratory pigments, thus extending their importance to the primary metabolism of phenazine-producing species. Despite their discovery in the mid-19th century, the molecular mechanisms behind their biosynthesis have only been unraveled in the last decade. Here, we review the contribution of structural biology that has led to our current understanding of phenazine biosynthesis. PMID:25215885

  1. Biosynthesis and biodegradation of wood components

    SciTech Connect

    Higuchi, T.

    1985-01-01

    A textbook containing 22 chapters by various authors covers the structure of wood, the localization of polysaccharides and lignins in wood cell walls, metabolism and synthetic function of cambial tissue, cell organelles and their function in the biosynthesis of cell wall components, biosynthesis of plant cell wall polysaccharides, lignin, cutin, suberin and associated waxes, phenolic acids and monolignols, quinones, flavonoids, tannins, stilbenes and terpenoid wood extractives, the occurrence of extractives, the metabolism of phenolic acids, wood degradation by micro-organisms and fungi, and biodegradation of cellulose, hemicelluloses, lignin, and aromatic extractives of wood. An index is included.

  2. Biosynthesis of coenzyme Q in eukaryotes.

    PubMed

    Kawamukai, Makoto

    2015-01-01

    Coenzyme Q (CoQ) is a component of the electron transport chain that participates in aerobic cellular respiration to produce ATP. In addition, CoQ acts as an electron acceptor in several enzymatic reactions involving oxidation-reduction. Biosynthesis of CoQ has been investigated mainly in Escherichia coli and Saccharomyces cerevisiae, and the findings have been extended to various higher organisms, including plants and humans. Analyses in yeast have contributed greatly to current understanding of human diseases related to CoQ biosynthesis. To date, human genetic disorders related to mutations in eight COQ biosynthetic genes have been reported. In addition, the crystal structures of a number of proteins involved in CoQ synthesis have been solved, including those of IspB, UbiA, UbiD, UbiX, UbiI, Alr8543 (Coq4 homolog), Coq5, ADCK3, and COQ9. Over the last decade, knowledge of CoQ biosynthesis has accumulated, and striking advances in related human genetic disorders and the crystal structure of proteins required for CoQ synthesis have been made. This review focuses on the biosynthesis of CoQ in eukaryotes, with some comparisons to the process in prokaryotes. PMID:26183239

  3. Cyclopiazonic acid biosynthesis by Aspergillus flavus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cyclopiazonic acid (CPA) is an indole-tetramic acid mycotoxin produced by some strains of Aspergillus flavus. Characterization of the CPA biosynthesis gene cluster confirmed that formation of CPA is via a three-enzyme pathway. This review examines the structure and organization of the CPA genes, elu...

  4. Control of aflatoxin biosynthesis in Aspergilli

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Expression of the genes in the AF biosynthesis cluster is mainly controlled by the pathway specific Cys6Zn2 DNA binding protein, AflR. While AflR appears to be necessary for the activation, a number of coactivators are important for fine-tuning of the timing of AflR’s activity. These proteins, AflJ,...

  5. 1s2s2p2 5p3 5S transition in B ii

    NASA Astrophysics Data System (ADS)

    Mannervik, S.; Cederquist, H.; Martinson, I.; Brage, T.; Froese Fischer, C.

    1987-04-01

    An experimental and theoretical study has been made of the 1s2s2p2 5P-1s2p3 5S transition in B ii. The experimental wavelength and lifetime (1323.92+/-0.07 Å and 0.65+/-0.01 ns), determined by beam-foil spectroscopy, are more than five times more accurate than previous experimental results. Our theoretical data, from multiconfiguration Hartree-Fock calculations, 1311.6 Å and 0.601 ns, are in excellent agreement with previous theoretical predictions of Beck and Nicolaides [Phys. Lett. 61A, 227 (1977)]. We have also observed the 1s2p3 5S-1s2p23s 5P transition, at 857.7+/-0.2 Å, in accord with the theoretical value 859.1 Å.

  6. Phylogenetic analysis of the genera Thiobacillus and Thiomicrospira by 5S rRNA sequences.

    PubMed Central

    Lane, D J; Stahl, D A; Olsen, G J; Heller, D J; Pace, N R

    1985-01-01

    5S rRNA nucleotide sequences from Thiobacillus neapolitanus, Thiobacillus ferrooxidans, Thiobacillus thiooxidans, Thiobacillus intermedius, Thiobacillus perometabolis, Thiobacillus thioparus, Thiobacillus versutus, Thiobacillus novellus, Thiobacillus acidophilus, Thiomicrospira pelophila, Thiomicrospira sp. strain L-12, and Acidiphilium cryptum were determined. A phylogenetic tree, based upon comparison of these and other related 5S rRNA sequences, is presented. The results place the thiobacilli, Thiomicrospira spp., and Acidiphilium spp. in the "purple photosynthetic" bacterial grouping which also includes the enteric, vibrio, pseudomonad, and other familiar eubacterial groups in addition to the purple photosynthetic bacteria. The genus Thiobacillus is not an evolutionarily coherent grouping but rather spans the full breadth of the purple photosynthetic bacteria. PMID:3924899

  7. Optical characterization of CuIn5S8 crystals by ellipsometry measurements

    NASA Astrophysics Data System (ADS)

    Isik, Mehmet; Gasanly, Nizami

    2016-04-01

    Optical properties of CuIn5S8 crystals grown by Bridgman method were investigated by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficients were obtained from the analysis of ellipsometry experiments performed in the 1.2-6.2 eV spectral region. Analysis of spectral dependence of the absorption coefficient revealed the existence of direct band gap transitions with energy 1.53 eV. Wemple-DiDomenico and Spitzer-Fan models were used to find the oscillator energy, dispersion energy, zero-frequency refractive index and high-frequency dielectric constant values. Structural properties of the CuIn5S8 crystals were investigated using X-ray diffraction and energy dispersive spectroscopy analysis.

  8. Ellipsometry study of optical parameters of AgIn5S8 crystals

    NASA Astrophysics Data System (ADS)

    Isik, Mehmet; Gasanly, Nizami

    2015-12-01

    AgIn5S8 crystals grown by Bridgman method were characterized for optical properties by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficient were obtained from ellipsometry experiments carried out in the 1.2-6.2 eV range. Direct band gap energy of 1.84 eV was found from the analysis of absorption coefficient vs. photon energy. The oscillator energy, dispersion energy and zero-frequency refractive index, high-frequency dielectric constant values were found from the analysis of the experimental data using Wemple-DiDomenico and Spitzer-Fan models. Crystal structure and atomic composition ratio of the constituent elements in the AgIn5S8 crystal were revealed from structural characterization techniques of X-ray diffraction and energy dispersive spectroscopy.

  9. Three-step laser excitation of the odd-parity 5s5d 3D → 5s nf 3F states of cadmium

    NASA Astrophysics Data System (ADS)

    Nadeem, Ali; Shah, M.; Haq, S. U.; Shahzada, S.; Mumtaz, M.; Waheed, A.; Nawaz, M.; Ahmed, M.; Baig, M. A.

    2014-07-01

    We report new experimental data on the term energies and effective quantum numbers of the highly excited odd parity states of cadmium in the 71 773-72 500 cm-1 energy range. The experiment was performed using three dye lasers simultaneously pumped by the second harmonic (532 nm) of the Nd;YAG laser. The vapor containment and detection system was a thermionic diode ion detector working in a space charge limited mode. The new observations include the 5snf3F3 (12 ⩽ n ⩽ 52), 5snf3F4 (13 ⩽ n ⩽ 33) and 5snf3F2 (12 ⩽ n ⩽ 22) Rydberg series excited from the 5s5d3D multiplet. A two parameter fit to the transitions energies of the 5snf3F3 series yields the binding energy of the 5snd 2D2 level as 13 042.178 ± 0.02 cm-1 and consequently the first ionization of cadmium is determined as 72 540.05 ± 0.13 cm-1, which is in good agreement with the previously reported value.

  10. Interplay of RNA Pol IV and ROS1 during post-embryonic 5S rDNA chromatin remodeling.

    PubMed

    Douet, Julien; Blanchard, Bertrand; Cuvillier, Claudine; Tourmente, Sylvette

    2008-12-01

    We have investigated the chromatin structure of 5S rDNA, a heterochromatic pericentromeric tandemly repeated family, at 2, 3, 4 and 5 days post-germination. Our results revealed a large-scale reorganization of 5S rDNA chromatin that occurs during the first days of development. Unexpectedly, there is a decondensation followed by a 're'condensation of 5S rDNA chromatin, to obtain almost mature nuclei 5 d post-germination. The reorganization of 5S rDNA chromatin is accompanied by a rapid and active demethylation of 5S rDNA mediated by the ROS1 (repressor of silencing 1) demethylase, whereas the plant-specific RNA polymerase IV (Pol IV) is essential to the 5S chromatin 're'condensation. In conclusion, Pol IV and ROS1 collaborate to unlock the 5S rDNA chromatin inherited from the seed, and establish adult features. PMID:18845569

  11. Molecular phylogenetic studies on filarial parasites based on 5S ribosomal spacer sequences.

    PubMed

    Xie, H; Bain, O; Williams, S A

    1994-06-01

    This paper is the first large-scale molecular phylogenetic study on filarial parasites (family Onchocercidae) which includes 16 species of 6 genera: Brugia beaveri Ash et Little, 1962, B. buckleyi Dissanaike et Paramananthan, 1961; B. malayi (Brug, 1927) Buckley, 1960; B. pahangi (Buckley et Edeson, 1956) Buckley, 1960; B. patei (Buckley, Nelson et Heisch, 1958) Buckley, 1960; B. timori Partono et al, 1977; Wuchereria bancrofti (Cobbold, 1877) Seurat, 1921: W. kalimantani Palmieri. Purnomo, Dennis and Marwoto, 1980: Mansonella perstans (Manson, 1891) Eberhard et Orihel, 1984; loa loc, Stiles, 1905; Onchocerca volvulus (Leuckart, 1983) Railliet er Henry, 1910; O. ochengi Bwangamoi, 1969; O. gutturosa Neumann, 1910; Dirofilaria immitis (Leidy, 1856) Railliet e Henry, 1911; Acanthocheilonema viteae (Krepkogorskaya, 1933) Bain, Baker et Chabaud, 1982 and Litomosoides sigmodontis Chandler, 1931. 5S rRNA gene spacer region sequence data were collected by PCR, cloning and dideoxy sequencing. The 5S rRNA gene spacer region sequences were aligned and analyzed by maximum parsimony algorithms, distance methods and maximum likelihood methods to construct phylogenetic trees. Bootstrap analysis was used to test the robustness of the different phylogenetic reconstructions. The data indicated that 5S spacer region sequences are highly conserved within species yet differ significantly between species. Spliced leader sequences were observed in all of the 5S rDNA spacers with no sequence variation, although flanking region sequence and length heterogeneity was observed even within species. All of the various tree-building methods gave very similar results. This study identified four clades which are strongly supported by bootstrap analysis the Brugia clade; the Wuchereria clade; the Brugia-Wuchereria clade and the Onchocerca clade. The analyses indicated that L. sigmodontis and A. viteae may be the most primitive among the 16 species studied. The data did not show any close

  12. Global determinants of mortality in under 5s: 10 year worldwide longitudinal study

    PubMed Central

    Nacher, Mathieu; Guihenneuc, Chantal; Tubert-Bitter, Pascale; Chavance, Michel

    2013-01-01

    Objective To assess at country level the association of mortality in under 5s with a large set of determinants. Design Longitudinal study. Setting 193 United Nations member countries, 2000-09. Methods Yearly data between 2000 and 2009 based on 12 world development indicators were used in a multivariable general additive mixed model allowing for non-linear relations and lag effects. Main outcome measure National rate of deaths in under 5s per 1000 live births Results The model retained the variables: gross domestic product per capita; percentage of the population having access to improved water sources, having access to improved sanitation facilities, and living in urban areas; adolescent fertility rate; public health expenditure per capita; prevalence of HIV; perceived level of corruption and of violence; and mean number of years in school for women of reproductive age. Most of these variables exhibited non-linear behaviours and lag effects. Conclusions By providing a unified framework for mortality in under 5s, encompassing both high and low income countries this study showed non-linear behaviours and lag effects of known or suspected determinants of mortality in this age group. Although some of the determinants presented a linear action on log mortality indicating that whatever the context, acting on them would be a pertinent strategy to effectively reduce mortality, others had a threshold based relation potentially mediated by lag effects. These findings could help designing efficient strategies to achieve maximum progress towards millennium development goal 4, which aims to reduce mortality in under 5s by two thirds between 1990 and 2015. PMID:24212105

  13. Nucleotide excision repair of the 5 S ribosomal RNA gene assembled into a nucleosome.

    PubMed

    Liu, X; Smerdon, M J

    2000-08-01

    A-175-base pair fragment containing the Xenopus borealis somatic 5 S ribosomal RNA gene was used as a model system to determine the effect of nucleosome assembly on nucleotide excision repair (NER) of the major UV photoproduct (cyclobutane pyrimidine dimer (CPD)) in DNA. Xenopus oocyte nuclear extracts were used to carry out repair in vitro on reconstituted, positioned 5 S rDNA nucleosomes. Nucleosome structure strongly inhibits NER at many CPD sites in the 5 S rDNA fragment while having little effect at a few sites. The time course of CPD removal at 35 different sites indicates that >85% of the CPDs in the naked DNA fragment have t(12) values <2 h, whereas <26% of the t(12) values in nucleosomes are <2 h, and 15% are >8 h. Moreover, removal of histone tails from these mononucleosomes has little effect on the repair rates. Finally, nucleosome inhibition of repair shows no correlation with the rotational setting of a 14-nucleotide-long pyrimidine tract located 30 base pairs from the nucleosome dyad. These results suggest that inhibition of NER by mononucleosomes is not significantly influenced by the rotational orientation of CPDs on the histone surface, and histone tails play little (or no) role in this inhibition. PMID:10821833

  14. Analysis of a 5S rRNA gene cloned from Euplotes eurstomus

    SciTech Connect

    Roberson, A.E.; Wolffe, A.; Olins, D.E.

    1987-05-01

    The macronucleus of the hypotrichous ciliated protozoan Euplotes eurystomus lends itself to the study of eukaryotic gene and chromatin structure because native macronuclear DNA exists as linear, gene-sized fragments between 400 and 20,000 bp in length. The macronuclear chromatin, while arranged in a typical nucleosomal structure, is freely soluble in low ionic strength buffers without treatment by nucleases. Thus, specific genes may be enriched as native, intact chromatin molecules. The 5S rRNA gene from Euplotes has been cloned to facilitate investigation of 5S gene-chromatin following characterization of the gene at the DNA level. It has been demonstrated that the gene, while in circular or linear form, can be transcribed in vitro by a Xenopus oocyte nuclear extract. The transcript generated in vitro is 120 nucleotides in length and is synthesized by RNA polymerase III. Anti-Xenopus TFIIIA antibodies recognize a Euplotes macronuclear chromatin-associated protein which is approx. 80 KD in size. It has been established that the sequence of the telomere flanking the 5S gene in Euplotes eurystomus is the same telomeric sequence published for Euplotes aediculatus.

  15. Two spatially separated phases in semiconducting Rb0.8Fe1.5S2

    DOE PAGESBeta

    Wang, Meng; Tian, Wei; Valdivia, P.; Chi, Songxue; Bourret-Courchesne, E.; Dai, Pengcheng; Birgeneau, R. J.

    2014-09-26

    We report neutron scattering and transport measurements on semiconducting Rb0.8Fe1.5S2, a compound isostructural and isoelectronic to the well-studied A0.8FeySe2(A = K, Rb, Cs, Tl/K) superconducting systems. Both resistivity and DC susceptibility measurements reveal a magnetic phase transition at T = 275 K. Neutron diffraction studies show that the 275 K transition originates from a phase with rhombic iron vacancy order which exhibits an in-plane stripe antiferromagnetic ordering below 275 K. In addition, the stripe antiferromagnetic phase interdigitates mesoscopically with an ubiquitous phase with √5 x√5 iron vacancy order. This phase has a magnetic transition at TN = 425 K andmore » an iron vacancy order-disorder transition at TS = 600 K. These two different structural phases are closely similar to those observed in the isomorphous Se materials. Based on the close similarities of the in-plane antiferromagnetic structures, moments sizes, and ordering temperatures in semiconducting Rb0.8Fe1.5S2 and K0.81Fe1.58Se2, we argue that the in-plane antiferromagnetic order arises from strong coupling between local moments. Superconductivity, previously observed in the A0.8FeySe2₋ zSz system, is absent in A0.8Fe1.5S2, which has a semiconducting ground state. We discuss the implied relationship between stripe and block antiferromagnetism and superconductivity in these materials as well as a strategy for further investigation.« less

  16. SAXS investigation on the temperature dependence of the conformation of Carcinus aestuarii 5S hemocyanin subunit

    NASA Astrophysics Data System (ADS)

    Beltramini, M.; Di Muro, P.; Favilla, R.; La Monaca, A.; Mariani, P.; Sabatucci, A. L.; Salvato, B.; Solari, P. L.

    1999-01-01

    The small-angle X-ray scattering technique has been used to study the spatial distribution of a subunit isolated from Carcinus hemocyanin, in solution at pH 7.5 in the 20°C-40°C temperature range. From the obtained scattering profiles, two species with different gyration radius have been detected by Guinier approximation: one species with Rg1≈25 Å is assigned to the 75 kDa 5S subunit whereas a second species with Rg2≈48 Å, and accounting for ≈3% of the total protein, is attributed to the 450 kDa 16S hexamer. Whereas Rg2 decreases slightly (≈10%) and reversibly on increasing the temperature, Rg2 decreases more markedly (≈30%), but irreversibly. The scattering data have been analysed also on the basis of the impenetrable spheres model and by means of the distance distribution function: the temperature dependence of the geometrical dimensions of the particles is confirmed. In addition, for the 5S subunit also the cross-section gyration radius decreases appreciably (15%) and reversibly with temperature. These results are interpreted on the basis of temperature induced structural rearrangements among the three domains of 5S subunit leading to an increased compactness of the molecule and a more elongated form. In contrast, the effect on the hexamer is assigned to its irreversible dissociation to monomers. This interpretation agrees with the analysis of the distance distribution functions, calculated from the Fourier's transforms of the scattering curves at the different temperatures.

  17. Magic wavelengths for the 5 s -18 s transition in rubidium

    NASA Astrophysics Data System (ADS)

    Goldschmidt, E. A.; Norris, D. G.; Koller, S. B.; Wyllie, R.; Brown, R. C.; Porto, J. V.; Safronova, U. I.; Safronova, M. S.

    2015-03-01

    Magic wavelengths, for which there is no differential ac Stark shift for the ground and excited state of the atom, allow trapping of excited Rydberg atoms without broadening the optical transition. This is an important tool for implementing quantum gates and other quantum information protocols with Rydberg atoms, and reliable theoretical methods to find such magic wavelengths are thus extremely useful. We use a high-precision all-order method to calculate magic wavelengths for the 5 s -18 s transition of rubidium, and compare the calculation to experiment by measuring the light shift for atoms held in an optical dipole trap at a range of wavelengths near a calculated magic value.

  18. Nucleotide sequences of 5S ribosomal RNA from four oomycete and chytrid water molds.

    PubMed

    Walker, W F; Doolittle, W F

    1982-09-25

    The nucleotide sequences of the 5S rRNAs of the oomycete water molds Saprolegnia ferax and Pythium hydnosporum and of the chytrid water molds Blastocladiella simplex and Phlyctochytrium irregulare were determined by chemical and enzymatic partial degradation of 3' and 5' end-labelled molecules, followed by gel sequence analysis. The two oomycete sequences differed in 24 positions and the two chytrid sequences differed in 27 positions. These pairs differed in a mean of 44 positions. The chytrid sequences clearly most resemble the sequence from the zygomycete Phycomyces, while the oomycete sequences appear to be allied with those from protozoa and slime molds. PMID:6890670

  19. Minimally invasive L5-S1 oblique lumbar interbody fusion with anterior plate.

    PubMed

    Pham, Martin H; Jakoi, Andre M; Hsieh, Patrick C

    2016-07-01

    Lumbar interbody fusion is an important technique for the treatment of degenerative disc disease and degenerative scoliosis. The oblique lumbar interbody fusion (OLIF) establishes a minimally invasive retroperitoneal exposure anterior to the psoas and lumbar plexus. In this video case presentation, the authors demonstrate the techniques of the OLIF at L5-S1 performed on a 69-year-old female with degenerative scoliosis as one component of an overall strategy for her deformity correction. The video can be found here: https://youtu.be/VMUYWKLAl0g . PMID:27364428

  20. Complete biosynthesis of opioids in yeast.

    PubMed

    Galanie, Stephanie; Thodey, Kate; Trenchard, Isis J; Filsinger Interrante, Maria; Smolke, Christina D

    2015-09-01

    Opioids are the primary drugs used in Western medicine for pain management and palliative care. Farming of opium poppies remains the sole source of these essential medicines, despite diverse market demands and uncertainty in crop yields due to weather, climate change, and pests. We engineered yeast to produce the selected opioid compounds thebaine and hydrocodone starting from sugar. All work was conducted in a laboratory that is permitted and secured for work with controlled substances. We combined enzyme discovery, enzyme engineering, and pathway and strain optimization to realize full opiate biosynthesis in yeast. The resulting opioid biosynthesis strains required the expression of 21 (thebaine) and 23 (hydrocodone) enzyme activities from plants, mammals, bacteria, and yeast itself. This is a proof of principle, and major hurdles remain before optimization and scale-up could be achieved. Open discussions of options for governing this technology are also needed in order to responsibly realize alternative supplies for these medically relevant compounds. PMID:26272907

  1. Chemical genetics to examine cellulose biosynthesis

    PubMed Central

    Brabham, Chad; DeBolt, Seth

    2013-01-01

    Long-term efforts to decode plant cellulose biosynthesis via molecular genetics and biochemical strategies are being enhanced by the ever-expanding scale of omics technologies. An alternative approach to consider are the prospects for inducing change in plant metabolism using exogenously supplied chemical ligands. Cellulose biosynthesis inhibitors (CBIs) have been identified among known herbicides, during diverse combinatorial chemical libraries screens, and natural chemical screens from microbial agents. In this review, we summarize the current knowledge of the inhibitory effects of CBIs and further group them by how they influence fluorescently tagged cellulose synthase A proteins. Additional attention is paid to the continuing development of the CBI toolbox to explore the cell biology and genetic mechanisms underpinning effector molecule activity. PMID:23372572

  2. Structural basis for phosphatidylinositol-phosphate biosynthesis

    PubMed Central

    Clarke, Oliver B.; Tomasek, David; Jorge, Carla D.; Dufrisne, Meagan Belcher; Kim, Minah; Banerjee, Surajit; Rajashankar, Kanagalaghatta R.; Shapiro, Lawrence; Hendrickson, Wayne A.; Santos, Helena; Mancia, Filippo

    2015-01-01

    Phosphatidylinositol is critical for intracellular signalling and anchoring of carbohydrates and proteins to outer cellular membranes. The defining step in phosphatidylinositol biosynthesis is catalysed by CDP-alcohol phosphotransferases, transmembrane enzymes that use CDP-diacylglycerol as donor substrate for this reaction, and either inositol in eukaryotes or inositol phosphate in prokaryotes as the acceptor alcohol. Here we report the structures of a related enzyme, the phosphatidylinositol-phosphate synthase from Renibacterium salmoninarum, with and without bound CDP-diacylglycerol to 3.6 and 2.5 Å resolution, respectively. These structures reveal the location of the acceptor site, and the molecular determinants of substrate specificity and catalysis. Functional characterization of the 40%-identical ortholog from Mycobacterium tuberculosis, a potential target for the development of novel anti-tuberculosis drugs, supports the proposed mechanism of substrate binding and catalysis. This work therefore provides a structural and functional framework to understand the mechanism of phosphatidylinositol-phosphate biosynthesis. PMID:26510127

  3. Ceramide biosynthesis and metabolism in trophoblast syncytialization.

    PubMed

    Singh, Ambika T; Dharmarajan, Arunasalam; Aye, Irving L M H; Keelan, Jeffrey A

    2012-10-15

    Sphingolipid mediators such as ceramide are pleiotropic regulators of cellular growth, differentiation and apoptosis. We investigated the role of ceramide biosynthesis, metabolism and actions in term human cytotrophoblasts syncytialized over 7 days in culture. Intracellular C16 ceramide levels increased modestly after 3 days in culture, then declined. Ceramidase was present at particularly high levels in syncytialized trophoblasts; inhibition of ceramidase reduced the degree of cell fusion. Exposure to short chain C8 ceramide or aSMase enhanced secretion of the differentiation marker hCG without affecting fusion or cell viability. In contrast, pharmacological inhibition of ceramidase reduced the extent of fusion. Inhibition of the ceramide-responsive JNK and PP2A pathways did not abolish the effects of ceramide, and JNK phosphorylation was unresponsive to ceramide; however, ceramide significantly inhibited phosphorylation of Akt. This study suggests that changes in ceramide biosynthesis and metabolism play a differential role in the biochemical and morphological features of trophoblast differentiation. PMID:22652149

  4. Structural basis for phosphatidylinositol-phosphate biosynthesis.

    PubMed

    Clarke, Oliver B; Tomasek, David; Jorge, Carla D; Dufrisne, Meagan Belcher; Kim, Minah; Banerjee, Surajit; Rajashankar, Kanagalaghatta R; Shapiro, Lawrence; Hendrickson, Wayne A; Santos, Helena; Mancia, Filippo

    2015-01-01

    Phosphatidylinositol is critical for intracellular signalling and anchoring of carbohydrates and proteins to outer cellular membranes. The defining step in phosphatidylinositol biosynthesis is catalysed by CDP-alcohol phosphotransferases, transmembrane enzymes that use CDP-diacylglycerol as donor substrate for this reaction, and either inositol in eukaryotes or inositol phosphate in prokaryotes as the acceptor alcohol. Here we report the structures of a related enzyme, the phosphatidylinositol-phosphate synthase from Renibacterium salmoninarum, with and without bound CDP-diacylglycerol to 3.6 and 2.5 Å resolution, respectively. These structures reveal the location of the acceptor site, and the molecular determinants of substrate specificity and catalysis. Functional characterization of the 40%-identical ortholog from Mycobacterium tuberculosis, a potential target for the development of novel anti-tuberculosis drugs, supports the proposed mechanism of substrate binding and catalysis. This work therefore provides a structural and functional framework to understand the mechanism of phosphatidylinositol-phosphate biosynthesis. PMID:26510127

  5. Structural basis for phosphatidylinositol-phosphate biosynthesis

    NASA Astrophysics Data System (ADS)

    Clarke, Oliver B.; Tomasek, David; Jorge, Carla D.; Dufrisne, Meagan Belcher; Kim, Minah; Banerjee, Surajit; Rajashankar, Kanagalaghatta R.; Shapiro, Lawrence; Hendrickson, Wayne A.; Santos, Helena; Mancia, Filippo

    2015-10-01

    Phosphatidylinositol is critical for intracellular signalling and anchoring of carbohydrates and proteins to outer cellular membranes. The defining step in phosphatidylinositol biosynthesis is catalysed by CDP-alcohol phosphotransferases, transmembrane enzymes that use CDP-diacylglycerol as donor substrate for this reaction, and either inositol in eukaryotes or inositol phosphate in prokaryotes as the acceptor alcohol. Here we report the structures of a related enzyme, the phosphatidylinositol-phosphate synthase from Renibacterium salmoninarum, with and without bound CDP-diacylglycerol to 3.6 and 2.5 Å resolution, respectively. These structures reveal the location of the acceptor site, and the molecular determinants of substrate specificity and catalysis. Functional characterization of the 40%-identical ortholog from Mycobacterium tuberculosis, a potential target for the development of novel anti-tuberculosis drugs, supports the proposed mechanism of substrate binding and catalysis. This work therefore provides a structural and functional framework to understand the mechanism of phosphatidylinositol-phosphate biosynthesis.

  6. Complete biosynthesis of opioids in yeast

    PubMed Central

    Galanie, Stephanie; Thodey, Kate; Trenchard, Isis J.; Interrante, Maria Filsinger; Smolke, Christina D.

    2016-01-01

    Opioids are the primary drugs used in Western medicine for pain management and palliative care. Farming of opium poppies remains the sole source of these essential medicines despite diverse market demands and uncertainty in crop yields due to weather, climate change, and pests. Here, we engineered yeast to produce the selected opioid compounds thebaine and hydrocodone starting from sugar. All work was conducted in a laboratory that is permitted and secured for work with controlled substances. We combined enzyme discovery, enzyme engineering, and pathway and strain optimization to realize full opiate biosynthesis in yeast. The resulting opioid biosynthesis strains required expression of 21 (thebaine) and 23 (hydrocodone) enzyme activities from plants, mammals, bacteria, and yeast itself. This is a proof-of-principle, and major hurdles remain before optimization and scale up could be achieved. Open discussions of options for governing this technology are also needed in order to responsibly realize alternative supplies for these medically relevant compounds. PMID:26272907

  7. Refinement of the spinal muscular atrophy locus to the interval between D5S435 and MAP1B

    SciTech Connect

    Soares, V.M.; Brzustowicz, L.M.; Kleyn, P.W.; Knowles, J.A.; Palmer, D.A.; Asokan, S.; Penchaszadeh, G.K.; Gilliam, T.C. ); Munsat, T.L. )

    1993-02-01

    The childhood-onset SMA locus has been mapped to chromosome 5q13, in a region bounded by the proximal locus, D5S6, and the closely linked distal loci, D5S112 and MAP1B. We now describe a highly polymorphic, tightly linked microsatellite marker (D5S435) that is very likely the closet proximal marker to the SMA locus. Multipoint linkage analysis firmly establishes the following order of markers at 5q13; centromere-D5S76-D5S6-D5S435-MAP1B/D5S112-D5S39-telomere. The data indicate that SMA resides in an approximately 0.7-cM (range 01.-2.1) region between D5S435 and MAP1B. This finding reduces by approximately fourfold the genetic region that most likely harbors the SMA locus and will facilitate the physical mapping and cloning of the disease gene region. 24 refs., 3 figs., 1 tab.

  8. Precursor activation in a pyoverdine biosynthesis.

    PubMed

    Menhart, N; Viswanatha, T

    1990-03-29

    The siderophore produced by Azotobacter vinelandii strain UW belongs to a large family of peptidic siderophores collectively called pyoverdines. The biosynthesis of the peptidyl moiety of this siderophore was shown to involve activation of the constituent amino acids as their adenylates, as demonstrated by amino acid-dependent ATP-[32P]pyrophosphate exchange. The enzyme system responsible for this activation was partially purified by chromatographic techniques. PMID:2156571

  9. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    NASA Astrophysics Data System (ADS)

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-03-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system.

  10. Intraspecific and Interspecific Variation in 5s RNA Genes Are Decoupled in Diploid Wheat Relatives

    PubMed Central

    Kellogg, E. A.; Appels, R.

    1995-01-01

    5S RNAs form part of the ribosome in most organisms. In some, e.g., prokaryotes and some fungi, the genes are part of the ribosomal operon, but in most eukaryotes they are in tandem arrays of hundreds to thousands of copies separate from the main ribosomal array. 5S RNA genes can be aligned across kingdoms. We were therefore surprised to find that, for 28 diploid species of the wheat tribe (Triticeae), nucleotide diversity within an array is up to 6.2% in the genes, not significantly different from that of the nontranscribed spacers. Rates of concerted evolution must therefore be insufficient to homogenize the entire array. Between species, there are significantly fewer fixed differences in the gene than would be expected, given the high within-species variation. In contrast, the amount of variation between species in the spacer is the same as or greater than that within individuals. This leads to a paradox. High variation within an individual suggests that there is little selection on any particular gene within an array. But conservation of the gene across species implies that polymorphisms are periodically eliminated at a rate approximately equal to or greater than that of speciation. Levels of intraspecific polymorphism and interspecific divergence are thus decoupled. This implies that selective mechanisms exist to eliminate mutations in the gene without also affecting the spacer. PMID:7635297

  11. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure.

    PubMed

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-01-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30-70 K in pressure range of 100-170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50-70 K in pressure range of 100-150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  12. Magnetization reversal phenomena in (Cr0.70Ti0.30)5S6

    NASA Astrophysics Data System (ADS)

    Hashimoto, Satoshi; Matsuda, Yuji; Sato, Tetsuya; Anzai, Shuichiro

    2005-12-01

    Magnetization reversal phenomena (MRP) along magnetic order-order transitions have recently been reported on impurity-doped magnetic systems. Because imperfect long-range magnetic order exists in these systems, it is expected that a systematic investigation of MRP will give physical information on thermomagnetic processes of magnetic systems in the range from the micro- to nanoscales. As a typical order-order transition (a state doubly modulated by helical and canting orders to a collinear ferrimagnetic state) has been known to occur on Cr5S6 at a transition temperature Tt, we investigate the magnetizations of (Cr0.70Ti0.30)5S6 on heating and cooling runs in various magnetic fields. At 20Oe, the field-cooled magnetization just below the Curie temperature has a positive sign; the sign turns negative below the compensation temperature TCM (first step) and finally returns to positive below Tt (second step). The first-step MRP observed in this system is explained by the potential barriers resulting from anisotropy energy when the preferred direction of collinear ferrimagnetic moment reverses. The proposed mechanism for second-step MRP is the pinning effect caused by the impurity atoms (Ti) in the helical long-range-order chains. Comparing other examples of MRPs, we discuss the roles of local impurity centers in the thermomagnetic process in magnetic order-order transitions.

  13. Construction of the mycoplasma evolutionary tree from 5S rRNA sequence data.

    PubMed Central

    Rogers, M J; Simmons, J; Walker, R T; Weisburg, W G; Woese, C R; Tanner, R S; Robinson, I M; Stahl, D A; Olsen, G; Leach, R H

    1985-01-01

    The 5S rRNA sequences of eubacteria and mycoplasmas have been analyzed and a phylogenetic tree constructed. We determined the sequences of 5S rRNA from Clostridium innocuum, Acholeplasma laidlawii, Acholeplasma modicum, Anaeroplasma bactoclasticum, Anaeroplasma abactoclasticum, Ureaplasma urealyticum, Mycoplasma mycoides mycoides, Mycoplasma pneumoniae, and Mycoplasma gallisepticum. Analysis of these and published sequences shows that mycoplasmas form a coherent phylogenetic group that, with C. innocuum, arose as a branch of the low G+C Gram-positive tree, near the lactobacilli and streptococci. The initial event in mycoplasma phylogeny was formation of the Acholeplasma branch; hence, loss of cell wall probably occurred at the time of genome reduction to approximately to 1000 MDa. A subsequent branch produced the Spiroplasma. This branch appears to have been the origin of sterol-requiring mycoplasmas. During development of the Spiroplasma branch there were several independent genome reductions, each to approximately 500 MDa, resulting in Mycoplasma and Ureaplasma species. Mycoplasmas, particularly species with the smallest genomes, have high mutation rates, suggesting that they are in a state of rapid evolution. PMID:2579388

  14. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    PubMed Central

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-01-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  15. Moss cell walls: structure and biosynthesis

    PubMed Central

    Roberts, Alison W.; Roberts, Eric M.; Haigler, Candace H.

    2012-01-01

    The genome sequence of the moss Physcomitrella patens has stimulated new research examining the cell wall polysaccharides of mosses and the glycosyl transferases that synthesize them as a means to understand fundamental processes of cell wall biosynthesis and plant cell wall evolution. The cell walls of mosses and vascular plants are composed of the same classes of polysaccharides, but with differences in side chain composition and structure. Similarly, the genomes of P. patens and angiosperms encode the same families of cell wall glycosyl transferases, yet, in many cases these families have diversified independently in each lineage. Our understanding of land plant evolution could be enhanced by more complete knowledge of the relationships among glycosyl transferase functional diversification, cell wall structural and biochemical specialization, and the roles of cell walls in plant adaptation. As a foundation for these studies, we review the features of P. patens as an experimental system, analyses of cell wall composition in various moss species, recent studies that elucidate the structure and biosynthesis of cell wall polysaccharides in P. patens, and phylogenetic analysis of P. patens genes potentially involved in cell wall biosynthesis. PMID:22833752

  16. Tetrahydrobiopterin biosynthesis, utilization and pharmacological effects.

    PubMed

    Werner-Felmayer, G; Golderer, G; Werner, E R

    2002-04-01

    Tetrahydrobiopterin (H4-biopterin) is an essential cofactor of a set of enzymes that are of central metabolic importance, i.e. the hydroxylases of the three aromatic amino acids phenylalanine, tyrosine, and tryptophan, of ether lipid oxidase, and of the three nitric oxide synthase (NOS) isoenzymes. As a consequence, H4-biopterin plays a key role in a vast number of biological processes and pathological states associated with neurotransmitter formation, vasorelaxation, and immune response. In mammals, its biosynthesis is controlled by hormones, cytokines and certain immune stimuli. This review aims to summarize recent developments concerning regulation of H4-biopterin biosynthetic and regulatory enzymes and pharmacological effects of H4-biopterin in various conditions, e.g. endothelial dysfunction or apoptosis of neuronal cells. Also, approaches towards gene therapy of diseases like the different forms of phenylketonuria or of Parkinson's disease are reviewed. Additional emphasis is given to H4-biopterin biosynthesis and function in non-mammalian species such as fruit fly, zebra fish, fungi, slime molds, the bacterium Nocardia as well as to the parasitic protozoan genus of Leishmania that is not capable of pteridine biosynthesis but has evolved a sophisticated salvage network for scavenging various pteridine compounds, notably folate and biopterin. PMID:12003348

  17. Regulation of Leucine Biosynthesis in Bacillus subtilis

    PubMed Central

    Ward, Jonathan B.; Zahler, Stanley A.

    1973-01-01

    The biosynthesis of α-isopropylmalate (αIPM) synthetase, IPM isomerase, and βIPM dehydrogenase in Bacillus subtilis can be derepressed in leucine auxotrophs by limiting them for leucine. The derepression of the three enzymes is apparently coordinate. A class of mutants resistant to 4-azaleucine excretes leucine and has derepressed levels of all three enzymes. The azaleucine-resistance mutations may lie in a gene (azlA) encoding a repressor. Efforts to find mutations characteristic of a constitutive operator have been unsuccessful. No polar mutations have been found among nine leucine auxotrophs that have characteristics of frameshift mutations. The enzyme catalyzing the first step in leucine biosynthesis, αIPM synthetase, is sensitive to feedback inhibition by leucine. We conclude that leucine biosynthesis is controlled by the inhibition of the activity of the first biosynthetic enzyme by leucine, and by the repression of the synthesis of the first three biosynthetic enzymes by leucine. The repression of the three enzymes may be under the control of a single repressor and a single operator, or of a single repressor and a separate operator for each structural gene. PMID:4200854

  18. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site

    PubMed Central

    Calviño, Fabiola R.; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-01-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1–RpL5-N–RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1–RpL5–RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP. PMID:25849277

  19. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    PubMed

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-01-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP. PMID:25849277

  20. Electric-dipole 5s - 5p Transitions in Promethiumlike Ions

    SciTech Connect

    Vilkas, M J; Ishikawa, Y; Trabert, E

    2008-02-29

    The 5s-5p electric-dipole resonance transitions in highly ionized promethiumlike ions have been studied applying relativistic multi-reference Moeller-Plesset second-order perturbation theory. The transition wavelengths are determined to within 0.2 {angstrom} in the more highly charged ions, where the level degeneracies are small. For somewhat lighter ions a very large reference space was used in order to account for the many degeneracies. In order to calculate transition probabilities and lifetimes, correlation corrections have been added to the transition operator in the next order. The contributions from the higher orders of the theory, that is, frequency-dependent Breit correction, Lamb shift, and mass shifts, have been estimated. The results are used to re-assess spectroscopic data from beam-foil, electron beam ion trap, and tokamak observations.

  1. Solution-Based Processing of the Phase-Change Material KSb5S8

    SciTech Connect

    Mitzi,D.; Raoux, S.; Schrott, A.; Copel, M.; Kellock, A.; Jordan-Sweet, J.

    2006-01-01

    A hydrazine-based process for solution-depositing phase-change materials (PCMs) is demonstrated, using KSb{sub 5}S{sub 8} (KSS) as an example. The process involves dissolving the elemental metals and chalcogen in hydrazine at room temperature and spin-coating the solution onto a substrate, followed by a short low-temperature (T {<=} 250 C) anneal. The spin-coated KSS films, which range in thickness from 10 to 90 nm, are examined using variable temperature X-ray diffraction, medium energy ion scattering (MEIS), Rutherford backscattering spectroscopy (RBS), and scanning electron microscopy (SEM). The spin-coated KSS films exhibit a reversible amorphous-crystalline transition with a relatively high crystallization temperature ({approx}280 C). Selected other chalcogenide-based PCMs are also expected to be suitable for thin-film deposition using this approach.

  2. Minimally Invasive Approach For Extraforaminal Synovial Cyst L5-S1

    PubMed Central

    Torres Campa-Santamarina, Jose; Towne, Sara; Alimi, Marjan; Härtl, Roger

    2015-01-01

    Symptoms from synovial cysts are produced by neural compression in the spinal canal or the foramen. Few cases of extraforaminal synovial cyst have been published in the literature. This is a case report of a 65-year-old female who presented with a three-month history of sciatic pain and no relief with conservative treatment. MRI showed a left-sided extraforaminal synovial cyst at L5-S1 with compression of the L5 nerve root at the lateral portion of the foramen. Minimally invasive surgery for resection was performed using an extraforaminal tubular microscopic endoscopy-assisted approach. The patient improved clinically and remained symptom-free for the entire follow-up of 30 months. PMID:26623217

  3. Magic wavelengths for the 5 s - 18 s transition in rubidium

    NASA Astrophysics Data System (ADS)

    Goldschmidt, Elizabeth; Norris, David; Koller, Silvio; Wyllie, Robert; Brown, Roger; Porto, Trey; Safronova, Ulyana; Safronova, Marianna

    2015-05-01

    Magic wavelengths, for which there is no differential ac Stark shift for the ground and excited state of the atom, allow trapping of excited Rydberg atoms without broadening the optical transition. This is an important tool for implementing quantum gates and other quantum information protocols with Rydberg atoms, and reliable theoretical methods to find such magic wavelengths are thus extremely useful. We use a high-precision all-order method to calculate magic wavelengths for the 5 s - 18 s transition of rubidium near the 18 s - 6 p resonances. We compare the calculation to experiment by measuring the light shift for atoms held in a crossed optical dipole trap with wavelength tuned around the 18 s - 6p3 / 2 resonance at the experimentally convenient wavelength of 1064 nm.

  4. Phylogenetic tree derived from bacterial, cytosol and organelle 5S rRNA sequences.

    PubMed Central

    Küntzel, H; Heidrich, M; Piechulla, B

    1981-01-01

    A phylogenetic tree was constructed by computer analysis of 47 completely determined 5S rRNA sequences. The wheat mitochondrial sequence is significantly more related to prokaryotic than to eukaryotic sequences, and its affinity to that of the thermophilic Gram-negative bacterium Thermus aquaticus is comparable to the affinity between Anacystis nidulans and chloroplastic sequences. This strongly supports the idea of an endosymbiotic origin of plant mitochondria. A comparison of the plant cytosol and chloroplast sub-trees suggests a similar rate of nucleotide substitution in nuclear genes and chloroplastic genes. Other features of the tree are a common precursor of protozoa and metazoa, which appears to be more related to the fungal than to the plant protosequence, and an early divergence of the archebacterial sequence (Halobacterium cutirubrum) from the prokaryotic branch. PMID:6785727

  5. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    NASA Technical Reports Server (NTRS)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  6. Classification of 5-S Epileptic EEG Recordings Using Distribution Entropy and Sample Entropy

    PubMed Central

    Li, Peng; Karmakar, Chandan; Yan, Chang; Palaniswami, Marimuthu; Liu, Changchun

    2016-01-01

    Epilepsy is an electrophysiological disorder of the brain, the hallmark of which is recurrent and unprovoked seizures. Electroencephalogram (EEG) measures electrical activity of the brain that is commonly applied as a non-invasive technique for seizure detection. Although a vast number of publications have been published on intelligent algorithms to classify interictal and ictal EEG, it remains an open question whether they can be detected using short-length EEG recordings. In this study, we proposed three protocols to select 5 s EEG segment for classifying interictal and ictal EEG from normal. We used the publicly-accessible Bonn database, which consists of normal, interical, and ictal EEG signals with a length of 4097 sampling points (23.6 s) per record. In this study, we selected three segments of 868 points (5 s) length from each recordings and evaluated results for each of them separately. The well-studied irregularity measure—sample entropy (SampEn)—and a more recently proposed complexity measure—distribution entropy (DistEn)—were used as classification features. A total of 20 combinations of input parameters m and τ for the calculation of SampEn and DistEn were selected for compatibility. Results showed that SampEn was undefined for half of the used combinations of input parameters and indicated a large intra-class variance. Moreover, DistEn performed robustly for short-length EEG data indicating relative independence from input parameters and small intra-class fluctuations. In addition, it showed acceptable performance for all three classification problems (interictal EEG from normal, ictal EEG from normal, and ictal EEG from interictal) compared to SampEn, which showed better results only for distinguishing normal EEG from interictal and ictal. Both SampEn and DistEn showed good reproducibility and consistency, as evidenced by the independence of results on analysing protocol. PMID:27148074

  7. Simple detection of the 5S ribosomal RNA of Pneumocystis carinii using in situ hybridisation.

    PubMed Central

    Kobayashi, M; Urata, T; Ikezoe, T; Hakoda, E; Uemura, Y; Sonobe, H; Ohtsuki, Y; Manabe, T; Miyagi, S; Miyoshi, I

    1996-01-01

    AIMS: To investigate the effectiveness of digoxigenin incorporated double stranded DNA probes produced by the polymerase chain reaction (PCR), for the detection of Pneumocystis carinii, using in situ hybridisation (ISH). METHODS: Formalin fixed, paraffin wax embedded sections of 26 human lung samples from 11 patients with P carinii pneumonia (PCP), and 15 with various types of fungal and viral pneumonia, were obtained during necropsy or transbronchial lung biopsy. Three additional PCP induced rat lung samples were also tested. PCR probes were prepared using the digoxigenin labelling mixture, and they were amplified from the DNA of a PCP induced rat lung after administration of dexamethasone, on the basis that 5S ribosomal RNA sequences are identical in human and rat P carinii. ISH was performed using this probe, and visualised using the digoxigenin nucleic acid detection kit. An immunohistochemical study using anti-human Pneumocystis monoclonal antibody was also carried out in parallel. RESULTS: ISH positively stained eight (of eight) lung necropsy specimens from patients with PCP, three (of three) transbronchial lung biopsy specimens from patients with PCP, and none of the three PCP induced rat lung specimens. In contrast, none of the specimens from patients with pneumonia caused by Aspergillus sp (n = 5), Candida sp (n = 4), Cryptococcus sp (n = 2), mucormycosis (n = 2), or cytomegalovirus (n = 2) were positive on ISH or immunohistochemistry. CONCLUSIONS: Using a digoxigenin labelled PCR probe for the entire 5S rRNA sequence in conjunction with conventional staining, ISH is highly reactive and specific for the diagnosis of PCP. Images PMID:9038753

  8. Metabolic flux analysis of diterpene biosynthesis pathway in rice.

    PubMed

    Chang, Yung-Jin; Kim, Bo-Ra; Kim, Soo-Un

    2005-09-01

    Relative transcript levels of eight rice diterpene cyclases at the branch points of gibberellins and phytoalexins biosynthesis pathway were measured by reverse transcription quantitative PCR. Metabolic flux analysis by the distribution ratio of common substrate showed that UV-irradiation of etiolated rice seedlings decreased the flux for primary metabolism of gibberellins biosynthesis by half (from 62 to 27%) and 41% of geranylgeranyl pyrophosphate was used for induction of pimaradiene intermediate as the major phytoalexin. In comparison, light-illumination used almost all geranylgeranyl pyrophosphate (96%) for gibberellin biosynthesis to stimulate the plant growth and strongly repressed the metabolic flux for phytoalexins biosynthesis. PMID:16215852

  9. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells

    PubMed Central

    Cao, Weibiao

    2016-01-01

    Mechanisms of the progression from Barrett’s esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK) inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA. PMID:26901778

  10. Computer aided gene mining for gingerol biosynthesis.

    PubMed

    James, Priyanka; Baby, Bincy; Charles, SonaSona; Nair, Lekshmysree Saraschandran; Nazeem, Puthiyaveetil Abdulla

    2015-01-01

    Inspite of the large body of genomic data obtained from the transcriptome of Zingiber officinale, very few studies have focused on the identification and characterization of miRNAs in gingerol biosynthesis. Zingiber officinale transcriptome was analyzed using EST dataset (38169 total) deposited in public domains. In this paper computational functional annotation of the available ESTs and identification of genes which play a significant role in gingerol biosynthesis are described. Zingiber officinale transcriptome was analyzed using EST dataset (38169 total) from ncbi. ESTs were clustered and assembled, resulting in 8624 contigs and 8821 singletons. Assembled dataset was then submitted to the EST functional annotation workflow including blast, gene ontology (go) analysis, and pathway enrichment by kyoto encyclopedia of genes and genomes (kegg) and interproscan. The unigene datasets were further exploited to identify simple sequence repeats that enable linkage mapping. A total of 409 simple sequence repeats were identified from the contigs. Furthermore we examined the existence of novel miRNAs from the ESTs in rhizome, root and leaf tissues. EST analysis revealed the presence of single hypothetical miRNA in rhizome tissue. The hypothetical miRNA is warranted to play an important role in controlling genes involved in gingerol biosynthesis and hence demands experimental validation. The assembly and associated information of transcriptome data provides a comprehensive functional and evolutionary characterization of genomics of Zingiber officinale. As an effort to make the genomic and transcriptomic data widely available to the public domain, the results were integrated into a web-based Ginger EST database which is freely accessible at http://www.kaubic.in/gingerest/. PMID:26229293

  11. The Biosynthesis of Capuramycin-type Antibiotics

    PubMed Central

    Cai, Wenlong; Goswami, Anwesha; Yang, Zhaoyong; Liu, Xiaodong; Green, Keith D.; Barnard-Britson, Sandra; Baba, Satoshi; Funabashi, Masanori; Nonaka, Koichi; Sunkara, Manjula; Morris, Andrew J.; Spork, Anatol P.; Ducho, Christian; Garneau-Tsodikova, Sylvie; Thorson, Jon S.; Van Lanen, Steven G.

    2015-01-01

    A-500359s, A-503083s, and A-102395 are capuramycin-type nucleoside antibiotics that were discovered using a screen to identify inhibitors of bacterial translocase I, an essential enzyme in peptidoglycan cell wall biosynthesis. Like the parent capuramycin, A-500359s and A-503083s consist of three structural components: a uridine-5′-carboxamide (CarU), a rare unsaturated hexuronic acid, and an aminocaprolactam, the last of which is substituted by an unusual arylamine-containing polyamide in A-102395. The biosynthetic gene clusters for A-500359s and A-503083s have been reported, and two genes encoding a putative non-heme Fe(II)-dependent α-ketoglutarate:UMP dioxygenase and an l-Thr:uridine-5′-aldehyde transaldolase were uncovered, suggesting that C–C bond formation during assembly of the high carbon (C6) sugar backbone of CarU proceeds from the precursors UMP and l-Thr to form 5′-C-glycyluridine (C7) as a biosynthetic intermediate. Here, isotopic enrichment studies with the producer of A-503083s were used to indeed establish l-Thr as the direct source of the carboxamide of CarU. With this knowledge, the A-102395 gene cluster was subsequently cloned and characterized. A genetic system in the A-102395-producing strain was developed, permitting the inactivation of several genes, including those encoding the dioxygenase (cpr19) and transaldolase (cpr25), which abolished the production of A-102395, thus confirming their role in biosynthesis. Heterologous production of recombinant Cpr19 and CapK, the transaldolase homolog involved in A-503083 biosynthesis, confirmed their expected function. Finally, a phosphotransferase (Cpr17) conferring self-resistance was functionally characterized. The results provide the opportunity to use comparative genomics along with in vivo and in vitro approaches to probe the biosynthetic mechanism of these intriguing structures. PMID:25855790

  12. Caste-Selective Pheromone Biosynthesis in Honeybees

    NASA Astrophysics Data System (ADS)

    Plettner, Erika; Slessor, Keith N.; Winston, Mark L.; Oliver, James E.

    1996-03-01

    Queen and worker honeybees (Apis mellifera L.) produce a caste-related blend of functionalized 8- and 10-carbon fatty acids in their mandibular glands. The biological functions of these compounds match the queen's reproductive and the worker's nonreproductive roles in the colony. Studies with deuterated substrates revealed that the biosynthesis of these acids begins with stearic acid, which is hydroxylated at the 17th or 18th position. The 18-carbon hydroxy acid chains are shortened, and the resulting 10-carbon hydroxy acids are oxidized in a caste-selective manner, thereby determining many of the functional differences between queens and workers.

  13. Developing New Antibiotics with Combinatorial Biosynthesis

    NASA Astrophysics Data System (ADS)

    Pohl, Nicola L.

    2000-11-01

    Polyketide synthases (PKSs), a class of enzymes found in soil bacteria that produce antibiotics such as erythromycin, string together acetate units using basic organic reactions. The manipulation of the sequence of these reactions at the genetic level has resulted in an alteration of the corresponding chemical structure of the antibiotic produced by the bacteria. This process, called combinatorial biosynthesis, allows the generation of many presently unknown complex structures that can be tested for antibacterial activity, thereby contributing to the race against antibiotic-resistant infectious bacteria.

  14. [Recent advances in lanthipeptide biosynthesis - A review].

    PubMed

    Mo, Tianlu; Xue, Lingui; Zhang, Qi

    2016-03-01

    Lanthipeptides are a growing class of ribosomally synthesized and posttranslationally modified peptide (RiPP) natural products. These compounds are widely distributed among taxonomically distant species, and their structures and biological activities are diverse, providing an important source for drug research and developement. In this review, we summarized the recent advances in the understanding of structure, classification, evolution and substrate-controlled biosynthetic mechanism of lanthipeptide, attempting to highlight the intriguing chemistry and enzymology in the biosynthesis of this growing family of natural products. PMID:27382781

  15. Biosynthesis of Gold Nanoparticles Using Pseudomonas Aeruginosa

    SciTech Connect

    Abd El-Aziz, M.; Badr, Y.; Mahmoud, M. A.

    2007-02-14

    Pseudomonas aeruginosa were used for extracellular biosynthesis of gold nanoparticles (Au NPs). Consequently, Au NPs were formed due to reduction of gold ion by bacterial cell supernatant of P. aeruginos ATCC 90271, P. aeruginos (2) and P. aeruginos (1). The UV-Vis. and fluorescence spectra of the bacterial as well as chemical prepared Au NPs were recorded. Transmission electron microscopy (TEM) micrograph showed the formation of well-dispersed gold nanoparticles in the range of 15-30 nm. The process of reduction being extracellular and may lead to the development of an easy bioprocess for synthesis of Au NPs.

  16. Carotenoid Biosynthesis in Arabidopsis: A Colorful Pathway

    PubMed Central

    Ruiz-Sola, M. Águila; Rodríguez-Concepción, Manuel

    2012-01-01

    Plant carotenoids are a family of pigments that participate in light harvesting and are essential for photoprotection against excess light. Furthermore, they act as precursors for the production of apocarotenoid hormones such as abscisic acid and strigolactones. In this review, we summarize the current knowledge on the genes and enzymes of the carotenoid biosynthetic pathway (which is now almost completely elucidated) and on the regulation of carotenoid biosynthesis at both transcriptional and post-transcriptional levels. We also discuss the relevance of Arabidopsis as a model system for the study of carotenogenesis and how metabolic engineering approaches in this plant have taught important lessons for carotenoid biotechnology. PMID:22582030

  17. A Pol V–Mediated Silencing, Independent of RNA–Directed DNA Methylation, Applies to 5S rDNA

    PubMed Central

    Douet, Julien; Tutois, Sylvie; Tourmente, Sylvette

    2009-01-01

    The plant-specific RNA polymerases Pol IV and Pol V are essential to RNA–directed DNA methylation (RdDM), which also requires activities from RDR2 (RNA–Dependent RNA Polymerase 2), DCL3 (Dicer-Like 3), AGO4 (Argonaute), and DRM2 (Domains Rearranged Methyltransferase 2). RdDM is dedicated to the methylation of target sequences which include transposable elements, regulatory regions of several protein-coding genes, and 5S rRNA–encoding DNA (rDNA) arrays. In this paper, we have studied the expression of the 5S-210 transcript, a marker of silencing release at 5S RNA genes, to show a differential impact of RNA polymerases IV and V on 5S rDNA arrays during early development of the plant. Using a combination of molecular and cytological assays, we show that Pol IV, RDR2, DRM2, and Pol V, actors of the RdDM, are required to maintain a transcriptional silencing of 5S RNA genes at chromosomes 4 and 5. Moreover, we have shown a derepression associated to chromatin decondensation specific to the 5S array from chromosome 4 and restricted to the Pol V–loss of function. In conclusion, our results highlight a new role for Pol V on 5S rDNA, which is RdDM–independent and comes specifically at chromosome 4, in addition to the RdDM pathway. PMID:19834541

  18. Analysis of 5S rDNA arrays in Arabidopsis thaliana: physical mapping and chromosome-specific polymorphisms.

    PubMed

    Cloix, C; Tutois, S; Mathieu, O; Cuvillier, C; Espagnol, M C; Picard, G; Tourmente, S

    2000-05-01

    A physical map of a pericentromeric region of chromosome 5 containing a 5S rDNA locus and spanning approximately 1000 kb was established using the CIC YAC clones. Three 5S rDNA arrays were resolved in this YAC contig by PFGE analysis and we have mapped different types of sequences between these three blocks. 5S rDNA units from each of these three arrays of chromosome 5, and from chromosomes 3 and 4, were isolated by PCR. A total of 38 new DNA sequences were obtained. Two types of 5S rDNA repeated units exist: the major variant with 0.5-kb repeats and one with short repeats (251 bp) only detected on YAC 11A3 from chromosome 3. Although the 38 sequences displayed noticeable heterogeneity, we were able to group them according to their 5S array origin. The presence of 5S array-specific variants was confirmed with the restriction polymorphism study of all the YACs carrying 5S units. PMID:10810091

  19. The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure.

    PubMed Central

    Leontis, N B; Westhof, E

    1998-01-01

    A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings

  20. The nature of Z_b states from a combined analysis of Upsilon (5S)rightarrow h_b(mP) π ^+ π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{(*)}π

    NASA Astrophysics Data System (ADS)

    Huo, Wen-Sheng; Chen, Guo-Ying

    2016-03-01

    With a combined analysis of data on Upsilon (5S)rightarrow h_b(1P,2P)π ^+π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{(*)}π in an effective field theory approach, we determine resonance parameters of Z_b states in two scenarios. In one scenario we assume that Z_b states are pure molecular states, while in the other one we assume that Z_b states contain compact components. We find that the present data favor that there should be some compact components inside Z_b^{(' )} associated with the molecular components. By fitting the invariant mass spectra of Upsilon (5S)rightarrow h_b(1P,2P)π ^+π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{*}π , we determine that the probability of finding the compact components in Z_b states may be as large as about 40 %.

  1. Origin and evolution of organisms as deduced from 5S ribosomal RNA sequences.

    PubMed

    Hori, H; Osawa, S

    1987-09-01

    A phylogenetic tree of most of the major groups of organisms has been constructed from the 352 5S ribosomal RNA sequences now available. The tree suggests that there are several major groups of eubacteria that diverged during the early stages of their evolution. Metabacteria (= archaebacteria) and eukaryotes separated after the emergence of eubacteria. Among eukaryotes, red algae emerged first; and, later, thraustochytrids (a Proctista group), ascomycetes (yeast), green plants (green algae and land plants), "yellow algae" (brown algae, diatoms, and chrysophyte algae), basidiomycetes (mushrooms and rusts), slime- and water molds, various protozoans, and animals emerged, approximately in that order. Three major types of photosynthetic eukaryotes--i.e., red algae (= Chlorophyll a group), green plants (Chl. a + b group) and yellow algae (Chl. a + c)--are remotely related to one another. Other photosynthetic unicellular protozoans--such as Cyanophora (Chl. a), Euglenophyta (Chl. a + b), Cryptophyta (Chl. a + c), and Dinophyta (Chl. a + c)--seem to have separated shortly after the emergence of the yellow algae. PMID:2452957

  2. Evolution of green plants as deduced from 5S rRNA sequences

    PubMed Central

    Hori, Hiroshi; Lim, Byung-Lak; Osawa, Syozo

    1985-01-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  3. Evolution of green plants as deduced from 5S rRNA sequences.

    PubMed

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  4. Hard X-ray XAFS beamline, BL5S1, at AichiSR

    NASA Astrophysics Data System (ADS)

    Tabuchi, M.; Asakura, H.; Morimoto, H.; Watanabe, N.; Takeda, Y.

    2016-05-01

    A XAFS beamline, BL5S1, had been operated at Aichi Synchrotron Radiation Center, Japan since March 2013. The beamline was designed for the measurements in the energy range from 5 to 20 keV. The photon flux of 6 x 1010 at around 9 keV and beam spot size of 0.5 x 0.3 mm at sample position are as good as designed. For the standard transmission XAFS measurement, both of the step- and quick- scan modes are available. Energy resolution at around 9keV is good enough to discuss the energy shift of the order of 0.1 eV or higher even when the measurements are conducted in the quick-scan mode. With several kinds of detectors for fluorescence and/or CEY detection mode measurements, and various kinds of sample holders which are supported by the XAFS measurement software, users easily obtain spectra for their samples. Such a standard, well operated and easy to access XAFS beamline must be very important to broaden the base of the XAFS society further.

  5. Design and performance of a 1 MW-5 s high temperature superconductor magnetic energy storage system

    NASA Astrophysics Data System (ADS)

    Morandi, Antonio; Gholizad, Babak; Fabbri, Massimo

    2016-01-01

    The feasibility of a 1 MW-5 s superconducting magnetic energy storage (SMES) system based on state-of-the-art high-temperature superconductor (HTS) materials is investigated in detail. Both YBCO coated conductors and MgB2 are considered. A procedure for the electromagnetic design of the coil is introduced and the final layout is arrived at and compared for the two materials. The choice of the inductance of the coil is carried out as part of the design procedure. Both low-field (3 T) and high-field (8 T) designs are considered for the YBCO. AC losses during a complete charge/discharge cycle at full power are estimated and the cooling power needed for continuous operation is derived. The power conditioning system and control algorithms needed to carry out various operations are discussed in detail. Performances of the SMES system during voltage sag compensation, load leveling and power factor correction are investigated by means of numerical simulation.

  6. Secondary structure and domain architecture of the 23S and 5S rRNAs

    PubMed Central

    Petrov, Anton S.; Bernier, Chad R.; Hershkovits, Eli; Xue, Yuzhen; Waterbury, Chris C.; Hsiao, Chiaolong; Stepanov, Victor G.; Gaucher, Eric A.; Grover, Martha A.; Harvey, Stephen C.; Hud, Nicholas V.; Wartell, Roger M.; Fox, George E.; Williams, Loren Dean

    2013-01-01

    We present a de novo re-determination of the secondary (2°) structure and domain architecture of the 23S and 5S rRNAs, using 3D structures, determined by X-ray diffraction, as input. In the traditional 2° structure, the center of the 23S rRNA is an extended single strand, which in 3D is seen to be compact and double helical. Accurately assigning nucleotides to helices compels a revision of the 23S rRNA 2° structure. Unlike the traditional 2° structure, the revised 2° structure of the 23S rRNA shows architectural similarity with the 16S rRNA. The revised 2° structure also reveals a clear relationship with the 3D structure and is generalizable to rRNAs of other species from all three domains of life. The 2° structure revision required us to reconsider the domain architecture. We partitioned the 23S rRNA into domains through analysis of molecular interactions, calculations of 2D folding propensities and compactness. The best domain model for the 23S rRNA contains seven domains, not six as previously ascribed. Domain 0 forms the core of the 23S rRNA, to which the other six domains are rooted. Editable 2° structures mapped with various data are provided (http://apollo.chemistry.gatech.edu/RibosomeGallery). PMID:23771137

  7. Ant trail pheromone biosynthesis is triggered by a neuropeptide hormone.

    PubMed

    Choi, Man-Yeon; Vander Meer, Robert K

    2012-01-01

    Our understanding of insect chemical communication including pheromone identification, synthesis, and their role in behavior has advanced tremendously over the last half-century. However, endocrine regulation of pheromone biosynthesis has progressed slowly due to the complexity of direct and/or indirect hormonal activation of the biosynthetic cascades resulting in insect pheromones. Over 20 years ago, a neurohormone, pheromone biosynthesis activating neuropeptide (PBAN) was identified that stimulated sex pheromone biosynthesis in a lepidopteran moth. Since then, the physiological role, target site, and signal transduction of PBAN has become well understood for sex pheromone biosynthesis in moths. Despite that PBAN-like peptides (∼200) have been identified from various insect Orders, their role in pheromone regulation had not expanded to the other insect groups except for Lepidoptera. Here, we report that trail pheromone biosynthesis in the Dufour's gland (DG) of the fire ant, Solenopsis invicta, is regulated by PBAN. RNAi knock down of PBAN gene (in subesophageal ganglia) or PBAN receptor gene (in DG) expression inhibited trail pheromone biosynthesis. Reduced trail pheromone was documented analytically and through a behavioral bioassay. Extension of PBAN's role in pheromone biosynthesis to a new target insect, mode of action, and behavioral function will renew research efforts on the involvement of PBAN in pheromone biosynthesis in Insecta. PMID:23226278

  8. Ant Trail Pheromone Biosynthesis Is Triggered by a Neuropeptide Hormone

    PubMed Central

    Choi, Man-Yeon; Vander Meer, Robert K.

    2012-01-01

    Our understanding of insect chemical communication including pheromone identification, synthesis, and their role in behavior has advanced tremendously over the last half-century. However, endocrine regulation of pheromone biosynthesis has progressed slowly due to the complexity of direct and/or indirect hormonal activation of the biosynthetic cascades resulting in insect pheromones. Over 20 years ago, a neurohormone, pheromone biosynthesis activating neuropeptide (PBAN) was identified that stimulated sex pheromone biosynthesis in a lepidopteran moth. Since then, the physiological role, target site, and signal transduction of PBAN has become well understood for sex pheromone biosynthesis in moths. Despite that PBAN-like peptides (∼200) have been identified from various insect Orders, their role in pheromone regulation had not expanded to the other insect groups except for Lepidoptera. Here, we report that trail pheromone biosynthesis in the Dufour's gland (DG) of the fire ant, Solenopsis invicta, is regulated by PBAN. RNAi knock down of PBAN gene (in subesophageal ganglia) or PBAN receptor gene (in DG) expression inhibited trail pheromone biosynthesis. Reduced trail pheromone was documented analytically and through a behavioral bioassay. Extension of PBAN's role in pheromone biosynthesis to a new target insect, mode of action, and behavioral function will renew research efforts on the involvement of PBAN in pheromone biosynthesis in Insecta. PMID:23226278

  9. Biosynthesis of nanoparticles using microbes- a review.

    PubMed

    Hulkoti, Nasreen I; Taranath, T C

    2014-09-01

    The biosynthesis of nanoparticles by microorganism is a green and eco-friendly technology. This review focuses on the use of consortium of diverse microorganisms belonging to both prokaryotes and eukaryotes for the synthesis of metallic nanoparticles viz. silver, gold, platinum, zirconium, palladium, iron, cadmium and metal oxides such as titanium oxide, zinc oxide, etc. These microorganisms include bacteria, actinomycetes, fungi and algae. The synthesis of nanoparticles may be intracellular or extracellular. The several workers have reported that NADH dependent nitrate reductase enzyme plays a vital role in the conversion of metallic ions to nanoparticles. The FTIR study reveals that diverse biomolecules viz. carboxyl group, primary and secondary amines, amide I, II, and III bands etc serve as a tool for bioreduction and capping agents there by offering stability to particles by preventing agglomeration and growth. The size and shape of the nanoparticles vary with the organism employed and conditions employed during the synthesis which included pH, temperature and substrate concentration. The microorganisms provide diverse environment for biosynthesis of nanoparticles. These particles are safe and eco-friendly with a lot of applications in medicine, agriculture, cosmetic industry, drug delivery and biochemical sensors. The challenges for redressal include optimal production and minimal time to obtain desired size and shape, to enhance the stability of nanoparticles and optimization of specific microorganisms for specific application. PMID:25001188

  10. Brassinosteroid biosynthesis and signalling in Petunia hybrida.

    PubMed

    Verhoef, Nathalie; Yokota, Takao; Shibata, Kyomi; de Boer, Gert-Jan; Gerats, Tom; Vandenbussche, Michiel; Koes, Ronald; Souer, Erik

    2013-05-01

    Brassinosteroids (BRs) are steroidal plant hormones that play an important role in the growth and development of plants. The biosynthesis of sterols and BRs as well as the signalling cascade they induce in plants have been elucidated largely through metabolic studies and the analysis of mutants in Arabidopsis and rice. Only fragmentary details about BR signalling in other plant species are known. Here a forward genetics strategy was used in Petunia hybrida, by which 19 families with phenotypic alterations typical for BR deficiency mutants were identified. In all mutants, the endogenous BR levels were severely reduced. In seven families, the tagged genes were revealed as the petunia BR biosynthesis genes CYP90A1 and CYP85A1 and the BR receptor gene BRI1. In addition, several homologues of key regulators of the BR signalling pathway were cloned from petunia based on homology with their Arabidopsis counterparts, including the BRI1 receptor, a member of the BES1/BZR1 transcription factor family (PhBEH2), and two GSK3-like kinases (PSK8 and PSK9). PhBEH2 was shown to interact with PSK8 and 14-3-3 proteins in yeast, revealing similar interactions to those during BR signalling in Arabidopsis. Interestingly, PhBEH2 also interacted with proteins implicated in other signalling pathways. This suggests that PhBEH2 might function as an important hub in the cross-talk between diverse signalling pathways. PMID:23599276

  11. Biosynthesis of archaeal membrane ether lipids

    PubMed Central

    Jain, Samta; Caforio, Antonella; Driessen, Arnold J. M.

    2014-01-01

    A vital function of the cell membrane in all living organism is to maintain the membrane permeability barrier and fluidity. The composition of the phospholipid bilayer is distinct in archaea when compared to bacteria and eukarya. In archaea, isoprenoid hydrocarbon side chains are linked via an ether bond to the sn-glycerol-1-phosphate backbone. In bacteria and eukarya on the other hand, fatty acid side chains are linked via an ester bond to the sn-glycerol-3-phosphate backbone. The polar head groups are globally shared in the three domains of life. The unique membrane lipids of archaea have been implicated not only in the survival and adaptation of the organisms to extreme environments but also to form the basis of the membrane composition of the last universal common ancestor (LUCA). In nature, a diverse range of archaeal lipids is found, the most common are the diether (or archaeol) and the tetraether (or caldarchaeol) lipids that form a monolayer. Variations in chain length, cyclization and other modifications lead to diversification of these lipids. The biosynthesis of these lipids is not yet well understood however progress in the last decade has led to a comprehensive understanding of the biosynthesis of archaeol. This review describes the current knowledge of the biosynthetic pathway of archaeal ether lipids; insights on the stability and robustness of archaeal lipid membranes; and evolutionary aspects of the lipid divide and the LUCA. It examines recent advances made in the field of pathway reconstruction in bacteria. PMID:25505460

  12. Fatty acid biosynthesis in pea root plastids

    SciTech Connect

    Stahl, R.J.; Sparace, S.A. )

    1989-04-01

    Fatty acid biosynthesis from (1-{sup 14}C)acetate was optimized in plastids isolated from primary root tips of 7-day-old germinating pea seeds. Fatty acid synthesis was maximum at approximately 80 nmoles/hr/mg protein in the presence of 200 {mu}M acetate, 0.5 mM each of NADH, NADPH and CoA, 6 mM each of ATP and MgCl{sub 2}, 1 mM each of the MnCl{sub 2} and glycerol-3-phosphate, 15 mM KHCO{sub 3}, and 0.1M Bis-tris-propane, pH 8.0 incubated at 35C. At the standard incubation temperature of 25C, fatty acid synthesis was linear from up to 6 hours with 80 to 100 {mu}g/mL plastid protein. ATP and CoA were absolute requirements, whereas KHCO{sub 3}, divalent cations and reduced nucleotides all improved activity by 80 to 85%. Mg{sup 2+} and NADH were the preferred cation and nucleotide, respectively. Dithiothreitol and detergents were generally inhibitory. The radioactive products of fatty acid biosynthesis were approximately 33% 16:0, 10% 18:0 and 56% 18:1 and generally did not vary with increasing concentrations of each cofactor.

  13. Essences in Metabolic Engineering of Lignan Biosynthesis

    PubMed Central

    Satake, Honoo; Koyama, Tomotsugu; Bahabadi, Sedigheh Esmaeilzadeh; Matsumoto, Erika; Ono, Eiichiro; Murata, Jun

    2015-01-01

    Lignans are structurally and functionally diverse phytochemicals biosynthesized in diverse plant species and have received wide attentions as leading compounds of novel drugs for tumor treatment and healthy diets to reduce of the risks of lifestyle-related non-communicable diseases. However, the lineage-specific distribution and the low-amount of production in natural plants, some of which are endangered species, hinder the efficient and stable production of beneficial lignans. Accordingly, the development of new procedures for lignan production is of keen interest. Recent marked advances in the molecular and functional characterization of lignan biosynthetic enzymes and endogenous and exogenous factors for lignan biosynthesis have suggested new methods for the metabolic engineering of lignan biosynthesis cascades leading to the efficient, sustainable, and stable lignan production in plants, including plant cell/organ cultures. Optimization of light conditions, utilization of a wide range of elicitor treatments, and construction of transiently gene-transfected or transgenic lignan-biosynthesizing plants are mainly being attempted. This review will present the basic and latest knowledge regarding metabolic engineering of lignans based on their biosynthetic pathways and biological activities, and the perspectives in lignan production via metabolic engineering. PMID:25946459

  14. Benzylisoquinoline alkaloid biosynthesis in opium poppy.

    PubMed

    Beaudoin, Guillaume A W; Facchini, Peter J

    2014-07-01

    Opium poppy (Papaver somniferum) is one of the world's oldest medicinal plants and remains the only commercial source for the narcotic analgesics morphine, codeine and semi-synthetic derivatives such as oxycodone and naltrexone. The plant also produces several other benzylisoquinoline alkaloids with potent pharmacological properties including the vasodilator papaverine, the cough suppressant and potential anticancer drug noscapine and the antimicrobial agent sanguinarine. Opium poppy has served as a model system to investigate the biosynthesis of benzylisoquinoline alkaloids in plants. The application of biochemical and functional genomics has resulted in a recent surge in the discovery of biosynthetic genes involved in the formation of major benzylisoquinoline alkaloids in opium poppy. The availability of extensive biochemical genetic tools and information pertaining to benzylisoquinoline alkaloid metabolism is facilitating the study of a wide range of phenomena including the structural biology of novel catalysts, the genomic organization of biosynthetic genes, the cellular and sub-cellular localization of biosynthetic enzymes and a variety of biotechnological applications. In this review, we highlight recent developments and summarize the frontiers of knowledge regarding the biochemistry, cellular biology and biotechnology of benzylisoquinoline alkaloid biosynthesis in opium poppy. PMID:24671624

  15. Monoterpene biosynthesis potential of plant subcellular compartments.

    PubMed

    Dong, Lemeng; Jongedijk, Esmer; Bouwmeester, Harro; Van Der Krol, Alexander

    2016-01-01

    Subcellular monoterpene biosynthesis capacity based on local geranyl diphosphate (GDP) availability or locally boosted GDP production was determined for plastids, cytosol and mitochondria. A geraniol synthase (GES) was targeted to plastids, cytosol, or mitochondria. Transient expression in Nicotiana benthamiana indicated local GDP availability for each compartment but resulted in different product levels. A GDP synthase from Picea abies (PaGDPS1) was shown to boost GDP production. PaGDPS1 was also targeted to plastids, cytosol or mitochondria and PaGDPS1 and GES were coexpressed in all possible combinations. Geraniol and geraniol-derived products were analyzed by GC-MS and LC-MS, respectively. GES product levels were highest for plastid-targeted GES, followed by mitochondrial- and then cytosolic-targeted GES. For each compartment local boosting of GDP biosynthesis increased GES product levels. GDP exchange between compartments is not equal: while no GDP is exchanged from the cytosol to the plastids, 100% of GDP in mitochondria can be exchanged to plastids, while only 7% of GDP from plastids is available for mitochondria. This suggests a direct exchange mechanism for GDP between plastids and mitochondria. Cytosolic PaGDPS1 competes with plastidial GES activity, suggesting an effective drain of isopentenyl diphosphate from the plastids to the cytosol. PMID:26356766

  16. Phytogenic biosynthesis and emission of methyl acetate.

    PubMed

    Jardine, Kolby; Wegener, Frederik; Abrell, Leif; van Haren, Joost; Werner, Christiane

    2014-02-01

    Acetylation of plant metabolites fundamentally changes their volatility, solubility and activity as semiochemicals. Here we present a new technique termed dynamic (13) C-pulse chasing to track the fate of C1-3 carbon atoms of pyruvate into the biosynthesis and emission of methyl acetate (MA) and CO2 . (13) C-labelling of MA and CO2 branch emissions respond within minutes to changes in (13) C-positionally labelled pyruvate solutions fed through the transpiration stream. Strong (13) C-labelling of MA emissions occurred only under pyruvate-2-(13) C and pyruvate-2,3-(13) C feeding, but not pyruvate-1-(13) C feeding. In contrast, strong (13) CO2 emissions were only observed under pyruvate-1-(13) C feeding. These results demonstrate that MA (and other volatile and non-volatile metabolites) derive from the C2,3 atoms of pyruvate while the C1 atom undergoes decarboxylation. The latter is a non-mitochondrial source of CO2 in the light generally not considered in studies of CO2 sources and sinks. Within a tropical rainforest mesocosm, we also observed atmospheric concentrations of MA up to 0.6 ppbv that tracked light and temperature conditions. Moreover, signals partially attributed to MA were observed in ambient air within and above a tropical rainforest in the Amazon. Our study highlights the potential importance of acetyl coenzyme A (CoA) biosynthesis as a source of acetate esters and CO2 to the atmosphere. PMID:23862653

  17. Engineering the MEP pathway enhanced ajmalicine biosynthesis.

    PubMed

    Chang, Kai; Qiu, Fei; Chen, Min; Zeng, Lingjiang; Liu, Xiaoqiang; Yang, Chunxian; Lan, Xiaozhong; Wang, Qiang; Liao, Zhihua

    2014-01-01

    The 2-C-methyl-D-erythritol-4-phosphate (MEP) pathway genes encoding DXR and MECS from Taxus species and STR from Catharanthus roseus were used to genetically modify the ajmalicine biosynthetic pathway in hairy root cultures of C. roseus. As expected, the STR-overexpressed root cultures showed twofold higher accumulation of ajmalicine than the control. It was important to discover that overexpression of the single DXR or MECS gene from the MEP pathway also remarkably enhanced ajmalicine biosynthesis in transgenic hairy root cultures, and this suggested that engineering the MEP pathway by overexpression of DXR or MECS promoted the metabolic flux into ajmalicine biosynthesis. The transgenic hairy root cultures with co-overexpression of DXR and STR or MECS and STR had higher levels of ajmalicine than those with overexpression of a single gene alone such as DXR, MECS, and STR. It could be concluded that transgenic hairy root cultures harboring both DXR/MECS and STR possessed an increased flux in the terpenoid indole alkaloid biosynthetic pathway that enhanced ajmalicine yield, which was more efficient than cultures harboring only one of the three genes. PMID:24237015

  18. Brassinosteroid biosynthesis and signalling in Petunia hybrida

    PubMed Central

    Verhoef, Nathalie; Yokota, Takao; Shibata, Kyomi; de Boer, Gert-Jan; Gerats, Tom; Vandenbussche, Michiel; Koes, Ronald; Souer, Erik

    2013-01-01

    Brassinosteroids (BRs) are steroidal plant hormones that play an important role in the growth and development of plants. The biosynthesis of sterols and BRs as well as the signalling cascade they induce in plants have been elucidated largely through metabolic studies and the analysis of mutants in Arabidopsis and rice. Only fragmentary details about BR signalling in other plant species are known. Here a forward genetics strategy was used in Petunia hybrida, by which 19 families with phenotypic alterations typical for BR deficiency mutants were identified. In all mutants, the endogenous BR levels were severely reduced. In seven families, the tagged genes were revealed as the petunia BR biosynthesis genes CYP90A1 and CYP85A1 and the BR receptor gene BRI1. In addition, several homologues of key regulators of the BR signalling pathway were cloned from petunia based on homology with their Arabidopsis counterparts, including the BRI1 receptor, a member of the BES1/BZR1 transcription factor family (PhBEH2), and two GSK3-like kinases (PSK8 and PSK9). PhBEH2 was shown to interact with PSK8 and 14-3-3 proteins in yeast, revealing similar interactions to those during BR signalling in Arabidopsis. Interestingly, PhBEH2 also interacted with proteins implicated in other signalling pathways. This suggests that PhBEH2 might function as an important hub in the cross-talk between diverse signalling pathways. PMID:23599276

  19. Essences in metabolic engineering of lignan biosynthesis.

    PubMed

    Satake, Honoo; Koyama, Tomotsugu; Bahabadi, Sedigheh Esmaeilzadeh; Matsumoto, Erika; Ono, Eiichiro; Murata, Jun

    2015-01-01

    Lignans are structurally and functionally diverse phytochemicals biosynthesized in diverse plant species and have received wide attentions as leading compounds of novel drugs for tumor treatment and healthy diets to reduce of the risks of lifestyle-related non-communicable diseases. However, the lineage-specific distribution and the low-amount of production in natural plants, some of which are endangered species, hinder the efficient and stable production of beneficial lignans. Accordingly, the development of new procedures for lignan production is of keen interest. Recent marked advances in the molecular and functional characterization of lignan biosynthetic enzymes and endogenous and exogenous factors for lignan biosynthesis have suggested new methods for the metabolic engineering of lignan biosynthesis cascades leading to the efficient, sustainable, and stable lignan production in plants, including plant cell/organ cultures. Optimization of light conditions, utilization of a wide range of elicitor treatments, and construction of transiently gene-transfected or transgenic lignan-biosynthesizing plants are mainly being attempted. This review will present the basic and latest knowledge regarding metabolic engineering of lignans based on their biosynthetic pathways and biological activities, and the perspectives in lignan production via metabolic engineering. PMID:25946459

  20. Molecular Regulation of Antibiotic Biosynthesis in Streptomyces

    PubMed Central

    Liu, Gang; Chandra, Govind; Niu, Guoqing

    2013-01-01

    SUMMARY Streptomycetes are the most abundant source of antibiotics. Typically, each species produces several antibiotics, with the profile being species specific. Streptomyces coelicolor, the model species, produces at least five different antibiotics. We review the regulation of antibiotic biosynthesis in S. coelicolor and other, nonmodel streptomycetes in the light of recent studies. The biosynthesis of each antibiotic is specified by a large gene cluster, usually including regulatory genes (cluster-situated regulators [CSRs]). These are the main point of connection with a plethora of generally conserved regulatory systems that monitor the organism's physiology, developmental state, population density, and environment to determine the onset and level of production of each antibiotic. Some CSRs may also be sensitive to the levels of different kinds of ligands, including products of the pathway itself, products of other antibiotic pathways in the same organism, and specialized regulatory small molecules such as gamma-butyrolactones. These interactions can result in self-reinforcing feed-forward circuitry and complex cross talk between pathways. The physiological signals and regulatory mechanisms may be of practical importance for the activation of the many cryptic secondary metabolic gene cluster pathways revealed by recent sequencing of numerous Streptomyces genomes. PMID:23471619

  1. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    PubMed

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus. PMID:26959315

  2. Chromosomal localization and molecular characterization of three different 5S ribosomal DNA clusters in the sea urchin Paracentrotus lividus.

    PubMed

    Caradonna, Fabio; Bellavia, Daniele; Clemente, Ann Maria; Sisino, Giorgia; Barbieri, Rainer

    2007-09-01

    In this paper the chromosomal localization and molecular cloning and characterization of three 5S rDNA clusters of 700 bp (base pairs), 900 bp, and 950 bp in the sea urchin Paracentrotus lividus are reported. Southern blot hybridization demonstrated the existence of three 5S rDNA repeats of differing length in the P. lividus genome. Fluorescence in situ hybridization analysis, performed in parallel on both haploid and diploid metaphases and interphase nuclei using different 5S rDNA units as probes, localized these 5S rDNA clusters in 3 different pairs of P. lividus chromosomes. This is the first complete gene mapping not only in a sea urchin but also in the phylum of echinoderms as a whole. PMID:17893727

  3. 5S rRNA sequences from four marine invertebrates and implications for base pairing models of metazoan sequences.

    PubMed

    Walker, W F; Doolittle, W F

    1983-08-11

    The nucleotide sequences of 5S rRNAs from the starfish Asterias vulgaris, the squid Illex illecebrosus, the sipunculid Phascolopsis gouldii and the jellyfish Aurelia aurita were determined. The sequence from Asterias lends support for one of two previous base pairing models for helix E in metazoan sequences. The Aurelia sequence differs by five nucleotides from that previously reported and does not violate the consensus secondary structure model for eukaryotic 5S rRNA. PMID:6136024

  4. Conformation of 4.5S RNA in the signal recognition particle and on the 30S ribosomal subunit

    PubMed Central

    GU, SHAN-QING; JÖCKEL, JOHANNES; BEINKER, PHILIPP; WARNECKE, JENS; SEMENKOV, YURI P.; RODNINA, MARINA V.; WINTERMEYER, WOLFGANG

    2005-01-01

    The signal recognition particle (SRP) from Escherichia coli consists of 4.5S RNA and protein Ffh. It is essential for targeting ribosomes that are translating integral membrane proteins to the translocation pore in the plasma membrane. Independently of Ffh, 4.5S RNA also interacts with elongation factor G (EF-G) and the 30S ribosomal subunit. Here we use a cross-linking approach to probe the conformation of 4.5S RNA in SRP and in the complex with the 30S ribosomal subunit and to map the binding site. The UV-activatable cross-linker p-azidophenacyl bromide (AzP) was attached to positions 1, 21, and 54 of wild-type or modified 4.5S RNA. In SRP, cross-links to Ffh were formed from AzP in all three positions in 4.5S RNA, indicating a strongly bent conformation in which the 5′ end (position 1) and the tetraloop region (including position 54) of the molecule are close to one another and to Ffh. In ribosomal complexes of 4.5S RNA, AzP in both positions 1 and 54 formed cross-links to the 30S ribosomal subunit, independently of the presence of Ffh. The major cross-linking target on the ribosome was protein S7; minor cross-links were formed to S2, S18, and S21. There were no cross-links from 4.5S RNA to the 50S subunit, where the primary binding site of SRP is located close to the peptide exit. The functional role of 4.5S RNA binding to the 30S subunit is unclear, as the RNA had no effect on translation or tRNA translocation on the ribosome. PMID:16043501

  5. Nucleotide sequences of 5S rRNAs from sponge Halichondria japonica and tunicate Halocynthia roretzi and their phylogenetic positions

    PubMed Central

    Komiya, Hiroyuki; Hasegawa, Masami; Takemura, Shosuke

    1983-01-01

    The nucleotide sequences of 5S rRNAs from sponge Halichondria japonica and tunicate Halocynthia roretzi were determined by chemical and enzymatic gel methods. Their phylogenetic positions among metazoans were derived from the 5S rRNA sequences by a computer analysis based on the maximum parsimony principle. It was suggested that the sponge is closely related to several invertebrates and the tunicate has affinity to vertebrates rather than invertebrates. PMID:6835845

  6. First step of glycosylphosphatidylinositol (GPI) biosynthesis cross-talks with ergosterol biosynthesis and Ras signaling in Candida albicans.

    PubMed

    Yadav, Bhawna; Bhatnagar, Shilpi; Ahmad, Mohammad Faiz; Jain, Priyanka; Pratyusha, Vavilala A; Kumar, Pravin; Komath, Sneha Sudha

    2014-02-01

    Candida albicans is a leading cause of fungal infections worldwide. It has several glycosylphosphatidylinositol (GPI)-anchored virulence factors. Inhibiting GPI biosynthesis attenuates its virulence. Building on our previous work, we explore the interaction of GPI biosynthesis in C. albicans with ergosterol biosynthesis and hyphal morphogenesis. This study is also the first report of transcriptional co-regulation existing between two subunits of the multisubunit enzyme complex, GPI-N-acetylglucosaminyltransferase (GPI-GnT), involved in the first step of GPI anchor biosynthesis in eukaryotes. Using mutational analysis, we show that the accessory subunits, GPI2 and GPI19, of GPI-GnT exhibit opposite effects on ergosterol biosynthesis and Ras signaling (which determines hyphal morphogenesis). This is because the two subunits negatively regulate one another; GPI19 mutants show up-regulation of GPI2, whereas GPI2 mutants show up-regulation of GPI19. Two different models were examined as follows. First, the two GPI-GnT subunits independently interact with ergosterol biosynthesis and Ras signaling. Second, the two subunits mutually regulate one another and thereby regulate sterol levels and Ras signaling. Analysis of double mutants of these subunits indicates that GPI19 controls ergosterol biosynthesis through ERG11 levels, whereas GPI2 determines the filamentation by cross-talk with Ras1 signaling. Taken together, this suggests that the first step of GPI biosynthesis talks to and regulates two very important pathways in C. albicans. This could have implications for designing new antifungal strategies. PMID:24356967

  7. Phylogenetic origins of the plant mitochondrion based on a comparative analysis of 5S ribosomal RNA sequences

    NASA Technical Reports Server (NTRS)

    Villanueva, E.; Delihas, N.; Luehrsen, K. R.; Fox, G. E.; Gibson, J.

    1985-01-01

    The complete nucleotide sequences of 5S ribosomal RNAs from Rhodocyclus gelatinosa, Rhodobacter sphaeroides, and Pseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains. Rhodobacter sphaeroides is specifically related to Paracoccus denitrificans and Rc. gelatinosa is related to Ps. cepacia. These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found in P. denitrificans are present also in the 5S RNA of Rb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of obtaining these new sequences is that it is possible to clarify the phylogenetic origins of the plant mitochondrion. In particular, a close phylogenetic relationship is found between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely, Rb. sphaeroides, P. denitrificans, and Rhodospirillum rubrum.

  8. Starch Biosynthesis in Developing Wheat Grain 1

    PubMed Central

    Keeling, Peter L.; Wood, John R.; Tyson, R. Huw; Bridges, Ian G.

    1988-01-01

    We have used 13C-labeled sugars and nuclear magnetic resonance (NMR) spectrometry to study the metabolic pathway of starch biosynthesis in developing wheat grain (Triticum aestivum cv Mardler). Our aim was to examine the extent of redistribution of 13C between carbons atoms 1 and 6 of [1-13C] or [6-13C]glucose (or fructose) incorporated into starch, and hence provide evidence for or against the involvement of triose phosphates in the metabolic pathway. Starch synthesis in the endosperm tissue was studied in two experimental systems. First, the 13C sugars were supplied to isolated endosperm tissue incubated in vitro, and second the 13C sugars were supplied in vivo to the intact plant. The 13C starch produced by the endosperm tissue of the grain was isolated and enzymically degraded to glucose using amyloglucosidase, and the distribution of 13C in all glucosyl carbons was quantified by 13C-NMR spectrometry. In all of the experiments, irrespective of the incubation time or incubation conditions, there was a similar pattern of partial (between 15 and 20%) redistribution of label between carbons 1 and 6 of glucose recovered from starch. There was no detectable increase over background 13C incidence in carbons 2 to 5. Within each experiment, the same pattern of partial redistribution of label was found in the glucosyl and fructosyl moieties of sucrose extracted from the tissue. Since it is unlikely that sucrose is present in the amyloplast, we suggest that the observed redistribution of label occurred in the cytosolic compartment of the endosperm cells and that both sucrose and starch are synthesized from a common pool of intermediates, such as hexose phosphate. We suggest that redistribution of label occurs via a cytosolic pathway cycle involving conversion of hexose phosphate to triose phosphate, interconversion of triose phosphate by triose phosphate isomerase, and resynthesis of hexose phosphate in the cytosol. A further round of triose phosphate interconversion in

  9. Auxin Biosynthesis: Are the Indole-3-Acetic Acid and Phenylacetic Acid Biosynthesis Pathways Mirror Images?

    PubMed

    Cook, Sam D; Nichols, David S; Smith, Jason; Chourey, Prem S; McAdam, Erin L; Quittenden, Laura; Ross, John J

    2016-06-01

    The biosynthesis of the main auxin in plants (indole-3-acetic acid [IAA]) has been elucidated recently and is thought to involve the sequential conversion of Trp to indole-3-pyruvic acid to IAA However, the pathway leading to a less well studied auxin, phenylacetic acid (PAA), remains unclear. Here, we present evidence from metabolism experiments that PAA is synthesized from the amino acid Phe, via phenylpyruvate. In pea (Pisum sativum), the reverse reaction, phenylpyruvate to Phe, is also demonstrated. However, despite similarities between the pathways leading to IAA and PAA, evidence from mutants in pea and maize (Zea mays) indicate that IAA biosynthetic enzymes are not the main enzymes for PAA biosynthesis. Instead, we identified a putative aromatic aminotransferase (PsArAT) from pea that may function in the PAA synthesis pathway. PMID:27208245

  10. Lanosterol biosynthesis in the prokaryote Methylococcus capsulatus: insight into the evolution of sterol biosynthesis.

    PubMed

    Lamb, David C; Jackson, Colin J; Warrilow, Andrew G S; Manning, Nigel J; Kelly, Diane E; Kelly, Steven L

    2007-08-01

    A putative operon containing homologues of essential eukaryotic sterol biosynthetic enzymes, squalene monooxygenase and oxidosqualene cyclase, has been identified in the genome of the prokaryote Methylococcus capsulatus. Expression of the squalene monooxygenase yielded a protein associated with the membrane fraction, while expression of oxidosqualene cyclase yielded a soluble protein, contrasting with the eukaryotic enzyme forms. Activity studies with purified squalene monooxygenase revealed a catalytic activity in epoxidation of 0.35 nmol oxidosqualene produced/min/nmol squalene monooxygenase, while oxidosqualene cyclase catalytic activity revealed cyclization of oxidosqualene to lanosterol with 0.6 nmol lanosterol produced/min/nmol oxidosqualene cyclase and no other products observed. The presence of prokaryotic sterol biosynthesis is still regarded as rare, and these are the first representatives of such prokaryotic enzymes to be studied, providing new insight into the evolution of sterol biosynthesis in general. PMID:17567593

  11. A Novel Muconic Acid Biosynthesis Approach by Shunting Tryptophan Biosynthesis via Anthranilate

    PubMed Central

    Sun, Xinxiao; Lin, Yuheng; Huang, Qin; Yuan, Qipeng

    2013-01-01

    Muconic acid is the synthetic precursor of adipic acid, and the latter is an important platform chemical that can be used for the production of nylon-6,6 and polyurethane. Currently, the production of adipic acid relies mainly on chemical processes utilizing petrochemicals, such as benzene, which are generally considered environmentally unfriendly and nonrenewable, as starting materials. Microbial synthesis from renewable carbon sources provides a promising alternative under the circumstance of petroleum depletion and environment deterioration. Here we devised a novel artificial pathway in Escherichia coli for the biosynthesis of muconic acid, in which anthranilate, the first intermediate in the tryptophan biosynthetic branch, was converted to catechol and muconic acid by anthranilate 1,2-dioxygenase (ADO) and catechol 1,2-dioxygenase (CDO), sequentially and respectively. First, screening for efficient ADO and CDO from different microbial species enabled the production of gram-per-liter level muconic acid from supplemented anthranilate in 5 h. To further achieve the biosynthesis of muconic acid from simple carbon sources, anthranilate overproducers were constructed by overexpressing the key enzymes in the shikimate pathway and blocking tryptophan biosynthesis. In addition, we found that introduction of a strengthened glutamine regeneration system by overexpressing glutamine synthase significantly improved anthranilate production. Finally, the engineered E. coli strain carrying the full pathway produced 389.96 ± 12.46 mg/liter muconic acid from simple carbon sources in shake flask experiments, a result which demonstrates scale-up potential for microbial production of muconic acid. PMID:23603682

  12. Biosynthesis and Heterologous Production of Epothilones

    NASA Astrophysics Data System (ADS)

    Müller, Rolf

    Although a variety of chemical syntheses for the epothilones and various derivatives have been described, modifying the backbone of those natural products remains a major challenge. One alternative to chemical alteration is the elucidation and subsequent manipulation of the biosynthetic pathway via genetic engineering in the producing organism. This type of approach is known as “combinatorial biosynthesis” and holds great promise, especially in conjunction with semi-synthesis methods to alter the structure of the natural product. In parallel, production can be optimized in the natural producer if the regulatory mechanisms governing the biosynthesis are understood. Alternatively, the entire gene cluster can be transferred into a heterologous host, more amenable both to genetic alteration and overexpression.

  13. Biosynthesis of cucurbitacins in Bryonia dioica seedlings.

    PubMed

    Cattel, L; Balliano, G; Caputo, O; Viola, F

    1981-04-01

    The biosynthesis of cucurbitacins during the seed germination of Bryonia dioica was studied by analysis of the cucurbitacin-triterpenoid fraction and by tracer experiments with acetate-[2- (14)C]. Isolation of 10alpha-cucurbita-5,24-dien-3beta-ol (9a), the simplest tetracyclic triterpene with a cucurbitane skeleton, supports the view that (9a) is the general precursor of cucurbitacins. Moreover, following the tracer experiments, cucurbitacin E (1a) was the first cucurbitacin formed, whereas the less oxygenated bryodulcosigenin (4a) was not detectable during germination of the plant. In the course of the present investigation, a new pentacyclic triterpene, isomultiflorenol (11a) (possible precursor of bryonolic acid (5a)), was also isolated. PMID:17401854

  14. A Molecular Description of Cellulose Biosynthesis

    PubMed Central

    McNamara, Joshua T.; Morgan, Jacob L.W.; Zimmer, Jochen

    2016-01-01

    Cellulose is the most abundant biopolymer on Earth, and certain organisms from bacteria to plants and animals synthesize cellulose as an extracellular polymer for various biological functions. Humans have used cellulose for millennia as a material and an energy source, and the advent of a lignocellulosic fuel industry will elevate it to the primary carbon source for the burgeoning renewable energy sector. Despite the biological and societal importance of cellulose, the molecular mechanism by which it is synthesized is now only beginning to emerge. On the basis of recent advances in structural and molecular biology on bacterial cellulose synthases, we review emerging concepts of how the enzymes polymerize glucose molecules, how the nascent polymer is transported across the plasma membrane, and how bacterial cellulose biosynthesis is regulated during biofilm formation. Additionally, we review evolutionary commonalities and differences between cellulose synthases that modulate the nature of the cellulose product formed. PMID:26034894

  15. Glycerolipid biosynthesis in isolated pea root plastids

    SciTech Connect

    Xue, Lingru; Sparace, S.A. )

    1990-05-01

    Plastids have been isolated from germinating pea (Pisum sativum L.) roots by differential centrifugation and purified on Percoll gradients. Marker enzymes (NADPH: cytochrome c reductase, fumarase and fatty acid synthesis) indicate that greater than 50% of the plastids are recovered essentially free from mitochondrial and endoplasmic reticulum contamination. Fatty acids synthesized from ({sup 14}C)acetate by Percoll-purified plastids are primarily 16:0, 16:1 and 18:1. ({sup 14}C)Acetate-labelled fatty acids and ({sup 14}C)glycerol-3-phosphate are both readily incorporated into glycerolipid. Approximately 12% of the total activity for glycerolipid biosynthesis from glycerol-3-phosphate is recovered in the purified plastid fraction. Glycerolipids synthesized from these precursors are primarily TAG, DAG, PE, PG, PC, PI and PA. Acyl-CoA's also accumulate when acetate is the precursor.

  16. Metabolic model for diversity-generating biosynthesis.

    PubMed

    Tianero, Ma Diarey; Pierce, Elizabeth; Raghuraman, Shrinivasan; Sardar, Debosmita; McIntosh, John A; Heemstra, John R; Schonrock, Zachary; Covington, Brett C; Maschek, J Alan; Cox, James E; Bachmann, Brian O; Olivera, Baldomero M; Ruffner, Duane E; Schmidt, Eric W

    2016-02-16

    A conventional metabolic pathway leads to a specific product. In stark contrast, there are diversity-generating metabolic pathways that naturally produce different chemicals, sometimes of great diversity. We demonstrate that for one such pathway, tru, each ensuing metabolic step is slower, in parallel with the increasing potential chemical divergence generated as the pathway proceeds. Intermediates are long lived and accumulate progressively, in contrast with conventional metabolic pathways, in which the first step is rate-limiting and metabolic intermediates are short-lived. Understanding these fundamental differences enables several different practical applications, such as combinatorial biosynthesis, some of which we demonstrate here. We propose that these principles may provide a unifying framework underlying diversity-generating metabolism in many different biosynthetic pathways. PMID:26831074

  17. Biosynthesis of amphetamine analogs in plants.

    PubMed

    Hagel, Jillian M; Krizevski, Raz; Marsolais, Frédéric; Lewinsohn, Efraim; Facchini, Peter J

    2012-07-01

    Amphetamine analogs are produced by plants in the genus Ephedra and by Catha edulis, and include the widely used decongestants and appetite suppressants pseudoephedrine and ephedrine. A combination of yeast (Candida utilis or Saccharomyces cerevisiae) fermentation and subsequent chemical modification is used for the commercial production of these compounds. The availability of certain plant biosynthetic genes would facilitate the engineering of yeast strains capable of de novo pseudoephedrine and ephedrine biosynthesis. Chemical synthesis has yielded amphetamine analogs with myriad functional group substitutions and diverse pharmacological properties. The isolation of enzymes with the serendipitous capacity to accept novel substrates could allow the production of substituted amphetamines in synthetic biosystems. Here, we review the biology, biochemistry and biotechnological potential of amphetamine analogs in plants. PMID:22502775

  18. Biosurfactant Mediated Biosynthesis of Selected Metallic Nanoparticles

    PubMed Central

    Płaza, Grażyna A.; Chojniak, Joanna; Banat, Ibrahim M.

    2014-01-01

    Developing a reliable experimental protocol for the synthesis of nanomaterials is one of the challenging topics in current nanotechnology particularly in the context of the recent drive to promote green technologies in their synthesis. The increasing need to develop clean, nontoxic and environmentally safe production processes for nanoparticles to reduce environmental impact, minimize waste and increase energy efficiency has become essential in this field. Consequently, recent studies on the use of microorganisms in the synthesis of selected nanoparticles are gaining increased interest as they represent an exciting area of research with considerable development potential. Microorganisms are known to be capable of synthesizing inorganic molecules that are deposited either intra- or extracellularly. This review presents a brief overview of current research on the use of biosurfactants in the biosynthesis of selected metallic nanoparticles and their potential importance. PMID:25110864

  19. Human genetic disorders of sphingolipid biosynthesis.

    PubMed

    Astudillo, Leonardo; Sabourdy, Frédérique; Therville, Nicole; Bode, Heiko; Ségui, Bruno; Andrieu-Abadie, Nathalie; Hornemann, Thorsten; Levade, Thierry

    2015-01-01

    Monogenic defects of sphingolipid biosynthesis have been recently identified in human patients. These enzyme deficiencies affect the synthesis of sphingolipid precursors, ceramides or complex glycosphingolipids. They are transmitted as autosomal recessive or dominant traits, and their resulting phenotypes often replicate the abnormalities seen in murine models deficient for the corresponding enzymes. In quite good agreement with the known critical roles of sphingolipids in cells from the nervous system and the epidermis, these genetic defects clinically manifest as neurological disorders, including paraplegia, epilepsy or peripheral neuropathies, or present with ichthyosis. The present review summarizes the genetic alterations, biochemical changes and clinical symptoms of this new group of inherited metabolic disorders. Hypotheses regarding the molecular pathophysiology and potential treatments of these diseases are also discussed. PMID:25141825

  20. Sargassum myriocystum mediated biosynthesis of gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Stalin Dhas, T.; Ganesh Kumar, V.; Stanley Abraham, L.; Karthick, V.; Govindaraju, K.

    2012-12-01

    Functionalized metal nanoparticles are unique in nature and are being developed for its specificity in drug targeting. In the present study, aqueous extract of Sargassum myriocystum is used for the biosynthesis of gold nanoparticles (AuNPs) by the reduction of chloroauric acid. The formation of nanoparticles reaction was complete within 15 min at 76 °C. The size, shape and elemental analysis of AuNPs were carried out using UV-visible absorption spectroscopy, FT-IR, TEM, SEM-EDAX, and XRD analysis. The newly formed AuNPs are stable, well-defined, polydispersed (triangular and spherical) and crystalline with an average size of 15 nm. The biomolecule involved in stabilizing AuNPs was identified using GC-MS.

  1. Flavones: From Biosynthesis to Health Benefits

    PubMed Central

    Jiang, Nan; Doseff, Andrea I.; Grotewold, Erich

    2016-01-01

    Flavones correspond to a flavonoid subgroup that is widely distributed in the plants, and which can be synthesized by different pathways, depending on whether they contain C- or O-glycosylation and hydroxylated B-ring. Flavones are emerging as very important specialized metabolites involved in plant signaling and defense, as well as key ingredients of the human diet, with significant health benefits. Here, we appraise flavone formation in plants, emphasizing the emerging theme that biosynthesis pathway determines flavone chemistry. Additionally, we briefly review the biological activities of flavones, both from the perspective of the functions that they play in biotic and abiotic plant interactions, as well as their roles as nutraceutical components of the human and animal diet. PMID:27338492

  2. Metabolic model for diversity-generating biosynthesis

    PubMed Central

    Tianero, Ma. Diarey; Pierce, Elizabeth; Raghuraman, Shrinivasan; Sardar, Debosmita; McIntosh, John A.; Heemstra, John R.; Schonrock, Zachary; Covington, Brett C.; Maschek, J. Alan; Cox, James E.; Bachmann, Brian O.; Olivera, Baldomero M.; Ruffner, Duane E.; Schmidt, Eric W.

    2016-01-01

    A conventional metabolic pathway leads to a specific product. In stark contrast, there are diversity-generating metabolic pathways that naturally produce different chemicals, sometimes of great diversity. We demonstrate that for one such pathway, tru, each ensuing metabolic step is slower, in parallel with the increasing potential chemical divergence generated as the pathway proceeds. Intermediates are long lived and accumulate progressively, in contrast with conventional metabolic pathways, in which the first step is rate-limiting and metabolic intermediates are short-lived. Understanding these fundamental differences enables several different practical applications, such as combinatorial biosynthesis, some of which we demonstrate here. We propose that these principles may provide a unifying framework underlying diversity-generating metabolism in many different biosynthetic pathways. PMID:26831074

  3. mitochondrial pathway for biosynthesis of lipid mediators

    PubMed Central

    Tyurina, Yulia Y.; Poloyac, Samuel M.; Tyurin, Vladimir A.; Kapralov, Alexander A.; Jiang, Jianfei; Anthonymuthu, Tamil Selvan; Kapralova, Valentina I.; Vikulina, Anna S.; Jung, Mi-Yeon; Epperly, Michael W.; Mohammadyani, Dariush; Klein-Seetharaman, Judith; Jackson, Travis C.; Kochanek, Patrick M.; Pitt, Bruce R.; Greenberger, Joel S.; Vladimirov, Yury A.; Bayır, Hülya; Kagan, Valerian E.

    2014-01-01

    The central role of mitochondria in metabolic pathways and in cell death mechanisms requires sophisticated signaling systems. Essential in this signaling process is an array of lipid mediators derived from polyunsaturated fatty acids. However, the molecular machinery for the production of oxygenated polyunsaturated fatty acids is localized in the cytosol and their biosynthesis has not been identified in mitochondria. Here we report that a range of diversified polyunsaturated molecular species derived from a mitochondria-specific phospholipid, cardiolipin, are oxidized by the intermembrane space hemoprotein, cytochrome c. We show that an assortment of oxygenated cardiolipin species undergoes phospholipase A2-catalyzed hydrolysis thus generating multiple oxygenated fatty acids, including well known lipid mediators. This represents a new biosynthetic pathway for lipid mediators. We demonstrate that this pathway including oxidation of polyunsaturated cardiolipins and accumulation of their hydrolysis products – oxygenated linoleic, arachidonic acids and monolyso-cardiolipins – is activated in vivo after acute tissue injury. PMID:24848241

  4. Terpenoids and Their Biosynthesis in Cyanobacteria

    PubMed Central

    Pattanaik, Bagmi; Lindberg, Pia

    2015-01-01

    Terpenoids, or isoprenoids, are a family of compounds with great structural diversity which are essential for all living organisms. In cyanobacteria, they are synthesized from the methylerythritol-phosphate (MEP) pathway, using glyceraldehyde 3-phosphate and pyruvate produced by photosynthesis as substrates. The products of the MEP pathway are the isomeric five-carbon compounds isopentenyl diphosphate and dimethylallyl diphosphate, which in turn form the basic building blocks for formation of all terpenoids. Many terpenoid compounds have useful properties and are of interest in the fields of pharmaceuticals and nutrition, and even potentially as future biofuels. The MEP pathway, its function and regulation, and the subsequent formation of terpenoids have not been fully elucidated in cyanobacteria, despite its relevance for biotechnological applications. In this review, we summarize the present knowledge about cyanobacterial terpenoid biosynthesis, both regarding the native metabolism and regarding metabolic engineering of cyanobacteria for heterologous production of non-native terpenoids. PMID:25615610

  5. A molecular description of cellulose biosynthesis.

    PubMed

    McNamara, Joshua T; Morgan, Jacob L W; Zimmer, Jochen

    2015-01-01

    Cellulose is the most abundant biopolymer on Earth, and certain organisms from bacteria to plants and animals synthesize cellulose as an extracellular polymer for various biological functions. Humans have used cellulose for millennia as a material and an energy source, and the advent of a lignocellulosic fuel industry will elevate it to the primary carbon source for the burgeoning renewable energy sector. Despite the biological and societal importance of cellulose, the molecular mechanism by which it is synthesized is now only beginning to emerge. On the basis of recent advances in structural and molecular biology on bacterial cellulose synthases, we review emerging concepts of how the enzymes polymerize glucose molecules, how the nascent polymer is transported across the plasma membrane, and how bacterial cellulose biosynthesis is regulated during biofilm formation. Additionally, we review evolutionary commonalities and differences between cellulose synthases that modulate the nature of the cellulose product formed. PMID:26034894

  6. Biosynthesis of the phytoalexin pisatin. [Pisum sativum

    SciTech Connect

    Preisig, C.L.; Bell, J.N.; Matthews, D.E.; VanEtten, H.D. ); Sun, Yuejin; Hrazdina, G. )

    1990-11-01

    NADPH-dependent reduction of 2{prime},7-dihydroxy-4{prime},5{prime}-methylenedioxyisoflavone to the isoflavanone sophorol, a proposed intermediate step in pisatin biosynthesis, was detected in extracts of Pisum sativum. This isoflavone reductase activity was inducible by treatment of pea seedlings with CuCl{sub 2}. The timing of induction coincided with that of the 6a-hydroxymaackiain 3-O-methyltransferase, which catalyzes the terminal biosynthetic step. Neither enzyme was light inducible. Further NADPH-dependent metabolism of sophorol by extracts of CuCl{sub 2}-treated seedlings was also observed; three products were radiolabeled when ({sup 3}H)sophorol was the substrate, one of which is tentatively identified as maackiain.

  7. Flavones: From Biosynthesis to Health Benefits.

    PubMed

    Jiang, Nan; Doseff, Andrea I; Grotewold, Erich

    2016-01-01

    Flavones correspond to a flavonoid subgroup that is widely distributed in the plants, and which can be synthesized by different pathways, depending on whether they contain C- or O-glycosylation and hydroxylated B-ring. Flavones are emerging as very important specialized metabolites involved in plant signaling and defense, as well as key ingredients of the human diet, with significant health benefits. Here, we appraise flavone formation in plants, emphasizing the emerging theme that biosynthesis pathway determines flavone chemistry. Additionally, we briefly review the biological activities of flavones, both from the perspective of the functions that they play in biotic and abiotic plant interactions, as well as their roles as nutraceutical components of the human and animal diet. PMID:27338492

  8. Glucose enhances indolic glucosinolate biosynthesis without reducing primary sulfur assimilation

    PubMed Central

    Miao, Huiying; Cai, Congxi; Wei, Jia; Huang, Jirong; Chang, Jiaqi; Qian, Hongmei; Zhang, Xin; Zhao, Yanting; Sun, Bo; Wang, Bingliang; Wang, Qiaomei

    2016-01-01

    The effect of glucose as a signaling molecule on induction of aliphatic glucosinolate biosynthesis was reported in our former study. Here, we further investigated the regulatory mechanism of indolic glucosinolate biosynthesis by glucose in Arabidopsis. Glucose exerted a positive influence on indolic glucosinolate biosynthesis, which was demonstrated by induced accumulation of indolic glucosinolates and enhanced expression of related genes upon glucose treatment. Genetic analysis revealed that MYB34 and MYB51 were crucial in maintaining the basal indolic glucosinolate accumulation, with MYB34 being pivotal in response to glucose signaling. The increased accumulation of indolic glucosinolates and mRNA levels of MYB34, MYB51, and MYB122 caused by glucose were inhibited in the gin2-1 mutant, suggesting an important role of HXK1 in glucose-mediated induction of indolic glucosinolate biosynthesis. In contrast to what was known on the function of ABI5 in glucose-mediated aliphatic glucosinolate biosynthesis, ABI5 was not required for glucose-induced indolic glucosinolate accumulation. In addition, our results also indicated that glucose-induced glucosinolate accumulation was due to enhanced sulfur assimilation instead of directed sulfur partitioning into glucosinolate biosynthesis. Thus, our data provide new insights into molecular mechanisms underlying glucose-regulated glucosinolate biosynthesis. PMID:27549907

  9. Glucose enhances indolic glucosinolate biosynthesis without reducing primary sulfur assimilation.

    PubMed

    Miao, Huiying; Cai, Congxi; Wei, Jia; Huang, Jirong; Chang, Jiaqi; Qian, Hongmei; Zhang, Xin; Zhao, Yanting; Sun, Bo; Wang, Bingliang; Wang, Qiaomei

    2016-01-01

    The effect of glucose as a signaling molecule on induction of aliphatic glucosinolate biosynthesis was reported in our former study. Here, we further investigated the regulatory mechanism of indolic glucosinolate biosynthesis by glucose in Arabidopsis. Glucose exerted a positive influence on indolic glucosinolate biosynthesis, which was demonstrated by induced accumulation of indolic glucosinolates and enhanced expression of related genes upon glucose treatment. Genetic analysis revealed that MYB34 and MYB51 were crucial in maintaining the basal indolic glucosinolate accumulation, with MYB34 being pivotal in response to glucose signaling. The increased accumulation of indolic glucosinolates and mRNA levels of MYB34, MYB51, and MYB122 caused by glucose were inhibited in the gin2-1 mutant, suggesting an important role of HXK1 in glucose-mediated induction of indolic glucosinolate biosynthesis. In contrast to what was known on the function of ABI5 in glucose-mediated aliphatic glucosinolate biosynthesis, ABI5 was not required for glucose-induced indolic glucosinolate accumulation. In addition, our results also indicated that glucose-induced glucosinolate accumulation was due to enhanced sulfur assimilation instead of directed sulfur partitioning into glucosinolate biosynthesis. Thus, our data provide new insights into molecular mechanisms underlying glucose-regulated glucosinolate biosynthesis. PMID:27549907

  10. Disorders of carnitine biosynthesis and transport.

    PubMed

    El-Hattab, Ayman W; Scaglia, Fernando

    2015-11-01

    Carnitine is a hydrophilic quaternary amine that plays a number of essential roles in metabolism with the main function being the transport of long-chain fatty acids from the cytosol to the mitochondrial matrix for β-oxidation. Carnitine can be endogenously synthesized. However, only a small fraction of carnitine is obtained endogenously while the majority is obtained from diet, mainly animal products. Carnitine is not metabolized and is excreted in urine. Carnitine homeostasis is regulated by efficient renal reabsorption that maintains carnitine levels within the normal range despite variabilities in dietary intake. Diseases occurring due to primary defects in carnitine metabolism and homeostasis are comprised in two groups: disorders of carnitine biosynthesis and carnitine transport defect. While the hallmark of carnitine transport defect is profound carnitine depletion, disorders of carnitine biosynthesis do not cause carnitine deficiency due to the fact that both carnitine obtained from diet and efficient renal carnitine reabsorption can maintain normal carnitine levels with the absence of endogenously synthesized carnitine. Carnitine transport defect phenotype encompasses a broad clinical spectrum including metabolic decompensation in infancy, cardiomyopathy in childhood, fatigability in adulthood, or absence of symptoms. The phenotypes associated with the carnitine transport defect result from the unavailability of enough carnitine to perform its functions particularly in fatty acid β-oxidation. Carnitine biosynthetic defects have been recently described and the phenotypic consequences of these defects are still emerging. Although these defects do not result in carnitine deficiency, they still could be associated with pathological phenotypes due to excess or deficiency of intermediate metabolites in the carnitine biosynthetic pathway and potential carnitine deficiency in early stages of life when brain and other organs develop. In addition to these two

  11. PLANT VOLATILES. Biosynthesis of monoterpene scent compounds in roses.

    PubMed

    Magnard, Jean-Louis; Roccia, Aymeric; Caissard, Jean-Claude; Vergne, Philippe; Sun, Pulu; Hecquet, Romain; Dubois, Annick; Hibrand-Saint Oyant, Laurence; Jullien, Frédéric; Nicolè, Florence; Raymond, Olivier; Huguet, Stéphanie; Baltenweck, Raymonde; Meyer, Sophie; Claudel, Patricia; Jeauffre, Julien; Rohmer, Michel; Foucher, Fabrice; Hugueney, Philippe; Bendahmane, Mohammed; Baudino, Sylvie

    2015-07-01

    The scent of roses (Rosa x hybrida) is composed of hundreds of volatile molecules. Monoterpenes represent up to 70% percent of the scent content in some cultivars, such as the Papa Meilland rose. Monoterpene biosynthesis in plants relies on plastid-localized terpene synthases. Combining transcriptomic and genetic approaches, we show that the Nudix hydrolase RhNUDX1, localized in the cytoplasm, is part of a pathway for the biosynthesis of free monoterpene alcohols that contribute to fragrance in roses. The RhNUDX1 protein shows geranyl diphosphate diphosphohydrolase activity in vitro and supports geraniol biosynthesis in planta. PMID:26138978

  12. Application of PRECEDE-PROCEED model to tackle problems identified with diarrhoea burden among under-5s in Botswana.

    PubMed

    Popoola, Tosin; Mchunu, Gugu

    2015-05-01

    Diarrhoea has been identified as the second leading cause of mortality among under-5s and also claims more life than HIV, measles and malaria combined together in the same category of population. This article is a combination of literature review and personal experience of lessons learnt from past diarrhoea outbreaks in Botswana that caused significant rate of mortality among under-5s. The paper used literature review to identify contributory factors to diarrhoea burden among under-5s in Botswana and applied a community health nursing framework (PRECEDE-PROCEED) to tackle the problems identified. The study revealed that Botswana mothers are lacking in knowledge related to exclusive breastfeeding, prevention and treatment of diarrhoea disease. The paper recommends that health-care workers in Botswana be sensitized on current diarrhoea management to tailor their health education methods appropriately. PMID:26125574

  13. Functional variants of 5S rRNA in the ribosomes of common sea urchin Paracentrotus lividus.

    PubMed

    Dimarco, Eufrosina; Cascone, Eleonora; Bellavia, Daniele; Caradonna, Fabio

    2012-10-15

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus; this study, performed at DNA level only, lends itself as starting point to verify that these clusters could contain transcribed genes, then, to demonstrate the presence of heterogeneity at functional RNA level, also. In the present work we report in P. lividus ribosomes the existence of several transcribed variants of the 5S rRNA and we associate all transcribed variants to the cluster to which belong. Our finding is the first demonstration of the presence of high heterogeneity in functional 5S rRNA molecules in animal ribosomes, a feature that had been considered a peculiarity of some plants. PMID:22967708

  14. Xenopus transcription factor IIIA binds primarily at junctions between double helical stems and internal loops in oocyte 5S RNA.

    PubMed Central

    Christiansen, J; Brown, R S; Sproat, B S; Garrett, R A

    1987-01-01

    RNases and chemical probes were used to study the accessibility of each nucleotide of 5S RNA in the native and reconstituted 7S particle from Xenopus laevis oocytes. RNase or chemically treated 5S RNA from intact 7S particles was isolated and analysed using an oligodeoxynucleotide primer and reverse transcriptase. The results were superimposed on a cylindrical projection of an RNA double helix and the protection effects were shown to cluster at two regions on the molecular surface. A three-dimensional model is proposed for the 7S particle in which protein-RNA contacts occur mainly in the major groove of 5S RNA. Images Fig. 1. Fig. 2. PMID:3582366

  15. Transsacral transdiscal L5-S1 screws for the management of high-grade spondylolisthesis in an adolescent.

    PubMed

    Palejwala, Ali; Fridley, Jared; Jea, Andrew

    2016-06-01

    The surgical management of high-grade spondylolisthesis in adolescents remains a controversial issue. Because the basic procedure, posterolateral fusion, is associated with a significant rate of pseudarthrosis and listhesis progression, there is a pressing need for alternative surgical techniques. In the present report, the authors describe the case of an adolescent patient with significant low-back pain who was found to have Grade IV spondylolisthesis at L5-S1 that was treated with transsacral transdiscal screw fixation. Bilateral pedicle screws were placed starting from the top of the S-1 pedicle, across the L5-S1 intervertebral disc space, and into the L-5 body. At 14 months after surgery, the patient had considerable improvement in his pain and radiographic fusion across L5-S1. The authors conclude that transsacral transdiscal pedicle screws may serve as an efficacious and safe option for the correction of high-grade spondylolisthesis in adolescent patients. PMID:26894520

  16. Dissociative excitation of the N(+)(5S) state by electron impact on N2 - Excitation function and quenching

    NASA Technical Reports Server (NTRS)

    Erdman, P. W.; Zipf, E. C.

    1986-01-01

    Metastable N(+)(5S) ions were produced in the laboratory by dissociative excitation of N2 with energetic electrons. The resulting radiative decay of the N(+)(5S) state was observed with sufficient resolution to completely resolve the doublet from the nearby N2 molecular radiation. The excitation function was measured from threshold to 500 eV. The cross section peaks at a high electron energy and also exhibits a high threshold energy both of which are typical of dissociative excitation-ionization processes. This finding complicates the explanation of electron impact on N2 as the mechanism for the source of the 2145 A 'auroral mystery feature' by further increasing the required peak cross section. It is suggested that the apparent N(+)(5S) quenching in auroras may be an artifact due to the softening of the electron energy spectrum in the auroral E region.

  17. D5S2500 is an ambiguously characterized STR: Identification and description of forensic microsatellites in the genomics age.

    PubMed

    Phillips, C; Parson, W; Amigo, J; King, J L; Coble, M D; Steffen, C R; Vallone, P M; Gettings, K B; Butler, J M; Budowle, B

    2016-07-01

    In the process of establishing short tandem repeat (STR) sequence variant nomenclature guidelines in anticipation of expanded forensic multiplexes for massively parallel sequencing (MPS), it was discovered that the STR D5S2500 has multiple positions and genomic characteristics reported. This ambiguity is because the marker named D5S2500 consists of two different microsatellites forming separate components in the capillary electrophoresis multiplexes of Qiagen's HDplex (Hilden, Germany) and AGCU ScienTech's non-CODIS STR 21plex (Wuxi, Jiangsu, China). This study outlines the genomic details used to identify each microsatellite and reveals the D5S2500 marker in HDplex has the correctly assigned STR name, while the D5S2500 marker in the AGCU 21plex, closely positioned a further 1643 nucleotides in the human reference sequence, is an unnamed microsatellite. The fact that the D5S2500 marker has existed as two distinct STR loci undetected for almost ten years, even with reported discordant genotypes for the standard control DNA, underlines the need for careful scrutiny of the genomic properties of forensic STRs, as they become adapted for sequence analysis with MPS systems. We make the recommendation that precise chromosome location data must be reported for any forensic marker under development but not in common use, so that the genomic characteristics of the locus are validated to the same level of accuracy as its allelic variation and forensic performance. To clearly differentiate each microsatellite, we propose the name D5S2800 be used to identify the Chromosome-5 STR in the AGCU 21plex. PMID:26974236

  18. Domain rearrangement of SRP protein Ffh upon binding 4.5S RNA and the SRP receptor FtsY

    PubMed Central

    BUSKIEWICZ, IWONA; KUBARENKO, ANDRIY; PESKE, FRANK; RODNINA, MARINA V.; WINTERMEYER, WOLFGANG

    2005-01-01

    The signal recognition particle (SRP) mediates membrane targeting of translating ribosomes displaying a signal-anchor sequence. In Escherichia coli, SRP consists of 4.5S RNA and a protein, Ffh, that recognizes the signal peptide emerging from the ribosome and the SRP receptor at the membrane, FtsY. In the present work, we studied the interactions between the NG and M domains in Ffh and their rearrangements upon complex formation with 4.5S RNA and/or FtsY. In free Ffh, the NG and M domains are facing one another in an orientation that allows cross-linking between positions 231 in the G domain and 377 in the M domain. There are binding interactions between the two domains, as the isolated domains form a strong complex. The interdomain contacts are disrupted upon binding of Ffh to 4.5S RNA, consuming a part of the total binding energy of 4.5S RNA-Ffh association that is roughly equivalent to the free energy of domain binding to each other. In the SRP particle, the NG domain binds to 4.5S RNA in a region adjacent to the binding site of the M domain. Ffh binding to FtsY also requires a reorientation of NG and M domains. These results suggest that in free Ffh, the binding sites for 4.5S RNA and FtsY are occluded by strong domain–domain interactions which must be disrupted for the formation of SRP or the Ffh-FtsY complex. PMID:15923378

  19. Domain rearrangement of SRP protein Ffh upon binding 4.5S RNA and the SRP receptor FtsY.

    PubMed

    Buskiewicz, Iwona; Kubarenko, Andriy; Peske, Frank; Rodnina, Marina V; Wintermeyer, Wolfgang

    2005-06-01

    The signal recognition particle (SRP) mediates membrane targeting of translating ribosomes displaying a signal-anchor sequence. In Escherichia coli, SRP consists of 4.5S RNA and a protein, Ffh, that recognizes the signal peptide emerging from the ribosome and the SRP receptor at the membrane, FtsY. In the present work, we studied the interactions between the NG and M domains in Ffh and their rearrangements upon complex formation with 4.5S RNA and/or FtsY. In free Ffh, the NG and M domains are facing one another in an orientation that allows cross-linking between positions 231 in the G domain and 377 in the M domain. There are binding interactions between the two domains, as the isolated domains form a strong complex. The interdomain contacts are disrupted upon binding of Ffh to 4.5S RNA, consuming a part of the total binding energy of 4.5S RNA-Ffh association that is roughly equivalent to the free energy of domain binding to each other. In the SRP particle, the NG domain binds to 4.5S RNA in a region adjacent to the binding site of the M domain. Ffh binding to FtsY also requires a reorientation of NG and M domains. These results suggest that in free Ffh, the binding sites for 4.5S RNA and FtsY are occluded by strong domain-domain interactions which must be disrupted for the formation of SRP or the Ffh-FtsY complex. PMID:15923378

  20. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    PubMed

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location. PMID:27334092

  1. Comparative structural analysis of eubacterial 5S rRNA by oxidation of adenines in the N-1 position.

    PubMed Central

    Pieler, T; Schreiber, A; Erdmann, V A

    1984-01-01

    Adenines in free 5S rRNA from Escherichia coli, Bacillus stearothermophilus and Thermus thermophilus have been oxidized at their N-1 position using monoperphthalic acid. The determination of the number of adenine 1-N-oxides was on the basis of UV spectroscopic data of the intact molecule. Identification of the most readily accessible nucleotides by sequencing gel analysis reveals that they are located in conserved positions within loops, exposed hairpin loops and single-base bulge loops. Implications for the structure and function of 5S rRNA will be discussed on the basis of this comparative analysis. Images PMID:6201825

  2. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    PubMed

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families. PMID:25315165

  3. Identification of a 5S rDNA spacer type specific Triticum urartu and wheats containing the T. urartu genome.

    PubMed

    Allaby, R G; Brown, T A

    2000-04-01

    A PCR system was designed to amplify 5S spacer rDNA specifically from homeologous chromosome 1 in a variety of species representative of the Aegilops and Triticum genera. Two polymerase chain reaction (PCR) primer combinations were used, one of which appears to be apomorphic in nature and specific to chromosome 1A in Triticum urartu and tetraploid and hexaploid wheats containing the AA genome donated by T. urartu. The value of studying single repeat types to investigate the molecular evolution of 5S-rDNA arrays is considered. PMID:10791812

  4. Regulation of volatile benzenoid biosynthesis in petunia flowers.

    PubMed

    Schuurink, Robert C; Haring, Michel A; Clark, David G

    2006-01-01

    The petunia flower has served as a model for the study of several physiological processes including floral development, self-incompatibility, anthocyanin biosynthesis and ethylene signalling during senescence. More recently, Petunia hybrida 'Mitchell' has been used to understand the complex regulation of volatile benzenoid biosynthesis, which occurs predominantly in flower petal tissues. Benzenoid biosynthesis is temporally and circadian controlled and is tightly down-regulated by ethylene during floral senescence. Using targeted transcriptomics and gene knockouts, both biosynthetic genes and a transcription factor regulating benzenoid synthesis have been recently discovered and characterized. It appears that benzenoid production is regulated predominantly by transcriptional control of the shikimate pathway, benzenoid biosynthesis genes and S-adenosyl-methionine cycle genes. PMID:16226052

  5. Pyrethrin biosynthesis and its regulation in Chrysanthemum cinerariaefolium.

    PubMed

    Matsuda, Kazuhiko

    2012-01-01

    Pyrethrins are a natural insecticide biosynthesized by the plant pyrethrum [Chrysanthemum cinerariaefolium (Current species name: Tanacetum cinerariifolium)] of the family Asteraceae. Although pyrethrins have been used to control household pests for the past century, little is known about the mechanism of biosynthesis, contrasting with intensive research on their synthetic analogs, pyrethroids. The author studied pyrethrin biosynthesis in young seedlings of C. cinerariaefolium. The results of experiments using (13)C-labeled glucose as the biosynthesis precursor indicated that the acid and alcohol moieties are biosynthesized via the 2-C-methyl-D: -erythritol 4-phosphate (MEP) and oxylipin pathways, respectively. Further study on the effects of wound-induced signals in leaves showed that biosynthesis is enhanced in response to both volatile and nonvolatile signals. PMID:22006239

  6. Biosynthesis of putrescine in the prostate gland of the rat

    PubMed Central

    Pegg, A. E.; Williams-Ashman, H. G.

    1968-01-01

    In the rat ventral prostate gland the biosynthesis of putrescine, a precursor of spermidine and spermine, is shown to occur by the direct decarboxylation of l-ornithine. Some properties of a soluble pyridoxal phosphate-dependent l-ornithine decarboxylase are described. The findings are discussed in relation to other enzymic reactions involved in the biosynthesis of polyamines by the prostate gland. PMID:5667265

  7. A Functional Genomics Approach to Tanshinone Biosynthesis Provides Stereochemical Insights

    PubMed Central

    2009-01-01

    Tanshinones are abietane-type norditerpenoid quinone natural products that are the bioactive components of the Chinese medicinal herb Salvia miltiorrhiza Bunge. The initial results from a functional genomics-based investigation of tanshinone biosynthesis, specifically the functional identification of the relevant diterpene synthases from S. miltiorrhiza, are reported. The cyclohexa-1,4-diene arrangement of the distal ring poises the resulting miltiradiene for the ensuing aromatization and hydroxylation to ferruginol suggested for tanshinone biosynthesis. PMID:19905026

  8. A functional genomics approach to tanshinone biosynthesis provides stereochemical insights.

    PubMed

    Gao, Wei; Hillwig, Matthew L; Huang, Luqi; Cui, Guanghong; Wang, Xueyong; Kong, Jianqiang; Yang, Bin; Peters, Reuben J

    2009-11-19

    Tanshinones are abietane-type norditerpenoid quinone natural products that are the bioactive components of the Chinese medicinal herb Salvia miltiorrhiza Bunge. The initial results from a functional genomics-based investigation of tanshinone biosynthesis, specifically the functional identification of the relevant diterpene synthases from S. miltiorrhiza, are reported. The cyclohexa-1,4-diene arrangement of the distal ring poises the resulting miltiradiene for the ensuing aromatization and hydroxylation to ferruginol suggested for tanshinone biosynthesis. PMID:19905026

  9. Complexity Generation during Natural Product Biosynthesis using Redox Enzymes

    PubMed Central

    Wang, Peng; Gao, Xue; Tang, Yi

    2012-01-01

    Redox enzymes such as FAD-dependent and cytochrome P450 oxygenases play indispensible roles in generating structural complexity during natural product biosynthesis. In the pre-assembly steps, redox enzymes can convert garden variety primary metabolites into unique starter and extender building blocks. In the post-assembly tailoring steps, redox cascades can transform nascent scaffolds into structurally complex final products. In this review, we will discuss several recently characterized redox enzymes in the biosynthesis of polyketides and nonribosomal peptides. PMID:22564679

  10. Increased thromboxane biosynthesis in essential thrombocythemia.

    PubMed

    Rocca, B; Ciabattoni, G; Tartaglione, R; Cortelazzo, S; Barbui, T; Patrono, C; Landolfi, R

    1995-11-01

    In order to investigate the in vivo thromboxane (TX) biosynthesis in essential thrombocythemia (ET), we measured the urinary excretion of the major enzymatic metabolites of TXB2, 11-dehydro-TXB2 and 2,3-dinor-TXB2 in 40 ET patients as well as in 26 gender- and age-matched controls. Urinary 11-dehydro-TXB2 was significantly higher (p < 0.001) in thrombocythemic patients (4,063 +/- 3,408 pg/mg creatinine; mean +/- SD) than in controls (504 +/- 267 pg/mg creatinine), with 34 patients (85%) having 11-dehydro-TXB2 > 2 SD above the control mean. Patients with platelet number < 1,000 x 10 (9)/1 (n = 25) had significantly higher (p < 0.05) 11-dehydro-TXB2 excretion than patients with higher platelet count (4,765 +/- 3,870 pg/mg creatinine, n = 25, versus 2,279 +/- 1,874 pg/mg creatinine, n = 15). Average excretion values of patients aging > 55 was significantly higher than in the younger group (4,784 +/- 3,948 pg/mg creatinine, n = 24, versus 2,405 +/- 1,885 pg/mg creatinine, n = 16, p < 0.05). Low-dose aspirin (50 mg/d for 7 days) largely suppressed 11-dehydro-TXB2 excretion in 7 thrombocythemic patients, thus suggesting that platelets were the main source of enhanced TXA2 biosynthesis. The platelet count-corrected 11-dehydro-TXB2 excretion was positively correlated with age (r = 0.325, n = 40, p < 0.05) and inversely correlated with platelet count (r = -0.381, n = 40, p < 0.05). In addition 11 out of 13 (85%) patients having increased count-corrected 11-dehydro-TXB2 excretion, belonged to the subgroup with age > 55 and platelet count < 1,000 x 10(9)/1. We conclude that in essential thrombocythemia: 1) enhanced 11-dehydro-TXB2 excretion largely reflects platelet activation in vivo; 2) age as well as platelet count appear to influence the determinants of platelet activation in this setting, and can help in assessing the thrombotic risk and therapeutic strategy in individual patients. PMID:8607099

  11. Fenarimol, a Pyrimidine-Type Fungicide, Inhibits Brassinosteroid Biosynthesis

    PubMed Central

    Oh, Keimei; Matsumoto, Tadashi; Yamagami, Ayumi; Hoshi, Tomoki; Nakano, Takeshi; Yoshizawa, Yuko

    2015-01-01

    The plant steroid hormone brassinosteroids (BRs) are important signal mediators that regulate broad aspects of plant growth and development. With the discovery of brassinoazole (Brz), the first specific inhibitor of BR biosynthesis, several triazole-type BR biosynthesis inhibitors have been developed. In this article, we report that fenarimol (FM), a pyrimidine-type fungicide, exhibits potent inhibitory activity against BR biosynthesis. FM induces dwarfism and the open cotyledon phenotype of Arabidopsis seedlings in the dark. The IC50 value for FM to inhibit stem elongation of Arabidopsis seedlings grown in the dark was approximately 1.8 ± 0.2 μM. FM-induced dwarfism of Arabidopsis seedlings could be restored by brassinolide (BL) but not by gibberellin (GA). Assessment of the target site of FM in BR biosynthesis by feeding BR biosynthesis intermediates indicated that FM interferes with the side chain hydroxylation of BR biosynthesis from campestanol to teasterone. Determination of the binding affinity of FM to purified recombinant CYP90D1 indicated that FM induced a typical type II binding spectrum with a Kd value of approximately 0.79 μM. Quantitative real-time PCR analysis of the expression level of the BR responsive gene in Arabidopsis seedlings indicated that FM induces the BR deficiency in Arabidopsis. PMID:26230686

  12. A methylated Neurospora 5S rRNA pseudogene contains a transposable element inactivated by repeat-induced point mutation.

    PubMed Central

    Margolin, B S; Garrett-Engele, P W; Stevens, J N; Fritz, D Y; Garrett-Engele, C; Metzenberg, R L; Selker, E U

    1998-01-01

    In an analysis of 22 of the roughly 100 dispersed 5S rRNA genes in Neurospora crassa, a methylated 5S rRNA pseudogene, Psi63, was identified. We characterized the Psi63 region to better understand the control and function of DNA methylation. The 120-bp 5S rRNA-like region of Psi63 is interrupted by a 1.9-kb insertion that has characteristics of sequences that have been modified by repeat-induced point mutation (RIP). We found sequences related to this insertion in wild-type strains of N. crassa and other Neurospora species. Most showed evidence of RIP; but one, isolated from the N. crassa host of Psi63, showed no evidence of RIP. A deletion from near the center of this sequence apparently rendered it incapable of participating in RIP with the related full-length copies. The Psi63 insertion and the related sequences have features of transposons and are related to the Fot1 class of fungal transposable elements. Apparently Psi63 was generated by insertion of a previously unrecognized Neurospora transposable element into a 5S rRNA gene, followed by RIP. We name the resulting inactivated Neurospora transposon PuntRIP1 and the related sequence showing no evidence of RIP, but harboring a deletion that presumably rendered it defective for transposition, dPunt. PMID:9691037

  13. Lipid Biosynthesis in Developing Mustard Seed

    PubMed Central

    Mukherjee, Kumar D.

    1983-01-01

    Cotyledons of developing mustard (Sinapis alba L.) seed have been found to synthesize lipids containing the common plant fatty acids and very long-chain monounsaturated (icosenoic, erucic, and tetracosenic) and saturated (icosanoic, docosanoic, and tetracosanoic) fatty acids from various radioactive precursors. The in vivo pattern of labeling of acyl lipids, either from fatty acids synthesized `endogenously' from radioactive acetate or malonate, or from radioactive fatty acids added `exogenously', indicates the involvement of the following pathways in the biosynthesis of triacylglycerols. Palmitic, stearic, and oleic acid, synthesized in the acyl carrier protein-track, are channeled to the Coenzyme A (CoA)-track and converted to triacylglycerols via the glycerol-3-phosphate pathway. Pools of stearoyl-CoA and oleoyl-CoA are elongated to very long-chain saturated and monounsaturated acyl-CoA, respectively. Most of the very long-chain saturated acyl-CoAs acylate preformed diacylglycerols. Very long-chain monounsaturated acyl-CoAs are converted to triacylglycerols, partly via phosphatidic acids and diacylglycerols, and partly by acylation of preformed diacylglycerols. PMID:16663345

  14. Cholesterol biosynthesis modulation regulates dengue viral replication.

    PubMed

    Rothwell, Christopher; Lebreton, Aude; Young Ng, Chuan; Lim, Joanne Y H; Liu, Wei; Vasudevan, Subhash; Labow, Mark; Gu, Feng; Gaither, L Alex

    2009-06-20

    We performed a focused siRNA screen in an A549 dengue type 2 New Guinea C subgenomic replicon cell line (Rluc-replicon) that contains a Renilla luciferase cassette. We found that siRNA mediated knock down of mevalonate diphospho decarboxylase (MVD) inhibited viral replication of the Rluc-replicon and DEN-2 NGC live virus replication in A549 cells. When the Rluc-replicon A459 cells were grown in delipidated media the replicon expression was suppressed and MVD knock down could further sensitize Renilla expression. Hymeglusin and zaragozic acid A could inhibit DEN-2 NGC live virus replication in K562 cells, while lovastatin could inhibit DEN-2 NGC live virus replication in human peripheral blood mononuclear cells. Renilla expression could be rescued in fluvastatin treated A549 Rluc-replicon cells after the addition of mevalonate, and partially restored with geranylgeranyl pyrophosphate, or farnesyl pyrophosphate. Our data suggest genetic and pharmacological modulation of cholesterol biosynthesis can regulate dengue virus replication. PMID:19419745

  15. A Biotin Biosynthesis Gene Restricted to Helicobacter

    PubMed Central

    Bi, Hongkai; Zhu, Lei; Jia, Jia; Cronan, John E.

    2016-01-01

    In most bacteria the last step in synthesis of the pimelate moiety of biotin is cleavage of the ester bond of pimeloyl-acyl carrier protein (ACP) methyl ester. The paradigm cleavage enzyme is Escherichia coli BioH which together with the BioC methyltransferase allows synthesis of the pimelate moiety by a modified fatty acid biosynthetic pathway. Analyses of the extant bacterial genomes showed that bioH is absent from many bioC-containing bacteria and is replaced by other genes. Helicobacter pylori lacks a gene encoding a homologue of the known pimeloyl-ACP methyl ester cleavage enzymes suggesting that it encodes a novel enzyme that cleaves this intermediate. We isolated the H. pylori gene encoding this enzyme, bioV, by complementation of an E. coli bioH deletion strain. Purified BioV cleaved the physiological substrate, pimeloyl-ACP methyl ester to pimeloyl-ACP by use of a catalytic triad, each member of which was essential for activity. The role of BioV in biotin biosynthesis was demonstrated using a reconstituted in vitro desthiobiotin synthesis system. BioV homologues seem the sole pimeloyl-ACP methyl ester esterase present in the Helicobacter species and their occurrence only in H. pylori and close relatives provide a target for development of drugs to specifically treat Helicobacter infections. PMID:26868423

  16. Explorations into the biosynthesis of bioscorine

    SciTech Connect

    Michelson, R.H.

    1988-01-01

    The biosynthesis of dioscorine in Dioscorea hispida has been studied by the feeding of putative precursors labelled at specific positions with {sup 2}H, {sup 3}H, and {sup 14}C. Administration of (3-{sup 14}C)3-hydroxy-3-methylglutaric acid to D. hispida by the wick method afforded dioscorine labelled preferentially at the C{sub 10} position implying that the biosynthetic pathway to the acetate-derived half of the dioscorine skeleton is going through this compound. Administration of ethyl (6-{sup 14}C)orsellinate to D. hispida by the wick method failed to give an appreciable incorporation into dioscroine thereby disproving an alternative mechanism describing the formation of the acetate-derived half of the dioscorine skeleton. Two attempts to simulate the alternative mechanism by oxidatively cleaving ethyl orsellinate also failed, further disfavoring this mechanism. Administration of (2,3){sup 13}C{sub 2}, {sup 14}C{sub 2}succinic acid, (3-{sup 14}C)aspartic acid and (7a-{sup 14}C)tryptophan by the leaf painting method gave very low incorporations into dioscorine making determination of the source of the nicotinic acid half of the dioscorine skeleton inconclusive. Administration of (6-{sup 2}H, {sup 3}H)nicotinic acid to D. hispida by the wick method afforded dioscorine exhibiting complete retention of {sup 3}H thereby disfavoring a mechanism involving a 3,6-dihydropyridine intermediate in the formation of the dioscorine skeleton.

  17. Mitochondrial Fusion Is Essential for Steroid Biosynthesis

    PubMed Central

    Cooke, Mariana; Soria, Gastón; Cornejo Maciel, Fabiana; Gottifredi, Vanesa; Podestá, Ernesto J.

    2012-01-01

    Although the contribution of mitochondrial dynamics (a balance in fusion/fission events and changes in mitochondria subcellular distribution) to key biological process has been reported, the contribution of changes in mitochondrial fusion to achieve efficient steroid production has never been explored. The mitochondria are central during steroid synthesis and different enzymes are localized between the mitochondria and the endoplasmic reticulum to produce the final steroid hormone, thus suggesting that mitochondrial fusion might be relevant for this process. In the present study, we showed that the hormonal stimulation triggers mitochondrial fusion into tubular-shaped structures and we demonstrated that mitochondrial fusion does not only correlate-with but also is an essential step of steroid production, being both events depend on PKA activity. We also demonstrated that the hormone-stimulated relocalization of ERK1/2 in the mitochondrion, a critical step during steroidogenesis, depends on mitochondrial fusion. Additionally, we showed that the SHP2 phosphatase, which is required for full steroidogenesis, simultaneously modulates mitochondrial fusion and ERK1/2 localization in the mitochondrion. Strikingly, we found that mitofusin 2 (Mfn2) expression, a central protein for mitochondrial fusion, is upregulated immediately after hormone stimulation. Moreover, Mfn2 knockdown is sufficient to impair steroid biosynthesis. Together, our findings unveil an essential role for mitochondrial fusion during steroidogenesis. These discoveries highlight the importance of organelles’ reorganization in specialized cells, prompting the exploration of the impact that organelle dynamics has on biological processes that include, but are not limited to, steroid synthesis. PMID:23029265

  18. Biosynthesis of plasmenylcholine in guinea pig heart

    SciTech Connect

    Wientzek, M.; Choy, P.C.

    1986-05-01

    In some mammalian hearts, up to 40% of the choline phosphoglyceride (CPG) exists as plasmenylcholine (1-alkenyl-2-acyl-glycero-3-phosphocholine). Although the majority of diacylphosphatidylcholine (PC) in mammalian hearts is synthesized from choline via the CDP-choline pathway, the formation of plasmenylcholine from choline was not known. In this study, they investigated the biosynthesis of plasmenyl-choline in the isolated guinea pig heart by perfusion with (/sup 3/H)choline. Labelled choline containing metabolites and labelled plasmenylcholine were isolated and determined at different perfusion time points. Significant amounts of labelling were found only in choline, phosphocholine, CDP-choline, plasmenyl-choline and PC. In addition, a precursor-product relationship was observed between the labelling of CDP-choline and plasmenylcholine. Such a relationship was not observed between choline and plasmenylcholine. Hence, they postulate that the incorporation of choline into plasmenylcholine is via the CDP-choline pathway and not via base exchange. The ability to condense 1-alkenyl-2-acyl-glycerol with CDP-choline was also demonstrated in vitro with guinea pig heart microsomes.

  19. Synthetic Biological Approaches to Natural Product Biosynthesis

    PubMed Central

    Winter, Jaclyn M; Tang, Yi

    2012-01-01

    Small molecules produced in Nature continue to be an inspiration for the development of new therapeutic agents. These natural products possess exquisite chemical diversity, which gives rise to their wide range of biological activities. In their host organism, natural products are assembled and modified by dedicated biosynthetic pathways that Nature has meticulously developed. Often times, the complex structures or chemical modifications instated by these pathways are difficult to replicate using traditional synthetic methods. An alternative approach for creating or enhancing the structural variation of natural products is through combinatorial biosynthesis. By rationally reprogramming and manipulating the biosynthetic machinery responsible for their production, unnatural metabolites that were otherwise inaccessible can be obtained. Additionally, new chemical structures can be synthesized or derivatized by developing the enzymes that carry out these complicated chemical reactions into biocatalysts. In this review, we will discuss a variety of combinatorial biosynthetic strategies, their technical challenges, and highlight some recent (since 2007) examples of rationally designed unnatural metabolites, as well as platforms that have been established for the production and modification of clinically important pharmaceutical compounds. PMID:22221832

  20. Regulation of Phosphatidylcholine Biosynthesis in Saccharomyces cerevisiae

    PubMed Central

    Waechter, Charles J.; Lester, Robert L.

    1971-01-01

    Evidence is presented which indicates that the biosynthesis of phosphatidylcholine by the methylation pathway in growing cultures of Saccharomyces cerevisiae is repressed by the presence of choline in the growth medium. This result, obtained previously for glucose-grown cells, was also observed for lactate-grown cells, of which half of the phosphatidylcholine is mitochondrial. A respiration-deficient mutant of the parent wild-type strain has been studied, and its inability to form functional mitochondria cannot be due to an impaired methylation pathway, as it has been shown to incorporate 14C-CH3-methionine into all of the methylated glycerophosphatides. The incorporation rate is depressed by the inclusion of 1 mm choline in the growth medium, suggesting a regulatory effect similar to that demonstrated for the wild-type strain. The effects of choline on the glycerophospholipid composition of lactate and glucose-grown cells is presented. The repressive effects of the two related bases, mono- and dimethylethanolamine, were examined, and reduced levels of 14C-CH3-methionine incorporation were found for cells grown in the presence of these bases. The effect of choline on the methylation rates is reversible and glucosegrown cells regain the nonrepressed level of methylation activity in 60 to 80 min after removal of choline from the growth medium. Images PMID:5547992

  1. The biosynthesis of sterols in higher plants

    PubMed Central

    Goad, L. J.; Goodwin, T. W.

    1966-01-01

    1. [2-14C]Mevalonate was incorporated into squalene and the major phytosterols of pea and maize leaves; it was also incorporated into compounds belonging to the 4,4-dimethyl and 4α-methyl steroid groups and which may be possible phytosterol intermediates. 2. l-[Me-14C]Methionine was incorporated into the major sterols and also into the 4,4-dimethyl and 4α-methyl steroid groups. No radioactivity was detected in squalene. 3. Under anaerobic conditions incorporation of [2-14C]-mevalonate into the non-saponifiable lipid of pea leaves was drastically decreased but radioactive squalene was accumulated. 4. Cycloartenol, 24-methylenecycloartanol, 24-methylenelophenol, 24-ethylidenelophenol, fucosterol, β-sitosterol, stigmasterol and campesterol have been identified by gas–liquid chromatography in pea leaves. 5. The significance of these results in connexion with phytosterol biosynthesis and the introduction of the alkyl group at C-24 into phytosterols is discussed. ImagesFig. 1. PMID:5964970

  2. Regulation of mammalian nucleotide metabolism and biosynthesis

    PubMed Central

    Lane, Andrew N.; Fan, Teresa W.-M.

    2015-01-01

    Nucleotides are required for a wide variety of biological processes and are constantly synthesized de novo in all cells. When cells proliferate, increased nucleotide synthesis is necessary for DNA replication and for RNA production to support protein synthesis at different stages of the cell cycle, during which these events are regulated at multiple levels. Therefore the synthesis of the precursor nucleotides is also strongly regulated at multiple levels. Nucleotide synthesis is an energy intensive process that uses multiple metabolic pathways across different cell compartments and several sources of carbon and nitrogen. The processes are regulated at the transcription level by a set of master transcription factors but also at the enzyme level by allosteric regulation and feedback inhibition. Here we review the cellular demands of nucleotide biosynthesis, their metabolic pathways and mechanisms of regulation during the cell cycle. The use of stable isotope tracers for delineating the biosynthetic routes of the multiple intersecting pathways and how these are quantitatively controlled under different conditions is also highlighted. Moreover, the importance of nucleotide synthesis for cell viability is discussed and how this may lead to potential new approaches to drug development in diseases such as cancer. PMID:25628363

  3. Lipid Flippases for Bacterial Peptidoglycan Biosynthesis

    PubMed Central

    Ruiz, Natividad

    2015-01-01

    The biosynthesis of cellular polysaccharides and glycoconjugates often involves lipid-linked intermediates that need to be translocated across membranes. Essential pathways such as N-glycosylation in eukaryotes and biogenesis of the peptidoglycan (PG) cell wall in bacteria share a common strategy where nucleotide-sugars are used to build a membrane-bound oligosaccharide precursor that is linked to a phosphorylated isoprenoid lipid. Once made, these lipid-linked intermediates must be translocated across a membrane so that they can serve as substrates in a different cellular compartment. How translocation occurs is poorly understood, although it clearly requires a transporter or flippase. Identification of these transporters is notoriously difficult, and, in particular, the identity of the flippase of lipid II, an intermediate required for PG biogenesis, has been the subject of much debate. Here, I will review the body of work that has recently fueled this controversy, centered on proposed flippase candidates FtsW, MurJ, and AmJ. PMID:26792999

  4. Retinoic acid: its biosynthesis and metabolism.

    PubMed

    Napoli, J L

    1999-01-01

    This article presents a model that integrates the functions of retinoid-binding proteins with retinoid metabolism. One of these proteins, the widely expressed (throughout retinoid target tissues and in all vertebrates) and highly conserved cellular retinol-binding protein (CRBP), sequesters retinol in an internal binding pocket that segregates it from the intracellular milieu. The CRBP-retinol complex appears to be the quantitatively major form of retinol in vivo, and may protect the promiscuous substrate from nonenzymatic degradation and/or non-specific enzymes. For example, at least seven types of dehydrogenases catalyze retinal synthesis from unbound retinol in vitro (NAD+ vs. NADP+ dependent, cytosolic vs. microsomal, short-chain dehydrogenases/reductases vs. medium-chain alcohol dehydrogenases). But only a fraction of these (some of the short-chain de-hydrogenases/reductases) have the fascinating additional ability of catalyzing retinal synthesis from CRBP-bound retinol as well. Similarly, CRBP and/or other retinoid-binding proteins function in the synthesis of retinal esters, the reduction of retinal generated from intestinal beta-carotene metabolism, and retinoic acid metabolism. The discussion details the evidence supporting an integrated model of retinoid-binding protein/metabolism. Also addressed are retinoid-androgen interactions and evidence incompatible with ethanol causing fetal alcohol syndrome by competing directly with retinol dehydrogenation to impair retinoic acid biosynthesis. PMID:10506831

  5. Biosynthesis of cadmium sulphide quantum semiconductor crystallites

    NASA Astrophysics Data System (ADS)

    Dameron, C. T.; Reese, R. N.; Mehra, R. K.; Kortan, A. R.; Carroll, P. J.; Steigerwald, M. L.; Brus, L. E.; Winge, D. R.

    1989-04-01

    NANOMETRE-SCALE semiconductor quantum crystallites exhibit size-dependent and discrete excited electronic states which occur at energies higher than the band gap of the corresponding bulk solid1-4. These crystallites are too small to have continuous energy bands, even though a bulk crystal structure is present. The onset of such quantum properties sets a fundamental limit to device miniaturization in microelectronics5. Structures with either one, two or all three dimensions on the nanometer scale are of particular interest in solid state physics6. We report here our discovery of the biosynthesis of quantum crystallites in yeasts Candida glabrata and Schizosaccharomyces pombe, cultured in the presence of cad-mium salts. Short chelating peptides of general structure (γ-Glu-Cys)n-Gly control the nucleation and growth of CdS crystallites to peptide-capped intracellular particles of diameter 20 Å. These quantum CdS crystallites are more monodisperse than CdS par-ticles synthesized chemically. X-ray data indicate that, at this small size, the CdS structure differs from that of bulk CdS and tends towards a six-coordinate rock-salt structure.

  6. Control of triacylglycerol biosynthesis in plants

    SciTech Connect

    Not Available

    1993-01-31

    Seeds of most species of the Umbelliferae (Apiaciae), Araliaceae, and Garryaceae families are characterized by their high content of the unusual C[sub 18] monounsaturated fatty acid petroselinic acid (18:l[Delta][sup 6cis]). Prior to a recent report of this lab, little was known of the biosynthetic origin of the cis[Delta][sup 6] double bond of petroselinic acid. Such knowledge may be of both biochemical and biotechnological significance. Because petroselinic acid is potentially the product of a novel desaturase, information regarding its synthesis may contribute to an understanding of fatty acid desaturation mechanisms in plants. Through chemical cleavage at its double bond, petroselinic acid can be used as a precursor of lauric acid (12:0), a component of detergents and surfactants, and adipic acid (6:0 dicarboxylic), the monomeric component of nylon 6,6. Therefore, the development of an agronomic source of an oil rich in petroselinic acid is of biotechnological interest. As such, studies of petroselinic acid biosynthesis may provide basic information required for any attempt to genetically engineer the production and accumulation of this fatty acid in an existing oilseed.

  7. Biosynthesis of the manumycin group antibiotics

    SciTech Connect

    Thiericke, R.; Zeeck, A. ); Nakagawa, Akira; Omura, Satoshi ); Herrold, R.E.; Wu, S.T.S. ); Beale, J.M.; Floss, H.G. )

    1990-05-09

    The biosynthesis of the manumycin group antibiotics manumycin (1) and asukamycin (2) was studied in Streptomyces parvulus Tue 64 and Streptomyces nodosus ssp. asukaensis ATCC 29,757 by using radioactive and stable isotope tracer techniques and high-field NMR spectroscopy. The results have demonstrated that the central, multifunctional mC{sub 7}N unit typical of this group of antibiotics, which serves as the starter unit for a short polyketide chain, is biosynthesized from a C{sub 4} Krebs cycle and a C{sub 3} triose phosphate pool intermediate by a new pathway, distinct from the shikimate, polyketide, or pentose phosphate routes leading to other mC{sub 7}N units in nature. The C{sub 5} unit in both 1 and 2 arises by a novel intramolecular cyclization of 5-aminolevulinic acid, and a cyclohexane ring and the adjacent carbon in 2 arise from the seven carbon atoms of shikimic acid. The side chains of both antibiotics represent typical polyketide-derived moieties, differing with respect to their combinations of starter and elongation units.

  8. Distribution of 5-methylcytosine residues in 5S rRNA genes in Arabidopsis thaliana and Secale cereale.

    PubMed

    Fulnecek, J; Matyásek, R; Kovarík, A

    2002-12-01

    Bisulfite genomic sequencing was used to localise 5-methylcytosine residues (mC) in 5S rRNA genes of Arabidopsis thaliana and Secale cereale. The maps of mC distribution were compared with the previously published map of the corresponding region in Nicotiana tabacum. In all three species, the level of methylation of 5S rRNA genes was generally higher than the average for the entire genome. The ratio of 5S rDNA methylation to average overall methylation was 44%/30-33% for N. tabacum, 27%/4-6% for A. thaliana and 24%/20-22% for S. cereale. With the exception of one clone from S. cereale, no methylation-free 5S rDNA was detected. The level of methylation at different sequence motifs in 5S rDNA was calculated for N. tabacum/A. thaliana/ S. cereale, and this analysis yielded the following values (expressed as a percentage of total C): mCG 90%/78%/85%, mCWG 89%/41%/53%, mCmCG 72%/32%/16%, mCCG 4%/2%/0%, mCHH 15%/6%/1%, where W=A or T, and H=A or C or T. Non-symmetrical methylation was almost negligible in the large genome of S. cereale but relatively frequent in N. tabacum and A. thaliana, suggesting that the strict correlation between genome size and cytosine methylation might be violated for this type of methylation. Among non-symmetrical motifs the mCWA triplets were significantly over-represented in Arabidopsis, while in tobacco this preference was not as pronounced. The differences in methylation levels in different sequence contexts might be of phylogenetic significance, but further species in related and different taxa need to be studied before firm conclusions can be drawn. PMID:12471448

  9. Soybean oil biosynthesis: role of diacylglycerol acyltransferases.

    PubMed

    Li, Runzhi; Hatanaka, Tomoko; Yu, Keshun; Wu, Yongmei; Fukushige, Hirotada; Hildebrand, David

    2013-03-01

    Diacylglycerol acyltransferase (DGAT) catalyzes the acyl-CoA-dependent acylation of sn-1,2-diacylglycerol to form seed oil triacylglycerol (TAG). To understand the features of genes encoding soybean (Glycine max) DGATs and possible roles in soybean seed oil synthesis and accumulation, two full-length cDNAs encoding type 1 diacylglycerol acyltransferases (GmDGAT1A and GmDGAT1B) were cloned from developing soybean seeds. These coding sequences share identities of 94 % and 95 % in protein and DNA sequences. The genomic architectures of GmDGAT1A and GmDGAT1B both contain 15 introns and 16 exons. Differences in the lengths of the first exon and most of the introns were found between GmDGAT1A and GmDGAT1B genomic sequences. Furthermore, detailed in silico analysis revealed a third predicted DGAT1, GmDGAT1C. GmDGAT1A and GmDGAT1B were found to have similar activity levels and substrate specificities. Oleoyl-CoA and sn-1,2-diacylglycerol were preferred substrates over vernoloyl-CoA and sn-1,2-divernoloylglycerol. Both transcripts are much more abundant in developing seeds than in other tissues including leaves, stem, roots, and flowers. Both soybean DGAT1A and DGAT1B are highly expressed at developing seed stages of maximal TAG accumulation with DGAT1B showing highest expression at somewhat later stages than DGAT1A. DGAT1A and DGAT1B show expression profiles consistent with important roles in soybean seed oil biosynthesis and accumulation. PMID:23322364

  10. Biosynthesis of the Aromatic Amino Acids.

    PubMed

    Pittard, James; Yang, Ji

    2008-09-01

    This chapter describes in detail the genes and proteins of Escherichia coli involved in the biosynthesis and transport of the three aromatic amino acids tyrosine, phenylalanine, and tryptophan. It provides a historical perspective on the elaboration of the various reactions of the common pathway converting erythrose-4-phosphate and phosphoenolpyruvate to chorismate and those of the three terminal pathways converting chorismate to phenylalanine, tyrosine, and tryptophan. The regulation of key reactions by feedback inhibition, attenuation, repression, and activation are also discussed. Two regulatory proteins, TrpR (108 amino acids) and TyrR (513 amino acids), play a major role in transcriptional regulation. The TrpR protein functions only as a dimer which, in the presence of tryptophan, represses the expression of trp operon plus four other genes (the TrpR regulon). The TyrR protein, which can function both as a dimer and as a hexamer, regulates the expression of nine genes constituting the TyrR regulon. TyrR can bind each of the three aromatic amino acids and ATP and under their influence can act as a repressor or activator of gene expression. The various domains of this protein involved in binding the aromatic amino acids and ATP, recognizing DNA binding sites, interacting with the alpha subunit of RNA polymerase, and changing from a monomer to a dimer or a hexamer are all described. There is also an analysis of the various strategies which allow TyrR in conjunction with particular amino acids to differentially affect the expression of individual genes of the TyrR regulon. PMID:26443741

  11. Dithiolopyrrolone Natural Products: Isolation, Synthesis and Biosynthesis

    PubMed Central

    Qin, Zhiwei; Huang, Sheng; Yu, Yi; Deng, Hai

    2013-01-01

    Dithiolopyrrolones are a class of antibiotics that possess the unique pyrrolinonodithiole (4H-[1,2] dithiolo [4,3-b] pyrrol-5-one) skeleton linked to two variable acyl groups. To date, there are approximately 30 naturally occurring dithiolopyrrolone compounds, including holomycin, thiolutin, and aureothricin, and more recently thiomarinols, a unique class of hybrid marine bacterial natural products containing a dithiolopyrrolone framework linked by an amide bridge with an 8-hydroxyoctanoyl chain linked to a monic acid. Generally, dithiolopyrrolone antibiotics have broad-spectrum antibacterial activity against various microorganisms, including Gram-positive and Gram-negative bacteria, and even parasites. Holomycin appeared to be active against rifamycin-resistant bacteria and also inhibit the growth of the clinical pathogen methicillin-resistant Staphylococcus aureus N315. Its mode of action is believed to inhibit RNA synthesis although the exact mechanism has yet to be established in vitro. A recent work demonstrated that the fish pathogen Yersinia ruckeri employs an RNA methyltransferase for self-resistance during the holomycin production. Moreover, some dithiolopyrrolone derivatives have demonstrated promising antitumor activities. The biosynthetic gene clusters of holomycin have recently been identified in S. clavuligerus and characterized biochemically and genetically. The biosynthetic gene cluster of thiomarinol was also identified from the marine bacterium Pseudoalteromonas sp. SANK 73390, which was uniquely encoded by two independent pathways for pseudomonic acid and pyrrothine in a novel plasmid. The aim of this review is to give an overview about the isolations, characterizations, synthesis, biosynthesis, bioactivities and mode of action of this unique family of dithiolopyrrolone natural products, focusing on the period from 1940s until now. PMID:24141227

  12. Coenzyme Q biosynthesis in health and disease.

    PubMed

    Acosta, Manuel Jesús; Vazquez Fonseca, Luis; Desbats, Maria Andrea; Cerqua, Cristina; Zordan, Roberta; Trevisson, Eva; Salviati, Leonardo

    2016-08-01

    Coenzyme Q (CoQ, or ubiquinone) is a remarkable lipid that plays an essential role in mitochondria as an electron shuttle between complexes I and II of the respiratory chain, and complex III. It is also a cofactor of other dehydrogenases, a modulator of the permeability transition pore and an essential antioxidant. CoQ is synthesized in mitochondria by a set of at least 12 proteins that form a multiprotein complex. The exact composition of this complex is still unclear. Most of the genes involved in CoQ biosynthesis (COQ genes) have been studied in yeast and have mammalian orthologues. Some of them encode enzymes involved in the modification of the quinone ring of CoQ, but for others the precise function is unknown. Two genes appear to have a regulatory role: COQ8 (and its human counterparts ADCK3 and ADCK4) encodes a putative kinase, while PTC7 encodes a phosphatase required for the activation of Coq7. Mutations in human COQ genes cause primary CoQ(10) deficiency, a clinically heterogeneous mitochondrial disorder with onset from birth to the seventh decade, and with clinical manifestation ranging from fatal multisystem disorders, to isolated encephalopathy or nephropathy. The pathogenesis of CoQ(10) deficiency involves deficient ATP production and excessive ROS formation, but possibly other aspects of CoQ(10) function are implicated. CoQ(10) deficiency is unique among mitochondrial disorders since an effective treatment is available. Many patients respond to oral CoQ(10) supplementation. Nevertheless, treatment is still problematic because of the low bioavailability of the compound, and novel pharmacological approaches are currently being investigated. This article is part of a Special Issue entitled 'EBEC 2016: 19th European Bioenergetics Conference, Riva del Garda, Italy, July 2-6, 2016', edited by Prof. Paolo Bernardi. PMID:27060254

  13. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-06-25

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  14. The 9S RNA precursor of Escherichia coli 5S RNA has three structural domains: implications for processing.

    PubMed Central

    Christiansen, J

    1988-01-01

    The secondary structure of the 9S RNA precursor to ribosomal 5S RNA in Escherichia coli has been determined using chemical reagents and ribonucleases in combination with a reverse transcription procedure. The 9S RNA precursor was generated in vitro by T7 RNA polymerase, and the rrnB operon terminator, T1, was able to terminate the in vitro transcript. The secondary structure model exhibits three structural domains corresponding to a 5' region, a mature region and a terminator region. The mature domain is structurally identical to 5S RNA, and the ribosomal proteins L18 and L25 are able to bind to the precursor. The processing endoribonuclease RNase E cleaves between the structural domains. Moreover, an intramolecular refolding of the nascent transcript must take place if the current view of RNase III processing stems is correct. Images PMID:3045757

  15. Photocarrier dynamics in transition metal dichalcogenide alloy Mo0.5W0.5S2.

    PubMed

    He, Jiaqi; He, Dawei; Wang, Yongsheng; Zhao, Hui

    2015-12-28

    We report a transient absorption study of photocarrier dynamics in transition metal dichalcogenide alloy, Mo0.5W0.5S2. Photocarriers were injected by a 400-nm pump pulse and detected by a 660-nm probe pulse. We observed a fast energy relaxation process of about 0.7 ps. The photocarrier lifetime is in the range of 50 - 100 ps, which weakly depends on the injected photocarrier density and is a few times shorter than MoS2 and WS2, reflecting the relatively lower crystalline quality of the alloy. Saturable absorption was also observed in Mo0.5W0.5S2, with a saturation energy fluence of 32 μJ cm(-2). These results provide important parameters on photocarrier properties of transition metal dichalcogenide alloys. PMID:26832001

  16. Theoretical study on the adsorption of carbon dioxide on individual and alkali-metal doped MOF-5s

    NASA Astrophysics Data System (ADS)

    Ha, Nguyen Thi Thu; Lefedova, O. V.; Ha, Nguyen Ngoc

    2016-01-01

    Density functional theory (DFT) calculations were performed to investigate the adsorption of carbon dioxide (CO2) on metal-organic framework (MOF-5) and alkali-metal (Li, K, Na) doped MOF-5s. The adsorption energy calculation showed that metal atom adsorption is exothermic in MOF-5 system. Moreover, alkali-metal doping can significantly improve the adsorption ability of carbon dioxide on MOF-5. The best influence is observed for Li-doping.

  17. Foraminoplastic transfacet epidural endoscopic approach for removal of intraforaminal disc herniation at the L5-S1 level

    PubMed Central

    Kaczmarczyk, Jacek; Nowakowski, Andrzej; Sulewski, Adam

    2014-01-01

    Transforaminal endoscopic disc removal in the L5-S1 motion segment of the lumbar spine creates a technical challenge due to anatomical reasons and individual variability. The majority of surgeons prefer a posterior classical or minimally invasive approach. There is only one foraminoplastic modification of the technique in the literature so far. In this paper we present a new technique with a foraminoplastic transfacet approach that may be suitable in older patients with advanced degenerative disease of the spine. PMID:24729817

  18. Chromosomal location of 18S and 5S rDNA sites in Triportheus fish species (Characiformes, Characidae)

    PubMed Central

    2009-01-01

    The location of 18S and 5S rDNA sites was determined in eight species and populations of the fish genus Triportheus by using fluorescent in situ hybridization (FISH). The males and females of all species had 2n = 52 chromosomes and a ZZ/ZW sex chromosome system. A single 18S rDNA site that was roughly equivalent to an Ag-NOR was detected on the short arms of a submetacentric pair in nearly all species, and up to two additional sites were also observed in some species. In addition, another 18S rDNA cluster was identified in a distal region on the long arms of the W chromosome; this finding corroborated previous evidence that this cluster would be a shared feature amongst Triportheus species. In T. angulatus, a heterozygotic paracentric inversion involving the short arms of one homolog of a metacentric pair was associated with NORs. The 5S rDNA sites were located on the short arms of a single submetacentric chromosomal pair, close to the centromeres, except in T. auritus, which had up to ten 5S rDNA sites. The 18S and 5S rDNA sites were co-localized and adjacent on the short arms of a chromosomal pair in two populations of T. nematurus. Although all Triportheus species have a similar karyotypic macrostructure, the results of this work show that in some species ribosomal genes may serve as species-specific markers when used in conjunction with other putatively synapomorphic features. PMID:21637644

  19. A Tale of Two Lines: Searching for the 5s - 5p Resonance Lines in Pm-like Ion Spectra

    SciTech Connect

    Trabert, E; Vilkas, M J; Ishikawa, Y

    2008-10-24

    Highly charged ions in the promethium sequence have been suggested to show spectral features resembling the alkali sequence ions. Guided by calculations, the 5s-5p resonance lines have been sought in a variety of experiments. In the light of the most extensive calculations of Pm-like ions yet, applying relativistic multi-reference Moeller-Plesset second-order perturbation theory, the experimental evidence is reviewed and the line identification problem assessed.

  20. Describing a new syndrome in L5-S1 disc herniation: Sexual and sphincter dysfunction without pain and muscle weakness

    PubMed Central

    Akca, Nezih; Ozdemir, Bulent; Kanat, Ayhan; Batcik, Osman Ersagun; Yazar, Ugur; Zorba, Orhan Unal

    2014-01-01

    Context: Little seems to be known about the sexual dysfunction (SD) in lumbar intervertebral disc herniation. Aims: Investigation of sexual and sphincter dysfunction in patient with lumbar disc hernitions. Settings and Design: A retrospective analysis. Materials and Methods: Sexual and sphincter dysfunction in patients admitted with lumbar disc herniations between September 2012-March 2014. Statistical Analysis Used: Statistical analysis was performed using the Predictive Analytics SoftWare (PASW) Statistics 18.0 for Windows (Statistical Package for the Social Sciences, SPSS Inc., Chicago, Illinois). The statistical significance was set at P < 0.05. The Wilcoxon signed ranks test was used to evaluate the difference between patients. Results: Four patients with sexual and sphincter dysfunction were found, including two women and two men, aged between 20 and 52 years. All of them admitted without low back pain. In addition, on neurological examination, reflex and motor deficit were not found. However, almost all patients had perianal sensory deficit and sexual and sphincter dysfunction. Magnetic resonance imaging (MRI) of three patients displayed a large extruded disc fragment at L5-S1 level on the left side. In fourth patient, there were not prominent disc herniations. There was not statistically significant difference between pre-operative and post-operative sexual function, anal-urethral sphincter function, and perianal sensation score. A syndrome in L5-S1 disc herniation with sexual and sphincter dysfunction without pain and muscle weakness was noted. We think that it is crucial for neurosurgeons to early realise that paralysis of the sphincter and sexual dysfunction are possible in patients with lumbar L5-S1 disc disease. Conclusion: A syndrome with perianal sensory deficit, paralysis of the sphincter, and sexual dysfunction may occur in patients with lumbar L5-S1 disc disease. The improvement of perianal sensory deficit after surgery was counteracted by a trend

  1. Recent advances in combinatorial biosynthesis for drug discovery

    PubMed Central

    Sun, Huihua; Liu, Zihe; Zhao, Huimin; Ang, Ee Lui

    2015-01-01

    Because of extraordinary structural diversity and broad biological activities, natural products have played a significant role in drug discovery. These therapeutically important secondary metabolites are assembled and modified by dedicated biosynthetic pathways in their host living organisms. Traditionally, chemists have attempted to synthesize natural product analogs that are important sources of new drugs. However, the extraordinary structural complexity of natural products sometimes makes it challenging for traditional chemical synthesis, which usually involves multiple steps, harsh conditions, toxic organic solvents, and byproduct wastes. In contrast, combinatorial biosynthesis exploits substrate promiscuity and employs engineered enzymes and pathways to produce novel “unnatural” natural products, substantially expanding the structural diversity of natural products with potential pharmaceutical value. Thus, combinatorial biosynthesis provides an environmentally friendly way to produce natural product analogs. Efficient expression of the combinatorial biosynthetic pathway in genetically tractable heterologous hosts can increase the titer of the compound, eventually resulting in less expensive drugs. In this review, we will discuss three major strategies for combinatorial biosynthesis: 1) precursor-directed biosynthesis; 2) enzyme-level modification, which includes swapping of the entire domains, modules and subunits, site-specific mutagenesis, and directed evolution; 3) pathway-level recombination. Recent examples of combinatorial biosynthesis employing these strategies will also be highlighted in this review. PMID:25709407

  2. Jasmonate-induced biosynthesis of andrographolide in Andrographis paniculata.

    PubMed

    Sharma, Shiv Narayan; Jha, Zenu; Sinha, Rakesh Kumar; Geda, Arvind Kumar

    2015-02-01

    Andrographolide is a prominent secondary metabolite found in Andrographis paniculata that exhibits enormous pharmacological effects. In spite of immense value, the normal biosynthesis of andrographolide results in low amount of the metabolite. To induce the biosynthesis of andrographolide, we attempted elicitor-induced activation of andrographolide biosynthesis in cell cultures of A. paniculata. This was carried out by using methyl jasmonate (MeJA) as an elicitor. Among the various concentrations of MeJA tested at different time periods, 5 µM MeJA yielded 5.25 times more andrographolide content after 24 h of treatment. The accumulation of andrographolide was correlated with the expression level of known regulatory genes (hmgs, hmgr, dxs, dxr, isph and ggps) of mevalonic acid (MVA) and 2-C-methyl-d-erythritol-4-phosphate (MEP) pathways. These results established the involvement of MeJA in andrographolide biosynthesis by inducing the transcription of its biosynthetic pathways genes. The coordination of isph, ggps and hmgs expression highly influenced the andrographolide biosynthesis. PMID:25104168

  3. Roles of lignin biosynthesis and regulatory genes in plant development.

    PubMed

    Yoon, Jinmi; Choi, Heebak; An, Gynheung

    2015-11-01

    Lignin is an important factor affecting agricultural traits, biofuel production, and the pulping industry. Most lignin biosynthesis genes and their regulatory genes are expressed mainly in the vascular bundles of stems and leaves, preferentially in tissues undergoing lignification. Other genes are poorly expressed during normal stages of development, but are strongly induced by abiotic or biotic stresses. Some are expressed in non-lignifying tissues such as the shoot apical meristem. Alterations in lignin levels affect plant development. Suppression of lignin biosynthesis genes causes abnormal phenotypes such as collapsed xylem, bending stems, and growth retardation. The loss of expression by genes that function early in the lignin biosynthesis pathway results in more severe developmental phenotypes when compared with plants that have mutations in later genes. Defective lignin deposition is also associated with phenotypes of seed shattering or brittle culm. MYB and NAC transcriptional factors function as switches, and some homeobox proteins negatively control lignin biosynthesis genes. Ectopic deposition caused by overexpression of lignin biosynthesis genes or master switch genes induces curly leaf formation and dwarfism. PMID:26297385

  4. Dissecting the role of glutathione biosynthesis in Plasmodium falciparum

    PubMed Central

    Patzewitz, Eva-Maria; Wong, Eleanor H; Müller, Sylke

    2012-01-01

    Glutathione (γ-glutamylcysteinyl-glycine, GSH) has vital functions as thiol redox buffer and cofactor of antioxidant and detoxification enzymes. Plasmodium falciparum possesses a functional GSH biosynthesis pathway and contains mM concentrations of the tripeptide. It was impossible to delete in P. falciparum the genes encoding γ-glutamylcysteine synthetase (γGCS) or glutathione synthetase (GS), the two enzymes synthesizing GSH, although both gene loci were not refractory to recombination. Our data show that the parasites cannot compensate for the loss of GSH biosynthesis via GSH uptake. This suggests an important if not essential function of GSH biosynthesis pathway for the parasites. Treatment with the irreversible inhibitor of γGCS L-buthionine sulfoximine (BSO) reduced intracellular GSH levels in P. falciparum and was lethal for their intra-erythrocytic development, corroborating the suggestion that GSH biosynthesis is important for parasite survival. Episomal expression of γgcs in P. falciparum increased tolerance to BSO attributable to increased levels of γGCS. Concomitantly expression of glutathione reductase was reduced leading to an increased GSH efflux. Together these data indicate that GSH levels are tightly regulated by a functional GSH biosynthesis and the reduction of GSSG. PMID:22151036

  5. The importance of ribosome production, and the 5S RNP–MDM2 pathway, in health and disease

    PubMed Central

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J.

    2016-01-01

    Ribosomes are abundant, large RNA–protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  6. Minimally Invasive Transforaminal Lumbar Interbody Fusion at L5-S1 through a Unilateral Approach: Technical Feasibility and Outcomes

    PubMed Central

    Choi, Won-Suh; Kim, Jin-Sung; Ryu, Kyeong-Sik; Hur, Jung-Woo; Seong, Ji-Hoon

    2016-01-01

    Background. Minimally invasive spinal transforaminal lumbar interbody fusion (MIS-TLIF) at L5-S1 is technically more demanding than it is at other levels because of the anatomical and biomechanical traits. Objective. To determine the clinical and radiological outcomes of MIS-TLIF for treatment of single-level spinal stenosis low-grade isthmic or degenerative spondylolisthesis at L5-S1. Methods. Radiological data and electronic medical records of patients who underwent MIS-TLIF between May 2012 and December 2014 were reviewed. Fusion rate, cage position, disc height (DH), disc angle (DA), disc slope angle, segmental lordotic angle (SLA), lumbar lordotic angle (LLA), and pelvic parameters were assessed. For functional assessment, the visual analogue scale (VAS), Oswestry disability index (ODI), and patient satisfaction rate (PSR) were utilized. Results. A total of 21 levels in 21 patients were studied. DH, DA, SLA, and LLA had increased from their preoperative measures at the final follow-up. Fusion rate was 86.7% (18/21) at 12 months' follow-up. The most common cage position was anteromedial (15/21). The mean VAS scores for back and leg pain mean ODI scores improved significantly at the final follow-up. PSR was 88%. Cage subsidence was observed in 33.3% (7/21). Conclusions. The clinical and radiologic outcomes after MIS-TLIF at L5-S1 in patients with spinal stenosis or spondylolisthesis are generally favorable. PMID:27433472

  7. Secondary structure of Tetrahymena thermophilia 5S ribosomal RNA as revealed by enzymatic digestion and microdensitometric analysis.

    PubMed Central

    Sneath, B; Vary, C; Pavlakis, G; Vournakis, J

    1986-01-01

    The secondary structure of [32P] end-labeled 5S rRNA from Tetrahymena thermophilia (strain B) has been investigated using the enzymes S1 nuclease, cobra venom ribonuclease and T2 ribonuclease. The results, analyzed by scanning microdensitometry and illustrated by three-dimensional computer graphics, support the secondary structure model of Curtiss and Vournakis for 5S rRNA. Aberrent mobility of certain RNA fragments on sequencing gels was observed as regions of band compression. These regions are postulated to be caused by stable internal base-pairing. The molecule was probed with T2 RNase in neutral (pH 7.5) and acidic (pH 4.5) buffers and only minor structural differences were revealed. One of the helices was found to be susceptible to enzymatic attack by both the single-strand and double-strand specific enzymes. These observations are evidence for the existence of dynamic structural equilibria in 5S rRNA. Images PMID:3005972

  8. Erythromycin and 5S rRNA binding properties of the spinach chloroplast ribosomal protein CL22.

    PubMed Central

    Carol, P; Rozier, C; Lazaro, E; Ballesta, J P; Mache, R

    1993-01-01

    The spinach chloroplast ribosomal protein (r-protein) CL22 contains a central region homologous to the Escherichia coli r-protein L22 plus long N- and C-terminal extensions. We show in this study that the CL22 combines two properties which in E. coli ribosome are split between two separate proteins. The CL22 which binds to the 5S rRNA can also be linked to an erythromycin derivative added to the 50S ribosomal subunit. This latter property is similar to that of the E. coli L22 and suggests a similar localization in the 50S subunit. We have overproduced the r-protein CL22 and deleted forms of this protein in E. coli. We show that the overproduced CL22 binds to the chloroplast 5S rRNA and that the deleted protein containing the N- and C-terminal extensions only has lost the 5S rRNA binding property. We suggest that the central homologous regions of the CL22 contains the RNA binding domain. Images PMID:8441674

  9. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    PubMed

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  10. Temporal and tissue specific gene expression patterns of the zebrafish kinesin-1 heavy chain family, kif5s, during development

    PubMed Central

    Campbell, Philip D.; Marlow, Florence L.

    2013-01-01

    Homo- and heterodimers of Kif5 proteins form the motor domain of Kinesin-1, a major plus-end directed microtubule motor. Kif5s have been implicated in the intracellular transport of organelles, vesicles, proteins, and RNAs in many cell types. There are three mammalian KIF5s. KIF5A and KIF5C proteins are strictly neural in mouse whereas, KIF5B is ubiquitously expressed. Mouse knockouts indicate crucial roles for KIF5 in development and human mutations in KIF5A lead to the neurodegenerative disease Hereditary Spastic Paraplegia. However, the developmental functions and the extent to which individual kif5 functions overlap have not been elucidated. Zebrafish possess five kif5 genes: kif5Aa, kif5Ab, kif5Ba, kif5Bb, and kif5C. Here we report their tissue specific expression patterns in embryonic and larval stages. Specifically, we find that kif5As are strictly zygotic and exhibit neural-specific expression. In contrast, kif5Bs exhibit strong maternal contribution and are ubiquitously expressed. Lastly, kif5C exhibits weak maternal expression followed by enrichment in neural populations. In addition, kif5s show distinct expression domains in the larval retina. PMID:23684767

  11. Pro-resolving actions and stereoselective biosynthesis of 18S E-series resolvins in human leukocytes and murine inflammation

    PubMed Central

    Oh, Sungwhan F.; Pillai, Padmini S.; Recchiuti, Antonio; Yang, Rong; Serhan, Charles N.

    2011-01-01

    E-series resolvins are antiinflammatory and pro-resolving lipid mediators derived from the ω-3 polyunsaturated fatty acid eicosapentaenoic acid (EPA) that actively clear inflammation to promote tissue homeostasis. Aspirin, in addition to exerting antithrombotic actions, also triggers the biosynthesis of these specialized pro-resolving mediators. Here, we used metabolomic profiling to investigate the biosynthesis of E-series resolvins with specific chiral chemistry in serum from human subjects and present evidence for new 18S series resolvins. Aspirin increased endogenous formation of 18S-hydroxyeicosapentaenoate (18S-HEPE) compared with 18R-HEPE, a known resolvin precursor. Human recombinant 5-lipoxygenase used both enantiomers as substrates, and recombinant LTA4 hydrolase (LTA4H) converted chiral 5S(6)-epoxide–containing intermediates to resolvin E1 and 18S-resolvin E1 (RvE1 and 18S-RvE1, respectively). 18S-RvE1 bound to the leukocyte GPCRs ChemR23 and BLT1 with increased affinity and potency compared with the R-epimer, but was more rapidly inactivated than RvE1 by dehydrogenase. Like RvE1, 18S-RvE1 enhanced macrophage phagocytosis of zymosan, E. coli, and apoptotic neutrophils and reduced both neutrophil infiltration and proinflammatory cytokines in murine peritonitis. These results demonstrate two parallel stereospecific pathways in the biosynthesis of E-series resolvins, 18R- and 18S-, which are antiinflammatory, pro-resolving, and non-phlogistic and may contribute to the beneficial actions of aspirin and ω-3 polyunsaturated fatty acids. PMID:21206090

  12. Amino acid biosynthesis in the spirochete Leptospira: evidence for a novel pathway of isoleucine biosynthesis.

    PubMed

    Charon, N W; Johnson, R C; Peterson, D

    1974-01-01

    Radioactive carbon dioxide was incubated with growing cells of Leptospira interrogans serotypes semaranga and tarassovi, and the specific activities and distribution of the label within the cellular amino acids were determined. The origins of the carbon skeletons of all the acid-stable amino acids except isoleucine were found to be consistent with known biosynthetic pathways for these amino acids. Experiments using radioactive carbon dioxide and other tracers indicated that most of the isoleucine was synthesized by a pathway not involving threonine. The origin of the carbon skeleton of isoleucine consisted of two residues of pyruvate (carbons 2 and 3) and acetate of acetyl-coenzyme A by this pathway. Isotope competition studies indicated that the pathway was regulated by isoleucine. The results are discussed in relation to two proposed pathways of isoleucine biosynthesis involving citramalate as an intermediate. PMID:4808901

  13. Sesterterpene ophiobolin biosynthesis involving multiple gene clusters in Aspergillus ustus

    PubMed Central

    Chai, Hangzhen; Yin, Ru; Liu, Yongfeng; Meng, Huiying; Zhou, Xianqiang; Zhou, Guolin; Bi, Xupeng; Yang, Xue; Zhu, Tonghan; Zhu, Weiming; Deng, Zixin; Hong, Kui

    2016-01-01

    Terpenoids are the most diverse and abundant natural products among which sesterterpenes account for less than 2%, with very few reports on their biosynthesis. Ophiobolins are tricyclic 5–8–5 ring sesterterpenes with potential pharmaceutical application. Aspergillus ustus 094102 from mangrove rizhosphere produces ophiobolin and other terpenes. We obtained five gene cluster knockout mutants, with altered ophiobolin yield using genome sequencing and in silico analysis, combined with in vivo genetic manipulation. Involvement of the five gene clusters in ophiobolin synthesis was confirmed by investigation of the five key terpene synthesis relevant enzymes in each gene cluster, either by gene deletion and complementation or in vitro verification of protein function. The results demonstrate that ophiobolin skeleton biosynthesis involves five gene clusters, which are responsible for C15, C20, C25, and C30 terpenoid biosynthesis. PMID:27273151

  14. Sesterterpene ophiobolin biosynthesis involving multiple gene clusters in Aspergillus ustus.

    PubMed

    Chai, Hangzhen; Yin, Ru; Liu, Yongfeng; Meng, Huiying; Zhou, Xianqiang; Zhou, Guolin; Bi, Xupeng; Yang, Xue; Zhu, Tonghan; Zhu, Weiming; Deng, Zixin; Hong, Kui

    2016-01-01

    Terpenoids are the most diverse and abundant natural products among which sesterterpenes account for less than 2%, with very few reports on their biosynthesis. Ophiobolins are tricyclic 5-8-5 ring sesterterpenes with potential pharmaceutical application. Aspergillus ustus 094102 from mangrove rizhosphere produces ophiobolin and other terpenes. We obtained five gene cluster knockout mutants, with altered ophiobolin yield using genome sequencing and in silico analysis, combined with in vivo genetic manipulation. Involvement of the five gene clusters in ophiobolin synthesis was confirmed by investigation of the five key terpene synthesis relevant enzymes in each gene cluster, either by gene deletion and complementation or in vitro verification of protein function. The results demonstrate that ophiobolin skeleton biosynthesis involves five gene clusters, which are responsible for C15, C20, C25, and C30 terpenoid biosynthesis. PMID:27273151

  15. Improved Precursor Directed Biosynthesis in E. coli via Directed Evolution

    PubMed Central

    Lee, Ho Young; Harvey, Colin J.B.; Cane, David E.; Khosla, Chaitan

    2010-01-01

    Erythromycin and related macrolide antibiotics are widely used polyketide natural products. We have evolved an engineered biosynthetic pathway in Escherichia coli that yields erythromycin analogs from simple synthetic precursors. Multiple rounds of mutagenesis and screening led to the identification of new mutant strains with improved efficiency for precursor directed biosynthesis. Genetic and biochemical analysis suggested that the phenotypically relevant alterations in these mutant strains were localized exclusively to the host-vector system, and not to the polyketide synthase. We also demonstrate the utility of this improved system through engineered biosynthesis of a novel alkynyl erythromycin derivative with comparable antibacterial activity to its natural counterpart. In addition to reinforcing the power of directed evolution for engineering macrolide biosynthesis, our studies have identified a new lead substance for investigating structure-function relationships in the bacterial ribosome. PMID:21081955

  16. Inhibitors targeting on cell wall biosynthesis pathway of MRSA.

    PubMed

    Hao, Haihong; Cheng, Guyue; Dai, Menghong; Wu, Qinghua; Yuan, Zonghui

    2012-11-01

    Methicillin resistant Staphylococcus aureus (MRSA), widely known as a type of new superbug, has aroused world-wide concern. Cell wall biosynthesis pathway is an old but good target for the development of antibacterial agents. Peptidoglycan and wall teichoic acids (WTAs) biosynthesis are two main processes of the cell wall biosynthesis pathway (CWBP). Other than penicillin-binding proteins (PBPs), some key factors (Mur enzymes, lipid I or II precursor, etc.) in CWBP are becoming attractive molecule targets for the discovery of anti-MRSA compounds. A number of new compounds, with higher affinity for PBPs or with inhibitory activity on such molecule targets in CWBP of MRSA, have been in the pipeline recently. This review concludes recent research achievements and provides a complete picture of CWBP of MRSA, including the peptidoglycan and wall teichoic acids synthesis pathway. The potential inhibitors targeting on CWBP are subsequently presented to improve development of novel therapeutic strategies for MRSA. PMID:22898792

  17. Squalestatin Is an Inhibitor of Carotenoid Biosynthesis in Plasmodium falciparum

    PubMed Central

    Gabriel, Heloisa B.; Silva, Marcia F.; Kimura, Emília A.; Wunderlich, Gerhard

    2015-01-01

    The increasing resistance of malaria parasites to almost all available drugs calls for the characterization of novel targets and the identification of new compounds. Carotenoids are polyisoprenoids from plants, algae, and some bacteria, and they are biosynthesized by Plasmodium falciparum but not by mammalian cells. Biochemical and reverse genetics approaches were applied to demonstrate that phytoene synthase (PSY) is a key enzyme for carotenoid biosynthesis in P. falciparum and is essential for intraerythrocytic growth. The known PSY inhibitor squalestatin reduces biosynthesis of phytoene and kills parasites during the intraerythrocytic cycle. PSY-overexpressing parasites showed increased biosynthesis of phytoene and its derived product phytofluene and presented a squalestatin-resistant phenotype, suggesting that this enzyme is the primary target of action of this drug in the parasite. PMID:25779575

  18. Quinolizidine alkaloid biosynthesis: recent advances and future prospects

    PubMed Central

    Bunsupa, Somnuk; Yamazaki, Mami; Saito, Kazuki

    2012-01-01

    Lys-derived alkaloids, including piperidine, quinolizidine, indolizidine, and lycopodium alkaloids, are widely distributed throughout the plant kingdom. Several of these alkaloids have beneficial properties for humans and have been used in medicine. However, the molecular mechanisms underlying the biosynthesis of these alkaloids are not well understood. In the present article, we discuss recent advances in our understanding of Lys-derived alkaloids, especially the biochemistry, molecular biology, and biotechnology of quinolizidine alkaloid (QA) biosynthesis. We have also highlighted Lys decarboxylase (LDC), the enzyme that catalyzes the first committed step of QA biosynthesis and answers a longstanding question about the molecular entity of LDC activity in plants. Further prospects using current advanced technologies, such as next-generation sequencing, in medicinal plants have also been discussed. PMID:23112802

  19. Lovastatin Biosynthesis by Aspergillus terreus in a Chemically Defined Medium

    PubMed Central

    Hajjaj, Hassan; Niederberger, Peter; Duboc, Philippe

    2001-01-01

    Lovastatin is a secondary metabolite produced by Aspergillus terreus. A chemically defined medium was developed in order to investigate the influence of carbon and nitrogen sources on lovastatin biosynthesis. Among several organic and inorganic defined nitrogen sources metabolized by A. terreus, glutamate and histidine gave the highest lovastatin biosynthesis level. For cultures on glucose and glutamate, lovastatin synthesis initiated when glucose consumption levelled off. When A. terreus was grown on lactose, lovastatin production initiated in the presence of residual lactose. Experimental results showed that carbon source starvation is required in addition to relief of glucose repression, while glutamate did not repress biosynthesis. A threefold-higher specific productivity was found with the defined medium on glucose and glutamate, compared to growth on complex medium with glucose, peptonized milk, and yeast extract. PMID:11375168

  20. Identification of unique mechanisms for triterpene biosynthesis in Botryococcus braunii

    PubMed Central

    Niehaus, Tom D.; Okada, Shigeru; Devarenne, Timothy P.; Watt, David S.; Sviripa, Vitaliy; Chappell, Joe

    2011-01-01

    Botryococcene biosynthesis is thought to resemble that of squalene, a metabolite essential for sterol metabolism in all eukaryotes. Squalene arises from an initial condensation of two molecules of farnesyl diphosphate (FPP) to form presqualene diphosphate (PSPP), which then undergoes a reductive rearrangement to form squalene. In principle, botryococcene could arise from an alternative rearrangement of the presqualene intermediate. Because of these proposed similarities, we predicted that a botryococcene synthase would resemble squalene synthase and hence isolated squalene synthase-like genes from Botryococcus braunii race B. While B. braunii does harbor at least one typical squalene synthase, none of the other three squalene synthase-like (SSL) genes encodes for botryococcene biosynthesis directly. SSL-1 catalyzes the biosynthesis of PSPP and SSL-2 the biosynthesis of bisfarnesyl ether, while SSL-3 does not appear able to directly utilize FPP as a substrate. However, when combinations of the synthase-like enzymes were mixed together, in vivo and in vitro, robust botryococcene (SSL-1+SSL-3) or squalene biosynthesis (SSL1+SSL-2) was observed. These findings were unexpected because squalene synthase, an ancient and likely progenitor to the other Botryococcus triterpene synthases, catalyzes a two-step reaction within a single enzyme unit without intermediate release, yet in B. braunii, these activities appear to have separated and evolved interdependently for specialized triterpene oil production greater than 500 MYA. Coexpression of the SSL-1 and SSL-3 genes in different configurations, as independent genes, as gene fusions, or targeted to intracellular membranes, also demonstrate the potential for engineering even greater efficiencies of botryococcene biosynthesis. PMID:21746901

  1. Genetic regulations of the biosynthesis of microbial surfactants: an overview.

    PubMed

    Das, Palashpriya; Mukherjee, Soumen; Sen, Ramkrishna

    2008-01-01

    Microbial biosurfactants are surface active metabolites synthesized by microbes growing on a variety of substrates. In spite of having great potential for commercial, therapeutic and environmental applications, industrial level production has not been realized for their low yields and productivities. One vital factor determining their biosynthesis is the genetic makeup of the producer organisms. Studies on molecular genetics and biochemistry of the synthesis of several biosurfactants have revealed the operons, the enzymes and the metabolic pathways required for their extracellular production. Surfactin, a cyclic lipopeptide biosurfactant is a potent antimicrobial agent and is produced as a result of non-ribosomal biosynthesis catalyzed by a large multienzyme peptide synthetase complex called the surfactin synthetase. Pathways for the synthesis of other lipopeptides such as iturin, lichenysin and arthrofactin are also mediated by similar enzyme complexes. These non-ribosomal peptide synthetases (NRPSs) responsible for lipopeptide biosynthesis display a high degree of structural similarity among themselves even from distant microbial species. Plasmid-encoded- rhlA, B, R and I genes of rhl quorum sensing system are required for production of glycolipid biosurfactants by Pseudomonas species. Molecular genetics of biosynthesis of alasan and emulsan by Acinetobacter species and of the fungal biosurfactants such as mannosylerythritol lipids (MEL) and hydrophobins have been deciphered. However, limited genetic information is available about biosynthesis of other biosurfactants such as viscosin, amphisin and putisolvin produced by some strains of Pseudomonas species. Understanding of the genetic regulatory mechanisms would help to develop metabolically engineered hyper-producing strains with better product characteristics and acquired capability of utilizing cheap agro-industrial wastes as substrates. This article thus provides an overview of the role and importance of

  2. Physiological insights into all-trans-retinoic acid biosynthesis

    PubMed Central

    Napoli, Joseph L.

    2011-01-01

    All-trans-retinoic acid (atRA) provides essential support to diverse biological systems and physiological processes. Epithelial differentiation and its relationship to cancer and embryogenesis have typified intense areas of interest into atRA function. Recently, however, interest in atRA action in the nervous system, the immune system, energy balance and obesity has increased considerably, especially concerning postnatal function. atRA action depends on atRA biosynthesis: defects in retinoid-dependent processes increasingly relate to defects in atRA biogenesis. Considerable evidence indicates that physiological atRA biosynthesis occurs via a regulated process, consisting of a complex interaction of retinoid binding-proteins and retinoid recognizing enzymes. An accrual of biochemical, physiological and genetic data have identified specific functional outcomes for the retinol dehydrogenases, RDH1, RDH10, and DHRS9, as physiological catalysts of the first step in atRA biosynthesis, and for the retinal dehydrogenases RALDH1, RALDH2, and RALDH3, as catalysts of the second and irreversible step. Each of these enzymes associates with explicit biological processes mediated by atRA. Redundancy occurs, but seems limited. Cumulative data supports a model of interactions among these enzymes with retinoid binding-proteins, with feedback regulation and/or control by atRA via modulating gene expression of multiple participants. The ratio apo-CRBP1/holo-CRBP1 participates by influencing retinol flux into and out of storage as retinyl esters, thereby modulating substrate to support atRA biosynthesis. atRA biosynthesis requires presence of both an RDH and an RALDH: conversely, absence of one isozyme of either step does not indicate lack of atRA biosynthesis at the site. PMID:21621639

  3. Natural Products as Tools for Chemogenomic Analysis of Mycotoxin Biosynthesis and Fungal Stress-Response Systems

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Certain phenolics having antioxidative activity can inhibit aflatoxin biosynthesis by Aspergillus flavus, with no effect on fungal growth. Contrastingly, exposing A. flavus to oxidative stress, such as hydrogen peroxide, enhances aflatoxin biosynthesis. Use of gene-deletion mutants of Saccharomyces ...

  4. [Advances in the regulation of cephalosporin C biosynthesis - A review].

    PubMed

    Liu, Jiajia; Liu, Gang

    2016-03-01

    The beta-lactam antibiotic cephalosporin C is produced industrially by Acremonium chrysogenum. Its derivative 7-aminocephalosporanic acid (7-ACA) is the intermediate of most chemical modification cephalosporins that are the most frequently used antibiotics for the therapy of infectious diseases. Due to its importance, the biosynthetic pathway of cephalosporin C has been elucidated in Acremonium chrysogenum. To improve the yield of cephalosporin C and reduce the cost of production, recent studies have been focused on the sophisticated regulation of cephalosporin C biosynthesis. In this review, recent advances in cephalosporin C biosynthesis and regulation are summarized. PMID:27382789

  5. Final Report on Regulation of Guaiacyl and Syringyl Monolignol Biosynthesis

    SciTech Connect

    Vincent L. Chiang

    2006-03-09

    The focus of this research is to understand syringyl monolignol biosynthesis that leads to the formation of syringyl lignin, a type of lignin that can be easily removed during biomass conversion. We have achieved the three originally proposed goals for this project. (1) SAD and CAD genes (enzyme catalytic and kinetic properties) and their functional relevance to CAld5H/AldOMT pathway, (2) spatiotemporal expression patterns of Cald5H, AldOMT, SAD and CAD genes, and (3) functions of CAld5H, AldOMT, and SAD genes in vivo using transgenic aspen. Furthermore, we also found that microRNA might be involved in the upstream regulatory network of lignin biosynthesis and wood formation. The achievements are as below. (1) Based on biochemical and molecular studies, we discovered a novel syringyl-specific alcohol dehydrogenase (SAD) involved in monolignol biosynthesis in angiosperm trees. Through CAld5H/OMT/SAD mediation, syringyl monolignol biosynthesis branches out from guaiacyl pathway at coniferaldehyde; (2) The function of CAld5H gene in this syringyl monolignol biosynthesis pathway also was confirmed in vivo in transgenic Populus; (3) The proposed major monolignol biosynthesis pathways were further supported by the involving biochemical functions of CCR based on a detailed kinetic study; (4) Gene promoter activity analysis also supported the cell-type specific expression of SAD and CAD genes in xylem tissue, consistent with the cell-specific locations of SAD and CAD proteins and with the proposed pathways; (5) We have developed a novel small interfering RNA (siRNA)-mediated stable gene-silencing system in transgenic plants; (6) Using the siRNA and P. trichocarpa transformation/regeneration systems we are currently producing transgenic P. trichocarpa to investigate the interactive functions of CAD and SAD in regulating guaiacyl and syringyl lignin biosynthesis; (7) We have cloned for the first time from a tree species, P. trichocarpa, small regulatory RNAs termed micro

  6. Cyclopiazonic Acid Biosynthesis of Aspergillus flavus and Aspergillus oryzae

    PubMed Central

    Chang, Perng-Kuang; Ehrlich, Kenneth C.; Fujii, Isao

    2009-01-01

    Cyclopiazonic acid (CPA) is an indole-tetramic acid neurotoxin produced by some of the same strains of A. flavus that produce aflatoxins and by some Aspergillus oryzae strains. Despite its discovery 40 years ago, few reviews of its toxicity and biosynthesis have been reported. This review examines what is currently known about the toxicity of CPA to animals and humans, both by itself or in combination with other mycotoxins. The review also discusses CPA biosynthesis and the genetic diversity of CPA production in A. flavus/oryzae populations. PMID:22069533

  7. Engineered Biosynthesis of Natural Products in Heterologous Hosts

    PubMed Central

    Luo, Yunzi; Li, Bing-Zhi; Liu, Duo; Zhang, Lu; Chen, Yan; Jia, Bin; Zeng, Bo-Xuan; Zhao, Huimin; Yuan, Ying-Jin

    2015-01-01

    Natural products produced by microorganisms and plants are a major resource of antibacterial and anticancer drugs as well as industrially useful compounds. However, the native producers often suffer from low productivity and titers. Here we summarize the recent applications of heterologous biosynthesis for the production of several important classes of natural products such as terpenoids, flavonoids, alkaloids, and polyketides. In addition, we will discuss the new tools and strategies at multi-scale levels including gene, pathway, genome and community levels for highly efficient heterologous biosynthesis of natural products. PMID:25960127

  8. Biotin biosynthesis in Mycobacterium tuberculosis: physiology, biochemistry and molecular intervention.

    PubMed

    Salaemae, Wanisa; Azhar, Al; Booker, Grant W; Polyak, Steven W

    2011-09-01

    Biotin is an important micronutrient that serves as an essential enzyme cofactor. Bacteria obtain biotin either through de novo synthesis or by active uptake from exogenous sources. Mycobacteria are unusual amongst bacteria in that their primary source of biotin is through de novo synthesis. Here we review the importance of biotin biosynthesis in the lifecycle of Mycobacteria. Genetic screens designed to identify key metabolic processes have highlighted a role for the biotin biosynthesis in bacilli growth, infection and survival during the latency phase. These studies help to establish the biotin biosynthetic pathway as a potential drug target for new anti-tuberculosis agents. PMID:21976058

  9. Biosynthesis of oxygen and nitrogen-containing heterocycles in polyketides

    PubMed Central

    Hemmerling, Franziska

    2016-01-01

    Summary This review highlights the biosynthesis of heterocycles in polyketide natural products with a focus on oxygen and nitrogen-containing heterocycles with ring sizes between 3 and 6 atoms. Heterocycles are abundant structural elements of natural products from all classes and they often contribute significantly to their biological activity. Progress in recent years has led to a much better understanding of their biosynthesis. In this context, plenty of novel enzymology has been discovered, suggesting that these pathways are an attractive target for future studies. PMID:27559404

  10. Endoscopic Trans-iliac Approach to L5-S1 Disc and Foramen – A Report on Clinical Experience

    PubMed Central

    Osman, Said G; Sherlekar, Sandeep; Malik, Atif; Winters, Charles; Grewal, PK; Narayanan, Malini; Gemechu, Nigussie

    2014-01-01

    Background The lumbosacral junction is a difficult area for spine surgery because of the complex anatomy. In the era of minimally invasive spine surgery, the presence of the iliac wing has, at the level of lumbosacral junction, created a major obstacle in the paths of two of the major approaches, namely, the direct lateral and percutaneous posterolateral endoscopic approaches. A trans-iliac cadaver study published by the senior author and co-workers in 1997, suggested the possibility of an alternative approach to the lumbosacral junction. Purpose To determine the feasibility of percutaneous, endoscopic trans-iliac approach to the L5-S1 disc and foramen Study Design Prospective case series study. Materials and Methods 15 consecutive patients undergoing the transiliac approach to L5-S1 disc and foramen were included in the study. Pre- and postoperative visual analogue scale (VAS); Oswestry Disability Index (ODI); and intra-operative blood loss and operative time, were obtained for the study. Preoperative MRI or CT scan was used to determine the need for trans-iliac access. The procedure was performed with the patient in prone position and under monitored sedation for decompression. Endotracheal anesthesia was used for fusion cases. The transiliac access was established with a cannulated drill or core drill through the iliac wing. Once the trans-iliac window had been created, the rest of the procedure proceeded as for percutaneous endoscopic transforaminal decompression and fusion. Results 15 patients (9 male and 6 female) participated in the study. The VAS for back and leg pain significantly improved in all patients. The ODI dropped by more than 50%. There was minimal blood loss, and transient post-operative dysesthesia in 2 cases which resolved after 3 weeks. Conclusion Endoscopic trans-iliac approach to the L5-S1 disc and foramen is feasible and safe. Decompression can be performed safely via trans-iliac access with minimal blood loss, and in a short operative time

  11. Hadron physics potential of future high-luminosity B-factories at the ϒ(5S) and above

    NASA Astrophysics Data System (ADS)

    Drutskoy, A. G.; Guo, F.-K.; Llanes-Estrada, F. J.; Nefediev, A. V.; Torres-Rincon, J. M.

    2013-01-01

    We point out the physics opportunities of future high-luminosity B-factories at the ϒ(5 S) resonance and above. Currently the two B-factories, the SuperB factory in Tor Vergata, Italy and the Belle II factory in KEK, Japan, are under development and are expected to start operation in 2017 and 2016, respectively. In this paper we discuss numerous interesting investigations, which can be performed in the e + e - center-of-mass energy region from the ϒ(5 S) and up to 11.5GeV, where an efficient data taking operation should be possible with the planned B-factories. These studies include abundant Bs production and decay properties; independent confirmation and, if found, exhaustive exploration of Belle's claimed charged bottomonia; clarification of puzzles of interquarkonium dipion transitions; extraction of the light-quark mass ratio from hadronic ϒ(5 S) decays; analysis of quarkonium and exotic internal structure from open flavour decays, leading to severe SU(3) symmetry violations; clarification of whether a hybrid state has similar mass to the ϒ(5 S) bottomonium, making it a double state; searches for molecular/tetraquark states that should be more stable with heavy quarks; completion of the table of positive-parity BJ mesons and study of their basic properties; production of Λ _b bar Λ _b heavy baryon pairs, that, following weak decay, open vistas on the charmed baryon spectrum and new channels to study CP violation; confirmation or refutation of the deviation from pQCD of the pion transition form factor, by extending the Q2 reach of current analysis; and possibly reaching the threshold for the production of triply charmed baryons. If, in addition, the future colliders can be later upgraded to 12.5GeV, then the possibility of copious production of B_c bar B_c pairs opens, entailing new studies of CP violation and improved, independent tests of the CKM picture (through determination of V bc , and of effective theories for heavy quarks.

  12. Biosynthesis of allene oxides in Physcomitrella patens

    PubMed Central

    2012-01-01

    Background The moss Physcomitrella patens contains C18- as well as C20-polyunsaturated fatty acids that can be metabolized by different enzymes to form oxylipins such as the cyclopentenone cis(+)-12-oxo phytodienoic acid. Mutants defective in the biosynthesis of cyclopentenones showed reduced fertility, aberrant sporophyte morphology and interrupted sporogenesis. The initial step in this biosynthetic route is the conversion of a fatty acid hydroperoxide to an allene oxide. This reaction is catalyzed by allene oxide synthase (AOS) belonging as hydroperoxide lyase (HPL) to the cytochrome P450 family Cyp74. In this study we characterized two AOS from P. patens, PpAOS1 and PpAOS2. Results Our results show that PpAOS1 is highly active with both C18 and C20-hydroperoxy-fatty acid substrates, whereas PpAOS2 is fully active only with C20-substrates, exhibiting trace activity (~1000-fold lower kcat/KM) with C18 substrates. Analysis of products of PpAOS1 and PpHPL further demonstrated that both enzymes have an inherent side activity mirroring the close inter-connection of AOS and HPL catalysis. By employing site directed mutagenesis we provide evidence that single amino acid residues in the active site are also determining the catalytic activity of a 9-/13-AOS – a finding that previously has only been reported for substrate specific 13-AOS. However, PpHPL cannot be converted into an AOS by exchanging the same determinant. Localization studies using YFP-labeled AOS showed that PpAOS2 is localized in the plastid while PpAOS1 may be found in the cytosol. Analysis of the wound-induced cis(+)-12-oxo phytodienoic acid accumulation in PpAOS1 and PpAOS2 single knock-out mutants showed that disruption of PpAOS1, in contrast to PpAOS2, results in a significantly decreased cis(+)-12-oxo phytodienoic acid formation. However, the knock-out mutants of neither PpAOS1 nor PpAOS2 showed reduced fertility, aberrant sporophyte morphology or interrupted sporogenesis. Conclusions Our study

  13. Structural and functional exchangeability of 5 S RNA species from the eubacterium E.coli and the thermoacidophilic archaebacterium Sulfolobus solfataricus.

    PubMed Central

    Teixidò, J; Altamura, S; Londei, P; Amils, R

    1989-01-01

    The role of 5 S RNA within the large ribosomal subunit of the extremely thermophilic archaebacterium Sulfolobus solfataricus has been analysed by means of in vitro reconstitution procedures. It is shown that Sulfolobus 50 S subunits reconstituted in the absence of 5 S RNA are inactive in protein synthesis and lack 2-3 ribosomal proteins. Furthermore, it has been determined that in the course of the in vitro assembly process Sulfolobus 5 S RNA can be replaced by the correspondent RNA species of E.coli; Sulfolobus reconstituted particles containing the eubacterial 5 S molecule are stable and active in polypeptide synthesis at high temperatures. Images PMID:2493632

  14. Biosynthesis and Molecular Genetics of Polyketides in Marine Dinoflagellates

    PubMed Central

    Kellmann, Ralf; Stüken, Anke; Orr, Russell J. S.; Svendsen, Helene M.; Jakobsen, Kjetill S.

    2010-01-01

    Marine dinoflagellates are the single most important group of algae that produce toxins, which have a global impact on human activities. The toxins are chemically diverse, and include macrolides, cyclic polyethers, spirolides and purine alkaloids. Whereas there is a multitude of studies describing the pharmacology of these toxins, there is limited or no knowledge regarding the biochemistry and molecular genetics involved in their biosynthesis. Recently, however, exciting advances have been made. Expressed sequence tag sequencing studies have revealed important insights into the transcriptomes of dinoflagellates, whereas other studies have implicated polyketide synthase genes in the biosynthesis of cyclic polyether toxins, and the molecular genetic basis for the biosynthesis of paralytic shellfish toxins has been elucidated in cyanobacteria. This review summarises the recent progress that has been made regarding the unusual genomes of dinoflagellates, the biosynthesis and molecular genetics of dinoflagellate toxins. In addition, the evolution of these metabolic pathways will be discussed, and an outlook for future research and possible applications is provided. PMID:20479965

  15. Two fatty acyl reductases involved in moth pheromone biosynthesis.

    PubMed

    Antony, Binu; Ding, Bao-Jian; Moto, Ken'Ichi; Aldosari, Saleh A; Aldawood, Abdulrahman S

    2016-01-01

    Fatty acyl reductases (FARs) constitute an evolutionarily conserved gene family found in all kingdoms of life. Members of the FAR gene family play diverse roles, including seed oil synthesis, insect pheromone biosynthesis, and mammalian wax biosynthesis. In insects, FAR genes dedicated to sex pheromone biosynthesis (pheromone-gland-specific fatty acyl reductase, pgFAR) form a unique clade that exhibits substantial modifications in gene structure and possesses unique specificity and selectivity for fatty acyl substrates. Highly selective and semi-selective 'single pgFARs' produce single and multicomponent pheromone signals in bombycid, pyralid, yponomeutid and noctuid moths. An intriguing question is how a 'single reductase' can direct the synthesis of several fatty alcohols of various chain lengths and isomeric forms. Here, we report two active pgFARs in the pheromone gland of Spodoptera, namely a semi-selective, C14:acyl-specific pgFAR and a highly selective, C16:acyl-specific pgFAR, and demonstrate that these pgFARs play a pivotal role in the formation of species-specific signals, a finding that is strongly supported by functional gene expression data. The study envisages a new area of research for disclosing evolutionary changes associated with C14- and C16-specific FARs in moth pheromone biosynthesis. PMID:27427355

  16. Shedding light on ovothiol biosynthesis in marine metazoans.

    PubMed

    Castellano, Immacolata; Migliaccio, Oriana; D'Aniello, Salvatore; Merlino, Antonello; Napolitano, Alessandra; Palumbo, Anna

    2016-01-01

    Ovothiol, isolated from marine invertebrate eggs, is considered one of the most powerful antioxidant with potential for drug development. However, its biological functions in marine organisms still represent a matter of debate. In sea urchins, the most accepted view is that ovothiol protects the eggs by the high oxidative burst at fertilization. In this work we address the role of ovothiol during sea urchin development to give new insights on ovothiol biosynthesis in metazoans. The gene involved in ovothiol biosynthesis OvoA was identified in Paracentrotus lividus genome (PlOvoA). PlOvoA embryo expression significantly increased at the pluteus stage and was up-regulated by metals at concentrations mimicking polluted sea-water and by cyclic toxic algal blooms, leading to ovothiol biosynthesis. In silico analyses of the PlOvoA upstream region revealed metal and stress responsive elements. Structural protein models highlighted conserved active site residues likely responsible for ovothiol biosynthesis. Phylogenetic analyses indicated that OvoA evolved in most marine metazoans and was lost in bony vertebrates during the transition from the aquatic to terrestrial environment. These results highlight the crucial role of OvoA in protecting embryos released in seawater from environmental cues, thus allowing the survival under different conditions. PMID:26916575

  17. HypC, the anthrone oxidase involved in aflatoxin biosynthesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Based on gene disruption and enzyme activity, hypC, an open reading frame in the pksA (aflC)/nor-1 (aflD) intergenic region in the aflatoxin biosynthesis cluster, encodes a 17 kDa oxidase that catalyzes the conversion of norsolorinic acid anthrone to norsolorinic acid....

  18. Sampangine inhibits heme biosynthesis in both yeast and human

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The azaoxoaporphine alkaloid sampangine exhibits strong antiproliferation activity in various organisms. Previous studies suggested that it somehow affects heme metabolism and stimulates production of reactive oxygen species (ROS). In this study, we show that inhibition of heme biosynthesis is the p...

  19. Shedding light on ovothiol biosynthesis in marine metazoans

    PubMed Central

    Castellano, Immacolata; Migliaccio, Oriana; D’Aniello, Salvatore; Merlino, Antonello; Napolitano, Alessandra; Palumbo, Anna

    2016-01-01

    Ovothiol, isolated from marine invertebrate eggs, is considered one of the most powerful antioxidant with potential for drug development. However, its biological functions in marine organisms still represent a matter of debate. In sea urchins, the most accepted view is that ovothiol protects the eggs by the high oxidative burst at fertilization. In this work we address the role of ovothiol during sea urchin development to give new insights on ovothiol biosynthesis in metazoans. The gene involved in ovothiol biosynthesis OvoA was identified in Paracentrotus lividus genome (PlOvoA). PlOvoA embryo expression significantly increased at the pluteus stage and was up-regulated by metals at concentrations mimicking polluted sea-water and by cyclic toxic algal blooms, leading to ovothiol biosynthesis. In silico analyses of the PlOvoA upstream region revealed metal and stress responsive elements. Structural protein models highlighted conserved active site residues likely responsible for ovothiol biosynthesis. Phylogenetic analyses indicated that OvoA evolved in most marine metazoans and was lost in bony vertebrates during the transition from the aquatic to terrestrial environment. These results highlight the crucial role of OvoA in protecting embryos released in seawater from environmental cues, thus allowing the survival under different conditions. PMID:26916575

  20. Shedding light on ovothiol biosynthesis in marine metazoans

    NASA Astrophysics Data System (ADS)

    Castellano, Immacolata; Migliaccio, Oriana; D'Aniello, Salvatore; Merlino, Antonello; Napolitano, Alessandra; Palumbo, Anna

    2016-02-01

    Ovothiol, isolated from marine invertebrate eggs, is considered one of the most powerful antioxidant with potential for drug development. However, its biological functions in marine organisms still represent a matter of debate. In sea urchins, the most accepted view is that ovothiol protects the eggs by the high oxidative burst at fertilization. In this work we address the role of ovothiol during sea urchin development to give new insights on ovothiol biosynthesis in metazoans. The gene involved in ovothiol biosynthesis OvoA was identified in Paracentrotus lividus genome (PlOvoA). PlOvoA embryo expression significantly increased at the pluteus stage and was up-regulated by metals at concentrations mimicking polluted sea-water and by cyclic toxic algal blooms, leading to ovothiol biosynthesis. In silico analyses of the PlOvoA upstream region revealed metal and stress responsive elements. Structural protein models highlighted conserved active site residues likely responsible for ovothiol biosynthesis. Phylogenetic analyses indicated that OvoA evolved in most marine metazoans and was lost in bony vertebrates during the transition from the aquatic to terrestrial environment. These results highlight the crucial role of OvoA in protecting embryos released in seawater from environmental cues, thus allowing the survival under different conditions.

  1. Two fatty acyl reductases involved in moth pheromone biosynthesis

    PubMed Central

    Antony, Binu; Ding, Bao-Jian; Moto, Ken’Ichi; Aldosari, Saleh A.; Aldawood, Abdulrahman S.

    2016-01-01

    Fatty acyl reductases (FARs) constitute an evolutionarily conserved gene family found in all kingdoms of life. Members of the FAR gene family play diverse roles, including seed oil synthesis, insect pheromone biosynthesis, and mammalian wax biosynthesis. In insects, FAR genes dedicated to sex pheromone biosynthesis (pheromone-gland-specific fatty acyl reductase, pgFAR) form a unique clade that exhibits substantial modifications in gene structure and possesses unique specificity and selectivity for fatty acyl substrates. Highly selective and semi-selective ‘single pgFARs’ produce single and multicomponent pheromone signals in bombycid, pyralid, yponomeutid and noctuid moths. An intriguing question is how a ‘single reductase’ can direct the synthesis of several fatty alcohols of various chain lengths and isomeric forms. Here, we report two active pgFARs in the pheromone gland of Spodoptera, namely a semi-selective, C14:acyl-specific pgFAR and a highly selective, C16:acyl-specific pgFAR, and demonstrate that these pgFARs play a pivotal role in the formation of species-specific signals, a finding that is strongly supported by functional gene expression data. The study envisages a new area of research for disclosing evolutionary changes associated with C14- and C16-specific FARs in moth pheromone biosynthesis. PMID:27427355

  2. Cyclopiazonic Acid Biosynthesis of Aspergillus flavus and Aspergillus oryzae

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cyclopiazonic acid (CPA) is an indole-tetramic acid neurotoxin produced by some of the same strains of A. flavus that produce aflatoxins and by some Aspergillus oryzae strains. Despite its discovery 40 years ago, few reviews of its toxicity and biosynthesis have been reported. This review examines w...

  3. Genetic aspects of auxin biosynthesis and its regulation.

    PubMed

    Brumos, Javier; Alonso, Jose M; Stepanova, Anna N

    2014-05-01

    Auxin is an essential plant hormone that controls nearly every aspect of a plant's life, from embryo development to organ senescence. In the last decade the key genes involved in auxin transport, perception, signaling and response have been identified and characterized, but the elucidation of auxin biosynthesis has proven to be especially challenging. In plants, a significant amount of indole-3-acetic acid (IAA), the predominant biologically active form of auxin, is synthesized via a simple two-step route where indole-3-pyruvic acid (IPyA) produced from l-tryptophan by tryptophan aminotransferases (TAA1/TAR) is converted to IAA by the YUC family of flavin monooxygenases. The TAA1/TAR and YUC gene families constitute the first complete auxin biosynthetic pathway described in plants. Detailed characterization of these genes' expression patterns suggested a key role of local auxin biosynthesis in plant development. This has prompted an active search for the molecular mechanisms that regulate the spatiotemporal activity of the IPyA route. In addition to the TAA1/TAR and YUC-mediated auxin biosynthesis, several alternative routes of IAA production have been postulated to function in plants, but their biological significance is yet to be demonstrated. Herein, we take a genetic perspective to describe the current view of auxin biosynthesis and its regulation in plants, focusing primarily on Arabidopsis. PMID:24007561

  4. The magnesium chelation step in chlorophyll biosynthesis. Progress report 1993

    SciTech Connect

    Weinstein, J.D.

    1993-12-31

    Progress is reported on the identification and fractionation of Magnesium chealatase, an enzyme involved in addition of Mg to chlorophyll during the later`s biosynthesis. Progress is documented as a series of synopsis of published and unpublished papers by the author.

  5. Aspirin therapy and thromboxane biosynthesis in systemic lupus erythematosus.

    PubMed

    Avalos, Ingrid; Chung, Cecilia P; Oeser, Annette; Milne, Ginger L; Borntrager, Holly; Morrow, Jason D; Raggi, Paolo; Solus, Joseph; Stein, C Michael

    2007-01-01

    Incomplete suppression of thromboxane biosynthesis during aspirin therapy is associated with increased cardiovascular risk. Since systemic lupus erythematosus (SLE) is associated with platelet activation and increased cardiovascular mortality, we compared thromboxane and prostacyclin biosynthesis in patients with SLE and control subjects, and measured inhibition of thromboxane excretion in aspirin-treated subjects. We measured the urinary excretion of 11-dehydro thromboxane B( 2) (TXB(2)) and 2,3-dinor 6-ketoPGF(1alpha) (PGI-M), the stable metabolites of thromboxane A(2) and prostacyclin, respectively, in 74 patients with SLE and 70 controls. In subjects who were not receiving aspirin, TXB(2) excretion was higher in patients with SLE [0.40 ng/mg creatinine (0.26-0.64), median (interquartile range)] than controls [0.31 ng/mg creatinine (0.23-0.44)] (P = 0.04), and in these patients, TXB(2) excretion correlated with disease activity (rho = 0.28, P = 0.03) and tumor necrosis factor alpha (rho = 0.48, P < 0.001). Aspirin therapy resulted in significantly lower TXB(2) excretion in controls (P = 0.01), but not in patients with SLE (P = 0.10), compared with subjects not receiving aspirin. Prostacyclin biosynthesis did not differ among patients and controls, and was not affected by aspirin (P all >0.35). Thromboxane biosynthesis is increased in SLE and is associated with disease activity. Additionally, response to aspirin may be attenuated in some patients with SLE. PMID:18042592

  6. AcsD catalyzes enantioselective citrate desymmetrization in siderophore biosynthesis.

    PubMed

    Schmelz, Stefan; Kadi, Nadia; McMahon, Stephen A; Song, Lijiang; Oves-Costales, Daniel; Oke, Muse; Liu, Huanting; Johnson, Kenneth A; Carter, Lester G; Botting, Catherine H; White, Malcolm F; Challis, Gregory L; Naismith, James H

    2009-03-01

    Bacterial pathogens need to scavenge iron from their host for growth and proliferation during infection. They have evolved several strategies to do this, one being the biosynthesis and excretion of small, high-affinity iron chelators known as siderophores. The biosynthesis of siderophores is an important area of study, not only for potential therapeutic intervention but also to illuminate new enzyme chemistries. Two general pathways for siderophore biosynthesis exist: the well-characterized nonribosomal peptide synthetase (NRPS)-dependent pathway and the NRPS-independent siderophore (NIS) pathway, which relies on a different family of sparsely investigated synthetases. Here we report structural and biochemical studies of AcsD from Pectobacterium (formerly Erwinia) chrysanthemi, an NIS synthetase involved in achromobactin biosynthesis. The structures of ATP and citrate complexes provide a mechanistic rationale for stereospecific formation of an enzyme-bound (3R)-citryladenylate, which reacts with L-serine to form a likely achromobactin precursor. AcsD is a unique acyladenylate-forming enzyme with a new fold and chemical catalysis strategy. PMID:19182782

  7. Exploiting nongenetic cell-to-cell variation for enhanced biosynthesis.

    PubMed

    Xiao, Yi; Bowen, Christopher H; Liu, Di; Zhang, Fuzhong

    2016-05-01

    Biosynthesis enables renewable production of manifold compounds, yet often biosynthetic performance must be improved for it to be economically feasible. Nongenetic, cell-to-cell variations in protein and metabolite concentrations are naturally inherent, suggesting the existence of both high- and low-performance variants in all cultures. Although having an intrinsic source of low performers might cause suboptimal ensemble biosynthesis, the existence of high performers suggests an avenue for performance enhancement. Here we develop in vivo population quality control (PopQC) to continuously select for high-performing, nongenetic variants. We apply PopQC to two biosynthetic pathways using two alternative design principles and demonstrate threefold enhanced production of both free fatty acid (FFA) and tyrosine. We confirm that PopQC improves ensemble biosynthesis by selecting for nongenetic high performers. Additionally, we use PopQC in fed-batch FFA production and achieve 21.5 g l(-1) titer and 0.5 g l(-1) h(-1) productivity. Given the ubiquity of nongenetic variation, PopQC should be applicable to a variety of metabolic pathways for enhanced biosynthesis. PMID:26999780

  8. Anaerobic biosynthesis of the lower ligand of vitamin B12

    PubMed Central

    Hazra, Amrita B.; Han, Andrew W.; Mehta, Angad P.; Mok, Kenny C.; Osadchiy, Vadim; Begley, Tadhg P.; Taga, Michiko E.

    2015-01-01

    Vitamin B12 (cobalamin) is required by humans and other organisms for diverse metabolic processes, although only a subset of prokaryotes is capable of synthesizing B12 and other cobamide cofactors. The complete aerobic and anaerobic pathways for the de novo biosynthesis of B12 are known, with the exception of the steps leading to the anaerobic biosynthesis of the lower ligand, 5,6-dimethylbenzimidazole (DMB). Here, we report the identification and characterization of the complete pathway for anaerobic DMB biosynthesis. This pathway, identified in the obligate anaerobic bacterium Eubacterium limosum, is composed of five previously uncharacterized genes, bzaABCDE, that together direct DMB production when expressed in anaerobically cultured Escherichia coli. Expression of different combinations of the bza genes revealed that 5-hydroxybenzimidazole, 5-methoxybenzimidazole, and 5-methoxy-6-methylbenzimidazole, all of which are lower ligands of cobamides produced by other organisms, are intermediates in the pathway. The bza gene content of several bacterial and archaeal genomes is consistent with experimentally determined structures of the benzimidazoles produced by these organisms, indicating that these genes can be used to predict cobamide structure. The identification of the bza genes thus represents the last remaining unknown component of the biosynthetic pathway for not only B12 itself, but also for three other cobamide lower ligands whose biosynthesis was previously unknown. Given the importance of cobamides in environmental, industrial, and human-associated microbial metabolism, the ability to predict cobamide structure may lead to an improved ability to understand and manipulate microbial metabolism. PMID:26246619

  9. Post-genome research on the biosynthesis of ergot alkaloids.

    PubMed

    Li, Shu-Ming; Unsöld, Inge A

    2006-10-01

    Genome sequencing provides new opportunities and challenges for identifying genes for the biosynthesis of secondary metabolites. A putative biosynthetic gene cluster of fumigaclavine C, an ergot alkaloid of the clavine type, was identified in the genome sequence of ASPERGILLUS FUMIGATUS by a bioinformatic approach. This cluster spans 22 kb of genomic DNA and comprises at least 11 open reading frames (ORFs). Seven of them are orthologous to genes from the biosynthetic gene cluster of ergot alkaloids in CLAVICEPS PURPUREA. Experimental evidence of the identified cluster was provided by heterologous expression and biochemical characterization of two ORFs, FgaPT1 and FgaPT2, in the cluster of A. FUMIGATUS, which show remarkable similarities to dimethylallyltryptophan synthase from C. PURPUREA and function as prenyltransferases. FgaPT2 converts L-tryptophan to dimethylallyltryptophan and thereby catalyzes the first step of ergot alkaloid biosynthesis, whilst FgaPT1 catalyzes the last step of the fumigaclavine C biosynthesis, i. e., the prenylation of fumigaclavine A at C-2 position of the indole nucleus. In addition to information obtained from the gene cluster of ergot alkaloids from C. PURPUREA, the identification of the biosynthetic gene cluster of fumigaclavine C in A. FUMIGATUS opens an alternative way to study the biosynthesis of ergot alkaloids in fungi. PMID:16902860

  10. On the phenotypic spectrum of serine biosynthesis defects.

    PubMed

    El-Hattab, Ayman W; Shaheen, Ranad; Hertecant, Jozef; Galadari, Hassan I; Albaqawi, Badi S; Nabil, Amira; Alkuraya, Fowzan S

    2016-05-01

    L-serine is a non-essential amino acid that is de novo synthesized via the enzymes phosphoglycerate dehydrogenase (PGDH), phosphoserine aminotransferase (PSAT), and phosphoserine phosphatase (PSP). Besides its role in protein synthesis, L-serine is a precursor of a number of important compounds. Serine biosynthesis defects result from deficiencies in PGDH, PSAT, or PSP and have a broad phenotypic spectrum ranging from Neu-Laxova syndrome, a lethal multiple congenital anomaly disease at the severe end to a childhood disease with intellectual disability at the mild end, with infantile growth deficiency, and severe neurological manifestations as an intermediate phenotype. In this report, we present three subjects with serine biosynthesis effects. The first was a stillbirth with Neu-Laxova syndrome and a homozygous mutation in PHGDH. The second was a neonate with growth deficiency, microcephaly, ichthyotic skin lesions, seizures, contractures, hypertonia, distinctive facial features, and a homozygous mutation in PSAT1. The third subject was an infant with growth deficiency, microcephaly, ichthyotic skin lesions, anemia, hypertonia, distinctive facial features, low serine and glycine in plasma and CSF, and a novel homozygous mutation in PHGDH gene. Herein, we also review previous reports of serine biosynthesis defects and mutations in the PHGDH, PSAT1, and PSPH genes, discuss the variability in the phenotypes associated with serine biosynthesis defects, and elaborate on the vital roles of serine and the potential consequences of its deficiency. PMID:26960553

  11. Redundant pathways of sunscreen biosynthesis in a cyanobacterium.

    PubMed

    Spence, Edward; Dunlap, Walter C; Shick, J Malcolm; Long, Paul F

    2012-03-01

    Route of the sun block: according to empirical evidence, sun-screening mycosporine-like amino acids (MAAs) in Eukarya originate from the shikimic acid pathway, whereas in cyanobacteria, biosynthesis of the MAA shinorine reportedly occurs through the pentose phosphate pathway. However, gene deletion shows that the cyanobacterium Anabaena variabilis ATCC 29143 does not biosynthesise shinorine exclusively by this route. PMID:22278966

  12. Brassinosteroids Are Master Regulators of Gibberellin Biosynthesis in Arabidopsis

    PubMed Central

    Unterholzner, Simon J.; Rozhon, Wilfried; Papacek, Michael; Ciomas, Jennifer; Lange, Theo; Kugler, Karl G.; Mayer, Klaus F.; Sieberer, Tobias; Poppenberger, Brigitte

    2015-01-01

    Plant growth and development are highly regulated processes that are coordinated by hormones including the brassinosteroids (BRs), a group of steroids with structural similarity to steroid hormones of mammals. Although it is well understood how BRs are produced and how their signals are transduced, BR targets, which directly confer the hormone’s growth-promoting effects, have remained largely elusive. Here, we show that BRs regulate the biosynthesis of gibberellins (GAs), another class of growth-promoting hormones, in Arabidopsis thaliana. We reveal that Arabidopsis mutants deficient in BR signaling are severely impaired in the production of bioactive GA, which is correlated with defective GA biosynthetic gene expression. Expression of the key GA biosynthesis gene GA20ox1 in the BR signaling mutant bri1-301 rescues many of its developmental defects. We provide evidence that supports a model in which the BR-regulated transcription factor BES1 binds to a regulatory element in promoters of GA biosynthesis genes in a BR-induced manner to control their expression. In summary, our study underscores a role of BRs as master regulators of GA biosynthesis and shows that this function is of major relevance for the growth and development of vascular plants. PMID:26243314

  13. Polyketides in Aspergillus terreus: biosynthesis pathway discovery and application.

    PubMed

    Yin, Ying; Cai, Menghao; Zhou, Xiangshan; Li, Zhiyong; Zhang, Yuanxing

    2016-09-01

    The knowledge of biosynthesis gene clusters, production improving methods, and bioactivity mechanisms is very important for the development of filamentous fungi metabolites. Metabolic engineering and heterologous expression methods can be applied to improve desired metabolite production, when their biosynthesis pathways have been revealed. And, stable supplement is a necessary basis of bioactivity mechanism discovery and following clinical trial. Aspergillus terreus is an outstanding producer of many bioactive agents, and a large part of them are polyketides. In this review, we took polyketides from A. terreus as examples, focusing on 13 polyketide synthase (PKS) genes in A. terreus NIH 2624 genome. The biosynthesis pathways of nine PKS genes have been reported, and their downstream metabolites are lovastatin, terreic acid, terrein, geodin, terretonin, citreoviridin, and asperfuranone, respectively. Among them, lovastatin is a well-known hypolipidemic agent. Terreic acid, terrein, citreoviridin, and asperfuranone show good bioactivities, especially anticancer activities. On the other hand, geodin and terretonin are mycotoxins. So, biosynthesis gene cluster information is important for the production or elimination of them. We also predicted three possible gene clusters that contain four PKS genes by homologous gene alignment with other Aspergillus strains. We think that this is an effective way to mine secondary metabolic gene clusters. PMID:27455860

  14. Radiochemical Assay of Juvenile Hormone Biosynthesis Rate in Ants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Juvenile hormone (JH) is an important insect hormone known to have many effects on development, reproduction,and behavior in both solitary and social insects. This protocol describes how to quantify in vitro biosynthesis rates from excised corpora allata (CA), the glands responsible for JH productio...

  15. Comparative Studies of 5S rDNA Profiles and Cyt b Sequences in two Onychostoma Species (Cyprinidae)

    PubMed Central

    Han, Chiao-Chuan; Yen, Tsair-Bor; Chen, Nian-Cih; Tseng, Mei-Chen

    2015-01-01

    Onychostoma barbatulum and O. alticorpus, two primarily freshwater cyprinid fish, have similar morphological characters and partially overlapping ecological habitats. In order to explore the genetic differences between these two species, chromosomal characteristics and genetic variations were examined by fluorescence in situ hybridization (FISH) of 5S rDNA and cytochrome (Cyt) b gene analysis. Ten specimens of O. barbatulum and O. alticorpus were collected from the Nanzihsian Stream in southern Taiwan. FISH revealed that the 5S rDNA loci of O. barbatulum and O. alticorpus were found at a pericentromeric and subtelomeric position, respectively, in a pair of submetacentric chromosomes. Cyt b genes were amplified and sequenced from five individuals of each species. Intraspecific genetic distances ranged from 0.001–0.004 in O. barbatulum and from 0.001–0.006 in O. alticorpus. Genetic distances between these two species ranged from 0.132–0.142. The phylogenetic tree showed these two species are not sister species. In conclusion, FISH cytogenetic information and Cyt b gene analyses indicated that these two species have significantly different genetic characteristics; nevertheless, their morphological similarities may be due to environmental adaptation. PMID:26690426

  16. Li(V0.5Ti0.5)S2 as a 1 V lithium intercalation electrode

    NASA Astrophysics Data System (ADS)

    Clark, Steve J.; Wang, Da; Armstrong, A. Robert; Bruce, Peter G.

    2016-03-01

    Graphite, the dominant anode in rechargeable lithium batteries, operates at ~0.1 V versus Li+/Li and can result in lithium plating on the graphite surface, raising safety concerns. Titanates, for example, Li4Ti5O12, intercalate lithium at~1.6 V versus Li+/Li, avoiding problematic lithium plating at the expense of reduced cell voltage. There is interest in 1 V anodes, as this voltage is sufficiently high to avoid lithium plating while not significantly reducing cell potential. The sulfides, LiVS2 and LiTiS2, have been investigated as possible 1 V intercalation electrodes but suffer from capacity fading, large 1st cycle irreversible capacity or polarization. Here we report that the 50/50 solid solution, Li1+x(V0.5Ti0.5)S2, delivers a reversible capacity to store charge of 220 mAhg-1 (at 0.9 V), 99% of theoretical, at a rate of C/2, retaining 205 mAhg-1 at C-rate (92% of theoretical). Rate capability is excellent with 200 mAhg-1 at 3C. C-rate is discharge in 1 h. Polarization is low, 100 mV at C/2. To the best of our knowledge, the properties/performances of Li(V0.5Ti0.5)S2 exceed all previous 1 V electrodes.

  17. Physical mapping of 18S and 5S genes in pelagic species of the genera Caranx and Carangoides (Carangidae).

    PubMed

    Jacobina, U P; Bertollo, L A C; Bello Cioffi, M; Molina, W F

    2014-01-01

    In Carangidae, Caranx is taxonomically controversial because of slight morphological differences among species, as well as because of its relationship with the genus Carangoides. Cytogenetic data has contributed to taxonomic and phylogenetic classification for some groups of fish. In this study, we examined the chromosomes of Caranx latus, Caranx lugubris, and Carangoides bartholomaei using classical methods, including conventional staining, C-banding, silver staining for nuclear organizer regions, base-specific fluorochrome, and 18S and 5S ribosomal sequence mapping using in situ hybridization. These 3 species showed chromosome numbers of 2n = 48, simple nuclear organizer regions (pair 1), and mainly centromeric heterochomatin. However, C. latus (NF = 50) and C. bartholomaei (NF = 50) showed a structurally conserved karyotype compared with C. lugubris (NF = 54), with a larger number of 2-armed chromosomes. The richness of GC-positive heterochromatic segments and sites in 5S rDNA in specific locations compared to the other 2 species reinforce the higher evolutionary dynamism in C. lugubris. Cytogenetic aspects shared between C. latus and C. bartholomaei confirm the remarkable phylogenetic proximity between these genera. PMID:25501173

  18. The karyotype and 5S rRNA genes from Spanish individuals of the bat species Rhinolophus hipposideros (Rhinolophidae; Chiroptera).

    PubMed

    Puerma, Eva; Acosta, Manuel J; Barragán, Maria José L; Martínez, Sergio; Marchal, Juan Alberto; Bullejos, Mónica; Sánchez, Antonio

    2008-11-01

    The karyotype of individuals of the species Rhinolophus hipposideros from Spain present a chromosome number of 2n = 54 (NFa = 62). The described karyotype for these specimens is very similar to another previously described in individual from Bulgaria. However, the presence of one additional pair of autosomal acrocentric chromosomes in the Bulgarian karyotype and the differences in X chromosome morphology indicated that we have described a new karyotype variant in this species. In addition, we have analyzed several clones of 1.4 and 1 kb of a PstI repeated DNA sequence from the genome of R. hipposideros. The repeated sequence included a region with high identity with the 5S rDNA genes and flanking regions, with no homology with GenBank sequences. Search for polymerase III regulatory elements demonstrated the presence of type I promoter elements (A-box, Intermediate Element and C-box) in the 5S rDNA region. In addition, upstream regulatory elements, as a D-box and Sp1 binding sequences, were present in flanking regions. All data indicated that the cloned repeated sequences are the functional rDNA genes from this species. Finally, FISH demonstrated the presence of rDNA in nine chromosome pairs, which is surprising as most mammals have only one carrier chromosome pair. PMID:18066670

  19. Thickness-Dependent and Magnetic-Field-Driven Suppression of Antiferromagnetic Order in Thin V5S8 Single Crystals.

    PubMed

    Hardy, Will J; Yuan, Jiangtan; Guo, Hua; Zhou, Panpan; Lou, Jun; Natelson, Douglas

    2016-06-28

    With materials approaching the 2D limit yielding many exciting systems with intriguing physical properties and promising technological functionalities, understanding and engineering magnetic order in nanoscale, layered materials is generating keen interest. One such material is V5S8, a metal with an antiferromagnetic ground state below the Néel temperature TN ∼ 32 K and a prominent spin-flop signature in the magnetoresistance (MR) when H∥c ∼ 4.2 T. Here we study nanoscale-thickness single crystals of V5S8, focusing on temperatures close to TN and the evolution of material properties in response to systematic reduction in crystal thickness. Transport measurements just below TN reveal magnetic hysteresis that we ascribe to a metamagnetic transition, the first-order magnetic-field-driven breakdown of the ordered state. The reduction of crystal thickness to ∼10 nm coincides with systematic changes in the magnetic response: TN falls, implying that antiferromagnetism is suppressed; and while the spin-flop signature remains, the hysteresis disappears, implying that the metamagnetic transition becomes second order as the thickness approaches the 2D limit. This work demonstrates that single crystals of magnetic materials with nanometer thicknesses are promising systems for future studies of magnetism in reduced dimensionality and quantum phase transitions. PMID:27163511

  20. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae)

    PubMed Central

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Abstract Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 ‘Azul’, Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700

  1. 5S program to reduce change-over time on forming department (case study on CV Piranti Works temanggung)

    NASA Astrophysics Data System (ADS)

    Rosiana Dewi, Septika; Setiawan, Budi; P, Susatyo Nugroho W.

    2013-06-01

    Productivity is one aspect that determines the success of a company in the competitive world of business. There are seven main types of activities that do not have value-added in manufacturing processes such as overproduction, waiting time, transportation, excess inventory, unnecessary motion and defects. The whole activity is a waste (waste) that can cause harm to the Company. Therefore, in production activities is important to pay attention so that the objectives of production productivity can be achieved. Problems experienced by CV Piranti Works is a production target is not achieved resulting in a lost sale raises the cost of which can cause harm to the Company. From the analysis conducted major known cause of the problem is the length of time required for changeover. This is supported by the high non-value added activity in the changeover activities. Lean Manufacturing is an approach to make system more efficient by reducing waste. This study refers to the book compiled by Takashi Osada (2004) and several other references. In this research used method 5S (Seiri, Seiton, Seiso, Seiketsu, and Shitsuke) for the of forming departement. The purpose of this research is to design a work environment using the 5S method (Seiri, Seiton, Seiso, Seiketsu, and Shitsuke) and make arrangement of equipment and working tool cabinet design with TRIZ methods. From these results, is expected to eliminate or reduce of non-value added activity and improved the changeover time so as to meet production targets completion of the company.

  2. YCZ-18 Is a New Brassinosteroid Biosynthesis Inhibitor

    PubMed Central

    Oh, Keimei; Matsumoto, Tadashi; Yamagami, Ayumi; Ogawa, Atushi; Yamada, Kazuhiro; Suzuki, Ryuichiro; Sawada, Takayuki; Fujioka, Shozo; Yoshizawa, Yuko; Nakano, Takeshi

    2015-01-01

    Plant hormone brassinosteroids (BRs) are a group of polyhydroxylated steroids that play critical roles in regulating broad aspects of plant growth and development. The structural diversity of BRs is generated by the action of several groups of P450s. Brassinazole is a specific inhibitor of C-22 hydroxylase (CYP90B1) in BR biosynthesis, and the application use of brassinazole has emerged as an effective way of complementing BR-deficient mutants to elucidate the functions of BRs. In this article, we report a new triazole-type BR biosynthesis inhibitor, YCZ-18. Quantitative analysis the endogenous levels of BRs in Arabidopsis indicated that YCZ-18 significantly decreased the BR contents in plant tissues. Assessment of the binding affinity of YCZ-18to purified recombinant CYP90D1 indicated that YCZ-18 induced a typical type II binding spectrum with a Kd value of approximately 0.79 μM. Analysis of the mechanisms underlying the dwarf phenotype associated with YCZ-18 treatment of Arabidopsis indicated that the chemically induced dwarf phenotype was caused by a failure of cell elongation. Moreover, dissecting the effect of YCZ-18 on the induction or down regulation of genes responsive to BRs indicated that YCZ-18 regulated the expression of genes responsible for BRs deficiency in Arabidopsis. These findings indicate that YCZ-18 is a potent BR biosynthesis inhibitor and has a new target site, C23-hydroxylation in BR biosynthesis. Application of YCZ-18 will be a good starting point for further elucidation of the detailed mechanism of BR biosynthesis and its regulation. PMID:25793645

  3. Basis for the control of purine biosynthesis by purine ribonucleotides.

    PubMed Central

    Itakura, M; Sabina, R L; Heald, P W; Holmes, E W

    1981-01-01

    An animal model was used to determine the basis for the increase in purine biosynthesis that results from hepatic depletion of purine nucleotides, such as seen in patients with type I glycogen storage disease or following fructose administration. Mice were injected intravenously with glucose or fructose, 2.5 mg/g of body weight, and the animals were killed at 0, 3, and 30 min following carbohydrate infusion. Fructose, but not glucose, administration led to a threefold increase in [14C]glycine incorporation into hepatic purine nucleotides documenting an increase in the rate of purine biosynthesis in the liver of fructose-treated animals. In the fructose, but not the glucose-treated animals, there was a reduction in the hepatic content of purine nucleotides that are inhibitory for amidophosphoribosyltransferase, the enzyme that catalyzes the first reaction unique to the pathway of purine biosynthesis. PP-ribose-P, an important metabolite in the control of purine biosynthesis, was increased 2,3-fold in liver following fructose, but not glucose administration. In conjunction with the decrease in inhibitory nucleotides and increase in PP-ribose-P 29% of amidophosphoribosyltransferase was shifted from the large inactive to the small active form of the enzyme. Results of these studies demonstrate that the end-products of the pathway, purine nucleotides, control the activity of the enzyme that catalyzes the first reaction leading to purine nucleotide synthesis either through a direct effect of purine nucleotides on the enzyme, through an indirect effect of the change in nucleotides on PP-ribose-P synthesis, or a combination of these effects. The resultant changes in amidophosphoribosyltransferase conformation and activity provide a basis for understanding the increase in purine biosynthesis that results from hepatic depletion of purine nucleotides. PMID:6162862

  4. Restoration of nucleic acid biosynthesis after clinical death and factors stimulating the process in vivo.

    PubMed

    Konikova, A S; Petukhova, L M; Pogossova, A V; Vinarskaya, A A; Nikulin, V I

    1975-01-01

    The biosynthesis of RNA and DNA falls almost to zero in 60 min after the death of rabbits from anoxia, in all the organs of the body. Rapid artificial cooling of the rabbits to 20 degrees C undertaken within 10 min after death preserved nucleic acid biosynthesis and permitted restoration of life 3-4 h after death, with recovery beginning in 60 min. During the reanimation the addition of ATP to the blood stimulated the restoration of RNA biosynthesis in the spinal cord to a considerable extent; the addition of cocarboxylase to the blood promoted cardiac RNA biosynthesis as well as cardiac and pancreatic DNA biosynthesis during recovery. PMID:1197938

  5. Recent advances in the elucidation of enzymatic function in natural product biosynthesis

    PubMed Central

    Tan, Gao-Yi; Deng, Zixin; Liu, Tiangang

    2016-01-01

    With the successful production of artemisinic acid in yeast, the promising potential of synthetic biology for natural product biosynthesis is now being realized. The recent total biosynthesis of opioids in microbes is considered to be another landmark in this field. The importance and significance of enzymes in natural product biosynthetic pathways have been re-emphasized by these advancements. Therefore, the characterization and elucidation of enzymatic function in natural product biosynthesis are undoubtedly fundamental for the development of new drugs and the heterologous biosynthesis of active natural products. Here, discoveries regarding enzymatic function in natural product biosynthesis over the past year are briefly reviewed. PMID:26989472

  6. Regulatory Cross-Talks and Cascades in Rice Hormone Biosynthesis Pathways Contribute to Stress Signaling

    PubMed Central

    Deb, Arindam; Grewal, Rumdeep K.; Kundu, Sudip

    2016-01-01

    Crosstalk among different hormone signaling pathways play an important role in modulating plant response to both biotic and abiotic stress. Hormone activity is controlled by its bio-availability, which is again influenced by its biosynthesis. Thus, independent hormone biosynthesis pathways must be regulated and co-ordinated to mount an integrated response. One of the possibilities is to use cis-regulatory elements to orchestrate expression of hormone biosynthesis genes. Analysis of CREs, associated with differentially expressed hormone biosynthesis related genes in rice leaf under Magnaporthe oryzae attack and drought stress enabled us to obtain insights about cross-talk among hormone biosynthesis pathways at the transcriptional level. We identified some master transcription regulators that co-ordinate different hormone biosynthesis pathways under stress. We found that Abscisic acid and Brassinosteroid regulate Cytokinin conjugation; conversely Brassinosteroid biosynthesis is affected by both Abscisic acid and Cytokinin. Jasmonic acid and Ethylene biosynthesis may be modulated by Abscisic acid through DREB transcription factors. Jasmonic acid or Salicylic acid biosynthesis pathways are co-regulated but they are unlikely to influence each others production directly. Thus, multiple hormones may modulate hormone biosynthesis pathways through a complex regulatory network, where biosynthesis of one hormone is affected by several other contributing hormones. PMID:27617021

  7. Regulatory Cross-Talks and Cascades in Rice Hormone Biosynthesis Pathways Contribute to Stress Signaling.

    PubMed

    Deb, Arindam; Grewal, Rumdeep K; Kundu, Sudip

    2016-01-01

    Crosstalk among different hormone signaling pathways play an important role in modulating plant response to both biotic and abiotic stress. Hormone activity is controlled by its bio-availability, which is again influenced by its biosynthesis. Thus, independent hormone biosynthesis pathways must be regulated and co-ordinated to mount an integrated response. One of the possibilities is to use cis-regulatory elements to orchestrate expression of hormone biosynthesis genes. Analysis of CREs, associated with differentially expressed hormone biosynthesis related genes in rice leaf under Magnaporthe oryzae attack and drought stress enabled us to obtain insights about cross-talk among hormone biosynthesis pathways at the transcriptional level. We identified some master transcription regulators that co-ordinate different hormone biosynthesis pathways under stress. We found that Abscisic acid and Brassinosteroid regulate Cytokinin conjugation; conversely Brassinosteroid biosynthesis is affected by both Abscisic acid and Cytokinin. Jasmonic acid and Ethylene biosynthesis may be modulated by Abscisic acid through DREB transcription factors. Jasmonic acid or Salicylic acid biosynthesis pathways are co-regulated but they are unlikely to influence each others production directly. Thus, multiple hormones may modulate hormone biosynthesis pathways through a complex regulatory network, where biosynthesis of one hormone is affected by several other contributing hormones. PMID:27617021

  8. Hydrogen sulfide mediates nicotine biosynthesis in tobacco (Nicotiana tabacum) under high temperature conditions.

    PubMed

    Chen, Xiaodong; Chen, Qian; Zhang, Xiaoming; Li, Ruijing; Jia, Yujie; Ef, Abd Allah; Jia, Aiqun; Hu, Liwei; Hu, Xiangyang

    2016-07-01

    Hydrogen sulfide (H2S) acts as a signal to induce many physiological processes in plants, but its role in controlling the biosynthesis of secondary metabolites is not well established. In this study, we found that high temperature (HT) treatment induced nicotine biosynthesis in tobacco (Nicotiana tabacum) and promoted the rapid accumulation of H2S. Furthermore, HT triggered the biosynthesis of jasmonic acid (JA), a plant hormone that promotes nicotine biosynthesis. Suppression of the H2S signal using chemical inhibitors or via RNAi suppression of l-cysteine desulphydrase (L-CD) in transgenic plants, compromised JA production and nicotine biosynthesis under HT treatments, and these inhibitory effects could be reversed by applying exogenous H2S. Based on these data, we propose that H2S is an important trigger of nicotine biosynthesis in tobacco under HT conditions, and that H2S acts upstream of JA signaling by modulating the transcription of genes associated with JA biosynthesis. PMID:27035256

  9. Appearance and evolution of the specific chromosomal rearrangements associated with malignant transformation of mouse m5S cells

    SciTech Connect

    Kodama, S.; Okumura, Y.; Komatsu, K.; Sasaki, M.S. )

    1991-06-01

    Chromosomal alterations were studied during the acquisition of malignant phenotypes in two karyotypically distinct cells isolated from transformed foci induced by x-irradiation in mouse m5S cells. Because the transformants, despite foci origin, showed low ability to grow in agar, they were cultured in vitro with serial transfer schedules to allow further cell generations and assayed for anchorage independence (AI) at each passage level. The AI frequency increased with the cell doubling numbers. Chromosome analysis showed that a focus was one cell origin, but the transformants showed karyotypic instability during cell proliferation, giving rise to the rearrangements clustered in the distal region of the specific chromosomes. These rearrangements appeared to be directed toward the acquisition of malignant phenotypes. Analysis of the types and sites of rearrangements indicated that a mechanism exists that induces frequent rearrangements of the specific region of a chromosome during the process of transformation into the malignant state.

  10. Molecular authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii by ITS and 5S rRNA spacer sequencing.

    PubMed

    Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui

    2007-01-01

    In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii. PMID:17202681

  11. Ln3I5(S2N2)(S2)(THF)10 - a new type of molecular compounds.

    PubMed

    Fagin, A A; Fukin, G K; Cherkasov, A V; Shestakov, A F; Pushkarev, A P; Balashova, T V; Maleev, A A; Bochkarev, M N

    2016-03-21

    Unprecedented complexes of the composition Ln3I5(S2N2)(S2)(THF)10 were obtained in the reactions of neodymium and dysprosium iodide-nitrides with sulfur. The inorganic core of the molecules contains the cyclic fragments Ln(μ-S2)Ln, LnSNSN and LnSN. Ten of the fourteen atoms of the core are coplanar, the remaining four S2 and I2 atoms lie in the other two orthogonal planes. The dysprosium complex upon excitation with UV light exhibits the metal-centered luminescence characteristic of the Dy(3+) ion. Geometric parameters of the molecules, computational data, electron spectroscopy and fluorescence suggest the existence of some conjugation in the mentioned heterocycles. PMID:26842841

  12. High pressure Raman study of layered Mo0.5W0.5S2 ternary compound

    NASA Astrophysics Data System (ADS)

    Kim, Joon-Seok; Moran, Samuel T.; Nayak, Avinash P.; Pedahzur, Shahar; Ruiz, Itzel; Ponce, Gabriela; Rodriguez, Daniela; Henny, Joanna; Liu, Jin; Lin, Jung-Fu; Akinwande, Deji

    2016-06-01

    Ternary two-dimensional (2D) transition metal dichalcogenide compounds exhibit a tunable electronic structure allowing for control of the interlayer and the intralayer atomic displacement to efficiently tune their physical and electronic properties. Using a diamond anvil cell, hydrostatic pressure was applied to Mo0.5W0.5S2 up to 40 GPa in order to study the optical phonon vibrational modes. Analysis of the high-pressure Raman spectra shows that the two in-plane E2g modes resembling that of pristine MoS2 and WS2, as well as disorder-activated longitudinal acoustic phonon mode, are hardened and suppressed as pressure increases. The two A1g modes of the ternary compound that resemble the A1g modes of pristine MoS2 and WS2, displayed similar Raman shifts to the pristine compounds as pressure increases. A Raman peak at 470 cm-1 that is close to A1g peaks emerges at ˜8 GPa, which represents a disorder-activated pressure-induced out-of-plane Raman mode observed only in the ternary compound under high pressure. At pressures above ˜30 GPa, a Raman peak at approximately 340 cm-1 is observed, signifying additional disorder-activated vibration mode. Our results reveal the enhanced interactions in the structural and vibrational behavior of the MoS2 and WS2 domains in the Mo0.5W0.5S2 compound under hydrostatic pressure. These results could have implications in understanding the electronic, optical, and structural properties of the new 2D ternary compound materials under extreme mechanical conditions.

  13. Farnesylation mediates brassinosteroid biosynthesis to regulate abscisic acid responses.

    PubMed

    Northey, Julian G B; Liang, Siyu; Jamshed, Muhammad; Deb, Srijani; Foo, Eloise; Reid, James B; McCourt, Peter; Samuel, Marcus A

    2016-01-01

    Protein farnesylation is a post-translational modification involving the addition of a 15-carbon farnesyl isoprenoid to the carboxy terminus of select proteins(1-3). Although the roles of this lipid modification are clear in both fungal and animal signalling, many of the mechanistic functions of farnesylation in plant signalling are still unknown. Here, we show that CYP85A2, the cytochrome P450 enzyme that performs the last step in brassinosteroid biosynthesis (conversion of castasterone to brassinolide)(4), must be farnesylated to function in Arabidopsis. Loss of either CYP85A2 or CYP85A2 farnesylation results in reduced brassinolide accumulation and increased plant responsiveness to the hormone abscisic acid (ABA) and overall drought tolerance, explaining previous observations(5). This result not only directly links farnesylation to brassinosteroid biosynthesis but also suggests new strategies to maintain crop yield under challenging climatic conditions. PMID:27455172

  14. Putative Genes Involved in Saikosaponin Biosynthesis in Bupleurum Species

    PubMed Central

    Lin, Tsai-Yun; Chiou, Chung-Yi; Chiou, Shu-Jiau

    2013-01-01

    Alternative medicinal agents, such as the herb Bupleurum, are increasingly used in modern medicine to supplement synthetic drugs. First, we present a review of the currently known effects of triterpene saponins-saikosaponins of Bupleurum species. The putative biosynthetic pathway of saikosaponins in Bupleurum species is summarized, followed by discussions on identification and characterization of genes involved in the biosynthesis of saikosaponins. The purpose is to provide a brief review of gene extraction, functional characterization of isolated genes and assessment of expression patterns of genes encoding enzymes in the process of saikosaponin production in Bupleurum species, mainly B. kaoi. We focus on the effects of MeJA on saikosaponin production, transcription patterns of genes involved in biosynthesis and on functional depiction. PMID:23783277

  15. Characterization of three amidinotransferases involved in the biosynthesis of ketomemicins.

    PubMed

    Ogasawara, Yasushi; Fujimori, Michiko; Kawata, Junpei; Dairi, Tohru

    2016-08-01

    We recently reported a novel class of amide bond forming enzymes (peptide ligases) involved in the biosynthesis of pheganomycins, resorcinomycins and ketomemicins. This class of enzymes exclusively utilizes Nα-amidino amino acids as the N-terminal substrate. In this Letter, we characterized three new amidinotransferases involved in the biosynthesis of ketomemicins and showed that l-arginine was the amidino-acceptor of amidinotransferases in both the Micromonospora sp. and Streptomyces mobaraensis clusters, while the Salinispora tropica enzyme recognized l-valine. Unexpectedly, the S. tropica enzyme accepted several different amino acids as amidino acceptors in addition to l-valine. Accordingly, we re-investigated the specific metabolites governed by the gene cluster of S. tropica and identified several minor congeners of ketomemicin C with different N-terminal amidino-amino acids. These results indicate that the amidinotransferase of S. tropica is promiscuous and could be useful to generate new ketomemicin-type natural products. PMID:27289319

  16. Biosynthesis of polyamines and polyamine-containing molecules.

    PubMed

    Michael, Anthony J

    2016-08-01

    Polyamines are evolutionarily ancient polycations derived from amino acids and are pervasive in all domains of life. They are essential for cell growth and proliferation in eukaryotes and are essential, important or dispensable for growth in bacteria. Polyamines present a useful scaffold to attach other moieties to, and are often incorporated into specialized metabolism. Life has evolved multiple pathways to synthesize polyamines, and structural variants of polyamines have evolved in bacteria, archaea and eukaryotes. Among the complex biosynthetic diversity, patterns of evolutionary reiteration can be distinguished, revealing evolutionary recycling of particular protein folds and enzyme chassis. The same enzyme activities have evolved from multiple protein folds, suggesting an inevitability of evolution of polyamine biosynthesis. This review discusses the different biosynthetic strategies used in life to produce diamines, triamines, tetra-amines and branched and long-chain polyamines. It also discusses the enzymes that incorporate polyamines into specialized metabolites and attempts to place polyamine biosynthesis in an evolutionary context. PMID:27470594

  17. Biosynthesis and Function of Polyacetylenes and Allied Natural Products

    PubMed Central

    Minto, Robert E.; Blacklock, Brenda J.

    2008-01-01

    Polyacetylenic natural products are a substantial class of often unstable compounds containing a unique carbon-carbon triple bond functionality, that are intriguing for their wide variety of biochemical and ecological functions, economic potential, and surprising mode of biosynthesis. Isotopic tracer experiments between 1960 and 1990 demonstrated that the majority of these compounds are derived from fatty acid and polyketide precursors. During the past decade, research into the metabolism of polyacetylenes has swiftly advanced, driven by the cloning of the first genes responsible for polyacetylene biosynthesis in plants, moss, fungi, and actinomycetes, and the initial characterization of the gene products. The current state of knowledge of the biochemistry and molecular genetics of polyacetylenic secondary metabolic pathways will be presented together with an up-to-date survey of new terrestrial and marine natural products, their known biological activities, and a discussion of their likely metabolic origins. PMID:18387369

  18. Biosynthesis of Phosphonic and Phosphinic Acid Natural Products

    PubMed Central

    Metcalf, William W.; van der Donk, Wilfred A.

    2009-01-01

    Natural products containing carbon-phosphorus bonds (phosphonic and phosphinic acids) have found widespread use in medicine and agriculture. Recent years have seen a renewed interest in the biochemistry and biology of these compounds with the cloning of the biosynthetic gene clusters for several family members. This review discusses the commonalities and differences in the molecular logic that lies behind the biosynthesis of these compounds. The current knowledge regarding the metabolic pathways and enzymes involved in the production of a number of natural products, including the approved antibiotic fosfomycin, the widely used herbicide phosphinothricin, and the clinical candidate for treatment of malaria FR900098, is presented. Many of the enzymes involved in the biosynthesis of these compounds catalyze chemically and biologically unprecedented transformations and a wealth of new biochemistry has been revealed through their study. These studies have also suggested new strategies for natural product discovery. PMID:19489722

  19. An engineered pathway for the biosynthesis of renewable propane

    PubMed Central

    Kallio, Pauli; Pásztor, András; Thiel, Kati; Akhtar, M. Kalim; Jones, Patrik R.

    2014-01-01

    The deployment of next-generation renewable biofuels can be enhanced by improving their compatibility with the current infrastructure for transportation, storage and utilization. Propane, the bulk component of liquid petroleum gas, is an appealing target as it already has a global market. In addition, it is a gas under standard conditions, but can easily be liquefied. This allows the fuel to immediately separate from the biocatalytic process after synthesis, yet does not preclude energy-dense storage as a liquid. Here we report, for the first time, a synthetic metabolic pathway for producing renewable propane. The pathway is based on a thioesterase specific for butyryl-acyl carrier protein (ACP), which allows native fatty acid biosynthesis of the Escherichia coli host to be redirected towards a synthetic alkane pathway. Propane biosynthesis is markedly stimulated by the introduction of an electron-donating module, optimizing the balance of O2 supply and removal of native aldehyde reductases. PMID:25181600

  20. An engineered pathway for the biosynthesis of renewable propane.

    PubMed

    Kallio, Pauli; Pásztor, András; Thiel, Kati; Akhtar, M Kalim; Jones, Patrik R

    2014-01-01

    The deployment of next-generation renewable biofuels can be enhanced by improving their compatibility with the current infrastructure for transportation, storage and utilization. Propane, the bulk component of liquid petroleum gas, is an appealing target as it already has a global market. In addition, it is a gas under standard conditions, but can easily be liquefied. This allows the fuel to immediately separate from the biocatalytic process after synthesis, yet does not preclude energy-dense storage as a liquid. Here we report, for the first time, a synthetic metabolic pathway for producing renewable propane. The pathway is based on a thioesterase specific for butyryl-acyl carrier protein (ACP), which allows native fatty acid biosynthesis of the Escherichia coli host to be redirected towards a synthetic alkane pathway. Propane biosynthesis is markedly stimulated by the introduction of an electron-donating module, optimizing the balance of O2 supply and removal of native aldehyde reductases. PMID:25181600

  1. Ontogenetic taurine biosynthesis ability in rainbow trout (Oncorhynchus mykiss).

    PubMed

    Wang, Xuan; He, Gen; Mai, Kangsen; Xu, Wei; Zhou, Huihui

    2015-07-01

    Taurine (2-aminoethane sulfonic acid) plays important roles in multiple physiological processes including osmoregulation, bile salt conjugation and membrane protection. It is known that taurine biosynthesis varies in different fish species. However, its ontogenetic regulation has not been clear. In the present study, we found that the hepatic concentrations of taurine increased marginally with rainbow trout growth. The mRNA expression, protein levels and enzyme activities of key enzymes involved in taurine biosynthesis, cysteine dioxygenase (CDO) and cysteine sulfinate decarboxylase (CSD), were analyzed. Our results showed that the mRNA levels and protein abundances of CSD increased dramatically with the development of rainbow trout stages while the enzyme activities showed a slight improvement. However, the expression and activities of CDO decreased with rainbow trout growth. These results provide valuable information on defining the exact supplementation of taurine in diets for different stages of rainbow trout and give new insights into elucidating the regulation of taurine metabolism in rainbow trout. PMID:25773436

  2. Heterologous biosynthesis of artemisinic acid in Saccharomyces cerevisiae.

    PubMed

    Li, C; Li, J; Wang, G; Li, X

    2016-06-01

    Artemisinic acid is a precursor of antimalarial compound artemisinin. The titre of biosynthesis of artemisinic acid using Saccharomyces cerevisiae platform has been achieved up to 25 g l(-1) ; however, the performance of platform cells is still industrial unsatisfied. Many strategies have been proposed to improve the titre of artemisinic acid. The traditional strategies mainly focused on partial target sites, simple up-regulation key genes or repression competing pathways in the total synthesis route. However, this may result in unbalance of carbon fluxes and dysfunction of metabolism. In this review, the recent advances on the promising methods in silico and in vivo for biosynthesis of artemisinic acid have been discussed. The bioinformatics and omics techniques have brought a great prospect for improving production of artemisinin and other pharmacal compounds in heterologous platform. PMID:26743771

  3. Regulation of Isoprenoid Pheromone Biosynthesis in Bumblebee Males.

    PubMed

    Prchalová, Darina; Buček, Aleš; Brabcová, Jana; Žáček, Petr; Kindl, Jiří; Valterová, Irena; Pichová, Iva

    2016-02-01

    Males of the closely related species Bombus terrestris and Bombus lucorum attract conspecific females by completely different marking pheromones. MP of B. terrestris and B. lucorum pheromones contain mainly isoprenoid (ISP) compounds and fatty acid derivatives, respectively. Here, we studied the regulation of ISP biosynthesis in both bumblebees. RNA-seq and qRT-PCR analyses indicated that acetoacetyl-CoA thiolase (AACT), 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR), and farnesyl diphosphate synthase (FPPS) transcripts are abundant in the B. terrestris labial gland. Maximal abundance of these transcripts correlated well with AACT enzymatic activity detected in the LG extracts. In contrast, transcript abundances of AACT, HMGR, and FPPS in B. lucorum were low, and AACT activity was not detected in LGs. These results suggest that transcriptional regulation plays a key role in the control of ISP biosynthetic gene expression and ISP pheromone biosynthesis in bumblebee males. PMID:26632352

  4. Biosynthesis and Function of Extracellular Glycans in Cyanobacteria

    PubMed Central

    Kehr, Jan-Christoph; Dittmann, Elke

    2015-01-01

    The cell surface of cyanobacteria is covered with glycans that confer versatility and adaptability to a multitude of environmental factors. The complex carbohydrates act as barriers against different types of stress and play a role in intra- as well as inter-species interactions. In this review, we summarize the current knowledge of the chemical composition, biosynthesis and biological function of exo- and lipo-polysaccharides from cyanobacteria and give an overview of sugar-binding lectins characterized from cyanobacteria. We discuss similarities with well-studied enterobacterial systems and highlight the unique features of cyanobacteria. We pay special attention to colony formation and EPS biosynthesis in the bloom-forming cyanobacterium, Microcystis aeruginosa. PMID:25587674

  5. Unraveling the biosynthesis of pilocarpine in Pilocarpus microphyllus.

    PubMed

    Sawaya, Alexandra Christine Helena Frankland; Costa, Yanna Dias; Mazzafera, Paulo

    2015-05-01

    Pilocarpine is found exclusively in species of Pilocarpus and the presence of other imidazole alkaloids has been reported in several species of the genus. Pilocarpine has several important pharmaceutical applications. Although several imidazole alkaloids related to pilocarpine have been reported in the previous years, little is still known about its biosynthetic route. At most, histidine has been reported as the precursor of pilocarpine. Based on our own previous reports and in an experiment where pilocarpine and related alkaloids (pilosine, trachyllophiline and anhydropilosine) were supplied to P. microphyllus leaves and the alkaloid profile analyzed by UPLC-MS, we suggest a biosynthesis pathway for pilocarpine. Further experiments using labeled precursors associated with transcriptome data may allow us to understand the whole biosynthesis pathway and its genetic control. PMID:26058143

  6. Predicted Roles of the Uncharacterized Clustered Genes in Aflatoxin Biosynthesis

    PubMed Central

    Ehrlich, Kenneth C.

    2009-01-01

    Biosynthesis of the toxic and carcinogenic aflatoxins (AFs) requires the activity of more than 27 enzymes. The roles in biosynthesis of newly described enzymes are discussed in this review. We suggest that HypC catalyzes the oxidation of norsolorinic acid anthrone; AvfA (AflI), the ring-closure step in formation of hydroxyversicolorone; HypB, the second oxidation step in conversion of O-methylsterigmatocystin to AF; and HypE and NorA (AflE), the final two steps in AFB1 formation. HypD, an integral membrane protein, affects fungal development and lowers AF production while AflJ (AflS), has a partial methyltransferase domain that may be important in its function as a transcriptional co-activator. PMID:22069531

  7. In-situ glyoxalization during biosynthesis of bacterial cellulose.

    PubMed

    Castro, Cristina; Cordeiro, Nereida; Faria, Marisa; Zuluaga, Robin; Putaux, Jean-Luc; Filpponen, Ilari; Velez, Lina; Rojas, Orlando J; Gañán, Piedad

    2015-08-01

    A novel method to synthesize highly crosslinked bacterial cellulose (BC) is reported. The glyoxalization is started in-situ, in the culture medium during biosynthesis of cellulose by Gluconacetobacter medellensis bacteria. Strong crosslinked networks were formed in the contact areas between extruded cellulose ribbons by reaction with the glyoxal precursors. The crystalline structure of cellulose was preserved while the acidic component of the surface energy was reduced. As a consequence, its predominant acidic character and the relative contribution of the dispersive component increased, endowing the BC network with a higher hydrophobicity. This route for in-situ crosslinking is expected to facilitate other modifications upon biosynthesis of cellulose ribbons by microorganisms and to engineer the strength and surface energy of their networks. PMID:25933519

  8. Tetrahydrobiopterin biosynthesis as an off-target of sulfa drugs.

    PubMed

    Haruki, Hirohito; Pedersen, Miriam Grønlund; Gorska, Katarzyna Irena; Pojer, Florence; Johnsson, Kai

    2013-05-24

    The introduction of sulfa drugs for the chemotherapy of bacterial infections in 1935 revolutionized medicine. Although their mechanism of action is understood, the molecular bases for most of their side effects remain obscure. Here, we report that sulfamethoxazole and other sulfa drugs interfere with tetrahydrobiopterin biosynthesis through inhibition of sepiapterin reductase. Crystal structures of sepiapterin reductase with bound sulfa drugs reveal how structurally diverse sulfa drugs achieve specific inhibition of the enzyme. The effect of sulfa drugs on tetrahydrobiopterin-dependent neurotransmitter biosynthesis in cell-based assays provides a rationale for some of their central nervous system-related side effects, particularly in high-dose sulfamethoxazole therapy of Pneumocystis pneumonia. Our findings reveal an unexpected aspect of the pharmacology of sulfa drugs and might translate into their improved medical use. PMID:23704574

  9. Understanding the biosynthesis of platelets-derived extracellular vesicles

    PubMed Central

    Antwi-Baffour, Samuel; Adjei, Jonathan; Aryeh, Claudia; Kyeremeh, Ransford; Kyei, Foster; Seidu, Mahmood A

    2015-01-01

    Platelet-derived extracellular vesicles (PEVs) are described as sub-cellular vesicles released into circulation upon platelets shear stress, activation, injury, or apoptosis. They are considered as universal biomarkers in a wide range of physiological and pathological processes. They are of tremendous significance for the prediction, diagnosis, and observation of the therapeutic success of many diseases. Understanding their biosynthesis and therefore functional properties would contribute to a better understanding of the pathological mechanisms leading to various diseases in which their levels are raised and they are implicated. The review takes a critical look at the historical background of PEVs, their structural components, the mechanism of their formation, physiological, and exogenous stimuli inducing their release and their detection. It concludes by highlighting on the importance of undertaking in-depth studies into PEVs biosynthesis and subsequently gaining a better understanding of their biological role in general. PMID:26417432

  10. Biosynthesis and Chemical Synthesis of Presilphiperfolanol Natural Products**

    PubMed Central

    Hong, Allen Y.

    2015-01-01

    Presilphiperfolanols constitute a family of biosynthetically important sesquiterpenes that can rearrange to diverse sesquiterpenoid skeletons. While the origin of these natural products can be traced to simple linear terpene precursors, the details of the enzymatic cyclization mechanism that form the stereochemically dense tricyclic skeleton have required extensive biochemical, computational, and synthetic investigation. Parallel efforts to prepare the unique and intriguing structures of these compounds by total synthesis have also inspired novel strategies, resulting in two synthetic approaches and two completed syntheses. While the biosynthesis and chemical synthesis studies performed to date have provided much insight into the role and properties of these molecules, new questions regarding the biosynthesis of newer members of the family and subtle details of the cyclization mechanism have yet to be explored. PMID:24771653

  11. Haemoglobin biosynthesis site in rabbit embryo erythroid cells.

    PubMed

    Cianciarullo, Aurora M; Bertho, Alvaro L; Soares, Maurilio J; Hosoda, Tânia M; Nogueira-Silva, Simone; Beçak, Willy

    2003-01-01

    Properly metabolized globin synthesis and iron uptake are indispensable for erythroid cell differentiation and maturation. Mitochondrial participation is crucial in the process of haeme synthesis for cytochromes and haemoglobin. We studied the final biosynthesis site of haemoglobin using an ultrastructural approach, with erythroid cells obtained from rabbit embryos, in order to compare these results with those of animals treated with saponine or phenylhydrazine. Our results are similar to those obtained in assays with adult mammals, birds, amphibians, reptiles and fish, after induction of haemolytic anaemia. Therefore, the treatment did not interfere with the process studied, confirming our previous findings. Immunoelectron microscopy showed no labelling of mitochondria or other cellular organelles supposedly involved in the final biosynthesis of haemoglobin molecules, suggesting instead that it occurs free in the cytoplasm immediately after the liberation of haeme from the mitochondria, by electrostatic attraction between haeme and globin chains. PMID:12972280

  12. Structural Framework for Metal Incorporation during Molybdenum Cofactor Biosynthesis.

    PubMed

    Kasaragod, Vikram Babu; Schindelin, Hermann

    2016-05-01

    The molybdenum cofactor (Moco) is essential for the catalytic activity of all molybdenum-containing enzymes with the exception of nitrogenase. Moco biosynthesis follows an evolutionarily highly conserved pathway and genetic deficiencies in the corresponding human enzymes result in Moco deficiency, which manifests itself in severe neurological symptoms and death in childhood. In humans the final steps of Moco biosynthesis are catalyzed by gephyrin, specifically the penultimate adenylation of molybdopterin (MPT) by its N-terminal G domain (GephG) and the final metal incorporation by its C-terminal E domain (GephE). To better understand the poorly defined molecular framework of this final step, we determined high-resolution crystal structures of GephE in the apo state and in complex with ADP, AMP, and molybdate. Our data provide novel insights into the catalytic steps leading to final Moco maturation, namely deadenylation as well as molybdate binding and insertion. PMID:27112598

  13. Inhibition of dengue virus through suppression of host pyrimidine biosynthesis.

    PubMed

    Wang, Qing-Yin; Bushell, Simon; Qing, Min; Xu, Hao Ying; Bonavia, Aurelio; Nunes, Sandra; Zhou, Jing; Poh, Mee Kian; Florez de Sessions, Paola; Niyomrattanakit, Pornwaratt; Dong, Hongping; Hoffmaster, Keith; Goh, Anne; Nilar, Shahul; Schul, Wouter; Jones, Susan; Kramer, Laura; Compton, Teresa; Shi, Pei-Yong

    2011-07-01

    Viral replication relies on the host to supply nucleosides. Host enzymes involved in nucleoside biosynthesis are potential targets for antiviral development. Ribavirin (a known antiviral drug) is such an inhibitor that suppresses guanine biosynthesis; depletion of the intracellular GTP pool was shown to be the major mechanism to inhibit flavivirus. Along similar lines, inhibitors of the pyrimidine biosynthesis pathway could be targeted for potential antiviral development. Here we report on a novel antiviral compound (NITD-982) that inhibits host dihydroorotate dehydrogenase (DHODH), an enzyme required for pyrimidine biosynthesis. The inhibitor was identified through screening 1.8 million compounds using a dengue virus (DENV) infection assay. The compound contains an isoxazole-pyrazole core structure, and it inhibited DENV with a 50% effective concentration (EC(50)) of 2.4 nM and a 50% cytotoxic concentration (CC(50)) of >5 μM. NITD-982 has a broad antiviral spectrum, inhibiting both flaviviruses and nonflaviviruses with nanomolar EC(90)s. We also show that (i) the compound inhibited the enzymatic activity of recombinant DHODH, (ii) an NITD-982 analogue directly bound to the DHODH protein, (iii) supplementing the culture medium with uridine reversed the compound-mediated antiviral activity, and (iv) DENV type 2 (DENV-2) variants resistant to brequinar (a known DHODH inhibitor) were cross resistant to NITD-982. Collectively, the results demonstrate that the compound inhibits DENV through depleting the intracellular pyrimidine pool. In contrast to the in vitro potency, the compound did not show any efficacy in the DENV-AG129 mouse model. The lack of in vivo efficacy is likely due to the exogenous uptake of pyrimidine from the diet or to a high plasma protein-binding activity of the current compound. PMID:21507975

  14. Molecular activities, biosynthesis and evolution of triterpenoid saponins.

    PubMed

    Augustin, Jörg M; Kuzina, Vera; Andersen, Sven B; Bak, Søren

    2011-04-01

    Saponins are bioactive compounds generally considered to be produced by plants to counteract pathogens and herbivores. Besides their role in plant defense, saponins are of growing interest for drug research as they are active constituents of several folk medicines and provide valuable pharmacological properties. Accordingly, much effort has been put into unraveling the modes of action of saponins, as well as in exploration of their potential for industrial processes and pharmacology. However, the exploitation of saponins for bioengineering crop plants with improved resistances against pests as well as circumvention of laborious and uneconomical extraction procedures for industrial production from plants is hampered by the lack of knowledge and availability of genes in saponin biosynthesis. Although the ability to produce saponins is rather widespread among plants, a complete synthetic pathway has not been elucidated in any single species. Current conceptions consider saponins to be derived from intermediates of the phytosterol pathway, and predominantly enzymes belonging to the multigene families of oxidosqualene cyclases (OSCs), cytochromes P450 (P450s) and family 1 UDP-glycosyltransferases (UGTs) are thought to be involved in their biosynthesis. Formation of unique structural features involves additional biosynthetical enzymes of diverse phylogenetic background. As an example of this, a serine carboxypeptidase-like acyltransferase (SCPL) was recently found to be involved in synthesis of triterpenoid saponins in oats. However, the total number of identified genes in saponin biosynthesis remains low as the complexity and diversity of these multigene families impede gene discovery based on sequence analysis and phylogeny. This review summarizes current knowledge of triterpenoid saponin biosynthesis in plants, molecular activities, evolutionary aspects and perspectives for further gene discovery. PMID:21333312

  15. Terpenoid biosynthesis in trichomes--current status and future opportunities.

    PubMed

    Lange, B Markus; Turner, Glenn W

    2013-01-01

    Glandular trichomes are anatomical structures specialized for the synthesis of secreted natural products. In this review we focus on the description of glands that accumulate terpenoid essential oils and oleoresins. We also provide an in-depth account of the current knowledge about the biosynthesis of terpenoids and secretion mechanisms in the highly specialized secretory cells of glandular trichomes, and highlight the implications for metabolic engineering efforts. PMID:22979959

  16. Monomethylarsonous acid inhibited endogenous cholesterol biosynthesis in human skin fibroblasts

    SciTech Connect

    Guo, Lei; Xiao, Yongsheng; Wang, Yinsheng

    2014-05-15

    Human exposure to arsenic in drinking water is a widespread public health concern, and such exposure is known to be associated with many human diseases. The detailed molecular mechanisms about how arsenic species contribute to the adverse human health effects, however, remain incompletely understood. Monomethylarsonous acid [MMA(III)] is a highly toxic and stable metabolite of inorganic arsenic. To exploit the mechanisms through which MMA(III) exerts its cytotoxic effect, we adopted a quantitative proteomic approach, by coupling stable isotope labeling by amino acids in cell culture (SILAC) with LC-MS/MS analysis, to examine the variation in the entire proteome of GM00637 human skin fibroblasts following acute MMA(III) exposure. Among the ∼ 6500 unique proteins quantified, ∼ 300 displayed significant changes in expression after exposure with 2 μM MMA(III) for 24 h. Subsequent analysis revealed the perturbation of de novo cholesterol biosynthesis, selenoprotein synthesis and Nrf2 pathways evoked by MMA(III) exposure. Particularly, MMA(III) treatment resulted in considerable down-regulation of several enzymes involved in cholesterol biosynthesis. In addition, real-time PCR analysis showed reduced mRNA levels of select genes in this pathway. Furthermore, MMA(III) exposure contributed to a distinct decline in cellular cholesterol content and significant growth inhibition of multiple cell lines, both of which could be restored by supplementation of cholesterol to the culture media. Collectively, the present study demonstrated that the cytotoxicity of MMA(III) may arise, at least in part, from the down-regulation of cholesterol biosynthesis enzymes and the resultant decrease of cellular cholesterol content. - Highlights: • MMA(III)-induced perturbation of the entire proteome of GM00637 cells is studied. • Quantitative proteomic approach revealed alterations of multiple cellular pathways. • MMA(III) inhibits de novo cholesterol biosynthesis. • MMA

  17. Tryptophan Biosynthesis in Cell Cultures of Nicotiana tabacum1

    PubMed Central

    Delmer, Deborah P.; Mills, S. E.

    1968-01-01

    Some of the general features of the pathway for l-tryptophan biosynthesis in cell cultures of Nicotiana tabccum var. Wisc. 38 have been investigated. The results of both isotope competition and direct-labeling experiments show that shikimic acid, anthranilic acid, indoleglycerol phosphate, and indole can serve as precursors to l-tryptophan in these cells, indicating that, in terms of its biochemical intermediates, the pathway is similar to that described for the bacteria and fungi. PMID:16656741

  18. Pigments and citrinin biosynthesis by fungi belonging to genus Monascus.

    PubMed

    Pisareva, Emiliya; Savov, Valentin; Kujumdzieva, Anna

    2005-01-01

    Citrinin is a mycotoxin, which is produced by fungi belonging to the genus Monascus, known in biotechnology as producers of azaphilone pigments. The relation between biosynthesis of these secondary metabolites was investigated in different species of the genus Monascus in batch-culture at the following cultivation conditions: T = 28 degrees C, agitation 220 rpm, and a medium, which induce citrinin production, containing ethanol as a carbon source. The screening was carried out with 16 fungal strains and the biosynthesis of citrinin and pigments was monitored quantitatively at the standard conditions mentioned above. Some kinetic parameters of the process have been determined. The values of the growth yield coefficient Y(X/C) were between 0.32 and 0.57. The amount of the extracellular red and orange pigments at the end of cultivation varied for the different strains between 0.09 and 1.33 OU/ mg dry weight, and 0.15 and 0.96 OU/mg dry weight, respectively. The amount of the total pigments measured was between 0.16 and 3.6 OU/mg dry weight, and between 0.21 and 3.39 OU/mg dry weight. The determined ratio 500 nm/400 nm, characterizing the pigment production, ranged between 0.60 and 1.06. Twelve of the investigated strains produced citrinin and pigments, two of them produced only pigments. Two strains were not able to produce neither pigments nor citrinin. Thus, the biosynthesis of citrinin appeared to be strain-specific and does not correlate with the pigments' biosynthesis by the fungal strains belonging to the genus Monascus. PMID:15787255

  19. Fungal biosynthesis of gold nanoparticles: mechanism and scale up

    PubMed Central

    Kitching, Michael; Ramani, Meghana; Marsili, Enrico

    2015-01-01

    Gold nanoparticles (AuNPs) are a widespread research tool because of their oxidation resistance, biocompatibility and stability. Chemical methods for AuNP synthesis often produce toxic residues that raise environmental concern. On the other hand, the biological synthesis of AuNPs in viable microorganisms and their cell-free extracts is an environmentally friendly and low-cost process. In general, fungi tolerate higher metal concentrations than bacteria and secrete abundant extracellular redox proteins to reduce soluble metal ions to their insoluble form and eventually to nanocrystals. Fungi harbour untapped biological diversity and may provide novel metal reductases for metal detoxification and bioreduction. A thorough understanding of the biosynthetic mechanism of AuNPs in fungi is needed to reduce the time of biosynthesis and to scale up the AuNP production process. In this review, we describe the known mechanisms for AuNP biosynthesis in viable fungi and fungal protein extracts and discuss the most suitable bioreactors for industrial AuNP biosynthesis. PMID:25154648

  20. Biosynthesis and Metabolic Fate of Phenylalanine in Conifers.

    PubMed

    Pascual, María B; El-Azaz, Jorge; de la Torre, Fernando N; Cañas, Rafael A; Avila, Concepción; Cánovas, Francisco M

    2016-01-01

    The amino acid phenylalanine (Phe) is a critical metabolic node that plays an essential role in the interconnection between primary and secondary metabolism in plants. Phe is used as a protein building block but it is also as a precursor for numerous plant compounds that are crucial for plant reproduction, growth, development, and defense against different types of stresses. The metabolism of Phe plays a central role in the channeling of carbon from photosynthesis to the biosynthesis of phenylpropanoids. The study of this metabolic pathway is particularly relevant in trees, which divert large amounts of carbon into the biosynthesis of Phe-derived compounds, particularly lignin, an important constituent of wood. The trunks of trees are metabolic sinks that consume a considerable percentage of carbon and energy from photosynthesis, and carbon is finally immobilized in wood. This paper reviews recent advances in the biosynthesis and metabolic utilization of Phe in conifer trees. Two alternative routes have been identified: the ancient phenylpyruvate pathway that is present in microorganisms, and the arogenate pathway that possibly evolved later during plant evolution. Additionally, an efficient nitrogen recycling mechanism is required to maintain sustained growth during xylem formation. The relevance of phenylalanine metabolic pathways in wood formation, the biotic interactions, and ultraviolet protection is discussed. The genetic manipulation and transcriptional regulation of the pathways are also outlined. PMID:27468292

  1. Evaluation of Biosynthetic Pathway and Engineered Biosynthesis of Alkaloids.

    PubMed

    Kishimoto, Shinji; Sato, Michio; Tsunematsu, Yuta; Watanabe, Kenji

    2016-01-01

    Varieties of alkaloids are known to be produced by various organisms, including bacteria, fungi and plants, as secondary metabolites that exhibit useful bioactivities. However, understanding of how those metabolites are biosynthesized still remains limited, because most of these compounds are isolated from plants and at a trace level of production. In this review, we focus on recent efforts in identifying the genes responsible for the biosynthesis of those nitrogen-containing natural products and elucidating the mechanisms involved in the biosynthetic processes. The alkaloids discussed in this review are ditryptophenaline (dimeric diketopiperazine alkaloid), saframycin (tetrahydroisoquinoline alkaloid), strictosidine (monoterpene indole alkaloid), ergotamine (ergot alkaloid) and opiates (benzylisoquinoline and morphinan alkaloid). This review also discusses the engineered biosynthesis of these compounds, primarily through heterologous reconstitution of target biosynthetic pathways in suitable hosts, such as Escherichia coli, Saccharomyces cerevisiae and Aspergillus nidulans. Those heterologous biosynthetic systems can be used to confirm the functions of the isolated genes, economically scale up the production of the alkaloids for commercial distributions and engineer the biosynthetic pathways to produce valuable analogs of the alkaloids. In particular, extensive involvement of oxidation reactions catalyzed by oxidoreductases, such as cytochrome P450s, during the secondary metabolite biosynthesis is discussed in details. PMID:27548127

  2. Peroxisomes contribute to biosynthesis of extracellular glycolipids in fungi.

    PubMed

    Freitag, Johannes; Ast, Julia; Linne, Uwe; Stehlik, Thorsten; Martorana, Domenica; Bölker, Michael; Sandrock, Björn

    2014-07-01

    Many microorganisms secrete surface-active glycolipids. The basidiomycetous fungus Ustilago maydis produces two different classes of glycolipids, mannosylerythritol lipids (MEL) and ustilagic acids (UAs). Here we report that biosynthesis of MELs is partially localized in peroxisomes and coupled to peroxisomal fatty acid degradation. The acyltransferases, Mac1 and Mac2, which acylate mannosylerythritol with fatty acids of different length, contain a type 1 peroxisomal targeting signal (PTS1). We demonstrate that Mac1 and Mac2 are targeted to peroxisomes, while other enzymes involved in MEL production reside in different compartments. Mis-targeting of Mac1 and Mac2 to the cytosol did not block MEL synthesis but promoted production of MEL species with altered acylation pattern. This is in contrast to peroxisome deficient mutants that produced MELs similar to the wild type. We could show that cytosolic targeting of Mac1 and Mac2 reduces the amount of UA presumably due to competition for overlapping substrates. Interestingly, hydroxylated fatty acids characteristic for UAs appear in MELs corroborating cross-talk between both biosynthesis pathways. Therefore, peroxisomal localization of MEL biosynthesis is not only prerequisite for generation of the natural spectrum of MELs, but also facilitates simultaneous assembly of different glycolipids in a single cell. PMID:24835306

  3. Reduction of PCN biosynthesis by NO in Pseudomonas aeruginosa.

    PubMed

    Gao, Lei; Zhang, Yuying; Wang, Yan; Qiao, Xinhua; Zi, Jing; Chen, Chang; Wan, Yi

    2016-08-01

    Pyocyanin (PCN), a virulence factor synthesized by Pseudomonas aeruginosa, plays an important role during clinical infections. There is no study of the effect of nitric oxide (NO) on PCN biosynthesis. Here, the effect of NO on PCN levels in Pseudomonas aeruginosa strain PAO1, a common reference strain, was tested. The results showed that the NO donor sodium nitroprusside (SNP) can significantly reduce PCN levels (82.5% reduction at 60μM SNP). Furthermore, the effect of endogenous NO on PCN was tested by constructing PAO1 nor (NO reductase gene) knockout mutants. Compared to the wild-type strain, the Δnor strain had a lower PCN (86% reduction in Δnor). To examine whether the results were universal with other P. aeruginosa strains, we collected 4 clinical strains from a hospital, tested their PCN levels after SNP treatment, and obtained similar results, i.e., PCN biosynthesis was inhibited by NO. These results suggest that NO treatment may be a new strategy to inhibit PCN biosynthesis and could provide novel insights into eliminating P. aeruginosa virulence as a clinical goal. PMID:26874276

  4. Genome-guided investigation of plant natural product biosynthesis.

    PubMed

    Kellner, Franziska; Kim, Jeongwoon; Clavijo, Bernardo J; Hamilton, John P; Childs, Kevin L; Vaillancourt, Brieanne; Cepela, Jason; Habermann, Marc; Steuernagel, Burkhard; Clissold, Leah; McLay, Kirsten; Buell, Carol Robin; O'Connor, Sarah E

    2015-05-01

    The medicinal plant Madagascar periwinkle, Catharanthus roseus (L.) G. Don, produces hundreds of biologically active monoterpene-derived indole alkaloid (MIA) metabolites and is the sole source of the potent, expensive anti-cancer compounds vinblastine and vincristine. Access to a genome sequence would enable insights into the biochemistry, control, and evolution of genes responsible for MIA biosynthesis. However, generation of a near-complete, scaffolded genome is prohibitive to small research communities due to the expense, time, and expertise required. In this study, we generated a genome assembly for C. roseus that provides a near-comprehensive representation of the genic space that revealed the genomic context of key points within the MIA biosynthetic pathway including physically clustered genes, tandem gene duplication, expression sub-functionalization, and putative neo-functionalization. The genome sequence also facilitated high resolution co-expression analyses that revealed three distinct clusters of co-expression within the components of the MIA pathway. Coordinated biosynthesis of precursors and intermediates throughout the pathway appear to be a feature of vinblastine/vincristine biosynthesis. The C. roseus genome also revealed localization of enzyme-rich genic regions and transporters near known biosynthetic enzymes, highlighting how even a draft genome sequence can empower the study of high-value specialized metabolites. PMID:25759247

  5. Disruption of Sphingolipid Biosynthesis Blocks Phagocytosis of Candida albicans.

    PubMed

    Tafesse, Fikadu G; Rashidfarrokhi, Ali; Schmidt, Florian I; Freinkman, Elizaveta; Dougan, Stephanie; Dougan, Michael; Esteban, Alexandre; Maruyama, Takeshi; Strijbis, Karin; Ploegh, Hidde L

    2015-10-01

    The ability of phagocytes to clear pathogens is an essential attribute of the innate immune response. The role of signaling lipid molecules such as phosphoinositides is well established, but the role of membrane sphingolipids in phagocytosis is largely unknown. Using a genetic approach and small molecule inhibitors, we show that phagocytosis of Candida albicans requires an intact sphingolipid biosynthetic pathway. Blockade of serine-palmitoyltransferase (SPT) and ceramide synthase-enzymes involved in sphingolipid biosynthesis- by myriocin and fumonisin B1, respectively, impaired phagocytosis by phagocytes. We used CRISPR/Cas9-mediated genome editing to generate Sptlc2-deficient DC2.4 dendritic cells, which lack serine palmitoyl transferase activity. Sptlc2-/- DC2.4 cells exhibited a stark defect in phagocytosis, were unable to bind fungal particles and failed to form a normal phagocytic cup to engulf C. albicans. Supplementing the growth media with GM1, the major ganglioside present at the cell surface, restored phagocytic activity of Sptlc2-/- DC2.4 cells. While overall membrane trafficking and endocytic pathways remained functional, Sptlc2-/- DC2.4 cells express reduced levels of the pattern recognition receptors Dectin-1 and TLR2 at the cell surface. Consistent with the in vitro data, compromised sphingolipid biosynthesis in mice sensitizes the animal to C. albicans infection. Sphingolipid biosynthesis is therefore critical for phagocytosis and in vivo clearance of C. albicans. PMID:26431038

  6. Genetic control of abscisic acid biosynthesis in maize.

    PubMed

    Tan, B C; Schwartz, S H; Zeevaart, J A; McCarty, D R

    1997-10-28

    Abscisic acid (ABA), an apocarotenoid synthesized from cleavage of carotenoids, regulates seed maturation and stress responses in plants. The viviparous seed mutants of maize identify genes involved in synthesis and perception of ABA. Two alleles of a new mutant, viviparous14 (vp14), were identified by transposon mutagenesis. Mutant embryos had normal sensitivity to ABA, and detached leaves of mutant seedlings showed markedly higher rates of water loss than those of wild type. The ABA content of developing mutant embryos was 70% lower than that of wild type, indicating a defect in ABA biosynthesis. vp14 embryos were not deficient in epoxy-carotenoids, and extracts of vp14 embryos efficiently converted the carotenoid cleavage product, xanthoxin, to ABA, suggesting a lesion in the cleavage reaction. vp14 was cloned by transposon tagging. The VP14 protein sequence is similar to bacterial lignostilbene dioxygenases (LSD). LSD catalyzes a double-bond cleavage reaction that is closely analogous to the carotenoid cleavage reaction of ABA biosynthesis. Southern blots indicated a family of four to six related genes in maize. The Vp14 mRNA is expressed in embryos and roots and is strongly induced in leaves by water stress. A family of Vp14-related genes evidently controls the first committed step of ABA biosynthesis. These genes are likely to play a key role in the developmental and environmental control of ABA synthesis in plants. PMID:9342392

  7. Two distinct pathways for essential metabolic precursors for isoprenoid biosynthesis.

    PubMed

    Kuzuyama, Tomohisa; Seto, Haruo

    2012-01-01

    Isoprenoids are a diverse group of molecules found in all organisms, where they perform such important biological functions as hormone signaling (e.g., steroids) in mammals, antioxidation (e.g., carotenoids) in plants, electron transport (e.g., ubiquinone), and cell wall biosynthesis intermediates in bacteria. All isoprenoids are synthesized by the consecutive condensation of the five-carbon monomer isopentenyl diphosphate (IPP) to its isomer, dimethylallyl diphosphate (DMAPP). The biosynthetic pathway for the formation of IPP from acetyl-CoA (i.e., the mevalonate pathway) had been established mainly in mice and the budding yeast Saccharomyces cerevisiae. Curiously, most prokaryotic microorganisms lack homologs of the genes in the mevalonate pathway, even though IPP and DMAPP are essential for isoprenoid biosynthesis in bacteria. This observation provided an impetus to search for an alternative pathway to synthesize IPP and DMAPP, ultimately leading to the discovery of the mevalonate-independent 2-C-methyl-D-erythritol 4-phosphate pathway. This review article focuses on our significant contributions to a comprehensive understanding of the biosynthesis of IPP and DMAPP. PMID:22450534

  8. Two distinct pathways for essential metabolic precursors for isoprenoid biosynthesis

    PubMed Central

    KUZUYAMA, Tomohisa; SETO, Haruo

    2012-01-01

    Isoprenoids are a diverse group of molecules found in all organisms, where they perform such important biological functions as hormone signaling (e.g., steroids) in mammals, antioxidation (e.g., carotenoids) in plants, electron transport (e.g., ubiquinone), and cell wall biosynthesis intermediates in bacteria. All isoprenoids are synthesized by the consecutive condensation of the five-carbon monomer isopentenyl diphosphate (IPP) to its isomer, dimethylallyl diphosphate (DMAPP). The biosynthetic pathway for the formation of IPP from acetyl-CoA (i.e., the mevalonate pathway) had been established mainly in mice and the budding yeast Saccharomyces cerevisiae. Curiously, most prokaryotic microorganisms lack homologs of the genes in the mevalonate pathway, even though IPP and DMAPP are essential for isoprenoid biosynthesis in bacteria. This observation provided an impetus to search for an alternative pathway to synthesize IPP and DMAPP, ultimately leading to the discovery of the mevalonate-independent 2-C-methyl-d-erythritol 4-phosphate pathway. This review article focuses on our significant contributions to a comprehensive understanding of the biosynthesis of IPP and DMAPP. PMID:22450534

  9. Plant-like biosynthesis of isoquinoline alkaloids in Aspergillus fumigatus.

    PubMed

    Baccile, Joshua A; Spraker, Joseph E; Le, Henry H; Brandenburger, Eileen; Gomez, Christian; Bok, Jin Woo; Macheleidt, Juliane; Brakhage, Axel A; Hoffmeister, Dirk; Keller, Nancy P; Schroeder, Frank C

    2016-06-01

    Natural product discovery efforts have focused primarily on microbial biosynthetic gene clusters (BGCs) containing large multimodular polyketide synthases and nonribosomal peptide synthetases; however, sequencing of fungal genomes has revealed a vast number of BGCs containing smaller NRPS-like genes of unknown biosynthetic function. Using comparative metabolomics, we show that a BGC in the human pathogen Aspergillus fumigatus named fsq, which contains an NRPS-like gene lacking a condensation domain, produces several new isoquinoline alkaloids known as the fumisoquins. These compounds derive from carbon-carbon bond formation between two amino acid-derived moieties followed by a sequence that is directly analogous to isoquinoline alkaloid biosynthesis in plants. Fumisoquin biosynthesis requires the N-methyltransferase FsqC and the FAD-dependent oxidase FsqB, which represent functional analogs of coclaurine N-methyltransferase and berberine bridge enzyme in plants. Our results show that BGCs containing incomplete NRPS modules may reveal new biosynthetic paradigms and suggest that plant-like isoquinoline biosynthesis occurs in diverse fungi. PMID:27065235

  10. Molecular Insights into the Biosynthesis of the F420 Coenzyme

    SciTech Connect

    Forouhar,F.; Abashidze, M.; Xu, H.; Grochowski, L.; Seetharaman, J.; Hussain, M.; Kuzin, A.; Chen, Y.; Zhou, W.; et al

    2008-01-01

    Coenzyme F420, a hydride carrier, is found in Archaea and some bacteria and has crucial roles in methanogenesis, antibiotic biosynthesis, DNA repair, and activation of antitubercular compounds. CofD, 2-phospho-l-lactate transferase, catalyzes the last step in the biosynthesis of F420-0 (F420 without polyglutamate), by transferring the lactyl phosphate moiety of lactyl(2)diphospho-(5')guanosine to 7,8-didemethyl-8-hydroxy-5-deazariboflavin ribitol (Fo). CofD is highly conserved among F420-producing organisms, and weak sequence homologs are also found in non-F420-producing organisms. This superfamily does not share any recognizable sequence conservation with other proteins. Here we report the first crystal structures of CofD, the free enzyme and two ternary complexes, with Fo and Pi or with Fo and GDP, from Methanosarcina mazei. The active site is located at the C-terminal end of a Rossmann fold core, and three large insertions make significant contributions to the active site and dimer formation. The observed binding modes of Fo and GDP can explain known biochemical properties of CofD and are also supported by our binding assays. The structures provide significant molecular insights into the biosynthesis of the F420 coenzyme. Large structural differences in the active site region of the non-F420-producing CofD homologs suggest that they catalyze a different biochemical reaction.

  11. High Divergence of the Precursor Peptides in Combinatorial Lanthipeptide Biosynthesis

    PubMed Central

    2015-01-01

    Lanthionine-containing peptides (lanthipeptides) are a rapidly growing family of polycyclic peptide natural products belonging to the large class of ribosomally synthesized and post-translationally modified peptides (RiPPs). These compounds are widely distributed in taxonomically distant species, and their biosynthetic systems and biological activities are diverse. A unique example of lanthipeptide biosynthesis is the prochlorosin synthetase ProcM from the marine cyanobacterium Prochlorococcus MIT9313, which transforms up to 29 different precursor peptides (ProcAs) into a library of lanthipeptides called prochlorosins (Pcns) with highly diverse sequences and ring topologies. Here, we show that many ProcM-like enzymes from a variety of bacteria have the capacity to carry out post-translational modifications on highly diverse precursor peptides, providing new examples of natural combinatorial biosynthesis. We also demonstrate that the leader peptides come from different evolutionary origins, suggesting that the combinatorial biosynthesis is tied to the enzyme and not a specific type of leader peptide. For some precursor peptides encoded in the genomes, the leader peptides apparently have been truncated at the N-termini, and we show that these N-terminally truncated peptides are still substrates of the enzymes. Consistent with this hypothesis, we demonstrate that about two-thirds of the ProcA N-terminal sequence is not essential for ProcM activity. Our results also highlight the potential of exploring this class of natural products by genome mining and bioengineering. PMID:25244001

  12. Bacterial cellulose biosynthesis: diversity of operons, subunits, products and functions

    PubMed Central

    Römling, Ute; Galperin, Michael Y.

    2015-01-01

    Summary Recent studies of bacterial cellulose biosynthesis, including structural characterization of a functional cellulose synthase complex, provided the first mechanistic insight into this fascinating process. In most studied bacteria, just two subunits, BcsA and BcsB, are necessary and sufficient for the formation of the polysaccharide chain in vitro. Other subunits – which differ among various taxa – affect the enzymatic activity and product yield in vivo by modulating expression of biosynthesis apparatus, export of the nascent β-D-glucan polymer to the cell surface, and the organization of cellulose fibers into a higher-order structure. These auxiliary subunits play key roles in determining the quantity and structure of the resulting biofilm, which is particularly important for interactions of bacteria with higher organisms that lead to rhizosphere colonization and modulate virulence of cellulose-producing bacterial pathogens inside and outside of host cells. Here we review the organization of four principal types of cellulose synthase operons found in various bacterial genomes, identify additional bcs genes that encode likely components of the cellulose biosynthesis and secretion machinery, and propose a unified nomenclature for these genes and subunits. We also discuss the role of cellulose as a key component of biofilms formed by a variety of free-living and pathogenic bacteria and, for the latter, in the choice between acute infection and persistence in the host. PMID:26077867

  13. Molecular insights on the biosynthesis of antitumour compounds by actinomycetes

    PubMed Central

    Olano, Carlos; Méndez, Carmen; Salas, José A.

    2011-01-01

    Summary Natural products are traditionally the main source of drug leads. In particular, many antitumour compounds are either natural products or derived from them. However, the search for novel antitumour drugs active against untreatable tumours, with fewer side‐effects or with enhanced therapeutic efficiency, is a priority goal in cancer chemotherapy. Microorganisms, particularly actinomycetes, are prolific producers of bioactive compounds, including antitumour drugs, produced as secondary metabolites. Structural genes involved in the biosynthesis of such compounds are normally clustered together with resistance and regulatory genes, which facilitates the isolation of the gene cluster. The characterization of these clusters has represented, during the last 25 years, a great source of genes for the generation of novel derivatives by using combinatorial biosynthesis approaches: gene inactivation, gene expression, heterologous expression of the clusters or mutasynthesis. In addition, these techniques have been also applied to improve the production yields of natural and novel antitumour compounds. In this review we focus on some representative antitumour compounds produced by actinomycetes covering the genetic approaches used to isolate and validate their biosynthesis gene clusters, which finally led to generating novel derivatives and to improving the production yields. PMID:21342461

  14. Essential oil biosynthesis and regulation in the genus Cymbopogon.

    PubMed

    Ganjewala, Deepak; Luthra, Rajesh

    2010-01-01

    Essential oils distilled from Cymbopogon species are of immense commercial value as flavors and fragrances in the perfumery, cosmetics, soaps, and detergents and in pharmaceutical industries. Two major constituents of the essential oil, geraniol and citral, due to their specific rose and lemon like aromas are widely used as flavors, fragrances and cosmetics. Citral is also used for the synthesis of vitamin A and ionones (for example, beta-ionone, methyl ionone). Moreover, Cymbopogon essential oils and constituents possess many useful biological activities including cytotoxic, anti-inflammatory and antioxidant. Despite the immense commercial and biological significance of the Cymbopogon essential oils, little is known about their biosynthesis and regulatory mechanisms. So far it is known that essential oils are biosynthesized via the classical acetate-MVA route and existence of a newly discovered MEP pathway in Cymbopogon remains as a topic for investigation. The aim of the present review is to discuss the biosynthesis and regulation of essential oils in the genus Cymbopogon with given emphasis to two elite members, lemongrass (C. flexuosus Nees ex Steud) and palmarosa (C. martinii Roxb.). This article highlights the work done so far towards understanding of essential oil biosynthesis and regulation in the genus Cymbopogon. Also, based on our experiences with Cymbopogon species, we would like to propose C. flexuosus as a model system for the study of essential oil metabolism beyond the much studied plant family Lamiaceae. PMID:20184044

  15. Biosynthesis and Metabolic Fate of Phenylalanine in Conifers

    PubMed Central

    Pascual, María B.; El-Azaz, Jorge; de la Torre, Fernando N.; Cañas, Rafael A.; Avila, Concepción; Cánovas, Francisco M.

    2016-01-01

    The amino acid phenylalanine (Phe) is a critical metabolic node that plays an essential role in the interconnection between primary and secondary metabolism in plants. Phe is used as a protein building block but it is also as a precursor for numerous plant compounds that are crucial for plant reproduction, growth, development, and defense against different types of stresses. The metabolism of Phe plays a central role in the channeling of carbon from photosynthesis to the biosynthesis of phenylpropanoids. The study of this metabolic pathway is particularly relevant in trees, which divert large amounts of carbon into the biosynthesis of Phe-derived compounds, particularly lignin, an important constituent of wood. The trunks of trees are metabolic sinks that consume a considerable percentage of carbon and energy from photosynthesis, and carbon is finally immobilized in wood. This paper reviews recent advances in the biosynthesis and metabolic utilization of Phe in conifer trees. Two alternative routes have been identified: the ancient phenylpyruvate pathway that is present in microorganisms, and the arogenate pathway that possibly evolved later during plant evolution. Additionally, an efficient nitrogen recycling mechanism is required to maintain sustained growth during xylem formation. The relevance of phenylalanine metabolic pathways in wood formation, the biotic interactions, and ultraviolet protection is discussed. The genetic manipulation and transcriptional regulation of the pathways are also outlined. PMID:27468292

  16. Reassessing the role of N-hydroxytryptamine in auxin biosynthesis.

    PubMed

    Tivendale, Nathan D; Davies, Noel W; Molesworth, Peter P; Davidson, Sandra E; Smith, Jason A; Lowe, Edwin K; Reid, James B; Ross, John J

    2010-12-01

    The tryptamine pathway is one of five proposed pathways for the biosynthesis of indole-3-acetic acid (IAA), the primary auxin in plants. The enzymes AtYUC1 (Arabidopsis thaliana), FZY (Solanum lycopersicum), and ZmYUC (Zea mays) are reported to catalyze the conversion of tryptamine to N-hydroxytryptamine, putatively a rate-limiting step of the tryptamine pathway for IAA biosynthesis. This conclusion was based on in vitro assays followed by mass spectrometry or HPLC analyses. However, there are major inconsistencies between the mass spectra reported for the reaction products. Here, we present mass spectral data for authentic N-hydroxytryptamine, 5-hydroxytryptamine (serotonin), and tryptamine to demonstrate that at least some of the published mass spectral data for the YUC in vitro product are not consistent with N-hydroxytryptamine. We also show that tryptamine is not metabolized to IAA in pea (Pisum sativum) seeds, even though a PsYUC-like gene is strongly expressed in these organs. Combining these findings, we propose that at present there is insufficient evidence to consider N-hydroxytryptamine an intermediate for IAA biosynthesis. PMID:20974893

  17. Deconvoluting heme biosynthesis to target blood-stage malaria parasites.

    PubMed

    Sigala, Paul A; Crowley, Jan R; Henderson, Jeffrey P; Goldberg, Daniel E

    2015-01-01

    Heme metabolism is central to blood-stage infection by the malaria parasite Plasmodium falciparum. Parasites retain a heme biosynthesis pathway but do not require its activity during infection of heme-rich erythrocytes, where they can scavenge host heme to meet metabolic needs. Nevertheless, heme biosynthesis in parasite-infected erythrocytes can be potently stimulated by exogenous 5-aminolevulinic acid (ALA), resulting in accumulation of the phototoxic intermediate protoporphyrin IX (PPIX). Here we use photodynamic imaging, mass spectrometry, parasite gene disruption, and chemical probes to reveal that vestigial host enzymes in the cytoplasm of Plasmodium-infected erythrocytes contribute to ALA-stimulated heme biosynthesis and that ALA uptake depends on parasite-established permeability pathways. We show that PPIX accumulation in infected erythrocytes can be harnessed for antimalarial chemotherapy using luminol-based chemiluminescence and combinatorial stimulation by low-dose artemisinin to photoactivate PPIX to produce cytotoxic reactive oxygen. This photodynamic strategy has the advantage of exploiting host enzymes refractory to resistance-conferring mutations. PMID:26173178

  18. Deconvoluting heme biosynthesis to target blood-stage malaria parasites

    PubMed Central

    Sigala, Paul A; Crowley, Jan R; Henderson, Jeffrey P; Goldberg, Daniel E

    2015-01-01

    Heme metabolism is central to blood-stage infection by the malaria parasite Plasmodium falciparum. Parasites retain a heme biosynthesis pathway but do not require its activity during infection of heme-rich erythrocytes, where they can scavenge host heme to meet metabolic needs. Nevertheless, heme biosynthesis in parasite-infected erythrocytes can be potently stimulated by exogenous 5-aminolevulinic acid (ALA), resulting in accumulation of the phototoxic intermediate protoporphyrin IX (PPIX). Here we use photodynamic imaging, mass spectrometry, parasite gene disruption, and chemical probes to reveal that vestigial host enzymes in the cytoplasm of Plasmodium-infected erythrocytes contribute to ALA-stimulated heme biosynthesis and that ALA uptake depends on parasite-established permeability pathways. We show that PPIX accumulation in infected erythrocytes can be harnessed for antimalarial chemotherapy using luminol-based chemiluminescence and combinatorial stimulation by low-dose artemisinin to photoactivate PPIX to produce cytotoxic reactive oxygen. This photodynamic strategy has the advantage of exploiting host enzymes refractory to resistance-conferring mutations. DOI: http://dx.doi.org/10.7554/eLife.09143.001 PMID:26173178

  19. Elucidation of an alternate isoleucine biosynthesis pathway in Geobacter sulfurreducens.

    PubMed

    Risso, Carla; Van Dien, Stephen J; Orloff, Amber; Lovley, Derek R; Coppi, Maddalena V

    2008-04-01

    The central metabolic model for Geobacter sulfurreducens included a single pathway for the biosynthesis of isoleucine that was analogous to that of Escherichia coli, in which the isoleucine precursor 2-oxobutanoate is generated from threonine. 13C labeling studies performed in G. sulfurreducens indicated that this pathway accounted for a minor fraction of isoleucine biosynthesis and that the majority of isoleucine was instead derived from acetyl-coenzyme A and pyruvate, possibly via the citramalate pathway. Genes encoding citramalate synthase (GSU1798), which catalyzes the first dedicated step in the citramalate pathway, and threonine ammonia-lyase (GSU0486), which catalyzes the conversion of threonine to 2-oxobutanoate, were identified and knocked out. Mutants lacking both of these enzymes were auxotrophs for isoleucine, whereas single mutants were capable of growth in the absence of isoleucine. Biochemical characterization of the single mutants revealed deficiencies in citramalate synthase and threonine ammonia-lyase activity. Thus, in G. sulfurreducens, 2-oxobutanoate can be synthesized either from citramalate or threonine, with the former being the main pathway for isoleucine biosynthesis. The citramalate synthase of G. sulfurreducens constitutes the first characterized member of a phylogenetically distinct clade of citramalate synthases, which contains representatives from a wide variety of microorganisms. PMID:18245290

  20. Histidine biosynthesis, its regulation and biotechnological application in Corynebacterium glutamicum

    PubMed Central

    Kulis-Horn, Robert K; Persicke, Marcus; Kalinowski, Jörn

    2014-01-01

    l-Histidine biosynthesis is an ancient metabolic pathway present in bacteria, archaea, lower eukaryotes, and plants. For decades l-histidine biosynthesis has been studied mainly in Escherichia coli and Salmonella typhimurium, revealing fundamental regulatory processes in bacteria. Furthermore, in the last 15 years this pathway has been also investigated intensively in the industrial amino acid-producing bacterium Corynebacterium glutamicum, revealing similarities to E. coli and S. typhimurium, as well as differences. This review summarizes the current knowledge of l-histidine biosynthesis in C. glutamicum. The genes involved and corresponding enzymes are described, in particular focusing on the imidazoleglycerol-phosphate synthase (HisFH) and the histidinol-phosphate phosphatase (HisN). The transcriptional organization of his genes in C. glutamicum is also reported, including the four histidine operons and their promoters. Knowledge of transcriptional regulation during stringent response and by histidine itself is summarized and a translational regulation mechanism is discussed, as well as clues about a histidine transport system. Finally, we discuss the potential of using this knowledge to create or improve C. glutamicum strains for the industrial l-histidine production. PMID:23617600

  1. Next Generation Sequencing in Predicting Gene Function in Podophyllotoxin Biosynthesis*

    PubMed Central

    Marques, Joaquim V.; Kim, Kye-Won; Lee, Choonseok; Costa, Michael A.; May, Gregory D.; Crow, John A.; Davin, Laurence B.; Lewis, Norman G.

    2013-01-01

    Podophyllum species are sources of (−)-podophyllotoxin, an aryltetralin lignan used for semi-synthesis of various powerful and extensively employed cancer-treating drugs. Its biosynthetic pathway, however, remains largely unknown, with the last unequivocally demonstrated intermediate being (−)-matairesinol. Herein, massively parallel sequencing of Podophyllum hexandrum and Podophyllum peltatum transcriptomes and subsequent bioinformatics analyses of the corresponding assemblies were carried out. Validation of the assembly process was first achieved through confirmation of assembled sequences with those of various genes previously established as involved in podophyllotoxin biosynthesis as well as other candidate biosynthetic pathway genes. This contribution describes characterization of two of the latter, namely the cytochrome P450s, CYP719A23 from P. hexandrum and CYP719A24 from P. peltatum. Both enzymes were capable of converting (−)-matairesinol into (−)-pluviatolide by catalyzing methylenedioxy bridge formation and did not act on other possible substrates tested. Interestingly, the enzymes described herein were highly similar to methylenedioxy bridge-forming enzymes from alkaloid biosynthesis, whereas candidates more similar to lignan biosynthetic enzymes were catalytically inactive with the substrates employed. This overall strategy has thus enabled facile further identification of enzymes putatively involved in (−)-podophyllotoxin biosynthesis and underscores the deductive power of next generation sequencing and bioinformatics to probe and deduce medicinal plant biosynthetic pathways. PMID:23161544

  2. Synergistic Actions of Tailoring Enzymes in Pradimicin Biosynthesis

    PubMed Central

    Napan, Kandy; Zhang, Shuwei; Morgan, Whitney; Anderson, Thomas; Takemoto, Jon Y.

    2014-01-01

    Three key tailoring enzymes PdmJ, PdmW and PdmN in pradimicin biosynthesis were investigated. PdmW was characterized as the C-6 hydroxylase by structural characterization of the corresponding product 6-hydroxy-G-2A. The efficiencies of the C-5 and C-6 hydroxylations catalyzed respectively by PdmJ and PdmW were low when they were expressed individually with the early biosynthetic enzymes that form G-2A. When these two cytochrome P450 enzymes were co-expressed, a dihydroxylated product 5,6-dihydroxy-G-2A was efficiently produced, indicating that these two enzymes work synergistically in pradimicin biosynthesis. Heterologously expressed PdmN in Streptomyces coelicolor CH999 converted G-2A to JX137a by ligating a unit of D-alanine to the carboxyl group. PdmN has relaxed substrate specificity toward both amino acid donors and acceptors. Through combinatorial biosynthesis, a series of new pradimicin analogues were produced. PMID:25155298

  3. Progesterone receptor membrane component-1 regulates hepcidin biosynthesis

    PubMed Central

    Li, Xiang; Rhee, David K.; Malhotra, Rajeev; Mayeur, Claire; Hurst, Liam A.; Ager, Emily; Shelton, Georgia; Kramer, Yael; McCulloh, David; Keefe, David; Bloch, Kenneth D.; Bloch, Donald B.; Peterson, Randall T.

    2015-01-01

    Iron homeostasis is tightly regulated by the membrane iron exporter ferroportin and its regulatory peptide hormone hepcidin. The hepcidin/ferroportin axis is considered a promising therapeutic target for the treatment of diseases of iron overload or deficiency. Here, we conducted a chemical screen in zebrafish to identify small molecules that decrease ferroportin protein levels. The chemical screen led to the identification of 3 steroid molecules, epitiostanol, progesterone, and mifepristone, which decrease ferroportin levels by increasing the biosynthesis of hepcidin. These hepcidin-inducing steroids (HISs) did not activate known hepcidin-inducing pathways, including the BMP and JAK/STAT3 pathways. Progesterone receptor membrane component-1 (PGRMC1) was required for HIS-dependent increases in hepcidin biosynthesis, as PGRMC1 depletion in cultured hepatoma cells and zebrafish blocked the ability of HISs to increase hepcidin mRNA levels. Neutralizing antibodies directed against PGRMC1 attenuated the ability of HISs to induce hepcidin gene expression. Inhibiting the kinases of the SRC family, which are downstream of PGRMC1, blocked the ability of HISs to increase hepcidin mRNA levels. Furthermore, HIS treatment increased hepcidin biosynthesis in mice and humans. Together, these data indicate that PGRMC1 regulates hepcidin gene expression through an evolutionarily conserved mechanism. These studies have identified drug candidates and potential therapeutic targets for the treatment of diseases of abnormal iron metabolism. PMID:26657863

  4. Bacterial cellulose biosynthesis: diversity of operons, subunits, products, and functions.

    PubMed

    Römling, Ute; Galperin, Michael Y

    2015-09-01

    Recent studies of bacterial cellulose biosynthesis, including structural characterization of a functional cellulose synthase complex, provided the first mechanistic insight into this fascinating process. In most studied bacteria, just two subunits, BcsA and BcsB, are necessary and sufficient for the formation of the polysaccharide chain in vitro. Other subunits - which differ among various taxa - affect the enzymatic activity and product yield in vivo by modulating (i) the expression of the biosynthesis apparatus, (ii) the export of the nascent β-D-glucan polymer to the cell surface, and (iii) the organization of cellulose fibers into a higher-order structure. These auxiliary subunits play key roles in determining the quantity and structure of resulting biofilms, which is particularly important for the interactions of bacteria with higher organisms - leading to rhizosphere colonization and modulating the virulence of cellulose-producing bacterial pathogens inside and outside of host cells. We review the organization of four principal types of cellulose synthase operon found in various bacterial genomes, identify additional bcs genes that encode components of the cellulose biosynthesis and secretion machinery, and propose a unified nomenclature for these genes and subunits. We also discuss the role of cellulose as a key component of biofilms and in the choice between acute infection and persistence in the host. PMID:26077867

  5. Progesterone receptor membrane component-1 regulates hepcidin biosynthesis.

    PubMed

    Li, Xiang; Rhee, David K; Malhotra, Rajeev; Mayeur, Claire; Hurst, Liam A; Ager, Emily; Shelton, Georgia; Kramer, Yael; McCulloh, David; Keefe, David; Bloch, Kenneth D; Bloch, Donald B; Peterson, Randall T

    2016-01-01

    Iron homeostasis is tightly regulated by the membrane iron exporter ferroportin and its regulatory peptide hormone hepcidin. The hepcidin/ferroportin axis is considered a promising therapeutic target for the treatment of diseases of iron overload or deficiency. Here, we conducted a chemical screen in zebrafish to identify small molecules that decrease ferroportin protein levels. The chemical screen led to the identification of 3 steroid molecules, epitiostanol, progesterone, and mifepristone, which decrease ferroportin levels by increasing the biosynthesis of hepcidin. These hepcidin-inducing steroids (HISs) did not activate known hepcidin-inducing pathways, including the BMP and JAK/STAT3 pathways. Progesterone receptor membrane component-1 (PGRMC1) was required for HIS-dependent increases in hepcidin biosynthesis, as PGRMC1 depletion in cultured hepatoma cells and zebrafish blocked the ability of HISs to increase hepcidin mRNA levels. Neutralizing antibodies directed against PGRMC1 attenuated the ability of HISs to induce hepcidin gene expression. Inhibiting the kinases of the SRC family, which are downstream of PGRMC1, blocked the ability of HISs to increase hepcidin mRNA levels. Furthermore, HIS treatment increased hepcidin biosynthesis in mice and humans. Together, these data indicate that PGRMC1 regulates hepcidin gene expression through an evolutionarily conserved mechanism. These studies have identified drug candidates and potential therapeutic targets for the treatment of diseases of abnormal iron metabolism. PMID:26657863

  6. Disruption of Sphingolipid Biosynthesis Blocks Phagocytosis of Candida albicans

    PubMed Central

    Schmidt, Florian I.; Freinkman, Elizaveta; Dougan, Stephanie; Dougan, Michael; Esteban, Alexandre; Maruyama, Takeshi; Strijbis, Karin; Ploegh, Hidde L.

    2015-01-01

    The ability of phagocytes to clear pathogens is an essential attribute of the innate immune response. The role of signaling lipid molecules such as phosphoinositides is well established, but the role of membrane sphingolipids in phagocytosis is largely unknown. Using a genetic approach and small molecule inhibitors, we show that phagocytosis of Candida albicans requires an intact sphingolipid biosynthetic pathway. Blockade of serine-palmitoyltransferase (SPT) and ceramide synthase-enzymes involved in sphingolipid biosynthesis- by myriocin and fumonisin B1, respectively, impaired phagocytosis by phagocytes. We used CRISPR/Cas9-mediated genome editing to generate Sptlc2-deficient DC2.4 dendritic cells, which lack serine palmitoyl transferase activity. Sptlc2-/- DC2.4 cells exhibited a stark defect in phagocytosis, were unable to bind fungal particles and failed to form a normal phagocytic cup to engulf C. albicans. Supplementing the growth media with GM1, the major ganglioside present at the cell surface, restored phagocytic activity of Sptlc2-/- DC2.4 cells. While overall membrane trafficking and endocytic pathways remained functional, Sptlc2-/- DC2.4 cells express reduced levels of the pattern recognition receptors Dectin-1 and TLR2 at the cell surface. Consistent with the in vitro data, compromised sphingolipid biosynthesis in mice sensitizes the animal to C. albicans infection. Sphingolipid biosynthesis is therefore critical for phagocytosis and in vivo clearance of C. albicans. PMID:26431038

  7. Metabolic engineering of cottonseed oil biosynthesis pathway via RNA interference.

    PubMed

    Xu, Zhongping; Li, Jingwen; Guo, Xiaoping; Jin, Shuangxia; Zhang, Xianlong

    2016-01-01

    Cottonseed oil is recognized as an important oil in food industry for its unique characters: low flavor reversion and the high level of antioxidants (VitaminE) as well as unsaturated fatty acid. However, the cottonseed oil content of cultivated cotton (Gossypium hirsutum) is only around 20%. In this study, we modified the accumulation of oils by the down-regulation of phosphoenolpyruvate carboxylase 1 (GhPEPC1) via RNA interference in transgenic cotton plants. The qRT-PCR and enzyme activity assay revealed that the transcription and expression of GhPEPC1 was dramatically down-regulated in transgenic lines. Consequently, the cottonseed oil content in several transgenic lines showed a significant (P < 0.01) increase (up to 16.7%) without obvious phenotypic changes under filed condition when compared to the control plants. In order to elucidate the molecular mechanism of GhPEPC1 in the regulation of seed oil content, we quantified the expression of the carbon metabolism related genes of transgenic GhPEPC1 RNAi lines by transcriptome analysis. This analysis revealed the decrease of GhPEPC1 expression led to the increase expression of triacylglycerol biosynthesis-related genes, which eventually contributed to the lipid biosynthesis in cotton. This result provides a valuable information for cottonseed oil biosynthesis pathway and shows the potential of creating high cottonseed oil germplasm by RNAi strategy for cotton breeding. PMID:27620452

  8. Phosphatidylcholine (PC) biosynthesis in pancreatic islets of Langerhans

    SciTech Connect

    Hoffman, J.M.; Laychock, S.G.

    1986-03-01

    Islets of Langerhans isolated from rat pancreata were incubated with (/sup 14/C)choline to determine the biosynthesis of PC by the CDP choline to determine the biosynthesis of PC by the CDPcholine pathway. Recovery of (/sup 14/C)PC in islet membranes was time-related, and stimulated by glucose (17mM) during 60 min. The rate of PC synthesis was constant during 60 min with glucose stimulation. In contrast, the sulfonylurea tolbutamide (2 mM) reduced the recovery of (/sup 14/C)choline in PC, and 8-bromo-cyclic AMP (5 mM) did not significantly affect (/sup 14/C)PC recovery. Incubation of islets in Ca/sup 2 +/-free medium enhanced glucose-stimulated recovery of (/sup 14/C)choline-labeled PC due to the inhibition of phospholipase and phospholipid hydrolysis. Inhibition of CTP:phosphocholine cytidylyltransferase with 5-deoxy-5'-isobutylthioadenosine (SIBA) reduced (/sup 14/C)PC levels and insulin release in a concentration dependent manner. Treatment with SIBA also reduced Mg/sup 2 +/-dependent Ca/sup 2 +/-ATPase activity in islet microsomes. Quantitation of membrane PC showed that glucose stimulation did not alter islet P levels. Thus, islet PC biosynthesis is linked to glucose stimulation and contributes to the maintenance of PC levels in membranes undergoing exocytosis and phospholipid hydrolysis. Adequate PC levels support Ca/sup 2 +/ pump activity and secretory mechanisms.

  9. Auxin Biosynthesis: Are the Indole-3-Acetic Acid and Phenylacetic Acid Biosynthesis Pathways Mirror Images?1[OPEN

    PubMed Central

    Nichols, David S.; Smith, Jason; Chourey, Prem S.; McAdam, Erin L.; Quittenden, Laura

    2016-01-01

    The biosynthesis of the main auxin in plants (indole-3-acetic acid [IAA]) has been elucidated recently and is thought to involve the sequential conversion of Trp to indole-3-pyruvic acid to IAA. However, the pathway leading to a less well studied auxin, phenylacetic acid (PAA), remains unclear. Here, we present evidence from metabolism experiments that PAA is synthesized from the amino acid Phe, via phenylpyruvate. In pea (Pisum sativum), the reverse reaction, phenylpyruvate to Phe, is also demonstrated. However, despite similarities between the pathways leading to IAA and PAA, evidence from mutants in pea and maize (Zea mays) indicate that IAA biosynthetic enzymes are not the main enzymes for PAA biosynthesis. Instead, we identified a putative aromatic aminotransferase (PsArAT) from pea that may function in the PAA synthesis pathway. PMID:27208245

  10. Molecular Cytogenetics in Digenean Parasites: Linked and Unlinked Major and 5S rDNAs, B Chromosomes and Karyotype Diversification.

    PubMed

    García-Souto, Daniel; Pasantes, Juan J

    2015-01-01

    Digenetic trematodes are the largest group of internal metazoan parasites, but their chromosomes are poorly studied. Although chromosome numbers and/or karyotypes are known for about 300 of the 18,000 described species, molecular cytogenetic knowledge is mostly limited to the mapping of telomeric sequences and/or of major rDNA clusters in 9 species. In this work we mapped major and 5S rDNA clusters and telomeric sequences in chromosomes of Bucephalus minimus, B. australis, Prosorhynchoides carvajali (Bucephaloidea), Monascus filiformis (Gymnophalloidea), Parorchis acanthus (Echinostomatoidea), Cryptocotyle lingua (Opisthorchioidea), Cercaria longicaudata, Monorchis parvus (Monorchioidea), Diphterostomum brusinae, and Bacciger bacciger (Microphalloidea). Whilst single major and minor rDNA clusters were mapped to different chromosome pairs in B. minimus and P. acanthus, overlapping signals were detected on a single chromosome pair in the remaining taxa. FISH experiments using major rDNA and telomeric probes clearly demonstrated the presence of highly stretched NORs in most of the digenean taxa analyzed. B chromosomes were detected in the B. bacciger samples hosted by Ruditapes decussatus. Although the cercariae specimens obtained from Donax trunculus, Tellina tenuis, and R. decussatus were in agreement with B. bacciger, their karyotypes showed striking morphological differences in agreement with the proposed assignation of these cercariae to different species of the genus Bacciger. Results are discussed in comparison with previous data on digenean chromosomes. PMID:26680763

  11. Radiation-modified structure of Ge25Sb15S60 and Ge35Sb5S60 glasses.

    PubMed

    Kavetskyy, T; Shpotyuk, O; Kaban, I; Hoyer, W

    2008-06-28

    Atomic structures of Ge(25)Sb(15)S(60) and Ge(35)Sb(5)S(60) glasses are investigated in the gamma-irradiated and annealed after gamma-irradiation states by means of high-energy synchrotron x-ray diffraction technique. The first sharp diffraction peak (FSDP) is detected at around 1.1 A(-1) in the structure factors of both alloys studied. The FSDP position is found to be stable for radiation/annealing treatment of the samples, while the FSDP intensity shows some changes between gamma-irradiated and annealed states. The peaks in the pair distribution functions observed between 2 and 4 A are related to the Ge-S, Ge-Sb, and Sb-Sb first neighbor correlations and Ge-Ge second neighbor correlations in the edge-shared GeS(42) tetrahedra, and S-S and/or Ge-Ge second neighbor correlations in the corner-shared GeS(42) tetrahedra. Three mechanisms of the radiation-/annealing-induced changes are discussed in the framework of coordination topological defect formation and bond-free solid angle concepts. PMID:18601355

  12. Involvement of multiple basic amino acids in yeast ribosomal protein L1 in 5S rRNA recognition.

    PubMed

    Yeh, L C; Lee, J C

    1995-01-01

    The role of basic amino acid residues located at the C-terminal region of the yeast ribosomal protein L1 in 5S rRNA binding was characterized in vitro and in vivo. Mutant proteins containing single or multiple amino acid substitutions were generated by site-directed mutagenesis of the L1 gene carried on a plasmid. In vitro RNP formation was examined by production of the mutant protein in the presence of the RNA molecule. The thermostability of the resultant RNP was also studied. Effects of these mutations on cell viability and ribosome assembly were characterized by transformation of a conditional null L1 yeast mutant with the mutated L1 gene expressed from the plasmid. Substitution of any one of the lysine or arginine residue did not affect significantly RNA binding in vitro or cell growth in vivo. However, several mutant proteins with substitutions of two of these basic amino acids bound RNA weakly and the RNPs were less stable. Cells expressing these mutant proteins were lethal. Theoretical structural prediction of these amino acids further provided information regarding their collective contributions to RNA recognition and to interaction between the RNP and other components of the 60S ribosomal subunit. PMID:8643400

  13. Facile Access to 5'-S-(4,4'-Dimethoxytrityl)-2',5'-Dideoxyribonucleosides via Stable Disulfide Intermediates.

    PubMed

    Reddy L, Chandra Shekhar; Sharma, Vivek K; Kumar, Rajesh; Singh, Ankita; Parmar, Virinder S; Sanghvi, Yogesh S; Prasad, Ashok K

    2015-01-01

    Thionucleosides represent an important class of modified nucleos(t)ides that have found distinct applications in the chemical biology of synthetic oligonucleotides, but the use of these compounds is substantially lessened by the instability or high reactivity of the sulfhydryl group. This unit describes a protocol for the synthesis of 2',5'-dideoxy-5'-thioribonucleoside disulfides by utilizing Mitsunobu reaction conditions on 3'-O-levulinyl-2'-deoxyribonucleosides in the presence of thiobenzoic acid followed by facile hydrolysis and in situ oxidation of the resulting 5'-thiolated nucleosides using methanolic ammonia. The utility of these disulfides has been demonstrated as stable precursors for the synthesis of 5'-thio-modified 2'-deoxynucleosides. To validate the potential of the methodology, 5'-S-(4,4'-dimethoxytrityl)-2',5'-dideoxythymidine phosphoramidite has been synthesized by in situ cleavage of the disulfide linkage of 2',5'-dideoxy-5'-thiothymidine disulfide followed by protection with a dimethoxytriphenyl (DMT) group and 3'-phosphitylation using 2-cyanoethyl N,N-diisopropylchlorophosphoramidite. PMID:26380902

  14. Effect of low temperature on highly unsaturated fatty acid biosynthesis in activated sludge.

    PubMed

    He, Su; Ding, Li-Li; Xu, Ke; Geng, Jin-Ju; Ren, Hong-Qiang

    2016-07-01

    Low temperature is a limiting factor for the microbial activity of activated sludge for sewage treatment plant in winter. Highly unsaturated fatty acid (UFA) biosynthesis, phospholipid fatty acid (PLFA) constituents and microbial structure in activated sludge at low temperature were investigated. Over 12 gigabases of metagenomic sequence data were generated with the Illumina HiSeq 2000 platform. The result showed 43.11% of phospholipid fatty acid (PLFA) in the activated sludge participated in UFA biosynthesis, and γ-Linolenic could be converted to Arachidonic acid at low temperature. The highly UFA biosynthesis in activated sludge was n-6 highly UFA biosynthesis, rather than n-3 highly UFA biosynthesis. The microbial community structures of activated sludge were analyzed by PLFA and high-throughput sequencing (HiSeq) simultaneously. Acidovorax, Pseudomonas, Flavobacterium and Polaromonas occupied higher percentage at 5°C, and genetic changes of highly UFA biosynthesis derived from microbial community structures change. PMID:27035483

  15. Reconstitution of biologically active 50S ribosomal subunits with artificial 5S RNA molecules carrying disturbances in the base pairing within the molecular stalk.

    PubMed Central

    Raué, H A; Lorenz, S; Erdmann, V A; Planta, R J

    1981-01-01

    Bacillus stearothermophilus 50S ribosomal subunits were reconstituted in vitro using artificial 5S RNA molecules constructed by combining parts of major and minor type (Raué et al. (1976) Europ. J. Biochem. 68, 169-176) B. licheniformis 5S RNA. The artificial 5S RNA molecules carry defined disturbances (A.C juxtapositions and extra G.U pairs) in the base pairing between the 5'- and 3'-terminal sequences of the molecule (the molecular stalk region). The biological activity of the reconstituted subunits was determined in an E. coli cell-free system programmed with poly-U. The results show that conservation of the base pairing within the molecular stalk is not required for biological activity of 5S RNA. Disturbances of the base pairing within this region do reduce the rate of reconstitution, however. Normal base pairing in the molecular stalk is thus required to ensure efficient ribosome assembly. PMID:6164987

  16. Karyotype divergence and spreading of 5S rDNA sequences between genomes of two species: darter and emerald gobies ( Ctenogobius , Gobiidae).

    PubMed

    Lima-Filho, P A; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Molina, W F

    2014-01-01

    Karyotype analyses of the cryptobenthic marine species Ctenogobius boleosoma and C. smaragdus were performed by means of classical and molecular cytogenetics, including physical mapping of the multigene 18S and 5S rDNA families. C. boleosoma has 2n = 44 chromosomes (2 submetacentrics + 42 acrocentrics; FN = 46) with a single chromosome pair each carrying 18S and 5S ribosomal sites; whereas C. smaragdus has 2n = 48 chromosomes (2 submetacentrics + 46 acrocentrics; FN = 50), also with a single pair bearing 18S rDNA, but an extensive increase in the number of GC-rich 5S rDNA sites in 21 chromosome pairs. The highly divergent karyotypes among Ctenogobius species contrast with observations in several other marine fish groups, demonstrating an accelerated rate of chromosomal evolution mediated by both chromosomal rearrangements and the extensive dispersion of 5S rDNA sequences in the genome. PMID:24643007

  17. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    PubMed

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment. PMID:22724546

  18. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

    PubMed Central

    Garcia, S; Kovařík, A

    2013-01-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S–5.8S–26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S–18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S–5.8S–26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants. PMID:23512008

  19. The Rare Codon AGA Is Involved in Regulation of Pyoluteorin Biosynthesis in Pseudomonas protegens Pf-5

    PubMed Central

    Yan, Qing; Philmus, Benjamin; Hesse, Cedar; Kohen, Max; Chang, Jeff H.; Loper, Joyce E.

    2016-01-01

    The soil bacterium Pseudomonas protegens Pf-5 can colonize root and seed surfaces of many plants, protecting them from infection by plant pathogenic fungi and oomycetes. The capacity to suppress disease is attributed to Pf-5's production of a large spectrum of antibiotics, which is controlled by complex regulatory circuits operating at the transcriptional and post-transcriptional levels. In this study, we analyzed the genomic sequence of Pf-5 for codon usage patterns and observed that the six rarest codons in the genome are present in all seven known antibiotic biosynthesis gene clusters. In particular, there is an abundance of rare codons in pltR, which encodes a member of the LysR transcriptional regulator family that controls the expression of pyoluteorin biosynthetic genes. To test the hypothesis that rare codons in pltR influence pyoluteorin production, we generated a derivative of Pf-5 in which 23 types of rare codons in pltR were substituted with synonymous preferred codons. The resultant mutant produced pyoluteorin at levels 15 times higher than that of the wild-type Pf-5. Accordingly, the promoter activity of the pyoluteorin biosynthetic gene pltL was 20 times higher in the codon-modified stain than in the wild-type. pltR has six AGA codons, which is the rarest codon in the Pf-5 genome. Substitution of all six AGA codons with preferred Arg codons resulted in a variant of pltR that conferred increased pyoluteorin production and pltL promoter activity. Furthermore, overexpression of tRNAUCUArg, the cognate tRNA for the AGA codon, significantly increased pyoluteorin production by Pf-5. A bias in codon usage has been linked to the regulation of many phenotypes in eukaryotes and prokaryotes but, to our knowledge, this is the first example of the role of a rare codon in the regulation of antibiotic production by a Gram-negative bacterium. PMID:27148187

  20. The Rare Codon AGA Is Involved in Regulation of Pyoluteorin Biosynthesis in Pseudomonas protegens Pf-5.

    PubMed

    Yan, Qing; Philmus, Benjamin; Hesse, Cedar; Kohen, Max; Chang, Jeff H; Loper, Joyce E

    2016-01-01

    The soil bacterium Pseudomonas protegens Pf-5 can colonize root and seed surfaces of many plants, protecting them from infection by plant pathogenic fungi and oomycetes. The capacity to suppress disease is attributed to Pf-5's production of a large spectrum of antibiotics, which is controlled by complex regulatory circuits operating at the transcriptional and post-transcriptional levels. In this study, we analyzed the genomic sequence of Pf-5 for codon usage patterns and observed that the six rarest codons in the genome are present in all seven known antibiotic biosynthesis gene clusters. In particular, there is an abundance of rare codons in pltR, which encodes a member of the LysR transcriptional regulator family that controls the expression of pyoluteorin biosynthetic genes. To test the hypothesis that rare codons in pltR influence pyoluteorin production, we generated a derivative of Pf-5 in which 23 types of rare codons in pltR were substituted with synonymous preferred codons. The resultant mutant produced pyoluteorin at levels 15 times higher than that of the wild-type Pf-5. Accordingly, the promoter activity of the pyoluteorin biosynthetic gene pltL was 20 times higher in the codon-modified stain than in the wild-type. pltR has six AGA codons, which is the rarest codon in the Pf-5 genome. Substitution of all six AGA codons with preferred Arg codons resulted in a variant of pltR that conferred increased pyoluteorin production and pltL promoter activity. Furthermore, overexpression of tRNA[Formula: see text], the cognate tRNA for the AGA codon, significantly increased pyoluteorin production by Pf-5. A bias in codon usage has been linked to the regulation of many phenotypes in eukaryotes and prokaryotes but, to our knowledge, this is the first example of the role of a rare codon in the regulation of antibiotic production by a Gram-negative bacterium. PMID:27148187

  1. Two cytochromes P450 catalyze S-heterocyclizations in cabbage phytoalexin biosynthesis.

    PubMed

    Klein, Andrew P; Sattely, Elizabeth S

    2015-11-01

    Phytoalexins are abundant in edible crucifers and have important biological activities, yet no dedicated gene for their biosynthesis is known. Here, we report two new cytochromes P450 from Brassica rapa (Chinese cabbage) that catalyze unprecedented S-heterocyclizations in cyclobrassinin and spirobrassinin biosynthesis. Our results provide genetic and biochemical insights into the biosynthesis of a prominent pair of dietary metabolites and have implications for pathway discovery across >20 recently sequenced crucifers. PMID:26389737

  2. Two cytochromes P450 catalyze S-heterocyclizations in cabbage phytoalexin biosynthesis

    PubMed Central

    Klein, Andrew P; Sattely, Elizabeth S

    2015-01-01

    Phytoalexins are abundant in edible crucifers and have important biological activities, yet no dedicated gene for their biosynthesis is known. Here, we report two new cytochromes P450 from Brassica rapa (Chinese cabbage) that catalyze unprecedented S-heterocyclizations in cyclobrassinin and spirobrassinin biosynthesis. Our results reveal the first genetic and biochemical insights into the biosynthesis of a prominent pair of dietary metabolites, and have implications for pathway discovery across >20 recently sequenced crucifers. PMID:26389737

  3. Chromosomal Locations of 5S and 45S rDNA in Gossypium Genus and Its Phylogenetic Implications Revealed by FISH

    PubMed Central

    Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo

    2013-01-01

    We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G. incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G. raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution. PMID:23826377

  4. Localization of 5S and 25S rRNA genes on somatic and meiotic chromosomes in Capsicum species of chili pepper.

    PubMed

    Kwon, Jin-Kyung; Kim, Byung-Dong

    2009-02-28

    The loci of the 5S and 45S rRNA genes were localized on chromosomes in five species of Capsicum, namely, annuum, chacoense, frutescens, baccatum, and chinense by FISH. The 5S rDNA was localized to the distal region of one chromosome in all species observed. The number of 45S rDNA loci varied among species; one in annuum, two in chacoense, frutescens, and chinense, and four in baccatum, with the exceptions that 'CM334' of annuum had three loci and 'tabasco' of frutescens had one locus. 'CM334'-derived BAC clones, 384B09 and 365P05, were screened with 5S rDNA as a probe, and BACs 278M03 and 262A23 were screened with 25S rDNA as a probe. Both ends of these BAC clones were sequenced. FISH with these BAC probes on pachytenes from 'CM334' plant showed one 5S rDNA locus and three 45S rDNA loci, consistent with the patterns on the somatic chromosomes. The 5S rDNA probe was also applied on extended DNA fibers to reveal that its coverage measured as long as 0.439 Mb in the pepper genome. FISH techniques applied on somatic and meiotic chromosomes and fibers have been established for chili to provide valuable information about the copy number variation of 45S rDNA and the actual physical size of the 5S rDNA in chili. PMID:19277503

  5. One-pot synthesis and visible light photocatalytic activity of monodispersed AgIn{sub 5}S{sub 8} microspheres

    SciTech Connect

    Li, Xiangqing; Wang, Lei; Wei, Dailong; Kang, Shizhao; Mu, Jin

    2013-02-15

    Graphical abstract: Display Omitted Highlights: ► Monodispersed AgIn{sub 5}S{sub 8} microspheres were prepared in a one-pot process. ► The process is environmental friendly. ► The AgIn{sub 5}S{sub 8} microspheres display high photocatalytic activity. -- Abstract: Monodispersed AgIn{sub 5}S{sub 8} microspheres were synthesized using a one-pot solution method and characterized with X-ray diffraction, UV–vis diffuse reflectance spectroscopy, scanning electron microscope, energy dispersive X-ray spectroscopy and N{sub 2} adsorption–desorption isotherm. The results indicated that the AgIn{sub 5}S{sub 8} microspheres were of cubic spinel structure and the mean diameter of about 0.5 μm. In addition, the visible light photocatalytic activity of AgIn{sub 5}S{sub 8} microspheres was also investigated at room temperature. The AgIn{sub 5}S{sub 8} microspheres showed very high photocatalytic activity for the degradation of methyl orange with a degradation efficiency of about 98% under visible light irradiation for 20 min.

  6. What does the 5S rRNA multigene family tell us about the origin of the annual Triticeae (Poaceae)?

    PubMed

    Baum, B R; Edwards, T; Johnson, D A

    2013-05-01

    We have investigated the complex relationships among the annual genera within the tribe Triticeae through phylogenetic analyses of the 5S rRNA multigene family. Cloned sequences were assigned to groups of orthologous sequences, called unit classes, that were subjected to several analyses including BLAST (Basic Local Alignment Search Tool) searches to assess possible ancestral relationships with perennial genera; phylogenetic analyses using parsimony (Pars), maximum likelihood (ML), and Bayesian methods; and minimum reticulation networks from the Pars, ML, and Bayesian trees. In this study, we included genera with both annual and perennial species, such as Dasypyrum, Hordeum, and Secale. BLAST pointed to Pseudoroegneria (carrier of the St genome) and possibly Thinopyrum (carrier of the J genome) as the potential next of kin. However, Thinopyrum and Pseudoroegneria have never fallen together on the individual trees with the former generally associated with Crithopsis, Aegilops, Triticum, and Dasypyrum, while the latter is usually associated with the rest of the genera within Triticeae. The "long" unit classes placed Dasypyrum breviaristatum together with Dasypyrum villosum, whereas the "short" unit classes put them far apart on the trees. None of the gene trees alone was able to summarize the complex relationships among the genera, in line with previous results in the Triticeae. However, the application of tools designed to display phylogenetic networks was able to depict the complex links among the genera based on the short and the long gene trees, including the close link between Thinopyrum and Pseudoroegneria suggested by the phylogenetic analyses. In addition, our analyses provide support for the hypothesis that at least some annual Triticeae taxa are derived from their perennial relatives. PMID:23789993

  7. Mutual co-regulation between GPI-N-acetylglucosaminyltransferase and ergosterol biosynthesis in Candida albicans.

    PubMed

    Victoria, Guiliana Soraya; Yadav, Bhawna; Hauhnar, Lalremruata; Jain, Priyanka; Bhatnagar, Shilpi; Komath, Sneha Sudha

    2012-05-01

    A novel co-regulation exists between the first step of GPI (glycosylphosphatidylinositol) anchor biosynthesis and the rate-determining step of ergosterol biosynthesis in Candida albicans. Depleting CaGpi19p, an accessory subunit of the enzyme complex that initiates GPI biosynthesis, down-regulates ERG11, altering ergosterol levels and drug response. This effect is specific to CaGpi19p depletion and is not due to cell wall defects or GPI deficiency. Additionally, down-regulation of ERG11 down-regulates CaGPI19 and GPI biosynthesis. PMID:22390164

  8. The HMG-CoA reductase inhibitor fluvastatin inhibits insect juvenile hormone biosynthesis.

    PubMed

    Debernard, S; Rossignol, F; Couillaud, F

    1994-07-01

    Fluvastatin (Sandoz Compound XU 62-320), a synthetic HMG-CoA reductase inhibitor, was assayed in vitro and in vivo for its ability to suppress juvenile hormone (JH) biosynthesis by corpora allata of Locusta migratoria migratorioides. Fluvastatin inhibited JH biosynthesis by corpora allata in vitro. Exogenous mevalonic acid lactone restored JH biosynthesis in corpora allata inhibited by fluvastatin. Fluvastatin injected into locusts in vivo inhibited JH biosynthesis, but maximal inhibition lasted for only 6 hr. There were no discernible effects on either JH-regulated metamorphosis or oocyte maturation. Lengthening of the fourth larval stadium was observed and increased doses (single or repeated injections) were fatal. PMID:7926659

  9. Two androsterone derivatives as inhibitors of androgen biosynthesis.

    PubMed

    Djigoue, Guy-Bertrand; Simard, Michel; Kenmogne, Lucie-Carolle; Poirier, Donald

    2012-06-01

    The title compounds, (3R,5S,5'R,8R,9S,10S,13S,14S)-10,13-dimethyl-5'-(2-methylpropyl)tetradecahydro-6'H-spiro[cyclopenta[a]phenanthrene-3,2'-[1,4]oxazinane]-6',17(2H)-dione, C(26)H(41)NO(3), (I), and methyl (2R)-2-[(3R,5S,8R,9S,10S,13S,14S)-10,13-dimethyl-2',17-dioxohexadecahydro-3'H-spiro[cyclopenta[a]phenanthrene-3,5'-[1,3]oxazolidin-3'-yl

  10. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).

    PubMed

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M

    2011-08-01

    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant. PMID:21364693

  11. Implementation of 5S management method for lean healthcare at a health center in Senegal: a qualitative study of staff perception

    PubMed Central

    Kanamori, Shogo; Sow, Seydou; Castro, Marcia C.; Matsuno, Rui; Tsuru, Akiko; Jimba, Masamine

    2015-01-01

    Background 5S is a lean method for workplace organization; it is an abbreviation representing five Japanese words that can be translated as sort, set in order, shine, standardize, and sustain. The 5S management method has been recognized recently as a potential solution for improving the quality of government healthcare services in low- and middle-income countries. Objective To assess how the 5S management method creates changes in the workplace and in the process and outcomes of healthcare services, and how it can be applicable in a resource-poor setting, based on data from a pilot intervention of the 5S program implemented in a health facility in Senegal. Design In this qualitative study, we interviewed 21 health center staff members 1 year after the pilot intervention. We asked them about their views on the changes brought on by the 5S program in their workplace, daily routines, and services provided. We then transcribed interview records and organized the narrative information by emerging themes using thematic analysis in the coding process. Results Study participants indicated that, despite resource constraints and other demotivating factors present at the health center, the 5S program created changes in the work environment, including fewer unwanted items, improved orderliness, and improved labeling and directional indicators of service units. These efforts engendered changes in the quality of services (e.g. making services more efficient, patient-centered, and safe), and in the attitude and behavior of staff and patients. Conclusions The pilot intervention of the 5S management method was perceived to have improved the quality of healthcare services and staff motivation in a resource-poor healthcare facility with a disorderly work environment in Senegal. Quantitative and qualitative research based on a larger-scale intervention would be needed to elaborate and validate these findings and to identify the cost-effectiveness of such intervention in low- and

  12. Genetic Dissection of Pyrimidine Biosynthesis and Salvage in Leishmania donovani*

    PubMed Central

    Wilson, Zachary N.; Gilroy, Caslin A.; Boitz, Jan M.; Ullman, Buddy; Yates, Phillip A.

    2012-01-01

    Protozoan parasites of the Leishmania genus express the metabolic machinery to synthesize pyrimidine nucleotides via both de novo and salvage pathways. To evaluate the relative contributions of pyrimidine biosynthesis and salvage to pyrimidine homeostasis in both life cycle stages of Leishmania donovani, individual mutant lines deficient in either carbamoyl phosphate synthetase (CPS), the first enzyme in pyrimidine biosynthesis, uracil phosphoribosyltransferase (UPRT), a salvage enzyme, or both CPS and UPRT were constructed. The Δcps lesion conferred pyrimidine auxotrophy and a growth requirement for medium supplementation with one of a plethora of pyrimidine nucleosides or nucleobases, although only dihydroorotate or orotate could circumvent the pyrimidine auxotrophy of the Δcps/Δuprt double knockout. The Δuprt null mutant was prototrophic for pyrimidines but could not salvage uracil or any pyrimidine nucleoside. The capability of the Δcps parasites to infect mice was somewhat diminished but still robust, indicating active pyrimidine salvage by the amastigote form of the parasite, but the Δcps/Δuprt mutant was completely attenuated with no persistent parasites detected after a 4-week infection. Complementation of the Δcps/Δuprt clone with either CPS or UPRT restored infectivity. These data establish that an intact pyrimidine biosynthesis pathway is essential for the growth of the promastigote form of L. donovani in culture, that all uracil and pyrimidine nucleoside salvage in the parasite is mediated by UPRT, and that both the biosynthetic and salvage pathways contribute to a robust infection of the mammalian host by the amastigote. These findings impact potential therapeutic design and vaccine strategies for visceral leishmaniasis. PMID:22367196

  13. Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis

    PubMed Central

    Pisithkul, Tippapha; Jacobson, Tyler B.; O'Brien, Thomas J.; Stevenson, David M.

    2015-01-01

    An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using 13C-labeled sugars and [15N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. PMID:26070680

  14. Terpenoid biosynthesis in Euphorbia lathyris and Copaifera spp

    SciTech Connect

    Skrukrud, C.L.

    1987-07-01

    Biosynthesis of triterpenoids by isolated latex of Euphorbia lathyris was investigated. The rate of in vitro incorporation of mevalonic acid into triterpenoids was thirty times greater than acetate incorporation indicating that the rate-limiting step in the pathway occurs prior to mevalonate. Both HMG-CoA reductase (EC 1.1.1.34) and HMG-CoA lyase (EC 4.1.3.4) activities were detected in isolated latex. HMG-CoA reductase was localized to a membrane-bound fraction of a 5000g pellet of latex. The rate of conversion of HMG-CoA to mevalonate by this enzyme is comparable to the overall rate of acetate incorporation into the triterpenoids suggesting that this enzyme is rate-determining in the biosynthesis of triterpenoids in E. lathyris latex. HMG-CoA reductase of E. lathyris vegetative tissue was localized to the membrane-bound portion of a particulate fraction (18,000g), and was solubilized by treatment with 2% polyoxyethylene ether W-1. Differences in the optimal pH for activity of HMG-CoA reductase from the latex and vegetative tissue suggest that isozymes of the enzyme may be present in the two tissue types. Studies of the incorporation of various precursors into leaf discs and cuttings taken from Copaifera spp. show differences in the rate of incorporation into Copaifera sesquiterpenes suggesting that the site of sesquiterpene biosynthesis may differ in its accessibility to the different substrates and/or reflecting the metabolic controls on carbon allocation to the terpenes. Mevalonate incorporation by Copaifera langsdorfii cuttings into sesquiterpenes was a hundred-fold greater than either acetate or glucose incorporation, however, its incorporation into squalene and triterpenoids was also a hundred-fold greater than the incorporation into sesquiterpenes. 119 refs., 58 figs., 16 tabs.

  15. Monomethylarsonous acid inhibited endogenous cholesterol biosynthesis in human skin fibroblasts.

    PubMed

    Guo, Lei; Xiao, Yongsheng; Wang, Yinsheng

    2014-05-15

    Human exposure to arsenic in drinking water is a widespread public health concern, and such exposure is known to be associated with many human diseases. The detailed molecular mechanisms about how arsenic species contribute to the adverse human health effects, however, remain incompletely understood. Monomethylarsonous acid [MMA(III)] is a highly toxic and stable metabolite of inorganic arsenic. To exploit the mechanisms through which MMA(III) exerts its cytotoxic effect, we adopted a quantitative proteomic approach, by coupling stable isotope labeling by amino acids in cell culture (SILAC) with LC-MS/MS analysis, to examine the variation in the entire proteome of GM00637 human skin fibroblasts following acute MMA(III) exposure. Among the ~6500 unique proteins quantified, ~300 displayed significant changes in expression after exposure with 2 μM MMA(III) for 24 h. Subsequent analysis revealed the perturbation of de novo cholesterol biosynthesis, selenoprotein synthesis and Nrf2 pathways evoked by MMA(III) exposure. Particularly, MMA(III) treatment resulted in considerable down-regulation of several enzymes involved in cholesterol biosynthesis. In addition, real-time PCR analysis showed reduced mRNA levels of select genes in this pathway. Furthermore, MMA(III) exposure contributed to a distinct decline in cellular cholesterol content and significant growth inhibition of multiple cell lines, both of which could be restored by supplementation of cholesterol to the culture media. Collectively, the present study demonstrated that the cytotoxicity of MMA(III) may arise, at least in part, from the down-regulation of cholesterol biosynthesis enzymes and the resultant decrease of cellular cholesterol content. PMID:24625837

  16. Bacterial Genome Mining of Enzymatic Tools for Alkyne Biosynthesis.

    PubMed

    Zhu, Xuejun; Su, Michael; Manickam, Kadhirvel; Zhang, Wenjun

    2015-12-18

    The alkyne is an important functionality widely used in material science, pharmaceutical science, and chemical biology, but the importance of this functionality is contrasted by the very limited number of enzymes known to be involved in alkyne biosynthesis. We recently reported the first known carrier protein-dependent pathway for terminal alkyne formation, and in silico analysis suggested that this mechanism could be widespread in bacteria. In this paper, we screened additional homologous gene cassettes presumed to be involved in alkyne biosynthesis using both in vitro biochemical study and an E. coli-polyketide synthase (PKS) reporting system for in vivo analysis. We discovered and characterized a new terminal alkyne biosynthetic pathway comprised of TtuA, -B, and -C from Teredinibacter turnerae T7901. While the acyl-CoA ligase homologue (TtuA) demonstrated promiscuity in the activation and loading of medium-chain fatty acids onto the carrier protein (TtuC), the desaturase homologue (TtuB) showed stringent substrate specificity toward C10 fatty acyl moieties. In addition, TtuB was demonstrated to be a bifunctional desaturase/acetylenase that efficiently catalyzed two sequential O2-dependent dehydrogenation reactions. A novel terminal-alkyne bearing polyketide was further produced upon coexpression of ttuABC and a PKS gene in E. coli. The discovery and characterization of TtuA, -B, and -C provides us with a new bifunctional desaturase/acetylenase for mechanistic and structural study and expands the scarce enzyme inventory for the biosynthesis of the alkyne functionality, which has important applications in synthetic and chemical biology. PMID:26441143

  17. Bacterial genome mining of enzymatic tools for alkyne biosynthesis

    PubMed Central

    Zhu, Xuejun; Su, Michael; Manickam, Kadhirvel; Zhang, Wenjun

    2015-01-01

    The alkyne is an important functionality widely used in material science, pharmaceutical science, and chemical biology, but the importance of this functionality is contrasted by the very limited number of enzymes known to be involved in alkyne biosynthesis. We recently reported the first known carrier protein-dependent pathway for terminal alkyne formation, and in silico analysis suggested that this mechanism could be widespread in bacteria. In this paper, we screened additional homologous gene cassettes presumed to be involved in alkyne biosynthesis using both in vitro biochemical study and an E. coli-polyketide synthase (PKS) reporting system for in vivo analysis. We discovered and characterized a new terminal alkyne biosynthetic pathway comprised of TtuA, B, and C from Teredinibacter turnerae T7901. While the acyl-CoA ligase homolog (TtuA) demonstrated promiscuity in the activation and loading of medium-chain fatty acids onto the carrier protein (TtuC), the desaturase homolog (TtuB) showed stringent substrate specificity towards C10 fatty acyl moieties. In addition, TtuB was demonstrated to be a bifunctional desaturase/acetylenase that efficiently catalyzed two sequential O2-dependent dehydrogenation reactions. A novel terminal-alkyne bearing polyketide was further produced upon co-expression of ttuABC and a PKS gene in E. coli. The discovery and characterization of TtuA, B, and C provides us with a new bifunctional desaturase/acetylenase for mechanistic and structural study and expands the scarce enzyme inventory for the biosynthesis of the alkyne functionality, which has important applications in synthetic and chemical biology. PMID:26441143

  18. Molecular Regulation of β-Lactam Biosynthesis in Filamentous Fungi

    PubMed Central

    Brakhage, Axel A.

    1998-01-01

    The most commonly used β-lactam antibiotics for the therapy of infectious diseases are penicillin and cephalosporin. Penicillin is produced as an end product by some fungi, most notably by Aspergillus (Emericella) nidulans and Penicillium chrysogenum. Cephalosporins are synthesized by both bacteria and fungi, e.g., by the fungus Acremonium chrysogenum (Cephalosporium acremonium). The biosynthetic pathways leading to both secondary metabolites start from the same three amino acid precursors and have the first two enzymatic reactions in common. Penicillin biosynthesis is catalyzed by three enzymes encoded by acvA (pcbAB), ipnA (pcbC), and aatA (penDE). The genes are organized into a cluster. In A. chrysogenum, in addition to acvA and ipnA, a second cluster contains the genes encoding enzymes that catalyze the reactions of the later steps of the cephalosporin pathway (cefEF and cefG). Within the last few years, several studies have indicated that the fungal β-lactam biosynthesis genes are controlled by a complex regulatory network, e.g., by the ambient pH, carbon source, and amino acids. A comparison with the regulatory mechanisms (regulatory proteins and DNA elements) involved in the regulation of genes of primary metabolism in lower eukaryotes is thus of great interest. This has already led to the elucidation of new regulatory mechanisms. Furthermore, such investigations have contributed to the elucidation of signals leading to the production of β-lactams and their physiological meaning for the producing fungi, and they can be expected to have a major impact on rational strain improvement programs. The knowledge of biosynthesis genes has already been used to produce new compounds. PMID:9729600

  19. Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis.

    PubMed

    Pisithkul, Tippapha; Jacobson, Tyler B; O'Brien, Thomas J; Stevenson, David M; Amador-Noguez, Daniel

    2015-09-01

    An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using (13)C-labeled sugars and [(15)N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. PMID:26070680

  20. Antioxidant Compounds from Vegetable Matrices: Biosynthesis, Occurrence, and Extraction Systems.

    PubMed

    Baiano, Antonietta; Del Nobile, Matteo Alessandro

    2016-09-01

    Natural antioxidants such as vitamin C, tocopherols and tocotrienols, carotenoids, and phenolic compounds are largely distributed in plant products. Most of them are not synthesized by human and need to be introduced with diet according to the Recommended Daily Intake (RDI). This work was aimed to give a comprehensive overview on the occurrence of these antioxidants in plants, in particular in plant foods, on the mechanisms of biosynthesis, and on conventional (liquid-liquid or solid-liquid extraction, Soxhlet) and innovative (enzymatic-assisted, pressurized fluid, supercritical fluid, ultrasound-assisted, microwave-assisted, pulsed electric field) extraction systems. PMID:25751787

  1. Biosynthesis and regulation of terpenoid indole alkaloids in Catharanthus roseus

    PubMed Central

    Zhu, Jianhua; Wang, Mingxuan; Wen, Wei; Yu, Rongmin

    2015-01-01

    Catharanthus roseus produces a wide range of terpenoid indole alkaloids (TIA). Many of them, such as vinblastine and vincristine, have significant bioactivity. They are valuable chemotherapy drugs used in combination with other drugs to treat lymphoma and leukemia. The TIA biosynthetic pathway has been investigated for many years, for scientific interest and for their potential in manufacturing applications, to fulfill the market demand. In this review, the progress and perspective of C. roseus TIA biosynthesis and its regulating enzymes are described. In addition, the culture condition, hormones, signaling molecules, precursor feeding on the accumulation of TIA, and gene expression are also evaluated and discussed. PMID:26009689

  2. Biosynthesis and regulation of terpenoid indole alkaloids in Catharanthus roseus.

    PubMed

    Zhu, Jianhua; Wang, Mingxuan; Wen, Wei; Yu, Rongmin

    2015-01-01

    Catharanthus roseus produces a wide range of terpenoid indole alkaloids (TIA). Many of them, such as vinblastine and vincristine, have significant bioactivity. They are valuable chemotherapy drugs used in combination with other drugs to treat lymphoma and leukemia. The TIA biosynthetic pathway has been investigated for many years, for scientific interest and for their potential in manufacturing applications, to fulfill the market demand. In this review, the progress and perspective of C. roseus TIA biosynthesis and its regulating enzymes are described. In addition, the culture condition, hormones, signaling molecules, precursor feeding on the accumulation of TIA, and gene expression are also evaluated and discussed. PMID:26009689

  3. Regulation of collagen biosynthesis by ascorbic acid: a review.

    PubMed Central

    Pinnell, S. R.

    1985-01-01

    L-ascorbic acid is an essential cofactor for lysyl hydroxylase and prolyl hydroxylase, enzymes essential for collagen biosynthesis. In addition, L-ascorbic acid preferentially stimulates collagen synthesis in a manner which appears unrelated to the effect of L-ascorbic acid on hydroxylation reactions. This reaction is stereospecific and unrelated to intracellular degradation of collagen. The effect apparently occurs at a transcriptional or translational level, since L-ascorbic acid preferentially stimulates collagen-specific mRNA. In addition, it stimulates lysyl hydroxylase activity but inhibits prolyl hydroxylase activity in human skin fibroblasts in culture. PMID:3008449

  4. Natural and engineered biosynthesis of nucleoside antibiotics in Actinomycetes.

    PubMed

    Chen, Wenqing; Qi, Jianzhao; Wu, Pan; Wan, Dan; Liu, Jin; Feng, Xuan; Deng, Zixin

    2016-03-01

    Nucleoside antibiotics constitute an important family of microbial natural products bearing diverse bioactivities and unusual structural features. Their biosynthetic logics are unique with involvement of complex multi-enzymatic reactions leading to the intricate molecules from simple building blocks. Understanding how nature builds this family of antibiotics in post-genomic era sets the stage for rational enhancement of their production, and also paves the way for targeted persuasion of the cell factories to make artificial designer nucleoside drugs and leads via synthetic biology approaches. In this review, we discuss the recent progress and perspectives on the natural and engineered biosynthesis of nucleoside antibiotics. PMID:26153500

  5. Experimental and Theoretical Studies on Corvol Ether Biosynthesis.

    PubMed

    Rabe, Patrick; Janusko, Aron; Goldfuss, Bernd; Dickschat, Jeroen S

    2016-01-01

    The biosynthesis of corvol ethers A and B, two sesquiterpenes from Kitasatospora setae, proceeds with involvement of either one 1,3- or two sequential 1,2-hydride shifts. Quantum chemical calculations revealed that the sequence of two 1,2-hydride shifts is energetically favoured. Labelling experiments were in agreement with this finding. In addition, the stereochemical course of a reprotonation step was investigated by incubation of (13)C-labelled isotopomers of farnesyl diphosphate in water and in deuterium oxide. PMID:26635093

  6. “Teichoic acid biosynthesis as an antibiotic target”

    PubMed Central

    Pasquina, Lincoln W; Santa Maria, John P; Walker, Suzanne

    2013-01-01

    The relentless spread of antibiotic resistant pathogens makes it imperative to develop new chemotherapeutic strategies to overcome infection. The bacterial cell wall has served as a rich source for both validated and unexploited pathways that are essential for virulence and survival. Lipoteichoic acids (LTAs) and wall teichoic acids (WTAs) are cell wall polymers that play fundamental roles in Gram-positive bacterial physiology and pathogenesis, and both have been proposed as novel antibacterial targets. Here we describe recent progress toward the discovery of teichoic acid biosynthesis inhibitors and their potential as antibiotics to combat Staphylococcus aureus infections. PMID:23916223

  7. Plant science. Biosynthesis, regulation, and domestication of bitterness in cucumber.

    PubMed

    Shang, Yi; Ma, Yongshuo; Zhou, Yuan; Zhang, Huimin; Duan, Lixin; Chen, Huiming; Zeng, Jianguo; Zhou, Qian; Wang, Shenhao; Gu, Wenjia; Liu, Min; Ren, Jinwei; Gu, Xingfang; Zhang, Shengping; Wang, Ye; Yasukawa, Ken; Bouwmeester, Harro J; Qi, Xiaoquan; Zhang, Zhonghua; Lucas, William J; Huang, Sanwen

    2014-11-28

    Cucurbitacins are triterpenoids that confer a bitter taste in cucurbits such as cucumber, melon, watermelon, squash, and pumpkin. These compounds discourage most pests on the plant and have also been shown to have antitumor properties. With genomics and biochemistry, we identified nine cucumber genes in the pathway for biosynthesis of cucurbitacin C and elucidated four catalytic steps. We discovered transcription factors Bl (Bitter leaf) and Bt (Bitter fruit) that regulate this pathway in leaves and fruits, respectively. Traces in genomic signatures indicated that selection imposed on Bt during domestication led to derivation of nonbitter cucurbits from their bitter ancestors. PMID:25430763

  8. Biosynthesis of brominated tyrosine metabolites by Aplysina fistularis.

    PubMed

    Carney, J R; Rinehart, K L

    1995-07-01

    The biosynthesis of brominated tyrosine metabolites by the marine sponge Aplysina fistularis was investigated. [U-14C]-L-Tyrosine, [U-14C]-L-3-bromotyrosine, and [U-14C]-L-3,5-dibromotyrosine were incorporated into both dibromoverongiaquinol [1] and aeroplysinin-1 [2], and [methyl-14C]methionine was specifically incorporated into the O-methyl group group of 2. [Methyl-14C]-L-O-methyltyrosine, [methyl-14C]-L-3,5-dibromo-O-methyltyrosine, and several putative nitrile precursors were not incorporated into 1 or 2. PMID:7561906

  9. [Biosynthesis, fermentation and application of vitamin B12--a review].

    PubMed

    Ma, Hui; Wang, Lili; Zhang, Chunxiao; Yi, Hong

    2008-06-01

    Vitamin B12 is an important nutrient widely used in feed, food and medicine field. China is the primary producing area and the VB12 production is 27 t in 2007, 77% of total production in the world. VB12 is the most complex small molecule difficult to chemosynthesize. It ismanufactured by bacteria and archaea via two alternative routes, aerobic or anaerobic pathway. The main strains used in industry fermentation are Propionibacterium freudenrechii and Pseudomonas denitrificans. The basic characteristics, biosynthesis and fermentation of vitamin B12 are reviewed. The vitamin B12 application and market are also summarized. PMID:18807971

  10. Lipid-based transfection reagents can interfere with cholesterol biosynthesis.

    PubMed

    Danielli, Mauro; Marinelli, Raúl A

    2016-02-15

    Lipid-based transfection reagents are widely used for delivery of small interfering RNA into cells. We examined whether the commonly used commercial transfection reagents DharmaFECT-4 and Lipofectamine 2000 can interfere with lipid metabolism by studying cholesterogenesis. Cholesterol de novo synthesis from [(14)C]acetate was assessed in human hepatocyte-derived Huh-7 cells. The results revealed that DharmaFECT, but not Lipofectamine, markedly inhibited cholesterol biosynthesis by approximately 70%. Cell viability was not significantly altered. These findings suggest that caution is required in the choice of certain lipid-based transfection reagents for gene silencing experiments, particularly when assessing cholesterol metabolism. PMID:26656923

  11. Photochlorophyll Biosynthesis in Cucumber (Cucumis sativus, L.) Cotyledons 1

    PubMed Central

    Rebeiz, Constantin A.; Yaghi, Moustapha; Abou-Haidar, Mounir; Castelfranco, Paul A.

    1970-01-01

    The formation of protochlorophyllide and protochlorophyllide phytyl ester was investigated during etioplast biogenesis in order to study the biosynthetic relation of these two compounds. Protochlorophyllide accumulates slowly during the first 2 days of germination, its rate of formation increases sharply during the 3rd day, and then it decreases. Protochlorophyllide phytyl ester starts accumulating a day later; its formation coincides with the initiation of xanthophyll biosynthesis. Kinetic analysis of specific radioactivities after 14C labeling of the protochlorophyll pools does not support the currently accepted conversion of protochlorophyllide into protochlorophyllide phytyl ester, but suggests that both compounds originate simultaneously from a common precursor pool. PMID:16657422

  12. Absolute Configuration of Hydroxysqualene. An Intermediate in Bacterial Hopanoid Biosynthesis.

    PubMed

    Pan, Jian-Jung; Ramamoorthy, Gurusankar; Poulter, C Dale

    2016-02-01

    Squalene (SQ) is a key intermediate in hopanoid biosynthesis. Many bacteria synthesize SQ from farnesyl diphosphate (FPP) in three steps: FPP to (1R,2R,3R)-presqualene diphosphate (PSPP), (1R,2R,3R)-PSPP to hydroxysqualene (HSQ), and HSQ to SQ. Chemical, biochemical, and spectroscopic methods were used to establish that HSQ synthase synthesizes (S)-HSQ. In contrast, eukaryotic squalene synthase catalyzes solvolysis of (1R,2R,3R)-PSPP to give (R)-HSQ. The bacterial enzyme that reduces HSQ to SQ does not accept (R)-HSQ as a substrate. PMID:26756303

  13. Superconductivity versus structural phase transition in the closely related Bi2Rh3.5S2 and Bi2Rh3S2

    DOE PAGESBeta

    Kaluarachchi, Udhara S.; Xie, Weiwei; Lin, Qisheng; Taufour, Valentin; Bud'ko, Sergey L.; Miller, Gordon J.; Canfield, Paul C.

    2015-05-19

    Single crystals of Bi2Rh3S2 and Bi2Rh3.5S2 were synthesized by solution growth, and the crystal structures and thermodynamic and transport properties of both compounds were studied. In the case of Bi2Rh3S2, a structural first-order transition at around 165 K is identified by single-crystal diffraction experiments, with clear signatures visible in resistivity, magnetization, and specific heat data. No superconducting transition for Bi2Rh3S2 was observed down to 0.5 K. In contrast, no structural phase transition at high temperature was observed for Bi2Rh3.5S2; however, bulk superconductivity with a critical temperature, Tc ≈ 1.7 K, was observed. The Sommerfeld coefficient γ and the Debye temperaturemore » (ΘD) were found to be 9.41 mJ mol–1K–2 and 209 K, respectively, for Bi2Rh3S2, and 22 mJ mol–1K–2 and 196 K, respectively, for Bi2Rh3.5S2. As a result, the study of the specific heat in the superconducting state of Bi2Rh3.5S2 suggests that Bi2Rh3.5S2 is a weakly coupled, BCS superconductor.« less

  14. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    PubMed

    Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S

    2015-11-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time. PMID:25987256

  15. Superconductivity versus structural phase transition in the closely related Bi2Rh3.5S2 and Bi2Rh3S2

    NASA Astrophysics Data System (ADS)

    Kaluarachchi, Udhara S.; Xie, Weiwei; Lin, Qisheng; Taufour, Valentin; Bud'ko, Sergey L.; Miller, Gordon J.; Canfield, Paul C.

    2015-05-01

    Single crystals of Bi2Rh3S2 and Bi2Rh3.5S2 were synthesized by solution growth, and the crystal structures and thermodynamic and transport properties of both compounds were studied. In the case of Bi2Rh3S2 , a structural first-order transition at around 165 K is identified by single-crystal diffraction experiments, with clear signatures visible in resistivity, magnetization, and specific heat data. No superconducting transition for Bi2Rh3S2 was observed down to 0.5 K. In contrast, no structural phase transition at high temperature was observed for Bi2Rh3.5S2 ; however, bulk superconductivity with a critical temperature, Tc≈1.7 K, was observed. The Sommerfeld coefficient γ and the Debye temperature (ΘD ) were found to be 9.41 mJ mol-1K-2 and 209 K, respectively, for Bi2Rh3S2 , and 22 mJ mol-1K-2 and 196 K, respectively, for Bi2Rh3.5S2 . Study of the specific heat in the superconducting state of Bi2Rh3.5S2 suggests that Bi2Rh3.5S2 is a weakly coupled, BCS superconductor.

  16. ATP Allosterically Activates the Human 5-Lipoxygenase Molecular Mechanism of Arachidonic Acid and 5(S)-Hydroperoxy-6(E),8(Z),11(Z),14(Z)-eicosatetraenoic Acid

    PubMed Central

    2015-01-01

    5-Lipoxygenase (5-LOX) reacts with arachidonic acid (AA) to first generate 5(S)-hydroperoxy-6(E),8(Z),11(Z),14(Z)-eicosatetraenoic acid [5(S)-HpETE] and then an epoxide from 5(S)-HpETE to form leukotriene A4, from a single polyunsaturated fatty acid. This work investigates the kinetic mechanism of these two processes and the role of ATP in their activation. Specifically, it was determined that epoxidation of 5(S)-HpETE (dehydration of the hydroperoxide) has a rate of substrate capture (Vmax/Km) significantly lower than that of AA hydroperoxidation (oxidation of AA to form the hydroperoxide); however, hyperbolic kinetic parameters for ATP activation indicate a similar activation for AA and 5(S)-HpETE. Solvent isotope effect results for both hydroperoxidation and epoxidation indicate that a specific step in its molecular mechanism is changed, possibly because of a lowering of the dependence of the rate-limiting step on hydrogen atom abstraction and an increase in the dependency on hydrogen bond rearrangement. Therefore, changes in ATP concentration in the cell could affect the production of 5-LOX products, such as leukotrienes and lipoxins, and thus have wide implications for the regulation of cellular inflammation. PMID:24893149

  17. Z{sub b}(10 610) and Z{sub b}(10 650) structures produced by the initial single pion emission in the {Upsilon}(5S) decays

    SciTech Connect

    Chen Dianyong; Liu Xiang

    2011-11-01

    We propose a unique mechanism called initial single pion emission existing in the {Upsilon}(5S) decays, and further study the line shapes of d{Gamma}({Upsilon}(5S{yields}{Upsilon}(nS){pi}{sup +}{pi}{sup -}))/dm{sub {Upsilon}}(nS){pi}{sup +} (n=1,2,3) and d{Gamma}({Upsilon}(5S{yields}h{sub b}(mP){pi}{sup +}{pi}{sup -}))/dm{sub h{sub b}(mP)}{pi}{sup +} (m=1,2). We find sharp structures around 10 610 MeV and 10 650 MeV in the obtained theoretical line shapes of d{Gamma}({Upsilon}(5S{yields}{Upsilon}(nS){pi}{sup +}{pi}{sup -}))/dm{sub {Upsilon}}(nS){pi}{sup +} and d{Gamma}({Upsilon}(5S{yields}h{sub b}(mP){pi}{sup +}{pi}{sup -}))/dm{sub h{sub b}(mP)}{pi}{sup +} distributions, which could naturally correspond to the Z{sub b}(10 610) and Z{sub b}(10 650) structures newly observed by Belle.

  18. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

    2013-10-01

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status. PMID:23933480

  19. Phylogenetic analysis of encapsulated and non-encapsulated Trichinella species by studying the 5S rDNA tandemly repeated intergenic region.

    PubMed

    van der Giessen, J W B; Fonville, M; Briels, I; Pozio, E

    2005-09-01

    The identification of sequence regions in the genomes of pathogens which can be useful to distinguish among species and genotypes, is of great importance for epidemiological, molecular, and phylogenetic studies. The 5S ribosomal DNA intergenic spacer region has been identified as a good target to distinguish among eight Trichinella species and genotypes. The recent discovery of two non-encapsulated species in this genus, Trichinella papuae and Trichinella zimbabwensis, which can infect both mammals and reptiles, has suggested analyzing their 5S rDNA. Amplification of the tandem repeats of the 5S rDNA intergenic region of encapsulated species of Trichinella shows a 751bp fragment, whereas the three non-encapsulated species show a fragment of 800bp with T. pseudospiralis showing an additional fragment of 522bp. Although the size of the 800bp PCR fragments of T. papuae and T. zimbabwensis are similar to that of T. pseudospiralis, there are differences in the 5S rDNA intergenic regions among the three non-encapsulated species. Phylogenetic analysis of the 5S rDNA intergenic regions shows a clustering together of the three non-encapsulated Trichinella species that is well separated from the encapsulated ones. In addition, a single PCR-based method allows distinguishing non-encapsulated and encapsulated species. PMID:16076532

  20. Microwave hydrothermal synthesis and photocatalytic activity of AgIn{sub 5}S{sub 8} for the degradation of dye

    SciTech Connect

    Zhang Wenjuan; Li Danzhen; Sun Meng; Shao Yu; Chen Zhixin; Xiao Guangcan; Fu Xianzhi

    2010-10-15

    AgIn{sub 5}S{sub 8} powders were successfully synthesized by a microwave hydrothermal method for the first time. This method is a mild and highly efficient route involves no templates, catalysts, or surfactants. Therefore, it is very promising for the low-cost and large-scale industrial production. The samples were characterized by X-ray diffraction, UV-vis spectroscopy, X-ray photoelectron spectroscopy, and scanning electron microscopy. The photocatalytic activity of AgIn{sub 5}S{sub 8} nanoparticles was investigated through the degradation of methyl orange under visible light irradiation. Compared with TiO{sub 2-x}N{sub x}, AgIn{sub 5}S{sub 8} has exhibited a superior activity under the same condition. A liquid chromatogram-mass spectrometer was used to separate and identify the dye and degradation products generated during the reaction. According to the experiment results, a possible mechanism for the degradation of organic pollutant over AgIn{sub 5}S{sub 8} was proposed. - Graphical abstract: Compared with TiO{sub 2-x}N{sub x}, AgIn{sub 5}S{sub 8} has exhibited a superior activity under the same condition.

  1. Natural Products as Tools for Chemogenomic Analysis of Mycotoxin Biosynthesis and Fungal Stress-Response Systems

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Certain phenolic compounds with antioxidant properties inhibit aflatoxin biosynthesis in the fungus Aspergillus flavus, without affecting growth. Similarly, some of the same phenolics also inhibit biosynthesis of ochratoxin by A. alliaceous. Exposing A. flavus to oxidative stress, such as hydrogen p...

  2. Glycoprotein Biochemistry (Biosynthesis)--A Vehicle for Teaching Many Aspects of Biochemistry and Molecular Biology.

    ERIC Educational Resources Information Center

    Cole, Clair R.; Smith, Christopher A.

    1990-01-01

    Information about the biosynthesis of the carbohydrate portions or glycans of glycoproteins is presented. The teaching of glycosylation can be used to develop and emphasize many general aspects of biosynthesis, in addition to explaining specific biochemical and molecular biological features associated with producing the oligosaccharide portions of…

  3. Structure, function, and biosynthesis of plant cell walls: proceedings of the seventh annual symposium in botany

    SciTech Connect

    Dugger, W.M.; Bartnicki-Garcia, S.

    1984-01-01

    Papers in the following areas were included in these symposium proceedings: (1) cell wall chemistry and biosynthesis; (2) cell wall hydrolysis and associated physiology; (3) cellular events associated with cell wall biosynthesis; and (4) interactions of plant cell walls with pathogens and related responses. Papers have been individually abstracted for the data base. (ACR)

  4. Fungal siderophore biosynthesis is partially localized in peroxisomes

    PubMed Central

    Gründlinger, Mario; Yasmin, Sabiha; Lechner, Beatrix Elisabeth; Geley, Stephan; Schrettl, Markus; Hynes, Michael; Haas, Hubertus

    2013-01-01

    Siderophores play a central role in iron metabolism and virulence of most fungi. Both Aspergillus fumigatus and Aspergillus nidulans excrete the siderophore triacetylfusarinine C (TAFC) for iron acquisition. In A. fumigatus, green fluorescence protein-tagging revealed peroxisomal localization of the TAFC biosynthetic enzymes SidI (mevalonyl-CoA ligase), SidH (mevalonyl-CoA hydratase) and SidF (anhydromevalonyl-CoA transferase), while elimination of the peroxisomal targeting signal (PTS) impaired both, peroxisomal SidH-targeting and TAFC biosynthesis. The analysis of A. nidulans mutants deficient in peroxisomal biogenesis, ATP import or protein import revealed that cytosolic mislocalization of one or two but, interestingly, not all three enzymes impairs TAFC production during iron starvation. The PTS motifs are conserved in fungal orthologues of SidF, SidH and SidI. In agreement with the evolutionary conservation of the partial peroxisomal compartmentalization of fungal siderophore biosynthesis, the SidI orthologue of coprogen-type siderophore-producing Neurospora crassa was confirmed to be peroxisomal. Taken together, this study identified and characterized a novel, evolutionary conserved metabolic function of peroxisomes. PMID:23617799

  5. Kinetic Modeling of Sunflower Grain Filling and Fatty Acid Biosynthesis.

    PubMed

    Durruty, Ignacio; Aguirrezábal, Luis A N; Echarte, María M

    2016-01-01

    Grain growth and oil biosynthesis are complex processes that involve various enzymes placed in different sub-cellular compartments of the grain. In order to understand the mechanisms controlling grain weight and composition, we need mathematical models capable of simulating the dynamic behavior of the main components of the grain during the grain filling stage. In this paper, we present a non-structured mechanistic kinetic model developed for sunflower grains. The model was first calibrated for sunflower hybrid ACA855. The calibrated model was able to predict the theoretical amount of carbohydrate equivalents allocated to the grain, grain growth and the dynamics of the oil and non-oil fraction, while considering maintenance requirements and leaf senescence. Incorporating into the model the serial-parallel nature of fatty acid biosynthesis permitted a good representation of the kinetics of palmitic, stearic, oleic, and linoleic acids production. A sensitivity analysis showed that the relative influence of input parameters changed along grain development. Grain growth was mostly affected by the specific growth parameter (μ') while fatty acid composition strongly depended on their own maximum specific rate parameters. The model was successfully applied to two additional hybrids (MG2 and DK3820). The proposed model can be the first building block toward the development of a more sophisticated model, capable of predicting the effects of environmental conditions on grain weight and composition, in a comprehensive and quantitative way. PMID:27242809

  6. Alteration of Ganglioside Biosynthesis Responsible for Complex Hereditary Spastic Paraplegia

    PubMed Central

    Boukhris, Amir; Schule, Rebecca; Loureiro, José L.; Lourenço, Charles Marques; Mundwiller, Emeline; Gonzalez, Michael A.; Charles, Perrine; Gauthier, Julie; Rekik, Imen; Acosta Lebrigio, Rafael F.; Gaussen, Marion; Speziani, Fiorella; Ferbert, Andreas; Feki, Imed; Caballero-Oteyza, Andrés; Dionne-Laporte, Alexandre; Amri, Mohamed; Noreau, Anne; Forlani, Sylvie; Cruz, Vitor T.; Mochel, Fanny; Coutinho, Paula; Dion, Patrick; Mhiri, Chokri; Schols, Ludger; Pouget, Jean; Darios, Frédéric; Rouleau, Guy A.; Marques, Wilson; Brice, Alexis; Durr, Alexandra; Zuchner, Stephan; Stevanin, Giovanni

    2013-01-01

    Hereditary spastic paraplegias (HSPs) form a heterogeneous group of neurological disorders. A whole-genome linkage mapping effort was made with three HSP-affected families from Spain, Portugal, and Tunisia and it allowed us to reduce the SPG26 locus interval from 34 to 9 Mb. Subsequently, a targeted capture was made to sequence the entire exome of affected individuals from these three families, as well as from two additional autosomal-recessive HSP-affected families of German and Brazilian origins. Five homozygous truncating (n = 3) and missense (n = 2) mutations were identified in B4GALNT1. After this finding, we analyzed the entire coding region of this gene in 65 additional cases, and three mutations were identified in two subjects. All mutated cases presented an early-onset spastic paraplegia, with frequent intellectual disability, cerebellar ataxia, and peripheral neuropathy as well as cortical atrophy and white matter hyperintensities on brain imaging. B4GALNT1 encodes β-1,4-N-acetyl-galactosaminyl transferase 1 (B4GALNT1), involved in ganglioside biosynthesis. These findings confirm the increasing interest of lipid metabolism in HSPs. Interestingly, although the catabolism of gangliosides is implicated in a variety of neurological diseases, SPG26 is only the second human disease involving defects of their biosynthesis. PMID:23746551

  7. Kinetic Modeling of Sunflower Grain Filling and Fatty Acid Biosynthesis

    PubMed Central

    Durruty, Ignacio; Aguirrezábal, Luis A. N.; Echarte, María M.

    2016-01-01

    Grain growth and oil biosynthesis are complex processes that involve various enzymes placed in different sub-cellular compartments of the grain. In order to understand the mechanisms controlling grain weight and composition, we need mathematical models capable of simulating the dynamic behavior of the main components of the grain during the grain filling stage. In this paper, we present a non-structured mechanistic kinetic model developed for sunflower grains. The model was first calibrated for sunflower hybrid ACA855. The calibrated model was able to predict the theoretical amount of carbohydrate equivalents allocated to the grain, grain growth and the dynamics of the oil and non-oil fraction, while considering maintenance requirements and leaf senescence. Incorporating into the model the serial-parallel nature of fatty acid biosynthesis permitted a good representation of the kinetics of palmitic, stearic, oleic, and linoleic acids production. A sensitivity analysis showed that the relative influence of input parameters changed along grain development. Grain growth was mostly affected by the specific growth parameter (μ′) while fatty acid composition strongly depended on their own maximum specific rate parameters. The model was successfully applied to two additional hybrids (MG2 and DK3820). The proposed model can be the first building block toward the development of a more sophisticated model, capable of predicting the effects of environmental conditions on grain weight and composition, in a comprehensive and quantitative way. PMID:27242809

  8. Engineered Biosynthesis of Medicinally Important Plant Natural Products in Microorganisms.

    PubMed

    Zhang, Shuwei; Wang, Siyuan; Zhan, Jixun

    2016-01-01

    Plants produce structurally and functionally diverse natural products. Some of these compounds possess promising health-benefiting properties, such as resveratrol (antioxidant) curcumin (anti-inflammatory, anti-allergic and anticancer), paclitaxel (anticancer) and artemisinin (antimalarial). These compounds are produced through particular biosynthetic pathways in the plants. While supply of these medicinally important molecules relies on extraction from the producing species, recent years have seen significant advances in metabolic engineering of microorganisms for the production of plant natural products. Escherichia coli and Saccharomyces cerevisiae are the two most widely used heterologous hosts for expression of enzymes and reconstitution of plant natural product biosynthetic pathways. Total biosynthesis of many plant polyketide natural products such as curcumin and piceatannol in microorganisms has been achieved. While the late biosynthetic steps of more complex molecules such as paclitaxel and artemisinin remain to be understood, reconstitution of their partial biosynthetic pathways and microbial production of key intermediates have been successful. This review covers recent advances in understanding and engineering the biosynthesis of plant polyketides and terpenoids in microbial hosts. PMID:26456465

  9. Alteration of ganglioside biosynthesis responsible for complex hereditary spastic paraplegia.

    PubMed

    Boukhris, Amir; Schule, Rebecca; Loureiro, José L; Lourenço, Charles Marques; Mundwiller, Emeline; Gonzalez, Michael A; Charles, Perrine; Gauthier, Julie; Rekik, Imen; Acosta Lebrigio, Rafael F; Gaussen, Marion; Speziani, Fiorella; Ferbert, Andreas; Feki, Imed; Caballero-Oteyza, Andrés; Dionne-Laporte, Alexandre; Amri, Mohamed; Noreau, Anne; Forlani, Sylvie; Cruz, Vitor T; Mochel, Fanny; Coutinho, Paula; Dion, Patrick; Mhiri, Chokri; Schols, Ludger; Pouget, Jean; Darios, Frédéric; Rouleau, Guy A; Marques, Wilson; Brice, Alexis; Durr, Alexandra; Zuchner, Stephan; Stevanin, Giovanni

    2013-07-11

    Hereditary spastic paraplegias (HSPs) form a heterogeneous group of neurological disorders. A whole-genome linkage mapping effort was made with three HSP-affected families from Spain, Portugal, and Tunisia and it allowed us to reduce the SPG26 locus interval from 34 to 9 Mb. Subsequently, a targeted capture was made to sequence the entire exome of affected individuals from these three families, as well as from two additional autosomal-recessive HSP-affected families of German and Brazilian origins. Five homozygous truncating (n = 3) and missense (n = 2) mutations were identified in B4GALNT1. After this finding, we analyzed the entire coding region of this gene in 65 additional cases, and three mutations were identified in two subjects. All mutated cases presented an early-onset spastic paraplegia, with frequent intellectual disability, cerebellar ataxia, and peripheral neuropathy as well as cortical atrophy and white matter hyperintensities on brain imaging. B4GALNT1 encodes β-1,4-N-acetyl-galactosaminyl transferase 1 (B4GALNT1), involved in ganglioside biosynthesis. These findings confirm the increasing interest of lipid metabolism in HSPs. Interestingly, although the catabolism of gangliosides is implicated in a variety of neurological diseases, SPG26 is only the second human disease involving defects of their biosynthesis. PMID:23746551

  10. Nervous control of juvenile hormone biosynthesis in Locusta migratoria.

    PubMed Central

    Horseman, G; Hartmann, R; Virant-Doberlet, M; Loher, W; Huber, F

    1994-01-01

    In Locusta migratoria migratorioides R. and F., two types of brain neurons innervate the juvenile hormone (JH)-producing corpora allata (CA). Thirteen cells in each pars lateralis (PL) innervate the ipsilateral CA, while four cells (two in each PL) innervate both glands. We investigated possible influences of these two neuronal types on JH production by a newly developed method. A radiochemical assay was used to measure hourly JH production by a CA with intact nerve connections to the brain. Then, changes in hormone production due to selective nerve stimulation or transection were assessed. In control preparations JH production per h remained approximately constant for at least 9 h. Simultaneous electrical stimulation of all neurons innervating one CA (i.e., 13 ipsilateral plus 4 bilaterally innervating cells) always inhibited JH production, while their transection led to a rapid progressive increase in JH biosynthesis in CA from females with oocytes longer than 4.5 mm. Thus, there is strong neurally mediated inhibition of the CA at certain phases of the vitellogenic cycle. The dramatic effects of nerve transection show that in vitro rates of JH production are an unreliable indicator of in vivo levels. Selective stimulation of the four neurons innervating both CA suggests that they do modulate JH biosynthesis but the effect varies qualitatively depending on the phase of the vitellogenic cycle. Images PMID:8159687

  11. Nervous control of juvenile hormone biosynthesis in Locusta migratoria.

    PubMed

    Horseman, G; Hartmann, R; Virant-Doberlet, M; Loher, W; Huber, F

    1994-04-12

    In Locusta migratoria migratorioides R. and F., two types of brain neurons innervate the juvenile hormone (JH)-producing corpora allata (CA). Thirteen cells in each pars lateralis (PL) innervate the ipsilateral CA, while four cells (two in each PL) innervate both glands. We investigated possible influences of these two neuronal types on JH production by a newly developed method. A radiochemical assay was used to measure hourly JH production by a CA with intact nerve connections to the brain. Then, changes in hormone production due to selective nerve stimulation or transection were assessed. In control preparations JH production per h remained approximately constant for at least 9 h. Simultaneous electrical stimulation of all neurons innervating one CA (i.e., 13 ipsilateral plus 4 bilaterally innervating cells) always inhibited JH production, while their transection led to a rapid progressive increase in JH biosynthesis in CA from females with oocytes longer than 4.5 mm. Thus, there is strong neurally mediated inhibition of the CA at certain phases of the vitellogenic cycle. The dramatic effects of nerve transection show that in vitro rates of JH production are an unreliable indicator of in vivo levels. Selective stimulation of the four neurons innervating both CA suggests that they do modulate JH biosynthesis but the effect varies qualitatively depending on the phase of the vitellogenic cycle. PMID:8159687

  12. Specialised metabolites regulating antibiotic biosynthesis in Streptomyces spp.

    PubMed

    Niu, Guoqing; Chater, Keith F; Tian, Yuqing; Zhang, Jihui; Tan, Huarong

    2016-07-01

    Streptomyces bacteria are the major source of antibiotics and other secondary metabolites. Various environmental and physiological conditions affect the onset and level of production of each antibiotic by influencing concentrations of the ligands for conserved global regulatory proteins. In addition, as reviewed here, well-known autoregulators such as γ-butyrolactones, themselves products of secondary metabolism, accumulate late in growth to concentrations allowing their effective interaction with cognate binding proteins, in a necessary prelude to antibiotic biosynthesis. Most autoregulator binding proteins target the conserved global regulatory gene adpA, and/or regulatory genes for 'cluster-situated regulators' (CSRs) linked to antibiotic biosynthetic gene clusters. It now appears that some CSRs bind intermediates and end products of antibiotic biosynthesis, with regulatory effects interwoven with those of autoregulators. These ligands can exert cross-pathway effects within producers of more than one antibiotic, and when excreted into the extracellular environment may have population-wide effects on production, and mediate interactions with neighbouring microorganisms in natural communities, influencing speciation. Greater understanding of these autoregulatory and cross-regulatory activities may aid the discovery of new signalling molecules and their use in activating cryptic antibiotic biosynthetic pathways. PMID:27288284

  13. Engineered biosynthesis of bacteriochlorophyll b in Rhodobacter sphaeroides

    PubMed Central

    Canniffe, Daniel P.; Hunter, C. Neil

    2014-01-01

    Bacteriochlorophyll b has the most red-shifted absorbance maximum of all naturally occurring photopigments. It has a characteristic ethylidene group at the C8 position in place of the more common ethyl group, the product of a C8-vinyl reductase, which is carried by the majority of chlorophylls and bacteriochlorophylls used in photosynthesis. The subsequent and first step exclusive to bacteriochlorophyll biosynthesis, the reduction of the C7 = C8 bond, is catalyzed by chlorophyllide oxidoreductase. It has been demonstrated that the enzyme from bacteriochlorophyll a-utilizing bacteria can catalyze the formation of compounds carrying an ethyl group at C8 from both ethyl- and vinyl-carrying substrates, indicating a surprising additional C8-vinyl reductase function, while the enzyme from organisms producing BChl b could only catalyze C7 = C8 reduction with a vinyl substrate, but this product carried an ethylidene group at the C8 position. We have replaced the native chlorophyllide oxidoreductase-encoding genes of Rhodobacter sphaeroides with those from Blastochloris viridis, but the switch from bacteriochlorophyll a to b biosynthesis is only detected when the native conventional C8-vinyl reductase is absent. We propose a non-enzymatic mechanism for ethylidene group formation based on the absence of cellular C8-vinyl reductase activity. PMID:25058304

  14. Biosynthesis of glucagon in isolated pancreatic islets of guinea pigs

    PubMed Central

    Hellerström, Claes; Howell, Simon L.; Edwards, John C.; Andersson, Arne; Östenson, Claes-Göran

    1974-01-01

    1. The biosynthesis of glucagon in guinea-pig A2 cells was investigated by incubation of isolated islets of Langerhans in the presence of [3H]tryptophan for periods of up to 14 days. Proteins were extracted from islets and incubation media and analysed by gel filtration. 2. In addition to very-high-molecular-weight (100000) proteins, the principal tryptophan-containing biosynthetic product after incubation for up to 17h was a protein of minimum mol.wt. 9000, which co-eluted on gel filtration with a peak of glucagon-like immunoreactivity, but was apparently devoid of biological activity in a fat-cell assay. A discrete peak of labelled glucagon was only recovered after incubation for at least 6 days. Losses of glucagon during the extraction and rapid secretion of newly synthesized glucagon into incubation media were excluded as reasons for the lack of recovery of labelled hormone from islets after shorter incubations. 3. The 9000-mol.wt. protein was localized to A2 cells in experiments using B-cell-depleted islets, and to A2-cell granules by subcellular fractionation and electron-microscopic radioautography. Only glucagon was secreted into the incubation medium. 4. Possible relationships between the 9000-mol.wt. protein and glucagon are discussed in the light of postulated mechanisms of glucagon biosynthesis. PMID:4615708

  15. Mechano-regulation of Collagen Biosynthesis in Periodontal Ligament

    PubMed Central

    Kaku, Masaru; Yamauchi, Mitsuo

    2014-01-01

    Purpose Periodontal ligament (PDL) plays critical roles in the development and maintenance of periodontium such as tooth eruption and dissipation of masticatory force. The mechanical properties of PDL are mainly derived from fibrillar type I collagen, the most abundant extracellular component. Study selection The biosynthesis of type I collagen is a long, complex process including a number of intra- and extracellular post-translational modifications. The final modification step is the formation of covalent intra- and intermolecular cross-links that provide collagen fibrils with stability and connectivity. Results It is now clear that collagen post-translational modifications are regulated by groups of specific enzymes and associated molecules in a tissue-specific manner; and these modifications appear to change in response to mechanical force. Conclusions This review focuses on the effect of mechanical loading on collagen biosynthesis and fibrillogenesis in PDL with emphasis on the post-translational modifications of collagens, which is an important molecular aspect to understand in the field of prosthetic dentistry. PMID:25311991

  16. Androgen biosynthesis in castration-resistant prostate cancer

    PubMed Central

    Penning, Trevor M

    2014-01-01

    Prostate cancer is the second leading cause of death in adult males in the USA. Recent advances have revealed that the fatal form of this cancer, known as castration-resistant prostate cancer (CRPC), remains hormonally driven despite castrate levels of circulating androgens. CRPC arises as the tumor undergoes adaptation to low levels of androgens by either synthesizing its own androgens (intratumoral androgens) or altering the androgen receptor (AR). This article reviews the major routes to testosterone and dihydrotestosterone synthesis in CRPC cells and examines the enzyme targets and progress in the development of isoform-specific inhibitors that could block intratumoral androgen biosynthesis. Because redundancy exists in these pathways, it is likely that inhibition of a single pathway will lead to upregulation of another so that drug resistance would be anticipated. Drugs that target multiple pathways or bifunctional agents that block intratumoral androgen biosynthesis and antagonize the AR offer the most promise. Optimal use of enzyme inhibitors or AR antagonists to ensure maximal benefits to CRPC patients will also require application of precision molecular medicine to determine whether a tumor in a particular patient will be responsive to these treatments either alone or in combination. PMID:24829267

  17. An Alternative Pathway for Formononetin Biosynthesis in Pueraria lobata.

    PubMed

    Li, Jia; Li, Changfu; Gou, Junbo; Wang, Xin; Fan, Rongyan; Zhang, Yansheng

    2016-01-01

    The O-methylation is an important tailing process in Pueraria lobata isoflavone metabolism, but the molecular mechanism governing it remains not elucidated. This manuscript describes the mining of key O-methyltransferases (OMTs) involved in the process. Using our previously constructed P. lobata transcriptome, the OMT candidates were searched, extensively analyzed, and their functions were investigated by expression in yeast, Escherichia coli, or Glycine max hairy roots. Here, we report the identification of the key OMT gene responsible for formononetin production in P. lobata (designated as PlOMT9). PlOMT9 primarily functions as an isoflavone-specific 4'-O-methyltransferase, although it shows high sequence identities with isoflavone 7-O-methyltransferases. Moreover, unlike the previously reported OMTs that catalyze the 4'-O-methylation for formononetin biosynthesis at the isoflavanone stage, PlOMT9 performs this modifying step at the isoflavone level, using daidzein rather than 2,7,4'-trihydroxy-isoflavanone as the substrate. Gene expression analyses and metabolite profiling supported its proposed roles in P. lobata. Using the system of transgenic G. max hairy roots, the role of PlOMT9 in the biosynthesis of formononetin was further demonstrated in vivo. PMID:27379141

  18. An Alternative Pathway for Formononetin Biosynthesis in Pueraria lobata

    PubMed Central

    Li, Jia; Li, Changfu; Gou, Junbo; Wang, Xin; Fan, Rongyan; Zhang, Yansheng

    2016-01-01

    The O-methylation is an important tailing process in Pueraria lobata isoflavone metabolism, but the molecular mechanism governing it remains not elucidated. This manuscript describes the mining of key O-methyltransferases (OMTs) involved in the process. Using our previously constructed P. lobata transcriptome, the OMT candidates were searched, extensively analyzed, and their functions were investigated by expression in yeast, Escherichia coli, or Glycine max hairy roots. Here, we report the identification of the key OMT gene responsible for formononetin production in P. lobata (designated as PlOMT9). PlOMT9 primarily functions as an isoflavone-specific 4′-O-methyltransferase, although it shows high sequence identities with isoflavone 7-O-methyltransferases. Moreover, unlike the previously reported OMTs that catalyze the 4′-O-methylation for formononetin biosynthesis at the isoflavanone stage, PlOMT9 performs this modifying step at the isoflavone level, using daidzein rather than 2,7,4′-trihydroxy-isoflavanone as the substrate. Gene expression analyses and metabolite profiling supported its proposed roles in P. lobata. Using the system of transgenic G. max hairy roots, the role of PlOMT9 in the biosynthesis of formononetin was further demonstrated in vivo. PMID:27379141

  19. Methionine salvage pathway in relation to ethylene biosynthesis

    SciTech Connect

    Miyazaki, J.H.

    1987-01-01

    The recycling of methionine during ethylene biosynthesis (the methionine cycle) was studied. During ethylene biosynthesis, the H/sub 3/CS-group of S-adenosylmethionine (SAM) is released at 5'-methylthioadenosine (MTA), which is recycled to methionine via 5'-methylthioribose (MTS). In mungbean hypocotyls and cell-free extracts of avocado fruit, (/sup 14/C)MTR was converted to labeled methionine via 2-keto-4-methylthiobutyric acid (KMB) and 2-hydroxy-4-methylthiobutyric acid (HMB) as intermediates. Radioactive tracer studies showed that KMB was converted readily in vivo and in vitro to methionine, while HMB was converted much more slowly. The conversion of KMB to methionine by dialyzed avocado extract required an amino group donor. Among several potential donors tested, L-glutamine was the most efficient. Incubation of (ribose-U-/sup 14/C)MTR with avocado extract resulted in the production of (/sup 14/C)formate, with little evolution of other /sup 14/C-labeled one-carbon compounds, indicating that the conversion of MTR to KMB involves a loss of formate, presumably from C-1 of MTR.

  20. Radical AdoMet enzymes in complex metal cluster biosynthesis.

    PubMed

    Duffus, Benjamin R; Hamilton, Trinity L; Shepard, Eric M; Boyd, Eric S; Peters, John W; Broderick, Joan B

    2012-11-01

    Radical S-adenosylmethionine (AdoMet) enzymes comprise a large superfamily of proteins that engage in a diverse series of biochemical transformations through generation of the highly reactive 5'-deoxyadenosyl radical intermediate. Recent advances into the biosynthesis of unique iron-sulfur (FeS)-containing cofactors such as the H-cluster in [FeFe]-hydrogenase, the FeMo-co in nitrogenase, as well as the iron-guanylylpyridinol (FeGP) cofactor in [Fe]-hydrogenase have implicated new roles for radical AdoMet enzymes in the biosynthesis of complex inorganic cofactors. Radical AdoMet enzymes in conjunction with scaffold proteins engage in modifying ubiquitous FeS precursors into unique clusters, through novel amino acid decomposition and sulfur insertion reactions. The ability of radical AdoMet enzymes to modify common metal centers to unusual metal cofactors may provide important clues into the stepwise evolution of these and other complex bioinorganic catalysts. This article is part of a Special Issue entitled: Radical SAM enzymes and Radical Enzymology. PMID:22269887

  1. Fungal biosynthesis of the bibenzoquinone oosporein to evade insect immunity

    PubMed Central

    Feng, Peng; Shang, Yanfang; Cen, Kai; Wang, Chengshu

    2015-01-01

    Quinones are widely distributed in nature and exhibit diverse biological or pharmacological activities; however, their biosynthetic machineries are largely unknown. The bibenzoquinone oosporein was first identified from the ascomycete insect pathogen Beauveria bassiana >50 y ago. The toxin can also be produced by different plant pathogenic and endophytic fungi with an array of biological activities. Here, we report the oosporein biosynthetic machinery in fungi, a polyketide synthase (PKS) pathway including seven genes for quinone biosynthesis. The PKS oosporein synthase 1 (OpS1) produces orsellinic acid that is hydroxylated to benzenetriol by the hydroxylase OpS4. The intermediate is oxidized either nonenzymatically to 5,5′-dideoxy-oosporein or enzymatically to benzenetetrol by the putative dioxygenase OpS7. The latter is further dimerized to oosporein by the catalase OpS5. The transcription factor OpS3 regulates intrapathway gene expression. Insect bioassays revealed that oosporein is required for fungal virulence and acts by evading host immunity to facilitate fungal multiplication in insects. These results contribute to the known mechanisms of quinone biosynthesis and the understanding of small molecules deployed by fungi that interact with their hosts. PMID:26305932

  2. Biosynthesis of ambiguine indole alkaloids in cyanobacterium Fischerella ambigua.

    PubMed

    Hillwig, Matthew L; Zhu, Qin; Liu, Xinyu

    2014-02-21

    Ambiguines belong to a family of hapalindole-type indole alkaloid natural products, with many of the members possessing up to eight consecutive carbon stereocenters in a fused pentacyclic 6-6-6-5-7 ring scaffold. Here, we report the identification of a 42 kbp ambiguine (amb) biosynthetic gene cluster that harbors 32 protein-coding genes in its native producer Fischerella ambigua UTEX1903. Association of the amb cluster with ambiguine biosynthesis was confirmed by both bioinformatic analysis and in vitro characterizations of enzymes responsible for 3-((Z)-2'-isocyanoethenyl) indole and geranyl pyrophosphate biosynthesis and a C-2 indole dimethylallyltransferase that regiospecifically tailors hapalindole G to ambiguine A. The presence of five nonheme iron-dependent oxygenase coding genes (including four Rieske-type oxygenases) within the amb cluster suggests late-stage C-H activations are likely responsible for the structural diversities of ambiguines by regio- and stereospecific chlorination, hydroxylation, epoxidation, and sp(2)-sp(3) C-C bond formation. PMID:24180436

  3. Widespread Occurrence of Secondary Lipid Biosynthesis Potential in Microbial Lineages

    PubMed Central

    Shulse, Christine N.; Allen, Eric E.

    2011-01-01

    Bacterial production of long-chain omega-3 polyunsaturated fatty acids (PUFAs), such as eicosapentaenoic acid (EPA, 20:5n-3) and docosahexaenoic acid (DHA, 22:6n-3), is constrained to a narrow subset of marine γ-proteobacteria. The genes responsible for de novo bacterial PUFA biosynthesis, designated pfaEABCD, encode large, multi-domain protein complexes akin to type I iterative fatty acid and polyketide synthases, herein referred to as “Pfa synthases”. In addition to the archetypal Pfa synthase gene products from marine bacteria, we have identified homologous type I FAS/PKS gene clusters in diverse microbial lineages spanning 45 genera representing 10 phyla, presumed to be involved in long-chain fatty acid biosynthesis. In total, 20 distinct types of gene clusters were identified. Collectively, we propose the designation of “secondary lipids” to describe these biosynthetic pathways and products, a proposition consistent with the “secondary metabolite” vernacular. Phylogenomic analysis reveals a high degree of functional conservation within distinct biosynthetic pathways. Incongruence between secondary lipid synthase functional clades and taxonomic group membership combined with the lack of orthologous gene clusters in closely related strains suggests horizontal gene transfer has contributed to the dissemination of specialized lipid biosynthetic activities across disparate microbial lineages. PMID:21629834

  4. Biosynthesis of dihydrochalcomycin: characterization of a deoxyallosyltransferase (gerGTI).

    PubMed

    Pageni, Binod Babu; Simkhada, Dinesh; Oh, Tae-Jin; Sohng, Jae Kyung

    2010-02-28

    Through an inactivation experiment followed by complementation, the gerGTII gene was previously characterized as a chalcosyltransferase gene involved in the biosynthesis of dihydochalcomycin. The glycosyltransferase gerGTI was identified as a deoxyallosyltransferase required for the glycosylation of D-mycinose sugar. This 6-deoxyhexose sugar was converted to mycinose, via bis-O-methylation, following attachment to the polyketide lactone during dihydrochalcomycin biosynthesis. Gene sequence alignment of gerGTI to several glycosyltransferases revealed a consensus sequence motif that appears to be characteristic of the enzymes in this sub-group of the glycosyltransferase family. To characterize its putative function, genetic disruption of gerGTI in the wild-type strain Streptomyces sp. KCTC 0041BP and in the gerGTII-deleted mutant (S. sp. Delta gerGTsss, as well as complementation of gerGTII in S. sp. Delta gerGTss-GTs, were carried out, and the products were analyzed by LC/MS. S. sp. Delta gerGTss-GTs mutant produced dihydrochalconolide macrolide. S. sp. Delta gerGTs and S. sp. Delta gerGTss-GTs complementation of gerGTII yielded dihydrochalconolide without the mycinose sugar. The intermediate shows that gerGTI encodes a deoxyallosyltransferase that acts after gerGTII. PMID:20069384

  5. Genetic, molecular, and biochemical basis of fungal tropolone biosynthesis

    PubMed Central

    Davison, Jack; al Fahad, Ahmed; Cai, Menghao; Song, Zhongshu; Yehia, Samar Y.; Lazarus, Colin M.; Bailey, Andrew M.; Simpson, Thomas J.; Cox, Russell J.

    2012-01-01

    A gene cluster encoding the biosynthesis of the fungal tropolone stipitatic acid was discovered in Talaromyces stipitatus (Penicillium stipitatum) and investigated by targeted gene knockout. A minimum of three genes are required to form the tropolone nucleus: tropA encodes a nonreducing polyketide synthase which releases 3-methylorcinaldehyde; tropB encodes a FAD-dependent monooxygenase which dearomatizes 3-methylorcinaldehyde via hydroxylation at C-3; and tropC encodes a non-heme Fe(II)-dependent dioxygenase which catalyzes the oxidative ring expansion to the tropolone nucleus via hydroxylation of the 3-methyl group. The tropA gene was characterized by heterologous expression in Aspergillus oryzae, whereas tropB and tropC were successfully expressed in Escherichia coli and the purified TropB and TropC proteins converted 3-methylorcinaldehyde to a tropolone in vitro. Finally, knockout of the tropD gene, encoding a cytochrome P450 monooxygenase, indicated its place as the next gene in the pathway, probably responsible for hydroxylation of the 6-methyl group. Comparison of the T. stipitatus tropolone biosynthetic cluster with other known gene clusters allows clarification of important steps during the biosynthesis of other fungal compounds including the xenovulenes, citrinin, sepedonin, sclerotiorin, and asperfuranone. PMID:22508998

  6. Dynamic changes of the ethylene biosynthesis in 'Jonagold' apple.

    PubMed

    Bulens, Inge; Van de Poel, Bram; Hertog, Maarten L A T M; Cristescu, Simona M; Harren, Frans J M; De Proft, Maurice P; Geeraerd, Annemie H; Nicolai, Bart M

    2014-02-01

    In this study, the short-term and dynamic changes of the ethylene biosynthesis of Jonagold apple during and after application of controlled atmosphere (CA) storage conditions were quantified using a systems biology approach. Rapid responses to imposed temperature and atmospheric conditions were captured by continuous online photoacoustic ethylene measurements. Discrete destructive sampling was done to understand observed changes of ethylene biosynthesis at the transcriptional, translational and metabolic level. Application of the ethylene inhibitor 1-methylcyclopropene (1-MCP) allowed for the discrimination between ethylene-mediated changes and ethylene-independent changes related to the imposed conditions. Online ethylene measurements showed fast and slower responses during and after application of CA conditions. The changes in 1-aminocyclopropane-1-carboxylate synthase (ACS) activity were most correlated with changes in ACS1 expression and regulated the cold-induced increase in ethylene production during the early chilling phase. Transcription of ACS3 was found ethylene independent and was triggered upon warming of CA-stored apples. Increased expression of ACO1 during shelf life led to a strong increase in 1-aminocyclopropane-1-carboxylate oxidase (ACO) activity, required for the exponential production of ethylene during system 2. Expression of ACO2 and ACO3 was upregulated in 1-MCP-treated fruit showing a negative correlation with ethylene production. ACO activity never became rate limiting. PMID:23957643

  7. BODYGUARD is required for the biosynthesis of cutin in Arabidopsis.

    PubMed

    Jakobson, Liina; Lindgren, Leif Ove; Verdier, Gaëtan; Laanemets, Kristiina; Brosché, Mikael; Beisson, Fred; Kollist, Hannes

    2016-07-01

    The cuticle plays a critical role in plant survival during extreme drought conditions. There are, however, surprisingly, many gaps in our understanding of cuticle biosynthesis. An Arabidopsis thaliana T-DNA mutant library was screened for mutants with enhanced transpiration using a simple condensation spot method. Five mutants, named cool breath (cb), were isolated. The cb5 mutant was found to be allelic to bodyguard (bdg), which is affected in an α/β-hydrolase fold protein important for cuticle structure. The analysis of cuticle components in cb5 (renamed as bdg-6) and another T-DNA mutant allele (bdg-7) revealed no impairment in wax synthesis, but a strong decrease in total cutin monomer load in young leaves and flowers. Root suberin content was also reduced. Overexpression of BDG increased total leaf cutin monomer content nearly four times by affecting preferentially C18 polyunsaturated ω-OH fatty acids and dicarboxylic acids. Whole-plant gas exchange analysis showed that bdg-6 had higher cuticular conductance and rate of transpiration; however, plant lines overexpressing BDG resembled the wild-type with regard to these characteristics. This study identifies BDG as an important component of the cutin biosynthesis machinery in Arabidopsis. We also show that, using BDG, cutin can be greatly modified without altering the cuticular water barrier properties and transpiration. PMID:26990896

  8. Regulation of Serine, Glycine, and One-Carbon Biosynthesis.

    PubMed

    Stauffer, George V

    2004-12-01

    The biosynthesis of serine, glycine, and one-carbon (C1) units constitutes a major metabolic pathway in Escherichia coli and Salmonella enterica serovar Typhimurium. C1 units derived from serine and glycine are used in the synthesis of purines, histidine, thymine, pantothenate, and methionine and in the formylation of the aminoacylated initiator fMet-TRNAfMet used to start translation in E. coli and serovar Typhimurium. The need for serine, glycine, and C1 units in many cellular functions makes it necessary for the genes encoding enzymes for their synthesis to be carefully regulated to meet the changing demands of the cell for these intermediates. This review discusses the regulation of the following genes: serA, serB, and serC; gly gene; gcvTHP operon; lpdA; gcvA and gcvR; and gcvB genes. Threonine utilization (the Tut cycle) constitutes a secondary pathway for serine and glycine biosynthesis. L-Serine inhibits the growth of E. coli cells in GM medium, and isoleucine releases this growth inhibition. The E. coli glycine transport system (Cyc) has been shown to transport glycine, D-alanine, D-serine, and the antibiotic D-cycloserine. Transport systems often play roles in the regulation of gene expression, by transporting effector molecules into the cell, where they are sensed by soluble or membrane-bound regulatory proteins. PMID:26443363

  9. Gangliosides in the Nervous System: Biosynthesis and Degradation

    NASA Astrophysics Data System (ADS)

    Yu, Robert K.; Ariga, Toshio; Yanagisawa, Makoto; Zeng, Guichao

    Gangliosides, abundant in the nervous system, are known to play crucial modulatory roles in cellular recognition, interaction, adhesion, and signal transduction, particularly during early developmental stages. The expression of gangliosides in the nervous system is developmentally regulated and is closely related to the differentiation state of the cell. Ganglioside biosynthesis occurs in intracellular organelles, from which gangliosides are transported to the plasma membrane. During brain development, the ganglioside composition of the nervous system undergoes remarkable changes and is strictly regulated by the activities of glycosyltransferases, which can occur at different levels of control, including glycosyltransferase gene transcription and posttranslational modification. Genes for glycosyltransferase involved in ganglioside biosynthesis have been cloned and classified into families of glycosyltransferases based on their amino acid sequence similarities. The donor and acceptor substrate specificities are determined by enzymatic analysis of the glycosyltransferase gene products. Cell-type specific regulation of these genes has also been studied. Gangliosides are degraded by lysosomal exoglycosidases. The action of these enzymes occurs frequently in cooperation with activator proteins. Several human diseases are caused by defects of degradative enzymes, resulting in massive accumulation of certain glycolipids, including gangliosides in the lysosomal compartment and other organelles in the brain and visceral organs. Some of the representative lysosomal storage diseases (LSDs) caused by the accumulation of lipids in late endosomes and lysosomes will be discussed.

  10. Fungal biosynthesis of the bibenzoquinone oosporein to evade insect immunity.

    PubMed

    Feng, Peng; Shang, Yanfang; Cen, Kai; Wang, Chengshu

    2015-09-01

    Quinones are widely distributed in nature and exhibit diverse biological or pharmacological activities; however, their biosynthetic machineries are largely unknown. The bibenzoquinone oosporein was first identified from the ascomycete insect pathogen Beauveria bassiana>50 y ago. The toxin can also be produced by different plant pathogenic and endophytic fungi with an array of biological activities. Here, we report the oosporein biosynthetic machinery in fungi, a polyketide synthase (PKS) pathway including seven genes for quinone biosynthesis. The PKS oosporein synthase 1 (OpS1) produces orsellinic acid that is hydroxylated to benzenetriol by the hydroxylase OpS4. The intermediate is oxidized either nonenzymatically to 5,5'-dideoxy-oosporein or enzymatically to benzenetetrol by the putative dioxygenase OpS7. The latter is further dimerized to oosporein by the catalase OpS5. The transcription factor OpS3 regulates intrapathway gene expression. Insect bioassays revealed that oosporein is required for fungal virulence and acts by evading host immunity to facilitate fungal multiplication in insects. These results contribute to the known mechanisms of quinone biosynthesis and the understanding of small molecules deployed by fungi that interact with their hosts. PMID:26305932

  11. Iterative type I polyketide synthases for enediyne core biosynthesis.

    PubMed

    Horsman, Geoffrey P; Van Lanen, Steven G; Shen, Ben

    2009-01-01

    Enediyne natural products are extremely potent antitumor antibiotics with a remarkable core structure consisting of two acetylenic groups conjugated to a double bond within either a 9- or 10-membered ring. Biosynthesis of this fascinating scaffold is catalyzed in part by an unusual iterative type I polyketide synthase, PKSE, that is shared among all enediyne biosynthetic pathways whose gene clusters have been sequenced to date. The PKSE is unusual in two main respects: (1) it contains an acyl carrier protein (ACP) domain with no sequence homology to any known proteins, and (2) it is self-phosphopantetheinylated by an integrated phosphopantetheinyl transferase (PPTase) domain. The unusual domain architecture and biochemistry of the PKSE hold promise both for the rapid identification of new enediyne natural products and for obtaining fundamental catalytic insights into enediyne biosynthesis. This chapter describes methods for rapid PCR-based classification of conserved enediyne biosynthetic genes, heterologous production of 9-membered PKSE proteins and isolation of the resulting polyene product, and in vitro characterization of the PKSE ACP domain. PMID:19362637

  12. Biosynthesis of Selenocysteine on Its tRNA in Eukaryotes

    PubMed Central

    Mix, Heiko; Zhang, Yan; Saira, Kazima; Glass, Richard S; Berry, Marla J; Gladyshev, Vadim N; Hatfield, Dolph L

    2007-01-01

    Selenocysteine (Sec) is cotranslationally inserted into protein in response to UGA codons and is the 21st amino acid in the genetic code. However, the means by which Sec is synthesized in eukaryotes is not known. Herein, comparative genomics and experimental analyses revealed that the mammalian Sec synthase (SecS) is the previously identified pyridoxal phosphate-containing protein known as the soluble liver antigen. SecS required selenophosphate and O-phosphoseryl-tRNA[Ser]Sec as substrates to generate selenocysteyl-tRNA[Ser]Sec. Moreover, it was found that Sec was synthesized on the tRNA scaffold from selenide, ATP, and serine using tRNA[Ser]Sec, seryl-tRNA synthetase, O-phosphoseryl-tRNA[Ser]Sec kinase, selenophosphate synthetase, and SecS. By identifying the pathway of Sec biosynthesis in mammals, this study not only functionally characterized SecS but also assigned the function of the O-phosphoseryl-tRNA[Ser]Sec kinase. In addition, we found that selenophosphate synthetase 2 could synthesize monoselenophosphate in vitro but selenophosphate synthetase 1 could not. Conservation of the overall pathway of Sec biosynthesis suggests that this pathway is also active in other eukaryotes and archaea that synthesize selenoproteins. PMID:17194211

  13. Formation of a Ternary Complex for Selenocysteine Biosynthesis in Bacteria.

    PubMed

    Silva, Ivan R; Serrão, Vitor H B; Manzine, Livia R; Faim, Lívia M; da Silva, Marco T A; Makki, Raphaela; Saidemberg, Daniel M; Cornélio, Marinônio L; Palma, Mário S; Thiemann, Otavio H

    2015-12-01

    The synthesis of selenocysteine-containing proteins (selenoproteins) involves the interaction of selenocysteine synthase (SelA), tRNA (tRNA(Sec)), selenophosphate synthetase (SelD, SPS), a specific elongation factor (SelB), and a specific mRNA sequence known as selenocysteine insertion sequence (SECIS). Because selenium compounds are highly toxic in the cellular environment, the association of selenium with proteins throughout its metabolism is essential for cell survival. In this study, we demonstrate the interaction of SPS with the SelA-tRNA(Sec) complex, resulting in a 1.3-MDa ternary complex of 27.0 ± 0.5 nm in diameter and 4.02 ± 0.05 nm in height. To assemble the ternary complex, SPS undergoes a conformational change. We demonstrated that the glycine-rich N-terminal region of SPS is crucial for the SelA-tRNA(Sec)-SPS interaction and selenoprotein biosynthesis, as revealed by functional complementation experiments. Taken together, our results provide new insights into selenoprotein biosynthesis, demonstrating for the first time the formation of the functional ternary SelA-tRNA(Sec)-SPS complex. We propose that this complex is necessary for proper selenocysteine synthesis and may be involved in avoiding the cellular toxicity of selenium compounds. PMID:26378233

  14. Truffle volatiles: from chemical ecology to aroma biosynthesis.

    PubMed

    Splivallo, Richard; Ottonello, Simone; Mello, Antonietta; Karlovsky, Petr

    2011-02-01

    Truffles (Tuber spp.) are symbiotic fungi that develop underground in association with plant roots. Food connoisseurs describe their scent as sensual, seductive and unique. These mysterious fungi, however, do not produce their aroma for the mere pleasure of humans. Truffle volatiles act as odorant cues for mammals and insects which are thus able to locate the precious fungi underground and spread their spores. They also freely diffuse in the soil and mediate interactions with microorganisms and plant roots, potentially regulating a complex molecular dialogue among soil fauna and flora. The aim of this review is to synthesize 30 yr of research on truffle volatiles, spanning fields of study from chemical ecology to aroma biosynthesis. Specific aspects of truffle volatile ecology and biology will be discussed, including which species have been studied so far and for what purpose, what ecological role has been demonstrated or speculated to exist for specific truffle volatiles, which volatiles are common or unique to certain species and what their biosynthetic route might be. Future challenges in truffle aroma research will also be addressed, focusing on how high-throughput post-genomic technologies may advance our understanding of truffle aroma biosynthesis and chemical ecology. PMID:21287717

  15. GROWTH RETARDANTS: Effects on Gibberellin Biosynthesis and Other Metabolic Pathways.

    PubMed

    Rademacher, Wilhelm

    2000-06-01

    Plant growth retardants are applied in agronomic and horticultural crops to reduce unwanted longitudinal shoot growth without lowering plant productivity. Most growth retardants act by inhibiting gibberellin (GA) biosynthesis. To date, four different types of such inhibitors are known: (a) Onium compounds, such as chlormequat chloride, mepiquat chloride, chlorphonium, and AMO-1618, which block the cyclases copalyl-diphosphate synthase and ent-kaurene synthase involved in the early steps of GA metabolism. (b) Compounds with an N-containing heterocycle, e.g. ancymidol, flurprimidol, tetcyclacis, paclobutrazol, uniconazole-P, and inabenfide. These retardants block cytochrome P450-dependent monooxygenases, thereby inhibiting oxidation of ent-kaurene into ent-kaurenoic acid. (c) Structural mimics of 2-oxoglutaric acid, which is the co-substrate of dioxygenases that catalyze late steps of GA formation. Acylcyclohexanediones, e.g. prohexadione-Ca and trinexapac-ethyl and daminozide, block particularly 3ss-hydroxylation, thereby inhibiting the formation of highly active GAs from inactive precursors, and (d) 16,17-Dihydro-GA5 and related structures act most likely by mimicking the GA precursor substrate of the same dioxygenases. Enzymes, similar to the ones involved in GA biosynthesis, are also of importance in the formation of abscisic acid, ethylene, sterols, flavonoids, and other plant constituents. Changes in the levels of these compounds found after treatment with growth retardants can mostly be explained by side activities on such enzymes. PMID:15012200

  16. [Biosynthesis and endocrine regulation of sex pheromones in moth].

    PubMed

    Wang, Bo; Lin, Xin-da; Du, Yong-jun

    2015-10-01

    The crucial importance of sex pheromones in driving mating behaviors in moths has been well demonstrated in the process of sexual communication between individuals that produce and recognize species specific pheromones. Sex-pheromone molecules from different moth species are chemically characteristic, showing different terminal functional groups, various carbon chain lengths, different position and configuration of double bond system. This review summarized information on the biosynthetic pathways and enzymes involved in producing pheromone molecules in different moths. Then we listed the components and their ratios in the sex pheromones of 15 moth species belonging to different subfamilies in Noctuidae. We also discussed the various viewpoints regarding how sex pheromones with specific ratios are produced. In the discussion we attempted to classify the pheromone molecules based on their producers, characteristics of their functional groups and carbon chain lengths. In particular, composition and ratio variations of pheromones in closely related species or within a species were compared, and the possible molecular mechanisms for these variations and their evolutionary significance were discussed. Finally, we reviewed the endocrine regulation and signal transduction pathways, in which the pheromone biosynthesis activating neuropeptide (PBAN) is involved. Comparing the biosynthetic pathways of sex pheromones among different species, this article aimed to reveal the common principles in pheromone biosynthesis among moth species and the characteristic features associated with the evolutionary course of individual species. Subsequently, some future research directions were proposed. PMID:26995936

  17. Traumatic Retrolisthesis of L5 and L5/S1 Extruded Disc Herniation; A Case Report and Review of the Literature

    PubMed Central

    Pourabbas, Babak; Effani, Mohammad Ali; Namdari, Asghar

    2016-01-01

    Traumatic retrolisthesis is a rare injury and may result in intervertebral disc extrusion and nerve root injury. These injuries are highly unstable and require surgery for decompression and stabilization. Traumatic retrolisthesis of L5 with acute L5/S1 disc extrusion associated with nerve root injury has not been reported previously in English literatures. We herein report a case of traumatic retrolisthesis of L5 and extruded disc. A 22 year-old patient presented with lower extremity weakness due to L5/S1 retrolisthesis and traumatic acute L5/S1 disc extrusion after falling of 8 meters height. The patient underwent surgical decompression and reduction with instrumentation. Accordingly complete recovery of neurologic deficit was occurred. Therefore, early decompression of the nerve roots followed by circumferential instrumentation and fusion of the involved segment results in dramatic improvement in neurologic symptoms.  PMID:27540553

  18. Molecular confirmation of the genomic constitution of Douglasdeweya (Triticeae: Poaceae): demonstration of the utility of the 5S rDNA sequence as a tool for haplome identification.

    PubMed

    Baum, Bernard R; Johnson, Douglas A

    2008-06-01

    A new genus Douglasdeweya containing the two species, Douglasdeweya deweyi and D. wangii was published in 2005 by Yen et al. based upon the results of cytogenetical and morphological findings. The genome constitution of Douglasdeweya-PPStSt-allowed its segregation from the genus Pseudoroegneria which contains the StSt or StStStSt genomes. Our previous work had demonstrated the utility of using 5S rDNA units, especially the non-transcribed spacer sequence variation, for the resolution of genomes (haplomes) previously established by cytology. Here, we show that sequence analysis of the 5S DNA units from these species strongly supports the proposed species relationships of Yen et al. (Can J Bot 83:413-419, 2005), i.e., the PP genome from Agropyron and the StSt genome from Pseudoroegneria. Analysis of the 5S rDNA units constitutes a powerful tool for genomic research especially in the Triticeae. PMID:18421479

  19. Traumatic Retrolisthesis of L5 and L5/S1 Extruded Disc Herniation; A Case Report and Review of the Literature.

    PubMed

    Pourabbas, Babak; Effani, Mohammad Ali; Namdari, Asghar

    2016-07-01

    Traumatic retrolisthesis is a rare injury and may result in intervertebral disc extrusion and nerve root injury. These injuries are highly unstable and require surgery for decompression and stabilization. Traumatic retrolisthesis of L5 with acute L5/S1 disc extrusion associated with nerve root injury has not been reported previously in English literatures. We herein report a case of traumatic retrolisthesis of L5 and extruded disc. A 22 year-old patient presented with lower extremity weakness due to L5/S1 retrolisthesis and traumatic acute L5/S1 disc extrusion after falling of 8 meters height. The patient underwent surgical decompression and reduction with instrumentation. Accordingly complete recovery of neurologic deficit was occurred. Therefore, early decompression of the nerve roots followed by circumferential instrumentation and fusion of the involved segment results in dramatic improvement in neurologic symptoms. PMID:27540553

  20. Isolation and analysis of (Gp)nXp sequences of rat liver 5S RNA by means of restricted ribonuclease T2 hydrolysis

    PubMed Central

    Willems, R.; Avdonina, T.; Lund, A.; Kisselev, L.L.

    1974-01-01

    Essentual difficulties arise when base number in oligoguanylic blocks and location of these blocks along the polynucleotide chain need to be determined in the course of determination of the nucleotide sequences in ribonucleic acids. To overcome this difficulty it is suggested to take advantage of a recently discovered resistance of phosphodiester bond between kethoxalated G and its 3′-neighbour against T2 RNase hydrolysis 1,2. The approach is illustrated by analysis of 5S RNA from rat liver. Sequences of general formula (Gp)nXp were isolated from T2 RNase hydrolysate of 5 S RNA rapidly and quantitatively. The information obtained greatly facilitates the whole procedure of sequencing. It is expected that the method proposed would be effective for analysis of 5 S and 4 S RNA and for highmolecular weight fragments of ribosomal and viral RNAs. PMID:4453523