Science.gov

Sample records for 5s clavam biosynthesis

  1. 5S clavam biosynthesis is controlled by an atypical two-component regulatory system in Streptomyces clavuligerus.

    PubMed

    Kwong, Thomas; Zelyas, Nathan J; Cai, Hui; Tahlan, Kapil; Wong, Annie; Jensen, Susan E

    2012-09-01

    Streptomyces clavuligerus produces a collection of five clavam metabolites, including the clinically important β-lactamase inhibitor clavulanic acid, as well as four structurally related metabolites called 5S clavams. The paralogue gene cluster of S. clavuligerus is one of three clusters of genes for the production of these clavam metabolites. A region downstream of the cluster was analyzed, and snk, res1, and res2, encoding elements of an atypical two-component regulatory system, were located. Mutation of any one of the three genes had no effect on clavulanic acid production, but snk and res2 mutants produced no 5S clavams, whereas res1 mutants overproduced 5S clavams. Reverse transcriptase PCR analyses showed that transcription of cvm7p (which encodes a transcriptional activator of 5S clavam biosynthesis) and 5S clavam biosynthetic genes was eliminated in snk and in res2 mutants but that snk and res2 transcription was unaffected in a cvm7p mutant. Both snk and res2 mutants could be complemented by introduction of cvm7p under the control of an independently regulated promoter. In vitro assays showed that Snk can autophosphorylate and transfer its phosphate group to both Res1 and Res2, and Snk-H365, Res1-D52, and Res2-D52 were identified as the phosphorylation sites for the system. Dephosphorylation assays indicated that Res1 stimulates dephosphorylation of Res2∼P. These results suggest a regulatory cascade in which Snk and Res2 form a two-component system controlling cvm7p transcription, with Res1 serving as a checkpoint to modulate phosphorylation levels. Cvm7P then activates transcription of 5S clavam biosynthetic genes.

  2. Genes Specific for the Biosynthesis of Clavam Metabolites Antipodal to Clavulanic Acid Are Clustered with the Gene for Clavaminate Synthase 1 in Streptomyces clavuligerus

    PubMed Central

    Mosher, Roy H.; Paradkar, Ashish S.; Anders, Cecilia; Barton, Barry; Jensen, Susan E.

    1999-01-01

    Portions of the Streptomyces clavuligerus chromosome flanking cas1, which encodes the clavaminate synthase 1 isoenzyme (CAS1), have been cloned and sequenced. Mutants of S. clavuligerus disrupted in cvm1, the open reading frame located immediately upstream of cas1, were constructed by a gene replacement procedure. Similar techniques were used to generate S. clavuligerus mutants carrying a deletion that encompassed portions of the two open reading frames, cvm4 and cvm5, located directly downstream of cas1. Both classes of mutants still produced clavulanic acid and cephamycin C but lost the ability to synthesize the antipodal clavam metabolites clavam-2-carboxylate, 2-hydroxymethyl-clavam, and 2-alanylclavam. These results suggested that cas1 is clustered with genes essential and specific for clavam metabolite biosynthesis. When a cas1 mutant of S. clavuligerus was constructed by gene replacement, it produced lower levels of both clavulanic acid and most of the antipodal clavams except for 2-alanylclavam. However, a double mutant of S. clavuligerus disrupted in both cas1 and cas2 produced neither clavulanic acid nor any of the antipodal clavams, including 2-alanylclavam. This outcome was consistent with the contribution of both CAS1 and CAS2 to a common pool of clavaminic acid that is shunted toward clavulanic acid and clavam metabolite biosynthesis. PMID:10223939

  3. The Paralogous Pairs of Genes Involved in Clavulanic Acid and Clavam Metabolite Biosynthesis Are Differently Regulated in Streptomyces clavuligerus

    PubMed Central

    Tahlan, Kapil; Anders, Cecilia; Jensen, Susan E.

    2004-01-01

    Carboxyethylarginine synthase, encoded by the paralogous ceaS1 and ceaS2 genes, catalyzes the first reaction in the shared biosynthetic pathway leading to clavulanic acid and the other clavam metabolites in Streptomyces clavuligerus. The nutritional regulation of ceaS1 and ceaS2 expression was analyzed by reverse transcriptase PCR and by the use of the enhanced green fluorescent protein-encoding gene (egfp) as a reporter. ceaS1 was transcribed in complex soy medium only, whereas ceaS2 was transcribed in both soy and defined starch-asparagine (SA) media. The transcriptional start points of the two genes were also mapped to a C residue 98 bp upstream of ceaS1 and a G residue 51 bp upstream of the ceaS2 start codon by S1 nuclease protection and primer extension analyses. Furthermore, transcriptional mapping of the genes encoding the beta-lactam synthetase (bls1) and proclavaminate amidinohydrolase (pah1) isoenzymes from the paralogue gene cluster indicated that a single polycistronic transcript of ∼4.9 kb includes ceaS1, bls1, and pah1. The expression of ceaS1 and ceaS2 in a mutant strain defective in the regulatory protein CcaR was also examined. ceaS1 transcription was not affected in the ccaR mutant, whereas that of ceaS2 was greatly reduced compared to the wild-type strain. Overall, our results suggest that different mechanisms are involved in regulating the expression of ceaS1 and ceaS2, and presumably also of other paralogous genes that encode proteins involved in the early stages of clavulanic acid and clavam metabolite biosynthesis. PMID:15342599

  4. Two Sets of Paralogous Genes Encode the Enzymes Involved in the Early Stages of Clavulanic Acid and Clavam Metabolite Biosynthesis in Streptomyces clavuligerus

    PubMed Central

    Tahlan, Kapil; Park, Hyeon Ung; Wong, Annie; Beatty, Perrin H.; Jensen, Susan E.

    2004-01-01

    Recently, a second copy of a gene encoding proclavaminate amidinohydrolase (pah1), an enzyme involved in the early stages of clavulanic acid and clavam metabolite biosynthesis in Streptomyces clavuligerus, was identified and isolated. Using Southern analysis, we have now isolated second copies of the genes encoding the carboxyethylarginine synthase (ceaS) and β-lactam synthetase (bls) enzymes. These new paralogues are given the gene designations ceaS1 and bls1 and are located immediately upstream of pah1 on the chromosome. Furthermore, sequence analysis of the region downstream of pah1 revealed a second copy of a gene encoding ornithine acetyltransferase (oat1), thus indicating the presence of a cluster of paralogue genes. ceaS1, bls1, and oat1 display 73, 60, and 63% identities, respectively, at the nucleotide level to the original ceaS2, bls2, and oat2 genes from the clavulanic acid gene cluster. Single mutants defective in ceaS1, bls1, or oat1 were prepared and characterized and were found to be affected to variable degrees in their ability to produce clavulanic acid and clavam metabolites. Double mutants defective in both copies of the genes were also prepared and tested. The ceaS1/ceaS2 and the bls1/bls2 mutant strains were completely blocked in clavulanic acid and clavam metabolite biosynthesis. On the other hand, oat1/oat2 double mutants still produced some clavulanic acid and clavam metabolites. This may be attributed to the presence of the argJ gene in S. clavuligerus, which encodes yet another ornithine acetyltransferase enzyme that may be able to compensate for the lack of OAT1 and -2 in the double mutants. PMID:14982786

  5. Inversion of the stereochemical configuration (3S, 5S)-clavaminic acid into (3R, 5R)-clavulanic acid: A computationally-assisted approach based on experimental evidence.

    PubMed

    Ramirez-Malule, Howard; Restrepo, Albeiro; Cardona, Wilson; Junne, Stefan; Neubauer, Peter; Rios-Estepa, Rigoberto

    2016-04-21

    Clavulanic acid (CA), a potent inhibitor of β-lactamase enzymes, is produced by Streptomyces clavuligerus (Sc) cultivation processes, for which low yields are commonly obtained. Improved knowledge of the clavam biosynthetic pathway, especially the steps involved in the inversion of 3S-5S into 3R-5R stereochemical configuration, would help to eventually identify bottlenecks in the pathway. In this work, we studied the role of acetate in CA biosynthesis by a combined continuous culture and computational simulation approach. From this we derived a new model for the synthesis of N-acetyl-glycyl-clavaminic acid (NAG-clavam) by Sc. Acetylated compounds, such as NAG-clavam and N-acetyl-clavaminic acid, have been reported in the clavam pathway. Although the acetyl group is present in the β-lactam intermediate NAG-clavam, it is unknown how this group is incorporated. Hence, under the consideration of the experimentally proven accumulation of acetate during CA biosynthesis, and the fact that an acetyl group is present in the NAG-clavam structure, a computational evaluation of the tentative formation of NAG-clavam was performed for the purpose of providing further understanding. The proposed reaction mechanism consists of two steps: first, acetate reacts with ATP to produce a reactive acylphosphate intermediate; second, a direct nucleophilic attack of the terminal amino group of N-glycyl-clavaminic on the carbonyl carbon of the acylphosphate intermediate leads to a tetrahydral intermediate, which collapses and produces ADP and N-acetyl-glycyl-clavaminic acid. The calculations suggest that for the proposed reaction mechanism, the reaction proceeds until completion of the first step, without the direct action of an enzyme, where acetate and ATP are involved. For this step, the computed activation energy was ≅2.82kcal/mol while the reaction energy was ≅2.38kcal/mol. As this is an endothermic chemical process with a relatively small activation energy, the reaction rate

  6. Inversion of the stereochemical configuration (3S, 5S)-clavaminic acid into (3R, 5R)-clavulanic acid: A computationally-assisted approach based on experimental evidence.

    PubMed

    Ramirez-Malule, Howard; Restrepo, Albeiro; Cardona, Wilson; Junne, Stefan; Neubauer, Peter; Rios-Estepa, Rigoberto

    2016-04-21

    Clavulanic acid (CA), a potent inhibitor of β-lactamase enzymes, is produced by Streptomyces clavuligerus (Sc) cultivation processes, for which low yields are commonly obtained. Improved knowledge of the clavam biosynthetic pathway, especially the steps involved in the inversion of 3S-5S into 3R-5R stereochemical configuration, would help to eventually identify bottlenecks in the pathway. In this work, we studied the role of acetate in CA biosynthesis by a combined continuous culture and computational simulation approach. From this we derived a new model for the synthesis of N-acetyl-glycyl-clavaminic acid (NAG-clavam) by Sc. Acetylated compounds, such as NAG-clavam and N-acetyl-clavaminic acid, have been reported in the clavam pathway. Although the acetyl group is present in the β-lactam intermediate NAG-clavam, it is unknown how this group is incorporated. Hence, under the consideration of the experimentally proven accumulation of acetate during CA biosynthesis, and the fact that an acetyl group is present in the NAG-clavam structure, a computational evaluation of the tentative formation of NAG-clavam was performed for the purpose of providing further understanding. The proposed reaction mechanism consists of two steps: first, acetate reacts with ATP to produce a reactive acylphosphate intermediate; second, a direct nucleophilic attack of the terminal amino group of N-glycyl-clavaminic on the carbonyl carbon of the acylphosphate intermediate leads to a tetrahydral intermediate, which collapses and produces ADP and N-acetyl-glycyl-clavaminic acid. The calculations suggest that for the proposed reaction mechanism, the reaction proceeds until completion of the first step, without the direct action of an enzyme, where acetate and ATP are involved. For this step, the computed activation energy was ≅2.82kcal/mol while the reaction energy was ≅2.38kcal/mol. As this is an endothermic chemical process with a relatively small activation energy, the reaction rate

  7. Biosynthesis of resorcylic acid lactone (5S)-5-hydroxylasiodiplodin in Lasiodiplodia theobromae.

    PubMed

    Kashima, Takasumi; Takahashi, Kosaku; Matsuura, Hideyuki; Nabeta, Kensuke

    2009-11-01

    An administration study of (2)H-labeled precursors showed that the 9-hydroxydecanoyl unit, the acyl intermediate of lasiodiplodin (1), was also the intermediate of (5S)-5-hydroxylasiodiplodin (2) in Lasiodiplodia theobromae. The incorporation of [O-methyl-(2)H(3)]-lasiodiplodin (6) into 2 indicated that hydroxylation at C-5 occurred after cyclization. PMID:19897901

  8. Clavulanic acid biosynthesis and genetic manipulation for its overproduction.

    PubMed

    Song, Ju Yeon; Jensen, Susan E; Lee, Kye Joon

    2010-10-01

    Clavulanic acid, a β-lactamase inhibitor, is used together with β-lactam antibiotics to create drug mixtures possessing potent antimicrobial activity. In view of the clinical and industrial importance of clavulanic acid, identification of the clavulanic acid biosynthetic pathway and the associated gene cluster(s) in the main producer species, Streptomyces clavuligerus, has been an intriguing research question. Clavulanic acid biosynthesis was revealed to involve an interesting mechanism common to all of the clavam metabolites produced by the organism, but different from that of other β-lactam compounds. Gene clusters involved in clavulanic acid biosynthesis in S. clavuligerus occupy large regions of nucleotide sequence in three loci of its genome. In this review, clavulanic acid biosynthesis and the associated gene clusters are discussed, and clavulanic acid improvement through genetic manipulation is explained.

  9. Chaperoning 5S RNA assembly.

    PubMed

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-07-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit.

  10. Chaperoning 5S RNA assembly

    PubMed Central

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-01-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998

  11. Enzymes Catalyzing the Early Steps of Clavulanic Acid Biosynthesis Are Encoded by Two Sets of Paralogous Genes in Streptomyces clavuligerus

    PubMed Central

    Jensen, Susan E.; Elder, Kenneth J.; Aidoo, Kwamena A.; Paradkar, Ashish S.

    2000-01-01

    Genes encoding the proteins required for clavulanic acid biosynthesis and for cephamycin biosynthesis are grouped into a “supercluster” in Streptomyces clavuligerus. Nine open reading frames (ORFs) associated with clavulanic acid biosynthesis were located in a 15-kb segment of the supercluster, including six ORFs encoding known biosynthetic enzymes or regulatory proteins, two ORFs that have been reported previously but whose involvement in clavulanic acid biosynthesis is unclear, and one ORF not previously reported. Evidence for the involvement of these ORFs in clavulanic acid production was obtained by generating mutants and showing that all were defective for clavulanic acid production when grown on starch asparagine medium. However, when five of the nine mutants, including mutants defective in known clavulanic acid biosynthetic enzymes, were grown in a soy-based medium, clavulanic acid-producing ability was restored. This ability to produce clavulanic acid when seemingly essential biosynthetic enzymes have been mutated suggests that paralogous genes encoding functionally equivalent proteins exist for each of the five genes but that these paralogues are expressed only in the soy-based medium. The five genes that have paralogues encode proteins involved in the early steps of the pathway common to the biosynthesis of both clavulanic acid and the other clavam metabolites produced by this organism. No evidence was seen for paralogues of the four remaining genes involved in late, clavulanic acid-specific steps in the pathway. PMID:10681345

  12. Auxin Biosynthesis

    PubMed Central

    Zhao, Yunde

    2014-01-01

    lndole-3-acetic acid (IAA), the most important natural auxin in plants, is mainly synthesized from the amino acid tryptophan (Trp). Recent genetic and biochemical studies in Arabidopsis have unambiguously established the first complete Trp-dependent auxin biosynthesis pathway. The first chemical step of auxin biosynthesis is the removal of the amino group from Trp by the TRYPTOPHAN AMINOTRANSFERASE OF ARABIDOPSIS (TAA) family of transaminases to generate indole-3-pyruvate (IPA). IPA then undergoes oxidative decarboxylation catalyzed by the YUCCA (YUC) family of flavin monooxygenases to produce IAA. This two-step auxin biosynthesis pathway is highly conserved throughout the plant kingdom and is essential for almost all of the major developmental processes. The successful elucidation of a complete auxin biosynthesis pathway provides the necessary tools for effectively modulating auxin concentrations in plants with temporal and spatial precision. The progress in auxin biosynthesis also lays a foundation for understanding polar auxin transport and for dissecting auxin signaling mechanisms during plant development. PMID:24955076

  13. 5S rRNA and ribosome.

    PubMed

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  14. β-Lactam formation by a non-ribosomal peptide synthetase during antibiotic biosynthesis

    PubMed Central

    Gaudelli, Nicole M.; Long, Darcie H.; Townsend, Craig A.

    2014-01-01

    Non-ribosomal peptide synthetases (NRPSs) are giant enzymes comprised of modules that house repeated sets of functional domains, which select, activate and couple amino acids drawn from a pool of nearly 500 potential building blocks.1 The structurally and stereochemically diverse peptides generated in this manner underlie the biosynthesis of a large sector of natural products. Many of their derived metabolites are bioactive such as the antibiotics vancomycin, bacitracin, daptomycin and the β-lactam-containing penicillins, cephalosporins and nocardicins. Although penicillins and cephalosporins are synthesised from a classically derived NRPS tripeptide (from ACVS, δ-(L-α-aminoadipyl)–L-cysteinyl–D-valine synthetase)2, we now report an unprecedented NRPS activity to both assemble a serine-containing peptide and mediate its cyclisation to the critical β-lactam ring of the nocardicin family of antibiotics. A histidine-rich condensation (C) domain, which typically carries out peptide bond formation during product assembly, was found to also synthesise the embedded 4-membered ring. Here, a mechanism is proposed and supporting experiments are described, which is distinct from the pathways that have evolved to the three other β-lactam antibiotic families: penicillin/cephalosporins, clavams and carbapenems. These findings raise the possibility that β-lactam rings can be regio- and stereospecifically integrated into engineered peptides for application as, for example, targeted protease inactivators.3,4 PMID:25624104

  15. The 5S genes of Drosophila melanogaster.

    PubMed

    Artavanis-Tsakonas, S; Schedl, P; Tschudi, C; Pirrotta, V; Steward, R; Gehring, W J

    1977-12-01

    We have cloned embryonic Drosophila DNA using the poly (dA-DT) connector method (Lobban and Kaiser, 1973) and the ampicillin-resistant plasmid pSF2124 (So, Gill and Falkow, 1975) as a cloning vehicle. Two clones, containing hybrid plasmids with sequences complementary to a 5S RNA probe isolated from Drosophila tissue culture cells, were identified by the Grunstein and Hogness (1975) colony hybridization procedure. One hybrid plasmid has a Drosophila insert which is comprised solely of tandem repeats of the 5S gene plus spacer sequences. The other plasmid contains an insert which has about 20 tandem 5S repeat units plus an additional 4 kilobases of adjacent sequences. The size of the 5S repeat unit was determined by gel electrophoresis and was found to be approximately 375 base pairs. We present a restriction map of both plasmids, and a detailed map of of the5S repeat unit. The 5S repat unit shows slight length and sequence heterogeneity. We present evidence suggesting that the 5S genes in Drosophila melanogaster may be arranged in a single continuous cluster. PMID:413625

  16. Generalized oscillator strengths for 5s, 5s{sup '}, and 5p excitations of krypton

    SciTech Connect

    Li Wenbin; Zhu Linfan; Yuan Zhensheng; Sun Jianmin; Cheng Huadong; Xu Kezun; Zhong Zhiping; Liu Xiaojing

    2003-06-01

    The absolute generalized oscillator strengths (GOSs) for 5s, 5s{sup '}, 5p [5/2]{sub 3,2}, 5p [3/2]{sub 1,2}, and 5p [1/2]{sub 0} transitions of krypton have been determined in a large K{sup 2} region at a high electron-impact energy of 2500 eV. The positions of the minima and maxima of these GOSs have been determined. The present results show that the angular resolution and pressure effect have great influence on the position and the amplitude of the minimum for the GOS of 5s+5s{sup '} transitions. When these effects are considered, the measured minimum position for the GOS of 5s+5s{sup '} transitions is in excellent agreement with the calculation of Chen and Msezane [J. Phys. B 33, 5397 (2000)].

  17. Oligomeric structure of proclavaminic acid amidino hydrolase: evolution of a hydrolytic enzyme in clavulanic acid biosynthesis.

    PubMed Central

    Elkins, Jonathan M; Clifton, Ian J; Hernández, Helena; Doan, Linh X; Robinson, Carol V; Schofield, Christopher J; Hewitson, Kirsty S

    2002-01-01

    During biosynthesis of the clinically used beta-lactamase inhibitor clavulanic acid, one of the three steps catalysed by clavaminic acid synthase is separated from the other two by a step catalysed by proclavaminic acid amidino hydrolase (PAH), in which the guanidino group of an intermediate is hydrolysed to give proclavaminic acid and urea. PAH shows considerable sequence homology with the primary metabolic arginases, which hydrolyse arginine to ornithine and urea, but does not accept arginine as a substrate. Like other members of the bacterial sub-family of arginases, PAH is hexameric in solution and requires Mn2+ ions for activity. Other metal ions, including Co2+, can substitute for Mn2+. Two new substrates for PAH were identified, N-acetyl-(L)-arginine and (3R)-hydroxy-N-acetyl-(L)-arginine. Crystal structures of PAH from Streptomyces clavuligerus (at 1.75 A and 2.45 A resolution, where 1 A=0.1 nm) imply how it binds beta-lactams rather than the amino acid substrate of the arginases from which it evolved. The structures also suggest how PAH selects for a particular alcohol intermediate in the clavam biosynthesis pathway. As observed for the arginases, each PAH monomer consists of a core of beta-strands surrounded by alpha-helices, and its active site contains a di-Mn2+ centre with a bridging water molecule responsible for hydrolytic attack on to the guanidino group of the substrate. Comparison of structures obtained under different conditions reveals different conformations of a flexible loop, which must move to allow substrate binding. PMID:12020346

  18. Eukaryotic 5S rRNA biogenesis

    PubMed Central

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  19. Analysis of the 5S RNA pool in Arabidopsis thaliana: RNAs are heterogeneous and only two of the genomic 5S loci produce mature 5S RNA.

    PubMed

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5'- and 3'-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array.

  20. {upsilon}(5S) Results from CLEO

    SciTech Connect

    Pavlunin, Victor

    2006-07-11

    Using the CLEO detector at the Cornell Electron Storage Ring, we have observed the Bs meson in e+e- annihilation at the {upsilon}(5S) resonance. We have fully reconstructed 14 candidates consistent with Bs decays into final states with a J/{psi} or a D{sub s}{sup (*)-}. The probability that this is a background fluctuation is less than 8 x 10-10. We have established that Bs production proceeds predominantly through the creation of B{sub s}*B-bar{sub s}* pairs with {sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s}*) =0[ .11{sub -0.03}{sup +0.04}(stat) {+-} 0.02(syst)] nb. The following limits are set: {sigma}(e{sup +}e{sup -} {yields} B{sub s}B-bar{sub s})/{sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s}*) < 0.16 and [{sigma}(e{sup +}e{sup -} {yields} B{sub s}B-bar{sub s}*) + {sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s})]/{sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s}*) < 0.16 (90% CL). In a separate analysis, by comparing production rates of D{sub s}{sup +} mesons in {upsilon}(5S) and {upsilon}(4S) decays, an estimate of the ratio of B{sub s}{sup (*)} B-bar{sub s}{sup (*)} to the total bb-bar quark pair production at the {upsilon}(5S) energy of (16 {+-} 3 {+-} 6)% is obtained.

  1. Compilation of 5S rRNA and 5S rRNA gene sequences

    PubMed Central

    Specht, Thomas; Wolters, Jörn; Erdmann, Volker A.

    1990-01-01

    The BERLIN RNA DATABANK as of Dezember 31, 1989, contains a total of 667 sequences of 5S rRNAs or their genes, which is an increase of 114 new sequence entries over the last compilation (1). It covers sequences from 44 archaebacteria, 267 eubacteria, 20 plastids, 6 mitochondria, 319 eukaryotes and 11 eukaryotic pseudogenes. The hardcopy shows only the list (Table 1) of those organisms whose sequences have been determined. The BERLIN RNA DATABANK uses the format of the EMBL Nucleotide Sequence Data Library complemented by a Sequence Alignment (SA) field including secondary structure information. PMID:1692116

  2. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    NASA Technical Reports Server (NTRS)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  3. Trypanosome Glycosylphosphatidylinositol Biosynthesis

    PubMed Central

    Kinoshita, Taroh

    2009-01-01

    Trypanosoma brucei, a protozoan parasite, causes sleeping sickness in humans and Nagana disease in domestic animals in central Africa. The trypanosome surface is extensively covered by glycosylphosphatidylinositol (GPI)-anchored proteins known as variant surface glycoproteins and procyclins. GPI anchoring is suggested to be important for trypanosome survival and establishment of infection. Trypanosomes are not only pathogenically important, but also constitute a useful model for elucidating the GPI biosynthesis pathway. This review focuses on the trypanosome GPI biosynthesis pathway. Studies on GPI that will be described indicate the potential for the design of drugs that specifically inhibit trypanosome GPI biosynthesis. PMID:19724691

  4. Increased 5S rRNA oxidation in Alzheimer's disease.

    PubMed

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  5. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  6. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces.

  7. [Structural organization of 5S ribosomal DNA of Rosa rugosa].

    PubMed

    Tynkevych, Iu O; Volkov, R A

    2014-01-01

    In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

  8. [Organization of 5S ribosomal DNA of Melitaea trivia].

    PubMed

    Cherevatov, O V; Volkov, R A

    2011-01-01

    Two length variants of 5S rDNA repeated units were detected in the genome of East European butterfly Melitaea trivia. Both repeat variants contain the 5S rRNA coding region of the same length of 120 bp, but possess the intergenic spacer region (IGS) of different size, 78 and 125 bp, respectively. The level of sequence similarity between the two 5S rDNA variants amounts to 43.9-45.5% in the IGS, whereas the coding region appears to be more conservative. In the IGS, microsatellite sequence motives were found; amplification of these motives could be involved in the evolution of the 5S rDNA.

  9. High-Resolution Infrared Spectroscopy of Carbon-Sulfur Chains: II. C_5S and SC_5S

    NASA Astrophysics Data System (ADS)

    Thorwirth, Sven; Salomon, Thomas; Dudek, John B.

    2016-06-01

    Unbiased high-resolution infrared survey scans of the ablation products from carbon-sulfur targets in the 2100 to 2150 cm-1 regime reveal two bands previously not observed in the gas phase. On the basis of comparison against laboratory matrix-isolation work and new high-level quantum-chemical calculations these bands are attributed to the linear C_5S and SC_5S clusters. While polar C_5S was studied earlier using Fourier-transform microwave techniques, the present work marks the first gas-phase spectroscopic detection of SC_5S. H. Wang, J. Szczepanski, P. Brucat, and M. Vala 2005, Int. J. Quant. Chem. 102, 795 Y. Kasai, K. Obi, Y. Ohshima, Y. Hirahara, Y. Endo, K. Kawaguchi, and A. Murakami 1993, ApJ 410, L45 V. D. Gordon, M. C. McCarthy, A. J. Apponi, and P. Thaddeus 2001, ApJS 134, 311

  10. Enterococcus faecium PBP5-S/R, the missing link between PBP5-S and PBP5-R.

    PubMed

    Pietta, Ester; Montealegre, Maria Camila; Roh, Jung Hyeob; Cocconcelli, Pier Sandro; Murray, Barbara E

    2014-11-01

    During a study to investigate the evolution of ampicillin resistance in Enterococcus faecium, we observed that a number of E. faecium strains, mainly from the recently described subclade A2, showed PBP5 sequences in between PBP5-S and PBP5-R. These hybrid PBP5-S/R patterns reveal a progression of amino acid changes from the S form to the R form of this protein; however, these changes do not strictly correlate with changes in ampicillin MICs.

  11. TFIIIA binds to different domains of 5S RNA and the Xenopus borealis 5S RNA gene.

    PubMed Central

    Sands, M S; Bogenhagen, D F

    1987-01-01

    We have established the conditions for the reassociation of 5S RNA and TFIIIA to form 7S particles. We tested the ability of altered 5S RNAs to bind TFIIIA, taking advantage of the slower mobility of 7S particles compared with free 5S RNA in native polyacrylamide gels. Linker substitution mutants were constructed encompassing the entire gene, including the intragenic control region. In vitro transcripts of the linker substitution mutants were tested for their ability to bind TFIIIA to form 7S ribonucleoprotein particles. Altered 5S RNAs with base changes in or around helices IV and V, which would interfere with the normal base pairing of that region, showed decreased ability to bind TFIIIA. The transcripts of some mutant genes that were efficiently transcribed (greater than 50% of wild-type efficiency) failed to bind TFIIIA in this gel assay. In contrast, the RNA synthesized from a poorly transcribed mutant, LS 86/97, in which residues 87 to 96 of the RNA were replaced in the single-stranded loop at the base of helix V, bound TFIIIA well. The data indicate that TFIIIA binds to different domains in the 5S RNA gene and 5S RNA. Images PMID:3431548

  12. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  13. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  14. Biosynthesis of resorcylic acid lactone lasiodiplodin in Lasiodiplodia theobromae.

    PubMed

    Kashima, Takasumi; Takahashi, Kosaku; Matsuura, Hideyuki; Nabeta, Kensuke

    2009-05-01

    The biosynthesis of lasiodiplodin (1) and its (5S)-5-hydroxylated derivative (2) were investigated by the administration of (13)C-labeled acetates to Lasiodiplodia theobromae. The labeling patterns of biosynthetically (13)C-labeled 1 and 2 were determined by (13)C-NMR and INADEQUATE spectra, demonstrating the octaketide origins of 1 and 2. Taking into account the biosynthetic study of resorcylic acid lactones, the involvement of highly reduced acyl intermediates in the biosynthesis of lasiodiplodins was presumed; thus, we synthesized (2)H-labeled hypothetical acyl intermediates of 1, 9-hydroxydecanoic acid (4) and its N-acetylcysteamine thioester (SNAC, 5). When L. theobromae was incubated with 5 mM of a (2)H-labeled intermediate, the (2)H-label from the intermediate was incorporated at the expected position of 1. These incorporation studies revealed that 1 was produced via a pathway which closely resembles that of resorcylic acid lactone biosynthesis. PMID:19420710

  15. L5-S1 Laparoscopic Anterior Interbody Fusion

    PubMed Central

    Zeni, Tallal M.; Phillips, Frank M.; Mathur, Sameer; Zografakis, John G.; Moore, Ronald M.; Laguna, Luis E.

    2006-01-01

    Objective: We evaluated our experience with laparoscopic L5-S1 anterior lumbar interbody fusion (ALIF). Methods: This represents a retrospective analysis of consecutive patients who underwent L5-S1 laparoscopic ALIF between February 1998 and August 2003. Results: Twenty-eight patients underwent L5-S1 LAIF (15 males and 13 females). The mean age was 43 years (range, 26 to 67). Mean operative time was 225 minutes (range, 137 to 309 minutes). No conversions to an open procedure were necessary. Twenty-four (85.7%) patients underwent successful bilateral cage placement. Four patients (14.3%) in whom only a single cage could be placed underwent supplementary posterior pedicle screw placement. Mean length of stay (LOS) was 4.1 days (range, 2 to 15). Two patients underwent reoperation subacutely secondary to symptomatic lateral displacement of the cage. One patient developed radiculopathy 6 months postoperatively and required reoperation. One patient developed a small bowel obstruction secondary to adhesions to the cage requiring laparoscopic reoperation. Fusion was achieved in all patients. Visual analogue scale scores for back pain were significantly improved from 8.6±0.8 to 2.8±0.8 (P<0.0001) at 1 year. Conclusion: L5-S1 LAIF is feasible and safe with all the advantages of minimally invasive surgery. Fusion rates and pain improvement were comparable to those with an open repair. PMID:17575763

  16. Analyzing Digital Library Initiatives: 5S Theory Perspective

    ERIC Educational Resources Information Center

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko

    2015-01-01

    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  17. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron.

    PubMed Central

    MacKay, R M; Salgado, D; Bonen, L; Stackebrandt, E; Doolittle, W F

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are (formula: see text), respectively. Specific phylogenetic relationships of P. denitrificans with purple non-sulphur bacteria, and of Prochloron with cyanobacteria are demonstrated, and unique features of potential secondary structure are described. PMID:7099971

  18. Functional domains of the Xenopus laevis 5S gene promoter.

    PubMed Central

    Pieler, T; Oei, S L; Hamm, J; Engelke, U; Erdmann, V A

    1985-01-01

    To study the fine structure of the Xenopus laevis somatic 5S gene internal control region, we have created 15 different transversions using mutagenic oligonucleotide primers. The effects of these mutations on 5S DNA transcription in vitro as well as on stable complex formation with transcription factor TF III A and TF III C in crude nuclear extracts were analyzed. Mutations in the common class III 5' promoter element (nucleotides 50-61 in the 5S gene) interfere with transcription activity and stable complex formation whenever they contradict the tDNA box A consensus sequence. The second promoter element is defined by a major sequence block (nucleotides 80-89, box C) and two additional internal residues (70 and 71) at a distance of roughly one helical turn from both the major 3' and 5' control sequences; these two 3' elements contain the primary TF III A binding domain. The remaining nucleotides (62-69 and 71-79) when mutated do not interfere with transcription activity or factor binding and thus they constitute two spacer elements within a symmetrically structured 5S gene promoter. An increase in the relative spacing of box A and box C by insertion of 3 bp between nucleotides 66 and 67 leads to a drastic reduction in transcription activity and the ability to form a stable complex with TF III A and/or TF III C. Thus, accurate spacing is essential for the proper orientation of TF III A on 5S DNA and/or TF III C binding. Images Fig. 1. Fig. 3. Fig. 4. PMID:3004969

  19. BIOSYNTHESIS OF YEAST CAROTENOIDS

    PubMed Central

    Simpson, Kenneth L.; Nakayama, T. O. M.; Chichester, C. O.

    1964-01-01

    Simpson, Kenneth L. (University of California, Davis), T. O. M. Nakayama, and C. O. Chichester. Biosynthesis of yeast carotenoids. J. Bacteriol. 88:1688–1694. 1964.—The biosynthesis of carotenoids was followed in Rhodotorula glutinis and in a new strain, 62-506. The treatment of the growing cultures by methylheptenone, or ionone, vapors permitted observations of the intermediates in the biosynthetic pathway. On the basis of concentration changes and accumulation in blocked pathways, the sequence of carotenoid formation is postulated as phytoene, phytofluene, ζ-carotene, neurosporene, β-zeacarotene, γ-carotene, torulin, a C40 aldehyde, and torularhodin. Torulin and torularhodin were established as the main carotenoids of 62-506. PMID:14240958

  20. Biosynthesis of pulcherriminic acid

    PubMed Central

    MacDonald, J. C.

    1965-01-01

    1. Candida pulcherrima was grown on a complex medium to which various compounds had been added to determine their effect on the biosynthesis of pulcherriminic acid. Most of the pulcherriminic acid synthesized by C. pulcherrima PRL2019 was derived from the l-[1-14C]leucine added to the medium. 2. The cyclic dipeptide of l-leucine (cyclo-l-leucyl-l-leucyl) was shown, by trapping experiments involving cycloleucyl-leucyl isomers, to be synthesized by strain PRL2019. Cyclo-l-leucyl-l-leucyl was derived from l-leucine and was converted into pulcherriminic acid. Cyclo-l-leucyl-l-leucyl was a precursor of pulcherriminic acid in strain PRL2007 also. 3. The results supported the hypothesis that pulcherriminic acid is derived from l-leucine and that cyclo-l-leucyl-l-leucyl is an intermediate in the biosynthesis. PMID:5837792

  1. Physical studies of 5S RNA variants at position 66.

    PubMed Central

    Zhang, P; Popieniek, P; Moore, P B

    1989-01-01

    Two variants of the 5S RNA of E. coli have been examined by imino proton NMR spectroscopy, one of them a deletion of A66 (Christiansen, J., Douthwaite, S.R., Christensen, A. and Garrett, R.A. (1985) EMBO J. 4, 1019-1024) and the other a replacement of A66 with a C (Goringer, H.U. and Wagner, R. (1986) Biol. Chem. Hoppe-Seyler 367, 769-780). Both are of interest because the role the bulged A in helix II of 5S RNA is supposed to play in interactions with ribosomal protein L18. The data show that the structural perturbations that result from these mutations are minimal, and assign the resonances of some of the imino protons around position 66. Some mutations at or near position 66 greatly reduce the L18-dependent increase in the circular dichroism of 5S RNA at 267 nm first observed by Bear and coworkers (Bear, D.G., Schleich, T., Noller, H.F. and Garrett, R.A. (1977) Nucl. Acids Res. 4, 2511-2526). PMID:2479908

  2. 5S rDNA genome regions of Lens species.

    PubMed

    Fernández, M; Ruiz, M L; Linares, C; Fominaya, A; Pérez de la Vega, M

    2005-10-01

    The length variability of the nontranscribed spacer (NTS) of the 5S rDNA repeats was analyzed in species of the genus Lens by means of PCR amplification. The NTS ranged from approximately 227 to approximately 952 bp. The polymorphism detected was higher than previous NTS polymorphisms described in this genus. Three NTS length variants from Lens culinaris subsp. culinaris and 2 from Lens culinaris subsp. orientalis were sequenced. The culinaris NTS fragment lengths were 239, 371, and 838 bp, whereas the orientalis ones were 472 bp and 506 bp, respectively. As a result of sequence similarities, 2 families of sequences were distinguished, 1 including the sequences of 838 and 506 bp, and others with the sequences of 239, 371, and 472 bp. The 1st family was characterized by the presence of a repeated sequence designated A, whereas the 2nd family showed a single A sequence and other repeated sequences designated B, C, and D. The presence of an (AT)n microsatellite was also observed in the 2nd family of sequences. The fragments, which included the 239-bp and 838-bp NTS sequences, as well as the intergenic spacer (IGS) of the 18S-5.8S-26S ribosomal DNA also from L. culinaris subsp. culinaris, were used to localize the nucleolar organizer region (NOR) and the 5S rDNA loci in the chromosomes of several species of the genus Lens by means of fluorescence in situ hybridization (FISH). The selective hybridization of the 2 NTS probes allowed us to distinguish between different 5S rDNA chromosomal loci.

  3. Identification and absolute configuration of dihydroxy-arachidonic acids formed by oxygenation of 5S-HETE by native and aspirin-acetylated COX-2.

    PubMed

    Mulugeta, Surafel; Suzuki, Takashi; Hernandez, Noemi Tejera; Griesser, Markus; Boeglin, William E; Schneider, Claus

    2010-03-01

    Biosynthesis of the prostaglandin endoperoxide by the cyclooxygenase (COX) enzymes is accompanied by formation of a small amount of 11R-hydroxyeicosatetraenoic acid (HETE), 15R-HETE, and 15S-HETE as by-products. Acetylation of COX-2 by aspirin abrogates prostaglandin synthesis and triggers formation of 15R-HETE as the sole product of oxygenation of arachidonic acid. Here, we investigated the formation of by-products of the transformation of 5S-HETE by native COX-2 and by aspirin-acetylated COX-2 using HPLC-ultraviolet, GC-MS, and LC-MS analysis. 5S,15S- dihydroxy (di)HETE, 5S,15R-diHETE, and 5S,11R-diHETE were identified as by-products of native COX-2, in addition to the previously described di-endoperoxide (5S,15S-dihydroxy-9S,11R,8S,12S-diperoxy-6E,13E-eicosadienoic acid) as the major oxygenation product. 5S,15R-diHETE was the only product formed by aspirin-acetylated COX-2. Both 5,15-diHETE and 5,11-diHETE were detected in CT26 mouse colon carcinoma cells as well as in lipopolysaccharide-activated RAW264.7 cells incubated with 5S-HETE, and their formation was attenuated in the presence of the COX-2 specific inhibitor, NS-398. Aspirin-treated CT26 cells gave 5,15-diHETE as the most prominent product formed from 5S-HETE. 5S,15S-diHETE has been described as a product of the cross-over of 5-lipoxygenase (5-LOX) and 15-LOX activities in elicited rat mononuclear cells and human leukocytes, and our studies implicate cross-over of the 5-LOX and COX-2 pathways as an additional biosynthetic route.

  4. Methionine Biosynthesis in Lemna

    PubMed Central

    Thompson, Gregory A.; Datko, Anne H.; Mudd, S. Harvey; Giovanelli, John

    1982-01-01

    Regulation of enzymes of methionine biosynthesis was investigated by measuring the specific activities of O-phosphohomoserine-dependent cystathionine γ-synthase, O-phosphohomoserine sulfhydrylase, and O-acetylserine sulfhydrylase in Lemna paucicostata Hegelm. 6746 grown under various conditions. For cystathionine γ-synthase, it was observed that (a) adding external methionine (2 μm) decreased specific activity to 15% of control, (b) blocking methionine synthesis with 0.05 μml-aminoethoxyvinylglycine or with 36 μm lysine plus 4 μm threonine (Datko, Mudd 1981 Plant Physiol 69: 1070-1076) caused a 2- to 3-fold increase in specific activity, and (c) blocking methionine synthesis and adding external methionine led to the decreased specific activity characteristic of methionine addition alone. Activity in extracts from control cultures was unaffected by addition of methionine, lysine, threonine, lysine plus threonine, S-adenosylmethionine, or S-methylmethionine sulfonium to the assay mixture. Parallel studies of O-phosphohomoserine sulfhydrylase and O-acetylserine sulfhydrylase showed that O-phosphohomoserine sulfhydrylase activity responded to growth conditions identically to cystathionine γ-synthase activity, whereas O-acetylserine sulfhydrylase activity remained unaffected. Lemna extracts did not catalyze lanthionine formation from O-acetylserine and cysteine. Estimates of kinetic constants for the three enzyme activities indicate that O-acetylserine sulfhydrylase has much higher activity and affinity for sulfide than O-phosphohomoserine sulfhydrylase. The results suggest that (a) methionine, or one of its products, regulates the amount of active cystathionine γ-synthase in Lemna, (b) O-phosphohomoserine sulfhydrylase and cystathionine γ-synthase are probably activities of one enzyme that has low specificity for its sulfur-containing substrate, and (c) O-acetylserine sulfhydrylase is a separate enzyme. The relatively high activity and affinity for sulfide of

  5. Biosynthesis of methanopterin

    SciTech Connect

    White, R.H. )

    1990-06-05

    The biosynthetic pathway for the generation of the methylated pterin in methanopterins was determined for the methanogenic bacteria Methanococcus volta and Methanobacterium formicicum. Extracts of M. volta were found to readily cleave L-7,8-dihydroneopterin to 7,8-dihydro-6-(hydroxymethyl)pterin, which was confirmed to be a precursor of the pterin portion of the methanopterin. (methylene{sup 2}H)-6-(hydroxymethyl)pterin was incorporated into methanopterin by growing cells of M. volta to an extent of 30%. Both the C-11 and C-12 methyl groups of methanopterin originate from (methyl-{sup 2}H{sub 3})methionine. Cells grown in the presence of (methylene-{sup 2}H)-6-(hydroxymethyl)pterin, (ethyl-{sup 2}H{sub 4})-6-(1 (RS)-hydroxyethyl)pterin, (methyl-{sup 2}H{sub 3})-6-(hydroxymethyl)-7-methylpterin, (ethyl-{sup 2}H{sub 4}, methyl-{sup 2}H{sub 3})-6-(1 (RS)-hydroxyethyl)-7-methylpterin, and (1-ethyl-{sup 3}H)-6-(1 (RS)-hydroxyethyl)-7-methylpterin showed that only the non-7-methylated pterins were incorporated into methanopterin. Cells extracts of M. formicicum readily condensed synthetic (methylene-{sup 3}H)-7,8-H{sub 2}-6-(hydroxymethyl)pterin-PP with methaniline to generate demethylated methanopterin, which is then methylated to methanopterin by the cell extract in the presence of S-adenosylmethionine. These observations indicate that the pterin portion of methanopterin is biosynthetically derived from 7,8-H{sub 2}-6-(hydroxymethyl)pterin, which is coupled to methaniline by a pathway analogous to the biosynthesis of folic acid. This pathway for the biosynthesis of methanopterin represents the first example of the modification of the specificity of a coenzyme through a methylation reaction.

  6. Diverse inhibitors of aflatoxin biosynthesis.

    PubMed

    Holmes, Robert A; Boston, Rebecca S; Payne, Gary A

    2008-03-01

    Pre-harvest and post-harvest contamination of maize, peanuts, cotton, and tree nuts by members of the genus Aspergillus and subsequent contamination with the mycotoxin aflatoxin pose a widespread food safety problem for which effective and inexpensive control strategies are lacking. Since the discovery of aflatoxin as a potently carcinogenic food contaminant, extensive research has been focused on identifying compounds that inhibit its biosynthesis. Numerous diverse compounds and extracts containing activity inhibitory to aflatoxin biosynthesis have been reported. Only recently, however, have tools been available to investigate the molecular mechanisms by which these inhibitors affect aflatoxin biosynthesis. Many inhibitors are plant-derived and a few may be amenable to pathway engineering for tissue-specific expression in susceptible host plants as a defense against aflatoxin contamination. Other compounds show promise as protectants during crop storage. Finally, inhibitors with different modes of action could be used in comparative transcriptional and metabolomic profiling experiments to identify regulatory networks controlling aflatoxin biosynthesis.

  7. Serine biosynthesis and transport defects.

    PubMed

    El-Hattab, Ayman W

    2016-07-01

    l-serine is a non-essential amino acid that is biosynthesized via the enzymes phosphoglycerate dehydrogenase (PGDH), phosphoserine aminotransferase (PSAT), and phosphoserine phosphatase (PSP). Besides its role in protein synthesis, l-serine is a potent neurotrophic factor and a precursor of a number of essential compounds including phosphatidylserine, sphingomyelin, glycine, and d-serine. Serine biosynthesis defects result from impairments of PGDH, PSAT, or PSP leading to systemic serine deficiency. Serine biosynthesis defects present in a broad phenotypic spectrum that includes, at the severe end, Neu-Laxova syndrome, a lethal multiple congenital anomaly disease, intermediately, infantile serine biosynthesis defects with severe neurological manifestations and growth deficiency, and at the mild end, the childhood disease with intellectual disability. A serine transport defect resulting from deficiency of the ASCT1, the main transporter for serine in the central nervous system, has been recently described in children with neurological manifestations that overlap with those observed in serine biosynthesis defects. l-serine therapy may be beneficial in preventing or ameliorating symptoms in serine biosynthesis and transport defects, if started before neurological damage occurs. Herein, we review serine metabolism and transport, the clinical, biochemical, and molecular aspects of serine biosynthesis and transport defects, the mechanisms of these diseases, and the potential role of serine therapy. PMID:27161889

  8. Stereoselectivity in Polyphenol Biosynthesis

    NASA Technical Reports Server (NTRS)

    Lewis, Norman G.; Davin, Laurence B.

    1992-01-01

    Stereoselectivity plays an important role in the late stages of phenyl-propanoid metabolism, affording lignins, lignans, and neolignans. Stereoselectivity is manifested during monolignol (glucoside) synthesis, e.g., where the geometry (E or Z) of the pendant double bond affects the specificity of UDPG:coniferyl alcohol glucosyltransferases in different species. Such findings are viewed to have important ramifications in monolignol transport and storage processes, with roles for both E- and Z-monolignols and their glucosides in lignin/lignan biosynthesis being envisaged. Stereoselectivity is also of great importance in enantiose-lective enzymatic processes affording optically active lignans. Thus, cell-free extracts from Forsythia species were demonstrated to synthesize the enantiomerically pure lignans, (-)-secoisolariciresinol, and (-)-pinoresinol, when NAD(P)H, H2O2 and E-coniferyl alcohol were added. Progress toward elucidating the enzymatic steps involved in such highly stereoselective processes is discussed. Also described are preliminary studies aimed at developing methodologies to determine the subcellular location of late-stage phenylpropanoid metabolites (e.g., coniferyl alcohol) and key enzymes thereof, in intact tissue or cells. This knowledge is essential if questions regarding lignin and lignan tissue specificity and regulation of these processes are to be deciphered.

  9. Repumping and spectroscopy of laser-cooled Sr atoms using the (5s5p)3P2-(5s4d)3D2 transition

    NASA Astrophysics Data System (ADS)

    Mickelson, P. G.; Martinez de Escobar, Y. N.; Anzel, P.; De Salvo, B. J.; Nagel, S. B.; Traverso, A. J.; Yan, M.; Killian, T. C.

    2009-12-01

    We describe repumping and spectroscopy of laser-cooled strontium (Sr) atoms using the (5s5p)3P2-(5s4d)3D2 transition. Atom number in a magneto-optical trap is enhanced by driving this transition because Sr atoms that have decayed into the (5s5p)3P2 dark state are repumped back into the (5s2)1S0 ground state. Spectroscopy of 84Sr, 86Sr, 87Sr and 88Sr improves the value of the (5s5p)3P2-(5s4d)3D2 transition frequency and determines the isotope shifts for the transition accurately enough to guide laser-cooling experiments with less abundant isotopes.

  10. D5S351 and D5S1414 located at the spinal muscular atrophy critical region represent novel informative markers in the Iranian population

    PubMed Central

    Sedghi, Maryam; Vallian, Sadeq

    2015-01-01

    Spinal muscular atrophy (SMA) is a degenerative neuromuscular disease associated with progressive symmetric weakness and atrophy of the limb muscles. In view of the involvement of numerous point mutations and deletions associated with the disease, the application of polymorphic markers flanking the SMA critical region could be valuable in molecular diagnosis of the disease. In the present study, D5S351 and D5S1414 polymorphic markers located at the SMA critical region in the Iranian populations were characterized. Genotyping of the markers indicated the presence of six and nine different alleles for D5S351 and D5S1414, respectively. Haplotype frequency estimation in 25 trios families and 75 unrelated individuals indicated the presence of six informative haplotypes with frequency higher than 0.05 in the studied population. Furthermore, the D′ coefficient and the χ2 value for D5S351 and D5S1414 markers revealed the presence of linkage disequilibrium between the two markers in the Iranians. These data suggested that D5S351 and D5S1414 could be suggested as informative markers for linkage analysis and molecular diagnosis of SMA in the Iranian population. PMID:26693404

  11. Auxin biosynthesis and storage forms

    PubMed Central

    Strader, Lucia C.

    2013-01-01

    The plant hormone auxin drives plant growth and morphogenesis. The levels and distribution of the active auxin indole-3-acetic acid (IAA) are tightly controlled through synthesis, inactivation, and transport. Many auxin precursors and modified auxin forms, used to regulate auxin homeostasis, have been identified; however, very little is known about the integration of multiple auxin biosynthesis and inactivation pathways. This review discusses the many ways auxin levels are regulated through biosynthesis, storage forms, and inactivation, and the potential roles modified auxins play in regulating the bioactive pool of auxin to affect plant growth and development. PMID:23580748

  12. Auxin biosynthesis and storage forms.

    PubMed

    Korasick, David A; Enders, Tara A; Strader, Lucia C

    2013-06-01

    The plant hormone auxin drives plant growth and morphogenesis. The levels and distribution of the active auxin indole-3-acetic acid (IAA) are tightly controlled through synthesis, inactivation, and transport. Many auxin precursors and modified auxin forms, used to regulate auxin homeostasis, have been identified; however, very little is known about the integration of multiple auxin biosynthesis and inactivation pathways. This review discusses the many ways auxin levels are regulated through biosynthesis, storage forms, and inactivation, and the potential roles modified auxins play in regulating the bioactive pool of auxin to affect plant growth and development.

  13. Alternate biosynthesis of valerenadiene and related sesquiterpenes.

    PubMed

    Paknikar, Shashikumar K; Kadam, Shahuraj H; Ehrlich, April L; Bates, Robert B

    2013-09-01

    It is proposed that the biosynthesis of the sesquiterpene valerenadiene, a key intermediate in the biosynthesis of a sedative in valerian, involves cyclopropane and not cyclobutane intermediates and includes as a key step a cyclopropylcarbinylcation-cyclopropylcarbinylcation rearrangement analogous to the one observed in the conversion of presqualene to squalene in triterpene and steroid biosynthesis. Similar mechanisms are proposed for the biosynthesis of the related sesquiterpenes pacifigorgiol, tamariscene and (+)-pacifigorgia-1,10-diene. PMID:24273843

  14. Phermone biosynthesis activation in fire ants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Over 20 years ago, a neurohormone, pheromone biosynthesis activating neuropeptide (PBAN), was identified to stimulate sex pheromone biosynthesis in a moth. Since then, the physiological role, target site and signal transduction of PBAN has become well understood for sex pheromone biosynthesis in mot...

  15. Identification of the gene encoding the 5S ribosomal RNA maturase in Bacillus subtilis: mature 5S rRNA is dispensable for ribosome function.

    PubMed Central

    Condon, C; Brechemier-Baey, D; Beltchev, B; Grunberg-Manago, M; Putzer, H

    2001-01-01

    Over 25 years ago, Pace and coworkers described an activity called RNase M5 in Bacillus subtilis cell extracts responsible for 5S ribosomal RNA maturation (Sogin & Pace, Nature, 1974, 252:598-600). Here we show that RNase M5 is encoded by a gene of previously unknown function that is highly conserved among the low G + C gram-positive bacteria. We propose that the gene be named rnmV. The rnmV gene is nonessential. B. subtilis strains lacking RNase M5 do not make mature 5S rRNA, indicating that this process is not necessary for ribosome function. 5S rRNA precursors can, however, be found in both free and translating ribosomes. In contrast to RNase E, which cleaves the Escherichia coli 5S precursor in a single-stranded region, which is then trimmed to yield mature 5S RNA, RNase M5 cleaves the B. subtilis equivalent in a double-stranded region to yield mature 5S rRNA in one step. For the most part, eubacteria contain one or the other system for 5S rRNA production, with an imperfect division along gram-negative and gram-positive lines. A potential correlation between the presence of RNase E or RNase M5 and the single- or double-stranded nature of the predicted cleavage sites is explored. PMID:11233981

  16. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.

    PubMed

    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto

    2006-05-01

    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes. PMID:16612546

  17. The Evolution of Aflatoxin Biosynthesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The biosynthesis of aflatoxin (AF) involves over 20 enzymatic reactions in a complex polyketide pathway that converts acetate and malonate to the intermediates sterigmatocystin (ST) and O-methylsterigmatocysin (OMST), the respective penultimate and ultimate precursors of AF. Although ST, OMST, and ...

  18. Transcriptional control of flavonoid biosynthesis

    PubMed Central

    Li, Shutian

    2014-01-01

    Flavonoids are plant secondary polyphenolic metabolites and fulfil many vital biological functions, offering a valuable metabolic and genetic model for studying transcriptional control of gene expression. Arabidopsis thaliana mainly accumulates 3 types of flavonoids, including flavonols, anthocyanins, and proanthocyanidins (PAs). Flavonoid biosynthesis involves a multitude of well-characterized enzymatic and regulatory proteins. Three R2R3-MYB proteins (MYB11, MYB12, and MYB111) control flavonol biosynthesis via activating the early biosynthetic steps, whereas the production of anthocyanins and PAs requires the MYB-bHLH-WD40 (MBW) complex to activate the late biosynthetic genes. Additional regulators of flavonoid biosynthesis have recently come to light, which interact with R2R3-MYBs or bHLHs to organize or disrupt the formation of the MBW complex, leading to enhanced or compromised flavonoid production. This mini-review gives an overview of how these novel players modulate flavonoid metabolism and thus plant developmental processes and further proposes a fine-tuning mechanism to complete the complex regulatory network controlling flavonoid biosynthesis. PMID:24393776

  19. (-)-Menthol biosynthesis and molecular genetics.

    PubMed

    Croteau, Rodney B; Davis, Edward M; Ringer, Kerry L; Wildung, Mark R

    2005-12-01

    (-)-Menthol is the most familiar of the monoterpenes as both a pure natural product and as the principal and characteristic constituent of the essential oil of peppermint (Mentha x piperita). In this paper, we review the biosynthesis and molecular genetics of (-)-menthol production in peppermint. In Mentha species, essential oil biosynthesis and storage is restricted to the peltate glandular trichomes (oil glands) on the aerial surfaces of the plant. A mechanical method for the isolation of metabolically functional oil glands, has provided a system for precursor feeding studies to elucidate pathway steps, as well as a highly enriched source of the relevant biosynthetic enzymes and of their corresponding transcripts with which cDNA libraries have been constructed to permit cloning and characterization of key structural genes. The biosynthesis of (-)-menthol from primary metabolism requires eight enzymatic steps, and involves the formation and subsequent cyclization of the universal monoterpene precursor geranyl diphosphate to the parent olefin (-)-(4S)-limonene as the first committed reaction of the sequence. Following hydroxylation at C3, a series of four redox transformations and an isomerization occur in a general "allylic oxidation-conjugate reduction" scheme that installs three chiral centers on the substituted cyclohexanoid ring to yield (-)-(1R, 3R, 4S)-menthol. The properties of each enzyme and gene of menthol biosynthesis are described, as are their probable evolutionary origins in primary metabolism. The organization of menthol biosynthesis is complex in involving four subcellular compartments, and regulation of the pathway appears to reside largely at the level of gene expression. Genetic engineering to up-regulate a flux-limiting step and down-regulate a side route reaction has led to improvement in the composition and yield of peppermint oil. PMID:16292524

  20. (-)-Menthol biosynthesis and molecular genetics

    NASA Astrophysics Data System (ADS)

    Croteau, Rodney B.; Davis, Edward M.; Ringer, Kerry L.; Wildung, Mark R.

    2005-12-01

    (-)-Menthol is the most familiar of the monoterpenes as both a pure natural product and as the principal and characteristic constituent of the essential oil of peppermint ( Mentha x piperita). In this paper, we review the biosynthesis and molecular genetics of (-)-menthol production in peppermint. In Mentha species, essential oil biosynthesis and storage is restricted to the peltate glandular trichomes (oil glands) on the aerial surfaces of the plant. A mechanical method for the isolation of metabolically functional oil glands, has provided a system for precursor feeding studies to elucidate pathway steps, as well as a highly enriched source of the relevant biosynthetic enzymes and of their corresponding transcripts with which cDNA libraries have been constructed to permit cloning and characterization of key structural genes. The biosynthesis of (-)-menthol from primary metabolism requires eight enzymatic steps, and involves the formation and subsequent cyclization of the universal monoterpene precursor geranyl diphosphate to the parent olefin (-)-(4 S)-limonene as the first committed reaction of the sequence. Following hydroxylation at C3, a series of four redox transformations and an isomerization occur in a general “allylic oxidation-conjugate reduction” scheme that installs three chiral centers on the substituted cyclohexanoid ring to yield (-)-(1 R, 3 R, 4 S)-menthol. The properties of each enzyme and gene of menthol biosynthesis are described, as are their probable evolutionary origins in primary metabolism. The organization of menthol biosynthesis is complex in involving four subcellular compartments, and regulation of the pathway appears to reside largely at the level of gene expression. Genetic engineering to up-regulate a flux-limiting step and down-regulate a side route reaction has led to improvement in the composition and yield of peppermint oil.

  1. Gibberellin biosynthesis in Gibberlla fujikuroi

    SciTech Connect

    Johnson, S.W.; Coolbaugh, R.C. )

    1989-04-01

    Gibberellins (GAs) are a group of plant growth hormones which were first isolated from the fungus Gibberella fujikuori. We have examined the biosynthesis of GAs in this fungus in liquid cultures using HPLC followed by GC-MS. Furthermore we have used cell-free enzyme extracts with {sup 14}C-labeled intermediates to examine the regulation of specific parts of the biosynthetic pathway. GA{sub 3} is the predominant GA in well aerated cultures. GA{sub 4} and GA{sub 7}, intermediates in GA{sub 3} biosynthesis, accumulate in cultures with low levels of dissolved oxygen, but are not detectable in more aerated cultures. Light stimulates GA production in G. fujikuroi cultures grown from young stock. Cell-free enzyme studies indicate that light has no effect on incorporation of mevalonic acid into kaurene, but does significantly stimulate the oxidation of kaurenoic acid.

  2. Lignification: Flexibility, Biosynthesis and Regulation.

    PubMed

    Zhao, Qiao

    2016-08-01

    Lignin is a complex phenolic polymer that is deposited in the secondary cell wall of all vascular plants. The evolution of lignin is considered to be a critical event during vascular plant development, because lignin provides mechanical strength, rigidity, and hydrophobicity to secondary cell walls to allow plants to grow tall and transport water and nutrients over a long distance. In recent years, great research efforts have been made to genetically alter lignin biosynthesis to improve biomass degradability for the production of second-generation biofuels. This global focus on lignin research has significantly advanced our understanding of the lignification process. Based on these advances, here I provide an overview of lignin composition, the biosynthesis pathway and its regulation. PMID:27131502

  3. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

    2005-01-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  4. Phosphatidylcholine biosynthesis and lipoprotein metabolism.

    PubMed

    Cole, Laura K; Vance, Jean E; Vance, Dennis E

    2012-05-01

    Phosphatidylcholine (PC) is the major phospholipid component of all plasma lipoprotein classes. PC is the only phospholipid which is currently known to be required for lipoprotein assembly and secretion. Impaired hepatic PC biosynthesis significantly reduces the levels of circulating very low density lipoproteins (VLDLs) and high density lipoproteins (HDLs). The reduction in plasma VLDLs is due in part to impaired hepatic secretion of VLDLs. Less PC within the hepatic secretory pathway results in nascent VLDL particles with reduced levels of PC. These particles are recognized as being defective and are degraded within the secretory system by an incompletely defined process that occurs in a post-endoplasmic reticulum compartment, consistent with degradation directed by the low-density lipoprotein receptor and/or autophagy. Moreover, VLDL particles are taken up more readily from the circulation when the PC content of the VLDLs is reduced, likely due to a preference of cell surface receptors and/or enzymes for lipoproteins that contain less PC. Impaired PC biosynthesis also reduces plasma HDLs by inhibiting hepatic HDL formation and by increasing HDL uptake from the circulation. These effects are mediated by elevated expression of ATP-binding cassette transporter A1 and hepatic scavenger receptor class B type 1, respectively. Hepatic PC availability has recently been linked to the progression of liver and heart disease. These findings demonstrate that hepatic PC biosynthesis can regulate the amount of circulating lipoproteins and suggest that hepatic PC biosynthesis may represent an important pharmaceutical target. This article is part of a Special Issue entitled Triglyceride Metabolism and Disease.

  5. Biosynthesis of Fungal Indole Alkaloids

    PubMed Central

    Xu, Wei; Gavia, Diego J.; Tang, Yi

    2014-01-01

    This review provides a summary of recent research advances in elucidating the biosynthesis of fungal indole alkaloids. Different strategies used to incorporate and derivatize the indole/indoline moieties in various families of fungal indole alkaloids will be discussed, including tryptophan-containing nonribosomal peptides and polyketide-nonribosomal peptide hybrids; and alkaloids derived from other indole building blocks. This review also includes discussion regarding the downstream modifications that generate chemical and structural diversity among indole alkaloids. PMID:25180619

  6. Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

    PubMed

    Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

    2013-11-01

    Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

  7. Pyrimidine Biosynthesis in Lactobacillus leichmannii

    PubMed Central

    Hutson, Judith Y.; Downing, Mancourt

    1968-01-01

    Tracer studies of pyrimidine biosynthesis in Lactobacillus leichmannii (ATCC 7830) indicated that, while aspartate is utilized in the usual manner, the guanido carbon of arginine, rather than carbon dioxide, is utilized as a pyrimidine precursor. The guanido carbon of arginine also contributes, to some extent, to the carbon dioxide pool utilized for purine biosynthesis. The enzyme of the first reaction leading from arginine to pyrimidines, arginine deiminase, was investigated in crude bacterial extracts. It was inhibited by thymidylic acid and purine ribonucleotides, and to a lesser extent by purine deoxynucleotides and deoxycytidylic acid. Under the assay conditions employed, a number of nucleotides had no effect on the enzyme activity of the aspartate transcarbamylase of L. leichmannii. Growth of the cells in media containing uracil, compared to growth in media without uracil, resulted in a four- to fivefold decrease in the concentrations of aspartate transcar-bamylase and dihydroorotase and a twofold increase in the concentration of arginine deiminase, as estimated from specific enzyme activity in crude extracts of the cells. A small increase in specific enzyme activity of ornithine transcarbamylase and carbamate kinase was also observed in extracts obtained from cells grown on uracil. No appreciable change in concentration of any of the five enzymes studied was detected when the cells were grown in media containing thymidine or guanylic acid. A hypothetical scheme which suggests a relationship between the control of purine and pyrimidine biosynthesis in this bacterium and which is consistent with the experimental results obtained is presented. PMID:5686000

  8. A tandem array of 5S ribosomal RNA genes in Pythium irregulare.

    PubMed

    Belkhiri, A; Intengan, H; Klassen, G R

    1997-02-28

    The 5S ribosomal RNA genes of the oomycete Pythium irregulare exist in tandem arrays unlinked to the rDNA repeat unit. A clone with a 9.2-kb insert containing an array of 5S genes was identified in a lambda genomic library and was characterized by restriction mapping and partial sequencing. The array consisted of 9 apparently identical 5S genes and their spacers in tandem, followed by a diverged 5S-like sequence that is likely to be a pseudogene. This gene arrangement, although almost universal in plants and animals, is rare in fungi and protists.

  9. Dysregulation of Plasmalogen Homeostasis Impairs Cholesterol Biosynthesis.

    PubMed

    Honsho, Masanori; Abe, Yuichi; Fujiki, Yukio

    2015-11-27

    Plasmalogen biosynthesis is regulated by modulating fatty acyl-CoA reductase 1 stability in a manner dependent on cellular plasmalogen level. However, physiological significance of the regulation of plasmalogen biosynthesis remains unknown. Here we show that elevation of the cellular plasmalogen level reduces cholesterol biosynthesis without affecting the isoprenylation of proteins such as Rab and Pex19p. Analysis of intermediate metabolites in cholesterol biosynthesis suggests that the first oxidative step in cholesterol biosynthesis catalyzed by squalene monooxygenase (SQLE), an important regulator downstream HMG-CoA reductase in cholesterol synthesis, is reduced by degradation of SQLE upon elevation of cellular plasmalogen level. By contrast, the defect of plasmalogen synthesis causes elevation of SQLE expression, resulting in the reduction of 2,3-epoxysqualene required for cholesterol synthesis, hence implying a novel physiological consequence of the regulation of plasmalogen biosynthesis.

  10. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

    PubMed

    Hori, H; Osawa, S; Iwabuchi, M

    1980-12-11

    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

  11. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  12. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  13. A search for the Bs meson in Υ(5S) decays

    NASA Astrophysics Data System (ADS)

    Shipsey, Ian

    2004-05-01

    The CLEO III detector has recorded approximately 0.5 fb-1 of e^+ e^- annihilation data at the Υ(5S) resonance. Using this data sample, we have searched for fully reconstructed Bs mesons in the reaction Υ(5S) arrow B_s^(*) barB_s^(*)

  14. Discovery and characterization of Acanthamoeba castellanii mitochondrial 5S rRNA.

    PubMed

    Bullerwell, Charles E; Schnare, Murray N; Gray, Michael W

    2003-03-01

    Although 5S rRNA is a highly conserved and universal component of eubacterial, archaeal, chloroplast, and eukaryotic cytoplasmic ribosomes, a mitochondrial DNA-encoded 5S rRNA has so far been identified only in land plants and certain protists. This raises the question of whether 5S rRNA is actually required for and used in mitochondrial translation. In the protist Acanthamoeba castellanii, BLAST searches fail to reveal a 5S rRNA gene in the complete mitochondrial genome sequence, nor is a 5S-sized RNA species detectable in ethidium bromide-stained gels of highly purified mitochondrial RNA preparations. Here we show that an alternative visualization technique, UV shadowing, readily detects a novel, mitochondrion-specific small RNA in A. castellanii mitochondrial RNA preparations, and that this RNA species is, in fact, a 5S rRNA encoded by the A. castellanii mitochondrial genome. These results emphasize the need for caution when interpreting negative results that suggest the absence of 5S rRNA and/or a mitochondrial DNA-encoded 5S rRNA sequence in other (particularly protist) mitochondrial systems.

  15. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  16. The 5S lean method as a tool of industrial management performances

    NASA Astrophysics Data System (ADS)

    Filip, F. C.; Marascu-Klein, V.

    2015-11-01

    Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

  17. Identifications of 5{{s}_{1/2}}-5{{p}_{3/2}} and 5{{s}^{2}}-5s5p EUV transitions of promethium-like Pt, Ir, Os and Re

    NASA Astrophysics Data System (ADS)

    Bekker, H.; Versolato, O. O.; Windberger, A.; Oreshkina, N. S.; Schupp, R.; Baumann, T. M.; Harman, Z.; Keitel, C. H.; Schmidt, P. O.; Ullrich, J.; Crespo López-Urrutia, J. R.

    2015-07-01

    We investigated Pm-, Nd-, and Pr-like spectra in the extreme ultra-violet region around 20 nm of Pt, Ir, Os, and Re (Z = 78-75) produced in the Heidelberg electron beam ion trap. Identification of the transitions was supported by several theoretical calculations, including collisional radiative modeling of the observed spectra. Special attention is given to the identifications of the alkaline-like 5{{s}1/2}-5{{p}3/2} resonance lines in promethium-like highly charged ions. Previous identifications of these lines have been tentative at best due to disagreements with theory and doubts about the experimental charge state identifications. Our experimental results for the 5{{s}1/2}-5{{p}3/2} wavelengths are accurate at the 0.005%-level. Understanding the level-structure of ions near the 4f-5s level crossing is of particular importance for future searches of a possible fine-structure constant variation, and new optical clocks.

  18. Evolution of rosmarinic acid biosynthesis.

    PubMed

    Petersen, Maike; Abdullah, Yana; Benner, Johannes; Eberle, David; Gehlen, Katja; Hücherig, Stephanie; Janiak, Verena; Kim, Kyung Hee; Sander, Marion; Weitzel, Corinna; Wolters, Stefan

    2009-01-01

    Rosmarinic acid and chlorogenic acid are caffeic acid esters widely found in the plant kingdom and presumably accumulated as defense compounds. In a survey, more than 240 plant species have been screened for the presence of rosmarinic and chlorogenic acids. Several rosmarinic acid-containing species have been detected. The rosmarinic acid accumulation in species of the Marantaceae has not been known before. Rosmarinic acid is found in hornworts, in the fern family Blechnaceae and in species of several orders of mono- and dicotyledonous angiosperms. The biosyntheses of caffeoylshikimate, chlorogenic acid and rosmarinic acid use 4-coumaroyl-CoA from the general phenylpropanoid pathway as hydroxycinnamoyl donor. The hydroxycinnamoyl acceptor substrate comes from the shikimate pathway: shikimic acid, quinic acid and hydroxyphenyllactic acid derived from l-tyrosine. Similar steps are involved in the biosyntheses of rosmarinic, chlorogenic and caffeoylshikimic acids: the transfer of the 4-coumaroyl moiety to an acceptor molecule by a hydroxycinnamoyltransferase from the BAHD acyltransferase family and the meta-hydroxylation of the 4-coumaroyl moiety in the ester by a cytochrome P450 monooxygenase from the CYP98A family. The hydroxycinnamoyltransferases as well as the meta-hydroxylases show high sequence similarities and thus seem to be closely related. The hydroxycinnamoyltransferase and CYP98A14 from Coleus blumei (Lamiaceae) are nevertheless specific for substrates involved in RA biosynthesis showing an evolutionary diversification in phenolic ester metabolism. Our current view is that only a few enzymes had to be "invented" for rosmarinic acid biosynthesis probably on the basis of genes needed for the formation of chlorogenic and caffeoylshikimic acid while further biosynthetic steps might have been recruited from phenylpropanoid metabolism, tocopherol/plastoquinone biosynthesis and photorespiration. PMID:19560175

  19. Evolution of rosmarinic acid biosynthesis.

    PubMed

    Petersen, Maike; Abdullah, Yana; Benner, Johannes; Eberle, David; Gehlen, Katja; Hücherig, Stephanie; Janiak, Verena; Kim, Kyung Hee; Sander, Marion; Weitzel, Corinna; Wolters, Stefan

    2009-01-01

    Rosmarinic acid and chlorogenic acid are caffeic acid esters widely found in the plant kingdom and presumably accumulated as defense compounds. In a survey, more than 240 plant species have been screened for the presence of rosmarinic and chlorogenic acids. Several rosmarinic acid-containing species have been detected. The rosmarinic acid accumulation in species of the Marantaceae has not been known before. Rosmarinic acid is found in hornworts, in the fern family Blechnaceae and in species of several orders of mono- and dicotyledonous angiosperms. The biosyntheses of caffeoylshikimate, chlorogenic acid and rosmarinic acid use 4-coumaroyl-CoA from the general phenylpropanoid pathway as hydroxycinnamoyl donor. The hydroxycinnamoyl acceptor substrate comes from the shikimate pathway: shikimic acid, quinic acid and hydroxyphenyllactic acid derived from l-tyrosine. Similar steps are involved in the biosyntheses of rosmarinic, chlorogenic and caffeoylshikimic acids: the transfer of the 4-coumaroyl moiety to an acceptor molecule by a hydroxycinnamoyltransferase from the BAHD acyltransferase family and the meta-hydroxylation of the 4-coumaroyl moiety in the ester by a cytochrome P450 monooxygenase from the CYP98A family. The hydroxycinnamoyltransferases as well as the meta-hydroxylases show high sequence similarities and thus seem to be closely related. The hydroxycinnamoyltransferase and CYP98A14 from Coleus blumei (Lamiaceae) are nevertheless specific for substrates involved in RA biosynthesis showing an evolutionary diversification in phenolic ester metabolism. Our current view is that only a few enzymes had to be "invented" for rosmarinic acid biosynthesis probably on the basis of genes needed for the formation of chlorogenic and caffeoylshikimic acid while further biosynthetic steps might have been recruited from phenylpropanoid metabolism, tocopherol/plastoquinone biosynthesis and photorespiration.

  20. Tetrahydrobiopterin biosynthesis, regeneration and functions.

    PubMed Central

    Thöny, B; Auerbach, G; Blau, N

    2000-01-01

    Tetrahydrobiopterin (BH(4)) cofactor is essential for various processes, and is present in probably every cell or tissue of higher organisms. BH(4) is required for various enzyme activities, and for less defined functions at the cellular level. The pathway for the de novo biosynthesis of BH(4) from GTP involves GTP cyclohydrolase I, 6-pyruvoyl-tetrahydropterin synthase and sepiapterin reductase. Cofactor regeneration requires pterin-4a-carbinolamine dehydratase and dihydropteridine reductase. Based on gene cloning, recombinant expression, mutagenesis studies, structural analysis of crystals and NMR studies, reaction mechanisms for the biosynthetic and recycling enzymes were proposed. With regard to the regulation of cofactor biosynthesis, the major controlling point is GTP cyclohydrolase I, the expression of which may be under the control of cytokine induction. In the liver at least, activity is inhibited by BH(4), but stimulated by phenylalanine through the GTP cyclohydrolase I feedback regulatory protein. The enzymes that depend on BH(4) are the phenylalanine, tyrosine and tryptophan hydroxylases, the latter two being the rate-limiting enzymes for catecholamine and 5-hydroxytryptamine (serotonin) biosynthesis, all NO synthase isoforms and the glyceryl-ether mono-oxygenase. On a cellular level, BH(4) has been found to be a growth or proliferation factor for Crithidia fasciculata, haemopoietic cells and various mammalian cell lines. In the nervous system, BH(4) is a self-protecting factor for NO, or a general neuroprotecting factor via the NO synthase pathway, and has neurotransmitter-releasing function. With regard to human disease, BH(4) deficiency due to autosomal recessive mutations in all enzymes (except sepiapterin reductase) have been described as a cause of hyperphenylalaninaemia. Furthermore, several neurological diseases, including Dopa-responsive dystonia, but also Alzheimer's disease, Parkinson's disease, autism and depression, have been suggested to be

  1. Chemical accessibility of the 4.5S RNA in spinach chloroplast ribosomes.

    PubMed Central

    Kumagai, I; Bartsch, M; Subramanian, A R; Erdmann, V A

    1983-01-01

    We have examined the accessibility to diethylpyrocarbonate of spinach chloroplast 4.5S ribosomal RNA when free and when it is part of the ribosomal structure. The modifications in free 4.5S RNA were found mostly in single-stranded regions of the secondary structure model proposed in our previous paper (Kumagai, I. et al. (1982) J.B.C. 257, 12924-28): adenines at positions 17, 19, 33, 36, 54, 55, 60, 64, 68, 72, 77, 86 and 87 were identified as the reactive residues. On the other hand, in 4.5S RNA in 70S ribosomes or 50S subunits, adenine 33 was exclusively modified, and its reactivity was much higher than in free 4.5S RNA. This highly accessible A33 of spinach 4.5S RNA is located within a characteristic seven nucleotide sequence, which is found in the 4.5S rRNAs from spinach, tobacco and a fern but deleted in 4.5S RNAs from maize and wheat. Images PMID:6828382

  2. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    SciTech Connect

    Hirose, Yutaka Harada, Fumio

    2008-01-04

    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus.

  3. Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

    PubMed Central

    Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B

    1978-01-01

    A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

  4. Abundant 5S rRNA-like transcripts encoded by the mitochondrial genome in amoebozoa.

    PubMed

    Bullerwell, Charles E; Burger, Gertraud; Gott, Jonatha M; Kourennaia, Olga; Schnare, Murray N; Gray, Michael W

    2010-05-01

    5S rRNAs are ubiquitous components of prokaryotic, chloroplast, and eukaryotic cytosolic ribosomes but are apparently absent from mitochondrial ribosomes (mitoribosomes) of many eukaryotic groups including animals and fungi. Nevertheless, a clearly identifiable, mitochondrion-encoded 5S rRNA is present in Acanthamoeba castellanii, a member of Amoebozoa. During a search for additional mitochondrial 5S rRNAs, we detected small abundant RNAs in other members of Amoebozoa, namely, in the lobose amoeba Hartmannella vermiformis and in the myxomycete slime mold Physarum polycephalum. These RNAs are encoded by mitochondrial DNA (mtDNA), cosediment with mitoribosomes in glycerol gradients, and can be folded into a secondary structure similar to that of bona fide 5S rRNAs. Further, in the mtDNA of another slime mold, Didymium nigripes, we identified a region that in sequence, potential secondary structure, and genomic location is similar to the corresponding region encoding the Physarum small RNA. A mtDNA-encoded small RNA previously identified in Dictyostelium discoideum is here shown to share several characteristics with known 5S rRNAs. Again, we detected genes encoding potential homologs of this RNA in the mtDNA of three other species of the genus Dictyostelium as well as in a related genus, Polysphondylium. Taken together, our results indicate a widespread occurrence of small, abundant, mtDNA-encoded RNAs with 5S rRNA-like structures that are associated with the mitoribosome in various amoebozoan taxa. Our working hypothesis is that these novel small abundant RNAs represent radically divergent mitochondrial 5S rRNA homologs. We posit that currently unrecognized 5S-like RNAs may exist in other mitochondrial systems in which a conventional 5S rRNA cannot be identified.

  5. Primary structure of the 5 S subunit of transcarboxylase as deduced from the genomic DNA sequence.

    PubMed

    Thornton, C G; Kumar, G K; Shenoy, B C; Haase, F C; Phillips, N F; Park, V M; Magner, W J; Hejlik, D P; Wood, H G; Samols, D

    1993-09-13

    Transcarboxylase from Propionibacterium shermanii is a complex biotin-containing enzyme composed of 30 polypeptides of three different types. It is composed of six dimeric outer subunits associated with a central cylindrical hexameric subunit through 12 biotinyl subunits; three outer subunits on each face of the central hexamer. Each outer dimer is termed a 5 S subunit which associates with two biotinyl subunits. The enzyme catalyzes a two-step reaction in which methylmalonyl-CoA and pyruvate form propionyl-CoA and oxalacetate, the 5 S subunit specifically catalyzing one of these reactions. We report here the cloning, sequencing and expression of the monomer of the 5 S subunit. The gene was identified by matching amino acid sequences derived from isolated authentic 5 S peptides with the deduced sequence of an open reading frame present on a cloned P. shermanii genomic fragment known to contain the gene encoding the 1.3 S biotinyl subunit. The cloned 5 S gene encodes a protein of 519 amino acids, M(r) 57,793. The deduced sequence shows regions of extensive homology with that of pyruvate carboxylase and oxalacetate decarboxylase, two enzymes which catalyze the same or reverse reaction. A fragment was subcloned into pUC19 in an orientation such that the 5 S open reading frame could be expressed from the lac promoter of the vector. Crude extracts prepared from these cells contained an immunoreactive band on Western blots which co-migrated with authentic 5 S and were fully active in catalyzing the 5 S partial reaction. We conclude that we have cloned, sequenced and expressed the monomer of the 5 S subunit and that the expressed product is catalytically active. PMID:8365490

  6. Fatty acid biosynthesis in actinomycetes

    PubMed Central

    Gago, Gabriela; Diacovich, Lautaro; Arabolaza, Ana; Tsai, Shiou-Chuan; Gramajo, Hugo

    2011-01-01

    All organisms that produce fatty acids do so via a repeated cycle of reactions. In mammals and other animals, these reactions are catalyzed by a type I fatty acid synthase (FAS), a large multifunctional protein to which the growing chain is covalently attached. In contrast, most bacteria (and plants) contain a type II system in which each reaction is catalyzed by a discrete protein. The pathway of fatty acid biosynthesis in Escherichia coli is well established and has provided a foundation for elucidating the type II FAS pathways in other bacteria (White et al., 2005). However, fatty acid biosynthesis is more diverse in the phylum Actinobacteria: Mycobacterium, possess both FAS systems while Streptomyces species have only the multi-enzyme FAS II system and Corynebacterium species exclusively FAS I. In this review we present an overview of the genome organization, biochemical properties and physiological relevance of the two FAS systems in the three genera of actinomycetes mentioned above. We also address in detail the biochemical and structural properties of the acyl-CoA carboxylases (ACCases) that catalyzes the first committed step of fatty acid synthesis in actinomycetes, and discuss the molecular bases of their substrate specificity and the structure-based identification of new ACCase inhibitors with anti-mycobacterial properties. PMID:21204864

  7. Oleic acid biosynthesis in cyanobacteria

    SciTech Connect

    VanDusen, W.J.; Jaworski, J.G.

    1986-05-01

    The biosynthesis of fatty acids in cyanobacteria is very similar to the well characterized system found in green plants. However, the initial desaturation of stearic acid in cyanobacteria appears to represent a significant departure from plant systems in which stearoyl-ACP is the exclusive substrate for desaturation. In Anabaena variabilis, the substrate appears to be monoglucosyldiacylglycerol, a lipid not found in plants. The authors examined five different cyanobacteria to determine if the pathway in A. variabilis was generally present in other cyanobacteria. The cyanobacteria studied were A. variabilis, Chlorogloeopsis sp., Schizothrix calcicola, Anacystis marina, and Anacystis nidulans. Each were grown in liquid culture, harvested, and examined for stearoyl-ACP desaturase activity or incubated with /sup 14/CO/sub 2/. None of the cyanobacteria contained any stearoyl-ACP desaturase activity in whole homogenates or 105,000g supernatants. All were capable of incorporating /sup 14/CO/sub 2/ into monoglucosyldiacylglycerol and results from incubations of 20 min, 1 hr, 1 hr + 10 hr chase were consistent with monoglucosyldiacylglycerol serving as precursor for monogalctosyldiacylglycerol. Thus, initial evidence is consistent with oleic acid biosynthesis occurring by desaturation of stearoyl-monoglucosyldiacylglycerol in all cyanobacteria.

  8. Lipoarabinomannans: from structure to biosynthesis.

    PubMed

    Nigou, Jérôme; Gilleron, Martine; Puzo, Germain

    2003-01-01

    Mycobacterium tuberculosis, the causative agent of tuberculosis, is one of the most effective human pathogens and the molecular basis of its virulence remains poorly understood. Here, we review our current knowledge about the structure and biosynthesis of the mycobacterial cell-wall lipoglycans, lipoarabinomannans (LAM). LAM are ubiquitous of mycobacteria and appear as the most potent non-peptidic molecules to modulate the host immune response. Nevertheless, LAM structure differs according to the mycobacterial species and three types of LAM have been described: mannose-capped LAM (ManLAM), phospho-myo-inositol-capped LAM (PILAM) and non-capped LAM (AraLAM). The type of capping is a major structural feature determining the ability of LAM to modulate the immune response. ManLAM, found in slow-growing mycobacteria, such as M. tuberculosis, have been demonstrated to be powerful anti-inflammatory molecules and emerge as key virulence factors that may be relevant drug targets. LAM-like molecules are not only confined to mycobacteria but are also present in actinomycetes (including the genera Rhodococcus, Corynebacterium or Gordonia). This offers the possibility of comparative studies that should help in deciphering the structure-function relationships and biosynthesis of these complex molecules in the future.

  9. Angular distribution of Xe 5s. -->. epsilonp photoelectrons: Disagreement between experiment and theory

    SciTech Connect

    Fahlman, A.; Carlson, T.A.; Krause, M.O.

    1983-04-11

    The angular asymmetry parameter ..beta.. for the Xe 5s..-->..epsilonp photoelectrons has been studied with use of synchrotron radiation (h..nu.. = 28--65 eV). The present results show that the relativistic random-phase approximation theory does not satisfactorily describe the Xe 5s photoionization process close to the Cooper minimum and thus require a renewed theoretical approach. The 5s partial photoionization cross section was obtained over the same photon region and the results agree with experimental values found in the literature.

  10. Abridged 5S rDNA units in sea beet (Beta vulgaris subsp. maritima).

    PubMed

    Turner, Daniel J; Brown, Terence A

    2005-04-01

    Amplification by polymerase chain reaction of the 5S rDNA repeat units of Beta vulgaris subsp. maritima resulted in a 350-bp product corresponding to the full-length 5S unit, but also revealed 4 abridged unit classes, each with a deletion that removed most of the spacer and 12-76 bp of the coding sequence. Each abridged type lacks at least 1 of the conserved elements involved in transcription of the 5S gene, and so appear to be nonfunctional. Network analysis revealed that the abridged units are evolving in the same manner as the full-length versions.

  11. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  12. Cellulose biosynthesis inhibitors - a multifunctional toolbox.

    PubMed

    Tateno, Mizuki; Brabham, Chad; DeBolt, Seth

    2016-01-01

    In the current review, we examine the growing number of existing Cellulose Biosynthesis Inhibitors (CBIs) and based on those that have been studied with live cell imaging we group their mechanism of action. Attention is paid to the use of CBIs as tools to ask fundamental questions about cellulose biosynthesis.

  13. Cellulose biosynthesis inhibitors - a multifunctional toolbox.

    PubMed

    Tateno, Mizuki; Brabham, Chad; DeBolt, Seth

    2016-01-01

    In the current review, we examine the growing number of existing Cellulose Biosynthesis Inhibitors (CBIs) and based on those that have been studied with live cell imaging we group their mechanism of action. Attention is paid to the use of CBIs as tools to ask fundamental questions about cellulose biosynthesis. PMID:26590309

  14. Current aspects of auxin biosynthesis in plants.

    PubMed

    Kasahara, Hiroyuki

    2015-01-01

    Auxin is an important plant hormone essential for many aspects of plant growth and development. Indole-3-acetic acid (IAA) is the most studied auxin in plants, and its biosynthesis pathway has been investigated for over 70 years. Although the complete picture of auxin biosynthesis remains to be elucidated, remarkable progress has been made recently in understanding the mechanism of IAA biosynthesis. Genetic and biochemical studies demonstrate that IAA is mainly synthesized from l-tryptophan (Trp) via indole-3-pyruvate by two-step reactions in Arabidopsis. While IAA is also produced from Trp via indole-3-acetaldoxime in Arabidopsis, this pathway likely plays an auxiliary role in plants of the family Brassicaceae. Recent studies suggest that the Trp-independent pathway is not a major route for IAA biosynthesis, but they reveal an important role for a cytosolic indole synthase in this pathway. In this review, I summarize current views and future prospects of IAA biosynthesis research in plants.

  15. Pressure broadening and line shifting of atomic strontium 5s{sup 2} {sup 1}S{sub 0}{yields}5s5p {sup 3}P{sub 1} and 5s5p {sup 3}P{sub 0,1,2}{yields}5s6s {sup 3}S{sub 1} absorption transitions induced by noble-gas collisions

    SciTech Connect

    Holtgrave, Jeremy C.; Wolf, Paul J.

    2005-07-15

    The broadening and shifting of spectral lines induced by collisions with the five noble gases in both the intercombination 5s{sup 2} {sup 1}S{sub 0}{yields}5s5p {sup 3}P{sub 1} system and the triplet 5s5p {sup 3}P{sub 0,1,2}{yields}5s6s {sup 3}S{sub 1} manifold of Sr are studied using tunable dye laser absorption spectroscopy. Cross sections for impact broadening and line shifting are determined from an examination of the spectral line profiles. These results are utilized in an analysis to compute difference potentials modeled by the Lennard-Jones (6-12) potential and the coefficients C{sub 6} and C{sub 12} derived from this analysis are reported.

  16. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    NASA Technical Reports Server (NTRS)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  17. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  18. 104. JOB NO. 1347F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    104. JOB NO. 1347-F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD MOTOR COMPANY; LONGITUDINAL SECTION AND TRUSS DETAILS - Ford Motor Company Long Beach Assembly Plant, Assembly Building, 700 Henry Ford Avenue, Long Beach, Los Angeles County, CA

  19. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

    PubMed

    MacKay, R M; Gray, M W; Doolittle, W F

    1980-11-11

    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.

  20. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    PubMed

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p< 0.001). After the implementation of 5S it was observed and determined that facilitating the job and setting up a safe environment created

  1. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    PubMed

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p< 0.001). After the implementation of 5S it was observed and determined that facilitating the job and setting up a safe environment created

  2. Interaction of Xenopus TFIIIC with the TFIIIA.5 S RNA gene complex.

    PubMed

    Keller, H J; Romaniuk, P J; Gottesfeld, J M

    1992-09-01

    The general transcription factor TFIIIC is necessary for transcription initiation by RNA polymerase III. TFIIIC binds predominantly to the B-Block promoter element, which is present in tRNA genes, several viral RNA genes and repetitive DNA elements, and to the TFIIIA.DNA complex on 5 S RNA genes. Here we report a characterization of Xenopus laevis TFIIIC and its interaction with the TFIIIA.5 S RNA gene complex. A polypeptide with apparent molecular mass of 85 kDa was specifically cross-linked to a B-Block oligonucleotide by UV light. This polypeptide was present in the partially purified TFIIIC fraction and in a complex with a B-Block double-stranded oligonucleotide isolated by nondenaturing gel electrophoresis. TFIIIC.TFIIIA.DNA gel mobility shift complexes were obtained using B-Block DNA affinity-purified TFIIIC and buffer conditions employing low Mg2+ (1 mM) and high dithiothreitol (7 mM) concentrations. Three TFIIIC.TFIIIA.5 S RNA gene complexes were observed by gel mobility shift analysis. One of these complexes was resistant to dissociation by the addition of competing DNA, but the formation of all three complexes was prevented by the inclusion of excess specific competitor DNA in the initial binding reactions. The apparent affinity of TFIIIC for the TFIIIA.5 S DNA complex was 5-fold higher for the somatic-type 5 S RNA gene than for the oocyte-type 5 S RNA gene. Mutations near the 5' boundary of the TFIIIA binding site alter the DNase I footprint of the TFIIIA.DNA complex and reduce the affinity of TFIIIA-mutant 5 S gene complexes for TFIIIC. Differences in TFIIIC affinity for the two classes of 5 S RNA genes may play a role in the developmental regulation of these gene families. PMID:1517247

  3. Satellite DNA derived from 5S rDNA in Physalaemus cuvieri (Anura, Leiuperidae).

    PubMed

    Vittorazzi, S E; Lourenço, L B; Del-Grande, M L; Recco-Pimentel, S M

    2011-01-01

    In the present study, we describe for the first time a family of 190-bp satellite DNA related to 5S rDNA in anurans and the existence of 2 forms of 5S rDNA, type I (201 bp) and type II (690 bp). The sequences were obtained from genomic DNA of Physalaemus cuvieri from Palmeiras, State of Bahia, Brazil. Analysis of the nucleotide sequence revealed that the satellite DNA obtained by digestion with EcoRI, called PcP190EcoRI, is 70% similar to the coding region of type I 5S rDNA and 66% similar to the coding region of type II 5S rDNA. Membrane hybridization and PCR amplification of the sequence showed that PcP190EcoRI is tandemly repeated. The satellite DNA as well as type I and type II 5S rDNA were localized in P. cuvieri chromosomes by fluorescent in situ hybridization. The PcP190EcoRI sequence was found in the centromeres of chromosomes 1-5 and in the pericentromeric region of chromosome 3. Type I 5S rDNA was detected in chromosome 3, coincident with the site of PcP190EcoRI. Type II 5S rDNA was located interstitially in the long arm of chromosome 5. None of these sequences co-localized with nucleolar organizer regions. Our data suggests that this satellite DNA originates from the 5S ribosomal multigene family, probably by gene duplication, nucleotide divergence and sequence dispersion in the genome.

  4. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  5. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  6. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  7. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    PubMed

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production.

  8. One-stage surgery through posterior approach-for L5-S1 spondyloptosis

    PubMed Central

    Suslu, Hikmet Turan; Celikoglu, Erhan; Borekcı, Ali; Hıcdonmez, Tufan; Suslu, Hüsnü

    2011-01-01

    Grade 5 spondylolisthesis or spondyloptosis is a rare condition. Generally, the surgical management of spondyloptosis includes multi-staged procedures instead of one-staged procedures. One-stage treatment for spondyloptosis is very rare. A 15-year-old girl with L5-S1 spondyloptosis was admitted with severe low back pain. There was no history of trauma. The patient underwent L5 laminectomy, L5-S1 discectomy, resection of sacral dome, reduction, L3-L4-L5-S1 pedicular screw fixation, and interbody-posterolateral fusion through the posterior approach. The reduction was maintained with bilateral L5-S1 discectomy, resection of the sacral dome, and transpedicular instrumentation from L3 to S1. In this particular case, one-staged approach was adequate for the treatment of L5-S1 spondyloptosis. One-staged surgery using the posterior approach may be adequate for the treatment of L5-S1 spondyloptosis while avoiding the risks inherent in anterior approaches. PMID:23125496

  9. Direct 5S rRNA Assay for Monitoring Mixed-Culture Bioprocesses

    PubMed Central

    Stoner, D. L.; Browning, C. K.; Bulmer, D. K.; Ward, T. E.; MacDonell, M. T.

    1996-01-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species extracted from collected biomass. Separation is based on the unique migration behavior of each 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the genera Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. PMID:16535333

  10. Topographic heterogeneity in cholesterol biosynthesis.

    PubMed

    Lange, Y; Muraski, M F

    1988-07-01

    We have examined the membrane topography of cholesterol biosynthesis in cultured human fibroblasts. We fed the cells with radioacetate and then interrupted the biosynthetic pathway so as to trap labeled intermediates in their subcellular locations. We analyzed homogenates of human fibroblasts labeled biosynthetically from radioacetate by centrifugation to equilibrium on sucrose gradients. The following two methods were used to interrupt cholesterol biosynthesis: incubation at 10 degrees C and treatment with 4,4,10 beta-trimethyl-trans-decal-3 beta-ol, a specific inhibitor of oxidosqualene cyclase. Incubation at 10 degrees C caused the accumulation of radiolanosterol at the expense of cholesterol. The lanosterol appeared predominantly at an unusually buoyant density (20% (w/w) sucrose; d = 1.08 g/cm3) as well as at the density normally labeled at 37 degrees C (30% sucrose; d = 1.13 g/cm3). 4,4,10 beta-Trimethyl-trans-decal-3 beta-ol treatment caused the accumulation of labeled squalene and squalene 2,3-oxide. Reversal of the block permitted the label to progress rapidly as a wave into lanosterol and ultimately into cholesterol. The profiles of the three precursors did not coincide, suggesting that they were mostly in different membranes. Squalene was uniquely confined to a density of 1.18 g/cm3 (40% sucrose) while squalene 2,3-oxide appeared in peaks of density 1.08 g/cm3 and 1.13 g/cm3 (20% and 30% sucrose). Lanosterol was in a peak of density 1.13 g/cm3. Pulse-chase experiments showed that lanosterol synthesized in the membranes at 20% sucrose moved rapidly to the membranes at 30% sucrose where it was converted to cholesterol. The density gradient profiles of the following organelle markers also were monitored: plasma membrane, cholesterol mass; Golgi apparatus, galactosyltransferase; endoplasmic reticulum, RNA, 3-hydroxy-3-methylglutaryl-coenzyme A reductase and cytochrome c reductase; peroxisomes, catalase. None of these markers appeared at the buoyant density

  11. Steroid biosynthesis in adipose tissue.

    PubMed

    Li, Jiehan; Papadopoulos, Vassilios; Vihma, Veera

    2015-11-01

    Tissue-specific expression of steroidogenic enzymes allows the modulation of active steroid levels in a local manner. Thus, the measurement of local steroid concentrations, rather than the circulating levels, has been recognized as a more accurate indicator of the steroid action within a specific tissue. Adipose tissue, one of the largest endocrine tissues in the human body, has been established as an important site for steroid storage and metabolism. Locally produced steroids, through the enzymatic conversion from steroid precursors delivered to adipose tissue, have been proven to either functionally regulate adipose tissue metabolism, or quantitatively contribute to the whole body's steroid levels. Most recently, it has been suggested that adipose tissue may contain the steroidogenic machinery necessary for the initiation of steroid biosynthesis de novo from cholesterol. This review summarizes the evidence indicating the presence of the entire steroidogenic apparatus in adipose tissue and discusses the potential roles of local steroid products in modulating adipose tissue activity and other metabolic parameters.

  12. Acylphloroglucinol Biosynthesis in Strawberry Fruit.

    PubMed

    Song, Chuankui; Ring, Ludwig; Hoffmann, Thomas; Huang, Fong-Chin; Slovin, Janet; Schwab, Wilfried

    2015-11-01

    Phenolics have health-promoting properties and are a major group of metabolites in fruit crops. Through reverse genetic analysis of the functions of four ripening-related genes in the octoploid strawberry (Fragaria × ananassa), we discovered four acylphloroglucinol (APG)-glucosides as native Fragaria spp. fruit metabolites whose levels were differently regulated in the transgenic fruits. The biosynthesis of the APG aglycones was investigated by examination of the enzymatic properties of three recombinant Fragaria vesca chalcone synthase (FvCHS) proteins. CHS is involved in anthocyanin biosynthesis during ripening. The F. vesca enzymes readily catalyzed the condensation of two intermediates in branched-chain amino acid metabolism, isovaleryl-Coenzyme A (CoA) and isobutyryl-CoA, with three molecules of malonyl-CoA to form phlorisovalerophenone and phlorisobutyrophenone, respectively, and formed naringenin chalcone when 4-coumaroyl-CoA was used as starter molecule. Isovaleryl-CoA was the preferred starter substrate of FvCHS2-1. Suppression of CHS activity in both transient and stable CHS-silenced fruit resulted in a substantial decrease of APG glucosides and anthocyanins and enhanced levels of volatiles derived from branched-chain amino acids. The proposed APG pathway was confirmed by feeding isotopically labeled amino acids. Thus, Fragaria spp. plants have the capacity to synthesize pharmaceutically important APGs using dual functional CHS/(phloriso)valerophenone synthases that are expressed during fruit ripening. Duplication and adaptive evolution of CHS is the most probable scenario and might be generally applicable to other plants. The results highlight that important promiscuous gene function may be missed when annotation relies solely on in silico analysis. PMID:26169681

  13. Acylphloroglucinol Biosynthesis in Strawberry Fruit.

    PubMed

    Song, Chuankui; Ring, Ludwig; Hoffmann, Thomas; Huang, Fong-Chin; Slovin, Janet; Schwab, Wilfried

    2015-11-01

    Phenolics have health-promoting properties and are a major group of metabolites in fruit crops. Through reverse genetic analysis of the functions of four ripening-related genes in the octoploid strawberry (Fragaria × ananassa), we discovered four acylphloroglucinol (APG)-glucosides as native Fragaria spp. fruit metabolites whose levels were differently regulated in the transgenic fruits. The biosynthesis of the APG aglycones was investigated by examination of the enzymatic properties of three recombinant Fragaria vesca chalcone synthase (FvCHS) proteins. CHS is involved in anthocyanin biosynthesis during ripening. The F. vesca enzymes readily catalyzed the condensation of two intermediates in branched-chain amino acid metabolism, isovaleryl-Coenzyme A (CoA) and isobutyryl-CoA, with three molecules of malonyl-CoA to form phlorisovalerophenone and phlorisobutyrophenone, respectively, and formed naringenin chalcone when 4-coumaroyl-CoA was used as starter molecule. Isovaleryl-CoA was the preferred starter substrate of FvCHS2-1. Suppression of CHS activity in both transient and stable CHS-silenced fruit resulted in a substantial decrease of APG glucosides and anthocyanins and enhanced levels of volatiles derived from branched-chain amino acids. The proposed APG pathway was confirmed by feeding isotopically labeled amino acids. Thus, Fragaria spp. plants have the capacity to synthesize pharmaceutically important APGs using dual functional CHS/(phloriso)valerophenone synthases that are expressed during fruit ripening. Duplication and adaptive evolution of CHS is the most probable scenario and might be generally applicable to other plants. The results highlight that important promiscuous gene function may be missed when annotation relies solely on in silico analysis.

  14. Saturation Mutagenesis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Smith, Maria W.; Meskauskas, Arturas; Wang, Pinger; Sergiev, Petr V.; Dinman, Jonathan D.

    2001-01-01

    rRNAs are the central players in the reactions catalyzed by ribosomes, and the individual rRNAs are actively involved in different ribosome functions. Our previous demonstration that yeast 5S rRNA mutants (called mof9) can impact translational reading frame maintenance showed an unexpected function for this ubiquitous biomolecule. At the time, however, the highly repetitive nature of the genes encoding rRNAs precluded more detailed genetic and molecular analyses. A new genetic system allows all 5S rRNAs in the cell to be transcribed from a small, easily manipulated plasmid. The system is also amenable for the study of the other rRNAs, and provides an ideal genetic platform for detailed structural and functional studies. Saturation mutagenesis reveals regions of 5S rRNA that are required for cell viability, translational accuracy, and virus propagation. Unexpectedly, very few lethal alleles were identified, demonstrating the resilience of this molecule. Superimposition of genetic phenotypes on a physical map of 5S rRNA reveals the existence of phenotypic clusters of mutants, suggesting that specific regions of 5S rRNA are important for specific functions. Mapping these mutants onto the Haloarcula marismortui large subunit reveals that these clusters occur at important points of physical interaction between 5S rRNA and the different functional centers of the ribosome. Our analyses lead us to propose that one of the major functions of 5S rRNA may be to enhance translational fidelity by acting as a physical transducer of information between all of the different functional centers of the ribosome. PMID:11713264

  15. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  16. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    PubMed

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit. PMID:27106499

  17. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    PubMed

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis.

  18. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    PubMed

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  19. Direct 5S rRNA assay for monitoring mixed-culture bioprocesses

    SciTech Connect

    Stoner, D.L.; Bulmer, D.K.; Ward, T.E.

    1996-06-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis in denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the general Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. 40 refs., 12 figs., 1 tab.

  20. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    PubMed

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

  1. Affinity chromatography of Drosophila melanogaster ribosomal proteins to 5S rRNA.

    PubMed

    Stark, B C; Chooi, W Y

    1985-02-20

    The binding of Drosophila melanogaster ribosomal proteins to D. melanogaster 5S rRNA was studied using affinity chromatography of total ribosomal proteins (TP80) on 5S rRNA linked via adipic acid dihydrazide to Sepharose 4B. Ribosomal proteins which bound 5S rRNA at 0.3 M potassium chloride and were eluted at 1 M potassium chloride were identified as proteins 1, L4, 2/3, L14/L16, and S1, S2, S3, S4, S5, by two-dimensional polyacrylamide gel electrophoresis. Using poly A-Sepharose 4B columns as a model of non-specific binding, we found that a subset of TP80 proteins is also bound. This subset, while containing some of the proteins bound by 5S rRNA columns, was distinctly different from the latter subset, indicating that the binding to 5S rRNA was specific for that RNA species. PMID:3923010

  2. 5 S and 5.8 S ribosomal RNA sequences and protist phylogenetics.

    PubMed

    Walker, W F

    1985-01-01

    More than 100 5 S 5.8 S rRNA sequences from protists, including fungi, are known. Through a combination of quantitative treeing and special consideration of "signature' nucleotide combinations, the most significant phylogenetic implications of these data are emphasized. Also, limitations of the data for phylogenetic inferences are discussed and other significant data are brought to bear on the inferences obtained. 5 S sequences from red algae are seen as the most isolated among eukaryotics. A 5 S sequence lineage consisting of oomycetes, euglenoids, most protozoa, most slime molds and perhaps dinoflagellates and mesozoa is defined. Such a lineage is not evident from 5.8 S rRNA or cytochrome c sequence data. 5 S sequences from Ascomycota and Basidiomycota are consistent with the proposal that each is derived from a mycelial form with a haploid yeast phase and simple septal pores, probably most resembling present Taphrinales. 5 S sequences from Chytridiomycota and Zygomycota are not clearly distinct from each other and suggest that a major lineage radiation occurred in the early history of each. Qualitative biochemical data clearly supports a dichotomy between an Ascomycota-Basidiomycota lineage and a Zygomycota-Chytridiomycota lineage.

  3. Diversity of 5S rRNA genes within individual prokaryotic genomes.

    PubMed

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V; Parsons, Tamasha; Yang, Liying; Gerz, Erika A; Lee, Peng; Xiang, Charlie; Nossa, Carlos W; Pei, Zhiheng

    2012-10-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1161 genomes from 779 unique species, 96 species exhibited > 3% diversity. Twenty-seven species with > 10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) of the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there are tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level.

  4. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    NASA Technical Reports Server (NTRS)

    Luehrsen, K. R.; Fox, G. E.

    1981-01-01

    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  5. Sterols of the fungi - Distribution and biosynthesis

    NASA Technical Reports Server (NTRS)

    Weete, J. D.

    1973-01-01

    The importance of sterols in the growth and reproduction in fungi is becoming increasingly apparent. This article concerns the composition and biosynthesis of ergosterol in these organisms. Comparison to plant and animal sterol formation are made.

  6. Sterols of the fungi - Distribution and biosynthesis.

    NASA Technical Reports Server (NTRS)

    Weete, J. D.

    1973-01-01

    The importance of sterols in the growth and reproduction in fungi is becoming increasingly apparent. This article concerns the composition and biosynthesis of ergosterol in these organisms. Comparison to plant and animal sterol formation are made.

  7. Characterization of the L4-L5-S1 motion segment using the stepwise reduction method.

    PubMed

    Jaramillo, Héctor Enrique; Puttlitz, Christian M; McGilvray, Kirk; García, José J

    2016-05-01

    The two aims of this study were to generate data for a more accurate calibration of finite element models including the L5-S1 segment, and to find mechanical differences between the L4-L5 and L5-S1 segments. Then, the range of motion (ROM) and facet forces for the L4-S1 segment were measured using the stepwise reduction method. This consists of sequentially testing and reducing each segment in nine stages by cutting the ligaments, facet capsules, and removing the nucleus. Five L4-S1 human segments (median: 65 years, range: 53-84 years, SD=11.0 years) were loaded under a maximum pure moment of 8Nm. The ROM was measured using stereo-photogrammetry via tracking of three markers and the facet contact forces (CF) were measured using a Tekscan system. The ROM for the L4-L5 segment and all stages showed good agreement with published data. The major differences in ROM between the L4-L5 and L5-S1 segments were found for lateral bending and all stages, for which the L4-L5 ROM was about 1.5-3 times higher than that of the L5-S1 segment, consistent with L5-S1 facet CF about 1.3 to 4 times higher than those measured for the L4-L5 segment. For the other movements and few stages, the L4-L5 ROM was significantly lower that of the L5-S1 segment. ROM and CF provide important baseline data for more accurate calibration of FE models and to understand the role that their structures play in lower lumbar spine mechanics.

  8. Characterization of the L4-L5-S1 motion segment using the stepwise reduction method.

    PubMed

    Jaramillo, Héctor Enrique; Puttlitz, Christian M; McGilvray, Kirk; García, José J

    2016-05-01

    The two aims of this study were to generate data for a more accurate calibration of finite element models including the L5-S1 segment, and to find mechanical differences between the L4-L5 and L5-S1 segments. Then, the range of motion (ROM) and facet forces for the L4-S1 segment were measured using the stepwise reduction method. This consists of sequentially testing and reducing each segment in nine stages by cutting the ligaments, facet capsules, and removing the nucleus. Five L4-S1 human segments (median: 65 years, range: 53-84 years, SD=11.0 years) were loaded under a maximum pure moment of 8Nm. The ROM was measured using stereo-photogrammetry via tracking of three markers and the facet contact forces (CF) were measured using a Tekscan system. The ROM for the L4-L5 segment and all stages showed good agreement with published data. The major differences in ROM between the L4-L5 and L5-S1 segments were found for lateral bending and all stages, for which the L4-L5 ROM was about 1.5-3 times higher than that of the L5-S1 segment, consistent with L5-S1 facet CF about 1.3 to 4 times higher than those measured for the L4-L5 segment. For the other movements and few stages, the L4-L5 ROM was significantly lower that of the L5-S1 segment. ROM and CF provide important baseline data for more accurate calibration of FE models and to understand the role that their structures play in lower lumbar spine mechanics. PMID:27017302

  9. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    NASA Technical Reports Server (NTRS)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  10. Strong nondipole effect created by multielectron correlation in 5s photoionization of xenon

    SciTech Connect

    Ricz, S.; Koever, A.; Varga, D.; Ricsoka, T.; Sankari, R.; Jurvansuu, M.; Nikkinen, J.; Aksela, H.; Aksela, S.

    2003-01-01

    The angular distribution of the Xe 5s photoelectrons was measured in the 90-225 eV photon energy range using linearly polarized synchrotron radiation. The experimentally determined angular distribution parameters were compared with theoretical values obtained from calculations based on the random-phase approximation and the time-dependent density-functional theory. Experiment shows that the dipole ({beta}) and nondipole ({gamma}) parameters vary strongly as a function of the photon energy, in accordance with calculations that account for the interchannel coupling. Nondipole effects observed clearly in experiment confirm the role of multielectron correlation in describing the 5s photoionization of Xe far from the ionization threshold.

  11. The radiative lifetime of the 5S(0)2 metastable level of O(2+)

    NASA Technical Reports Server (NTRS)

    Johnson, B. C.; Smith, P. L.; Knight, R. D.

    1984-01-01

    The radiative lifetime of the 5S(0)2 metastable level of O(2+) was measured as 1.22 + or - 0.08 ms at the 90 percent confidence level by observing the time dependence of the spontaneous emission from metastable ions created and stored in a cylindrical radio-frequency ion trap. The intersystem line emission 2s(2)2p(2) 3P - 2s2p(3) 5S(0) was observed at 1660.8 and 1666.2 A. Discrepancies between measured and calculated values indicate that certain calculated transition probabilities for intersystem lines may be less reliable than previously believed.

  12. The nucleotide sequences of 5S rRNAs from three ciliated protozoa.

    PubMed Central

    Kumazaki, T; Hori, H; Osawa, S; Mita, T; Higashinakagawa, T

    1982-01-01

    The nucleotide sequences of 5S rRNAs from three ciliated protozoa, Paramecium tetraurelia, Tetrahymena thermophila and Blepharisma japonicum have been determined. All of them are 120 nucleotides long and the sequence of probable tRNA binding site of position 41-44 is GAAC which is characteristic of the plant 5S rRNAs. The sequence similarity percents are 87% (Paramecium/Tetrahymena), 86% (Paramecium/Blepharisma) and 79% (Tetrahymena/Blepharisma), suggesting a close relationship of these three ciliates. PMID:7122243

  13. Carotenoid Biosynthesis in Daucus carota.

    PubMed

    Simpson, Kevin; Cerda, Ariel; Stange, Claudia

    2016-01-01

    Carrot (Daucus carota) is one of the most important vegetable cultivated worldwide and the main source of dietary provitamin A. Contrary to other plants, almost all carrot varieties accumulate massive amounts of carotenoids in the root, resulting in a wide variety of colors, including those with purple, yellow, white, red and orange roots. During the first weeks of development the root, grown in darkness, is thin and pale and devoid of carotenoids. At the second month, the thickening of the root and the accumulation of carotenoids begins, and it reaches its highest level at 3 months of development. This normal root thickening and carotenoid accumulation can be completely altered when roots are grown in light, in which chromoplasts differentiation is redirected to chloroplasts development in accordance with an altered carotenoid profile. Here we discuss the current evidence on the biosynthesis of carotenoid in carrot roots in response to environmental cues that has contributed to our understanding of the mechanism that regulates the accumulation of carotenoids, as well as the carotenogenic gene expression and root development in D. carota. PMID:27485223

  14. Carotenoid Biosynthesis in Daucus carota.

    PubMed

    Simpson, Kevin; Cerda, Ariel; Stange, Claudia

    2016-01-01

    Carrot (Daucus carota) is one of the most important vegetable cultivated worldwide and the main source of dietary provitamin A. Contrary to other plants, almost all carrot varieties accumulate massive amounts of carotenoids in the root, resulting in a wide variety of colors, including those with purple, yellow, white, red and orange roots. During the first weeks of development the root, grown in darkness, is thin and pale and devoid of carotenoids. At the second month, the thickening of the root and the accumulation of carotenoids begins, and it reaches its highest level at 3 months of development. This normal root thickening and carotenoid accumulation can be completely altered when roots are grown in light, in which chromoplasts differentiation is redirected to chloroplasts development in accordance with an altered carotenoid profile. Here we discuss the current evidence on the biosynthesis of carotenoid in carrot roots in response to environmental cues that has contributed to our understanding of the mechanism that regulates the accumulation of carotenoids, as well as the carotenogenic gene expression and root development in D. carota.

  15. Biosynthesis of trichothecenes and apotrichothecenes.

    PubMed

    Zamir, L O; Nikolakakis, A; Sauriol, F; Mamer, O

    1999-05-01

    Fusarium culmorum produces two major trichothecenes, 3-acetyldeoxynivalenol and sambucinol, and some minor apotrichothecenes. It was desired to investigate if during their biosynthesis a C-11-keto intermediate was involved. To verify this postulate, trichodiene, a known precursor to trichothecenes, was synthesized with two deuteriums at C-11 and one at C-15. It was then fed to F. culmorum cultures, and the derived metabolites were purified and analyzed. The results ruled out the involvement of an 11-keto intermediate but revealed two novel apotrichothecenes. The characterization of their structures suggested that one of the 2-hydroxy-11alpha-apotrichothecene stereoisomers (2alpha or 2beta) could be converted to sambucinol. These apotrichothecenes were therefore synthesized labeled specifically with two deuteriums at C-4 and C-15 and fed to F. culmorum cultures. Indeed, the result established for the first time that 2alpha-hydroxy-11alpha-apotrichothecene was a precursor to sambucinol. A biosynthetic scheme for the production of trichothecenes and apotrichothecenes is described.

  16. Salicylic Acid Biosynthesis and Metabolism

    PubMed Central

    Dempsey, D'Maris Amick; Vlot, A. Corina; Wildermuth, Mary C.; Klessig, Daniel F.

    2011-01-01

    Salicylic acid (SA) has been shown to regulate various aspects of growth and development; it also serves as a critical signal for activating disease resistance in Arabidopsis thaliana and other plant species. This review surveys the mechanisms involved in the biosynthesis and metabolism of this critical plant hormone. While a complete biosynthetic route has yet to be established, stressed Arabidopsis appear to synthesize SA primarily via an isochorismate-utilizing pathway in the chloroplast. A distinct pathway utilizing phenylalanine as the substrate also may contribute to SA accumulation, although to a much lesser extent. Once synthesized, free SA levels can be regulated by a variety of chemical modifications. Many of these modifications inactivate SA; however, some confer novel properties that may aid in long distance SA transport or the activation of stress responses complementary to those induced by free SA. In addition, a number of factors that directly or indirectly regulate the expression of SA biosynthetic genes or that influence the rate of SA catabolism have been identified. An integrated model, encompassing current knowledge of SA metabolism in Arabidopsis, as well as the influence other plant hormones exert on SA metabolism, is presented. PMID:22303280

  17. Biosynthesis of trichothecenes and apotrichothecenes.

    PubMed

    Zamir, L O; Nikolakakis, A; Sauriol, F; Mamer, O

    1999-05-01

    Fusarium culmorum produces two major trichothecenes, 3-acetyldeoxynivalenol and sambucinol, and some minor apotrichothecenes. It was desired to investigate if during their biosynthesis a C-11-keto intermediate was involved. To verify this postulate, trichodiene, a known precursor to trichothecenes, was synthesized with two deuteriums at C-11 and one at C-15. It was then fed to F. culmorum cultures, and the derived metabolites were purified and analyzed. The results ruled out the involvement of an 11-keto intermediate but revealed two novel apotrichothecenes. The characterization of their structures suggested that one of the 2-hydroxy-11alpha-apotrichothecene stereoisomers (2alpha or 2beta) could be converted to sambucinol. These apotrichothecenes were therefore synthesized labeled specifically with two deuteriums at C-4 and C-15 and fed to F. culmorum cultures. Indeed, the result established for the first time that 2alpha-hydroxy-11alpha-apotrichothecene was a precursor to sambucinol. A biosynthetic scheme for the production of trichothecenes and apotrichothecenes is described. PMID:10552458

  18. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON QSAR

    EPA Science Inventory

    Dyer, S.D., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to predict HC5's Based on QSARs (Abstract). To be presented at the SETAC Europe 14th Annual Meeting: Environmental Science Solution: A Pan-European Perspective, 18-...

  19. Nucleotide sequences of 5S rRNAs from four jellyfishes.

    PubMed

    Hori, H; Ohama, T; Kumazaki, T; Osawa, S

    1982-11-25

    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica.

  20. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON MINIMAL DATA

    EPA Science Inventory

    Dyer, S., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to Predict HC5's Based on Minimal Data (Abstract). To be presented at the SETAC Fourth World Congress, 14-18 November 2004, Portland, OR. 1 p. (ERL,GB R1013).

  1. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules

    PubMed Central

    Valach, Matus; Burger, Gertraud; Gray, Michael W.; Lang, B. Franz

    2014-01-01

    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator. PMID:25429974

  2. Molecular organization of the 5S rDNA gene type II in elasmobranchs

    PubMed Central

    Castro, Sergio I.; Hleap, Jose S.; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    ABSTRACT The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS. PMID:26488198

  3. The 5-S RNA . protein complex from an extreme halophile, Halobacterium cutirubrum. Purification and characterization.

    PubMed

    Smith, N; Matheson, A T; Yaguchi, M; Willick, G E; Nazar, R N

    1978-09-01

    A 5-S RNA . protein complex has been isolated from the 50-S ribosomal subunit of an extreme halophile, Halobacterium cutirubrum. The 50-S ribosomal subunit from the extreme halophile requires 3.4 M K+ and 100 mM Mg2+ for stability. However, if the high K+ concentration is maintained but the Mg2+ concentration lowered to 0.3 mM, the 5-S RNA . protein complex is selectively extracted from the subunit. After being purified on an Agarose 0.5-m column the complex had a molecular weight of about 80000 and contained 5-S RNA and two proteins, HL13 and HL19, with molecular weights (by sedimentation equilibrium) of 18700 and 18000, respectively. No ATPase or GTPase activity could be detected in the 5-S RNA . protein complex. The amino acid composition and electrophoretic mobility on polyacrylamide gels indicated both proteins were much more acidic than the equivalent from Escherichia coli or Bacillus stearothermophilus. Partial amino acid sequence data suggest HL13 is homologous to EL18 and HL19 to EL5.

  4. Characterization of Ffh of Mycobacterium tuberculosis and its interaction with 4.5S RNA.

    PubMed

    Palaniyandi, Kannan; Veerasamy, Malini; Narayanan, Sujatha

    2012-10-12

    Signal recognition particle (SRP) mediates targeting of proteins to appropriate cellular compartments, which is an important process in all living organisms. In prokaryotes, SRP consists of Ffh, a protein, and 4.5S RNA that recognizes signal peptide emerging from ribosomes. The SRP (Ffh) of one the most successful intracellular pathogen, Mycobacterium tuberculosis, has been investigated with respect to biochemical properties. In the present study, Ffh of M. tuberculosis was overexpressed and was confirmed to be a GTPase using thin layer chromatography and malachite green assay. The GTP binding ability was confirmed by GTP overlay assay. The 4.5S RNA sequence of M. tuberculosis was synthesized by in vitro transcription assay. The interaction between Ffh and 4.5S RNA was confirmed by overlay assay and RNA gel shift assay. The results show that the biochemical properties of M. tuberculosis Ffh have been conserved, and this is the first report that shows the interaction of components of SRP in M. tuberculosis, namely Ffh protein and 4.5S RNA.

  5. 10. GIRDER APPROACH ON YORKTOWN SIDE, SHOWING PIERS 8S5S (LEFT ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. GIRDER APPROACH ON YORKTOWN SIDE, SHOWING PIERS 8S-5S (LEFT TO RIGHT), AND FLOORBEAM/STRINGER SYSTEM. VIEW LOOKING NORTH. - George P. Coleman Memorial Bridge, Spanning York River at U.S. Route 17, Yorktown, York County, VA

  6. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules.

    PubMed

    Valach, Matus; Burger, Gertraud; Gray, Michael W; Lang, B Franz

    2014-12-16

    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator.

  7. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    PubMed

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.

  8. Nucleolar association and transcriptional inhibition through 5S rDNA in mammals.

    PubMed

    Fedoriw, Andrew M; Starmer, Joshua; Yee, Della; Magnuson, Terry

    2012-01-01

    Changes in the spatial positioning of genes within the mammalian nucleus have been associated with transcriptional differences and thus have been hypothesized as a mode of regulation. In particular, the localization of genes to the nuclear and nucleolar peripheries is associated with transcriptional repression. However, the mechanistic basis, including the pertinent cis- elements, for such associations remains largely unknown. Here, we provide evidence that demonstrates a 119 bp 5S rDNA can influence nucleolar association in mammals. We found that integration of transgenes with 5S rDNA significantly increases the association of the host region with the nucleolus, and their degree of association correlates strongly with repression of a linked reporter gene. We further show that this mechanism may be functional in endogenous contexts: pseudogenes derived from 5S rDNA show biased conservation of their internal transcription factor binding sites and, in some cases, are frequently associated with the nucleolus. These results demonstrate that 5S rDNA sequence can significantly contribute to the positioning of a locus and suggest a novel, endogenous mechanism for nuclear organization in mammals.

  9. Relativistic effects on interchannel coupling in atomic photoionization: The photoelectron angular distribution of Xe 5s

    SciTech Connect

    Hemmers, O.; Manson, S. T.; Sant'Anna, M. M.; Focke, P.; Wang, H.; Sellin, I. A.; Lindle, D. W.

    2001-08-01

    Measurements of the photoelectron angular-distribution asymmetry parameter {beta} for Xe 5s photoionization have been performed in the 80--200 eV photon-energy region. The results show a substantial deviation from the nonrelativistic value of {beta}=2 and provide a clear signature of significant relativistic effects in interchannel coupling.

  10. 12. PIERS 5S AND 4S, SHOWING TRANSITION AT 4S FROM ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. PIERS 5S AND 4S, SHOWING TRANSITION AT 4S FROM GIRDER SPAN TO 'SUSPENDED' TRUSS SPAN AT U0. VIEW LOOKING WEST. - George P. Coleman Memorial Bridge, Spanning York River at U.S. Route 17, Yorktown, York County, VA

  11. An efficient synthetic approach to 6,5'-(S)- and 6,5'-(R)-cyclouridine.

    PubMed

    Theile, Christopher S; McLaughlin, Larry W

    2012-06-01

    Here we present new routes for the efficient syntheses of 6,5'-(S)- and 6,5'-(R)-cyclouridine. The syntheses utilize readily accessible uridine as a starting material. This route to the R diastereomer is significantly more efficient than previous synthetic efforts, allowing us to obtain large amounts of pure material for future biological testing.

  12. Nucleotide sequences of 5S rRNAs from four jellyfishes.

    PubMed

    Hori, H; Ohama, T; Kumazaki, T; Osawa, S

    1982-11-25

    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica. PMID:6130512

  13. Adaptation of the S-5-S pendulum seismometer for measurement of rotational ground motion

    NASA Astrophysics Data System (ADS)

    Knejzlík, Jaromír; Kaláb, Zdeněk; Rambouský, Zdeněk

    2012-10-01

    The Russian electrodynamic seismometer model S-5-S has been adapted for the measurement of rotational ground motion. The mechanical system of the original S-5-S seismometer consists of electrodynamic sensing and damping transducer coils mounted on an asymmetrical double-arm pendulum. This pendulum is suspended on a footing using two pairs of crossed flat springs, which operate as the axis of rotation. The pendulum is stabilised by an additional spring. The S-5-S can be used either as a vertical or as a horizontal sensor. The adaptation of the S-5-S seismometer described below involves removal of the additional spring and installation of an additional mass on the damping arm. Strain gauge angle sensors are installed on one pair of the crossed flat springs. The main dynamic parameters of the rotational seismometer created in this way, i.e. the natural period and damping, are controlled electronically by feedback currents proportional to the angular displacement and angular velocity, both fed to the damping transducer coil. This new seismometer, named the S-5-SR, enables measurement of the rotational component of ground motion around the horizontal or the vertical axes. The output signal from this S-5-SR seismometer can be proportional either to rotational displacement or rotational velocity.

  14. Photodissociation dynamics of superexcited O2: Dissociation channels O(5S) vs. O(3S)

    NASA Astrophysics Data System (ADS)

    Zhou, Yiyong; Meng, Qingnan; Mo, Yuxiang

    2014-07-01

    The photodissociation dynamics of O2, O2 + hυ → O(3P) + O(2p3(4S)3s, 3S/5S), has been studied by combining the XUV laser pump / UV laser probe and velocity map imaging methods in the photon energy range 14.64-15.20 eV. The fragment yield spectra of O(3S) and O(5S) and their velocity map images have been recorded using the state-selective (1+1) REMPI method to detect the fragments. The fragment yield spectra show resolved fine structure that arises from the predissociated Rydberg states I, I' and I″ (3ΠΩ = 0,1,2). The branching ratios between the two decay channels have been measured by one-photon ionization of the fragments O(3S) and O(5S) simultaneously. It is surprising to find that the dissociation cross sections for the production of O(5S) are larger than, or comparable to, those of O(3S) for the I and I' states, while the cross sections for the production of O(5S) are smaller than those of O(3S) for the I″ state. All fragments O(5S) arise from perpendicular transitions, which provides direct experimental evidence about the symmetry assignments of the states I, I' and I″ excited in this energy region. Although most of the fragments O(3S) arise from perpendicular transitions, some of them are from parallel transitions. Based on the calculated ab initio potential energy curves, we propose that the neutral dissociation into O(3P) + O(3S) occurs mainly via the interaction of the Rydberg states I, I', and I″ with the vibrational continuum of the diabatic 83Πu state (1π _u^{ - 1} (a^4 {Π}_u {)3}sσ _g ,^3 Π_u), while the neutral dissociation into O(3P) + O(5S) occurs mainly via the interaction of Rydberg states I, I', and I″ with the diabatic 73Πu (1π _g^{ - 1} (X^2 {Π}_g {)3}p{σ }_u ,^3 Π_u).

  15. Transcription factor IIIA induced bending of the Xenopus somatic 5S gene promoter.

    PubMed

    Schroth, G P; Cook, G R; Bradbury, E M; Gottesfeld, J M

    1989-08-10

    Transcription factor IIIA (TFIIIA), the canonical zinc-finger protein, is a protein of relative molecular mass 39,000 (39K) that is required for transcription of 5S-ribosomal subunit genes in Xenopus. It binds in a sequence-specific manner to the internal control region of the 5S gene (see Fig. 1) and facilitates transcription of the gene by RNA polymerase III. It also binds to the 5S gene product to form a 7S ribonucleoprotein particle. In oocytes the 7S particle acts as a storage form of the RNA to be utilized later in development. TFIIIA binds to DNA through its 30 K N-terminal domain, which contains nine zinc-fingers. TFIIIA was the first protein described to have this type of DNA binding motif, but numerous other proteins have now been shown to have zinc-finger domains. A structure for a single zinc-finger from the yeast protein ADR1, was recently proposed based on two-dimensional NMR data (ref. 8), and a similar structure was proposed based on comparison with crystal structures of other metalloproteins. Although models for the interaction of TFIIIA with the 5S-ribosomal gene DNA have been proposed, based on nuclease digestion and methylation interference data, little precise structural information is available for TFIIIA and the physical basis for the interaction of zinc-fingers with DNA is not understood. Using both circular permutation and circularization assays we provide convincing biochemical evidence that TFIIIA bends the DNA at the internal promoter of the 5S gene.

  16. Ultraviolet damage and nucleosome folding of the 5S ribosomal RNA gene.

    SciTech Connect

    Liu, X; Mann, David B.; Suquet, C; Springer, David L. ); Smerdon, Michael J.

    2000-01-25

    The Xenopus borealis somatic 5S ribosomal RNA gene was used as a model system to determine the mutual effects of nucleosome folding and formation of ultraviolet (UV) photoproducts (primarily cis-syn cyclobutane pyrimidine dimers, or CPDs) in chromatin. We analyzed the preferred rotational and translational settings of 5S rDNA on the histone octamer surface after induction of up to 0.8 CPD/nucleosome core (2.5 kJ/m(2) UV dose). DNase I and hydroxyl radical footprints indicate that UV damage at these levels does not affect the average rotational setting of the 5S rDNA molecules. Moreover, a combination of nuclease trimming and restriction enzyme digestion indicates the preferred translational positions of the histone octamer are not affected by this level of UV damage. We also did not observe differences in the UV damage patterns of irradiated 5S rDNA before or after nucleosome formation, indicating there is little difference in the inhibition of nucleosome folding by specific CPD sites in the 5S rRNA gene. Conversely, nucleosome folding significantly restricts CPD formation at all sites in the three helical turns of the nontranscribed strand located in the dyad axis region of the nucleosome, where DNA is bound exclusively by the histone H3-H4 tetramer. Finally, modulation of the CPD distribution in a 14 nt long pyrimidine tract correlates with its rotational setting on the histone surface, when the strong sequence bias for CPD formation in this tract is minimized by normalization. These results help establish the mutual roles of histone binding and UV photoproducts on their formation in chromatin.

  17. Veratrole biosynthesis in white campion.

    PubMed

    Akhtar, Tariq A; Pichersky, Eran

    2013-05-01

    White campion (Silene latifolia) is a dioecious plant that emits 1,2-dimethoxybenzene (veratrole), a potent pollinator attractant to the nocturnal moth Hadena bicruris. Little is known about veratrole biosynthesis, although methylation of 2-methoxyphenol (guaiacol), another volatile emitted from white campion flowers, has been proposed. Here, we explore the biosynthetic route to veratrole. Feeding white campion flowers with [(13)C9]l-phenylalanine increased guaiacol and veratrole emission, and a significant portion of these volatile molecules contained the stable isotope. When white campion flowers were treated with the phenylalanine ammonia lyase inhibitor 2-aminoindan-2-phosphonic acid, guaiacol and veratrole levels were reduced by 50% and 63%, respectively. Feeding with benzoic acid (BA) or salicylic acid (SA) increased veratrole emission 2-fold, while [(2)H5]BA and [(2)H6]SA feeding indicated that the benzene ring of both guaiacol and veratrole is derived from BA via SA. We further report guaiacol O-methyltransferase (GOMT) activity in the flowers of white campion. The enzyme was purified to apparent homogeneity, and the peptide sequence matched that encoded by a recently identified complementary DNA (SlGOMT1) from a white campion flower expressed sequence tag database. Screening of a small population of North American white campion plants for floral volatile emission revealed that not all plants emitted veratrole or possessed GOMT activity, and SlGOMT1 expression was only observed in veratrole emitters. Collectively these data suggest that veratrole is derived by the methylation of guaiacol, which itself originates from phenylalanine via BA and SA, and therefore implies a novel branch point of the general phenylpropanoid pathway.

  18. Biosynthesis of gold nanoparticles: A green approach.

    PubMed

    Ahmed, Shakeel; Annu; Ikram, Saiqa; Yudha S, Salprima

    2016-08-01

    Nanotechnology is an immensely developing field due to its extensive range of applications in different areas of technology and science. Different types of methods are employed for synthesis of nanoparticles due to their wide applications. The conventional chemical methods have certain limitations with them either in the form of chemical contaminations during their syntheses procedures or in later applications and use of higher energy. During the last decade research have been focussed on developing simple, clean, non-toxic, cost effective and eco-friendly protocols for synthesis of nanoparticles. In order to get this objective, biosynthesis methods have been developed in order to fill this gap. The biosynthesis of nanoparticles is simple, single step, eco-friendly and a green approach. The biochemical processes in biological agents reduce the dissolved metal ions into nano metals. The various biological agents like plant tissues, fungi, bacteria, etc. are used for biosynthesis for metal nanoparticles. In this review article, we summarised recent literature on biosynthesis of gold nanoparticles which have revolutionised technique of synthesis for their applications in different fields. Due to biocompatibility of gold nanoparticles, it has find its applications in biomedical applications. The protocol and mechanism of biosynthesis of gold nanoparticles along with various applications have also been discussed. PMID:27236049

  19. Biosynthesis of gold nanoparticles: A green approach.

    PubMed

    Ahmed, Shakeel; Annu; Ikram, Saiqa; Yudha S, Salprima

    2016-08-01

    Nanotechnology is an immensely developing field due to its extensive range of applications in different areas of technology and science. Different types of methods are employed for synthesis of nanoparticles due to their wide applications. The conventional chemical methods have certain limitations with them either in the form of chemical contaminations during their syntheses procedures or in later applications and use of higher energy. During the last decade research have been focussed on developing simple, clean, non-toxic, cost effective and eco-friendly protocols for synthesis of nanoparticles. In order to get this objective, biosynthesis methods have been developed in order to fill this gap. The biosynthesis of nanoparticles is simple, single step, eco-friendly and a green approach. The biochemical processes in biological agents reduce the dissolved metal ions into nano metals. The various biological agents like plant tissues, fungi, bacteria, etc. are used for biosynthesis for metal nanoparticles. In this review article, we summarised recent literature on biosynthesis of gold nanoparticles which have revolutionised technique of synthesis for their applications in different fields. Due to biocompatibility of gold nanoparticles, it has find its applications in biomedical applications. The protocol and mechanism of biosynthesis of gold nanoparticles along with various applications have also been discussed.

  20. Light-controlled flavonoid biosynthesis in fruits

    PubMed Central

    Zoratti, Laura; Karppinen, Katja; Luengo Escobar, Ana; Häggman, Hely; Jaakola, Laura

    2014-01-01

    Light is one of the most important environmental factors affecting flavonoid biosynthesis in plants. The absolute dependency of light to the plant development has driven evolvement of sophisticated mechanisms to sense and transduce multiple aspects of the light signal. Light effects can be categorized in photoperiod (duration), intensity (quantity), direction and quality (wavelength) including UV-light. Recently, new information has been achieved on the regulation of light-controlled flavonoid biosynthesis in fruits, in which flavonoids have a major contribution on quality. This review focuses on the effects of the different light conditions on the control of flavonoid biosynthesis in fruit producing plants. An overview of the currently known mechanisms of the light-controlled flavonoid accumulation is provided. R2R3 MYB transcription factors are known to regulate by differential expression the biosynthesis of distinct flavonoids in response to specific light wavelengths. Despite recent advances, many gaps remain to be understood in the mechanisms of the transduction pathway of light-controlled flavonoid biosynthesis. A better knowledge on these regulatory mechanisms is likely to be useful for breeding programs aiming to modify fruit flavonoid pattern. PMID:25346743

  1. Three-step laser excitation of the odd-parity 5s5d 3D → 5s nf 3F states of cadmium

    NASA Astrophysics Data System (ADS)

    Nadeem, Ali; Shah, M.; Haq, S. U.; Shahzada, S.; Mumtaz, M.; Waheed, A.; Nawaz, M.; Ahmed, M.; Baig, M. A.

    2014-07-01

    We report new experimental data on the term energies and effective quantum numbers of the highly excited odd parity states of cadmium in the 71 773-72 500 cm-1 energy range. The experiment was performed using three dye lasers simultaneously pumped by the second harmonic (532 nm) of the Nd;YAG laser. The vapor containment and detection system was a thermionic diode ion detector working in a space charge limited mode. The new observations include the 5snf3F3 (12 ⩽ n ⩽ 52), 5snf3F4 (13 ⩽ n ⩽ 33) and 5snf3F2 (12 ⩽ n ⩽ 22) Rydberg series excited from the 5s5d3D multiplet. A two parameter fit to the transitions energies of the 5snf3F3 series yields the binding energy of the 5snd 2D2 level as 13 042.178 ± 0.02 cm-1 and consequently the first ionization of cadmium is determined as 72 540.05 ± 0.13 cm-1, which is in good agreement with the previously reported value.

  2. Nucleotide excision repair of the 5 S ribosomal RNA gene assembled into a nucleosome.

    PubMed

    Liu, X; Smerdon, M J

    2000-08-01

    A-175-base pair fragment containing the Xenopus borealis somatic 5 S ribosomal RNA gene was used as a model system to determine the effect of nucleosome assembly on nucleotide excision repair (NER) of the major UV photoproduct (cyclobutane pyrimidine dimer (CPD)) in DNA. Xenopus oocyte nuclear extracts were used to carry out repair in vitro on reconstituted, positioned 5 S rDNA nucleosomes. Nucleosome structure strongly inhibits NER at many CPD sites in the 5 S rDNA fragment while having little effect at a few sites. The time course of CPD removal at 35 different sites indicates that >85% of the CPDs in the naked DNA fragment have t(12) values <2 h, whereas <26% of the t(12) values in nucleosomes are <2 h, and 15% are >8 h. Moreover, removal of histone tails from these mononucleosomes has little effect on the repair rates. Finally, nucleosome inhibition of repair shows no correlation with the rotational setting of a 14-nucleotide-long pyrimidine tract located 30 base pairs from the nucleosome dyad. These results suggest that inhibition of NER by mononucleosomes is not significantly influenced by the rotational orientation of CPDs on the histone surface, and histone tails play little (or no) role in this inhibition. PMID:10821833

  3. Analysis of a 5S rRNA gene cloned from Euplotes eurstomus

    SciTech Connect

    Roberson, A.E.; Wolffe, A.; Olins, D.E.

    1987-05-01

    The macronucleus of the hypotrichous ciliated protozoan Euplotes eurystomus lends itself to the study of eukaryotic gene and chromatin structure because native macronuclear DNA exists as linear, gene-sized fragments between 400 and 20,000 bp in length. The macronuclear chromatin, while arranged in a typical nucleosomal structure, is freely soluble in low ionic strength buffers without treatment by nucleases. Thus, specific genes may be enriched as native, intact chromatin molecules. The 5S rRNA gene from Euplotes has been cloned to facilitate investigation of 5S gene-chromatin following characterization of the gene at the DNA level. It has been demonstrated that the gene, while in circular or linear form, can be transcribed in vitro by a Xenopus oocyte nuclear extract. The transcript generated in vitro is 120 nucleotides in length and is synthesized by RNA polymerase III. Anti-Xenopus TFIIIA antibodies recognize a Euplotes macronuclear chromatin-associated protein which is approx. 80 KD in size. It has been established that the sequence of the telomere flanking the 5S gene in Euplotes eurystomus is the same telomeric sequence published for Euplotes aediculatus.

  4. Abscisic acid: biosynthesis, inactivation, homoeostasis and signalling.

    PubMed

    Dong, Ting; Park, Youngmin; Hwang, Inhwan

    2015-01-01

    The phytohormone abscisic acid (ABA) plays crucial roles in numerous physiological processes during plant growth and abiotic stress responses. The endogenous ABA level is controlled by complex regulatory mechanisms involving biosynthesis, catabolism, transport and signal transduction pathways. This complex regulatory network may target multiple levels, including transcription, translation and post-translational regulation of genes involved in ABA responses. Most of the genes involved in ABA biosynthesis, catabolism and transport have been characterized. The local ABA concentration is critical for initiating ABA-mediated signalling during plant development and in response to environmental changes. In this chapter we discuss the mechanisms that regulate ABA biosynthesis, catabolism, transport and homoeostasis. We also present the findings of recent research on ABA perception by cellular receptors, and ABA signalling in response to cellular and environmental conditions.

  5. Bacterial exopolysaccharides: biosynthesis pathways and engineering strategies

    PubMed Central

    Schmid, Jochen; Sieber, Volker; Rehm, Bernd

    2015-01-01

    Bacteria produce a wide range of exopolysaccharides which are synthesized via different biosynthesis pathways. The genes responsible for synthesis are often clustered within the genome of the respective production organism. A better understanding of the fundamental processes involved in exopolysaccharide biosynthesis and the regulation of these processes is critical toward genetic, metabolic and protein-engineering approaches to produce tailor-made polymers. These designer polymers will exhibit superior material properties targeting medical and industrial applications. Exploiting the natural design space for production of a variety of biopolymer will open up a range of new applications. Here, we summarize the key aspects of microbial exopolysaccharide biosynthesis and highlight the latest engineering approaches toward the production of tailor-made variants with the potential to be used as valuable renewable and high-performance products for medical and industrial applications. PMID:26074894

  6. Unconventional membrane lipid biosynthesis in Xanthomonas campestris.

    PubMed

    Aktas, Meriyem; Narberhaus, Franz

    2015-09-01

    All bacteria are surrounded by at least one bilayer membrane mainly composed of phospholipids (PLs). Biosynthesis of the most abundant PLs phosphatidylethanolamine (PE), phosphatidylglycerol (PG) and cardiolipin (CL) is well understood in model bacteria such as Escherichia coli. It recently emerged, however, that the diversity of bacterial membrane lipids is huge and that not yet explored biosynthesis pathways exist, even for the common PLs. A good example is the plant pathogen Xanthomonas campestris pv. campestris. It contains PE, PG and CL as major lipids and small amounts of the N-methylated PE derivatives monomethyl PE and phosphatidylcholine (PC = trimethylated PE). Xanthomonas campestris uses a repertoire of canonical and non-canonical enzymes for the synthesis of its membrane lipids. In this minireview, we briefly recapitulate standard pathways and integrate three recently discovered pathways into the overall picture of bacterial membrane biosynthesis.

  7. The Terpenoid Biosynthesis Toolkit of Trichoderma.

    PubMed

    Bansal, Ravindra; Mukherjee, Prasun Kumar

    2016-04-01

    The widely used biotechnologically important fungi belonging to the genus Trichoderma are rich sources of secondary metabolites. Even though the genomes of several Trichoderma spp. have been published, and data are available on the genes involved in biosynthesis of non-ribosomal peptide synthetases and polyketide synthases, no genome-wide data are available for the terpenoid biosynthesis machinery in these organisms. In the present study, we have identified the genes involved in terpene biosynthesis in the genomes of three Trichoderma spp., viz., T. virens, T. atroviride and T. reesei. While the genes involved in the condensation steps are highly conserved across the three species, these fungi differed in the number and organization of terpene cyclases. T. virens genome harbours eleven terpene cyclases, while T. atroviride harbours seven, and T. reeseisix in their genomes; seven, three and two being part of putative secondary metabolism related gene clusters.

  8. Ethylene Biosynthesis-Inducing Xylanase 1

    PubMed Central

    Dean, Jeffrey F. D.; Gross, Kenneth C.; Anderson, James D.

    1991-01-01

    Induction of ethylene biosynthesis in tobacco (Nicotiana tabacum cv Xanthi) leaf discs by the ethylene biosynthesis-inducing xylanase (EIX) isolated from Cellulysin or xylan-grown cultures of Trichoderma viride was dependent upon the concentration of xylanase applied and upon the length of incubation. Arrhenius activation energies of 9,100 and 10,500 calories for the Cellulysin and T. viride EIX xylanase activities, respectively, were derived from the Km and Vmax values determined for each enzyme at several temperatures. The two xylanases digested xylan in a strictly endo fashion, releasing neither xylobiose nor free xylose, and no debranching activity was associated with either enzyme. The xylanases released polysaccharides from ground corn cobs, but little or no carbohydrate was released from tobacco mesophyll cell walls incubated with EIX. No heat-stable products capable of inducing ethylene biosynthesis in tobacco leaf discs were found in EIX digests of purified xylans. PMID:16668223

  9. Triterpenoid Biosynthesis and Engineering in Plants

    PubMed Central

    Sawai, Satoru; Saito, Kazuki

    2011-01-01

    Triterpenoid saponins are a diverse group of natural products in plants and are considered defensive compounds against pathogenic microbes and herbivores. Because of their various beneficial properties for humans, saponins are used in wide-ranging applications in addition to medicinally. Saponin biosynthesis involves three key enzymes: oxidosqualene cyclases, which construct the basic triterpenoid skeletons; cytochrome P450 monooxygenases, which mediate oxidations; and uridine diphosphate-dependent glycosyltransferases, which catalyze glycosylations. The discovery of genes committed to saponin biosynthesis is important for the stable supply and biotechnological application of these compounds. Here, we review the identified genes involved in triterpenoid biosynthesis, summarize the recent advances in the biotechnological production of useful plant terpenoids, and discuss the bioengineering of plant triterpenoids. PMID:22639586

  10. Biosynthesis and metabolism of salicylic acid

    SciTech Connect

    Lee, H.; Leon, J.; Raskin, I.

    1995-05-09

    Pathways of salicylic acid (SA) biosynthesis and metabolism in tobacco have been recently identified. SA, an endogenous regulator of disease resistance, is a product of phenylpropanoid metabolism formed via decarboxylation of trans-cinnamic acid to benzoic acid and its subsequent 2-hydroxylation to SA. In tobacco mosaic virus-inoculated tobacco leaves, newly synthesized SA is rapidly metabolized to SA O-{beta}-D-glucoside and methyl salicylate. Two key enzymes involved in SA biosynthesis and metabolism: benzoic acid 2-hydroxylase, which converts benzoic acid to SA, and UDPglucose:SA glucosyltransferase (EC 2.4.1.35), which catalyzes conversion of SA to SA glucoside have been partially purified and characterized. Progress in enzymology and molecular biology of SA biosynthesis and metabolism will provide a better understanding of signal transduction pathway involved in plant disease resistance. 62 refs., 1 fig.

  11. The Terpenoid Biosynthesis Toolkit of Trichoderma.

    PubMed

    Bansal, Ravindra; Mukherjee, Prasun Kumar

    2016-04-01

    The widely used biotechnologically important fungi belonging to the genus Trichoderma are rich sources of secondary metabolites. Even though the genomes of several Trichoderma spp. have been published, and data are available on the genes involved in biosynthesis of non-ribosomal peptide synthetases and polyketide synthases, no genome-wide data are available for the terpenoid biosynthesis machinery in these organisms. In the present study, we have identified the genes involved in terpene biosynthesis in the genomes of three Trichoderma spp., viz., T. virens, T. atroviride and T. reesei. While the genes involved in the condensation steps are highly conserved across the three species, these fungi differed in the number and organization of terpene cyclases. T. virens genome harbours eleven terpene cyclases, while T. atroviride harbours seven, and T. reeseisix in their genomes; seven, three and two being part of putative secondary metabolism related gene clusters. PMID:27396184

  12. Triterpenoid biosynthesis in Euphorbia lathyris latex

    SciTech Connect

    Hawkins, D.R.

    1987-11-01

    The structures of triterpenols, not previously been known, from Euphorbia lathyris latex are reported. A method for quantifying very small amounts of these compounds was developed. Concerning the biochemistry of the latex, no exogenous cofactors were required for the biosynthesis and the addition of compounds such as NADPAH and ATP do not stimulate the biosynthesis. The addition of DTE or a similar anti-oxidant was found to help reduce the oxidation of the latex, thus increasing the length of time that the latex remains active. The requirement of a divalent cation and the preference for Mn in the pellet was observed. The effect of several inhibitors on the biosynthesis of the triterpenoids was examined. Mevinolin was found to inhibit the biosynthesis of the triterpenoids from acetate, but not mevalonate. A dixon plot of the inhibition of acetate incorporation showed an I/sub 50/ concentration of 3.2 ..mu..M. Fenpropimorph was found to have little or no effect on the biosynthesis. Tridemorph was found to inhibit the biosynthesis of all of the triterpenoids with an I/sub 50/ of 4 ..mu..M. It was also observed that the cyclopropyl containing triterpenols, cycloartenol and 24-methylenecycloartenol were inhibited much more strongly than those containing an 8-9 double bond, lanosterol and 24-methylenelanosterol. The evidence indicates, but does not definetely prove, that lanosterol and 24-methylenelanosterol are not made from cycloartenol and 24-methylenecycloartenol via a ring-opening enzyme such as cycloeucalenol-obtusifoliol isomerase. The possibilty that cycloartenol is made via lanosterol was investigated by synthesizing 4-R-4-/sup 3/H-mevalonic acid and incubating latex with a mixture of this and /sup 14/C-mevalonic acid. From the /sup 3/H//sup 14/C ratio it was shown that cycloartenol and 24-methylenecycloartenol are not made via an intermediate containing as 8-9 double bond. 88 refs., 15 figs., 30 tabs.

  13. Cytogenetic analysis in Polypterus ornatipinnis (Actinopterygii, Cladistia, Polypteridae) and 5S rDNA.

    PubMed

    Morescalchi, Maria Alessandra; Stingo, Vincenzo; Capriglione, Teresa

    2011-03-01

    Polypteridae is a family of archaic freshwater African fish that constitute an interesting subject for the study of the karyological evolution in vertebrates, on account of their primitive morphological characters and peculiar relationships with lower Osteichthyans. In this paper, a cytogenetic analysis on twenty specimens of both sexes of Polypterus ornatipinnis the ornate "bichir", coming from the Congo River basin, was performed by using both classical and molecular techniques. The karyotypic formula (2n=36; FN=72) was composed of 26 M+10 SM. The Alu I banding, performed to characterize heterochromatin in this species, was mainly centromeric. Both the chromosome location of the ribosomal 5S and 18S rRNA genes were examined by using Ag-NOR, classical C-banding, CMA(3) staining and FISH. CMA(3) marked all centromerical regions and showed the presence of two GC rich regions on the p arm of the chromosome pair n°1 and on the q arm of the pair n°14. Staining with Ag-NOR marked the only telomeric region of the chromosome n°1 p arm. After PCR, the 5S rDNA in this species was cloned, sequenced and analyzed. In the 665bp 5S rDNA sequence of P.ornatipinnis, a conserved 120bp gene region for the 5S rDNA was identified, followed by a non-transcribed variable spacer (NTS) which included simple repeats, microsatellites and a fragment of a non-LTR retrotransposon R-TEX. FISH with 5S rDNA marked the subtelomeric region of the q arm of the chromosome pair n°14, previously marked by CMA(3). FISH with 18S rDNA marked the telomeric region of the p arm of the pair n°1, previously marked both by Ag-NOR and CMA(3). The (GATA)(7) repeats marked the telomeric regions of all chromosome pairs, with the exclusion of the n°1, n°3 and n°14; hybridization with telomeric probes (TTAGGG)(n) showed signals at the end of all chromosomes. Karyotype evolution in Polypterus genus was finally discussed, including the new data obtained.

  14. Cytogenetic analysis in Polypterus ornatipinnis (Actinopterygii, Cladistia, Polypteridae) and 5S rDNA.

    PubMed

    Morescalchi, Maria Alessandra; Stingo, Vincenzo; Capriglione, Teresa

    2011-03-01

    Polypteridae is a family of archaic freshwater African fish that constitute an interesting subject for the study of the karyological evolution in vertebrates, on account of their primitive morphological characters and peculiar relationships with lower Osteichthyans. In this paper, a cytogenetic analysis on twenty specimens of both sexes of Polypterus ornatipinnis the ornate "bichir", coming from the Congo River basin, was performed by using both classical and molecular techniques. The karyotypic formula (2n=36; FN=72) was composed of 26 M+10 SM. The Alu I banding, performed to characterize heterochromatin in this species, was mainly centromeric. Both the chromosome location of the ribosomal 5S and 18S rRNA genes were examined by using Ag-NOR, classical C-banding, CMA(3) staining and FISH. CMA(3) marked all centromerical regions and showed the presence of two GC rich regions on the p arm of the chromosome pair n°1 and on the q arm of the pair n°14. Staining with Ag-NOR marked the only telomeric region of the chromosome n°1 p arm. After PCR, the 5S rDNA in this species was cloned, sequenced and analyzed. In the 665bp 5S rDNA sequence of P.ornatipinnis, a conserved 120bp gene region for the 5S rDNA was identified, followed by a non-transcribed variable spacer (NTS) which included simple repeats, microsatellites and a fragment of a non-LTR retrotransposon R-TEX. FISH with 5S rDNA marked the subtelomeric region of the q arm of the chromosome pair n°14, previously marked by CMA(3). FISH with 18S rDNA marked the telomeric region of the p arm of the pair n°1, previously marked both by Ag-NOR and CMA(3). The (GATA)(7) repeats marked the telomeric regions of all chromosome pairs, with the exclusion of the n°1, n°3 and n°14; hybridization with telomeric probes (TTAGGG)(n) showed signals at the end of all chromosomes. Karyotype evolution in Polypterus genus was finally discussed, including the new data obtained. PMID:21429462

  15. The expanding universe of alkaloid biosynthesis.

    PubMed

    De Luca, V; Laflamme, P

    2001-06-01

    Characterization of many of the major gene families responsible for the generation of central intermediates and for their decoration, together with the development of large genomics and proteomics databases, has revolutionized our capability to identify exotic and interesting natural-product pathways. Over the next few years, these tools will facilitate dramatic advances in our knowledge of the biosynthesis of alkaloids, which will far surpass that which we have learned in the past 50 years. These tools will also be exploited for the rapid characterization of regulatory genes, which control the development of specialized cell factories for alkaloid biosynthesis.

  16. Combinatorial Biosynthesis of Polyketides – A Perspective

    PubMed Central

    Wong, Fong T.; Khosla, Chaitan

    2012-01-01

    Since their discovery, polyketide synthases have been attractive targets of biosynthetic engineering to make “unnatural” natural products. Although combinatorial biosynthesis has made encouraging advances over the past two decades, the field remains in its infancy. In this enzyme-centric perspective, we discuss the scientific and technological challenges that could accelerate the adoption of combinatorial biosynthesis as a method of choice for the preparation of encoded libraries of bioactive small molecules. Borrowing a page from the protein structure prediction community, we propose a periodic challenge program to vet the most promising methods in the field, and to foster the collective development of useful tools and algorithms. PMID:22342766

  17. Nucleoside antibiotics: biosynthesis, regulation, and biotechnology.

    PubMed

    Niu, Guoqing; Tan, Huarong

    2015-02-01

    The alarming rise in antibiotic-resistant pathogens has coincided with a decline in the supply of new antibiotics. It is therefore of great importance to find and create new antibiotics. Nucleoside antibiotics are a large family of natural products with diverse biological functions. Their biosynthesis is a complex process through multistep enzymatic reactions and is subject to hierarchical regulation. Genetic and biochemical studies of the biosynthetic machinery have provided the basis for pathway engineering and combinatorial biosynthesis to create new or hybrid nucleoside antibiotics. Dissection of regulatory mechanisms is leading to strategies to increase the titer of bioactive nucleoside antibiotics.

  18. The structural biology of phenazine biosynthesis

    PubMed Central

    Blankenfeldt, Wulf; Parsons, James F.

    2014-01-01

    The phenazines are a class of over 150 nitrogen-containing aromatic compounds of bacterial and archeal origin. Their redox properties not only explain their activity as broad-specificity antibiotics and virulence factors but also enable them to function as respiratory pigments, thus extending their importance to the primary metabolism of phenazine-producing species. Despite their discovery in the mid-19th century, the molecular mechanisms behind their biosynthesis have only been unraveled in the last decade. Here, we review the contribution of structural biology that has led to our current understanding of phenazine biosynthesis. PMID:25215885

  19. Biosynthesis and biodegradation of wood components

    SciTech Connect

    Higuchi, T.

    1985-01-01

    A textbook containing 22 chapters by various authors covers the structure of wood, the localization of polysaccharides and lignins in wood cell walls, metabolism and synthetic function of cambial tissue, cell organelles and their function in the biosynthesis of cell wall components, biosynthesis of plant cell wall polysaccharides, lignin, cutin, suberin and associated waxes, phenolic acids and monolignols, quinones, flavonoids, tannins, stilbenes and terpenoid wood extractives, the occurrence of extractives, the metabolism of phenolic acids, wood degradation by micro-organisms and fungi, and biodegradation of cellulose, hemicelluloses, lignin, and aromatic extractives of wood. An index is included.

  20. Combinatorial biosynthesis of polyketides--a perspective.

    PubMed

    Wong, Fong T; Khosla, Chaitan

    2012-04-01

    Since their discovery, polyketide synthases have been attractive targets of biosynthetic engineering to make 'unnatural' natural products. Although combinatorial biosynthesis has made encouraging advances over the past two decades, the field remains in its infancy. In this enzyme-centric perspective, we discuss the scientific and technological challenges that could accelerate the adoption of combinatorial biosynthesis as a method of choice for the preparation of encoded libraries of bioactive small molecules. Borrowing a page from the protein structure prediction community, we propose a periodic challenge program to vet the most promising methods in the field, and to foster the collective development of useful tools and algorithms.

  1. Climatic controls on drainage basin topography - a synopsis of the western Andean flanks between 15.5 S and 41.5 S lat

    NASA Astrophysics Data System (ADS)

    Rehak, K.; Strecker, M. R.; Echtler, H. P.; Bookhagen, B.

    2007-12-01

    Topography in tectonically active mountain ranges is determined by the interplay between tectonics and climate. Due to the complexity of natural systems it is difficult to evaluate tectonic versus climatic contributions to the long- term landscape evolution. Previous studies suggest that rainfall and its variability strongly influence the morphology of river profiles and mountain ranges. However, it is still controversially discussed how drainage basins reflect tectonic and climatic processes. The Andean Cordillera provides a unique natural setting for studying the relationship between climate, tectonics, and topography. The Andes host various climatic zones with pronounced differences in rainfall regimes. In the central to southern western Andes, climate ranges from hyperarid in the Atacama Desert, 22 to 23°S lat, with a mean annual rainfall of ~ 5 mm/yr to year-round humid conditions south of Valdivia, ~ 40°S lat, with more than 2500 mm/yr. This zonation is controlled by hemisphere-scale atmospheric circulation patterns. With the exception of a northward shift of the Southern Hemisphere Westerlies during glacials the overall precipitation pattern has remained stable on the west coast of South America. The shelf width is reasonably constant along the margin. Uplift rate and lithology vary non-systematically and do not correlate with climatic parameters. Here, we present an analysis of 120 drainage basins along the watershed of the western Andean flank between 15.5 S and 41.5 S lat, using SRTMV3-90m data and a high-resolution rainfall dataset (TRMM 5x5 km). The basins comprise drainage areas of 1 to ~ 30 x 103 km2 and were split into subsets according to position and size. For each basin, we extracted 21 geometry, relief, and climate parameters in order to unravel the determinants of drainage-basin morphology. Our data shows that river-profile concavity and slope, hypsometric integral, basin maximum and mean elevation decrease with increasing rainfall and

  2. Inhibition of Abscisic Acid Biosynthesis in Cercospora rosicola by Inhibitors of Gibberellin Biosynthesis and Plant Growth Retardants

    PubMed Central

    Norman, Shirley M.; Poling, Stephen M.; Maier, Vincent P.; Orme, Edward D.

    1983-01-01

    The fungus Cercospora rosicola produces abscisic acid (ABA) as a secondary metabolite. We developed a convenient system using this fungus to determine the effects of compounds on the biosynthesis of ABA. Inasmuch as ABA and the gibberellins (GAs) both arise via the isoprenoid pathway, it was of interest to determine if inhibitors of GA biosynthesis affect ABA biosynthesis. All five putative inhibitors of GA biosynthesis tested inhibited ABA biosynthesis. Several plant growth retardants with poorly understood actions in plants were also tested; of these, six inhibited ABA biosynthesis to varying degrees and two had no effect. Effects of plant growth retardants on various branches of the isoprenoid biosynthetic pathway may help to explain some of the diverse and unexpected results reported for these compounds. Knowledge that certain inhibitors of GA biosynthesis also have the ability to inhibit ABA biosynthesis in C. rosicola indicates the need for further studies in plants on the mode of action of these compounds. PMID:16662775

  3. Two spatially separated phases in semiconducting Rb0.8Fe1.5S2

    DOE PAGES

    Wang, Meng; Tian, Wei; Valdivia, P.; Chi, Songxue; Bourret-Courchesne, E.; Dai, Pengcheng; Birgeneau, R. J.

    2014-09-26

    We report neutron scattering and transport measurements on semiconducting Rb0.8Fe1.5S2, a compound isostructural and isoelectronic to the well-studied A0.8FeySe2(A = K, Rb, Cs, Tl/K) superconducting systems. Both resistivity and DC susceptibility measurements reveal a magnetic phase transition at T = 275 K. Neutron diffraction studies show that the 275 K transition originates from a phase with rhombic iron vacancy order which exhibits an in-plane stripe antiferromagnetic ordering below 275 K. In addition, the stripe antiferromagnetic phase interdigitates mesoscopically with an ubiquitous phase with √5 x√5 iron vacancy order. This phase has a magnetic transition at TN = 425 K andmore » an iron vacancy order-disorder transition at TS = 600 K. These two different structural phases are closely similar to those observed in the isomorphous Se materials. Based on the close similarities of the in-plane antiferromagnetic structures, moments sizes, and ordering temperatures in semiconducting Rb0.8Fe1.5S2 and K0.81Fe1.58Se2, we argue that the in-plane antiferromagnetic order arises from strong coupling between local moments. Superconductivity, previously observed in the A0.8FeySe2₋ zSz system, is absent in A0.8Fe1.5S2, which has a semiconducting ground state. We discuss the implied relationship between stripe and block antiferromagnetism and superconductivity in these materials as well as a strategy for further investigation.« less

  4. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18.

    PubMed

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P; Tarassov, Ivan

    2011-06-15

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes.

  5. Physical mapping of 5S rDNA in two species of Knifefishes: Gymnotus pantanal and Gymnotus paraguensis (Gymnotiformes).

    PubMed

    da Silva, M; Matoso, D A; Vicari, M R; de Almeida, M C; Margarido, V P; Artoni, R F

    2011-01-01

    Physical mapping of 5S rDNA in 2 species of knifefishes, Gymnotuspantanal and G. paraguensis (Gymnotiformes), was performed using fluorescence in situ hybridization with a 5S rDNA probe. The 5S rDNA PCR product from the genomes of both species was also sequenced and aligned to determine non-transcribed spacer sequences (NTS). Both species under study had different patterns of 5S rDNA gene cluster distribution. While in the karyotype of G. pantanal two 5S rDNA-bearing pairs were observed, the karyotype of G. paraguensis possessed as many as 19 such pairs. Such multiplication of 5S rDNA gene clusters might be caused by the involvement of transposable elements because the NTS of G. paraguensis was 400 bp long with high identity (90%) with a mobile transposable element called Tc1-like transposon, described from the cyprinid fish Labeo rohita.

  6. Minimally invasive L5-S1 oblique lumbar interbody fusion with anterior plate.

    PubMed

    Pham, Martin H; Jakoi, Andre M; Hsieh, Patrick C

    2016-07-01

    Lumbar interbody fusion is an important technique for the treatment of degenerative disc disease and degenerative scoliosis. The oblique lumbar interbody fusion (OLIF) establishes a minimally invasive retroperitoneal exposure anterior to the psoas and lumbar plexus. In this video case presentation, the authors demonstrate the techniques of the OLIF at L5-S1 performed on a 69-year-old female with degenerative scoliosis as one component of an overall strategy for her deformity correction. The video can be found here: https://youtu.be/VMUYWKLAl0g . PMID:27364428

  7. Biosynthesis of coenzyme Q in eukaryotes.

    PubMed

    Kawamukai, Makoto

    2015-01-01

    Coenzyme Q (CoQ) is a component of the electron transport chain that participates in aerobic cellular respiration to produce ATP. In addition, CoQ acts as an electron acceptor in several enzymatic reactions involving oxidation-reduction. Biosynthesis of CoQ has been investigated mainly in Escherichia coli and Saccharomyces cerevisiae, and the findings have been extended to various higher organisms, including plants and humans. Analyses in yeast have contributed greatly to current understanding of human diseases related to CoQ biosynthesis. To date, human genetic disorders related to mutations in eight COQ biosynthetic genes have been reported. In addition, the crystal structures of a number of proteins involved in CoQ synthesis have been solved, including those of IspB, UbiA, UbiD, UbiX, UbiI, Alr8543 (Coq4 homolog), Coq5, ADCK3, and COQ9. Over the last decade, knowledge of CoQ biosynthesis has accumulated, and striking advances in related human genetic disorders and the crystal structure of proteins required for CoQ synthesis have been made. This review focuses on the biosynthesis of CoQ in eukaryotes, with some comparisons to the process in prokaryotes.

  8. Peroxidase enzymes regulate collagen extracellular matrix biosynthesis.

    PubMed

    DeNichilo, Mark O; Panagopoulos, Vasilios; Rayner, Timothy E; Borowicz, Romana A; Greenwood, John E; Evdokiou, Andreas

    2015-05-01

    Myeloperoxidase and eosinophil peroxidase are heme-containing enzymes often physically associated with fibrotic tissue and cancer in various organs, without any direct involvement in promoting fibroblast recruitment and extracellular matrix (ECM) biosynthesis at these sites. We report herein novel findings that show peroxidase enzymes possess a well-conserved profibrogenic capacity to stimulate the migration of fibroblastic cells and promote their ability to secrete collagenous proteins to generate a functional ECM both in vitro and in vivo. Mechanistic studies conducted using cultured fibroblasts show that these cells are capable of rapidly binding and internalizing both myeloperoxidase and eosinophil peroxidase. Peroxidase enzymes stimulate collagen biosynthesis at a post-translational level in a prolyl 4-hydroxylase-dependent manner that does not require ascorbic acid. This response was blocked by the irreversible myeloperoxidase inhibitor 4-amino-benzoic acid hydrazide, indicating peroxidase catalytic activity is essential for collagen biosynthesis. These results suggest that peroxidase enzymes, such as myeloperoxidase and eosinophil peroxidase, may play a fundamental role in regulating the recruitment of fibroblast and the biosynthesis of collagen ECM at sites of normal tissue repair and fibrosis, with enormous implications for many disease states where infiltrating inflammatory cells deposit peroxidases.

  9. The lipid biosynthesis hole in the rickettsiales

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Using a complementation assay in E. coli, we have shown that the propionyl-CoA carboxylase complex (PCC) from Wolbachia pipientis wMel, order Rickettsiales, provides for lipid biosynthesis through malonyl-CoA production. Normally, the prototypical prokaryote fatty acid synthesis (FASII) initiation ...

  10. Biosynthesis of sphinganine-analog mycotoxins.

    PubMed

    Du, L; Zhu, X; Gerber, R; Huffman, J; Lou, L; Jorgenson, J; Yu, F; Zaleta-Rivera, K; Wang, Q

    2008-06-01

    Sphinganine-analog mycotoxins (SAMT) are polyketide-derived natural products produced by a number of plant pathogenic fungi and are among the most economically important mycotoxins. The toxins are structurally similar to sphinganine, a key intermediate in the biosynthesis of ceramides and sphingolipids, and competitive inhibitors for ceramide synthase. The inhibition of ceramide and sphingolipid biosynthesis is associated with several fatal diseases in domestic animals and esophageal cancer and neural tube defects in humans. SAMT contains a highly reduced, acyclic polyketide carbon backbone, which is assembled by a single module polyketide synthase. The biosynthesis of SAMT involves a unique polyketide chain-releasing mechanism, in which a pyridoxal 5'-phosphate-dependent enzyme catalyzes the termination, offloading and elongation of the polyketide chain. This leads to the introduction of a new carbon-carbon bond and an amino group to the polyketide chain. The mechanism is fundamentally different from the thioesterase/cyclase-catalyzed polyketide chain releasing found in bacterial and other fungal polyketide biosynthesis. Genetic data suggest that the ketosynthase domain of the polyketide synthase and the chain-releasing enzyme are important for controlling the final product structure. In addition, several post-polyketide modifications have to take place before SAMT become mature toxins.

  11. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    PubMed

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  12. Analysis of 5S rDNA organization and variation in polyploid hybrids from crosses of different fish subfamilies.

    PubMed

    Qin, Qinbo; He, Weiguo; Liu, Shaojun; Wang, Jing; Xiao, Jun; Liu, Yun

    2010-07-15

    In this article, sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) were conducted in red crucian carp (RCC), blunt snout bream (BSB), and their polyploid offspring. Three monomeric 5S rDNA classes (designated class I: 203 bp; class II: 340 bp; and class III: 477 bp) of RCC were characterized by distinct NTS types (designated NTS-I, II, and III for the 83, 220, and 357 bp monomers, respectively). In BSB, only one monomeric 5S rDNA was observed (designated class IV: 188 bp), which was characterized by one NTS type (designated NTS-IV: 68 bp). In the polyploid offspring, the tetraploid (4nRB) hybrids partially inherited 5S rDNA classes from their female parent (RCC); however, they also possessed a unique 5S rDNA sequence (designated class I-L: 203 bp) with a novel NTS sequence (designated NTS-I-L: 83 bp). The characteristic paternal 5S rDNA sequences (class IV) were not observed. The 5S rDNA of triploid (3nRB) hybrids was completely inherited from the parental species, and generally preserved the parental 5S rDNA structural organization. These results first revealed the influence of polyploidy on the organization and evolution of the multigene family of 5S rDNA of fish, and are also useful in clarifying aspects of vertebrate genome evolution.

  13. Electron-correlation-induced interchange of lifetime broadenings of 5s{sup -1} multiplet states in atomic Cs

    SciTech Connect

    Partanen, L.; Holappa, M.; Aksela, H.; Aksela, S.; Schulz, J.

    2009-10-15

    The lifetime broadenings of the most intense 5s photolines of Cs were studied. The aim of this study was to understand the origin of the remarkable differences in the lifetime widths of different 5s{sup -1} multiplet states. The 5s photoelectron spectra of the 6s{yields}6p{sub 1/2,3/2} laser-excited states are presented in the binding energy region of 30-34 eV showing the main 5s photolines of the ground state and laser-excited states as well as the 5s5p{sup 6}6p shakeup satellites. The lifetime widths of the states were determined. The Hartree-Fock calculations were carried out to predict the 5s photoelectron spectrum. The lifetime broadenings of the 5s photolines were found to be due to the transition rates of the subsequent Coster-Kronig transitions to the 5s{sup 2}5p{sup 5} states. It was found that a straightforward single-configuration explanation cannot be given for the lifetime differences. Instead, electron correlation plays an essential role and the lifetime broadenings were found to be predicted well only when configuration interaction between the 5s{sup -1} and 5p{sup -2}5d configurations is taking into account.

  14. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    PubMed Central

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-01-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  15. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    NASA Astrophysics Data System (ADS)

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-03-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system.

  16. Bottomonium physics at Υ(4S, 5S, 6S) energies with the Belle detector

    NASA Astrophysics Data System (ADS)

    Tamponi, Umberto

    2016-08-01

    The description of quarkonia as pure quark anti-quark bound states has been recently challenged by the observation of charged states in both the charmonium and bottomonium region and large violations of the heavy quark spin symmetry in hadronic transitions. All these effects can be ascribable to non-negligible contributions from the light quark degrees of freedom in the description of both charmonia and bottomonia. We will report the most recent experimental measurements performed by the Belle collaboration in the Y(4S), Y(5S) and Y(6S) regions, including the measurement of the ratio σ[e+e- → bb̅]/σ[e+e- → μ+ μ- ], the search for neutral states near the B0B̅0 threshold, the first observation of the transition ϒ(4S) → ηhb (lP) and the study of the η transitions at the ϒ(5S) energy. The contribution to the study of the structure of these states coming from the measurement of hadronic transitions will be discussed.

  17. Magnetization reversal phenomena in (Cr0.70Ti0.30)5S6

    NASA Astrophysics Data System (ADS)

    Hashimoto, Satoshi; Matsuda, Yuji; Sato, Tetsuya; Anzai, Shuichiro

    2005-12-01

    Magnetization reversal phenomena (MRP) along magnetic order-order transitions have recently been reported on impurity-doped magnetic systems. Because imperfect long-range magnetic order exists in these systems, it is expected that a systematic investigation of MRP will give physical information on thermomagnetic processes of magnetic systems in the range from the micro- to nanoscales. As a typical order-order transition (a state doubly modulated by helical and canting orders to a collinear ferrimagnetic state) has been known to occur on Cr5S6 at a transition temperature Tt, we investigate the magnetizations of (Cr0.70Ti0.30)5S6 on heating and cooling runs in various magnetic fields. At 20Oe, the field-cooled magnetization just below the Curie temperature has a positive sign; the sign turns negative below the compensation temperature TCM (first step) and finally returns to positive below Tt (second step). The first-step MRP observed in this system is explained by the potential barriers resulting from anisotropy energy when the preferred direction of collinear ferrimagnetic moment reverses. The proposed mechanism for second-step MRP is the pinning effect caused by the impurity atoms (Ti) in the helical long-range-order chains. Comparing other examples of MRPs, we discuss the roles of local impurity centers in the thermomagnetic process in magnetic order-order transitions.

  18. Structural Preservation Percutaneous Endoscopic Lumbar Interlaminar Discectomy for L5-S1 Herniated Nucleus Pulposus

    PubMed Central

    Jang, Jee-Soo; Jang, Il-Tae

    2016-01-01

    Objective. Structures such as ligamentum flavum, annulus, and lamina play an important role in the segmental function. We proposed the surgical technique for achieving the sufficient preservation of segmental structures, in spite of sufficient removal of pathologic disc in the L5-S1 using the ligamentum flavum splitting and sealing technique. Methods. We retrospectively analyzed 80 cases that underwent percutaneous endoscopic lumbar discectomy for L5-S1 herniated nucleus pulposus, using the ligamentum flavum splitting and sealing technique between January 2011 and June 2013. Outcomes were assessed using VAS (leg, back), MacNab's criteria, and the immediate postoperative MRI for all patients. Structural preservation was classified as complete, sufficient, and incomplete. Results. The surgical results are as follows: 65 cases were complete, 15 cases were sufficient, and 0 cases were incomplete. The VAS was decreased at the last follow-up (leg: from 7.91 ± 0.73 to 1.15 ± 0.62; back: from 5.15 ± 0.71 to 1.19 ± 0.75). A favorable outcome (excellent or good outcome by MacNab's criteria) was achieved in 77 patients (96.25%). During the follow-up period, 2 cases (2.5%) of recurrence have occurred. Conclusion. According to the result, we could obtain the favorable clinical and radiological outcomes while simultaneously removing pathologic discs using the ligamentum flavum splitting and annular fissure sealing technique. PMID:27803927

  19. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro.

    PubMed

    Sharwood, Robert E; Hotto, Amber M; Bollenbach, Thomas J; Stern, David B

    2011-02-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3'-to-5' exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNA(Arg), raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S-AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1.

  20. Evolution in the block: common elements of 5S rDNA organization and evolutionary patterns in distant fish genera.

    PubMed

    Campo, Daniel; García-Vázquez, Eva

    2012-01-01

    The 5S rDNA is organized in the genome as tandemly repeated copies of a structural unit composed of a coding sequence plus a nontranscribed spacer (NTS). The coding region is highly conserved in the evolution, whereas the NTS vary in both length and sequence. It has been proposed that 5S rRNA genes are members of a gene family that have arisen through concerted evolution. In this study, we describe the molecular organization and evolution of the 5S rDNA in the genera Lepidorhombus and Scophthalmus (Scophthalmidae) and compared it with already known 5S rDNA of the very different genera Merluccius (Merluccidae) and Salmo (Salmoninae), to identify common structural elements or patterns for understanding 5S rDNA evolution in fish. High intra- and interspecific diversity within the 5S rDNA family in all the genera can be explained by a combination of duplications, deletions, and transposition events. Sequence blocks with high similarity in all the 5S rDNA members across species were identified for the four studied genera, with evidences of intense gene conversion within noncoding regions. We propose a model to explain the evolution of the 5S rDNA, in which the evolutionary units are blocks of nucleotides rather than the entire sequences or single nucleotides. This model implies a "two-speed" evolution: slow within blocks (homogenized by recombination) and fast within the gene family (diversified by duplications and deletions).

  1. Strong nondipole effects in low-energy photoionization of the 5s and 5p subshells of xenon

    SciTech Connect

    Johnson, W. R.; Cheng, K. T.

    2001-02-01

    Large nondipole effects are predicted in the angular distribution of photoelectrons from the 5s and 5p subshells of xenon for photon energies below 200 eV. The nondipole parameter {gamma}{sub 5s} exhibits a dispersion-curve variation near the first minimum of the 5s cross section at 35 eV, reaching a minimum value of -0.8 near 40 eV. Rapid variation of {gamma}{sub 5s} is also found near the second minimum of the 5s cross section at 150 eV, where {gamma}{sub 5s} reaches a maximum value of 1.2. Smaller, but significant, nondipole effects are also found in the parameter {zeta}{sub 5p}={gamma}{sub 5p}+3{delta}{sub 5p}, which has a maximum value of 0.15 near 50 eV, and a second maximum value of 0.18 near 160 eV. The higher energy maxima in {gamma}{sub 5s} and {zeta}{sub 5p} arise from correlation enhanced by shape resonances in the 4p{yields}f quadrupole photoionization channels. These predictions are based on relativistic random-phase approximation calculations in which excitations from 5p, 5s, 4d, 4p, and 4s subshells are coupled.

  2. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    PubMed

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-07

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  3. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site

    NASA Astrophysics Data System (ADS)

    Calviño, Fabiola R.; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  4. Plantago lagopus B Chromosome Is Enriched in 5S rDNA-Derived Satellite DNA.

    PubMed

    Kumke, Katrin; Macas, Jiří; Fuchs, Jörg; Altschmied, Lothar; Kour, Jasmeet; Dhar, Manoj K; Houben, Andreas

    2016-01-01

    B chromosomes are supernumerary dispensable parts of the karyotype which appear in some individuals of some populations in some species. Using advanced sequencing technology, we in silico characterized the high-copy DNA composition of Plantago lagopus with and without B chromosomes. The nuclear genome (2.46 pg/2C) was found to be relatively rich in repetitive sequences, with highly and moderately repeated elements making up 68% of the genome. Besides a centromere-specific marker, we identified a B-specific satellite and a repeat enriched in polymorphic A chromosome segments. The B-specific tandem repeat PLsatB originated from sequence amplification including 5S rDNA fragments. PMID:27173804

  5. The FERRUM project: Experimental transition probabilities from highly excited even 5s levels in Cr ii

    NASA Astrophysics Data System (ADS)

    Engström, L.; Lundberg, H.; Nilsson, H.; Hartman, H.; Bäckström, E.

    2014-10-01

    We report lifetime measurements of the five levels in the 3d4(a5D)5s e6D term in Cr ii at an energy around 83 000 cm-1, and log(gf) values for 38 transitions from the investigated levels. The lifetimes are obtained using time-resolved, laser-induced fluorescence on ions from a laser-produced plasma. Since the levels have the same parity as the low-lying states directly populated in the plasma, we used a two-photon excitation scheme. This process is greatly facilitated by the presence of the 3d4(a5D)4p z6F levels at roughly half the energy difference. The f-values are obtained by combining the experimental lifetimes with branching fractions derived using relative intensities from a hollow cathode lamp recorded with a Fourier transform spectrometer.

  6. Taxonomy of 5 S ribosomal RNA by the linguistic technique: probing with mitochondrial and mammalian sequences.

    PubMed

    Guimarães, R C; Trifonov, E N; Lagunez-Otero, J

    1997-09-01

    Linguistic similarities and dissimilarities between 5 S rRNA sequences allowed taxonomical separation of species and classes. Comparisons with the molecule from mammals distinguished fungi and plants from protists and animals. Similarities to mammalians progressively increased from protists to invertebrates and to somatic-type molecules of the vertebrates lineage. In this, deviations were detected in avian, oocyte type, and pseudogene sequences. Among bacteria, actinobacteria were most similar to the mammalians, which could be related to the high frequency of associations among members of these groups. Some archaebacterial species most similar to the mammalians belonged to the Thermoproteales and Halobacteria groups. Comparisons with the soybean mitochondrial molecule revealed high internal homogeneity among plant mitochondria. The eubacterial groups most similar to it were Thermus and Rhodobacteria gamma-1 and alpha-2. Other procedures have already indicated similarities of Rhodobacteria alpha to mitochondria but the linguistic similarities were on the average higher with the first two groups.

  7. Direct lateral interbody fusion (DLIF) at the lumbosacral junction L5-S1.

    PubMed

    Shirzadi, Ali; Birch, Kurtis; Drazin, Doniel; Liu, John C; Acosta, Frank

    2012-07-01

    The direct lateral interbody fusion (DLIF), a minimally invasive lateral approach for placement of an interbody fusion device, does not require nerve root retraction or any contact with the great vessels and can lead to short operative times with little blood loss. Due to anatomical restrictions, this procedure has not been used at the lumbosacral (L5-S1) junction. Lumbosacral transitional vertebrae (LSTV), a structural anomaly of the lumbosacral spine associated with low back pain, can result in a level being wrongly identified pre-operatively due to misnumbering of the vertebral levels. To our knowledge, use of the DLIF graft in this patient is the first report of an interbody fusion graft being placed at the disc space between the LSTV and S1 via the transpsoas route. We present a review of the literature regarding the LSTV variation as well as the lateral placement of interbody fusion grafts at the lumbosacral junction.

  8. Electric-dipole 5s - 5p Transitions in Promethiumlike Ions

    SciTech Connect

    Vilkas, M J; Ishikawa, Y; Trabert, E

    2008-02-29

    The 5s-5p electric-dipole resonance transitions in highly ionized promethiumlike ions have been studied applying relativistic multi-reference Moeller-Plesset second-order perturbation theory. The transition wavelengths are determined to within 0.2 {angstrom} in the more highly charged ions, where the level degeneracies are small. For somewhat lighter ions a very large reference space was used in order to account for the many degeneracies. In order to calculate transition probabilities and lifetimes, correlation corrections have been added to the transition operator in the next order. The contributions from the higher orders of the theory, that is, frequency-dependent Breit correction, Lamb shift, and mass shifts, have been estimated. The results are used to re-assess spectroscopic data from beam-foil, electron beam ion trap, and tokamak observations.

  9. Phylogenetic relationships among diploid Aegilops species inferred from 5S rDNA units.

    PubMed

    Baum, B R; Edwards, T; Johnson, D A

    2009-10-01

    Relationships among the currently recognized 11 diploid species within the genus Aegilops have been investigated. Sequence similarity analysis, based upon 363 sequenced 5S rDNA clones from 44 accessions plus 15 sequences retrieved from GenBank, depicted two unit classes labeled the long AE1 and short AE1. Several different analytical methods were applied to infer relationships within haplomes, between haplomes and among the species, including maximum parsimony and maximum likelihood analyses of consensus sequences, "total evidence" phylogeny analysis and "matrix representation with parsimony" analysis. None were able to depict suites of markers or unit classes that could discern among the seven haplomes as is observed among established haplomes in other genera within the tribe Triticeae; however, most species could be separated when displayed on gene trees. These results suggest that the haplomes currently recognized are so refined that they may be relegated as sub-haplomes or haplome variants. Amblyopyrum shares the same 5S rDNA unit classes with the diploid Aegilops species suggesting that it belongs within the latter. Comparisons of the Aegilops sequences with those of Triticum showed that the long AE1 unit class of Ae. tauschii shared the clade with the equivalent long D1 unit class, i.e., the putative D haplome donor, but the short AE1 unit class did not. The long AE1 unit class but not the short, of Ae. speltoides and Ae. searsii both share the clade with the previously identified long {S1 and long G1 unit classes meaning that both Aegilops species can be equally considered putative B haplome donors to tetraploid Triticum species. The semiconserved nature of the nontranscribed spacer in Aegilops and in Triticeae in general is discussed in view that it may have originated by processes of incomplete gene conversion or biased gene conversion or birth-and-death evolution.

  10. Measurement of {Upsilon}(5S) decays to B{sup 0} and B{sup +} mesons

    SciTech Connect

    Drutskoy, A.; Kinoshita, K.; Schwartz, A. J.; Adachi, I.; Haba, J.; Itoh, R.; Iwasaki, Y.; Katayama, N.; Kichimi, H.; Krokovny, P.; Nakao, M.; Nishida, S.; Sakai, Y.; Sumisawa, K.; Trabelsi, K.; Tsuboyama, T.; Uno, S.; Wicht, J.; Aihara, H.; Aulchenko, V.

    2010-06-01

    Decays of the {Upsilon}(5S) resonance to channels with B{sup +} and B{sup 0} mesons are studied using a 23.6 fb{sup -1} data sample collected with the Belle detector at the KEKB asymmetric-energy e{sup +}e{sup -} collider. Fully reconstructed B{sup +{yields}}J/{psi}K{sup +}, B{sup 0{yields}}J/{psi}K*{sup 0}, B{sup +{yields}}D{sup 0{pi}+}, and B{sup 0{yields}}D{sup -{pi}+} decays are used to obtain the charged and neutral B production rates per bb event, f(B{sup +})=(72.1{sub -3.8}{sup +3.9{+-}}5.0)% and f(B{sup 0})=(77.0{sub -5.6}{sup +5.8{+-}}6.1)%. Assuming equal rates to B{sup +} and B{sup 0} mesons in all channels produced at the {Upsilon}(5S) energy, we measure the fractions for transitions to two-body and three-body channels with B meson pairs, f(BB)=(5.5{sub -0.9}{sup +1.0{+-}}0.4)%, f(BB*+B*B)=(13.7{+-}1.3{+-}1.1)%, f(B*B*)=(37.5{sub -1.9}{sup +2.1{+-}}3.0)%, f(BB{pi})=(0.0{+-}1.2{+-}0.3)%, f(BB*{pi}+B*B{pi})=(7.3{sub -2.1}{sup +2.3{+-}}0.8)%, and f(B*B*{pi})=(1.0{sub -1.3}{sup +1.4{+-}}0.4)%. The latter three fractions are obtained assuming isospin conservation.

  11. Measuring B{sub s} width difference at the {Upsilon}(5s) using quantum entanglement

    SciTech Connect

    Atwood, David; Soni, Amarjit

    2010-08-01

    About 90% of B{sub s}B{sub s} pairs produced at the {Upsilon}(5s) resonance are initially B{sub s}{sup *}B{sub s}{sup *} pairs which decay radiatively to B{sub s}B{sub s}. This implies that the B{sub s}B{sub s} pair will then be in an eigenstate of charge conjugation (i.e. C=-1) and therefore in an entangled state. This allows for a determination of {Delta}{Gamma}{sub s}/{Gamma}{sub s} and the CP phase using a number of possible correlations between the decays of the two B{sub s} mesons. In particular, we consider the time integrated correlation, the time ordering asymmetry, and the time ordering-charge asymmetry, which in addition to time ordering distinguishes B{sub s} from B{sub s}, for various combinations of final states. With the statistics of about O(10{sup 7}-10{sup 8}) {Upsilon}(5s) events available at B factories, we find that the time ordering asymmetry between suitably defined hadronic and flavor specific (tagging) decays offers a promising method for determining the width difference. The corresponding time ordering-charge asymmetry can also bound the mixing phase. Similar observables involving exclusive decays are also considered. At the super B factories with O(50) times greater luminosity time ordering and time ordering-charge asymmetries between inclusive and exclusive modes may also provide additional bounds on the phases in those decays.

  12. Observation of B{sub s} Production at the {upsilon}(5S) Resonance

    SciTech Connect

    Bonvicini, G.; Cinabro, D.; Dubrovin, M.; Lincoln, A.; Bornheim, A.; Pappas, S.P.; Weinstein, A.; Asner, D.M.; Edwards, K.W.; Briere, R.A.; Chen, G.P.; Chen, J.; Ferguson, T.; Tatishvili, G.; Vogel, H.; Watkins, M.E.; Rosner, J.L.; Adam, N.E.; Alexander, J.P.; Berkelman, K.

    2006-01-20

    Using the CLEO detector at the Cornell Electron Storage Ring, we have observed the B{sub s} meson in e{sup +}e{sup -} annihilation at the {upsilon}(5S) resonance. We find 14 candidates consistent with B{sub s} decays into final states with a J/{psi} or a D{sub s}{sup (*)-}. The probability that we have observed a background fluctuation is less than 8x10{sup -10}. We have established that at the energy of the {upsilon}(5S) resonance B{sub s} production proceeds predominantly through the creation of B{sub s}*B{sub s}* pairs. We find {sigma}(e{sup +}e{sup -}{yields}B{sub s}*B{sub s}*)=[0.11{sub -0.03}{sup +0.04}(stat){+-}0.02(syst)] nb, and set the following limits: {sigma}(e{sup +}e{sup -}{yields}B{sub s}B{sub s})/{sigma}(e{sup +}e{sup -}{yields}B{sub s}*B{sub s}*)<0.16 and [{sigma}(e{sup +}e{sup -}{yields}B{sub s}B{sub s}*)+{sigma}(e{sup +}e{sup -}{yields}B{sub s}*B{sub s})]/{sigma}(e{sup +}e{sup -}{yields}B{sub s}*= B{sub s}*)<0.16 (90% C.L.). The mass of the B{sub s}* meson is measured to be M{sub B{sub s}}{sub *}=[5.414{+-}0.001(stat){+-}0.003(syst)] GeV/c{sup 2}.

  13. Classification of 5-S Epileptic EEG Recordings Using Distribution Entropy and Sample Entropy.

    PubMed

    Li, Peng; Karmakar, Chandan; Yan, Chang; Palaniswami, Marimuthu; Liu, Changchun

    2016-01-01

    Epilepsy is an electrophysiological disorder of the brain, the hallmark of which is recurrent and unprovoked seizures. Electroencephalogram (EEG) measures electrical activity of the brain that is commonly applied as a non-invasive technique for seizure detection. Although a vast number of publications have been published on intelligent algorithms to classify interictal and ictal EEG, it remains an open question whether they can be detected using short-length EEG recordings. In this study, we proposed three protocols to select 5 s EEG segment for classifying interictal and ictal EEG from normal. We used the publicly-accessible Bonn database, which consists of normal, interical, and ictal EEG signals with a length of 4097 sampling points (23.6 s) per record. In this study, we selected three segments of 868 points (5 s) length from each recordings and evaluated results for each of them separately. The well-studied irregularity measure-sample entropy (SampEn)-and a more recently proposed complexity measure-distribution entropy (DistEn)-were used as classification features. A total of 20 combinations of input parameters m and τ for the calculation of SampEn and DistEn were selected for compatibility. Results showed that SampEn was undefined for half of the used combinations of input parameters and indicated a large intra-class variance. Moreover, DistEn performed robustly for short-length EEG data indicating relative independence from input parameters and small intra-class fluctuations. In addition, it showed acceptable performance for all three classification problems (interictal EEG from normal, ictal EEG from normal, and ictal EEG from interictal) compared to SampEn, which showed better results only for distinguishing normal EEG from interictal and ictal. Both SampEn and DistEn showed good reproducibility and consistency, as evidenced by the independence of results on analysing protocol.

  14. Classification of 5-S Epileptic EEG Recordings Using Distribution Entropy and Sample Entropy

    PubMed Central

    Li, Peng; Karmakar, Chandan; Yan, Chang; Palaniswami, Marimuthu; Liu, Changchun

    2016-01-01

    Epilepsy is an electrophysiological disorder of the brain, the hallmark of which is recurrent and unprovoked seizures. Electroencephalogram (EEG) measures electrical activity of the brain that is commonly applied as a non-invasive technique for seizure detection. Although a vast number of publications have been published on intelligent algorithms to classify interictal and ictal EEG, it remains an open question whether they can be detected using short-length EEG recordings. In this study, we proposed three protocols to select 5 s EEG segment for classifying interictal and ictal EEG from normal. We used the publicly-accessible Bonn database, which consists of normal, interical, and ictal EEG signals with a length of 4097 sampling points (23.6 s) per record. In this study, we selected three segments of 868 points (5 s) length from each recordings and evaluated results for each of them separately. The well-studied irregularity measure—sample entropy (SampEn)—and a more recently proposed complexity measure—distribution entropy (DistEn)—were used as classification features. A total of 20 combinations of input parameters m and τ for the calculation of SampEn and DistEn were selected for compatibility. Results showed that SampEn was undefined for half of the used combinations of input parameters and indicated a large intra-class variance. Moreover, DistEn performed robustly for short-length EEG data indicating relative independence from input parameters and small intra-class fluctuations. In addition, it showed acceptable performance for all three classification problems (interictal EEG from normal, ictal EEG from normal, and ictal EEG from interictal) compared to SampEn, which showed better results only for distinguishing normal EEG from interictal and ictal. Both SampEn and DistEn showed good reproducibility and consistency, as evidenced by the independence of results on analysing protocol. PMID:27148074

  15. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    NASA Technical Reports Server (NTRS)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  16. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells

    PubMed Central

    Cao, Weibiao

    2016-01-01

    Mechanisms of the progression from Barrett’s esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK) inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA. PMID:26901778

  17. Two distinct structural elements of 5S rRNA are needed for its import into human mitochondria.

    PubMed

    Smirnov, Alexandre; Tarassov, Ivan; Mager-Heckel, Anne-Marie; Letzelter, Michel; Martin, Robert P; Krasheninnikov, Igor A; Entelis, Nina

    2008-04-01

    RNA import into mitochondria is a widespread phenomenon. Studied in details for yeast, protists, and plants, it still awaits thorough investigation for human cells, in which the nuclear DNA-encoded 5S rRNA is imported. Only the general requirements for this pathway have been described, whereas specific protein factors needed for 5S rRNA delivery into mitochondria and its structural determinants of import remain unknown. In this study, a systematic analysis of the possible role of human 5S rRNA structural elements in import was performed. Our experiments in vitro and in vivo show that two distinct regions of the human 5S rRNA molecule are needed for its mitochondrial targeting. One of them is located in the proximal part of the helix I and contains a conserved uncompensated G:U pair. The second and most important one is associated with the loop E-helix IV region with several noncanonical structural features. Destruction or even destabilization of these sites leads to a significant decrease of the 5S rRNA import efficiency. On the contrary, the beta-domain of the 5S rRNA was proven to be dispensable for import, and thus it can be deleted or substituted without affecting the 5S rRNA importability. This finding was used to demonstrate that the 5S rRNA can function as a vector for delivering heterologous RNA sequences into human mitochondria. 5S rRNA-based vectors containing a substitution of a part of the beta-domain by a foreign RNA sequence were shown to be much more efficiently imported in vivo than the wild-type 5S rRNA.

  18. Structural basis for phosphatidylinositol-phosphate biosynthesis

    NASA Astrophysics Data System (ADS)

    Clarke, Oliver B.; Tomasek, David; Jorge, Carla D.; Dufrisne, Meagan Belcher; Kim, Minah; Banerjee, Surajit; Rajashankar, Kanagalaghatta R.; Shapiro, Lawrence; Hendrickson, Wayne A.; Santos, Helena; Mancia, Filippo

    2015-10-01

    Phosphatidylinositol is critical for intracellular signalling and anchoring of carbohydrates and proteins to outer cellular membranes. The defining step in phosphatidylinositol biosynthesis is catalysed by CDP-alcohol phosphotransferases, transmembrane enzymes that use CDP-diacylglycerol as donor substrate for this reaction, and either inositol in eukaryotes or inositol phosphate in prokaryotes as the acceptor alcohol. Here we report the structures of a related enzyme, the phosphatidylinositol-phosphate synthase from Renibacterium salmoninarum, with and without bound CDP-diacylglycerol to 3.6 and 2.5 Å resolution, respectively. These structures reveal the location of the acceptor site, and the molecular determinants of substrate specificity and catalysis. Functional characterization of the 40%-identical ortholog from Mycobacterium tuberculosis, a potential target for the development of novel anti-tuberculosis drugs, supports the proposed mechanism of substrate binding and catalysis. This work therefore provides a structural and functional framework to understand the mechanism of phosphatidylinositol-phosphate biosynthesis.

  19. [Peculiarities of Proteus mirabilis extracellular metalloproteinase biosynthesis].

    PubMed

    Zamaliutdinova, N M; Sharipova, M R; Bogomol'naia, L M; Bozhokina, E S; Mardanova, A M

    2015-01-01

    Biosynthesis of metalloproteinase by the Proteus mirabilis 5127-1 strain on different media and the influence of glucose and urea on biosynthesis were studied. It was found that the P. mirabilis 5127-1 bacteria secretes metalloproteinase in the medium in two isoforms (52 and 50 kDa). It was established that proteinase synthesis is completely suppressed during the growth of bacteria on synthetic media, as well as in the presence of LB glucose in the medium. It was demonstrated that addition of urea in the medium results in an increase of the culture productivity in the proteinase synthesis. Maximal culture productivity in the proteinase synthesis was found in the medium with natural urine. During the growth of bacteria on artificial urine, proteinase appeared in the medium only after 12 hours of growth as a single isoform. PMID:25872397

  20. Ceramide biosynthesis and metabolism in trophoblast syncytialization.

    PubMed

    Singh, Ambika T; Dharmarajan, Arunasalam; Aye, Irving L M H; Keelan, Jeffrey A

    2012-10-15

    Sphingolipid mediators such as ceramide are pleiotropic regulators of cellular growth, differentiation and apoptosis. We investigated the role of ceramide biosynthesis, metabolism and actions in term human cytotrophoblasts syncytialized over 7 days in culture. Intracellular C16 ceramide levels increased modestly after 3 days in culture, then declined. Ceramidase was present at particularly high levels in syncytialized trophoblasts; inhibition of ceramidase reduced the degree of cell fusion. Exposure to short chain C8 ceramide or aSMase enhanced secretion of the differentiation marker hCG without affecting fusion or cell viability. In contrast, pharmacological inhibition of ceramidase reduced the extent of fusion. Inhibition of the ceramide-responsive JNK and PP2A pathways did not abolish the effects of ceramide, and JNK phosphorylation was unresponsive to ceramide; however, ceramide significantly inhibited phosphorylation of Akt. This study suggests that changes in ceramide biosynthesis and metabolism play a differential role in the biochemical and morphological features of trophoblast differentiation.

  1. Circular Bacteriocins: Biosynthesis and Mode of Action

    PubMed Central

    Brede, Dag A.; Nes, Ingolf F.; Diep, Dzung B.

    2014-01-01

    Circular bacteriocins are a group of N-to-C-terminally linked antimicrobial peptides, produced by Gram-positive bacteria of the phylum Firmicutes. Circular bacteriocins generally exhibit broad-spectrum antimicrobial activity, including against common food-borne pathogens, such as Clostridium and Listeria spp. These peptides are further known for their high pH and thermal stability, as well as for resistance to many proteolytic enzymes, properties which make this group of bacteriocins highly promising for potential industrial applications and their biosynthesis of particular interest as a possible model system for the synthesis of highly stable bioactive peptides. In this review, we summarize the current knowledge on this group of bacteriocins, with emphasis on the recent progress in understanding circular bacteriocin genetics, biosynthesis, and mode of action; in addition, we highlight the current challenges and future perspectives for the application of these peptides. PMID:25172850

  2. Chemical genetics to examine cellulose biosynthesis

    PubMed Central

    Brabham, Chad; DeBolt, Seth

    2013-01-01

    Long-term efforts to decode plant cellulose biosynthesis via molecular genetics and biochemical strategies are being enhanced by the ever-expanding scale of omics technologies. An alternative approach to consider are the prospects for inducing change in plant metabolism using exogenously supplied chemical ligands. Cellulose biosynthesis inhibitors (CBIs) have been identified among known herbicides, during diverse combinatorial chemical libraries screens, and natural chemical screens from microbial agents. In this review, we summarize the current knowledge of the inhibitory effects of CBIs and further group them by how they influence fluorescently tagged cellulose synthase A proteins. Additional attention is paid to the continuing development of the CBI toolbox to explore the cell biology and genetic mechanisms underpinning effector molecule activity. PMID:23372572

  3. Complete biosynthesis of opioids in yeast

    PubMed Central

    Galanie, Stephanie; Thodey, Kate; Trenchard, Isis J.; Interrante, Maria Filsinger; Smolke, Christina D.

    2016-01-01

    Opioids are the primary drugs used in Western medicine for pain management and palliative care. Farming of opium poppies remains the sole source of these essential medicines despite diverse market demands and uncertainty in crop yields due to weather, climate change, and pests. Here, we engineered yeast to produce the selected opioid compounds thebaine and hydrocodone starting from sugar. All work was conducted in a laboratory that is permitted and secured for work with controlled substances. We combined enzyme discovery, enzyme engineering, and pathway and strain optimization to realize full opiate biosynthesis in yeast. The resulting opioid biosynthesis strains required expression of 21 (thebaine) and 23 (hydrocodone) enzyme activities from plants, mammals, bacteria, and yeast itself. This is a proof-of-principle, and major hurdles remain before optimization and scale up could be achieved. Open discussions of options for governing this technology are also needed in order to responsibly realize alternative supplies for these medically relevant compounds. PMID:26272907

  4. Functional specialization in proline biosynthesis of melanoma.

    PubMed

    De Ingeniis, Jessica; Ratnikov, Boris; Richardson, Adam D; Scott, David A; Aza-Blanc, Pedro; De, Surya K; Kazanov, Marat; Pellecchia, Maurizio; Ronai, Ze'ev; Osterman, Andrei L; Smith, Jeffrey W

    2012-01-01

    Proline metabolism is linked to hyperprolinemia, schizophrenia, cutis laxa, and cancer. In the latter case, tumor cells tend to rely on proline biosynthesis rather than salvage. Proline is synthesized from either glutamate or ornithine; both are converted to pyrroline-5-carboxylate (P5C), and then to proline via pyrroline-5-carboxylate reductases (PYCRs). Here, the role of three isozymic versions of PYCR was addressed in human melanoma cells by tracking the fate of (13)C-labeled precursors. Based on these studies we conclude that PYCR1 and PYCR2, which are localized in the mitochondria, are primarily involved in conversion of glutamate to proline. PYCRL, localized in the cytosol, is exclusively linked to the conversion of ornithine to proline. This analysis provides the first clarification of the role of PYCRs to proline biosynthesis.

  5. Biosynthesis and toxicological effects of patulin.

    PubMed

    Puel, Olivier; Galtier, Pierre; Oswald, Isabelle P

    2010-04-01

    Patulin is a toxic chemical contaminant produced by several species of mold, especially within Aspergillus, Penicillium and Byssochlamys. It is the most common mycotoxin found in apples and apple-derived products such as juice, cider, compotes and other food intended for young children. Exposure to this mycotoxin is associated with immunological, neurological and gastrointestinal outcomes. Assessment of the health risks due to patulin consumption by humans has led many countries to regulate the quantity in food. A full understanding of the molecular genetics of patulin biosynthesis is incomplete, unlike other regulated mycotoxins (aflatoxins, trichothecenes and fumonisins), although the chemical structures of patulin precursors are now known. The biosynthetic pathway consists of approximately 10 steps, as suggested by biochemical studies. Recently, a cluster of 15 genes involved in patulin biosynthesis was reported, containing characterized enzymes, a regulation factor and transporter genes. This review includes information on the current understanding of the mechanisms of patulin toxinogenesis and summarizes its toxicological effects.

  6. Combinatorial biosynthesis--potential and problems.

    PubMed

    Floss, Heinz G

    2006-06-25

    Because of their ecological functions, natural products have been optimized in evolution for interaction with biological systems and receptors. However, they have not necessarily been optimized for other desirable drug properties and thus can often be improved by structural modification. Using examples from the literature, this paper reviews the opportunities for increasing structural diversity among natural products by combinatorial biosynthesis, i.e., the genetic manipulation of biosynthetic pathways. It distinguishes between combinatorial biosynthesis in a narrower sense to generate libraries of modified structures, and metabolic engineering for the targeted formation of specific structural analogs. Some of the problems and limitations encountered with these approaches are also discussed. Work from the author's laboratory on ansamycin antibiotics is presented which illustrates some of the opportunities and limitations.

  7. Functional Specialization in Proline Biosynthesis of Melanoma

    PubMed Central

    Richardson, Adam D.; Scott, David A.; Aza-Blanc, Pedro; De, Surya K.; Kazanov, Marat; Pellecchia, Maurizio; Ronai, Ze'ev; Osterman, Andrei L.; Smith, Jeffrey W.

    2012-01-01

    Proline metabolism is linked to hyperprolinemia, schizophrenia, cutis laxa, and cancer. In the latter case, tumor cells tend to rely on proline biosynthesis rather than salvage. Proline is synthesized from either glutamate or ornithine; both are converted to pyrroline-5-carboxylate (P5C), and then to proline via pyrroline-5-carboxylate reductases (PYCRs). Here, the role of three isozymic versions of PYCR was addressed in human melanoma cells by tracking the fate of 13C-labeled precursors. Based on these studies we conclude that PYCR1 and PYCR2, which are localized in the mitochondria, are primarily involved in conversion of glutamate to proline. PYCRL, localized in the cytosol, is exclusively linked to the conversion of ornithine to proline. This analysis provides the first clarification of the role of PYCRs to proline biosynthesis. PMID:23024808

  8. Structural basis for phosphatidylinositol-phosphate biosynthesis

    PubMed Central

    Clarke, Oliver B.; Tomasek, David; Jorge, Carla D.; Dufrisne, Meagan Belcher; Kim, Minah; Banerjee, Surajit; Rajashankar, Kanagalaghatta R.; Shapiro, Lawrence; Hendrickson, Wayne A.; Santos, Helena; Mancia, Filippo

    2015-01-01

    Phosphatidylinositol is critical for intracellular signalling and anchoring of carbohydrates and proteins to outer cellular membranes. The defining step in phosphatidylinositol biosynthesis is catalysed by CDP-alcohol phosphotransferases, transmembrane enzymes that use CDP-diacylglycerol as donor substrate for this reaction, and either inositol in eukaryotes or inositol phosphate in prokaryotes as the acceptor alcohol. Here we report the structures of a related enzyme, the phosphatidylinositol-phosphate synthase from Renibacterium salmoninarum, with and without bound CDP-diacylglycerol to 3.6 and 2.5 Å resolution, respectively. These structures reveal the location of the acceptor site, and the molecular determinants of substrate specificity and catalysis. Functional characterization of the 40%-identical ortholog from Mycobacterium tuberculosis, a potential target for the development of novel anti-tuberculosis drugs, supports the proposed mechanism of substrate binding and catalysis. This work therefore provides a structural and functional framework to understand the mechanism of phosphatidylinositol-phosphate biosynthesis. PMID:26510127

  9. Complete biosynthesis of opioids in yeast.

    PubMed

    Galanie, Stephanie; Thodey, Kate; Trenchard, Isis J; Filsinger Interrante, Maria; Smolke, Christina D

    2015-09-01

    Opioids are the primary drugs used in Western medicine for pain management and palliative care. Farming of opium poppies remains the sole source of these essential medicines, despite diverse market demands and uncertainty in crop yields due to weather, climate change, and pests. We engineered yeast to produce the selected opioid compounds thebaine and hydrocodone starting from sugar. All work was conducted in a laboratory that is permitted and secured for work with controlled substances. We combined enzyme discovery, enzyme engineering, and pathway and strain optimization to realize full opiate biosynthesis in yeast. The resulting opioid biosynthesis strains required the expression of 21 (thebaine) and 23 (hydrocodone) enzyme activities from plants, mammals, bacteria, and yeast itself. This is a proof of principle, and major hurdles remain before optimization and scale-up could be achieved. Open discussions of options for governing this technology are also needed in order to responsibly realize alternative supplies for these medically relevant compounds. PMID:26272907

  10. β-alanine biosynthesis in Methanocaldococcus jannaschii.

    PubMed

    Wang, Yu; Xu, Huimin; White, Robert H

    2014-08-01

    One efficient approach to assigning function to unannotated genes is to establish the enzymes that are missing in known biosynthetic pathways. One group of such pathways is those involved in coenzyme biosynthesis. In the case of the methanogenic archaeon Methanocaldococcus jannaschii as well as most methanogens, none of the expected enzymes for the biosynthesis of the β-alanine and pantoic acid moieties required for coenzyme A are annotated. To identify the gene(s) for β-alanine biosynthesis, we have established the pathway for the formation of β-alanine in this organism after experimentally eliminating other known and proposed pathways to β-alanine from malonate semialdehyde, l-alanine, spermine, dihydrouracil, and acryloyl-coenzyme A (CoA). Our data showed that the decarboxylation of aspartate was the only source of β-alanine in cell extracts of M. jannaschii. Unlike other prokaryotes where the enzyme producing β-alanine from l-aspartate is a pyruvoyl-containing l-aspartate decarboxylase (PanD), the enzyme in M. jannaschii is a pyridoxal phosphate (PLP)-dependent l-aspartate decarboxylase encoded by MJ0050, the same enzyme that was found to decarboxylate tyrosine for methanofuran biosynthesis. A Km of ∼0.80 mM for l-aspartate with a specific activity of 0.09 μmol min(-1) mg(-1) at 70°C for the decarboxylation of l-aspartate was measured for the recombinant enzyme. The MJ0050 gene was also demonstrated to complement the Escherichia coli panD deletion mutant cells, in which panD encoding aspartate decarboxylase in E. coli had been knocked out, thus confirming the function of this gene in vivo.

  11. Investigating the Elusive Mechanism of Glycosaminoglycan Biosynthesis*

    PubMed Central

    Victor, Xylophone V.; Nguyen, Thao K. N.; Ethirajan, Manivannan; Tran, Vy M.; Nguyen, Khiem V.; Kuberan, Balagurunathan

    2009-01-01

    Glycosaminoglycan (GAG) biosynthesis requires numerous biosynthetic enzymes and activated sulfate and sugar donors. Although the sequence of biosynthetic events is resolved using reconstituted systems, little is known about the emergence of cell-specific GAG chains (heparan sulfate, chondroitin sulfate, and dermatan sulfate) with distinct sulfation patterns. We have utilized a library of click-xylosides that have various aglycones to decipher the mechanism of GAG biosynthesis in a cellular system. Earlier studies have shown that both the concentration of the primers and the structure of the aglycone moieties can affect the composition of the newly synthesized GAG chains. However, it is largely unknown whether structural features of aglycone affect the extent of sulfation, sulfation pattern, disaccharide composition, and chain length of GAG chains. In this study, we show that aglycones can switch not only the type of GAG chains, but also their fine structures. Our findings provide suggestive evidence for the presence of GAGOSOMES that have different combinations of enzymes and their isoforms regulating the synthesis of cell-specific combinatorial structures. We surmise that click-xylosides are differentially recognized by the GAGOSOMES to generate distinct GAG structures as observed in this study. These novel click-xylosides offer new avenues to profile the cell-specific GAG chains, elucidate the mechanism of GAG biosynthesis, and to decipher the biological actions of GAG chains in model organisms. PMID:19628873

  12. Moss cell walls: structure and biosynthesis

    PubMed Central

    Roberts, Alison W.; Roberts, Eric M.; Haigler, Candace H.

    2012-01-01

    The genome sequence of the moss Physcomitrella patens has stimulated new research examining the cell wall polysaccharides of mosses and the glycosyl transferases that synthesize them as a means to understand fundamental processes of cell wall biosynthesis and plant cell wall evolution. The cell walls of mosses and vascular plants are composed of the same classes of polysaccharides, but with differences in side chain composition and structure. Similarly, the genomes of P. patens and angiosperms encode the same families of cell wall glycosyl transferases, yet, in many cases these families have diversified independently in each lineage. Our understanding of land plant evolution could be enhanced by more complete knowledge of the relationships among glycosyl transferase functional diversification, cell wall structural and biochemical specialization, and the roles of cell walls in plant adaptation. As a foundation for these studies, we review the features of P. patens as an experimental system, analyses of cell wall composition in various moss species, recent studies that elucidate the structure and biosynthesis of cell wall polysaccharides in P. patens, and phylogenetic analysis of P. patens genes potentially involved in cell wall biosynthesis. PMID:22833752

  13. Polyketides from dinoflagellates: origins, pharmacology and biosynthesis.

    PubMed

    Rein, K S; Borrone, J

    1999-10-01

    Dinoflagellates, unicellular marine protists, produce some of the largest and most complex polyketides identified to date. The biological activities of these compounds are quite diverse. Compounds having potential therapeutic value as anti-cancer agents as well as deadly neurotoxins, whose production has resulted in severe public health hazards and economic hardships, are represented in this group of secondary metabolites. Stable isotope feeding experiments have firmly established the polyketide origins of representative compounds from each of the three structural classes, the polyether ladders, the macrocycles and the linear polyethers. Yet some unusual labeling patterns have been observed in each class. Pendant methyl groups are most often derived from C-2 of acetate and deletions of C-1 of acetate are common. Studies on the biosynthesis of dinoflagellate derived polyketides at the genomic level have not been reported, in part due to the peculiarities of the dinoflagellate nucleus and the lack of a dinoflagellate transformation system. Nevertheless, a fundamental understanding of the genetics of polyketide biosynthesis by dinoflagellates could be the catalyst for developing several fruitful avenues of research. Dinoflagellate derived polyketides are reviewed with special emphasis on pharmacology and biosynthesis.

  14. Tetrahydrobiopterin biosynthesis, utilization and pharmacological effects.

    PubMed

    Werner-Felmayer, G; Golderer, G; Werner, E R

    2002-04-01

    Tetrahydrobiopterin (H4-biopterin) is an essential cofactor of a set of enzymes that are of central metabolic importance, i.e. the hydroxylases of the three aromatic amino acids phenylalanine, tyrosine, and tryptophan, of ether lipid oxidase, and of the three nitric oxide synthase (NOS) isoenzymes. As a consequence, H4-biopterin plays a key role in a vast number of biological processes and pathological states associated with neurotransmitter formation, vasorelaxation, and immune response. In mammals, its biosynthesis is controlled by hormones, cytokines and certain immune stimuli. This review aims to summarize recent developments concerning regulation of H4-biopterin biosynthetic and regulatory enzymes and pharmacological effects of H4-biopterin in various conditions, e.g. endothelial dysfunction or apoptosis of neuronal cells. Also, approaches towards gene therapy of diseases like the different forms of phenylketonuria or of Parkinson's disease are reviewed. Additional emphasis is given to H4-biopterin biosynthesis and function in non-mammalian species such as fruit fly, zebra fish, fungi, slime molds, the bacterium Nocardia as well as to the parasitic protozoan genus of Leishmania that is not capable of pteridine biosynthesis but has evolved a sophisticated salvage network for scavenging various pteridine compounds, notably folate and biopterin. PMID:12003348

  15. Biosynthesis of plant-derived flavor compounds.

    PubMed

    Schwab, Wilfried; Davidovich-Rikanati, Rachel; Lewinsohn, Efraim

    2008-05-01

    Plants have the capacity to synthesize, accumulate and emit volatiles that may act as aroma and flavor molecules due to interactions with human receptors. These low-molecular-weight substances derived from the fatty acid, amino acid and carbohydrate pools constitute a heterogenous group of molecules with saturated and unsaturated, straight-chain, branched-chain and cyclic structures bearing various functional groups (e.g. alcohols, aldehydes, ketones, esters and ethers) and also nitrogen and sulfur. They are commercially important for the food, pharmaceutical, agricultural and chemical industries as flavorants, drugs, pesticides and industrial feedstocks. Due to the low abundance of the volatiles in their plant sources, many of the natural products had been replaced by their synthetic analogues by the end of the last century. However, the foreseeable shortage of the crude oil that is the source for many of the artificial flavors and fragrances has prompted recent interest in understanding the formation of these compounds and engineering their biosynthesis. Although many of the volatile constituents of flavors and aromas have been identified, many of the enzymes and genes involved in their biosynthesis are still not known. However, modification of flavor by genetic engineering is dependent on the knowledge and availability of genes that encode enzymes of key reactions that influence or divert the biosynthetic pathways of plant-derived volatiles. Major progress has resulted from the use of molecular and biochemical techniques, and a large number of genes encoding enzymes of volatile biosynthesis have recently been reported.

  16. The biosynthesis of the molybdenum cofactors.

    PubMed

    Mendel, Ralf R; Leimkühler, Silke

    2015-03-01

    The biosynthesis of the molybdenum cofactors (Moco) is an ancient, ubiquitous, and highly conserved pathway leading to the biochemical activation of molybdenum. Moco is the essential component of a group of redox enzymes, which are diverse in terms of their phylogenetic distribution and their architectures, both at the overall level and in their catalytic geometry. A wide variety of transformations are catalyzed by these enzymes at carbon, sulfur and nitrogen atoms, which include the transfer of an oxo group or two electrons to or from the substrate. More than 50 molybdoenzymes were identified to date. In all molybdoenzymes except nitrogenase, molybdenum is coordinated to a dithiolene group on the 6-alkyl side chain of a pterin called molybdopterin (MPT). The biosynthesis of Moco can be divided into three general steps, with a fourth one present only in bacteria and archaea: (1) formation of the cyclic pyranopterin monophosphate, (2) formation of MPT, (3) insertion of molybdenum into molybdopterin to form Moco, and (4) additional modification of Moco in bacteria with the attachment of a nucleotide to the phosphate group of MPT, forming the dinucleotide variant of Moco. This review will focus on the biosynthesis of Moco in bacteria, humans and plants.

  17. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

    PubMed

    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

    2012-07-01

    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA.

  18. The nature of Z_b states from a combined analysis of Upsilon (5S)rightarrow h_b(mP) π ^+ π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{(*)}π

    NASA Astrophysics Data System (ADS)

    Huo, Wen-Sheng; Chen, Guo-Ying

    2016-03-01

    With a combined analysis of data on Upsilon (5S)rightarrow h_b(1P,2P)π ^+π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{(*)}π in an effective field theory approach, we determine resonance parameters of Z_b states in two scenarios. In one scenario we assume that Z_b states are pure molecular states, while in the other one we assume that Z_b states contain compact components. We find that the present data favor that there should be some compact components inside Z_b^{(' )} associated with the molecular components. By fitting the invariant mass spectra of Upsilon (5S)rightarrow h_b(1P,2P)π ^+π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{*}π , we determine that the probability of finding the compact components in Z_b states may be as large as about 40 %.

  19. Two sequence classes of kinetoplastid 5S ribosomal RNA gene revealed among bodonid spliced leader RNA gene arrays.

    PubMed

    Santana, D M; Lukes, J; Sturm, N R; Campbell, D A

    2001-11-13

    The spliced leader RNA genes of Bodo saltans, Cryptobia helicis and Dimastigella trypaniformis were analyzed as molecular markers for additional taxa within the suborder Bodonina. The non-transcribed spacer regions were distinctive for each organism, and 5S rRNA genes were present in Bodo and Dimastigella but not in C. helicis. Two sequence classes of 5S rRNA were evident from analysis of the bodonid genes. The two classes of 5S rRNA genes were found in other Kinetoplastids independent of co-localization with the spliced leader RNA gene.

  20. Evolution of green plants as deduced from 5S rRNA sequences.

    PubMed

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other.

  1. Evolution of green plants as deduced from 5S rRNA sequences

    PubMed Central

    Hori, Hiroshi; Lim, Byung-Lak; Osawa, Syozo

    1985-01-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  2. Evolution of green plants as deduced from 5S rRNA sequences.

    PubMed

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  3. Hard X-ray XAFS beamline, BL5S1, at AichiSR

    NASA Astrophysics Data System (ADS)

    Tabuchi, M.; Asakura, H.; Morimoto, H.; Watanabe, N.; Takeda, Y.

    2016-05-01

    A XAFS beamline, BL5S1, had been operated at Aichi Synchrotron Radiation Center, Japan since March 2013. The beamline was designed for the measurements in the energy range from 5 to 20 keV. The photon flux of 6 x 1010 at around 9 keV and beam spot size of 0.5 x 0.3 mm at sample position are as good as designed. For the standard transmission XAFS measurement, both of the step- and quick- scan modes are available. Energy resolution at around 9keV is good enough to discuss the energy shift of the order of 0.1 eV or higher even when the measurements are conducted in the quick-scan mode. With several kinds of detectors for fluorescence and/or CEY detection mode measurements, and various kinds of sample holders which are supported by the XAFS measurement software, users easily obtain spectra for their samples. Such a standard, well operated and easy to access XAFS beamline must be very important to broaden the base of the XAFS society further.

  4. Potentials for modeling cold collisions between Na (3S) and Rb (5S) atoms

    SciTech Connect

    Pashov, A.; Docenko, O.; Tamanis, M.; Ferber, R.; Knoeckel, H.; Tiemann, E.

    2005-12-15

    The experimental characterization of the electronic states correlated to the asymptote of ground state Na (3S) and Rb (5S) atoms was expanded by spectroscopic data on a {sup 3}{sigma}{sup +} state levels using a high resolution Fourier transform spectroscopy technique. The hyperfine splitting of the a {sup 3}{sigma}{sup +} state levels was partially resolved and analyzed for both Na {sup 85}Rb and Na {sup 87}Rb isotopomers. Transitions to high lying levels of the a {sup 3}{sigma}{sup +} and X {sup 1}{sigma}{sup +} states were recorded simultaneously which enables one to determine long range parameters of the molecular potentials. Coupled channels calculations based on the Fourier grid method were finally applied for deriving accurate potential energy curves of the a {sup 3}{sigma}{sup +} and X {sup 1}{sigma}{sup +} states capable of a reliable description of cold collisions between Na and Rb atoms in their ground states. Scattering lengths and Feshbach resonances were calculated for some quantum states.

  5. Design and performance of a 1 MW-5 s high temperature superconductor magnetic energy storage system

    NASA Astrophysics Data System (ADS)

    Morandi, Antonio; Gholizad, Babak; Fabbri, Massimo

    2016-01-01

    The feasibility of a 1 MW-5 s superconducting magnetic energy storage (SMES) system based on state-of-the-art high-temperature superconductor (HTS) materials is investigated in detail. Both YBCO coated conductors and MgB2 are considered. A procedure for the electromagnetic design of the coil is introduced and the final layout is arrived at and compared for the two materials. The choice of the inductance of the coil is carried out as part of the design procedure. Both low-field (3 T) and high-field (8 T) designs are considered for the YBCO. AC losses during a complete charge/discharge cycle at full power are estimated and the cooling power needed for continuous operation is derived. The power conditioning system and control algorithms needed to carry out various operations are discussed in detail. Performances of the SMES system during voltage sag compensation, load leveling and power factor correction are investigated by means of numerical simulation.

  6. Eukaryotic origins: string analysis of 5S ribosomal RNA sequences from some relevant organisms.

    PubMed

    Nanney, D L; Mobley, D O; Preparata, R M; Meyer, E B; Simon, E M

    1991-04-01

    Using the PHYLOGEN tree-forming programs, we evaluate the published 5S rRNA sequences in certain of the files in the Berlin DataBank in an attempt to identify the connection between archaebacteria and the eukaryotic protists. These programs are based on methods of string analysis developed by Sankoff and others. Their discriminatory power is derived from their continuous realignment of sequences through repeated assessment of insertions and deletions as well as substitutions. The programs demonstrate that even these small molecules (ca. 120 bases) retain substantial records of evolutionary events that occurred over a billion years ago. The eukaryotes seem to have been derived from ancestors near the common origins of the halobacterial and Methanococcales groups. Identifying what might have been a primordial eukaryote is more difficult because several of the species considered as early derivatives from the common root are isolated species with large genetic differences from each other and from all other extant forms that have been sequenced. The ameboid, flagellated, and ciliated protists seem to have emerged nearly simultaneously from an ancient cluster, but the sarcodinid protozoa have preference as the group of most ancient origin. The euglenozoa and the ciliates are of later derivation. Our ability to tease plausible trees from such small molecules suggests that the mode of analysis rather than the size of the molecule is often a major limitation in the reconstruction of acceptable ancient phylogenics.(ABSTRACT TRUNCATED AT 250 WORDS)

  7. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    PubMed

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus. PMID:26959315

  8. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    PubMed

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus.

  9. Chromosomal localization and molecular characterization of three different 5S ribosomal DNA clusters in the sea urchin Paracentrotus lividus.

    PubMed

    Caradonna, Fabio; Bellavia, Daniele; Clemente, Ann Maria; Sisino, Giorgia; Barbieri, Rainer

    2007-09-01

    In this paper the chromosomal localization and molecular cloning and characterization of three 5S rDNA clusters of 700 bp (base pairs), 900 bp, and 950 bp in the sea urchin Paracentrotus lividus are reported. Southern blot hybridization demonstrated the existence of three 5S rDNA repeats of differing length in the P. lividus genome. Fluorescence in situ hybridization analysis, performed in parallel on both haploid and diploid metaphases and interphase nuclei using different 5S rDNA units as probes, localized these 5S rDNA clusters in 3 different pairs of P. lividus chromosomes. This is the first complete gene mapping not only in a sea urchin but also in the phylum of echinoderms as a whole. PMID:17893727

  10. The cell and developmental biology of alkaloid biosynthesis.

    PubMed

    De Luca, V; St Pierre, B

    2000-04-01

    Plants produce unique natural products as a result of gene mutation and subsequent adaptation of metabolic pathways to create new secondary metabolites. However, their biosynthesis and accumulation remains remarkably under the control of the biotic and abiotic environments. Alkaloid biosynthesis, which requires the adaptation of cellular activities to perform specialized metabolism without compromising general homeostasis, is accomplished by restricting product biosynthesis and accumulation to particular cells and to defined times of plant development. The cell and developmental biology of alkaloid biosynthesis, which is remarkably complex, evolved in part by recruiting pre-existing enzymes to perform new functions.

  11. Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

    PubMed

    Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

    2011-11-01

    Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

  12. Chromosomal localization of 18S and 5S rDNA using FISH in the genus Tor (Pisces, Cyprinidae).

    PubMed

    Singh, Mamta; Kumar, Ravindra; Nagpure, N S; Kushwaha, B; Gond, Indramani; Lakra, W S

    2009-12-01

    Dual color fluorescence in situ hybridization (FISH) was performed to study the simultaneous chromosomal localization of 18S and 5S ribosomal genes in the genus Tor for the first time. The 18S and 5S rDNAs in four Tor species were amplified, sequenced and mapped on the metaphase chromosomes. The number and distribution of 18S and 5S rDNA clusters were examined on metaphase chromosome spreads using FISH. The specimens of T. chelynoides, T. putitora and T. progeneius showed six bright fluorescent signals of 18S rDNA and T. tor exhibited ten such signals. The 5S rDNA signals were present only on one pair of chromosomes in all the four Tor species. Ag-NORs were observed on two pairs of chromosomes in T. chelynoides, T. putitora, T. progeneius and four pairs in T. tor. Comparison of the observed 18S rDNA FISH signals and Ag-NORs strongly suggested a possible inactivation of NORs localized at the telomeres of a subtelocentric and telocentric chromosome pairs in all four species. The 5S rDNA contained an identical 120 bp long coding region and 81 bp long highly divergent non-transcribed spacers in all species examined. 18S and 5S rDNA sequencing and chromosomal localization can be a useful genetic marker in species identification as well as phylogenetic and evolutionary studies.

  13. Phylogenetic origins of the plant mitochondrion based on a comparative analysis of 5S ribosomal RNA sequences

    NASA Technical Reports Server (NTRS)

    Villanueva, E.; Delihas, N.; Luehrsen, K. R.; Fox, G. E.; Gibson, J.

    1985-01-01

    The complete nucleotide sequences of 5S ribosomal RNAs from Rhodocyclus gelatinosa, Rhodobacter sphaeroides, and Pseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains. Rhodobacter sphaeroides is specifically related to Paracoccus denitrificans and Rc. gelatinosa is related to Ps. cepacia. These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found in P. denitrificans are present also in the 5S RNA of Rb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of obtaining these new sequences is that it is possible to clarify the phylogenetic origins of the plant mitochondrion. In particular, a close phylogenetic relationship is found between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely, Rb. sphaeroides, P. denitrificans, and Rhodospirillum rubrum.

  14. Localized frustration and binding-induced conformational change in recognition of 5S RNA by TFIIIA zinc finger.

    PubMed

    Tan, Cheng; Li, Wenfei; Wang, Wei

    2013-12-19

    Protein TFIIIA is composed of nine tandemly arranged Cys2His2 zinc fingers. It can bind either to the 5S RNA gene as a transcription factor or to the 5S RNA transcript as a chaperone. Although structural and biochemical data provided valuable information on the recognition between the TFIIIIA and the 5S DNA/RNA, the involved conformational motions and energetic factors contributing to the binding affinity and specificity remain unclear. In this work, we conducted MD simulations and MM/GBSA calculations to investigate the binding-induced conformational changes in the recognition of the 5S RNA by the central three zinc fingers of TFIIIA and the energetic factors that influence the binding affinity and specificity at an atomistic level. Our results revealed drastic interdomain conformational changes between these three zinc fingers, involving the exposure/burial of several crucial DNA/RNA binding residues, which can be related to the competition between DNA and RNA for the binding of TFIIIA. We also showed that the specific recognition between finger 4/finger 6 and the 5S RNA introduces frustrations to the nonspecific interactions between finger 5 and the 5S RNA, which may be important to achieve optimal binding affinity and specificity.

  15. The Molecular Genetics of Mycolic Acid Biosynthesis.

    PubMed

    Pawełczyk, Jakub; Kremer, Laurent

    2014-08-01

    Mycolic acids are major and specific long-chain fatty acids that represent essential components of the Mycobacterium tuberculosis cell envelope. They play a crucial role in the cell wall architecture and impermeability, hence the natural resistance of mycobacteria to most antibiotics, and represent key factors in mycobacterial virulence. Biosynthesis of mycolic acid precursors requires two types of fatty acid synthases (FASs), the eukaryotic-like multifunctional enzyme FAS I and the acyl carrier protein (ACP)-dependent FAS II systems, which consists of a series of discrete mono-functional proteins, each catalyzing one reaction in the pathway. Unlike FAS II synthases of other bacteria, the mycobacterial FAS II is incapable of de novo fatty acid synthesis from acetyl-coenzyme A, but instead elongates medium-chain-length fatty acids previously synthesized by FAS I, leading to meromycolic acids. In addition, mycolic acid subspecies with defined biological properties can be distinguished according to the chemical modifications decorating the meromycolate. Nearly all the genetic components involved in both elongation and functionalization of the meromycolic acid have been identified and are generally clustered in distinct transcriptional units. A large body of information has been generated on the enzymology of the mycolic acid biosynthetic pathway and on their genetic and biochemical/structural characterization as targets of several antitubercular drugs. This chapter is a comprehensive overview of mycolic acid structure, function, and biosynthesis. Special emphasis is given to recent work addressing the regulation of mycolic acid biosynthesis, adding new insights to our understanding of how pathogenic mycobacteria adapt their cell wall composition in response to environmental changes.

  16. The Biosynthesis of Capuramycin-type Antibiotics

    PubMed Central

    Cai, Wenlong; Goswami, Anwesha; Yang, Zhaoyong; Liu, Xiaodong; Green, Keith D.; Barnard-Britson, Sandra; Baba, Satoshi; Funabashi, Masanori; Nonaka, Koichi; Sunkara, Manjula; Morris, Andrew J.; Spork, Anatol P.; Ducho, Christian; Garneau-Tsodikova, Sylvie; Thorson, Jon S.; Van Lanen, Steven G.

    2015-01-01

    A-500359s, A-503083s, and A-102395 are capuramycin-type nucleoside antibiotics that were discovered using a screen to identify inhibitors of bacterial translocase I, an essential enzyme in peptidoglycan cell wall biosynthesis. Like the parent capuramycin, A-500359s and A-503083s consist of three structural components: a uridine-5′-carboxamide (CarU), a rare unsaturated hexuronic acid, and an aminocaprolactam, the last of which is substituted by an unusual arylamine-containing polyamide in A-102395. The biosynthetic gene clusters for A-500359s and A-503083s have been reported, and two genes encoding a putative non-heme Fe(II)-dependent α-ketoglutarate:UMP dioxygenase and an l-Thr:uridine-5′-aldehyde transaldolase were uncovered, suggesting that C–C bond formation during assembly of the high carbon (C6) sugar backbone of CarU proceeds from the precursors UMP and l-Thr to form 5′-C-glycyluridine (C7) as a biosynthetic intermediate. Here, isotopic enrichment studies with the producer of A-503083s were used to indeed establish l-Thr as the direct source of the carboxamide of CarU. With this knowledge, the A-102395 gene cluster was subsequently cloned and characterized. A genetic system in the A-102395-producing strain was developed, permitting the inactivation of several genes, including those encoding the dioxygenase (cpr19) and transaldolase (cpr25), which abolished the production of A-102395, thus confirming their role in biosynthesis. Heterologous production of recombinant Cpr19 and CapK, the transaldolase homolog involved in A-503083 biosynthesis, confirmed their expected function. Finally, a phosphotransferase (Cpr17) conferring self-resistance was functionally characterized. The results provide the opportunity to use comparative genomics along with in vivo and in vitro approaches to probe the biosynthetic mechanism of these intriguing structures. PMID:25855790

  17. Massetolide A biosynthesis in Pseudomonas fluorescens.

    PubMed

    de Bruijn, I; de Kock, M J D; de Waard, P; van Beek, T A; Raaijmakers, J M

    2008-04-01

    Massetolide A is a cyclic lipopeptide (CLP) antibiotic produced by various Pseudomonas strains from diverse environments. Cloning, sequencing, site-directed mutagenesis, and complementation showed that massetolide A biosynthesis in P. fluorescens SS101 is governed by three nonribosomal peptide synthetase (NRPS) genes, designated massA, massB, and massC, spanning approximately 30 kb. Prediction of the nature and configuration of the amino acids by in silico analysis of adenylation and condensation domains of the NRPSs was consistent with the chemically determined structure of the peptide moiety of massetolide A. Structural analysis of massetolide A derivatives produced by SS101 indicated that most of the variations in the peptide moiety occur at amino acid positions 4 and 9. Regions flanking the mass genes contained several genes found in other Pseudomonas CLP biosynthesis clusters, which encode LuxR-type transcriptional regulators, ABC transporters, and an RND-like outer membrane protein. In contrast to most Pseudomonas CLP gene clusters known to date, the mass genes are not physically linked but are organized in two separate clusters, with massA disconnected from massB and massC. Quantitative real-time PCR analysis indicated that transcription of massC is strongly reduced when massB is mutated, suggesting that these two genes function in an operon, whereas transcription of massA is independent of massBC and vice versa. Massetolide A is produced in the early exponential growth phase, and biosynthesis appears not to be regulated by N-acylhomoserine lactone-based quorum sensing. Massetolide A production is essential in swarming motility of P. fluorescens SS101 and plays an important role in biofilm formation.

  18. Computer aided gene mining for gingerol biosynthesis

    PubMed Central

    James, Priyanka; Baby, Bincy; Charles, SonaSona; Nair, Lekshmysree Saraschandran; Nazeem, Puthiyaveetil Abdulla

    2015-01-01

    Inspite of the large body of genomic data obtained from the transcriptome of Zingiber officinale, very few studies have focused on the identification and characterization of miRNAs in gingerol biosynthesis. Zingiber officinale transcriptome was analyzed using EST dataset (38169 total) deposited in public domains. In this paper computational functional annotation of the available ESTs and identification of genes which play a significant role in gingerol biosynthesis are described. Zingiber officinale transcriptome was analyzed using EST dataset (38169 total) from ncbi. ESTs were clustered and assembled, resulting in 8624 contigs and 8821 singletons. Assembled dataset was then submitted to the EST functional annotation workflow including blast, gene ontology (go) analysis, and pathway enrichment by kyoto encyclopedia of genes and genomes (kegg) and interproscan. The unigene datasets were further exploited to identify simple sequence repeats that enable linkage mapping. A total of 409 simple sequence repeats were identified from the contigs. Furthermore we examined the existence of novel miRNAs from the ESTs in rhizome, root and leaf tissues. EST analysis revealed the presence of single hypothetical miRNA in rhizome tissue. The hypothetical miRNA is warranted to play an important role in controlling genes involved in gingerol biosynthesis and hence demands experimental validation. The assembly and associated information of transcriptome data provides a comprehensive functional and evolutionary characterization of genomics of Zingiber officinale. As an effort to make the genomic and transcriptomic data widely available to the public domain, the results were integrated into a web-based Ginger EST database which is freely accessible at http://www.kaubic.in/gingerest/. PMID:26229293

  19. Massetolide A Biosynthesis in Pseudomonas fluorescens▿

    PubMed Central

    de Bruijn, I.; de Kock, M. J. D.; de Waard, P.; van Beek, T. A.; Raaijmakers, J. M.

    2008-01-01

    Massetolide A is a cyclic lipopeptide (CLP) antibiotic produced by various Pseudomonas strains from diverse environments. Cloning, sequencing, site-directed mutagenesis, and complementation showed that massetolide A biosynthesis in P. fluorescens SS101 is governed by three nonribosomal peptide synthetase (NRPS) genes, designated massA, massB, and massC, spanning approximately 30 kb. Prediction of the nature and configuration of the amino acids by in silico analysis of adenylation and condensation domains of the NRPSs was consistent with the chemically determined structure of the peptide moiety of massetolide A. Structural analysis of massetolide A derivatives produced by SS101 indicated that most of the variations in the peptide moiety occur at amino acid positions 4 and 9. Regions flanking the mass genes contained several genes found in other Pseudomonas CLP biosynthesis clusters, which encode LuxR-type transcriptional regulators, ABC transporters, and an RND-like outer membrane protein. In contrast to most Pseudomonas CLP gene clusters known to date, the mass genes are not physically linked but are organized in two separate clusters, with massA disconnected from massB and massC. Quantitative real-time PCR analysis indicated that transcription of massC is strongly reduced when massB is mutated, suggesting that these two genes function in an operon, whereas transcription of massA is independent of massBC and vice versa. Massetolide A is produced in the early exponential growth phase, and biosynthesis appears not to be regulated by N-acylhomoserine lactone-based quorum sensing. Massetolide A production is essential in swarming motility of P. fluorescens SS101 and plays an important role in biofilm formation. PMID:17993540

  20. Marine Pyridoacridine Alkaloids: Biosynthesis and Biological Activities.

    PubMed

    Ibrahim, Sabrin R M; Mohamed, Gamal A

    2016-01-01

    Pyridoacridines are a class of strictly marine-derived alkaloids that constitute one of the largest chemical families of marine alkaloids. During the last few years, both natural pyridoacridines and their analogues have constituted excellent targets for synthetic works. They have been the subject of intense study due to their significant biological activities; cytotoxic, antibacterial, antifungal, antiviral, insecticidal, anti-HIV, and anti-parasitic activities. In the present review, 95 pyridoacridine alkaloids isolated from marine organisms are discussed in term of their occurrence, biosynthesis, biological activities, and structural assignment.

  1. Biosynthesis of silver nanoparticles using Saccharomyces cerevisiae.

    PubMed

    Korbekandi, Hassan; Mohseni, Soudabeh; Mardani Jouneghani, Rasoul; Pourhossein, Meraj; Iravani, Siavash

    2016-01-01

    The objectives of this study were the biosynthesis of silver nanoparticles (NPs) by biotransformations using Saccharomyces cerevisiae and analysis of the sizes and shapes of the NPs produced. Dried and freshly cultured S. cerevisiae were used as the biocatalyst. Dried yeast synthesized few NPs, but freshly cultured yeast produced a large amount of them. Silver NPs were spherical, 2-20 nm in diameter, and the NPs with the size of 5.4 nm were the most frequent ones. NPs were seen inside the cells, within the cell membrane, attached to the cell membrane during the exocytosis, and outside of the cells.

  2. Developing New Antibiotics with Combinatorial Biosynthesis

    NASA Astrophysics Data System (ADS)

    Pohl, Nicola L.

    2000-11-01

    Polyketide synthases (PKSs), a class of enzymes found in soil bacteria that produce antibiotics such as erythromycin, string together acetate units using basic organic reactions. The manipulation of the sequence of these reactions at the genetic level has resulted in an alteration of the corresponding chemical structure of the antibiotic produced by the bacteria. This process, called combinatorial biosynthesis, allows the generation of many presently unknown complex structures that can be tested for antibacterial activity, thereby contributing to the race against antibiotic-resistant infectious bacteria.

  3. [Recent advances in lanthipeptide biosynthesis - A review].

    PubMed

    Mo, Tianlu; Xue, Lingui; Zhang, Qi

    2016-03-01

    Lanthipeptides are a growing class of ribosomally synthesized and posttranslationally modified peptide (RiPP) natural products. These compounds are widely distributed among taxonomically distant species, and their structures and biological activities are diverse, providing an important source for drug research and developement. In this review, we summarized the recent advances in the understanding of structure, classification, evolution and substrate-controlled biosynthetic mechanism of lanthipeptide, attempting to highlight the intriguing chemistry and enzymology in the biosynthesis of this growing family of natural products. PMID:27382781

  4. Structural and mechanistic studies of the orf12 gene product from the clavulanic acid biosynthesis pathway.

    PubMed

    Valegård, Karin; Iqbal, Aman; Kershaw, Nadia J; Ivison, David; Généreux, Catherine; Dubus, Alain; Blikstad, Cecilia; Demetriades, Marina; Hopkinson, Richard J; Lloyd, Adrian J; Roper, David I; Schofield, Christopher J; Andersson, Inger; McDonough, Michael A

    2013-08-01

    Structural and biochemical studies of the orf12 gene product (ORF12) from the clavulanic acid (CA) biosynthesis gene cluster are described. Sequence and crystallographic analyses reveal two domains: a C-terminal penicillin-binding protein (PBP)/β-lactamase-type fold with highest structural similarity to the class A β-lactamases fused to an N-terminal domain with a fold similar to steroid isomerases and polyketide cyclases. The C-terminal domain of ORF12 did not show β-lactamase or PBP activity for the substrates tested, but did show low-level esterase activity towards 3'-O-acetyl cephalosporins and a thioester substrate. Mutagenesis studies imply that Ser173, which is present in a conserved SXXK motif, acts as a nucleophile in catalysis, consistent with studies of related esterases, β-lactamases and D-Ala carboxypeptidases. Structures of wild-type ORF12 and of catalytic residue variants were obtained in complex with and in the absence of clavulanic acid. The role of ORF12 in clavulanic acid biosynthesis is unknown, but it may be involved in the epimerization of (3S,5S)-clavaminic acid to (3R,5R)-clavulanic acid.

  5. Transcription of the Drosophila melanogaster 5S RNA gene requires an upstream promoter and four intragenic sequence elements

    SciTech Connect

    Sharp, S.J.; Garcia, A.D.

    1988-03-01

    Linker-scanning (LS) mutations were constructed spanning the length of the Drosophila melanogaster 5S RNA gene. In vitro transcription analysis of the LS 5S DNAs revealed five transcription control regions. One control region essential for the transcription initiation was identified in the 5'-flanking sequence. The major sequence determinants of this upstream promoter region were located between coordinates -39 and -26 (-30 region), but important sequences extended to the transcription start site at position 1. Since mutations in the upstream promoter did not alter the ability of 5S DNA to sequester transcription factors into a stable transcription complex, it appears that this control region involved the interaction of RNA polymerase III. Active 5S DNA transcription additionally required the four intragenic control regions (ICRs) located between coordinates 3 and 18 (ICR I), 37 and 44 (ICR II), 48 and 61 (ICR III), and 78 and 98 (ICR IV). LS mutations in each ICR decreased the ability of 5S DNA to sequester transcription factors. ICR III, ICR IV, and the spacer sequence between were similar in sequence and position to the determinant elements of the multipartite ICR of Xenopus 5S DNA. The importance of ICR III and ICR IV in transcription initiation and in sequestering transcription factors suggests the presence of an activity in D. melanogaster similar to transcription factor TFIIIA of Xenopus laevis and HeLa cells. Transcription initiation of Drosophila 5S DNA was not eliminated by LS mutations in the spacer region even though these mutations reduced the ability of the TFIIIA-like activity to bind.

  6. Partial sequence homogenization in the 5S multigene families may generate sequence chimeras and spurious results in phylogenetic reconstructions.

    PubMed

    Galián, José A; Rosato, Marcela; Rosselló, Josep A

    2014-03-01

    Multigene families have provided opportunities for evolutionary biologists to assess molecular evolution processes and phylogenetic reconstructions at deep and shallow systematic levels. However, the use of these markers is not free of technical and analytical challenges. Many evolutionary studies that used the nuclear 5S rDNA gene family rarely used contiguous 5S coding sequences due to the routine use of head-to-tail polymerase chain reaction primers that are anchored to the coding region. Moreover, the 5S coding sequences have been concatenated with independent, adjacent gene units in many studies, creating simulated chimeric genes as the raw data for evolutionary analysis. This practice is based on the tacitly assumed, but rarely tested, hypothesis that strict intra-locus concerted evolution processes are operating in 5S rDNA genes, without any empirical evidence as to whether it holds for the recovered data. The potential pitfalls of analysing the patterns of molecular evolution and reconstructing phylogenies based on these chimeric genes have not been assessed to date. Here, we compared the sequence integrity and phylogenetic behavior of entire versus concatenated 5S coding regions from a real data set obtained from closely related plant species (Medicago, Fabaceae). Our results suggest that within arrays sequence homogenization is partially operating in the 5S coding region, which is traditionally assumed to be highly conserved. Consequently, concatenating 5S genes increases haplotype diversity, generating novel chimeric genotypes that most likely do not exist within the genome. In addition, the patterns of gene evolution are distorted, leading to incorrect haplotype relationships in some evolutionary reconstructions.

  7. Contrasting patterns of the 5S and 45S rDNA evolutions in the Byblis liniflora complex (Byblidaceae).

    PubMed

    Fukushima, Kenji; Imamura, Kaori; Nagano, Katsuya; Hoshi, Yoshikazu

    2011-03-01

    To clarify the evolutionary dynamics of ribosomal RNA genes (rDNAs) in the Byblis liniflora complex (Byblidaceae), we investigated the 5S and 45S rDNA genes through (1) chromosomal physical mapping by fluorescence in situ hybridization (FISH) and (2) phylogenetic analyses using the nontranscribed spacer of 5S rDNA (5S-NTS) and the internal transcribed spacer of 45S rDNA (ITS). In addition, we performed phylogenetic analyses based on rbcL and trnK intron. The complex was divided into 2 clades: B. aquatica-B. filifolia and B. guehoi-B. liniflora-B. rorida. Although members of the complex had conservative symmetric karyotypes, they were clearly differentiated on chromosomal rDNA distribution patterns. The sequence data indicated that ITS was almost homogeneous in all taxa in which two or four 45S rDNA arrays were frequently found at distal regions of chromosomes in the somatic karyotype. ITS homogenization could have been prompted by relatively distal 45S rDNA positions. In contrast, 2-12 5S rDNA arrays were mapped onto proximal/interstitial regions of chromosomes, and some paralogous 5S-NTS were found in the genomes harboring 4 or more arrays. 5S-NTS sequence type-specific FISH analysis showed sequence heterogeneity within and between some 5S rDNA arrays. Interlocus homogenization may have been hampered by their proximal location on chromosomes. Chromosomal location may have affected the contrasting evolutionary dynamics of rDNAs in the B. liniflora complex.

  8. Seasonal dynamics of bacterioplankton community structure in a eutrophic lake as determined by 5S rRNA analysis.

    PubMed

    Höfle, M G; Haas, H; Dominik, K

    1999-07-01

    Community structure of bacterioplankton was studied during the major growth season for phytoplankton (April to October) in the epilimnion of a temperate eutrophic lake (Lake Plusssee, northern Germany) by using comparative 5S rRNA analysis. Estimates of the relative abundances of single taxonomic groups were made on the basis of the amounts of single 5S rRNA bands obtained after high-resolution electrophoresis of RNA directly from the bacterioplankton. Full-sequence analysis of single environmental 5S rRNAs enabled the identification of single taxonomic groups of bacteria. Comparison of partial 5S rRNA sequences allowed the detection of changes of single taxa over time. Overall, the whole bacterioplankton community showed two to eight abundant (>4% of the total 5S rRNA) taxa. A distinctive seasonal succession was observed in the taxonomic structure of this pelagic community. A rather-stable community structure, with seven to eight different taxonomic units, was observed beginning in April during the spring phytoplankton bloom. A strong reduction in this diversity occurred at the beginning of the clear-water phase (early May), when only two to four abundant taxa were observed, with one taxon dominating (up to 72% of the total 5S rRNA). The community structure during summer stagnation (June and July) was characterized by frequent changes of different dominating taxa. During late summer, a dinoflagellate bloom (Ceratium hirudinella) occurred, with Comamonas acidovorans (beta-subclass of the class Proteobacteria) becoming the dominant bacterial species (average abundance of 43% of the total 5S rRNA). Finally, the seasonal dynamics of the community structure of bacterioplankton were compared with the abundances of other major groups of the aquatic food web, such as phyto- and zooplankton, revealing that strong grazing pressure by zooplankton can reduce microbial diversity substantially in pelagic environments.

  9. Essences in Metabolic Engineering of Lignan Biosynthesis

    PubMed Central

    Satake, Honoo; Koyama, Tomotsugu; Bahabadi, Sedigheh Esmaeilzadeh; Matsumoto, Erika; Ono, Eiichiro; Murata, Jun

    2015-01-01

    Lignans are structurally and functionally diverse phytochemicals biosynthesized in diverse plant species and have received wide attentions as leading compounds of novel drugs for tumor treatment and healthy diets to reduce of the risks of lifestyle-related non-communicable diseases. However, the lineage-specific distribution and the low-amount of production in natural plants, some of which are endangered species, hinder the efficient and stable production of beneficial lignans. Accordingly, the development of new procedures for lignan production is of keen interest. Recent marked advances in the molecular and functional characterization of lignan biosynthetic enzymes and endogenous and exogenous factors for lignan biosynthesis have suggested new methods for the metabolic engineering of lignan biosynthesis cascades leading to the efficient, sustainable, and stable lignan production in plants, including plant cell/organ cultures. Optimization of light conditions, utilization of a wide range of elicitor treatments, and construction of transiently gene-transfected or transgenic lignan-biosynthesizing plants are mainly being attempted. This review will present the basic and latest knowledge regarding metabolic engineering of lignans based on their biosynthetic pathways and biological activities, and the perspectives in lignan production via metabolic engineering. PMID:25946459

  10. Brassinosteroid biosynthesis and signalling in Petunia hybrida

    PubMed Central

    Verhoef, Nathalie; Yokota, Takao; Shibata, Kyomi; de Boer, Gert-Jan; Gerats, Tom; Vandenbussche, Michiel; Koes, Ronald; Souer, Erik

    2013-01-01

    Brassinosteroids (BRs) are steroidal plant hormones that play an important role in the growth and development of plants. The biosynthesis of sterols and BRs as well as the signalling cascade they induce in plants have been elucidated largely through metabolic studies and the analysis of mutants in Arabidopsis and rice. Only fragmentary details about BR signalling in other plant species are known. Here a forward genetics strategy was used in Petunia hybrida, by which 19 families with phenotypic alterations typical for BR deficiency mutants were identified. In all mutants, the endogenous BR levels were severely reduced. In seven families, the tagged genes were revealed as the petunia BR biosynthesis genes CYP90A1 and CYP85A1 and the BR receptor gene BRI1. In addition, several homologues of key regulators of the BR signalling pathway were cloned from petunia based on homology with their Arabidopsis counterparts, including the BRI1 receptor, a member of the BES1/BZR1 transcription factor family (PhBEH2), and two GSK3-like kinases (PSK8 and PSK9). PhBEH2 was shown to interact with PSK8 and 14-3-3 proteins in yeast, revealing similar interactions to those during BR signalling in Arabidopsis. Interestingly, PhBEH2 also interacted with proteins implicated in other signalling pathways. This suggests that PhBEH2 might function as an important hub in the cross-talk between diverse signalling pathways. PMID:23599276

  11. Molecular genetics of carbapenem antibiotic biosynthesis.

    PubMed

    McGowan, S J; Holden, M T; Bycroft, B W; Salmond, G P

    1999-01-01

    Carbapenems are potent beta-lactam antibiotics with a broad spectrum of activity against both Gram positive and Gram negative bacteria. As naturally produced metabolites, they have been isolated from species of Streptomyces, Erwinia and Serratia. The latter two members of the Enterobacteriaceae have proved to be genetically amenable and a growing body of research on these organisms now exists concerning the genes responsible for carbapenem biosynthesis and the regulatory mechanisms controlling their expression. A cluster of nine carbapenem (car) genes has been identified on the chromosome of Erwinia carotovora. These genes encode the enzymes required for construction of carbapenem and the proteins responsible for a novel beta-lactam resistance mechanism, conferring carbapenem immunity in the producing host. Although sharing no homology with the well known enzymes of penicillin biosynthesis, two of the encoded proteins are apparently similar to enzymes of the clavulanic acid biosynthetic pathway implying a common mechanism for construction of the beta-lactam ring. In addition, a transcriptional activator is encoded as the first gene of the carbapenem cluster and this allows positive expression of the remaining downstream genes in response to a quorum sensing, N-acyl homoserine lactone, signalling molecule.

  12. Plant Sterols: Diversity, Biosynthesis, and Physiological Functions.

    PubMed

    Valitova, J N; Sulkarnayeva, A G; Minibayeva, F V

    2016-08-01

    Sterols, which are isoprenoid derivatives, are structural components of biological membranes. Special attention is now being given not only to their structure and function, but also to their regulatory roles in plants. Plant sterols have diverse composition; they exist as free sterols, sterol esters with higher fatty acids, sterol glycosides, and acylsterol glycosides, which are absent in animal cells. This diversity of types of phytosterols determines a wide spectrum of functions they play in plant life. Sterols are precursors of a group of plant hormones, the brassinosteroids, which regulate plant growth and development. Furthermore, sterols participate in transmembrane signal transduction by forming lipid microdomains. The predominant sterols in plants are β-sitosterol, campesterol, and stigmasterol. These sterols differ in the presence of a methyl or an ethyl group in the side chain at the 24th carbon atom and are named methylsterols or ethylsterols, respectively. The balance between 24-methylsterols and 24-ethylsterols is specific for individual plant species. The present review focuses on the key stages of plant sterol biosynthesis that determine the ratios between the different types of sterols, and the crosstalk between the sterol and sphingolipid pathways. The main enzymes involved in plant sterol biosynthesis are 3-hydroxy-3-methylglutaryl-CoA reductase, C24-sterol methyltransferase, and C22-sterol desaturase. These enzymes are responsible for maintaining the optimal balance between sterols. Regulation of the ratios between the different types of sterols and sterols/sphingolipids can be of crucial importance in the responses of plants to stresses.

  13. Fatty acid biosynthesis in pea root plastids

    SciTech Connect

    Stahl, R.J.; Sparace, S.A. )

    1989-04-01

    Fatty acid biosynthesis from (1-{sup 14}C)acetate was optimized in plastids isolated from primary root tips of 7-day-old germinating pea seeds. Fatty acid synthesis was maximum at approximately 80 nmoles/hr/mg protein in the presence of 200 {mu}M acetate, 0.5 mM each of NADH, NADPH and CoA, 6 mM each of ATP and MgCl{sub 2}, 1 mM each of the MnCl{sub 2} and glycerol-3-phosphate, 15 mM KHCO{sub 3}, and 0.1M Bis-tris-propane, pH 8.0 incubated at 35C. At the standard incubation temperature of 25C, fatty acid synthesis was linear from up to 6 hours with 80 to 100 {mu}g/mL plastid protein. ATP and CoA were absolute requirements, whereas KHCO{sub 3}, divalent cations and reduced nucleotides all improved activity by 80 to 85%. Mg{sup 2+} and NADH were the preferred cation and nucleotide, respectively. Dithiothreitol and detergents were generally inhibitory. The radioactive products of fatty acid biosynthesis were approximately 33% 16:0, 10% 18:0 and 56% 18:1 and generally did not vary with increasing concentrations of each cofactor.

  14. Benzylisoquinoline alkaloid biosynthesis in opium poppy.

    PubMed

    Beaudoin, Guillaume A W; Facchini, Peter J

    2014-07-01

    Opium poppy (Papaver somniferum) is one of the world's oldest medicinal plants and remains the only commercial source for the narcotic analgesics morphine, codeine and semi-synthetic derivatives such as oxycodone and naltrexone. The plant also produces several other benzylisoquinoline alkaloids with potent pharmacological properties including the vasodilator papaverine, the cough suppressant and potential anticancer drug noscapine and the antimicrobial agent sanguinarine. Opium poppy has served as a model system to investigate the biosynthesis of benzylisoquinoline alkaloids in plants. The application of biochemical and functional genomics has resulted in a recent surge in the discovery of biosynthetic genes involved in the formation of major benzylisoquinoline alkaloids in opium poppy. The availability of extensive biochemical genetic tools and information pertaining to benzylisoquinoline alkaloid metabolism is facilitating the study of a wide range of phenomena including the structural biology of novel catalysts, the genomic organization of biosynthetic genes, the cellular and sub-cellular localization of biosynthetic enzymes and a variety of biotechnological applications. In this review, we highlight recent developments and summarize the frontiers of knowledge regarding the biochemistry, cellular biology and biotechnology of benzylisoquinoline alkaloid biosynthesis in opium poppy.

  15. Molecular Regulation of Antibiotic Biosynthesis in Streptomyces

    PubMed Central

    Liu, Gang; Chandra, Govind; Niu, Guoqing

    2013-01-01

    SUMMARY Streptomycetes are the most abundant source of antibiotics. Typically, each species produces several antibiotics, with the profile being species specific. Streptomyces coelicolor, the model species, produces at least five different antibiotics. We review the regulation of antibiotic biosynthesis in S. coelicolor and other, nonmodel streptomycetes in the light of recent studies. The biosynthesis of each antibiotic is specified by a large gene cluster, usually including regulatory genes (cluster-situated regulators [CSRs]). These are the main point of connection with a plethora of generally conserved regulatory systems that monitor the organism's physiology, developmental state, population density, and environment to determine the onset and level of production of each antibiotic. Some CSRs may also be sensitive to the levels of different kinds of ligands, including products of the pathway itself, products of other antibiotic pathways in the same organism, and specialized regulatory small molecules such as gamma-butyrolactones. These interactions can result in self-reinforcing feed-forward circuitry and complex cross talk between pathways. The physiological signals and regulatory mechanisms may be of practical importance for the activation of the many cryptic secondary metabolic gene cluster pathways revealed by recent sequencing of numerous Streptomyces genomes. PMID:23471619

  16. Benzylisoquinoline alkaloid biosynthesis in opium poppy.

    PubMed

    Beaudoin, Guillaume A W; Facchini, Peter J

    2014-07-01

    Opium poppy (Papaver somniferum) is one of the world's oldest medicinal plants and remains the only commercial source for the narcotic analgesics morphine, codeine and semi-synthetic derivatives such as oxycodone and naltrexone. The plant also produces several other benzylisoquinoline alkaloids with potent pharmacological properties including the vasodilator papaverine, the cough suppressant and potential anticancer drug noscapine and the antimicrobial agent sanguinarine. Opium poppy has served as a model system to investigate the biosynthesis of benzylisoquinoline alkaloids in plants. The application of biochemical and functional genomics has resulted in a recent surge in the discovery of biosynthetic genes involved in the formation of major benzylisoquinoline alkaloids in opium poppy. The availability of extensive biochemical genetic tools and information pertaining to benzylisoquinoline alkaloid metabolism is facilitating the study of a wide range of phenomena including the structural biology of novel catalysts, the genomic organization of biosynthetic genes, the cellular and sub-cellular localization of biosynthetic enzymes and a variety of biotechnological applications. In this review, we highlight recent developments and summarize the frontiers of knowledge regarding the biochemistry, cellular biology and biotechnology of benzylisoquinoline alkaloid biosynthesis in opium poppy. PMID:24671624

  17. Biosynthesis of archaeal membrane ether lipids

    PubMed Central

    Jain, Samta; Caforio, Antonella; Driessen, Arnold J. M.

    2014-01-01

    A vital function of the cell membrane in all living organism is to maintain the membrane permeability barrier and fluidity. The composition of the phospholipid bilayer is distinct in archaea when compared to bacteria and eukarya. In archaea, isoprenoid hydrocarbon side chains are linked via an ether bond to the sn-glycerol-1-phosphate backbone. In bacteria and eukarya on the other hand, fatty acid side chains are linked via an ester bond to the sn-glycerol-3-phosphate backbone. The polar head groups are globally shared in the three domains of life. The unique membrane lipids of archaea have been implicated not only in the survival and adaptation of the organisms to extreme environments but also to form the basis of the membrane composition of the last universal common ancestor (LUCA). In nature, a diverse range of archaeal lipids is found, the most common are the diether (or archaeol) and the tetraether (or caldarchaeol) lipids that form a monolayer. Variations in chain length, cyclization and other modifications lead to diversification of these lipids. The biosynthesis of these lipids is not yet well understood however progress in the last decade has led to a comprehensive understanding of the biosynthesis of archaeol. This review describes the current knowledge of the biosynthetic pathway of archaeal ether lipids; insights on the stability and robustness of archaeal lipid membranes; and evolutionary aspects of the lipid divide and the LUCA. It examines recent advances made in the field of pathway reconstruction in bacteria. PMID:25505460

  18. Plant Sterols: Diversity, Biosynthesis, and Physiological Functions.

    PubMed

    Valitova, J N; Sulkarnayeva, A G; Minibayeva, F V

    2016-08-01

    Sterols, which are isoprenoid derivatives, are structural components of biological membranes. Special attention is now being given not only to their structure and function, but also to their regulatory roles in plants. Plant sterols have diverse composition; they exist as free sterols, sterol esters with higher fatty acids, sterol glycosides, and acylsterol glycosides, which are absent in animal cells. This diversity of types of phytosterols determines a wide spectrum of functions they play in plant life. Sterols are precursors of a group of plant hormones, the brassinosteroids, which regulate plant growth and development. Furthermore, sterols participate in transmembrane signal transduction by forming lipid microdomains. The predominant sterols in plants are β-sitosterol, campesterol, and stigmasterol. These sterols differ in the presence of a methyl or an ethyl group in the side chain at the 24th carbon atom and are named methylsterols or ethylsterols, respectively. The balance between 24-methylsterols and 24-ethylsterols is specific for individual plant species. The present review focuses on the key stages of plant sterol biosynthesis that determine the ratios between the different types of sterols, and the crosstalk between the sterol and sphingolipid pathways. The main enzymes involved in plant sterol biosynthesis are 3-hydroxy-3-methylglutaryl-CoA reductase, C24-sterol methyltransferase, and C22-sterol desaturase. These enzymes are responsible for maintaining the optimal balance between sterols. Regulation of the ratios between the different types of sterols and sterols/sphingolipids can be of crucial importance in the responses of plants to stresses. PMID:27677551

  19. Anticoagulant Heparan Sulfate: Structural Specificity and Biosynthesis

    PubMed Central

    Liu, Jian; Pedersen, Lars C.

    2007-01-01

    Summary Heparan sulfate (HS) is present on the surface of endothelial and surrounding tissues in large quantities. It plays important roles in regulating numerous functions of the blood vessel wall, including blood coagulation, inflammation response and cell differentiation. HS is a highly sulfated polysaccharide containing glucosamine and glucuronic/iduronic acid repeating disaccharide units. The unique sulfated saccharide sequences of HS determine its specific functions. Heparin, an analogue of heparan sulfate, is the most commonly used anticoagulant drug. Because of its wide range of biological functions, HS has become an interesting molecule to biochemists, medicinal chemists and developmental biologists. Here, we summarize recent progress towards understanding the interaction between heparan sulfate and blood coagulating factors, the biosynthesis of anticoagulant heparan sulfate and the mechanism of action of heparan sulfate biosynthetic enzymes. Further, knowledge of the biosynthesis of HS facilitates the development of novel enzymatic approaches to synthesize HS from bacterial capsular polysaccharides and to produce polysaccharide end products with high specificity for the biological target. These advancements provide the foundation for the development of polysaccharide-based therapeutic agents. PMID:17131147

  20. Ant Trail Pheromone Biosynthesis Is Triggered by a Neuropeptide Hormone

    PubMed Central

    Choi, Man-Yeon; Vander Meer, Robert K.

    2012-01-01

    Our understanding of insect chemical communication including pheromone identification, synthesis, and their role in behavior has advanced tremendously over the last half-century. However, endocrine regulation of pheromone biosynthesis has progressed slowly due to the complexity of direct and/or indirect hormonal activation of the biosynthetic cascades resulting in insect pheromones. Over 20 years ago, a neurohormone, pheromone biosynthesis activating neuropeptide (PBAN) was identified that stimulated sex pheromone biosynthesis in a lepidopteran moth. Since then, the physiological role, target site, and signal transduction of PBAN has become well understood for sex pheromone biosynthesis in moths. Despite that PBAN-like peptides (∼200) have been identified from various insect Orders, their role in pheromone regulation had not expanded to the other insect groups except for Lepidoptera. Here, we report that trail pheromone biosynthesis in the Dufour's gland (DG) of the fire ant, Solenopsis invicta, is regulated by PBAN. RNAi knock down of PBAN gene (in subesophageal ganglia) or PBAN receptor gene (in DG) expression inhibited trail pheromone biosynthesis. Reduced trail pheromone was documented analytically and through a behavioral bioassay. Extension of PBAN's role in pheromone biosynthesis to a new target insect, mode of action, and behavioral function will renew research efforts on the involvement of PBAN in pheromone biosynthesis in Insecta. PMID:23226278

  1. High-Throughput Screening for Streptomyces Antibiotic Biosynthesis Activators

    PubMed Central

    Chen, Li; Wang, Yemin; Guo, Hang; Xu, Min; Deng, Zixin

    2012-01-01

    A genomic cosmid library of Streptomyces clavuligerus was constructed and transferred efficiently by conjugation to Streptomyces lividans, and 12 distinct groups of overlapping cosmid clones that activated the silent actinorhodin biosynthesis gene cluster were identified. This generally applicable high-throughput screening procedure greatly facilitates the identification of antibiotic biosynthesis activators. PMID:22504805

  2. Ant trail pheromone biosynthesis is triggered by a neuropeptide hormone.

    PubMed

    Choi, Man-Yeon; Vander Meer, Robert K

    2012-01-01

    Our understanding of insect chemical communication including pheromone identification, synthesis, and their role in behavior has advanced tremendously over the last half-century. However, endocrine regulation of pheromone biosynthesis has progressed slowly due to the complexity of direct and/or indirect hormonal activation of the biosynthetic cascades resulting in insect pheromones. Over 20 years ago, a neurohormone, pheromone biosynthesis activating neuropeptide (PBAN) was identified that stimulated sex pheromone biosynthesis in a lepidopteran moth. Since then, the physiological role, target site, and signal transduction of PBAN has become well understood for sex pheromone biosynthesis in moths. Despite that PBAN-like peptides (∼200) have been identified from various insect Orders, their role in pheromone regulation had not expanded to the other insect groups except for Lepidoptera. Here, we report that trail pheromone biosynthesis in the Dufour's gland (DG) of the fire ant, Solenopsis invicta, is regulated by PBAN. RNAi knock down of PBAN gene (in subesophageal ganglia) or PBAN receptor gene (in DG) expression inhibited trail pheromone biosynthesis. Reduced trail pheromone was documented analytically and through a behavioral bioassay. Extension of PBAN's role in pheromone biosynthesis to a new target insect, mode of action, and behavioral function will renew research efforts on the involvement of PBAN in pheromone biosynthesis in Insecta. PMID:23226278

  3. Scalar resonance contributions to the dipion transition rates of {upsilon}(4S,5S) in the rescattering model

    SciTech Connect

    Meng Ce; Chao, K.-T.

    2008-04-01

    In order to explain the observed unusually large dipion transition rates of {upsilon}(10870), the scalar resonance contributions in the rescattering model to the dipion transitions of {upsilon}(4S) and {upsilon}(5S) are studied. Since the imaginary part of the rescattering amplitude is expected to be dominant, the large ratios of the transition rates of {upsilon}(10870), which is identified with {upsilon}(5S), to that of {upsilon}(4S) can be understood as mainly coming from the difference between the p values in their decays into open bottom channels, and the ratios are estimated numerically to be about 200-600 with reasonable choices of parameters. The absolute and relative rates of {upsilon}(5S){yields}{upsilon}(1S,2S,3S){pi}{sup +}{pi}{sup -} and {upsilon}(5S){yields}{upsilon}(1S)K{sup +}K{sup -} are roughly consistent with data. We emphasize that the dipion transitions observed for some of the newly discovered Y states associated with charmonia may have similar features to the dipion transitions of {upsilon}(5S). Measurements on the dipion transitions of {upsilon}(6S) could provide further tests for this mechanism.

  4. Binding site for Xenopus ribosomal protein L5 and accompanying structural changes in 5S rRNA.

    PubMed

    Scripture, J Benjamin; Huber, Paul W

    2011-05-10

    The structure of the eukaryotic L5-5S rRNA complex was investigated in protection and interference experiments and is compared with the corresponding structure (L18-5S rRNA) in the Haloarcula marismortui 50S subunit. In close correspondence with the archaeal structure, the contact sites for the eukaryotic ribosomal protein are located primarily in helix III and loop C and secondarily in loop A and helix V. While the former is unique to L5, the latter is also a critical contact site for transcription factor IIIA (TFIIIA), accounting for the mutually exclusive binding of these two proteins to 5S RNA. The binding of L5 causes structural changes in loops B and C that expose nucleotides that contact the Xenopus L11 ortholog in H. marismortui. This induced change in the structure of the RNA reveals the origins of the cooperative binding to 5S rRNA that has been observed for the bacterial counterparts of these proteins. The native structure of helix IV and loop D antagonizes binding of L5, indicating that this region of the RNA is dynamic and also influenced by the protein. Examination of the crystal structures of Thermus thermophilus ribosomes in the pre- and post-translocation states identified changes in loop D and in the surrounding region of 23S rRNA that support the proposal that 5S rRNA acts to transmit information between different functional domains of the large subunit.

  5. Genetic characterization of the Neurospora crassa molybdenum cofactor biosynthesis.

    PubMed

    Probst, Corinna; Ringel, Phillip; Boysen, Verena; Wirsing, Lisette; Alexander, Mariko Matsuda; Mendel, Ralf R; Kruse, Tobias

    2014-05-01

    Molybdenum (Mo) is a trace element that is essential for important cellular processes. To gain biological activity, Mo must be complexed in the molybdenum cofactor (Moco), a pterin derivative of low molecular weight. Moco synthesis is a multi-step pathway that involves a variable number of genes in eukaryotes, which are assigned to four steps of eukaryotic Moco biosynthesis. Moco biosynthesis mutants lack any Moco-dependent enzymatic activities, including assimilation of nitrate (plants and fungi), detoxification of sulfite (humans and plants) and utilization of hypoxanthine as sole N-source (fungi). We report the first comprehensive genetic characterization of the Neurospora crassa (N. crassa) Moco biosynthesis pathway, annotating five genes which encode all pathway enzymes, and compare it with the characterized Aspergillus nidulans pathway. Biochemical characterization of the corresponding knock-out mutants confirms our annotation model, documenting the N. crassa/A. nidulans (fungal) Moco biosynthesis as unique, combining the organizational structure of both plant and human Moco biosynthesis genes.

  6. First Step of Glycosylphosphatidylinositol (GPI) Biosynthesis Cross-talks with Ergosterol Biosynthesis and Ras Signaling in Candida albicans*

    PubMed Central

    Yadav, Bhawna; Bhatnagar, Shilpi; Ahmad, Mohammad Faiz; Jain, Priyanka; Pratyusha, Vavilala A.; Kumar, Pravin; Komath, Sneha Sudha

    2014-01-01

    Candida albicans is a leading cause of fungal infections worldwide. It has several glycosylphosphatidylinositol (GPI)-anchored virulence factors. Inhibiting GPI biosynthesis attenuates its virulence. Building on our previous work, we explore the interaction of GPI biosynthesis in C. albicans with ergosterol biosynthesis and hyphal morphogenesis. This study is also the first report of transcriptional co-regulation existing between two subunits of the multisubunit enzyme complex, GPI-N-acetylglucosaminyltransferase (GPI-GnT), involved in the first step of GPI anchor biosynthesis in eukaryotes. Using mutational analysis, we show that the accessory subunits, GPI2 and GPI19, of GPI-GnT exhibit opposite effects on ergosterol biosynthesis and Ras signaling (which determines hyphal morphogenesis). This is because the two subunits negatively regulate one another; GPI19 mutants show up-regulation of GPI2, whereas GPI2 mutants show up-regulation of GPI19. Two different models were examined as follows. First, the two GPI-GnT subunits independently interact with ergosterol biosynthesis and Ras signaling. Second, the two subunits mutually regulate one another and thereby regulate sterol levels and Ras signaling. Analysis of double mutants of these subunits indicates that GPI19 controls ergosterol biosynthesis through ERG11 levels, whereas GPI2 determines the filamentation by cross-talk with Ras1 signaling. Taken together, this suggests that the first step of GPI biosynthesis talks to and regulates two very important pathways in C. albicans. This could have implications for designing new antifungal strategies. PMID:24356967

  7. Application of PRECEDE-PROCEED model to tackle problems identified with diarrhoea burden among under-5s in Botswana.

    PubMed

    Popoola, Tosin; Mchunu, Gugu

    2015-05-01

    Diarrhoea has been identified as the second leading cause of mortality among under-5s and also claims more life than HIV, measles and malaria combined together in the same category of population. This article is a combination of literature review and personal experience of lessons learnt from past diarrhoea outbreaks in Botswana that caused significant rate of mortality among under-5s. The paper used literature review to identify contributory factors to diarrhoea burden among under-5s in Botswana and applied a community health nursing framework (PRECEDE-PROCEED) to tackle the problems identified. The study revealed that Botswana mothers are lacking in knowledge related to exclusive breastfeeding, prevention and treatment of diarrhoea disease. The paper recommends that health-care workers in Botswana be sensitized on current diarrhoea management to tailor their health education methods appropriately. PMID:26125574

  8. Triphosphate residues at the 5' ends of rRNA precursor and 5S RNA from Dictyostelium discoideum.

    PubMed Central

    Batts-Young, B; Lodish, H F

    1978-01-01

    We present here direct evidence for the preservation of a transcriptional initiation sequence in a eukaryotic rRNA precursor: the 5'-end group for precursor to 17S rRNA (p17S RNA) from Dictyostelium discoideum is identified as the triphosphate residue pppA-. We also show that mature 5S RNA form Dictyostelium bears a different triphosphate residue, pppG-. In contrast, we find no evidence for more than one phosphate at the 5' end of the 25S rRNA precursor (p25S RNA). These observations indicate that synthesis of the large ribosomal RNAs of Dictyostelium begins with the 5'-terminal sequence of the p17S RNA, and that 5S RNA transcription must be initiated independently, despite the close association of the 5S and rRNA coding segments. Images PMID:204930

  9. Xe 5s,5p correlation satellites in the region of strong interchannel interactions, 28--75 eV

    SciTech Connect

    Fahlman, A.; Krause, M.O.; Carlson, T.A.; Svensson, A.

    1984-08-01

    The Xe 5s,5p photoelectron satellite spectrum has been studied in the photon-energy range from 28 to 75 eV with the aid of synchrotron radiation. This range includes the Xe 5s Cooper minimum, and the cross sections and angular distribution data demonstrate the importance of the strong two-electron channels in the region where the 5s cross section is small. Although the behavior of the satellites was not recorded over the 4d maximum, the data near 75 eV show an enhancement in the cross section in that region. The data underline the need of including the two-electron channels explicitly in the theory over a wide photon-energy range.

  10. Characterization of a novel association between two trypanosome-specific proteins and 5S rRNA.

    PubMed

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC.

  11. Application of PRECEDE-PROCEED model to tackle problems identified with diarrhoea burden among under-5s in Botswana.

    PubMed

    Popoola, Tosin; Mchunu, Gugu

    2015-05-01

    Diarrhoea has been identified as the second leading cause of mortality among under-5s and also claims more life than HIV, measles and malaria combined together in the same category of population. This article is a combination of literature review and personal experience of lessons learnt from past diarrhoea outbreaks in Botswana that caused significant rate of mortality among under-5s. The paper used literature review to identify contributory factors to diarrhoea burden among under-5s in Botswana and applied a community health nursing framework (PRECEDE-PROCEED) to tackle the problems identified. The study revealed that Botswana mothers are lacking in knowledge related to exclusive breastfeeding, prevention and treatment of diarrhoea disease. The paper recommends that health-care workers in Botswana be sensitized on current diarrhoea management to tailor their health education methods appropriately.

  12. Dissociative excitation of the N(+)(5S) state by electron impact on N2 - Excitation function and quenching

    NASA Technical Reports Server (NTRS)

    Erdman, P. W.; Zipf, E. C.

    1986-01-01

    Metastable N(+)(5S) ions were produced in the laboratory by dissociative excitation of N2 with energetic electrons. The resulting radiative decay of the N(+)(5S) state was observed with sufficient resolution to completely resolve the doublet from the nearby N2 molecular radiation. The excitation function was measured from threshold to 500 eV. The cross section peaks at a high electron energy and also exhibits a high threshold energy both of which are typical of dissociative excitation-ionization processes. This finding complicates the explanation of electron impact on N2 as the mechanism for the source of the 2145 A 'auroral mystery feature' by further increasing the required peak cross section. It is suggested that the apparent N(+)(5S) quenching in auroras may be an artifact due to the softening of the electron energy spectrum in the auroral E region.

  13. Functional variants of 5S rRNA in the ribosomes of common sea urchin Paracentrotus lividus.

    PubMed

    Dimarco, Eufrosina; Cascone, Eleonora; Bellavia, Daniele; Caradonna, Fabio

    2012-10-15

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus; this study, performed at DNA level only, lends itself as starting point to verify that these clusters could contain transcribed genes, then, to demonstrate the presence of heterogeneity at functional RNA level, also. In the present work we report in P. lividus ribosomes the existence of several transcribed variants of the 5S rRNA and we associate all transcribed variants to the cluster to which belong. Our finding is the first demonstration of the presence of high heterogeneity in functional 5S rRNA molecules in animal ribosomes, a feature that had been considered a peculiarity of some plants. PMID:22967708

  14. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    PubMed

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location. PMID:27334092

  15. D5S2500 is an ambiguously characterized STR: Identification and description of forensic microsatellites in the genomics age.

    PubMed

    Phillips, C; Parson, W; Amigo, J; King, J L; Coble, M D; Steffen, C R; Vallone, P M; Gettings, K B; Butler, J M; Budowle, B

    2016-07-01

    In the process of establishing short tandem repeat (STR) sequence variant nomenclature guidelines in anticipation of expanded forensic multiplexes for massively parallel sequencing (MPS), it was discovered that the STR D5S2500 has multiple positions and genomic characteristics reported. This ambiguity is because the marker named D5S2500 consists of two different microsatellites forming separate components in the capillary electrophoresis multiplexes of Qiagen's HDplex (Hilden, Germany) and AGCU ScienTech's non-CODIS STR 21plex (Wuxi, Jiangsu, China). This study outlines the genomic details used to identify each microsatellite and reveals the D5S2500 marker in HDplex has the correctly assigned STR name, while the D5S2500 marker in the AGCU 21plex, closely positioned a further 1643 nucleotides in the human reference sequence, is an unnamed microsatellite. The fact that the D5S2500 marker has existed as two distinct STR loci undetected for almost ten years, even with reported discordant genotypes for the standard control DNA, underlines the need for careful scrutiny of the genomic properties of forensic STRs, as they become adapted for sequence analysis with MPS systems. We make the recommendation that precise chromosome location data must be reported for any forensic marker under development but not in common use, so that the genomic characteristics of the locus are validated to the same level of accuracy as its allelic variation and forensic performance. To clearly differentiate each microsatellite, we propose the name D5S2800 be used to identify the Chromosome-5 STR in the AGCU 21plex.

  16. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    PubMed

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location.

  17. D5S2500 is an ambiguously characterized STR: Identification and description of forensic microsatellites in the genomics age.

    PubMed

    Phillips, C; Parson, W; Amigo, J; King, J L; Coble, M D; Steffen, C R; Vallone, P M; Gettings, K B; Butler, J M; Budowle, B

    2016-07-01

    In the process of establishing short tandem repeat (STR) sequence variant nomenclature guidelines in anticipation of expanded forensic multiplexes for massively parallel sequencing (MPS), it was discovered that the STR D5S2500 has multiple positions and genomic characteristics reported. This ambiguity is because the marker named D5S2500 consists of two different microsatellites forming separate components in the capillary electrophoresis multiplexes of Qiagen's HDplex (Hilden, Germany) and AGCU ScienTech's non-CODIS STR 21plex (Wuxi, Jiangsu, China). This study outlines the genomic details used to identify each microsatellite and reveals the D5S2500 marker in HDplex has the correctly assigned STR name, while the D5S2500 marker in the AGCU 21plex, closely positioned a further 1643 nucleotides in the human reference sequence, is an unnamed microsatellite. The fact that the D5S2500 marker has existed as two distinct STR loci undetected for almost ten years, even with reported discordant genotypes for the standard control DNA, underlines the need for careful scrutiny of the genomic properties of forensic STRs, as they become adapted for sequence analysis with MPS systems. We make the recommendation that precise chromosome location data must be reported for any forensic marker under development but not in common use, so that the genomic characteristics of the locus are validated to the same level of accuracy as its allelic variation and forensic performance. To clearly differentiate each microsatellite, we propose the name D5S2800 be used to identify the Chromosome-5 STR in the AGCU 21plex. PMID:26974236

  18. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    PubMed

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.

  19. Release of ribosome-bound 5S rRNA upon cleavage of the phosphodiester bond between nucleotides A54 and A55 in 5S rRNA.

    PubMed

    Holmberg, L; Nygård, O

    2000-11-01

    Reticulocyte lysates contain ribosome-bound and free populations of 5S RNA. The free population is sensitive to nuclease cleavage in the internal loop B, at the phosphodiester bond connecting nucleotides A54 and A55. Similar cleavage sites were detected in 5S rRNA in 60S subunits and 80S ribosomes. However, 5S rRNA in reticulocyte polysomes is insensitive to cleavage unless ribosomes are salt-washed. This suggests that a translational factor protects the backbone surrounding A54 from cleavage in polysomes. Upon nuclease treatment of mouse 60S subunits or reticulocyte lysates a small population of ribosomes released its 5S rRNA together with ribosomal protein L5. Furthermore, rRNA sequences from 5.8S, 28S and 18S rRNA were released. In 18S rRNA the sequences mainly originate from the 630 loop and stem (helix 18) in the 5' domain, whereas in 28S rRNA a majority of fragments is derived from helices 47 and 81 in domains III and V, respectively. We speculate that this type of rRNA-fragmentation may mimic a ribosome degradation pathway.

  20. Auxin Biosynthesis: Are the Indole-3-Acetic Acid and Phenylacetic Acid Biosynthesis Pathways Mirror Images?

    PubMed

    Cook, Sam D; Nichols, David S; Smith, Jason; Chourey, Prem S; McAdam, Erin L; Quittenden, Laura; Ross, John J

    2016-06-01

    The biosynthesis of the main auxin in plants (indole-3-acetic acid [IAA]) has been elucidated recently and is thought to involve the sequential conversion of Trp to indole-3-pyruvic acid to IAA However, the pathway leading to a less well studied auxin, phenylacetic acid (PAA), remains unclear. Here, we present evidence from metabolism experiments that PAA is synthesized from the amino acid Phe, via phenylpyruvate. In pea (Pisum sativum), the reverse reaction, phenylpyruvate to Phe, is also demonstrated. However, despite similarities between the pathways leading to IAA and PAA, evidence from mutants in pea and maize (Zea mays) indicate that IAA biosynthetic enzymes are not the main enzymes for PAA biosynthesis. Instead, we identified a putative aromatic aminotransferase (PsArAT) from pea that may function in the PAA synthesis pathway. PMID:27208245

  1. Substrate Control in Stereoselective Lanthionine Biosynthesis

    PubMed Central

    Tang, Weixin; Jiménez-Osés, Gonzalo; Houk, K. N.; van der Donk, Wilfred A.

    2014-01-01

    Enzymes are typically highly stereoselective catalysts that enforce a reactive conformation on their native substrates. We report here a rare example where the substrate controls the stereoselectivity of an enzyme-catalyzed Michael-type addition during the biosynthesis of lanthipeptides. These natural products contain thioether crosslinks formed by cysteine attack on dehydrated Ser and Thr residues. We demonstrate that several lanthionine synthetases catalyze highly selective anti additions in which the substrate (and not the enzyme) determines whether the addition occurs from the Re or Si face. A single point mutation in the peptide substrate completely inverted the stereochemical outcome of the enzymatic modification. Quantum mechanical calculations reproduced the experimentally observed selectivity and suggest that conformational restraints imposed by the amino acid sequence on the transition states determine the face selectivity of the Michael-type cyclization. PMID:25515891

  2. Terpenoids and Their Biosynthesis in Cyanobacteria

    PubMed Central

    Pattanaik, Bagmi; Lindberg, Pia

    2015-01-01

    Terpenoids, or isoprenoids, are a family of compounds with great structural diversity which are essential for all living organisms. In cyanobacteria, they are synthesized from the methylerythritol-phosphate (MEP) pathway, using glyceraldehyde 3-phosphate and pyruvate produced by photosynthesis as substrates. The products of the MEP pathway are the isomeric five-carbon compounds isopentenyl diphosphate and dimethylallyl diphosphate, which in turn form the basic building blocks for formation of all terpenoids. Many terpenoid compounds have useful properties and are of interest in the fields of pharmaceuticals and nutrition, and even potentially as future biofuels. The MEP pathway, its function and regulation, and the subsequent formation of terpenoids have not been fully elucidated in cyanobacteria, despite its relevance for biotechnological applications. In this review, we summarize the present knowledge about cyanobacterial terpenoid biosynthesis, both regarding the native metabolism and regarding metabolic engineering of cyanobacteria for heterologous production of non-native terpenoids. PMID:25615610

  3. Metabolic model for diversity-generating biosynthesis

    PubMed Central

    Tianero, Ma. Diarey; Pierce, Elizabeth; Raghuraman, Shrinivasan; Sardar, Debosmita; McIntosh, John A.; Heemstra, John R.; Schonrock, Zachary; Covington, Brett C.; Maschek, J. Alan; Cox, James E.; Bachmann, Brian O.; Olivera, Baldomero M.; Ruffner, Duane E.; Schmidt, Eric W.

    2016-01-01

    A conventional metabolic pathway leads to a specific product. In stark contrast, there are diversity-generating metabolic pathways that naturally produce different chemicals, sometimes of great diversity. We demonstrate that for one such pathway, tru, each ensuing metabolic step is slower, in parallel with the increasing potential chemical divergence generated as the pathway proceeds. Intermediates are long lived and accumulate progressively, in contrast with conventional metabolic pathways, in which the first step is rate-limiting and metabolic intermediates are short-lived. Understanding these fundamental differences enables several different practical applications, such as combinatorial biosynthesis, some of which we demonstrate here. We propose that these principles may provide a unifying framework underlying diversity-generating metabolism in many different biosynthetic pathways. PMID:26831074

  4. Biosurfactant Mediated Biosynthesis of Selected Metallic Nanoparticles

    PubMed Central

    Płaza, Grażyna A.; Chojniak, Joanna; Banat, Ibrahim M.

    2014-01-01

    Developing a reliable experimental protocol for the synthesis of nanomaterials is one of the challenging topics in current nanotechnology particularly in the context of the recent drive to promote green technologies in their synthesis. The increasing need to develop clean, nontoxic and environmentally safe production processes for nanoparticles to reduce environmental impact, minimize waste and increase energy efficiency has become essential in this field. Consequently, recent studies on the use of microorganisms in the synthesis of selected nanoparticles are gaining increased interest as they represent an exciting area of research with considerable development potential. Microorganisms are known to be capable of synthesizing inorganic molecules that are deposited either intra- or extracellularly. This review presents a brief overview of current research on the use of biosurfactants in the biosynthesis of selected metallic nanoparticles and their potential importance. PMID:25110864

  5. Serine in plants: biosynthesis, metabolism, and functions.

    PubMed

    Ros, Roc; Muñoz-Bertomeu, Jesús; Krueger, Stephan

    2014-09-01

    Serine (Ser) has a fundamental role in metabolism and signaling in living organisms. In plants, the existence of different pathways of Ser biosynthesis has complicated our understanding of this amino acid homeostasis. The photorespiratory glycolate pathway has been considered to be of major importance, whereas the nonphotorespiratory phosphorylated pathway has been relatively neglected. Recent advances indicate that the phosphorylated pathway has an important function in plant metabolism and development. Plants deficient in this pathway display developmental defects in embryos, male gametophytes, and roots. We propose that the phosphorylated pathway is more important than was initially thought because it is the only Ser source for specific cell types involved in developmental events. Here, we discuss its importance as a link between metabolism and development in plants.

  6. Biosynthesis and Heterologous Production of Epothilones

    NASA Astrophysics Data System (ADS)

    Müller, Rolf

    Although a variety of chemical syntheses for the epothilones and various derivatives have been described, modifying the backbone of those natural products remains a major challenge. One alternative to chemical alteration is the elucidation and subsequent manipulation of the biosynthetic pathway via genetic engineering in the producing organism. This type of approach is known as “combinatorial biosynthesis” and holds great promise, especially in conjunction with semi-synthesis methods to alter the structure of the natural product. In parallel, production can be optimized in the natural producer if the regulatory mechanisms governing the biosynthesis are understood. Alternatively, the entire gene cluster can be transferred into a heterologous host, more amenable both to genetic alteration and overexpression.

  7. Biosynthesis of the phytoalexin pisatin. [Pisum sativum

    SciTech Connect

    Preisig, C.L.; Bell, J.N.; Matthews, D.E.; VanEtten, H.D. ); Sun, Yuejin; Hrazdina, G. )

    1990-11-01

    NADPH-dependent reduction of 2{prime},7-dihydroxy-4{prime},5{prime}-methylenedioxyisoflavone to the isoflavanone sophorol, a proposed intermediate step in pisatin biosynthesis, was detected in extracts of Pisum sativum. This isoflavone reductase activity was inducible by treatment of pea seedlings with CuCl{sub 2}. The timing of induction coincided with that of the 6a-hydroxymaackiain 3-O-methyltransferase, which catalyzes the terminal biosynthetic step. Neither enzyme was light inducible. Further NADPH-dependent metabolism of sophorol by extracts of CuCl{sub 2}-treated seedlings was also observed; three products were radiolabeled when ({sup 3}H)sophorol was the substrate, one of which is tentatively identified as maackiain.

  8. Metabolic model for diversity-generating biosynthesis.

    PubMed

    Tianero, Ma Diarey; Pierce, Elizabeth; Raghuraman, Shrinivasan; Sardar, Debosmita; McIntosh, John A; Heemstra, John R; Schonrock, Zachary; Covington, Brett C; Maschek, J Alan; Cox, James E; Bachmann, Brian O; Olivera, Baldomero M; Ruffner, Duane E; Schmidt, Eric W

    2016-02-16

    A conventional metabolic pathway leads to a specific product. In stark contrast, there are diversity-generating metabolic pathways that naturally produce different chemicals, sometimes of great diversity. We demonstrate that for one such pathway, tru, each ensuing metabolic step is slower, in parallel with the increasing potential chemical divergence generated as the pathway proceeds. Intermediates are long lived and accumulate progressively, in contrast with conventional metabolic pathways, in which the first step is rate-limiting and metabolic intermediates are short-lived. Understanding these fundamental differences enables several different practical applications, such as combinatorial biosynthesis, some of which we demonstrate here. We propose that these principles may provide a unifying framework underlying diversity-generating metabolism in many different biosynthetic pathways. PMID:26831074

  9. Glycerolipid biosynthesis in isolated pea root plastids

    SciTech Connect

    Xue, Lingru; Sparace, S.A. )

    1990-05-01

    Plastids have been isolated from germinating pea (Pisum sativum L.) roots by differential centrifugation and purified on Percoll gradients. Marker enzymes (NADPH: cytochrome c reductase, fumarase and fatty acid synthesis) indicate that greater than 50% of the plastids are recovered essentially free from mitochondrial and endoplasmic reticulum contamination. Fatty acids synthesized from ({sup 14}C)acetate by Percoll-purified plastids are primarily 16:0, 16:1 and 18:1. ({sup 14}C)Acetate-labelled fatty acids and ({sup 14}C)glycerol-3-phosphate are both readily incorporated into glycerolipid. Approximately 12% of the total activity for glycerolipid biosynthesis from glycerol-3-phosphate is recovered in the purified plastid fraction. Glycerolipids synthesized from these precursors are primarily TAG, DAG, PE, PG, PC, PI and PA. Acyl-CoA's also accumulate when acetate is the precursor.

  10. Serine Biosynthesis and Regulation in Haemophilus influenzae

    PubMed Central

    Pizer, Lewis I.; Ponce-De-Leon, Manuel; Michalka, Jack

    1969-01-01

    Nutritional mutants of Haemophilus influenzae requiring l-serine for growth were shown to be deficient in their capacity to synthesize serine-phosphate from 3-phosphoglycerate. On the basis of the correlation between this block and the requirement for an exogenous supply of the amino acid, it was concluded that the “phosphorylated” pathway is the only pathway used by H. influenzae for serine biosynthesis. Serine inhibits serine-phosphate production, thereby regulating its own synthesis in a manner analagous to the Enterobacteriaceae. A mutant strain that required either serine or tryptophan for growth was normal in serine-phosphate synthesis and regulation. It was concluded that this strain probably has a tryptophan synthetase with an increased Michaelis constant for serine. PMID:5305003

  11. A molecular description of cellulose biosynthesis.

    PubMed

    McNamara, Joshua T; Morgan, Jacob L W; Zimmer, Jochen

    2015-01-01

    Cellulose is the most abundant biopolymer on Earth, and certain organisms from bacteria to plants and animals synthesize cellulose as an extracellular polymer for various biological functions. Humans have used cellulose for millennia as a material and an energy source, and the advent of a lignocellulosic fuel industry will elevate it to the primary carbon source for the burgeoning renewable energy sector. Despite the biological and societal importance of cellulose, the molecular mechanism by which it is synthesized is now only beginning to emerge. On the basis of recent advances in structural and molecular biology on bacterial cellulose synthases, we review emerging concepts of how the enzymes polymerize glucose molecules, how the nascent polymer is transported across the plasma membrane, and how bacterial cellulose biosynthesis is regulated during biofilm formation. Additionally, we review evolutionary commonalities and differences between cellulose synthases that modulate the nature of the cellulose product formed. PMID:26034894

  12. Flavones: From Biosynthesis to Health Benefits

    PubMed Central

    Jiang, Nan; Doseff, Andrea I.; Grotewold, Erich

    2016-01-01

    Flavones correspond to a flavonoid subgroup that is widely distributed in the plants, and which can be synthesized by different pathways, depending on whether they contain C- or O-glycosylation and hydroxylated B-ring. Flavones are emerging as very important specialized metabolites involved in plant signaling and defense, as well as key ingredients of the human diet, with significant health benefits. Here, we appraise flavone formation in plants, emphasizing the emerging theme that biosynthesis pathway determines flavone chemistry. Additionally, we briefly review the biological activities of flavones, both from the perspective of the functions that they play in biotic and abiotic plant interactions, as well as their roles as nutraceutical components of the human and animal diet. PMID:27338492

  13. Sargassum myriocystum mediated biosynthesis of gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Stalin Dhas, T.; Ganesh Kumar, V.; Stanley Abraham, L.; Karthick, V.; Govindaraju, K.

    2012-12-01

    Functionalized metal nanoparticles are unique in nature and are being developed for its specificity in drug targeting. In the present study, aqueous extract of Sargassum myriocystum is used for the biosynthesis of gold nanoparticles (AuNPs) by the reduction of chloroauric acid. The formation of nanoparticles reaction was complete within 15 min at 76 °C. The size, shape and elemental analysis of AuNPs were carried out using UV-visible absorption spectroscopy, FT-IR, TEM, SEM-EDAX, and XRD analysis. The newly formed AuNPs are stable, well-defined, polydispersed (triangular and spherical) and crystalline with an average size of 15 nm. The biomolecule involved in stabilizing AuNPs was identified using GC-MS.

  14. A Molecular Description of Cellulose Biosynthesis

    PubMed Central

    McNamara, Joshua T.; Morgan, Jacob L.W.; Zimmer, Jochen

    2016-01-01

    Cellulose is the most abundant biopolymer on Earth, and certain organisms from bacteria to plants and animals synthesize cellulose as an extracellular polymer for various biological functions. Humans have used cellulose for millennia as a material and an energy source, and the advent of a lignocellulosic fuel industry will elevate it to the primary carbon source for the burgeoning renewable energy sector. Despite the biological and societal importance of cellulose, the molecular mechanism by which it is synthesized is now only beginning to emerge. On the basis of recent advances in structural and molecular biology on bacterial cellulose synthases, we review emerging concepts of how the enzymes polymerize glucose molecules, how the nascent polymer is transported across the plasma membrane, and how bacterial cellulose biosynthesis is regulated during biofilm formation. Additionally, we review evolutionary commonalities and differences between cellulose synthases that modulate the nature of the cellulose product formed. PMID:26034894

  15. A Novel Muconic Acid Biosynthesis Approach by Shunting Tryptophan Biosynthesis via Anthranilate

    PubMed Central

    Sun, Xinxiao; Lin, Yuheng; Huang, Qin; Yuan, Qipeng

    2013-01-01

    Muconic acid is the synthetic precursor of adipic acid, and the latter is an important platform chemical that can be used for the production of nylon-6,6 and polyurethane. Currently, the production of adipic acid relies mainly on chemical processes utilizing petrochemicals, such as benzene, which are generally considered environmentally unfriendly and nonrenewable, as starting materials. Microbial synthesis from renewable carbon sources provides a promising alternative under the circumstance of petroleum depletion and environment deterioration. Here we devised a novel artificial pathway in Escherichia coli for the biosynthesis of muconic acid, in which anthranilate, the first intermediate in the tryptophan biosynthetic branch, was converted to catechol and muconic acid by anthranilate 1,2-dioxygenase (ADO) and catechol 1,2-dioxygenase (CDO), sequentially and respectively. First, screening for efficient ADO and CDO from different microbial species enabled the production of gram-per-liter level muconic acid from supplemented anthranilate in 5 h. To further achieve the biosynthesis of muconic acid from simple carbon sources, anthranilate overproducers were constructed by overexpressing the key enzymes in the shikimate pathway and blocking tryptophan biosynthesis. In addition, we found that introduction of a strengthened glutamine regeneration system by overexpressing glutamine synthase significantly improved anthranilate production. Finally, the engineered E. coli strain carrying the full pathway produced 389.96 ± 12.46 mg/liter muconic acid from simple carbon sources in shake flask experiments, a result which demonstrates scale-up potential for microbial production of muconic acid. PMID:23603682

  16. Regulation of penicillin biosynthesis in filamentous fungi.

    PubMed

    Brakhage, Axel A; Spröte, Petra; Al-Abdallah, Qusai; Gehrke, Alexander; Plattner, Hans; Tüncher, André

    2004-01-01

    The beta-lactam antibiotic penicillin is one of the mainly used antibiotics for the therapy of infectious diseases. It is produced as end product by some filamentous fungi only, most notably by Aspergillus (Emericella) nidulans and Penicillium chrysogenum. The penicillin biosynthesis is catalysed by three enzymes which are encoded by the following three genes: acvA (pcbAB), ipnA (pcbC) and aatA (penDE). The genes are organised into a gene cluster. Although the production of secondary metabolites as penicillin is not essential for the direct survival of the producing organisms, several studies indicated that the penicillin biosynthesis genes are controlled by a complex regulatory network, e.g. by the ambient pH, carbon source, amino acids, nitrogen etc. A comparison with the regulatory mechanisms (regulatory proteins and DNA elements) involved in the regulation of genes of primary metabolism in lower eukaryotes is thus of great interest. This has already led to the elucidation of new regulatory mechanisms. Positively acting regulators have been identified such as the pH dependent transcriptional regulator PACC, the CCAAT-binding complex AnCF and seem also to be represented by recessive trans-acting mutations of A. nidulans (prgA1, prgB1, npeE1) and R chrysogenum (carried by mutants Npe2 and Npe3). In addition, repressors like AnBH1 and VeA are involved in the regulation. Furthermore, such investigations have contributed to the elucidation of signals leading to the production of penicillin and can be expected to have a major impact on rational strain improvement programs.

  17. Glucose enhances indolic glucosinolate biosynthesis without reducing primary sulfur assimilation

    PubMed Central

    Miao, Huiying; Cai, Congxi; Wei, Jia; Huang, Jirong; Chang, Jiaqi; Qian, Hongmei; Zhang, Xin; Zhao, Yanting; Sun, Bo; Wang, Bingliang; Wang, Qiaomei

    2016-01-01

    The effect of glucose as a signaling molecule on induction of aliphatic glucosinolate biosynthesis was reported in our former study. Here, we further investigated the regulatory mechanism of indolic glucosinolate biosynthesis by glucose in Arabidopsis. Glucose exerted a positive influence on indolic glucosinolate biosynthesis, which was demonstrated by induced accumulation of indolic glucosinolates and enhanced expression of related genes upon glucose treatment. Genetic analysis revealed that MYB34 and MYB51 were crucial in maintaining the basal indolic glucosinolate accumulation, with MYB34 being pivotal in response to glucose signaling. The increased accumulation of indolic glucosinolates and mRNA levels of MYB34, MYB51, and MYB122 caused by glucose were inhibited in the gin2-1 mutant, suggesting an important role of HXK1 in glucose-mediated induction of indolic glucosinolate biosynthesis. In contrast to what was known on the function of ABI5 in glucose-mediated aliphatic glucosinolate biosynthesis, ABI5 was not required for glucose-induced indolic glucosinolate accumulation. In addition, our results also indicated that glucose-induced glucosinolate accumulation was due to enhanced sulfur assimilation instead of directed sulfur partitioning into glucosinolate biosynthesis. Thus, our data provide new insights into molecular mechanisms underlying glucose-regulated glucosinolate biosynthesis. PMID:27549907

  18. Glucose enhances indolic glucosinolate biosynthesis without reducing primary sulfur assimilation.

    PubMed

    Miao, Huiying; Cai, Congxi; Wei, Jia; Huang, Jirong; Chang, Jiaqi; Qian, Hongmei; Zhang, Xin; Zhao, Yanting; Sun, Bo; Wang, Bingliang; Wang, Qiaomei

    2016-01-01

    The effect of glucose as a signaling molecule on induction of aliphatic glucosinolate biosynthesis was reported in our former study. Here, we further investigated the regulatory mechanism of indolic glucosinolate biosynthesis by glucose in Arabidopsis. Glucose exerted a positive influence on indolic glucosinolate biosynthesis, which was demonstrated by induced accumulation of indolic glucosinolates and enhanced expression of related genes upon glucose treatment. Genetic analysis revealed that MYB34 and MYB51 were crucial in maintaining the basal indolic glucosinolate accumulation, with MYB34 being pivotal in response to glucose signaling. The increased accumulation of indolic glucosinolates and mRNA levels of MYB34, MYB51, and MYB122 caused by glucose were inhibited in the gin2-1 mutant, suggesting an important role of HXK1 in glucose-mediated induction of indolic glucosinolate biosynthesis. In contrast to what was known on the function of ABI5 in glucose-mediated aliphatic glucosinolate biosynthesis, ABI5 was not required for glucose-induced indolic glucosinolate accumulation. In addition, our results also indicated that glucose-induced glucosinolate accumulation was due to enhanced sulfur assimilation instead of directed sulfur partitioning into glucosinolate biosynthesis. Thus, our data provide new insights into molecular mechanisms underlying glucose-regulated glucosinolate biosynthesis. PMID:27549907

  19. A methylated Neurospora 5S rRNA pseudogene contains a transposable element inactivated by repeat-induced point mutation.

    PubMed Central

    Margolin, B S; Garrett-Engele, P W; Stevens, J N; Fritz, D Y; Garrett-Engele, C; Metzenberg, R L; Selker, E U

    1998-01-01

    In an analysis of 22 of the roughly 100 dispersed 5S rRNA genes in Neurospora crassa, a methylated 5S rRNA pseudogene, Psi63, was identified. We characterized the Psi63 region to better understand the control and function of DNA methylation. The 120-bp 5S rRNA-like region of Psi63 is interrupted by a 1.9-kb insertion that has characteristics of sequences that have been modified by repeat-induced point mutation (RIP). We found sequences related to this insertion in wild-type strains of N. crassa and other Neurospora species. Most showed evidence of RIP; but one, isolated from the N. crassa host of Psi63, showed no evidence of RIP. A deletion from near the center of this sequence apparently rendered it incapable of participating in RIP with the related full-length copies. The Psi63 insertion and the related sequences have features of transposons and are related to the Fot1 class of fungal transposable elements. Apparently Psi63 was generated by insertion of a previously unrecognized Neurospora transposable element into a 5S rRNA gene, followed by RIP. We name the resulting inactivated Neurospora transposon PuntRIP1 and the related sequence showing no evidence of RIP, but harboring a deletion that presumably rendered it defective for transposition, dPunt. PMID:9691037

  20. Chromosomal localization of 5S rRNA gene loci and the implications for relationships within the Allium complex.

    PubMed

    Lee, S H; Do, G S; Seo, B B

    1999-01-01

    Chromosomal localizations and distribution patterns of the 5S rRNA genes by means of fluorescence in-situ hybridization in diploid Allium species could help to classify species into chromosome types and aid in determining relationships among genomes. All eleven diploid species were classified into five types, A to E. Species of type A showed a pair of 5S rRNA signals on the short arm of chromosome 5 and two pairs of signals on both arms of chromosome 7. Species of types B and C showed one pair and two pairs of signals on the short arm of chromosome 7, respectively. Type D species showed two pairs of signals on the satellite region of the short arm and a pair of signals on the long arm of chromosome 7. Type E species showed three distinct 5S rRNA gene loci signals on the short arm of chromosome 7. Information on chromosomal localization of 5S rRNA gene loci and distribution patterns within chromosomes in diploid Allium species could help to infer the pathway of origin of the three kinds of alloploid species. Data indicate that A. wakegi is an allopolyploid with genomes of types B and C, and A. deltoide-fistulosum is an allotetraploid derived from a natural hybridization between different species within chromosome type A. Results indicate that A. senescens is an allopolyploid with type B chromosomes and an unidentified chromosomal type. PMID:10328620

  1. snoU6 and 5S RNAs are not reliable miRNA reference genes in neuronal differentiation.

    PubMed

    Lim, Q E; Zhou, L; Ho, Y K; Wan, G; Too, H P

    2011-12-29

    Accurate profiling of microRNAs (miRNAs) is an essential step for understanding the functional significance of these small RNAs in both physiological and pathological processes. Quantitative real-time PCR (qPCR) has gained acceptance as a robust and reliable transcriptomic method to profile subtle changes in miRNA levels and requires reference genes for accurate normalization of gene expression. 5S and snoU6 RNAs are commonly used as reference genes in microRNA quantification. It is currently unknown if these small RNAs are stably expressed during neuronal differentiation. Panels of miRNAs have been suggested as alternative reference genes to 5S and snoU6 in various physiological contexts. To test the hypothesis that miRNAs may serve as stable references during neuronal differentiation, the expressions of eight miRNAs, 5S and snoU6 RNAs in five differentiating neuronal cell types were analyzed using qPCR. The stabilities of the expressions were evaluated using two complementary statistical approaches (geNorm and Normfinder). Expressions of 5S and snoU6 RNAs were stable under some but not all conditions of neuronal differentiation and thus are not suitable reference genes. In contrast, a combination of three miRNAs (miR-103, miR-106b and miR-26b) allowed accurate expression normalization across different models of neuronal differentiation.

  2. Peak shifts due to B{sup (*)}-B{sup (*)} rescattering in {upsilon}(5S) dipion transitions

    SciTech Connect

    Meng Ce; Chao Kuangta

    2008-08-01

    We study the energy distributions of dipion transitions {upsilon}(5S) to {upsilon}(1S,2S,3S){pi}{sup +}{pi}{sup -} in the final-state rescattering model. Since the {upsilon}(5S) is well above the open bottom thresholds, the dipion transitions are expected to mainly proceed through the real processes {upsilon}(5S){yields}B{sup (*)}B{sup (*)} and B{sup (*)}B{sup (*)}{yields}{upsilon}(1S,2S,3S){pi}{sup +}{pi}{sup -}. We find that the energy distributions of {upsilon}(1S,2S,3S){pi}{sup +}{pi}{sup -} markedly differ from that of {upsilon}(5S){yields}B{sup (*)}B{sup (*)}. In particular, the resonance peak will be pushed up by about 7-20 MeV for these dipion transitions relative to the main hadronic decay modes. These predictions can be used to test the final-state rescattering mechanism in hadronic transitions for heavy quarkonia above the open flavor thresholds.

  3. Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

    PubMed

    Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

    2015-03-01

    The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.

  4. Contralateral interlaminar approach for intraforaminal lumbar degenerative disease with special emphasis on L5-S1 level: A technical note

    PubMed Central

    Zekaj, Edvin; Menghetti, Claudia; Saleh, Christian; Isidori, Alessandra; Bona, Alberto R.; Aimar, Enrico; Servello, Domenico

    2016-01-01

    Background: Intraforaminal disc herniations at the L5-S1 level are extremely surgically challenging lesions. Intracanal approaches frequently require partial or total facetectomy, which may lead to instability. Solely extraforaminal approaches may offer limited visualization of the more medial superiorly exiting and inferiorly exiting nerve roots; this approach is also more complicated at L5-S1 due to the often large L5 transverse process and the iliac wing. Methods: Nine patients with intraforaminal L5-S1 disc herniations, foraminal stenosis, or synovial cysts underwent contralateral interlaminar approaches for lesion resection. Preoperative and postoperative visual analog scale scores were evaluated, and complications were reviewed. Results: All 9 patients demonstrated immediate postoperative clinical improvement. None of the patients exhibited complications and none developed instability or neuropathic disorders. Conclusions: Although the number of cases in our sample was very small (9 in total), the contralateral interlaminar approach appeared to effectively address multiple degenerative L5-S1 foraminal pathologies. Large studies are needed to further evaluate the pros and cons of this approach. PMID:27713854

  5. BIOSYNTHESIS OF MYCOBACILLIN, A NEW ANTIFUNGAL PEPTIDE II.

    PubMed Central

    Banerjee, Arun B.; Bose, S. K.

    1964-01-01

    Banerjee, Arun B. (University of Calcutta, Calcutta, India), and S. K. Bose. Biosynthesis of mycobacillin, a new antifungal peptide. II. Relation between streptomycin dependence and biosynthesis. J. Bacteriol. 87:1402–1405. 1964.—A streptomycin-dependent variant was isolated by a single-step mutation process from a strain of Bacillus subtilis capable of producing mycobacillin, a cyclic polypeptide antifungal antibiotic. Streptomycin inhibited the growth of this variant in concentrations exceeding the optimal level. Studies on the biosynthesis of mycobacillin and protein in this variant indicate that the two processes are different and that the deprivation of streptomycin has no effect on mycobacillin synthesis. PMID:14188720

  6. Distribution of 5-methylcytosine residues in 5S rRNA genes in Arabidopsis thaliana and Secale cereale.

    PubMed

    Fulnecek, J; Matyásek, R; Kovarík, A

    2002-12-01

    Bisulfite genomic sequencing was used to localise 5-methylcytosine residues (mC) in 5S rRNA genes of Arabidopsis thaliana and Secale cereale. The maps of mC distribution were compared with the previously published map of the corresponding region in Nicotiana tabacum. In all three species, the level of methylation of 5S rRNA genes was generally higher than the average for the entire genome. The ratio of 5S rDNA methylation to average overall methylation was 44%/30-33% for N. tabacum, 27%/4-6% for A. thaliana and 24%/20-22% for S. cereale. With the exception of one clone from S. cereale, no methylation-free 5S rDNA was detected. The level of methylation at different sequence motifs in 5S rDNA was calculated for N. tabacum/A. thaliana/ S. cereale, and this analysis yielded the following values (expressed as a percentage of total C): mCG 90%/78%/85%, mCWG 89%/41%/53%, mCmCG 72%/32%/16%, mCCG 4%/2%/0%, mCHH 15%/6%/1%, where W=A or T, and H=A or C or T. Non-symmetrical methylation was almost negligible in the large genome of S. cereale but relatively frequent in N. tabacum and A. thaliana, suggesting that the strict correlation between genome size and cytosine methylation might be violated for this type of methylation. Among non-symmetrical motifs the mCWA triplets were significantly over-represented in Arabidopsis, while in tobacco this preference was not as pronounced. The differences in methylation levels in different sequence contexts might be of phylogenetic significance, but further species in related and different taxa need to be studied before firm conclusions can be drawn. PMID:12471448

  7. Unexpected Accumulation of ncm5U and ncm5s2U in a trm9 Mutant Suggests an Additional Step in the Synthesis of mcm5U and mcm5s2U

    PubMed Central

    Chen, Changchun; Huang, Bo; Anderson, James T.; Byström, Anders S.

    2011-01-01

    Background Transfer RNAs are synthesized as a primary transcript that is processed to produce a mature tRNA. As part of the maturation process, a subset of the nucleosides are modified. Modifications in the anticodon region often modulate the decoding ability of the tRNA. At position 34, the majority of yeast cytosolic tRNA species that have a uridine are modified to 5-carbamoylmethyluridine (ncm5U), 5-carbamoylmethyl-2′-O-methyluridine (ncm5Um), 5-methoxycarbonylmethyl-uridine (mcm5U) or 5-methoxycarbonylmethyl-2-thiouridine (mcm5s2U). The formation of mcm5 and ncm5 side chains involves a complex pathway, where the last step in formation of mcm5 is a methyl esterification of cm5 dependent on the Trm9 and Trm112 proteins. Methodology and Principal Findings Both Trm9 and Trm112 are required for the last step in formation of mcm5 side chains at wobble uridines. By co-expressing a histidine-tagged Trm9p together with a native Trm112p in E. coli, these two proteins purified as a complex. The presence of Trm112p dramatically improves the methyltransferase activity of Trm9p in vitro. Single tRNA species that normally contain mcm5U or mcm5s2U nucleosides were isolated from trm9Δ or trm112Δ mutants and the presence of modified nucleosides was analyzed by HPLC. In both mutants, mcm5U and mcm5s2U nucleosides are absent in tRNAs and the major intermediates accumulating were ncm5U and ncm5s2U, not the expected cm5U and cm5s2U. Conclusions Trm9p and Trm112p function together at the final step in formation of mcm5U in tRNA by using the intermediate cm5U as a substrate. In tRNA isolated from trm9Δ and trm112Δ strains, ncm5U and ncm5s2U nucleosides accumulate, questioning the order of nucleoside intermediate formation of the mcm5 side chain. We propose two alternative explanations for this observation. One is that the intermediate cm5U is generated from ncm5U by a yet unknown mechanism and the other is that cm5U is formed before ncm5U and mcm5U. PMID:21687733

  8. Regulation of volatile benzenoid biosynthesis in petunia flowers.

    PubMed

    Schuurink, Robert C; Haring, Michel A; Clark, David G

    2006-01-01

    The petunia flower has served as a model for the study of several physiological processes including floral development, self-incompatibility, anthocyanin biosynthesis and ethylene signalling during senescence. More recently, Petunia hybrida 'Mitchell' has been used to understand the complex regulation of volatile benzenoid biosynthesis, which occurs predominantly in flower petal tissues. Benzenoid biosynthesis is temporally and circadian controlled and is tightly down-regulated by ethylene during floral senescence. Using targeted transcriptomics and gene knockouts, both biosynthetic genes and a transcription factor regulating benzenoid synthesis have been recently discovered and characterized. It appears that benzenoid production is regulated predominantly by transcriptional control of the shikimate pathway, benzenoid biosynthesis genes and S-adenosyl-methionine cycle genes.

  9. Thiamine biosynthesis can be used to dissect metabolic integration.

    PubMed

    Koenigsknecht, Mark J; Downs, Diana M

    2010-06-01

    The emergence of systems biology has re-emphasized the advantages of understanding biological processes with a global perspective. One biological process amenable to global approaches is microbial metabolism. This review describes a model system that contributes to the goals of systems biology by experimentally defining metabolic integration found in a bacterial cell and thus providing data needed for implementation and interpretation of systems approaches. We have taken a largely unbiased in vivo approach centered on thiamine biosynthesis to identify new metabolic components and connections, and to explore uncharacterized paradigms of the integration between them. This article summarizes recent results from this approach that include the identification of the function of unknown genes, connections between cofactors biosynthesis and thiamine biosynthesis, and how metabolites from one biosynthetic pathway can be used in thiamine biosynthesis.

  10. Reinvigorating natural product combinatorial biosynthesis with synthetic biology.

    PubMed

    Kim, Eunji; Moore, Bradley S; Yoon, Yeo Joon

    2015-09-01

    Natural products continue to play a pivotal role in drug-discovery efforts and in the understanding if human health. The ability to extend nature's chemistry through combinatorial biosynthesis--altering functional groups, regiochemistry and scaffold backbones through the manipulation of biosynthetic enzymes--offers unique opportunities to create natural product analogs. Incorporating emerging synthetic biology techniques has the potential to further accelerate the refinement of combinatorial biosynthesis as a robust platform for the diversification of natural chemical drug leads. Two decades after the field originated, we discuss the current limitations, the realities and the state of the art of combinatorial biosynthesis, including the engineering of substrate specificity of biosynthetic enzymes and the development of heterologous expression systems for biosynthetic pathways. We also propose a new perspective for the combinatorial biosynthesis of natural products that could reinvigorate drug discovery by using synthetic biology in combination with synthetic chemistry.

  11. Effect of latitude on flavonoid biosynthesis in plants.

    PubMed

    Jaakola, Laura; Hohtola, Anja

    2010-08-01

    The growth conditions in different latitudes vary markedly with season, day length, light quality and temperature. Many plant species have adapted well to the distinct environments through different strategies, one of which is the production of additional secondary metabolites. Flavonoids are a widely spread group of plant secondary metabolites that are involved in many crucial functions of plants. Our understanding of the biosynthesis, occurrence and function of flavonoids has increased rapidly in recent decades. Numerous studies have been published on the influence of environmental factors on the biosynthesis of flavonoids. However, extensive long-term studies that examine the effect of the characteristics of northern climates on flavonoid biosynthesis are still scarce. This review focuses on the current knowledge about the effect of light intensity, photoperiod and temperature on the gene-environment interaction related to flavonoid biosynthesis in plants.

  12. Transformation of Aspergillus flavus to study aflatoxin biosynthesis.

    PubMed

    Payne, G A; Woloshuk, C P

    1989-09-01

    Aflatoxin contamination of agricultural commodities continues to be a serious problem in the United States. Breeding for resistant genotypes has been unsuccessful and detoxification of food sources is not economically feasible. New strategies for control may become apparent once more is known about the biosynthesis and regulation of aflatoxin. Although the biosynthetic pathway of aflatoxin has been extensively studied, little is known about the regulation of the individual steps in the pathway. We have developed a genetic transformation system for Aspergillus flavus that provides a new and expedient approach to studying the biosynthesis of aflatoxin and its regulation. Through the use of this genetic transformation system, genes for aflatoxin biosynthesis can be identified and isolated by the complementation of aflatoxin negative mutants. In this paper we discuss molecular strategies for studying the regulation and biosynthesis of aflatoxin. PMID:2515438

  13. Reinvigorating natural product combinatorial biosynthesis with synthetic biology

    PubMed Central

    Kim, Eunji; Moore, Bradley S.; Yoon, Yeo Joon

    2016-01-01

    Natural products continue to play a pivotal role in drug discovery efforts and in understanding human health. The ability to extend nature’s chemistry through combinatorial biosynthesis – altering functional groups, regiochemistry, and scaffold backbones through manipulation of biosynthetic enzymes – offers unique opportunities to create natural product analogues. Incorporating emerging synthetic biology techniques has the potential to further accelerate the refinement of combinatorial biosynthesis as a robust platform for the diversification of natural chemical drug leads. Two decades after the field originated, we discuss the current limitations, realities, and the state of the art of combinatorial biosynthesis, including the engineering of substrate specificity of biosynthetic enzymes and the development heterologous expression systems for biosynthetic pathways. We also propose a new perspective for the combinatorial biosynthesis of natural products that could reinvigorate drug discovery by using synthetic biology in combination with synthetic chemistry. PMID:26284672

  14. Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection

    PubMed Central

    2011-01-01

    Background The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. Results The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. Conclusions These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection. PMID:22004418

  15. Increased thromboxane biosynthesis in essential thrombocythemia.

    PubMed

    Rocca, B; Ciabattoni, G; Tartaglione, R; Cortelazzo, S; Barbui, T; Patrono, C; Landolfi, R

    1995-11-01

    In order to investigate the in vivo thromboxane (TX) biosynthesis in essential thrombocythemia (ET), we measured the urinary excretion of the major enzymatic metabolites of TXB2, 11-dehydro-TXB2 and 2,3-dinor-TXB2 in 40 ET patients as well as in 26 gender- and age-matched controls. Urinary 11-dehydro-TXB2 was significantly higher (p < 0.001) in thrombocythemic patients (4,063 +/- 3,408 pg/mg creatinine; mean +/- SD) than in controls (504 +/- 267 pg/mg creatinine), with 34 patients (85%) having 11-dehydro-TXB2 > 2 SD above the control mean. Patients with platelet number < 1,000 x 10 (9)/1 (n = 25) had significantly higher (p < 0.05) 11-dehydro-TXB2 excretion than patients with higher platelet count (4,765 +/- 3,870 pg/mg creatinine, n = 25, versus 2,279 +/- 1,874 pg/mg creatinine, n = 15). Average excretion values of patients aging > 55 was significantly higher than in the younger group (4,784 +/- 3,948 pg/mg creatinine, n = 24, versus 2,405 +/- 1,885 pg/mg creatinine, n = 16, p < 0.05). Low-dose aspirin (50 mg/d for 7 days) largely suppressed 11-dehydro-TXB2 excretion in 7 thrombocythemic patients, thus suggesting that platelets were the main source of enhanced TXA2 biosynthesis. The platelet count-corrected 11-dehydro-TXB2 excretion was positively correlated with age (r = 0.325, n = 40, p < 0.05) and inversely correlated with platelet count (r = -0.381, n = 40, p < 0.05). In addition 11 out of 13 (85%) patients having increased count-corrected 11-dehydro-TXB2 excretion, belonged to the subgroup with age > 55 and platelet count < 1,000 x 10(9)/1. We conclude that in essential thrombocythemia: 1) enhanced 11-dehydro-TXB2 excretion largely reflects platelet activation in vivo; 2) age as well as platelet count appear to influence the determinants of platelet activation in this setting, and can help in assessing the thrombotic risk and therapeutic strategy in individual patients. PMID:8607099

  16. Studies on the biosynthesis of ralfuranones in Ralstonia solanacearum.

    PubMed

    Kai, Kenji; Ohnishi, Hideyuki; Kiba, Akinori; Ohnishi, Kouhei; Hikichi, Yasufumi

    2016-01-01

    Ralfuranones, aryl-furanone secondary metabolites, are involved in the virulence of Ralstonia solanacearum in solanaceous plants. Ralfuranone I (6) has been suggested as a biosynthetic precursor for other ralfuranones; however, this conversion has not been confirmed. We herein investigate the biosynthesis of ralfuranones using feeding experiments with ralfuranone I (6) and its putative metabolite, ralfuranone B (2). The results obtained demonstrated that the biosynthesis of ralfuranones proceeded in enzymatic and non-enzymatic manners. PMID:26645956

  17. Biosynthesis of putrescine in the prostate gland of the rat

    PubMed Central

    Pegg, A. E.; Williams-Ashman, H. G.

    1968-01-01

    In the rat ventral prostate gland the biosynthesis of putrescine, a precursor of spermidine and spermine, is shown to occur by the direct decarboxylation of l-ornithine. Some properties of a soluble pyridoxal phosphate-dependent l-ornithine decarboxylase are described. The findings are discussed in relation to other enzymic reactions involved in the biosynthesis of polyamines by the prostate gland. PMID:5667265

  18. Studies on the biosynthesis of ralfuranones in Ralstonia solanacearum.

    PubMed

    Kai, Kenji; Ohnishi, Hideyuki; Kiba, Akinori; Ohnishi, Kouhei; Hikichi, Yasufumi

    2016-01-01

    Ralfuranones, aryl-furanone secondary metabolites, are involved in the virulence of Ralstonia solanacearum in solanaceous plants. Ralfuranone I (6) has been suggested as a biosynthetic precursor for other ralfuranones; however, this conversion has not been confirmed. We herein investigate the biosynthesis of ralfuranones using feeding experiments with ralfuranone I (6) and its putative metabolite, ralfuranone B (2). The results obtained demonstrated that the biosynthesis of ralfuranones proceeded in enzymatic and non-enzymatic manners.

  19. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed Central

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-01-01

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  20. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-06-25

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period.

  1. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-06-25

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  2. Fenarimol, a Pyrimidine-Type Fungicide, Inhibits Brassinosteroid Biosynthesis.

    PubMed

    Oh, Keimei; Matsumoto, Tadashi; Yamagami, Ayumi; Hoshi, Tomoki; Nakano, Takeshi; Yoshizawa, Yuko

    2015-07-29

    The plant steroid hormone brassinosteroids (BRs) are important signal mediators that regulate broad aspects of plant growth and development. With the discovery of brassinoazole (Brz), the first specific inhibitor of BR biosynthesis, several triazole-type BR biosynthesis inhibitors have been developed. In this article, we report that fenarimol (FM), a pyrimidine-type fungicide, exhibits potent inhibitory activity against BR biosynthesis. FM induces dwarfism and the open cotyledon phenotype of Arabidopsis seedlings in the dark. The IC50 value for FM to inhibit stem elongation of Arabidopsis seedlings grown in the dark was approximately 1.8 ± 0.2 μM. FM-induced dwarfism of Arabidopsis seedlings could be restored by brassinolide (BL) but not by gibberellin (GA). Assessment of the target site of FM in BR biosynthesis by feeding BR biosynthesis intermediates indicated that FM interferes with the side chain hydroxylation of BR biosynthesis from campestanol to teasterone. Determination of the binding affinity of FM to purified recombinant CYP90D1 indicated that FM induced a typical type II binding spectrum with a Kd value of approximately 0.79 μM. Quantitative real-time PCR analysis of the expression level of the BR responsive gene in Arabidopsis seedlings indicated that FM induces the BR deficiency in Arabidopsis.

  3. Chromosomal location of 18S and 5S rDNA sites in Triportheus fish species (Characiformes, Characidae)

    PubMed Central

    2009-01-01

    The location of 18S and 5S rDNA sites was determined in eight species and populations of the fish genus Triportheus by using fluorescent in situ hybridization (FISH). The males and females of all species had 2n = 52 chromosomes and a ZZ/ZW sex chromosome system. A single 18S rDNA site that was roughly equivalent to an Ag-NOR was detected on the short arms of a submetacentric pair in nearly all species, and up to two additional sites were also observed in some species. In addition, another 18S rDNA cluster was identified in a distal region on the long arms of the W chromosome; this finding corroborated previous evidence that this cluster would be a shared feature amongst Triportheus species. In T. angulatus, a heterozygotic paracentric inversion involving the short arms of one homolog of a metacentric pair was associated with NORs. The 5S rDNA sites were located on the short arms of a single submetacentric chromosomal pair, close to the centromeres, except in T. auritus, which had up to ten 5S rDNA sites. The 18S and 5S rDNA sites were co-localized and adjacent on the short arms of a chromosomal pair in two populations of T. nematurus. Although all Triportheus species have a similar karyotypic macrostructure, the results of this work show that in some species ribosomal genes may serve as species-specific markers when used in conjunction with other putatively synapomorphic features. PMID:21637644

  4. Theoretical study on the adsorption of carbon dioxide on individual and alkali-metal doped MOF-5s

    NASA Astrophysics Data System (ADS)

    Ha, Nguyen Thi Thu; Lefedova, O. V.; Ha, Nguyen Ngoc

    2016-01-01

    Density functional theory (DFT) calculations were performed to investigate the adsorption of carbon dioxide (CO2) on metal-organic framework (MOF-5) and alkali-metal (Li, K, Na) doped MOF-5s. The adsorption energy calculation showed that metal atom adsorption is exothermic in MOF-5 system. Moreover, alkali-metal doping can significantly improve the adsorption ability of carbon dioxide on MOF-5. The best influence is observed for Li-doping.

  5. A Tale of Two Lines: Searching for the 5s - 5p Resonance Lines in Pm-like Ion Spectra

    SciTech Connect

    Trabert, E; Vilkas, M J; Ishikawa, Y

    2008-10-24

    Highly charged ions in the promethium sequence have been suggested to show spectral features resembling the alkali sequence ions. Guided by calculations, the 5s-5p resonance lines have been sought in a variety of experiments. In the light of the most extensive calculations of Pm-like ions yet, applying relativistic multi-reference Moeller-Plesset second-order perturbation theory, the experimental evidence is reviewed and the line identification problem assessed.

  6. Foraminoplastic transfacet epidural endoscopic approach for removal of intraforaminal disc herniation at the L5-S1 level

    PubMed Central

    Kaczmarczyk, Jacek; Nowakowski, Andrzej; Sulewski, Adam

    2014-01-01

    Transforaminal endoscopic disc removal in the L5-S1 motion segment of the lumbar spine creates a technical challenge due to anatomical reasons and individual variability. The majority of surgeons prefer a posterior classical or minimally invasive approach. There is only one foraminoplastic modification of the technique in the literature so far. In this paper we present a new technique with a foraminoplastic transfacet approach that may be suitable in older patients with advanced degenerative disease of the spine. PMID:24729817

  7. The nuclear 5S RNAs from chicken, rat and man. U5 RNAs are encoded by multiple genes.

    PubMed

    Krol, A; Gallinaro, H; Lazar, E; Jacob, M; Branlant, C

    1981-02-25

    Preparations of chicken, rat and human nuclear 5S RNA contain two sets of molecules. The set with the lowest electrophoretic mobility (5Sa) contains RNAs identical or closely related to ribosomal 5S RNA from the corresponding animal species. In HeLa cells and rat brain, we only detected an RNA identical to the ribosomal 5S RNA. In hen brain and liver, we found other species differing by a limited number of substitutions. The results suggest that mutated 5S genes may be expressed differently according to the cell type. The set with the highest mobility corresponds to U5 RNA. In both rat brain and HeLa cells, U5 RNA was found to be composed of 4 and 5 different molecules respectively (U5A, U5B1-4) differing by a small number of substitutions or insertions. In hen brain, no U5B was detected but U5A' differing from U5A by the absence of the 3'-terminal adenosine. All the U5 RNAs contain the same set of modified nucleotides. They also have the same secondary structure which consists of two hairpins joined together by a 17 nucleotide long single-stranded region. The 3' half of the molecule has a compact conformation. Together, the results suggest that U5 RNAs are transcribed from a multigene family and that mutated genes may be expressed as far as secondary structure is conserved. The conformation of U5 RNA is likely to be related to its function and it is of interest to mention that several similarities of structure are found between U5 and U1A RNA.

  8. Describing a new syndrome in L5-S1 disc herniation: Sexual and sphincter dysfunction without pain and muscle weakness

    PubMed Central

    Akca, Nezih; Ozdemir, Bulent; Kanat, Ayhan; Batcik, Osman Ersagun; Yazar, Ugur; Zorba, Orhan Unal

    2014-01-01

    Context: Little seems to be known about the sexual dysfunction (SD) in lumbar intervertebral disc herniation. Aims: Investigation of sexual and sphincter dysfunction in patient with lumbar disc hernitions. Settings and Design: A retrospective analysis. Materials and Methods: Sexual and sphincter dysfunction in patients admitted with lumbar disc herniations between September 2012-March 2014. Statistical Analysis Used: Statistical analysis was performed using the Predictive Analytics SoftWare (PASW) Statistics 18.0 for Windows (Statistical Package for the Social Sciences, SPSS Inc., Chicago, Illinois). The statistical significance was set at P < 0.05. The Wilcoxon signed ranks test was used to evaluate the difference between patients. Results: Four patients with sexual and sphincter dysfunction were found, including two women and two men, aged between 20 and 52 years. All of them admitted without low back pain. In addition, on neurological examination, reflex and motor deficit were not found. However, almost all patients had perianal sensory deficit and sexual and sphincter dysfunction. Magnetic resonance imaging (MRI) of three patients displayed a large extruded disc fragment at L5-S1 level on the left side. In fourth patient, there were not prominent disc herniations. There was not statistically significant difference between pre-operative and post-operative sexual function, anal-urethral sphincter function, and perianal sensation score. A syndrome in L5-S1 disc herniation with sexual and sphincter dysfunction without pain and muscle weakness was noted. We think that it is crucial for neurosurgeons to early realise that paralysis of the sphincter and sexual dysfunction are possible in patients with lumbar L5-S1 disc disease. Conclusion: A syndrome with perianal sensory deficit, paralysis of the sphincter, and sexual dysfunction may occur in patients with lumbar L5-S1 disc disease. The improvement of perianal sensory deficit after surgery was counteracted by a trend

  9. Minimally Invasive Transforaminal Lumbar Interbody Fusion at L5-S1 through a Unilateral Approach: Technical Feasibility and Outcomes.

    PubMed

    Choi, Won-Suh; Kim, Jin-Sung; Ryu, Kyeong-Sik; Hur, Jung-Woo; Seong, Ji-Hoon

    2016-01-01

    Background. Minimally invasive spinal transforaminal lumbar interbody fusion (MIS-TLIF) at L5-S1 is technically more demanding than it is at other levels because of the anatomical and biomechanical traits. Objective. To determine the clinical and radiological outcomes of MIS-TLIF for treatment of single-level spinal stenosis low-grade isthmic or degenerative spondylolisthesis at L5-S1. Methods. Radiological data and electronic medical records of patients who underwent MIS-TLIF between May 2012 and December 2014 were reviewed. Fusion rate, cage position, disc height (DH), disc angle (DA), disc slope angle, segmental lordotic angle (SLA), lumbar lordotic angle (LLA), and pelvic parameters were assessed. For functional assessment, the visual analogue scale (VAS), Oswestry disability index (ODI), and patient satisfaction rate (PSR) were utilized. Results. A total of 21 levels in 21 patients were studied. DH, DA, SLA, and LLA had increased from their preoperative measures at the final follow-up. Fusion rate was 86.7% (18/21) at 12 months' follow-up. The most common cage position was anteromedial (15/21). The mean VAS scores for back and leg pain mean ODI scores improved significantly at the final follow-up. PSR was 88%. Cage subsidence was observed in 33.3% (7/21). Conclusions. The clinical and radiologic outcomes after MIS-TLIF at L5-S1 in patients with spinal stenosis or spondylolisthesis are generally favorable. PMID:27433472

  10. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    PubMed

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  11. Erythromycin and 5S rRNA binding properties of the spinach chloroplast ribosomal protein CL22.

    PubMed Central

    Carol, P; Rozier, C; Lazaro, E; Ballesta, J P; Mache, R

    1993-01-01

    The spinach chloroplast ribosomal protein (r-protein) CL22 contains a central region homologous to the Escherichia coli r-protein L22 plus long N- and C-terminal extensions. We show in this study that the CL22 combines two properties which in E. coli ribosome are split between two separate proteins. The CL22 which binds to the 5S rRNA can also be linked to an erythromycin derivative added to the 50S ribosomal subunit. This latter property is similar to that of the E. coli L22 and suggests a similar localization in the 50S subunit. We have overproduced the r-protein CL22 and deleted forms of this protein in E. coli. We show that the overproduced CL22 binds to the chloroplast 5S rRNA and that the deleted protein containing the N- and C-terminal extensions only has lost the 5S rRNA binding property. We suggest that the central homologous regions of the CL22 contains the RNA binding domain. Images PMID:8441674

  12. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    PubMed

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease.

  13. Minimally Invasive Transforaminal Lumbar Interbody Fusion at L5-S1 through a Unilateral Approach: Technical Feasibility and Outcomes

    PubMed Central

    Choi, Won-Suh; Kim, Jin-Sung; Ryu, Kyeong-Sik; Hur, Jung-Woo; Seong, Ji-Hoon

    2016-01-01

    Background. Minimally invasive spinal transforaminal lumbar interbody fusion (MIS-TLIF) at L5-S1 is technically more demanding than it is at other levels because of the anatomical and biomechanical traits. Objective. To determine the clinical and radiological outcomes of MIS-TLIF for treatment of single-level spinal stenosis low-grade isthmic or degenerative spondylolisthesis at L5-S1. Methods. Radiological data and electronic medical records of patients who underwent MIS-TLIF between May 2012 and December 2014 were reviewed. Fusion rate, cage position, disc height (DH), disc angle (DA), disc slope angle, segmental lordotic angle (SLA), lumbar lordotic angle (LLA), and pelvic parameters were assessed. For functional assessment, the visual analogue scale (VAS), Oswestry disability index (ODI), and patient satisfaction rate (PSR) were utilized. Results. A total of 21 levels in 21 patients were studied. DH, DA, SLA, and LLA had increased from their preoperative measures at the final follow-up. Fusion rate was 86.7% (18/21) at 12 months' follow-up. The most common cage position was anteromedial (15/21). The mean VAS scores for back and leg pain mean ODI scores improved significantly at the final follow-up. PSR was 88%. Cage subsidence was observed in 33.3% (7/21). Conclusions. The clinical and radiologic outcomes after MIS-TLIF at L5-S1 in patients with spinal stenosis or spondylolisthesis are generally favorable. PMID:27433472

  14. Characterization and physical mapping of 18S and 5S ribosomal genes in Indian major carps (Pisces, Cyprinidae).

    PubMed

    Ravindra Kumar; Kushwaha, Basdeo; Nagpure, Naresh S

    2013-06-01

    Characterization of the major (18S) and minor (5S) ribosomal RNA genes were carried out in three commercially important Indian major carp (IMC) species, viz. Catla catla, Labeo rohita and Cirrhinus mrigala along with their physical localizations using dual colour fluorescence in situ hybridization. The diploid chromosome number in the above carps was confirmed to be 50 with inter-species karyo-morphological variations. The 18S rDNA signals were observed on 3 pair of chromosomes in C. catla and L. rohita, and two pairs in C. mrigala. The 5S rDNA signal was found on single pair of chromosome in all the species with variation in their position on chromosomes. The sequencing of 18S rDNA generated 1804, 1805 and 1805 bp long fragments, respectively, in C. catla, L. rohita and C. mrigala with more than 98% sequence identity among them. Similarly, sequencing of 5S rDNA generated 191 bp long fragments in the three species with 100% identity in coding region and 23.2% overall variability in non-transcribed spacer region. Thus, these molecular markers could be used as species-specific markers for taxonomic identification and might help in understanding the genetic diversity, genome organization and karyotype evolution of these species.

  15. The importance of ribosome production, and the 5S RNP–MDM2 pathway, in health and disease

    PubMed Central

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J.

    2016-01-01

    Ribosomes are abundant, large RNA–protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  16. Mitochondrial Fusion Is Essential for Steroid Biosynthesis

    PubMed Central

    Cooke, Mariana; Soria, Gastón; Cornejo Maciel, Fabiana; Gottifredi, Vanesa; Podestá, Ernesto J.

    2012-01-01

    Although the contribution of mitochondrial dynamics (a balance in fusion/fission events and changes in mitochondria subcellular distribution) to key biological process has been reported, the contribution of changes in mitochondrial fusion to achieve efficient steroid production has never been explored. The mitochondria are central during steroid synthesis and different enzymes are localized between the mitochondria and the endoplasmic reticulum to produce the final steroid hormone, thus suggesting that mitochondrial fusion might be relevant for this process. In the present study, we showed that the hormonal stimulation triggers mitochondrial fusion into tubular-shaped structures and we demonstrated that mitochondrial fusion does not only correlate-with but also is an essential step of steroid production, being both events depend on PKA activity. We also demonstrated that the hormone-stimulated relocalization of ERK1/2 in the mitochondrion, a critical step during steroidogenesis, depends on mitochondrial fusion. Additionally, we showed that the SHP2 phosphatase, which is required for full steroidogenesis, simultaneously modulates mitochondrial fusion and ERK1/2 localization in the mitochondrion. Strikingly, we found that mitofusin 2 (Mfn2) expression, a central protein for mitochondrial fusion, is upregulated immediately after hormone stimulation. Moreover, Mfn2 knockdown is sufficient to impair steroid biosynthesis. Together, our findings unveil an essential role for mitochondrial fusion during steroidogenesis. These discoveries highlight the importance of organelles’ reorganization in specialized cells, prompting the exploration of the impact that organelle dynamics has on biological processes that include, but are not limited to, steroid synthesis. PMID:23029265

  17. Biosynthesis and metabolism of steroids in molluscs.

    PubMed

    Fernandes, Denise; Loi, Barbara; Porte, Cinta

    2011-11-01

    Molluscs are the second most diverse animal group, they are ecologically important and they are considered excellent indicators of ecosystem health. Some species have been widely used in pollution biomonitoring programs; however, their endocrinology is still poorly known. Despite some studies reporting the presence of (vertebrate-type) steroids in molluscs, information regarding enzymatic pathways involved in steroid synthesis and further catabolism of those steroids is still fragmentary. Regarding steroidogenesis, a number of excellent studies were performed in the 70s using different radio-labelled steroid precursors and detecting the formation of different metabolites. But, since then a long gap of research exist until the late 90s when the 'endocrine disruption' issue raised the need of a better knowledge of mollusc (and invertebrate) endocrinology in order to assess alterations caused by pollutants. Here we summarize past and recent studies dealing with steroid biosynthesis and metabolism in different mollusc species. Most of these studies suggest the involvement of steroids in mollusc reproduction. However, the knowledge is still fragmentary and many questions remain to be answered.

  18. A Biotin Biosynthesis Gene Restricted to Helicobacter

    PubMed Central

    Bi, Hongkai; Zhu, Lei; Jia, Jia; Cronan, John E.

    2016-01-01

    In most bacteria the last step in synthesis of the pimelate moiety of biotin is cleavage of the ester bond of pimeloyl-acyl carrier protein (ACP) methyl ester. The paradigm cleavage enzyme is Escherichia coli BioH which together with the BioC methyltransferase allows synthesis of the pimelate moiety by a modified fatty acid biosynthetic pathway. Analyses of the extant bacterial genomes showed that bioH is absent from many bioC-containing bacteria and is replaced by other genes. Helicobacter pylori lacks a gene encoding a homologue of the known pimeloyl-ACP methyl ester cleavage enzymes suggesting that it encodes a novel enzyme that cleaves this intermediate. We isolated the H. pylori gene encoding this enzyme, bioV, by complementation of an E. coli bioH deletion strain. Purified BioV cleaved the physiological substrate, pimeloyl-ACP methyl ester to pimeloyl-ACP by use of a catalytic triad, each member of which was essential for activity. The role of BioV in biotin biosynthesis was demonstrated using a reconstituted in vitro desthiobiotin synthesis system. BioV homologues seem the sole pimeloyl-ACP methyl ester esterase present in the Helicobacter species and their occurrence only in H. pylori and close relatives provide a target for development of drugs to specifically treat Helicobacter infections. PMID:26868423

  19. Regulation of mammalian nucleotide metabolism and biosynthesis.

    PubMed

    Lane, Andrew N; Fan, Teresa W-M

    2015-02-27

    Nucleotides are required for a wide variety of biological processes and are constantly synthesized de novo in all cells. When cells proliferate, increased nucleotide synthesis is necessary for DNA replication and for RNA production to support protein synthesis at different stages of the cell cycle, during which these events are regulated at multiple levels. Therefore the synthesis of the precursor nucleotides is also strongly regulated at multiple levels. Nucleotide synthesis is an energy intensive process that uses multiple metabolic pathways across different cell compartments and several sources of carbon and nitrogen. The processes are regulated at the transcription level by a set of master transcription factors but also at the enzyme level by allosteric regulation and feedback inhibition. Here we review the cellular demands of nucleotide biosynthesis, their metabolic pathways and mechanisms of regulation during the cell cycle. The use of stable isotope tracers for delineating the biosynthetic routes of the multiple intersecting pathways and how these are quantitatively controlled under different conditions is also highlighted. Moreover, the importance of nucleotide synthesis for cell viability is discussed and how this may lead to potential new approaches to drug development in diseases such as cancer.

  20. Retinoic acid: its biosynthesis and metabolism.

    PubMed

    Napoli, J L

    1999-01-01

    This article presents a model that integrates the functions of retinoid-binding proteins with retinoid metabolism. One of these proteins, the widely expressed (throughout retinoid target tissues and in all vertebrates) and highly conserved cellular retinol-binding protein (CRBP), sequesters retinol in an internal binding pocket that segregates it from the intracellular milieu. The CRBP-retinol complex appears to be the quantitatively major form of retinol in vivo, and may protect the promiscuous substrate from nonenzymatic degradation and/or non-specific enzymes. For example, at least seven types of dehydrogenases catalyze retinal synthesis from unbound retinol in vitro (NAD+ vs. NADP+ dependent, cytosolic vs. microsomal, short-chain dehydrogenases/reductases vs. medium-chain alcohol dehydrogenases). But only a fraction of these (some of the short-chain de-hydrogenases/reductases) have the fascinating additional ability of catalyzing retinal synthesis from CRBP-bound retinol as well. Similarly, CRBP and/or other retinoid-binding proteins function in the synthesis of retinal esters, the reduction of retinal generated from intestinal beta-carotene metabolism, and retinoic acid metabolism. The discussion details the evidence supporting an integrated model of retinoid-binding protein/metabolism. Also addressed are retinoid-androgen interactions and evidence incompatible with ethanol causing fetal alcohol syndrome by competing directly with retinol dehydrogenation to impair retinoic acid biosynthesis. PMID:10506831

  1. Biosynthesis of cadmium sulphide quantum semiconductor crystallites

    NASA Astrophysics Data System (ADS)

    Dameron, C. T.; Reese, R. N.; Mehra, R. K.; Kortan, A. R.; Carroll, P. J.; Steigerwald, M. L.; Brus, L. E.; Winge, D. R.

    1989-04-01

    NANOMETRE-SCALE semiconductor quantum crystallites exhibit size-dependent and discrete excited electronic states which occur at energies higher than the band gap of the corresponding bulk solid1-4. These crystallites are too small to have continuous energy bands, even though a bulk crystal structure is present. The onset of such quantum properties sets a fundamental limit to device miniaturization in microelectronics5. Structures with either one, two or all three dimensions on the nanometer scale are of particular interest in solid state physics6. We report here our discovery of the biosynthesis of quantum crystallites in yeasts Candida glabrata and Schizosaccharomyces pombe, cultured in the presence of cad-mium salts. Short chelating peptides of general structure (γ-Glu-Cys)n-Gly control the nucleation and growth of CdS crystallites to peptide-capped intracellular particles of diameter 20 Å. These quantum CdS crystallites are more monodisperse than CdS par-ticles synthesized chemically. X-ray data indicate that, at this small size, the CdS structure differs from that of bulk CdS and tends towards a six-coordinate rock-salt structure.

  2. Regulation of mammalian nucleotide metabolism and biosynthesis

    PubMed Central

    Lane, Andrew N.; Fan, Teresa W.-M.

    2015-01-01

    Nucleotides are required for a wide variety of biological processes and are constantly synthesized de novo in all cells. When cells proliferate, increased nucleotide synthesis is necessary for DNA replication and for RNA production to support protein synthesis at different stages of the cell cycle, during which these events are regulated at multiple levels. Therefore the synthesis of the precursor nucleotides is also strongly regulated at multiple levels. Nucleotide synthesis is an energy intensive process that uses multiple metabolic pathways across different cell compartments and several sources of carbon and nitrogen. The processes are regulated at the transcription level by a set of master transcription factors but also at the enzyme level by allosteric regulation and feedback inhibition. Here we review the cellular demands of nucleotide biosynthesis, their metabolic pathways and mechanisms of regulation during the cell cycle. The use of stable isotope tracers for delineating the biosynthetic routes of the multiple intersecting pathways and how these are quantitatively controlled under different conditions is also highlighted. Moreover, the importance of nucleotide synthesis for cell viability is discussed and how this may lead to potential new approaches to drug development in diseases such as cancer. PMID:25628363

  3. Control of triacylglycerol biosynthesis in plants

    SciTech Connect

    Not Available

    1993-01-31

    Seeds of most species of the Umbelliferae (Apiaciae), Araliaceae, and Garryaceae families are characterized by their high content of the unusual C[sub 18] monounsaturated fatty acid petroselinic acid (18:l[Delta][sup 6cis]). Prior to a recent report of this lab, little was known of the biosynthetic origin of the cis[Delta][sup 6] double bond of petroselinic acid. Such knowledge may be of both biochemical and biotechnological significance. Because petroselinic acid is potentially the product of a novel desaturase, information regarding its synthesis may contribute to an understanding of fatty acid desaturation mechanisms in plants. Through chemical cleavage at its double bond, petroselinic acid can be used as a precursor of lauric acid (12:0), a component of detergents and surfactants, and adipic acid (6:0 dicarboxylic), the monomeric component of nylon 6,6. Therefore, the development of an agronomic source of an oil rich in petroselinic acid is of biotechnological interest. As such, studies of petroselinic acid biosynthesis may provide basic information required for any attempt to genetically engineer the production and accumulation of this fatty acid in an existing oilseed.

  4. Lipid Flippases for Bacterial Peptidoglycan Biosynthesis

    PubMed Central

    Ruiz, Natividad

    2015-01-01

    The biosynthesis of cellular polysaccharides and glycoconjugates often involves lipid-linked intermediates that need to be translocated across membranes. Essential pathways such as N-glycosylation in eukaryotes and biogenesis of the peptidoglycan (PG) cell wall in bacteria share a common strategy where nucleotide-sugars are used to build a membrane-bound oligosaccharide precursor that is linked to a phosphorylated isoprenoid lipid. Once made, these lipid-linked intermediates must be translocated across a membrane so that they can serve as substrates in a different cellular compartment. How translocation occurs is poorly understood, although it clearly requires a transporter or flippase. Identification of these transporters is notoriously difficult, and, in particular, the identity of the flippase of lipid II, an intermediate required for PG biogenesis, has been the subject of much debate. Here, I will review the body of work that has recently fueled this controversy, centered on proposed flippase candidates FtsW, MurJ, and AmJ. PMID:26792999

  5. The biosynthesis of sterols in higher plants

    PubMed Central

    Goad, L. J.; Goodwin, T. W.

    1966-01-01

    1. [2-14C]Mevalonate was incorporated into squalene and the major phytosterols of pea and maize leaves; it was also incorporated into compounds belonging to the 4,4-dimethyl and 4α-methyl steroid groups and which may be possible phytosterol intermediates. 2. l-[Me-14C]Methionine was incorporated into the major sterols and also into the 4,4-dimethyl and 4α-methyl steroid groups. No radioactivity was detected in squalene. 3. Under anaerobic conditions incorporation of [2-14C]-mevalonate into the non-saponifiable lipid of pea leaves was drastically decreased but radioactive squalene was accumulated. 4. Cycloartenol, 24-methylenecycloartanol, 24-methylenelophenol, 24-ethylidenelophenol, fucosterol, β-sitosterol, stigmasterol and campesterol have been identified by gas–liquid chromatography in pea leaves. 5. The significance of these results in connexion with phytosterol biosynthesis and the introduction of the alkyl group at C-24 into phytosterols is discussed. ImagesFig. 1. PMID:5964970

  6. Synthetic Biological Approaches to Natural Product Biosynthesis

    PubMed Central

    Winter, Jaclyn M; Tang, Yi

    2012-01-01

    Small molecules produced in Nature continue to be an inspiration for the development of new therapeutic agents. These natural products possess exquisite chemical diversity, which gives rise to their wide range of biological activities. In their host organism, natural products are assembled and modified by dedicated biosynthetic pathways that Nature has meticulously developed. Often times, the complex structures or chemical modifications instated by these pathways are difficult to replicate using traditional synthetic methods. An alternative approach for creating or enhancing the structural variation of natural products is through combinatorial biosynthesis. By rationally reprogramming and manipulating the biosynthetic machinery responsible for their production, unnatural metabolites that were otherwise inaccessible can be obtained. Additionally, new chemical structures can be synthesized or derivatized by developing the enzymes that carry out these complicated chemical reactions into biocatalysts. In this review, we will discuss a variety of combinatorial biosynthetic strategies, their technical challenges, and highlight some recent (since 2007) examples of rationally designed unnatural metabolites, as well as platforms that have been established for the production and modification of clinically important pharmaceutical compounds. PMID:22221832

  7. Biosynthesis, Synthesis and Biological Activities of Pyrrolobenzodiazepines

    PubMed Central

    Gerratana, Barbara

    2014-01-01

    Pyrrolobenzodiazepines (PBDs) are sequence selective DNA alkylating agents with remarkable antineoplastic activity. They are either naturally produced by actinomycetes or synthetically produced. The remarkable broad spectrum of activities of the naturally produced PBDs encouraged the synthesis of several PBDs, including dimeric and hybrid PBDs yielding to an improvement in the DNA binding sequence specificity and in the potency of this class of compounds. However, limitation in the chemical synthesis prevented the testing of one of the most potent PBDs, sibiromycin, a naturally produced glycosylated PBDs. Only recently the biosynthetic gene clusters for PBDs have been identified opening the doors to the production of glycosylated PBDs by mutasynthesis and biosynthetic engineering. The present review describes the recent studies on the biosynthesis of naturally produced pyrrolobenzodiazepines. In addition, it provides an overview on the isolation and characterization of naturally produced PBDs, on the chemical synthesis of PBDs, on the mechanism of DNA alkylation, and on the DNA binding affinity and cytotoxic properties of both naturally produced and synthetic pyrrolobenzodiazepines. PMID:20544978

  8. Mitochondrial fusion is essential for steroid biosynthesis.

    PubMed

    Duarte, Alejandra; Poderoso, Cecilia; Cooke, Mariana; Soria, Gastón; Cornejo Maciel, Fabiana; Gottifredi, Vanesa; Podestá, Ernesto J

    2012-01-01

    Although the contribution of mitochondrial dynamics (a balance in fusion/fission events and changes in mitochondria subcellular distribution) to key biological process has been reported, the contribution of changes in mitochondrial fusion to achieve efficient steroid production has never been explored. The mitochondria are central during steroid synthesis and different enzymes are localized between the mitochondria and the endoplasmic reticulum to produce the final steroid hormone, thus suggesting that mitochondrial fusion might be relevant for this process. In the present study, we showed that the hormonal stimulation triggers mitochondrial fusion into tubular-shaped structures and we demonstrated that mitochondrial fusion does not only correlate-with but also is an essential step of steroid production, being both events depend on PKA activity. We also demonstrated that the hormone-stimulated relocalization of ERK1/2 in the mitochondrion, a critical step during steroidogenesis, depends on mitochondrial fusion. Additionally, we showed that the SHP2 phosphatase, which is required for full steroidogenesis, simultaneously modulates mitochondrial fusion and ERK1/2 localization in the mitochondrion. Strikingly, we found that mitofusin 2 (Mfn2) expression, a central protein for mitochondrial fusion, is upregulated immediately after hormone stimulation. Moreover, Mfn2 knockdown is sufficient to impair steroid biosynthesis. Together, our findings unveil an essential role for mitochondrial fusion during steroidogenesis. These discoveries highlight the importance of organelles' reorganization in specialized cells, prompting the exploration of the impact that organelle dynamics has on biological processes that include, but are not limited to, steroid synthesis.

  9. Biosynthesis of the manumycin group antibiotics

    SciTech Connect

    Thiericke, R.; Zeeck, A. ); Nakagawa, Akira; Omura, Satoshi ); Herrold, R.E.; Wu, S.T.S. ); Beale, J.M.; Floss, H.G. )

    1990-05-09

    The biosynthesis of the manumycin group antibiotics manumycin (1) and asukamycin (2) was studied in Streptomyces parvulus Tue 64 and Streptomyces nodosus ssp. asukaensis ATCC 29,757 by using radioactive and stable isotope tracer techniques and high-field NMR spectroscopy. The results have demonstrated that the central, multifunctional mC{sub 7}N unit typical of this group of antibiotics, which serves as the starter unit for a short polyketide chain, is biosynthesized from a C{sub 4} Krebs cycle and a C{sub 3} triose phosphate pool intermediate by a new pathway, distinct from the shikimate, polyketide, or pentose phosphate routes leading to other mC{sub 7}N units in nature. The C{sub 5} unit in both 1 and 2 arises by a novel intramolecular cyclization of 5-aminolevulinic acid, and a cyclohexane ring and the adjacent carbon in 2 arise from the seven carbon atoms of shikimic acid. The side chains of both antibiotics represent typical polyketide-derived moieties, differing with respect to their combinations of starter and elongation units.

  10. Enzymatic basis of "hybridity" in thiomarinol biosynthesis.

    PubMed

    Dunn, Zachary D; Wever, Walter J; Economou, Nicoleta J; Bowers, Albert A; Li, Bo

    2015-04-20

    Thiomarinol is a naturally occurring double-headed antibiotic that is highly potent against methicillin-resistant Staphylococcus aureus. Its structure comprises two antimicrobial subcomponents, pseudomonic acid analogue and holothin, linked by an amide bond. TmlU was thought to be the sole enzyme responsible for this amide-bond formation. In contrast to this idea, we show that TmlU acts as a CoA ligase that activates pseudomonic acid as a thioester that is processed by the acetyltransferase HolE to catalyze the amidation. TmlU prefers complex acyl acids as substrates, whereas HolE is relatively promiscuous, accepting a range of acyl-CoA and amine substrates. Our results provide detailed biochemical information on thiomarinol biosynthesis, and evolutionary insight regarding how the pseudomonic acid and holothin pathways converge to generate this potent hybrid antibiotic. This work also demonstrates the potential of TmlU/HolE enzymes as engineering tools to generate new "hybrid" molecules. PMID:25726835

  11. Biosynthesis of plasmenylcholine in guinea pig heart

    SciTech Connect

    Wientzek, M.; Choy, P.C.

    1986-05-01

    In some mammalian hearts, up to 40% of the choline phosphoglyceride (CPG) exists as plasmenylcholine (1-alkenyl-2-acyl-glycero-3-phosphocholine). Although the majority of diacylphosphatidylcholine (PC) in mammalian hearts is synthesized from choline via the CDP-choline pathway, the formation of plasmenylcholine from choline was not known. In this study, they investigated the biosynthesis of plasmenyl-choline in the isolated guinea pig heart by perfusion with (/sup 3/H)choline. Labelled choline containing metabolites and labelled plasmenylcholine were isolated and determined at different perfusion time points. Significant amounts of labelling were found only in choline, phosphocholine, CDP-choline, plasmenyl-choline and PC. In addition, a precursor-product relationship was observed between the labelling of CDP-choline and plasmenylcholine. Such a relationship was not observed between choline and plasmenylcholine. Hence, they postulate that the incorporation of choline into plasmenylcholine is via the CDP-choline pathway and not via base exchange. The ability to condense 1-alkenyl-2-acyl-glycerol with CDP-choline was also demonstrated in vitro with guinea pig heart microsomes.

  12. Heme biosynthesis and its regulation: towards understanding and improvement of heme biosynthesis in filamentous fungi.

    PubMed

    Franken, Angelique C W; Lokman, B Christien; Ram, Arthur F J; Punt, Peter J; van den Hondel, Cees A M J J; de Weert, Sandra

    2011-08-01

    Heme biosynthesis in fungal host strains has acquired considerable interest in relation to the production of secreted heme-containing peroxidases. Class II peroxidase enzymes have been suggested as eco-friendly replacements of polluting chemical processes in industry. These peroxidases are naturally produced in small amounts by basidiomycetes. Filamentous fungi like Aspergillus sp. are considered as suitable hosts for protein production due to their high capacity of protein secretion. For the purpose of peroxidase production, heme is considered a putative limiting factor. However, heme addition is not appropriate in large-scale production processes due to its high hydrophobicity and cost price. The preferred situation in order to overcome the limiting effect of heme would be to increase intracellular heme levels. This requires a thorough insight into the biosynthetic pathway and its regulation. In this review, the heme biosynthetic pathway is discussed with regards to synthesis, regulation, and transport. Although the heme biosynthetic pathway is a highly conserved and tightly regulated pathway, the mode of regulation does not appear to be conserved among eukaryotes. However, common factors like feedback inhibition and regulation by heme, iron, and oxygen appear to be involved in regulation of the heme biosynthesis pathway in most organisms. Therefore, they are the initial targets to be investigated in Aspergillus niger. PMID:21687966

  13. Two linear regression models predicting cumulative dynamic L5/S1 joint moment during a range of lifting tasks based on static postures.

    PubMed

    Xu, Xu; Chang, Chien-Chi; Lu, Ming-Lun

    2012-01-01

    Previous studies have indicated that cumulative L5/S1 joint load is a potential risk factor for low back pain. The assessment of cumulative L5/S1 joint load during a field study is challenging due to the difficulty of continuously monitoring the dynamic joint load. This study proposes two regression models predicting cumulative dynamic L5/S1 joint moment based on the static L5/S1 joint moment of a lifting task at lift-off and set-down and the lift duration. Twelve men performed lifting tasks at varying lifting ranges and asymmetric angles in a laboratory environment. The cumulative L5/S1 joint moment was calculated from continuous dynamic L5/S1 moments as the reference for comparison. The static L5/S1 joint moments at lift-off and set-down were measured for the two regression models. The prediction error of the cumulative L5/S1 joint moment was 21 ± 14 Nm × s (12% of the measured cumulative L5/S1 joint moment) and 14 ± 9 Nm × s (8%) for the first and the second models, respectively. Practitioner Summary: The proposed regression models may provide a practical approach for predicting the cumulative dynamic L5/S1 joint loading of a lifting task for field studies since it requires only the lifting duration and the static moments at the lift-off and/or set-down instants of the lift.

  14. Macromolecular syntheses during biosynthesis of prodigiosin by Serratia marcescens.

    PubMed

    Williams, R P; Scott, R H; Lim, D V; Qadri, S M

    1976-01-01

    Amino acids that were utilized as sole sources of carbon and nitrogen for growth of Serratia marcescens Nima resulted in biosynthesis of prodigiosin in non-proliferating bacteria. Addition of alanine, proline, or histidine to non-proliferating cells incubated at 27 C increased the rate of protein synthesis and also caused biosynthesis of prodigiosin. No increase in the rate of protein synthesis was observed upon the addition of amino acids that did not stimulate prodigiosin biosynthesis. Increased rates of synthesis of ribonucleic acid (RNA) and of deoxyribonucleic acid (DNA) (a small amount) also occurred after addition of amino acids that resulted in biosynthesis of prodigiosin. After incubation of 24 h, the total amount of protein in suspensions of bacteria to which alanine or proline was added increased 67 and 98%, respectively. Total amounts of DNA and of RNA also increased before synthesis of prodigiosin. The amounts of these macromolecules did not increase after addition of amino acids that did not induce biosynthesis of progidiosin. However, macromolecular synthesis was not related only to prodigiosin biosynthesis because the rates of DNA, RNA, and protein synthesis also increased in suspensions of bacteria incubated with proline at 39 C, at which temperature no prodigiosin was synthesized. The quantities of DNA, RNA, and protein synthesized were lower in non-proliferating cells than in growing cells. The data indicated that amino acids causing biosynthesis of prodigiosin in non-proliferating cells must be metabolized and serve as sources of carbon and of nitrogen for synthesis of macromolecules and intermediates. Prodigiosin was synthesized secondarily to these primary metabolic events.

  15. Vitamin B6 biosynthesis in higher plants

    PubMed Central

    Tambasco-Studart, Marina; Titiz, Olca; Raschle, Thomas; Forster, Gabriela; Amrhein, Nikolaus; Fitzpatrick, Teresa B.

    2005-01-01

    Vitamin B6 is an essential metabolite in all organisms. It can act as a coenzyme for numerous metabolic enzymes and has recently been shown to be a potent antioxidant. Plants and microorganisms have a de novo biosynthetic pathway for vitamin B6, but animals must obtain it from dietary sources. In Escherichia coli, it is known that the vitamin is derived from deoxyxylulose 5-phosphate (an intermediate in the nonmevalonate pathway of isoprenoid biosynthesis) and 4-phosphohydroxy-l-threonine. It has been assumed that vitamin B6 is synthesized in the same way in plants, but this hypothesis has never been experimentally proven. Here, we show that, in plants, synthesis of the vitamin takes an entirely different route, which does not involve deoxyxylulose 5-phosphate but instead utilizes intermediates from the pentose phosphate pathway, i.e., ribose 5-phosphate or ribulose 5-phosphate, and from glycolysis, i.e., dihydroxyacetone phosphate or glyceraldehyde 3-phosphate. The revelation is based on the recent discovery that, in bacteria and fungi, a novel pathway is in place that involves two genes (PDX1 and PDX2), neither of which is homologous to any of those involved in the previously doctrined E. coli pathway. We demonstrate that Arabidopsis thaliana has two functional homologs of PDX1 and a single homolog of PDX2. Furthermore, and contrary to what was inferred previously, we show that the pathway appears to be cytosolic and is not localized to the plastid. Last, we report that the single PDX2 homolog is essential for plant viability. PMID:16157873

  16. Coenzyme Q biosynthesis in health and disease.

    PubMed

    Acosta, Manuel Jesús; Vazquez Fonseca, Luis; Desbats, Maria Andrea; Cerqua, Cristina; Zordan, Roberta; Trevisson, Eva; Salviati, Leonardo

    2016-08-01

    Coenzyme Q (CoQ, or ubiquinone) is a remarkable lipid that plays an essential role in mitochondria as an electron shuttle between complexes I and II of the respiratory chain, and complex III. It is also a cofactor of other dehydrogenases, a modulator of the permeability transition pore and an essential antioxidant. CoQ is synthesized in mitochondria by a set of at least 12 proteins that form a multiprotein complex. The exact composition of this complex is still unclear. Most of the genes involved in CoQ biosynthesis (COQ genes) have been studied in yeast and have mammalian orthologues. Some of them encode enzymes involved in the modification of the quinone ring of CoQ, but for others the precise function is unknown. Two genes appear to have a regulatory role: COQ8 (and its human counterparts ADCK3 and ADCK4) encodes a putative kinase, while PTC7 encodes a phosphatase required for the activation of Coq7. Mutations in human COQ genes cause primary CoQ(10) deficiency, a clinically heterogeneous mitochondrial disorder with onset from birth to the seventh decade, and with clinical manifestation ranging from fatal multisystem disorders, to isolated encephalopathy or nephropathy. The pathogenesis of CoQ(10) deficiency involves deficient ATP production and excessive ROS formation, but possibly other aspects of CoQ(10) function are implicated. CoQ(10) deficiency is unique among mitochondrial disorders since an effective treatment is available. Many patients respond to oral CoQ(10) supplementation. Nevertheless, treatment is still problematic because of the low bioavailability of the compound, and novel pharmacological approaches are currently being investigated. This article is part of a Special Issue entitled 'EBEC 2016: 19th European Bioenergetics Conference, Riva del Garda, Italy, July 2-6, 2016', edited by Prof. Paolo Bernardi. PMID:27060254

  17. Coenzyme Q biosynthesis in health and disease.

    PubMed

    Acosta, Manuel Jesús; Vazquez Fonseca, Luis; Desbats, Maria Andrea; Cerqua, Cristina; Zordan, Roberta; Trevisson, Eva; Salviati, Leonardo

    2016-08-01

    Coenzyme Q (CoQ, or ubiquinone) is a remarkable lipid that plays an essential role in mitochondria as an electron shuttle between complexes I and II of the respiratory chain, and complex III. It is also a cofactor of other dehydrogenases, a modulator of the permeability transition pore and an essential antioxidant. CoQ is synthesized in mitochondria by a set of at least 12 proteins that form a multiprotein complex. The exact composition of this complex is still unclear. Most of the genes involved in CoQ biosynthesis (COQ genes) have been studied in yeast and have mammalian orthologues. Some of them encode enzymes involved in the modification of the quinone ring of CoQ, but for others the precise function is unknown. Two genes appear to have a regulatory role: COQ8 (and its human counterparts ADCK3 and ADCK4) encodes a putative kinase, while PTC7 encodes a phosphatase required for the activation of Coq7. Mutations in human COQ genes cause primary CoQ(10) deficiency, a clinically heterogeneous mitochondrial disorder with onset from birth to the seventh decade, and with clinical manifestation ranging from fatal multisystem disorders, to isolated encephalopathy or nephropathy. The pathogenesis of CoQ(10) deficiency involves deficient ATP production and excessive ROS formation, but possibly other aspects of CoQ(10) function are implicated. CoQ(10) deficiency is unique among mitochondrial disorders since an effective treatment is available. Many patients respond to oral CoQ(10) supplementation. Nevertheless, treatment is still problematic because of the low bioavailability of the compound, and novel pharmacological approaches are currently being investigated. This article is part of a Special Issue entitled 'EBEC 2016: 19th European Bioenergetics Conference, Riva del Garda, Italy, July 2-6, 2016', edited by Prof. Paolo Bernardi.

  18. Soybean oil biosynthesis: role of diacylglycerol acyltransferases.

    PubMed

    Li, Runzhi; Hatanaka, Tomoko; Yu, Keshun; Wu, Yongmei; Fukushige, Hirotada; Hildebrand, David

    2013-03-01

    Diacylglycerol acyltransferase (DGAT) catalyzes the acyl-CoA-dependent acylation of sn-1,2-diacylglycerol to form seed oil triacylglycerol (TAG). To understand the features of genes encoding soybean (Glycine max) DGATs and possible roles in soybean seed oil synthesis and accumulation, two full-length cDNAs encoding type 1 diacylglycerol acyltransferases (GmDGAT1A and GmDGAT1B) were cloned from developing soybean seeds. These coding sequences share identities of 94 % and 95 % in protein and DNA sequences. The genomic architectures of GmDGAT1A and GmDGAT1B both contain 15 introns and 16 exons. Differences in the lengths of the first exon and most of the introns were found between GmDGAT1A and GmDGAT1B genomic sequences. Furthermore, detailed in silico analysis revealed a third predicted DGAT1, GmDGAT1C. GmDGAT1A and GmDGAT1B were found to have similar activity levels and substrate specificities. Oleoyl-CoA and sn-1,2-diacylglycerol were preferred substrates over vernoloyl-CoA and sn-1,2-divernoloylglycerol. Both transcripts are much more abundant in developing seeds than in other tissues including leaves, stem, roots, and flowers. Both soybean DGAT1A and DGAT1B are highly expressed at developing seed stages of maximal TAG accumulation with DGAT1B showing highest expression at somewhat later stages than DGAT1A. DGAT1A and DGAT1B show expression profiles consistent with important roles in soybean seed oil biosynthesis and accumulation.

  19. Biosynthesis of the Aromatic Amino Acids.

    PubMed

    Pittard, James; Yang, Ji

    2008-09-01

    This chapter describes in detail the genes and proteins of Escherichia coli involved in the biosynthesis and transport of the three aromatic amino acids tyrosine, phenylalanine, and tryptophan. It provides a historical perspective on the elaboration of the various reactions of the common pathway converting erythrose-4-phosphate and phosphoenolpyruvate to chorismate and those of the three terminal pathways converting chorismate to phenylalanine, tyrosine, and tryptophan. The regulation of key reactions by feedback inhibition, attenuation, repression, and activation are also discussed. Two regulatory proteins, TrpR (108 amino acids) and TyrR (513 amino acids), play a major role in transcriptional regulation. The TrpR protein functions only as a dimer which, in the presence of tryptophan, represses the expression of trp operon plus four other genes (the TrpR regulon). The TyrR protein, which can function both as a dimer and as a hexamer, regulates the expression of nine genes constituting the TyrR regulon. TyrR can bind each of the three aromatic amino acids and ATP and under their influence can act as a repressor or activator of gene expression. The various domains of this protein involved in binding the aromatic amino acids and ATP, recognizing DNA binding sites, interacting with the alpha subunit of RNA polymerase, and changing from a monomer to a dimer or a hexamer are all described. There is also an analysis of the various strategies which allow TyrR in conjunction with particular amino acids to differentially affect the expression of individual genes of the TyrR regulon. PMID:26443741

  20. Dithiolopyrrolone Natural Products: Isolation, Synthesis and Biosynthesis

    PubMed Central

    Qin, Zhiwei; Huang, Sheng; Yu, Yi; Deng, Hai

    2013-01-01

    Dithiolopyrrolones are a class of antibiotics that possess the unique pyrrolinonodithiole (4H-[1,2] dithiolo [4,3-b] pyrrol-5-one) skeleton linked to two variable acyl groups. To date, there are approximately 30 naturally occurring dithiolopyrrolone compounds, including holomycin, thiolutin, and aureothricin, and more recently thiomarinols, a unique class of hybrid marine bacterial natural products containing a dithiolopyrrolone framework linked by an amide bridge with an 8-hydroxyoctanoyl chain linked to a monic acid. Generally, dithiolopyrrolone antibiotics have broad-spectrum antibacterial activity against various microorganisms, including Gram-positive and Gram-negative bacteria, and even parasites. Holomycin appeared to be active against rifamycin-resistant bacteria and also inhibit the growth of the clinical pathogen methicillin-resistant Staphylococcus aureus N315. Its mode of action is believed to inhibit RNA synthesis although the exact mechanism has yet to be established in vitro. A recent work demonstrated that the fish pathogen Yersinia ruckeri employs an RNA methyltransferase for self-resistance during the holomycin production. Moreover, some dithiolopyrrolone derivatives have demonstrated promising antitumor activities. The biosynthetic gene clusters of holomycin have recently been identified in S. clavuligerus and characterized biochemically and genetically. The biosynthetic gene cluster of thiomarinol was also identified from the marine bacterium Pseudoalteromonas sp. SANK 73390, which was uniquely encoded by two independent pathways for pseudomonic acid and pyrrothine in a novel plasmid. The aim of this review is to give an overview about the isolations, characterizations, synthesis, biosynthesis, bioactivities and mode of action of this unique family of dithiolopyrrolone natural products, focusing on the period from 1940s until now. PMID:24141227

  1. Microdecompression for Extraforaminal L5-S1 Disc Herniation; The Significance of Concomitant Foraminal Disc Herniation for Postoperative Leg Pain

    PubMed Central

    Lee, Dong Yeob

    2008-01-01

    Objective To analyze the relationship of concomitant foraminal lumbar disc herniation (FLDH) with postoperative leg pain after microdecompression for extraforaminal lumbar disc herniation (EFLDH) at the L5-S1 level. Methods Sixty-five patients who underwent microdecompression for symptomatic EFLDH at the L5-S1 level were enrolled. According to the severity of accompanying FLDH, EFLDH was classified into four categories (Class I : no FLDH; Class II : mild to moderate FLDH confined within a lateral foraminal zone; Class III : severe FLDH extending to a medial foraminal zone; Class IV : Class III with intracanalicular disc herniation). The incidence of postoperative leg pain, dysesthesia, analgesic medication, epidural block, and requirement for revision surgery due to leg pain were evaluated and compared at three months after initial surgery. Results The incidences of postoperative leg pain and dysesthesia were 36.9% and 26.1%, respectively. Pain medication and epidural block was performed on 40% and 41.5%, respectively. Revision surgery was recommended in six patients (9.2%) due to persistent leg pain. The incidences of leg pain, dysesthesia, and requirement for epidural block were higher in Class III/IV, compared with Class I/II. The incidence of requirement for analgesic medication was significantly higher in Class III/IV, compared with Class I/II (p=0.02, odds ratio=9.82). All patients who required revision surgery due to persistent leg pain were included in Class III/IV. Conclusion Concomitant FLDH seems related to postoperative residual leg pain after microdecompression for EFLDH at the L5-S1 level. PMID:19096652

  2. Measurement of the photoionization cross section of the 5S{sub 1/2} state of rubidium

    SciTech Connect

    Lowell, J.R.; Northup, T.; Patterson, B.M.; Takekoshi, T.; Knize, R.J.

    2002-12-01

    We report the measurement of the photoionization cross section for the 5S{sub 1/2} state of rubidium, using atoms confined in a magneto-optical trap. A single-photon rate at {lambda}=266 nm was found by monitoring the decay of trap fluorescence after exposure to ionizing radiation from a quadrupled Nd:YVO{sub 4} laser. In order to eliminate excited-state ionization, the photoionization and trapping lasers were alternately chopped, so that only ground-state atoms were ionized. We determine that the photoionization cross section at {lambda}=266 nm is {sigma}=1.7(2)x10{sup -20} cm{sup 2}.

  3. In Vivo Production of Small Recombinant RNAs Embedded in a 5S rRNA-Derived Protective Scaffold.

    PubMed

    Stepanov, Victor G; Fox, George E

    2015-01-01

    Preparative synthesis of RNA is a challenging task that is usually accomplished using either chemical or enzymatic polymerization of ribonucleotides in vitro. Herein, we describe an alternative approach in which RNAs of interest are expressed as a fusion with a 5S rRNA-derived scaffold. The scaffold provides protection against cellular ribonucleases resulting in cellular accumulations comparable to those of regular ribosomal RNAs. After isolation of the chimeric RNA from the cells, the scaffold can be removed if necessary by deoxyribozyme-catalyzed cleavage followed by preparative electrophoretic separation of the cleavage reaction products. The protocol is designed for sustained production of high quality RNA on the milligram scale.

  4. Recent advances in combinatorial biosynthesis for drug discovery

    PubMed Central

    Sun, Huihua; Liu, Zihe; Zhao, Huimin; Ang, Ee Lui

    2015-01-01

    Because of extraordinary structural diversity and broad biological activities, natural products have played a significant role in drug discovery. These therapeutically important secondary metabolites are assembled and modified by dedicated biosynthetic pathways in their host living organisms. Traditionally, chemists have attempted to synthesize natural product analogs that are important sources of new drugs. However, the extraordinary structural complexity of natural products sometimes makes it challenging for traditional chemical synthesis, which usually involves multiple steps, harsh conditions, toxic organic solvents, and byproduct wastes. In contrast, combinatorial biosynthesis exploits substrate promiscuity and employs engineered enzymes and pathways to produce novel “unnatural” natural products, substantially expanding the structural diversity of natural products with potential pharmaceutical value. Thus, combinatorial biosynthesis provides an environmentally friendly way to produce natural product analogs. Efficient expression of the combinatorial biosynthetic pathway in genetically tractable heterologous hosts can increase the titer of the compound, eventually resulting in less expensive drugs. In this review, we will discuss three major strategies for combinatorial biosynthesis: 1) precursor-directed biosynthesis; 2) enzyme-level modification, which includes swapping of the entire domains, modules and subunits, site-specific mutagenesis, and directed evolution; 3) pathway-level recombination. Recent examples of combinatorial biosynthesis employing these strategies will also be highlighted in this review. PMID:25709407

  5. Recent advances in combinatorial biosynthesis for drug discovery.

    PubMed

    Sun, Huihua; Liu, Zihe; Zhao, Huimin; Ang, Ee Lui

    2015-01-01

    Because of extraordinary structural diversity and broad biological activities, natural products have played a significant role in drug discovery. These therapeutically important secondary metabolites are assembled and modified by dedicated biosynthetic pathways in their host living organisms. Traditionally, chemists have attempted to synthesize natural product analogs that are important sources of new drugs. However, the extraordinary structural complexity of natural products sometimes makes it challenging for traditional chemical synthesis, which usually involves multiple steps, harsh conditions, toxic organic solvents, and byproduct wastes. In contrast, combinatorial biosynthesis exploits substrate promiscuity and employs engineered enzymes and pathways to produce novel "unnatural" natural products, substantially expanding the structural diversity of natural products with potential pharmaceutical value. Thus, combinatorial biosynthesis provides an environmentally friendly way to produce natural product analogs. Efficient expression of the combinatorial biosynthetic pathway in genetically tractable heterologous hosts can increase the titer of the compound, eventually resulting in less expensive drugs. In this review, we will discuss three major strategies for combinatorial biosynthesis: 1) precursor-directed biosynthesis; 2) enzyme-level modification, which includes swapping of the entire domains, modules and subunits, site-specific mutagenesis, and directed evolution; 3) pathway-level recombination. Recent examples of combinatorial biosynthesis employing these strategies will also be highlighted in this review.

  6. Structural and functional exchangeability of 5 S RNA species from the eubacterium E.coli and the thermoacidophilic archaebacterium Sulfolobus solfataricus.

    PubMed Central

    Teixidò, J; Altamura, S; Londei, P; Amils, R

    1989-01-01

    The role of 5 S RNA within the large ribosomal subunit of the extremely thermophilic archaebacterium Sulfolobus solfataricus has been analysed by means of in vitro reconstitution procedures. It is shown that Sulfolobus 50 S subunits reconstituted in the absence of 5 S RNA are inactive in protein synthesis and lack 2-3 ribosomal proteins. Furthermore, it has been determined that in the course of the in vitro assembly process Sulfolobus 5 S RNA can be replaced by the correspondent RNA species of E.coli; Sulfolobus reconstituted particles containing the eubacterial 5 S molecule are stable and active in polypeptide synthesis at high temperatures. Images PMID:2493632

  7. Absolute photoabsorption cross sections of Sr I from the 5s ionization threshold to the 5p threshold

    NASA Astrophysics Data System (ADS)

    Chu, C. C.; Fung, H. S.; Wu, H. H.; Yih, T. S.

    1998-09-01

    We have measured the absolute photoabsorption cross sections of Sr I from its 5s ionization threshold up to the 0953-4075/31/17/010/img1 thresholds. The spectrum includes the Sr I 0953-4075/31/17/010/img2, 0953-4075/31/17/010/img3, 0953-4075/31/17/010/img4 and 0953-4075/31/17/010/img5 doubly excited series which converge to the 0953-4075/31/17/010/img6 or 0953-4075/31/17/010/img1 series limits. Synchrotron radiation, from the 1 m Seya-Namioka beam line of the Synchrotron Radiation Research Center at Hsin-Chu, Taiwan, was used as the background continuum. The absolute column density was determined by measuring simultaneously the temperature distribution profiles and the total pressure in a heatpipe. Absolute cross sections were obtained using the Beer-Lambert law. The measured absolute cross section for the 5s ionization threshold was 0953-4075/31/17/010/img8. At the most significant autoionizing resonance, 0953-4075/31/17/010/img9 around 0953-4075/31/17/010/img10, the absolute cross section was measured as 0953-4075/31/17/010/img11. The absolute cross sections presented here are larger than those based on saturated vapour-pressure data, and less than those based on the f-value measurements. All the absolute cross sections in this work are compared with both recent experiments and

  8. Thickness-Dependent and Magnetic-Field-Driven Suppression of Antiferromagnetic Order in Thin V5S8 Single Crystals.

    PubMed

    Hardy, Will J; Yuan, Jiangtan; Guo, Hua; Zhou, Panpan; Lou, Jun; Natelson, Douglas

    2016-06-28

    With materials approaching the 2D limit yielding many exciting systems with intriguing physical properties and promising technological functionalities, understanding and engineering magnetic order in nanoscale, layered materials is generating keen interest. One such material is V5S8, a metal with an antiferromagnetic ground state below the Néel temperature TN ∼ 32 K and a prominent spin-flop signature in the magnetoresistance (MR) when H∥c ∼ 4.2 T. Here we study nanoscale-thickness single crystals of V5S8, focusing on temperatures close to TN and the evolution of material properties in response to systematic reduction in crystal thickness. Transport measurements just below TN reveal magnetic hysteresis that we ascribe to a metamagnetic transition, the first-order magnetic-field-driven breakdown of the ordered state. The reduction of crystal thickness to ∼10 nm coincides with systematic changes in the magnetic response: TN falls, implying that antiferromagnetism is suppressed; and while the spin-flop signature remains, the hysteresis disappears, implying that the metamagnetic transition becomes second order as the thickness approaches the 2D limit. This work demonstrates that single crystals of magnetic materials with nanometer thicknesses are promising systems for future studies of magnetism in reduced dimensionality and quantum phase transitions.

  9. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae).

    PubMed

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country's economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 'Azul', Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700

  10. 5S program to reduce change-over time on forming department (case study on CV Piranti Works temanggung)

    NASA Astrophysics Data System (ADS)

    Rosiana Dewi, Septika; Setiawan, Budi; P, Susatyo Nugroho W.

    2013-06-01

    Productivity is one aspect that determines the success of a company in the competitive world of business. There are seven main types of activities that do not have value-added in manufacturing processes such as overproduction, waiting time, transportation, excess inventory, unnecessary motion and defects. The whole activity is a waste (waste) that can cause harm to the Company. Therefore, in production activities is important to pay attention so that the objectives of production productivity can be achieved. Problems experienced by CV Piranti Works is a production target is not achieved resulting in a lost sale raises the cost of which can cause harm to the Company. From the analysis conducted major known cause of the problem is the length of time required for changeover. This is supported by the high non-value added activity in the changeover activities. Lean Manufacturing is an approach to make system more efficient by reducing waste. This study refers to the book compiled by Takashi Osada (2004) and several other references. In this research used method 5S (Seiri, Seiton, Seiso, Seiketsu, and Shitsuke) for the of forming departement. The purpose of this research is to design a work environment using the 5S method (Seiri, Seiton, Seiso, Seiketsu, and Shitsuke) and make arrangement of equipment and working tool cabinet design with TRIZ methods. From these results, is expected to eliminate or reduce of non-value added activity and improved the changeover time so as to meet production targets completion of the company.

  11. Li(V0.5Ti0.5)S2 as a 1 V lithium intercalation electrode

    NASA Astrophysics Data System (ADS)

    Clark, Steve J.; Wang, Da; Armstrong, A. Robert; Bruce, Peter G.

    2016-03-01

    Graphite, the dominant anode in rechargeable lithium batteries, operates at ~0.1 V versus Li+/Li and can result in lithium plating on the graphite surface, raising safety concerns. Titanates, for example, Li4Ti5O12, intercalate lithium at~1.6 V versus Li+/Li, avoiding problematic lithium plating at the expense of reduced cell voltage. There is interest in 1 V anodes, as this voltage is sufficiently high to avoid lithium plating while not significantly reducing cell potential. The sulfides, LiVS2 and LiTiS2, have been investigated as possible 1 V intercalation electrodes but suffer from capacity fading, large 1st cycle irreversible capacity or polarization. Here we report that the 50/50 solid solution, Li1+x(V0.5Ti0.5)S2, delivers a reversible capacity to store charge of 220 mAhg-1 (at 0.9 V), 99% of theoretical, at a rate of C/2, retaining 205 mAhg-1 at C-rate (92% of theoretical). Rate capability is excellent with 200 mAhg-1 at 3C. C-rate is discharge in 1 h. Polarization is low, 100 mV at C/2. To the best of our knowledge, the properties/performances of Li(V0.5Ti0.5)S2 exceed all previous 1 V electrodes.

  12. Physical mapping of 18S and 5S genes in pelagic species of the genera Caranx and Carangoides (Carangidae).

    PubMed

    Jacobina, U P; Bertollo, L A C; Bello Cioffi, M; Molina, W F

    2014-11-14

    In Carangidae, Caranx is taxonomically controversial because of slight morphological differences among species, as well as because of its relationship with the genus Carangoides. Cytogenetic data has contributed to taxonomic and phylogenetic classification for some groups of fish. In this study, we examined the chromosomes of Caranx latus, Caranx lugubris, and Carangoides bartholomaei using classical methods, including conventional staining, C-banding, silver staining for nuclear organizer regions, base-specific fluorochrome, and 18S and 5S ribosomal sequence mapping using in situ hybridization. These 3 species showed chromosome numbers of 2n = 48, simple nuclear organizer regions (pair 1), and mainly centromeric heterochomatin. However, C. latus (NF = 50) and C. bartholomaei (NF = 50) showed a structurally conserved karyotype compared with C. lugubris (NF = 54), with a larger number of 2-armed chromosomes. The richness of GC-positive heterochromatic segments and sites in 5S rDNA in specific locations compared to the other 2 species reinforce the higher evolutionary dynamism in C. lugubris. Cytogenetic aspects shared between C. latus and C. bartholomaei confirm the remarkable phylogenetic proximity between these genera.

  13. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae)

    PubMed Central

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Abstract Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 ‘Azul’, Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700

  14. Biosynthesis of the pyrimidine moiety of thiamine. A new route of pyrimidine biosynthesis involving purine intermediates

    PubMed Central

    Newell, P. C.; Tucker, R. G.

    1968-01-01

    1. The pattern of distribution on the purine pathway of mutants of Salmonella typhimurium LT2 that had the double growth requirement for a purine plus the pyrimidine moiety of thiamine (ath mutants) indicated that purines and the pyrimidine moiety of thiamine share the early part of their biosynthetic pathways, and that 4-aminoimidazole ribonucleotide (AIR) is the last common intermediate. Two mutants that at first appeared anomalous were further investigated and found not to affect this deduction. 2. The ribonucleoside form of AIR (AIRs) satisfied the requirements both for a purine and for the pyrimidine moiety of thiamine of an ath mutant. 3. Methionine was required for the conversion of AIR into the pyrimidine moiety. 4. Radioactive AIRs was converted into radioactive pyrimidine moiety by an ath mutant without significant dilution of specific radioactivity. 5. Possible mechanisms for pyrimidine-moiety biosynthesis from AIR are discussed. PMID:4889364

  15. Carotenoid biosynthesis and overproduction in Corynebacterium glutamicum

    PubMed Central

    2012-01-01

    Background Corynebacterium glutamicum contains the glycosylated C50 carotenoid decaprenoxanthin as yellow pigment. Starting from isopentenyl pyrophosphate, which is generated in the non-mevalonate pathway, decaprenoxanthin is synthesized via the intermediates farnesyl pyrophosphate, geranylgeranyl pyrophosphate, lycopene and flavuxanthin. Results Here, we showed that the genes of the carotenoid gene cluster crtE-cg0722-crtBIYeYfEb are co-transcribed and characterized defined gene deletion mutants. Gene deletion analysis revealed that crtI, crtEb, and crtYeYf, respectively, code for the only phytoene desaturase, lycopene elongase, and carotenoid C45/C50 ɛ-cyclase, respectively. However, the genome of C. glutamicum also encodes a second carotenoid gene cluster comprising crtB2I2-1/2 shown to be co-transcribed, as well. Ectopic expression of crtB2 could compensate for the lack of phytoene synthase CrtB in C. glutamicum ΔcrtB, thus, C. glutamicum possesses two functional phytoene synthases, namely CrtB and CrtB2. Genetic evidence for a crtI2-1/2 encoded phytoene desaturase could not be obtained since plasmid-borne expression of crtI2-1/2 did not compensate for the lack of phytoene desaturase CrtI in C. glutamicum ΔcrtI. The potential of C. glutamicum to overproduce carotenoids was estimated with lycopene as example. Deletion of the gene crtEb prevented conversion of lycopene to decaprenoxanthin and entailed accumulation of lycopene to 0.03 ± 0.01 mg/g cell dry weight (CDW). When the genes crtE, crtB and crtI for conversion of geranylgeranyl pyrophosphate to lycopene were overexpressed in C. glutamicum ΔcrtEb intensely red-pigmented cells and an 80 fold increased lycopene content of 2.4 ± 0.3 mg/g CDW were obtained. Conclusion C. glutamicum possesses a certain degree of redundancy in the biosynthesis of the C50 carotenoid decaprenoxanthin as it possesses two functional phytoene synthase genes. Already metabolic engineering of only the terminal reactions

  16. Quinolizidine alkaloid biosynthesis: recent advances and future prospects

    PubMed Central

    Bunsupa, Somnuk; Yamazaki, Mami; Saito, Kazuki

    2012-01-01

    Lys-derived alkaloids, including piperidine, quinolizidine, indolizidine, and lycopodium alkaloids, are widely distributed throughout the plant kingdom. Several of these alkaloids have beneficial properties for humans and have been used in medicine. However, the molecular mechanisms underlying the biosynthesis of these alkaloids are not well understood. In the present article, we discuss recent advances in our understanding of Lys-derived alkaloids, especially the biochemistry, molecular biology, and biotechnology of quinolizidine alkaloid (QA) biosynthesis. We have also highlighted Lys decarboxylase (LDC), the enzyme that catalyzes the first committed step of QA biosynthesis and answers a longstanding question about the molecular entity of LDC activity in plants. Further prospects using current advanced technologies, such as next-generation sequencing, in medicinal plants have also been discussed. PMID:23112802

  17. Inhibitors of amino acids biosynthesis as antifungal agents.

    PubMed

    Jastrzębowska, Kamila; Gabriel, Iwona

    2015-02-01

    Fungal microorganisms, including the human pathogenic yeast and filamentous fungi, are able to synthesize all proteinogenic amino acids, including nine that are essential for humans. A number of enzymes catalyzing particular steps of human-essential amino acid biosynthesis are fungi specific. Numerous studies have shown that auxotrophic mutants of human pathogenic fungi impaired in biosynthesis of particular amino acids exhibit growth defect or at least reduced virulence under in vivo conditions. Several chemical compounds inhibiting activity of one of these enzymes exhibit good antifungal in vitro activity in minimal growth media, which is not always confirmed under in vivo conditions. This article provides a comprehensive overview of the present knowledge on pathways of amino acids biosynthesis in fungi, with a special emphasis put on enzymes catalyzing particular steps of these pathways as potential targets for antifungal chemotherapy.

  18. Enzyme biosynthesis in bacteria as a basis for toxicity testing

    SciTech Connect

    Dutton, R.J.

    1988-01-01

    An assay based on the inhibition of {beta}-galactosidase biosynthesis was compared to a similar assay based on the inhibition of {beta}-galactosidase activity. In both test, Escherichia coli were induced to synthesize {beta}-galactosidase by exposure to isopropyl-{beta}-thiogalactoside (IPTG). The induction step preceded contact of the cells with toxic chemicals in the enzyme activity assay, whereas in the enzyme biosynthesis test, IPTG was added following contact of cells with the toxicant. Relative sensitivity was judged on the basis of responses to heavy metals and organic toxicants of environmental importance. Comparison of these results to median inhibitory concentration data (IC50s) achieved with other microbial systems, Daphnia bioassay, and fish bioassay indicate that the enzyme activity test was sensitive to heavy metals, but was insensitive to organic toxicants. The test based on inhibition of {beta}-galactosidase biosynthesis was sensitive to both heavy metals and organics.

  19. Squalestatin Is an Inhibitor of Carotenoid Biosynthesis in Plasmodium falciparum

    PubMed Central

    Gabriel, Heloisa B.; Silva, Marcia F.; Kimura, Emília A.; Wunderlich, Gerhard

    2015-01-01

    The increasing resistance of malaria parasites to almost all available drugs calls for the characterization of novel targets and the identification of new compounds. Carotenoids are polyisoprenoids from plants, algae, and some bacteria, and they are biosynthesized by Plasmodium falciparum but not by mammalian cells. Biochemical and reverse genetics approaches were applied to demonstrate that phytoene synthase (PSY) is a key enzyme for carotenoid biosynthesis in P. falciparum and is essential for intraerythrocytic growth. The known PSY inhibitor squalestatin reduces biosynthesis of phytoene and kills parasites during the intraerythrocytic cycle. PSY-overexpressing parasites showed increased biosynthesis of phytoene and its derived product phytofluene and presented a squalestatin-resistant phenotype, suggesting that this enzyme is the primary target of action of this drug in the parasite. PMID:25779575

  20. Sugar-Hormone Cross-Talk in Anthocyanin Biosynthesis

    PubMed Central

    Das, Prasanta Kumar; Shin, Dong Ho; Choi, Sang-Bong; Park, Youn-Il

    2012-01-01

    Anthocyanins, a class of flavonoids, are recognized for their diverse functions in plant development and beneficial effects on human health. Many of the genes encoding anthocyanin biosynthesis enzymes and the transcription factors that activate or repress them have been identified. Regulatory proteins that control anthocyanin biosynthesis by regulating the expression of different structural genes at the transcriptional and post-transcriptional levels are differentially modulated by environmental and biological factors such as light, temperature, sugar and hormones. This minireview summarizes the recent findings contributing to our understanding of the role of sugars and hormones in the modulation of the anthocyanin biosynthesis pathway with emphasis on the coordinated regulation of the critical transcriptional R2R3-MYB/bHLH/WD40 (MBW) complex in Arabidopsis. PMID:22936387

  1. Sesterterpene ophiobolin biosynthesis involving multiple gene clusters in Aspergillus ustus

    PubMed Central

    Chai, Hangzhen; Yin, Ru; Liu, Yongfeng; Meng, Huiying; Zhou, Xianqiang; Zhou, Guolin; Bi, Xupeng; Yang, Xue; Zhu, Tonghan; Zhu, Weiming; Deng, Zixin; Hong, Kui

    2016-01-01

    Terpenoids are the most diverse and abundant natural products among which sesterterpenes account for less than 2%, with very few reports on their biosynthesis. Ophiobolins are tricyclic 5–8–5 ring sesterterpenes with potential pharmaceutical application. Aspergillus ustus 094102 from mangrove rizhosphere produces ophiobolin and other terpenes. We obtained five gene cluster knockout mutants, with altered ophiobolin yield using genome sequencing and in silico analysis, combined with in vivo genetic manipulation. Involvement of the five gene clusters in ophiobolin synthesis was confirmed by investigation of the five key terpene synthesis relevant enzymes in each gene cluster, either by gene deletion and complementation or in vitro verification of protein function. The results demonstrate that ophiobolin skeleton biosynthesis involves five gene clusters, which are responsible for C15, C20, C25, and C30 terpenoid biosynthesis. PMID:27273151

  2. Comparative calorimetric studies on the dynamic conformation of plant 5S rRNA. I. Thermal unfolding pattern of lupin seeds and wheat germ 5S rRNAs, also in the presence of magnesium and sperminium cations.

    PubMed Central

    Barciszewski, J; Bratek-Wiewiórowska, M D; Górnicki, P; Naskret-Barciszewska, M; Wiewiórowski, M; Zielenkiewicz, A; Zielenkiewicz, W

    1988-01-01

    An attempt has been made to correlate differential scanning calorimetry melting profiles of 5S rRNAs from lupin seeds (L.s.) and wheat germ (W.g.) with their structure. It is suggested that the observed differences in thermal unfolding are due to differences in RNA nucleotide sequence and as a consequence in higher order structures. Interesting effects induced by magnesium cation, perprotonated and permethylated sperminium tetracations are discussed. It is suggested that the difference in the stabilizing effect of the three cations results from different mode of their interactions with RNA. "Pure" electrostatic interactions expected for permethylated tetracations are rather weak due to the steric hindrance around each positively charged nitrogen atom. Electrostatic interactions of the other two cations are significantly enhanced by coordination bonding for magnesium and by hydrogen bonding for protonated sperminium cation. PMID:3340550

  3. Physiological insights into all-trans-retinoic acid biosynthesis

    PubMed Central

    Napoli, Joseph L.

    2011-01-01

    All-trans-retinoic acid (atRA) provides essential support to diverse biological systems and physiological processes. Epithelial differentiation and its relationship to cancer and embryogenesis have typified intense areas of interest into atRA function. Recently, however, interest in atRA action in the nervous system, the immune system, energy balance and obesity has increased considerably, especially concerning postnatal function. atRA action depends on atRA biosynthesis: defects in retinoid-dependent processes increasingly relate to defects in atRA biogenesis. Considerable evidence indicates that physiological atRA biosynthesis occurs via a regulated process, consisting of a complex interaction of retinoid binding-proteins and retinoid recognizing enzymes. An accrual of biochemical, physiological and genetic data have identified specific functional outcomes for the retinol dehydrogenases, RDH1, RDH10, and DHRS9, as physiological catalysts of the first step in atRA biosynthesis, and for the retinal dehydrogenases RALDH1, RALDH2, and RALDH3, as catalysts of the second and irreversible step. Each of these enzymes associates with explicit biological processes mediated by atRA. Redundancy occurs, but seems limited. Cumulative data supports a model of interactions among these enzymes with retinoid binding-proteins, with feedback regulation and/or control by atRA via modulating gene expression of multiple participants. The ratio apo-CRBP1/holo-CRBP1 participates by influencing retinol flux into and out of storage as retinyl esters, thereby modulating substrate to support atRA biosynthesis. atRA biosynthesis requires presence of both an RDH and an RALDH: conversely, absence of one isozyme of either step does not indicate lack of atRA biosynthesis at the site. PMID:21621639

  4. Genetic regulations of the biosynthesis of microbial surfactants: an overview.

    PubMed

    Das, Palashpriya; Mukherjee, Soumen; Sen, Ramkrishna

    2008-01-01

    Microbial biosurfactants are surface active metabolites synthesized by microbes growing on a variety of substrates. In spite of having great potential for commercial, therapeutic and environmental applications, industrial level production has not been realized for their low yields and productivities. One vital factor determining their biosynthesis is the genetic makeup of the producer organisms. Studies on molecular genetics and biochemistry of the synthesis of several biosurfactants have revealed the operons, the enzymes and the metabolic pathways required for their extracellular production. Surfactin, a cyclic lipopeptide biosurfactant is a potent antimicrobial agent and is produced as a result of non-ribosomal biosynthesis catalyzed by a large multienzyme peptide synthetase complex called the surfactin synthetase. Pathways for the synthesis of other lipopeptides such as iturin, lichenysin and arthrofactin are also mediated by similar enzyme complexes. These non-ribosomal peptide synthetases (NRPSs) responsible for lipopeptide biosynthesis display a high degree of structural similarity among themselves even from distant microbial species. Plasmid-encoded- rhlA, B, R and I genes of rhl quorum sensing system are required for production of glycolipid biosurfactants by Pseudomonas species. Molecular genetics of biosynthesis of alasan and emulsan by Acinetobacter species and of the fungal biosurfactants such as mannosylerythritol lipids (MEL) and hydrophobins have been deciphered. However, limited genetic information is available about biosynthesis of other biosurfactants such as viscosin, amphisin and putisolvin produced by some strains of Pseudomonas species. Understanding of the genetic regulatory mechanisms would help to develop metabolically engineered hyper-producing strains with better product characteristics and acquired capability of utilizing cheap agro-industrial wastes as substrates. This article thus provides an overview of the role and importance of

  5. Evolutionary dynamics of the 5S rDNA gene family in the mussel Mytilus: mixed effects of birth-and-death and concerted evolution.

    PubMed

    Freire, Ruth; Arias, Alberto; Insua, Ana M; Méndez, Josefina; Eirín-López, José M

    2010-05-01

    In higher eukaryotes, the gene family encoding the 5S ribosomal RNA (5S rRNA) has been used (together with histones) to showcase the archetypal example of a gene family subject to concerted evolution. However, recent studies have revealed conspicuous features challenging the predictions of this model, including heterogeneity of repeat units, the presence of functional 5S gene variants as well as the existence of 5S rDNA divergent pseudogenes lacking traces of homogenization. In the present work, we have broadened the scope in the evolutionary study of ribosomal gene families by studying the 5S rRNA family in mussels, a model organism which stands out among other animals due to the heterogeneity it displays regarding sequence and organization. To this end, 48 previously unknown 5S rDNA units (coding and spacer regions) were sequenced in five mussel species, leading to the characterization of two new types of units (referred to here as small-beta 5S rDNA and gamma-5S rDNA) coexisting in the genome with alpha and beta rDNA units. The intense genetic dynamics of this family is further supported by the first description of an association between gamma-5S rDNA units and tRNA genes. Molecular evolutionary and phylogenetic analyses revealed an extensive lack of homology among spacer sequences belonging to different rDNA types, suggesting the presence of independent evolutionary pathways leading to their differentiation. Overall, our results suggest that the long-term evolution of the 5S rRNA gene family in mussels is most likely mediated by a mixed mechanism involving the generation of genetic diversity through birth-and-death, followed by a process of local homogenization resulting from concerted evolution in order to maintain the genetic identities of the different 5S units, probably after their transposition to independent chromosomal locations.

  6. Cyclopiazonic Acid Biosynthesis of Aspergillus flavus and Aspergillus oryzae

    PubMed Central

    Chang, Perng-Kuang; Ehrlich, Kenneth C.; Fujii, Isao

    2009-01-01

    Cyclopiazonic acid (CPA) is an indole-tetramic acid neurotoxin produced by some of the same strains of A. flavus that produce aflatoxins and by some Aspergillus oryzae strains. Despite its discovery 40 years ago, few reviews of its toxicity and biosynthesis have been reported. This review examines what is currently known about the toxicity of CPA to animals and humans, both by itself or in combination with other mycotoxins. The review also discusses CPA biosynthesis and the genetic diversity of CPA production in A. flavus/oryzae populations. PMID:22069533

  7. Final Report on Regulation of Guaiacyl and Syringyl Monolignol Biosynthesis

    SciTech Connect

    Vincent L. Chiang

    2006-03-09

    The focus of this research is to understand syringyl monolignol biosynthesis that leads to the formation of syringyl lignin, a type of lignin that can be easily removed during biomass conversion. We have achieved the three originally proposed goals for this project. (1) SAD and CAD genes (enzyme catalytic and kinetic properties) and their functional relevance to CAld5H/AldOMT pathway, (2) spatiotemporal expression patterns of Cald5H, AldOMT, SAD and CAD genes, and (3) functions of CAld5H, AldOMT, and SAD genes in vivo using transgenic aspen. Furthermore, we also found that microRNA might be involved in the upstream regulatory network of lignin biosynthesis and wood formation. The achievements are as below. (1) Based on biochemical and molecular studies, we discovered a novel syringyl-specific alcohol dehydrogenase (SAD) involved in monolignol biosynthesis in angiosperm trees. Through CAld5H/OMT/SAD mediation, syringyl monolignol biosynthesis branches out from guaiacyl pathway at coniferaldehyde; (2) The function of CAld5H gene in this syringyl monolignol biosynthesis pathway also was confirmed in vivo in transgenic Populus; (3) The proposed major monolignol biosynthesis pathways were further supported by the involving biochemical functions of CCR based on a detailed kinetic study; (4) Gene promoter activity analysis also supported the cell-type specific expression of SAD and CAD genes in xylem tissue, consistent with the cell-specific locations of SAD and CAD proteins and with the proposed pathways; (5) We have developed a novel small interfering RNA (siRNA)-mediated stable gene-silencing system in transgenic plants; (6) Using the siRNA and P. trichocarpa transformation/regeneration systems we are currently producing transgenic P. trichocarpa to investigate the interactive functions of CAD and SAD in regulating guaiacyl and syringyl lignin biosynthesis; (7) We have cloned for the first time from a tree species, P. trichocarpa, small regulatory RNAs termed micro

  8. [Advances in the regulation of cephalosporin C biosynthesis - A review].

    PubMed

    Liu, Jiajia; Liu, Gang

    2016-03-01

    The beta-lactam antibiotic cephalosporin C is produced industrially by Acremonium chrysogenum. Its derivative 7-aminocephalosporanic acid (7-ACA) is the intermediate of most chemical modification cephalosporins that are the most frequently used antibiotics for the therapy of infectious diseases. Due to its importance, the biosynthetic pathway of cephalosporin C has been elucidated in Acremonium chrysogenum. To improve the yield of cephalosporin C and reduce the cost of production, recent studies have been focused on the sophisticated regulation of cephalosporin C biosynthesis. In this review, recent advances in cephalosporin C biosynthesis and regulation are summarized. PMID:27382789

  9. Engineered Biosynthesis of Natural Products in Heterologous Hosts

    PubMed Central

    Luo, Yunzi; Li, Bing-Zhi; Liu, Duo; Zhang, Lu; Chen, Yan; Jia, Bin; Zeng, Bo-Xuan; Zhao, Huimin; Yuan, Ying-Jin

    2015-01-01

    Natural products produced by microorganisms and plants are a major resource of antibacterial and anticancer drugs as well as industrially useful compounds. However, the native producers often suffer from low productivity and titers. Here we summarize the recent applications of heterologous biosynthesis for the production of several important classes of natural products such as terpenoids, flavonoids, alkaloids, and polyketides. In addition, we will discuss the new tools and strategies at multi-scale levels including gene, pathway, genome and community levels for highly efficient heterologous biosynthesis of natural products. PMID:25960127

  10. Biosynthesis of oxygen and nitrogen-containing heterocycles in polyketides

    PubMed Central

    Hemmerling, Franziska

    2016-01-01

    Summary This review highlights the biosynthesis of heterocycles in polyketide natural products with a focus on oxygen and nitrogen-containing heterocycles with ring sizes between 3 and 6 atoms. Heterocycles are abundant structural elements of natural products from all classes and they often contribute significantly to their biological activity. Progress in recent years has led to a much better understanding of their biosynthesis. In this context, plenty of novel enzymology has been discovered, suggesting that these pathways are an attractive target for future studies. PMID:27559404

  11. Scleroglucan: biosynthesis, production and application of a versatile hydrocolloid.

    PubMed

    Schmid, Jochen; Meyer, Vera; Sieber, Volker

    2011-08-01

    Since its first description in the early 1960s, scleroglucan attracted much attention from both academia and industry. Scleroglucan is an exopolysaccharide secreted by the basidiomycete Sclerotium rolfsii and appreciated as a multipurpose compound applicable in many industrial fields, including oil industry, food industry and pharmacy. In this review, the current knowledge on scleroglucan chemistry, genetics, biosynthesis and production will be summarized and different application possibilities will be discussed. The biosynthesis of scleroglucan in S. rolfsii will be highlighted by recent transcriptomic data and linked to physiological data to better understand the biogenesis of scleroglucan and its link to the phytopathologic lifestyle of S. rolfsii.

  12. Prodigiosin biosynthesis gene cluster in the roseophilin producer Streptomyces griseoviridis.

    PubMed

    Kawasaki, Takashi; Sakurai, Fumi; Nagatsuka, Shun-ya; Hayakawa, Yoichi

    2009-05-01

    Streptomyces griseoviridis 2464-S5 produces prodigiosin R1, a tripyrrole antibiotic, and roseophilin, a structurally related compound containing two pyrrole and one furan rings. A gene cluster for the biosynthesis of a prodigiosin was identified in S. griseoviridis. The cluster consisted of 24 open reading frames, including 21 genes (rphD-rphZ) homologous to prodigiosin biosynthesis genes in the red cluster in Streptomyces coelicolor A3(2). The expression of rphN in S. coelicolor lacking redN restored the production of prodigiosin.

  13. [Biosynthesis of biologically active low-molecular weight compounds by fungi of the genus Penicillium (review)].

    PubMed

    Kozlovskii, A G; Antipova, T V; Zhelifonova, V P

    2015-01-01

    The recent data on exometabolite biosynthesis in fungi of the genus Penicillium is summarized. The study of creative species, as well as those isolated from extreme ecotopes, resulted in the identification of a number of novel, biologically active compounds. Alkaloid biosynthesis has been shown to begin on.the first day of fungus cultivation and to proceed throughout the cultivation period. Idiophase kinetics was observed for the biosynthesis of polyketide metabolites. The mechanisms of regulation of biosynthesis of promising bioactive compounds are discussed.

  14. Measurements of the Exclusive Decays of the {upsilon}(5S) to B Meson Final States and Improved B{sub s}* Mass Measurement

    SciTech Connect

    Aquines, O.; Li, Z.; Lopez, A.; Mendez, H.; Ramirez, J.; Huang, G.S.; Miller, D.H.; Pavlunin, V.; Sanghi, B.; Shipsey, I.P.J.; Xin, B.; Adams, G.S.; Anderson, M.; Cummings, J.P.; Danko, I.; Napolitano, J.; He, Q.; Insler, J.; Muramatsu, H.; Park, C.S.

    2006-04-21

    Using 420 pb{sup -1} of data collected on the {upsilon}(5S) resonance with the CLEO III detector, we reconstruct B mesons in 25 exclusive decay channels to measure or set upper limits on the decay rate of {upsilon}(5S) into B meson final states. We measure the inclusive B cross section to be {sigma}({upsilon}(5S){yields}BB(X))=(0.177{+-}0.030{+-}0.016) nb and make the first measurements of the production rates of {sigma}({upsilon}(5S){yields}B*B*)=(0.131{+-}0.025{+-}0.014) nb and {sigma}({upsilon}(5S){yields}BB*)=(0.043{+-}0.016{+-}0.006) nb, respectively. We set 90% confidence level limits of {sigma}({upsilon}(5S){yields}BB)<0.038 nb, {sigma}({upsilon}(5S){yields}B{sup (*)}B{sup (*)}{pi})<0.055 nb and {sigma}({upsilon}(5S){yields}BB{pi}{pi})<0.024 nb. We also extract the most precise value of the B{sub s}* mass to date, M(B{sub s}*)=(5411.7{+-}1.6{+-}0.6) MeV/c{sup 2}.

  15. Ln3I5(S2N2)(S2)(THF)10 - a new type of molecular compounds.

    PubMed

    Fagin, A A; Fukin, G K; Cherkasov, A V; Shestakov, A F; Pushkarev, A P; Balashova, T V; Maleev, A A; Bochkarev, M N

    2016-03-21

    Unprecedented complexes of the composition Ln3I5(S2N2)(S2)(THF)10 were obtained in the reactions of neodymium and dysprosium iodide-nitrides with sulfur. The inorganic core of the molecules contains the cyclic fragments Ln(μ-S2)Ln, LnSNSN and LnSN. Ten of the fourteen atoms of the core are coplanar, the remaining four S2 and I2 atoms lie in the other two orthogonal planes. The dysprosium complex upon excitation with UV light exhibits the metal-centered luminescence characteristic of the Dy(3+) ion. Geometric parameters of the molecules, computational data, electron spectroscopy and fluorescence suggest the existence of some conjugation in the mentioned heterocycles. PMID:26842841

  16. Molecular authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii by ITS and 5S rRNA spacer sequencing.

    PubMed

    Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui

    2007-01-01

    In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii. PMID:17202681

  17. Appearance and evolution of the specific chromosomal rearrangements associated with malignant transformation of mouse m5S cells

    SciTech Connect

    Kodama, S.; Okumura, Y.; Komatsu, K.; Sasaki, M.S. )

    1991-06-01

    Chromosomal alterations were studied during the acquisition of malignant phenotypes in two karyotypically distinct cells isolated from transformed foci induced by x-irradiation in mouse m5S cells. Because the transformants, despite foci origin, showed low ability to grow in agar, they were cultured in vitro with serial transfer schedules to allow further cell generations and assayed for anchorage independence (AI) at each passage level. The AI frequency increased with the cell doubling numbers. Chromosome analysis showed that a focus was one cell origin, but the transformants showed karyotypic instability during cell proliferation, giving rise to the rearrangements clustered in the distal region of the specific chromosomes. These rearrangements appeared to be directed toward the acquisition of malignant phenotypes. Analysis of the types and sites of rearrangements indicated that a mechanism exists that induces frequent rearrangements of the specific region of a chromosome during the process of transformation into the malignant state.

  18. Species identification of Crassostrea and Ostrea oysters by polymerase chain reaction amplification of the 5S rRNA gene.

    PubMed

    Cross, Ismael; Rebordinos, Laureana; Diaz, Edgardo

    2006-01-01

    A specific multiplex polymerase chain reaction (PCR) was developed for the identification of Crassostrea angulata, C. gigas, Ostrea edulis, and O. stentina oyster species. Universal primers were used for the amplification of complete repetition units of 5S rDNA in each of the 4 species. The alignment of the obtained sequences was the basis for the specific design of species-specific primers (ED1, ED2, ST1, ST2, CR1, and CR2) located in the nontranscribed spacer regions. The different sizes of the species-specific amplicons, separated by agarose gel electrophoresis, allowed identification of Crassostrea and Ostrea species. A multiplex PCR with a set of the 6 designed primers showed that they did not interfere with each other and bound specifically to the DNA target. This genetic marker can be very useful for traceability of the species, application in the management of oyster cultures, and conservation of the genetic resources of the species. PMID:16512239

  19. Fission properties of the 1. 5-s spontaneous fission activity produced in bombardmentof /sup 248/Cm with /sup 18/O

    SciTech Connect

    Hoffman, D.C.; Lee, D.; Ghiorso, A.; Nurmia, M.J.; Aleklett, K.; Leino, M.

    1981-08-01

    We have measured the mass and kinetic-energy distributions of fragments from the spontaneous fission of a 1.5-s activity produced in bombardments of /sup 248/Cm with 95-MeV /sup 18/O ions. Its spontaneous fission decay exhibits a very symmetric, narrow (full width at half maximum = 12 mass units) mass distribution, a very high total kinetic energy of 234 +- 2 MeV, and increasing total kinetic energy with increasingly symmetric mass division. Based on its half-life and the similarity of its fission properties to the unique fission properties so far only observed for /sup 258/Fm and /sup 259/Fm, the most likely assignment of this activity is to the known /sup 259/Fm. However, assignment to some as yet undiscovered neutron-rich heavy element isotope such as /sup 260/Md cannot be unequivocally excluded.

  20. High pressure Raman study of layered Mo0.5W0.5S2 ternary compound

    NASA Astrophysics Data System (ADS)

    Kim, Joon-Seok; Moran, Samuel T.; Nayak, Avinash P.; Pedahzur, Shahar; Ruiz, Itzel; Ponce, Gabriela; Rodriguez, Daniela; Henny, Joanna; Liu, Jin; Lin, Jung-Fu; Akinwande, Deji

    2016-06-01

    Ternary two-dimensional (2D) transition metal dichalcogenide compounds exhibit a tunable electronic structure allowing for control of the interlayer and the intralayer atomic displacement to efficiently tune their physical and electronic properties. Using a diamond anvil cell, hydrostatic pressure was applied to Mo0.5W0.5S2 up to 40 GPa in order to study the optical phonon vibrational modes. Analysis of the high-pressure Raman spectra shows that the two in-plane E2g modes resembling that of pristine MoS2 and WS2, as well as disorder-activated longitudinal acoustic phonon mode, are hardened and suppressed as pressure increases. The two A1g modes of the ternary compound that resemble the A1g modes of pristine MoS2 and WS2, displayed similar Raman shifts to the pristine compounds as pressure increases. A Raman peak at 470 cm-1 that is close to A1g peaks emerges at ˜8 GPa, which represents a disorder-activated pressure-induced out-of-plane Raman mode observed only in the ternary compound under high pressure. At pressures above ˜30 GPa, a Raman peak at approximately 340 cm-1 is observed, signifying additional disorder-activated vibration mode. Our results reveal the enhanced interactions in the structural and vibrational behavior of the MoS2 and WS2 domains in the Mo0.5W0.5S2 compound under hydrostatic pressure. These results could have implications in understanding the electronic, optical, and structural properties of the new 2D ternary compound materials under extreme mechanical conditions.

  1. Brassinosteroids Are Master Regulators of Gibberellin Biosynthesis in Arabidopsis.

    PubMed

    Unterholzner, Simon J; Rozhon, Wilfried; Papacek, Michael; Ciomas, Jennifer; Lange, Theo; Kugler, Karl G; Mayer, Klaus F; Sieberer, Tobias; Poppenberger, Brigitte

    2015-08-01

    Plant growth and development are highly regulated processes that are coordinated by hormones including the brassinosteroids (BRs), a group of steroids with structural similarity to steroid hormones of mammals. Although it is well understood how BRs are produced and how their signals are transduced, BR targets, which directly confer the hormone's growth-promoting effects, have remained largely elusive. Here, we show that BRs regulate the biosynthesis of gibberellins (GAs), another class of growth-promoting hormones, in Arabidopsis thaliana. We reveal that Arabidopsis mutants deficient in BR signaling are severely impaired in the production of bioactive GA, which is correlated with defective GA biosynthetic gene expression. Expression of the key GA biosynthesis gene GA20ox1 in the BR signaling mutant bri1-301 rescues many of its developmental defects. We provide evidence that supports a model in which the BR-regulated transcription factor BES1 binds to a regulatory element in promoters of GA biosynthesis genes in a BR-induced manner to control their expression. In summary, our study underscores a role of BRs as master regulators of GA biosynthesis and shows that this function is of major relevance for the growth and development of vascular plants.

  2. Anaerobic biosynthesis of the lower ligand of vitamin B12.

    PubMed

    Hazra, Amrita B; Han, Andrew W; Mehta, Angad P; Mok, Kenny C; Osadchiy, Vadim; Begley, Tadhg P; Taga, Michiko E

    2015-08-25

    Vitamin B12 (cobalamin) is required by humans and other organisms for diverse metabolic processes, although only a subset of prokaryotes is capable of synthesizing B12 and other cobamide cofactors. The complete aerobic and anaerobic pathways for the de novo biosynthesis of B12 are known, with the exception of the steps leading to the anaerobic biosynthesis of the lower ligand, 5,6-dimethylbenzimidazole (DMB). Here, we report the identification and characterization of the complete pathway for anaerobic DMB biosynthesis. This pathway, identified in the obligate anaerobic bacterium Eubacterium limosum, is composed of five previously uncharacterized genes, bzaABCDE, that together direct DMB production when expressed in anaerobically cultured Escherichia coli. Expression of different combinations of the bza genes revealed that 5-hydroxybenzimidazole, 5-methoxybenzimidazole, and 5-methoxy-6-methylbenzimidazole, all of which are lower ligands of cobamides produced by other organisms, are intermediates in the pathway. The bza gene content of several bacterial and archaeal genomes is consistent with experimentally determined structures of the benzimidazoles produced by these organisms, indicating that these genes can be used to predict cobamide structure. The identification of the bza genes thus represents the last remaining unknown component of the biosynthetic pathway for not only B12 itself, but also for three other cobamide lower ligands whose biosynthesis was previously unknown. Given the importance of cobamides in environmental, industrial, and human-associated microbial metabolism, the ability to predict cobamide structure may lead to an improved ability to understand and manipulate microbial metabolism.

  3. Shedding light on ovothiol biosynthesis in marine metazoans

    PubMed Central

    Castellano, Immacolata; Migliaccio, Oriana; D’Aniello, Salvatore; Merlino, Antonello; Napolitano, Alessandra; Palumbo, Anna

    2016-01-01

    Ovothiol, isolated from marine invertebrate eggs, is considered one of the most powerful antioxidant with potential for drug development. However, its biological functions in marine organisms still represent a matter of debate. In sea urchins, the most accepted view is that ovothiol protects the eggs by the high oxidative burst at fertilization. In this work we address the role of ovothiol during sea urchin development to give new insights on ovothiol biosynthesis in metazoans. The gene involved in ovothiol biosynthesis OvoA was identified in Paracentrotus lividus genome (PlOvoA). PlOvoA embryo expression significantly increased at the pluteus stage and was up-regulated by metals at concentrations mimicking polluted sea-water and by cyclic toxic algal blooms, leading to ovothiol biosynthesis. In silico analyses of the PlOvoA upstream region revealed metal and stress responsive elements. Structural protein models highlighted conserved active site residues likely responsible for ovothiol biosynthesis. Phylogenetic analyses indicated that OvoA evolved in most marine metazoans and was lost in bony vertebrates during the transition from the aquatic to terrestrial environment. These results highlight the crucial role of OvoA in protecting embryos released in seawater from environmental cues, thus allowing the survival under different conditions. PMID:26916575

  4. Two fatty acyl reductases involved in moth pheromone biosynthesis

    PubMed Central

    Antony, Binu; Ding, Bao-Jian; Moto, Ken’Ichi; Aldosari, Saleh A.; Aldawood, Abdulrahman S.

    2016-01-01

    Fatty acyl reductases (FARs) constitute an evolutionarily conserved gene family found in all kingdoms of life. Members of the FAR gene family play diverse roles, including seed oil synthesis, insect pheromone biosynthesis, and mammalian wax biosynthesis. In insects, FAR genes dedicated to sex pheromone biosynthesis (pheromone-gland-specific fatty acyl reductase, pgFAR) form a unique clade that exhibits substantial modifications in gene structure and possesses unique specificity and selectivity for fatty acyl substrates. Highly selective and semi-selective ‘single pgFARs’ produce single and multicomponent pheromone signals in bombycid, pyralid, yponomeutid and noctuid moths. An intriguing question is how a ‘single reductase’ can direct the synthesis of several fatty alcohols of various chain lengths and isomeric forms. Here, we report two active pgFARs in the pheromone gland of Spodoptera, namely a semi-selective, C14:acyl-specific pgFAR and a highly selective, C16:acyl-specific pgFAR, and demonstrate that these pgFARs play a pivotal role in the formation of species-specific signals, a finding that is strongly supported by functional gene expression data. The study envisages a new area of research for disclosing evolutionary changes associated with C14- and C16-specific FARs in moth pheromone biosynthesis. PMID:27427355

  5. AcsD catalyzes enantioselective citrate desymmetrization in siderophore biosynthesis.

    PubMed

    Schmelz, Stefan; Kadi, Nadia; McMahon, Stephen A; Song, Lijiang; Oves-Costales, Daniel; Oke, Muse; Liu, Huanting; Johnson, Kenneth A; Carter, Lester G; Botting, Catherine H; White, Malcolm F; Challis, Gregory L; Naismith, James H

    2009-03-01

    Bacterial pathogens need to scavenge iron from their host for growth and proliferation during infection. They have evolved several strategies to do this, one being the biosynthesis and excretion of small, high-affinity iron chelators known as siderophores. The biosynthesis of siderophores is an important area of study, not only for potential therapeutic intervention but also to illuminate new enzyme chemistries. Two general pathways for siderophore biosynthesis exist: the well-characterized nonribosomal peptide synthetase (NRPS)-dependent pathway and the NRPS-independent siderophore (NIS) pathway, which relies on a different family of sparsely investigated synthetases. Here we report structural and biochemical studies of AcsD from Pectobacterium (formerly Erwinia) chrysanthemi, an NIS synthetase involved in achromobactin biosynthesis. The structures of ATP and citrate complexes provide a mechanistic rationale for stereospecific formation of an enzyme-bound (3R)-citryladenylate, which reacts with L-serine to form a likely achromobactin precursor. AcsD is a unique acyladenylate-forming enzyme with a new fold and chemical catalysis strategy. PMID:19182782

  6. Biosynthesis and Characterization of Silver Nanoparticles by Aspergillus Species.

    PubMed

    Zomorodian, Kamiar; Pourshahid, Seyedmohammad; Sadatsharifi, Arman; Mehryar, Pouyan; Pakshir, Keyvan; Rahimi, Mohammad Javad; Arabi Monfared, Ali

    2016-01-01

    Currently, researchers turn to natural processes such as using biological microorganisms in order to develop reliable and ecofriendly methods for the synthesis of metallic nanoparticles. In this study, we have investigated extracellular biosynthesis of silver nanoparticles using four Aspergillus species including A. fumigatus, A. clavatus, A. niger, and A. flavus. We have also analyzed nitrate reductase activity in the studied species in order to determine the probable role of this enzyme in the biosynthesis of silver nanoparticles. The formation of silver nanoparticles in the cell filtrates was confirmed by the passage of laser light, change in the color of cell filtrates, absorption peak at 430 nm in UV-Vis spectra, and atomic force microscopy (AFM). There was a logical relationship between the efficiencies of studied Aspergillus species in the production of silver nanoparticles and their nitrate reductase activity. A. fumigatus as the most efficient species showed the highest nitrate reductase activity among the studied species while A. flavus exhibited the lowest capacity in the biosynthesis of silver nanoparticles which was in accord with its low nitrate reductase activity. The present study showed that Aspergillus species had potential for the biosynthesis of silver nanoparticles depending on their nitrate reductase activity. PMID:27652264

  7. Biosynthesis of a thiamin antivitamin in Clostridium botulinum.

    PubMed

    Cooper, Lisa E; O'Leary, Seán E; Begley, Tadhg P

    2014-04-15

    Bacimethrin-derived 2'-methoxythiamin pyrophosphate inhibits microbial growth by disrupting metabolic pathways dependent on thiamin-utilizing enzymes. This study describes the discovery of the bacimethrin biosynthetic gene cluster of Clostridium botulinum A ATCC 19397 and in vitro reconstitution of bacimethrin biosynthesis from cytidine 5'-monophosphate.

  8. The magnesium chelation step in chlorophyll biosynthesis. Progress report 1993

    SciTech Connect

    Weinstein, J.D.

    1993-12-31

    Progress is reported on the identification and fractionation of Magnesium chealatase, an enzyme involved in addition of Mg to chlorophyll during the later`s biosynthesis. Progress is documented as a series of synopsis of published and unpublished papers by the author.

  9. Sampangine inhibits heme biosynthesis in both yeast and human

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The azaoxoaporphine alkaloid sampangine exhibits strong antiproliferation activity in various organisms. Previous studies suggested that it somehow affects heme metabolism and stimulates production of reactive oxygen species (ROS). In this study, we show that inhibition of heme biosynthesis is the p...

  10. Shedding light on ovothiol biosynthesis in marine metazoans

    NASA Astrophysics Data System (ADS)

    Castellano, Immacolata; Migliaccio, Oriana; D’Aniello, Salvatore; Merlino, Antonello; Napolitano, Alessandra; Palumbo, Anna

    2016-02-01

    Ovothiol, isolated from marine invertebrate eggs, is considered one of the most powerful antioxidant with potential for drug development. However, its biological functions in marine organisms still represent a matter of debate. In sea urchins, the most accepted view is that ovothiol protects the eggs by the high oxidative burst at fertilization. In this work we address the role of ovothiol during sea urchin development to give new insights on ovothiol biosynthesis in metazoans. The gene involved in ovothiol biosynthesis OvoA was identified in Paracentrotus lividus genome (PlOvoA). PlOvoA embryo expression significantly increased at the pluteus stage and was up-regulated by metals at concentrations mimicking polluted sea-water and by cyclic toxic algal blooms, leading to ovothiol biosynthesis. In silico analyses of the PlOvoA upstream region revealed metal and stress responsive elements. Structural protein models highlighted conserved active site residues likely responsible for ovothiol biosynthesis. Phylogenetic analyses indicated that OvoA evolved in most marine metazoans and was lost in bony vertebrates during the transition from the aquatic to terrestrial environment. These results highlight the crucial role of OvoA in protecting embryos released in seawater from environmental cues, thus allowing the survival under different conditions.

  11. Biosynthesis and Characterization of Silver Nanoparticles by Aspergillus Species

    PubMed Central

    Pourshahid, Seyedmohammad; Mehryar, Pouyan; Pakshir, Keyvan; Rahimi, Mohammad Javad; Arabi Monfared, Ali

    2016-01-01

    Currently, researchers turn to natural processes such as using biological microorganisms in order to develop reliable and ecofriendly methods for the synthesis of metallic nanoparticles. In this study, we have investigated extracellular biosynthesis of silver nanoparticles using four Aspergillus species including A. fumigatus, A. clavatus, A. niger, and A. flavus. We have also analyzed nitrate reductase activity in the studied species in order to determine the probable role of this enzyme in the biosynthesis of silver nanoparticles. The formation of silver nanoparticles in the cell filtrates was confirmed by the passage of laser light, change in the color of cell filtrates, absorption peak at 430 nm in UV-Vis spectra, and atomic force microscopy (AFM). There was a logical relationship between the efficiencies of studied Aspergillus species in the production of silver nanoparticles and their nitrate reductase activity. A. fumigatus as the most efficient species showed the highest nitrate reductase activity among the studied species while A. flavus exhibited the lowest capacity in the biosynthesis of silver nanoparticles which was in accord with its low nitrate reductase activity. The present study showed that Aspergillus species had potential for the biosynthesis of silver nanoparticles depending on their nitrate reductase activity. PMID:27652264

  12. Aspirin therapy and thromboxane biosynthesis in systemic lupus erythematosus.

    PubMed

    Avalos, Ingrid; Chung, Cecilia P; Oeser, Annette; Milne, Ginger L; Borntrager, Holly; Morrow, Jason D; Raggi, Paolo; Solus, Joseph; Stein, C Michael

    2007-01-01

    Incomplete suppression of thromboxane biosynthesis during aspirin therapy is associated with increased cardiovascular risk. Since systemic lupus erythematosus (SLE) is associated with platelet activation and increased cardiovascular mortality, we compared thromboxane and prostacyclin biosynthesis in patients with SLE and control subjects, and measured inhibition of thromboxane excretion in aspirin-treated subjects. We measured the urinary excretion of 11-dehydro thromboxane B( 2) (TXB(2)) and 2,3-dinor 6-ketoPGF(1alpha) (PGI-M), the stable metabolites of thromboxane A(2) and prostacyclin, respectively, in 74 patients with SLE and 70 controls. In subjects who were not receiving aspirin, TXB(2) excretion was higher in patients with SLE [0.40 ng/mg creatinine (0.26-0.64), median (interquartile range)] than controls [0.31 ng/mg creatinine (0.23-0.44)] (P = 0.04), and in these patients, TXB(2) excretion correlated with disease activity (rho = 0.28, P = 0.03) and tumor necrosis factor alpha (rho = 0.48, P < 0.001). Aspirin therapy resulted in significantly lower TXB(2) excretion in controls (P = 0.01), but not in patients with SLE (P = 0.10), compared with subjects not receiving aspirin. Prostacyclin biosynthesis did not differ among patients and controls, and was not affected by aspirin (P all >0.35). Thromboxane biosynthesis is increased in SLE and is associated with disease activity. Additionally, response to aspirin may be attenuated in some patients with SLE. PMID:18042592

  13. Two fatty acyl reductases involved in moth pheromone biosynthesis.

    PubMed

    Antony, Binu; Ding, Bao-Jian; Moto, Ken'Ichi; Aldosari, Saleh A; Aldawood, Abdulrahman S

    2016-01-01

    Fatty acyl reductases (FARs) constitute an evolutionarily conserved gene family found in all kingdoms of life. Members of the FAR gene family play diverse roles, including seed oil synthesis, insect pheromone biosynthesis, and mammalian wax biosynthesis. In insects, FAR genes dedicated to sex pheromone biosynthesis (pheromone-gland-specific fatty acyl reductase, pgFAR) form a unique clade that exhibits substantial modifications in gene structure and possesses unique specificity and selectivity for fatty acyl substrates. Highly selective and semi-selective 'single pgFARs' produce single and multicomponent pheromone signals in bombycid, pyralid, yponomeutid and noctuid moths. An intriguing question is how a 'single reductase' can direct the synthesis of several fatty alcohols of various chain lengths and isomeric forms. Here, we report two active pgFARs in the pheromone gland of Spodoptera, namely a semi-selective, C14:acyl-specific pgFAR and a highly selective, C16:acyl-specific pgFAR, and demonstrate that these pgFARs play a pivotal role in the formation of species-specific signals, a finding that is strongly supported by functional gene expression data. The study envisages a new area of research for disclosing evolutionary changes associated with C14- and C16-specific FARs in moth pheromone biosynthesis. PMID:27427355

  14. Brassinosteroids Are Master Regulators of Gibberellin Biosynthesis in Arabidopsis

    PubMed Central

    Unterholzner, Simon J.; Rozhon, Wilfried; Papacek, Michael; Ciomas, Jennifer; Lange, Theo; Kugler, Karl G.; Mayer, Klaus F.; Sieberer, Tobias; Poppenberger, Brigitte

    2015-01-01

    Plant growth and development are highly regulated processes that are coordinated by hormones including the brassinosteroids (BRs), a group of steroids with structural similarity to steroid hormones of mammals. Although it is well understood how BRs are produced and how their signals are transduced, BR targets, which directly confer the hormone’s growth-promoting effects, have remained largely elusive. Here, we show that BRs regulate the biosynthesis of gibberellins (GAs), another class of growth-promoting hormones, in Arabidopsis thaliana. We reveal that Arabidopsis mutants deficient in BR signaling are severely impaired in the production of bioactive GA, which is correlated with defective GA biosynthetic gene expression. Expression of the key GA biosynthesis gene GA20ox1 in the BR signaling mutant bri1-301 rescues many of its developmental defects. We provide evidence that supports a model in which the BR-regulated transcription factor BES1 binds to a regulatory element in promoters of GA biosynthesis genes in a BR-induced manner to control their expression. In summary, our study underscores a role of BRs as master regulators of GA biosynthesis and shows that this function is of major relevance for the growth and development of vascular plants. PMID:26243314

  15. Post-genome research on the biosynthesis of ergot alkaloids.

    PubMed

    Li, Shu-Ming; Unsöld, Inge A

    2006-10-01

    Genome sequencing provides new opportunities and challenges for identifying genes for the biosynthesis of secondary metabolites. A putative biosynthetic gene cluster of fumigaclavine C, an ergot alkaloid of the clavine type, was identified in the genome sequence of ASPERGILLUS FUMIGATUS by a bioinformatic approach. This cluster spans 22 kb of genomic DNA and comprises at least 11 open reading frames (ORFs). Seven of them are orthologous to genes from the biosynthetic gene cluster of ergot alkaloids in CLAVICEPS PURPUREA. Experimental evidence of the identified cluster was provided by heterologous expression and biochemical characterization of two ORFs, FgaPT1 and FgaPT2, in the cluster of A. FUMIGATUS, which show remarkable similarities to dimethylallyltryptophan synthase from C. PURPUREA and function as prenyltransferases. FgaPT2 converts L-tryptophan to dimethylallyltryptophan and thereby catalyzes the first step of ergot alkaloid biosynthesis, whilst FgaPT1 catalyzes the last step of the fumigaclavine C biosynthesis, i. e., the prenylation of fumigaclavine A at C-2 position of the indole nucleus. In addition to information obtained from the gene cluster of ergot alkaloids from C. PURPUREA, the identification of the biosynthetic gene cluster of fumigaclavine C in A. FUMIGATUS opens an alternative way to study the biosynthesis of ergot alkaloids in fungi. PMID:16902860

  16. A blueprint of the amino acid biosynthesis network of hemiascomycetes.

    PubMed

    Förster, Jan; Halbfeld, Christoph; Zimmermann, Martin; Blank, Lars M

    2014-11-01

    The structure and regulation of biosynthesis pathways in Saccharomyces cerevisiae have been detailed extensively. For other hemiascomycetes, genomic sequences are primarily available, whereas biochemical information on them is scarce. The resulting biochemical networks that are used for research in basic science and biotechnology are often biased by data from S. cerevisiae, assuming that there are often implicitly conserved structures between species. We examined the structure of the amino acid biosynthesis network in nine hemiascomycetes, spanning the phylogenetic clade. Differences in the genetic inventory included the presence and absence of isoenzymes and compartmentation of the pathways. Notably, no two hemiascomycetes had identical genetic inventories. For example, the lack of the mitochondrial αIPMS isoenzyme and presence of only one copy of the BCAA aminotransferase in Pichia pastoris indicate a disparately compartmented leucine biosynthesis pathway. Our findings suggest that αIPMS and BCAA aminotransferase are solely located in the cytosol of P. pastoris, requiring correction of the leucine biosynthesis pathway layout in this species. Our results argue for careful use of information from S. cerevisiae and for joint efforts to fill the knowledge gaps in other species. Such analysis will lead to contributions in biotechnology disciplines, such as protein production and compartment engineering. PMID:25187056

  17. Biosynthesis of glyoxylate from glycine in Saccharomyces cerevisiae.

    PubMed

    Villas-Bôas, Silas Granato; Kesson, Mats; Nielsen, Jens

    2005-05-01

    Glyoxylate biosynthesis in Saccharomyces cerevisiae is traditionally mainly ascribed to the reaction catalyzed by isocitrate lyase (Icl), which converts isocitrate to glyoxylate and succinate. However, Icl is generally reported to be repressed by glucose and yet glyoxylate is detected at high levels in S. cerevisiae extracts during cultivation on glucose. In bacteria there is an alternative pathway for glyoxylate biosynthesis that involves a direct oxidation of glycine. Therefore, we investigated the glycine metabolism in S. cerevisiae coupling metabolomics data and (13)C-isotope-labeling analysis of two reference strains and a mutant with a deletion in a gene encoding an alanine:glyoxylate aminotransferase. The strains were cultivated on minimal medium containing glucose or galactose, and (13)C-glycine as sole nitrogen source. Glyoxylate presented (13)C-labeling in all cultivation conditions. Furthermore, glyoxylate seemed to be converted to 2-oxovalerate, an unusual metabolite in S. cerevisiae. 2-Oxovalerate can possibly be converted to 2-oxoisovalerate, a key precursor in the biosynthesis of branched-chain amino acids. Hence, we propose a new pathway for glycine catabolism and glyoxylate biosynthesis in S. cerevisiae that seems not to be repressed by glucose and is active under both aerobic and anaerobic conditions. This work demonstrates the great potential of coupling metabolomics data and isotope-labeling analysis for pathway reconstructions.

  18. Polyketides in Aspergillus terreus: biosynthesis pathway discovery and application.

    PubMed

    Yin, Ying; Cai, Menghao; Zhou, Xiangshan; Li, Zhiyong; Zhang, Yuanxing

    2016-09-01

    The knowledge of biosynthesis gene clusters, production improving methods, and bioactivity mechanisms is very important for the development of filamentous fungi metabolites. Metabolic engineering and heterologous expression methods can be applied to improve desired metabolite production, when their biosynthesis pathways have been revealed. And, stable supplement is a necessary basis of bioactivity mechanism discovery and following clinical trial. Aspergillus terreus is an outstanding producer of many bioactive agents, and a large part of them are polyketides. In this review, we took polyketides from A. terreus as examples, focusing on 13 polyketide synthase (PKS) genes in A. terreus NIH 2624 genome. The biosynthesis pathways of nine PKS genes have been reported, and their downstream metabolites are lovastatin, terreic acid, terrein, geodin, terretonin, citreoviridin, and asperfuranone, respectively. Among them, lovastatin is a well-known hypolipidemic agent. Terreic acid, terrein, citreoviridin, and asperfuranone show good bioactivities, especially anticancer activities. On the other hand, geodin and terretonin are mycotoxins. So, biosynthesis gene cluster information is important for the production or elimination of them. We also predicted three possible gene clusters that contain four PKS genes by homologous gene alignment with other Aspergillus strains. We think that this is an effective way to mine secondary metabolic gene clusters. PMID:27455860

  19. Biosynthesis and Characterization of Silver Nanoparticles by Aspergillus Species

    PubMed Central

    Pourshahid, Seyedmohammad; Mehryar, Pouyan; Pakshir, Keyvan; Rahimi, Mohammad Javad; Arabi Monfared, Ali

    2016-01-01

    Currently, researchers turn to natural processes such as using biological microorganisms in order to develop reliable and ecofriendly methods for the synthesis of metallic nanoparticles. In this study, we have investigated extracellular biosynthesis of silver nanoparticles using four Aspergillus species including A. fumigatus, A. clavatus, A. niger, and A. flavus. We have also analyzed nitrate reductase activity in the studied species in order to determine the probable role of this enzyme in the biosynthesis of silver nanoparticles. The formation of silver nanoparticles in the cell filtrates was confirmed by the passage of laser light, change in the color of cell filtrates, absorption peak at 430 nm in UV-Vis spectra, and atomic force microscopy (AFM). There was a logical relationship between the efficiencies of studied Aspergillus species in the production of silver nanoparticles and their nitrate reductase activity. A. fumigatus as the most efficient species showed the highest nitrate reductase activity among the studied species while A. flavus exhibited the lowest capacity in the biosynthesis of silver nanoparticles which was in accord with its low nitrate reductase activity. The present study showed that Aspergillus species had potential for the biosynthesis of silver nanoparticles depending on their nitrate reductase activity.

  20. On the phenotypic spectrum of serine biosynthesis defects.

    PubMed

    El-Hattab, Ayman W; Shaheen, Ranad; Hertecant, Jozef; Galadari, Hassan I; Albaqawi, Badi S; Nabil, Amira; Alkuraya, Fowzan S

    2016-05-01

    L-serine is a non-essential amino acid that is de novo synthesized via the enzymes phosphoglycerate dehydrogenase (PGDH), phosphoserine aminotransferase (PSAT), and phosphoserine phosphatase (PSP). Besides its role in protein synthesis, L-serine is a precursor of a number of important compounds. Serine biosynthesis defects result from deficiencies in PGDH, PSAT, or PSP and have a broad phenotypic spectrum ranging from Neu-Laxova syndrome, a lethal multiple congenital anomaly disease at the severe end to a childhood disease with intellectual disability at the mild end, with infantile growth deficiency, and severe neurological manifestations as an intermediate phenotype. In this report, we present three subjects with serine biosynthesis effects. The first was a stillbirth with Neu-Laxova syndrome and a homozygous mutation in PHGDH. The second was a neonate with growth deficiency, microcephaly, ichthyotic skin lesions, seizures, contractures, hypertonia, distinctive facial features, and a homozygous mutation in PSAT1. The third subject was an infant with growth deficiency, microcephaly, ichthyotic skin lesions, anemia, hypertonia, distinctive facial features, low serine and glycine in plasma and CSF, and a novel homozygous mutation in PHGDH gene. Herein, we also review previous reports of serine biosynthesis defects and mutations in the PHGDH, PSAT1, and PSPH genes, discuss the variability in the phenotypes associated with serine biosynthesis defects, and elaborate on the vital roles of serine and the potential consequences of its deficiency. PMID:26960553

  1. Exploiting nongenetic cell-to-cell variation for enhanced biosynthesis.

    PubMed

    Xiao, Yi; Bowen, Christopher H; Liu, Di; Zhang, Fuzhong

    2016-05-01

    Biosynthesis enables renewable production of manifold compounds, yet often biosynthetic performance must be improved for it to be economically feasible. Nongenetic, cell-to-cell variations in protein and metabolite concentrations are naturally inherent, suggesting the existence of both high- and low-performance variants in all cultures. Although having an intrinsic source of low performers might cause suboptimal ensemble biosynthesis, the existence of high performers suggests an avenue for performance enhancement. Here we develop in vivo population quality control (PopQC) to continuously select for high-performing, nongenetic variants. We apply PopQC to two biosynthetic pathways using two alternative design principles and demonstrate threefold enhanced production of both free fatty acid (FFA) and tyrosine. We confirm that PopQC improves ensemble biosynthesis by selecting for nongenetic high performers. Additionally, we use PopQC in fed-batch FFA production and achieve 21.5 g l(-1) titer and 0.5 g l(-1) h(-1) productivity. Given the ubiquity of nongenetic variation, PopQC should be applicable to a variety of metabolic pathways for enhanced biosynthesis. PMID:26999780

  2. YCZ-18 Is a New Brassinosteroid Biosynthesis Inhibitor

    PubMed Central

    Oh, Keimei; Matsumoto, Tadashi; Yamagami, Ayumi; Ogawa, Atushi; Yamada, Kazuhiro; Suzuki, Ryuichiro; Sawada, Takayuki; Fujioka, Shozo; Yoshizawa, Yuko; Nakano, Takeshi

    2015-01-01

    Plant hormone brassinosteroids (BRs) are a group of polyhydroxylated steroids that play critical roles in regulating broad aspects of plant growth and development. The structural diversity of BRs is generated by the action of several groups of P450s. Brassinazole is a specific inhibitor of C-22 hydroxylase (CYP90B1) in BR biosynthesis, and the application use of brassinazole has emerged as an effective way of complementing BR-deficient mutants to elucidate the functions of BRs. In this article, we report a new triazole-type BR biosynthesis inhibitor, YCZ-18. Quantitative analysis the endogenous levels of BRs in Arabidopsis indicated that YCZ-18 significantly decreased the BR contents in plant tissues. Assessment of the binding affinity of YCZ-18to purified recombinant CYP90D1 indicated that YCZ-18 induced a typical type II binding spectrum with a Kd value of approximately 0.79 μM. Analysis of the mechanisms underlying the dwarf phenotype associated with YCZ-18 treatment of Arabidopsis indicated that the chemically induced dwarf phenotype was caused by a failure of cell elongation. Moreover, dissecting the effect of YCZ-18 on the induction or down regulation of genes responsive to BRs indicated that YCZ-18 regulated the expression of genes responsible for BRs deficiency in Arabidopsis. These findings indicate that YCZ-18 is a potent BR biosynthesis inhibitor and has a new target site, C23-hydroxylation in BR biosynthesis. Application of YCZ-18 will be a good starting point for further elucidation of the detailed mechanism of BR biosynthesis and its regulation. PMID:25793645

  3. Recent advances in the elucidation of enzymatic function in natural product biosynthesis.

    PubMed

    Tan, Gao-Yi; Deng, Zixin; Liu, Tiangang

    2015-01-01

    With the successful production of artemisinic acid in yeast, the promising potential of synthetic biology for natural product biosynthesis is now being realized. The recent total biosynthesis of opioids in microbes is considered to be another landmark in this field. The importance and significance of enzymes in natural product biosynthetic pathways have been re-emphasized by these advancements. Therefore, the characterization and elucidation of enzymatic function in natural product biosynthesis are undoubtedly fundamental for the development of new drugs and the heterologous biosynthesis of active natural products. Here, discoveries regarding enzymatic function in natural product biosynthesis over the past year are briefly reviewed.

  4. Recent advances in the elucidation of enzymatic function in natural product biosynthesis

    PubMed Central

    Tan, Gao-Yi; Deng, Zixin; Liu, Tiangang

    2016-01-01

    With the successful production of artemisinic acid in yeast, the promising potential of synthetic biology for natural product biosynthesis is now being realized. The recent total biosynthesis of opioids in microbes is considered to be another landmark in this field. The importance and significance of enzymes in natural product biosynthetic pathways have been re-emphasized by these advancements. Therefore, the characterization and elucidation of enzymatic function in natural product biosynthesis are undoubtedly fundamental for the development of new drugs and the heterologous biosynthesis of active natural products. Here, discoveries regarding enzymatic function in natural product biosynthesis over the past year are briefly reviewed. PMID:26989472

  5. Increased sesquiterpenoid biosynthesis and an apparent decrease in sterol biosynthesis in elicitor-treated tobacco cell suspension cultures

    SciTech Connect

    Voegeli, U.; Bhatt, P.N.; Chappell, J.

    1987-04-01

    Addition of fungel elicitor prepared from Phytophthora parasitica to tobacco cell suspension cultures leads to an increased production of the phytoalexin capsidiol. Capsidiol is a sesquiterpenoid which is most likely synthesized from farnesylpyrophosphat (FPP) by a bicyclic cyclase reaction. Because FPP is also a substrate for squalene synthetase and therefore a precursor of sterol biosynthesis, the question arises whether or not the accumulation of capsidiol in elicitor-treated cells occurs at the expense of sterol biosynthesis. (/sup 14/C)-acetate was given to elicitor-treated and control (no treatment) cell cultures and incorporation into sterols and capsidiol determined. No labeled capsidiol was detected in control cells. In elicitor-treated cells about 12-15% of the radioactivity taken up by the cells was incorporated into capsidiol. In contrast, control cells incorporated 4 times more radioactivity into sterols than elicitor-treated cells. Similar results were obtained using (/sup 3/H)-mevalonate as a precursor of capsidiol and sterol biosynthesis. Likely explanations for the apparently decline in sterol biosynthesis in elicitor-treated cells include: (1) inhibition of squalene synthetase; (2) induction of capsidiol synthesizing enzymes; and (3) metabolic channeling of FPP into capsidiol versus sterols. These possibilities will be discussed further together with other results.

  6. A 5 S rRNA gene is present in the mitochondrial genome of the protist Reclinomonas americana but is absent from red algal mitochondrial DNA.

    PubMed

    Lang, B F; Goff, L J; Gray, M W

    1996-09-01

    Except in the case of land plants, mitochondrial ribosomes apparently lack a 5 S rRNA species, even though this small RNA is a component of all prokaryotic, chloroplast and eukaryotic cytosol ribosomes. In plants, the mitochondrial 5 S rRNA is encoded by mtDNA and differs in sequence from the 5 S rRNA specified by plant nuclear and chloroplast genomes. A distinctive 5 S rRNA component has not been found in the mitochondrial ribosomes of non-plant eukaryotes and, with the notable exception of the chlorophycean alga, Prototheca wickerhamii, a 5 S rRNA gene has not been identified in those non-plant mtDNAs characterized to date. Here, we report the presence of a 5 S rRNA gene in the mtDNA of the heterotrophic flagellate Reclinomonas americana. This unicellular eukaryote is a member of the jakobid flagellates, an early-diverging group of protists that share ultrastructural characteristics with the retortamonads, primitive protists that lack mitochondria. We report sequence data from the mtDNAs of the red algae Porphyra purpurea and Gracilariopsis lemaneiformis, which we use to evaluate a recent claim that a 5 S rRNA gene exists in the mtDNA of a third rhodophyte alga, Chondrus crispus. Our results lead us to the opposite conclusion: that a 5 S rRNA gene is not encoded by red algal mtDNA. In view of the accumulating evidence favoring a monophyletic origin of the mitochondrial genome, it is likely that a 5 S rRNA gene was present in an ancestral proto-mitochondrial genome, and that contemporary mtDNA-encoded 5 S rRNA genes have all descended from this ancestral gene. Considering the highly restricted phylogenetic distribution of identified mtDNA-encoded 5 S rRNA genes, it follows that the mitochondrial 5 S rRNA gene must have been lost multiple times during evolutionary diversification of the eukaryotic lineage.

  7. Regulatory Cross-Talks and Cascades in Rice Hormone Biosynthesis Pathways Contribute to Stress Signaling.

    PubMed

    Deb, Arindam; Grewal, Rumdeep K; Kundu, Sudip

    2016-01-01

    Crosstalk among different hormone signaling pathways play an important role in modulating plant response to both biotic and abiotic stress. Hormone activity is controlled by its bio-availability, which is again influenced by its biosynthesis. Thus, independent hormone biosynthesis pathways must be regulated and co-ordinated to mount an integrated response. One of the possibilities is to use cis-regulatory elements to orchestrate expression of hormone biosynthesis genes. Analysis of CREs, associated with differentially expressed hormone biosynthesis related genes in rice leaf under Magnaporthe oryzae attack and drought stress enabled us to obtain insights about cross-talk among hormone biosynthesis pathways at the transcriptional level. We identified some master transcription regulators that co-ordinate different hormone biosynthesis pathways under stress. We found that Abscisic acid and Brassinosteroid regulate Cytokinin conjugation; conversely Brassinosteroid biosynthesis is affected by both Abscisic acid and Cytokinin. Jasmonic acid and Ethylene biosynthesis may be modulated by Abscisic acid through DREB transcription factors. Jasmonic acid or Salicylic acid biosynthesis pathways are co-regulated but they are unlikely to influence each others production directly. Thus, multiple hormones may modulate hormone biosynthesis pathways through a complex regulatory network, where biosynthesis of one hormone is affected by several other contributing hormones.

  8. Regulatory Cross-Talks and Cascades in Rice Hormone Biosynthesis Pathways Contribute to Stress Signaling

    PubMed Central

    Deb, Arindam; Grewal, Rumdeep K.; Kundu, Sudip

    2016-01-01

    Crosstalk among different hormone signaling pathways play an important role in modulating plant response to both biotic and abiotic stress. Hormone activity is controlled by its bio-availability, which is again influenced by its biosynthesis. Thus, independent hormone biosynthesis pathways must be regulated and co-ordinated to mount an integrated response. One of the possibilities is to use cis-regulatory elements to orchestrate expression of hormone biosynthesis genes. Analysis of CREs, associated with differentially expressed hormone biosynthesis related genes in rice leaf under Magnaporthe oryzae attack and drought stress enabled us to obtain insights about cross-talk among hormone biosynthesis pathways at the transcriptional level. We identified some master transcription regulators that co-ordinate different hormone biosynthesis pathways under stress. We found that Abscisic acid and Brassinosteroid regulate Cytokinin conjugation; conversely Brassinosteroid biosynthesis is affected by both Abscisic acid and Cytokinin. Jasmonic acid and Ethylene biosynthesis may be modulated by Abscisic acid through DREB transcription factors. Jasmonic acid or Salicylic acid biosynthesis pathways are co-regulated but they are unlikely to influence each others production directly. Thus, multiple hormones may modulate hormone biosynthesis pathways through a complex regulatory network, where biosynthesis of one hormone is affected by several other contributing hormones. PMID:27617021

  9. Regulatory Cross-Talks and Cascades in Rice Hormone Biosynthesis Pathways Contribute to Stress Signaling

    PubMed Central

    Deb, Arindam; Grewal, Rumdeep K.; Kundu, Sudip

    2016-01-01

    Crosstalk among different hormone signaling pathways play an important role in modulating plant response to both biotic and abiotic stress. Hormone activity is controlled by its bio-availability, which is again influenced by its biosynthesis. Thus, independent hormone biosynthesis pathways must be regulated and co-ordinated to mount an integrated response. One of the possibilities is to use cis-regulatory elements to orchestrate expression of hormone biosynthesis genes. Analysis of CREs, associated with differentially expressed hormone biosynthesis related genes in rice leaf under Magnaporthe oryzae attack and drought stress enabled us to obtain insights about cross-talk among hormone biosynthesis pathways at the transcriptional level. We identified some master transcription regulators that co-ordinate different hormone biosynthesis pathways under stress. We found that Abscisic acid and Brassinosteroid regulate Cytokinin conjugation; conversely Brassinosteroid biosynthesis is affected by both Abscisic acid and Cytokinin. Jasmonic acid and Ethylene biosynthesis may be modulated by Abscisic acid through DREB transcription factors. Jasmonic acid or Salicylic acid biosynthesis pathways are co-regulated but they are unlikely to influence each others production directly. Thus, multiple hormones may modulate hormone biosynthesis pathways through a complex regulatory network, where biosynthesis of one hormone is affected by several other contributing hormones.

  10. Regulatory Cross-Talks and Cascades in Rice Hormone Biosynthesis Pathways Contribute to Stress Signaling.

    PubMed

    Deb, Arindam; Grewal, Rumdeep K; Kundu, Sudip

    2016-01-01

    Crosstalk among different hormone signaling pathways play an important role in modulating plant response to both biotic and abiotic stress. Hormone activity is controlled by its bio-availability, which is again influenced by its biosynthesis. Thus, independent hormone biosynthesis pathways must be regulated and co-ordinated to mount an integrated response. One of the possibilities is to use cis-regulatory elements to orchestrate expression of hormone biosynthesis genes. Analysis of CREs, associated with differentially expressed hormone biosynthesis related genes in rice leaf under Magnaporthe oryzae attack and drought stress enabled us to obtain insights about cross-talk among hormone biosynthesis pathways at the transcriptional level. We identified some master transcription regulators that co-ordinate different hormone biosynthesis pathways under stress. We found that Abscisic acid and Brassinosteroid regulate Cytokinin conjugation; conversely Brassinosteroid biosynthesis is affected by both Abscisic acid and Cytokinin. Jasmonic acid and Ethylene biosynthesis may be modulated by Abscisic acid through DREB transcription factors. Jasmonic acid or Salicylic acid biosynthesis pathways are co-regulated but they are unlikely to influence each others production directly. Thus, multiple hormones may modulate hormone biosynthesis pathways through a complex regulatory network, where biosynthesis of one hormone is affected by several other contributing hormones. PMID:27617021

  11. Radiation-modified structure of Ge25Sb15S60 and Ge35Sb5S60 glasses.

    PubMed

    Kavetskyy, T; Shpotyuk, O; Kaban, I; Hoyer, W

    2008-06-28

    Atomic structures of Ge(25)Sb(15)S(60) and Ge(35)Sb(5)S(60) glasses are investigated in the gamma-irradiated and annealed after gamma-irradiation states by means of high-energy synchrotron x-ray diffraction technique. The first sharp diffraction peak (FSDP) is detected at around 1.1 A(-1) in the structure factors of both alloys studied. The FSDP position is found to be stable for radiation/annealing treatment of the samples, while the FSDP intensity shows some changes between gamma-irradiated and annealed states. The peaks in the pair distribution functions observed between 2 and 4 A are related to the Ge-S, Ge-Sb, and Sb-Sb first neighbor correlations and Ge-Ge second neighbor correlations in the edge-shared GeS(42) tetrahedra, and S-S and/or Ge-Ge second neighbor correlations in the corner-shared GeS(42) tetrahedra. Three mechanisms of the radiation-/annealing-induced changes are discussed in the framework of coordination topological defect formation and bond-free solid angle concepts.

  12. Molecular Cytogenetics in Digenean Parasites: Linked and Unlinked Major and 5S rDNAs, B Chromosomes and Karyotype Diversification.

    PubMed

    García-Souto, Daniel; Pasantes, Juan J

    2015-01-01

    Digenetic trematodes are the largest group of internal metazoan parasites, but their chromosomes are poorly studied. Although chromosome numbers and/or karyotypes are known for about 300 of the 18,000 described species, molecular cytogenetic knowledge is mostly limited to the mapping of telomeric sequences and/or of major rDNA clusters in 9 species. In this work we mapped major and 5S rDNA clusters and telomeric sequences in chromosomes of Bucephalus minimus, B. australis, Prosorhynchoides carvajali (Bucephaloidea), Monascus filiformis (Gymnophalloidea), Parorchis acanthus (Echinostomatoidea), Cryptocotyle lingua (Opisthorchioidea), Cercaria longicaudata, Monorchis parvus (Monorchioidea), Diphterostomum brusinae, and Bacciger bacciger (Microphalloidea). Whilst single major and minor rDNA clusters were mapped to different chromosome pairs in B. minimus and P. acanthus, overlapping signals were detected on a single chromosome pair in the remaining taxa. FISH experiments using major rDNA and telomeric probes clearly demonstrated the presence of highly stretched NORs in most of the digenean taxa analyzed. B chromosomes were detected in the B. bacciger samples hosted by Ruditapes decussatus. Although the cercariae specimens obtained from Donax trunculus, Tellina tenuis, and R. decussatus were in agreement with B. bacciger, their karyotypes showed striking morphological differences in agreement with the proposed assignation of these cercariae to different species of the genus Bacciger. Results are discussed in comparison with previous data on digenean chromosomes. PMID:26680763

  13. Karyotype divergence and spreading of 5S rDNA sequences between genomes of two species: darter and emerald gobies ( Ctenogobius , Gobiidae).

    PubMed

    Lima-Filho, P A; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Molina, W F

    2014-01-01

    Karyotype analyses of the cryptobenthic marine species Ctenogobius boleosoma and C. smaragdus were performed by means of classical and molecular cytogenetics, including physical mapping of the multigene 18S and 5S rDNA families. C. boleosoma has 2n = 44 chromosomes (2 submetacentrics + 42 acrocentrics; FN = 46) with a single chromosome pair each carrying 18S and 5S ribosomal sites; whereas C. smaragdus has 2n = 48 chromosomes (2 submetacentrics + 46 acrocentrics; FN = 50), also with a single pair bearing 18S rDNA, but an extensive increase in the number of GC-rich 5S rDNA sites in 21 chromosome pairs. The highly divergent karyotypes among Ctenogobius species contrast with observations in several other marine fish groups, demonstrating an accelerated rate of chromosomal evolution mediated by both chromosomal rearrangements and the extensive dispersion of 5S rDNA sequences in the genome. PMID:24643007

  14. Karyotype divergence and spreading of 5S rDNA sequences between genomes of two species: darter and emerald gobies ( Ctenogobius , Gobiidae).

    PubMed

    Lima-Filho, P A; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Molina, W F

    2014-01-01

    Karyotype analyses of the cryptobenthic marine species Ctenogobius boleosoma and C. smaragdus were performed by means of classical and molecular cytogenetics, including physical mapping of the multigene 18S and 5S rDNA families. C. boleosoma has 2n = 44 chromosomes (2 submetacentrics + 42 acrocentrics; FN = 46) with a single chromosome pair each carrying 18S and 5S ribosomal sites; whereas C. smaragdus has 2n = 48 chromosomes (2 submetacentrics + 46 acrocentrics; FN = 50), also with a single pair bearing 18S rDNA, but an extensive increase in the number of GC-rich 5S rDNA sites in 21 chromosome pairs. The highly divergent karyotypes among Ctenogobius species contrast with observations in several other marine fish groups, demonstrating an accelerated rate of chromosomal evolution mediated by both chromosomal rearrangements and the extensive dispersion of 5S rDNA sequences in the genome.

  15. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

    PubMed Central

    Garcia, S; Kovařík, A

    2013-01-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S–5.8S–26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S–18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S–5.8S–26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants. PMID:23512008

  16. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    PubMed

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment. PMID:22724546

  17. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

    PubMed

    Garcia, S; Kovařík, A

    2013-07-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

  18. Early evolutionary colocalization of the nuclear ribosomal 5S and 45S gene families in seed plants: evidence from the living fossil gymnosperm Ginkgo biloba.

    PubMed

    Galián, J A; Rosato, M; Rosselló, J A

    2012-06-01

    In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S-5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S-5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S-5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S-5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary.

  19. Organization and variation analysis of 5S rDNA in different ploidy-level hybrids of red crucian carp × topmouth culter.

    PubMed

    He, Weiguo; Qin, Qinbo; Liu, Shaojun; Li, Tangluo; Wang, Jing; Xiao, Jun; Xie, Lihua; Zhang, Chun; Liu, Yun

    2012-01-01

    Through distant crossing, diploid, triploid and tetraploid hybrids of red crucian carp (Carassius auratus red var., RCC♀, Cyprininae, 2n = 100) × topmouth culter (Erythroculter ilishaeformis Bleeker, TC♂, Cultrinae, 2n = 48) were successfully produced. Diploid hybrids possessed 74 chromosomes with one set from RCC and one set from TC; triploid hybrids harbored 124 chromosomes with two sets from RCC and one set from TC; tetraploid hybrids had 148 chromosomes with two sets from RCC and two sets from TC. The 5S rDNA of the three different ploidy-level hybrids and their parents were sequenced and analyzed. There were three monomeric 5S rDNA classes (designated class I: 203 bp; class II: 340 bp; and class III: 477 bp) in RCC and two monomeric 5S rDNA classes (designated class IV: 188 bp, and class V: 286 bp) in TC. In the hybrid offspring, diploid hybrids inherited three 5S rDNA classes from their female parent (RCC) and only class IV from their male parent (TC). Triploid hybrids inherited class II and class III from their female parent (RCC) and class IV from their male parent (TC). Tetraploid hybrids gained class II and class III from their female parent (RCC), and generated a new 5S rDNA sequence (designated class I-N). The specific paternal 5S rDNA sequence of class V was not found in the hybrid offspring. Sequence analysis of 5S rDNA revealed the influence of hybridization and polyploidization on the organization and variation of 5S rDNA in fish. This is the first report on the coexistence in vertebrates of viable diploid, triploid and tetraploid hybrids produced by crossing parents with different chromosome numbers, and these new hybrids are novel specimens for studying the genomic variation in the first generation of interspecific hybrids, which has significance for evolution and fish genetics.

  20. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    PubMed

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment.

  1. The nucleotide sequences of 5S rRNAs from a sea-cucumber, a starfish and a sea-urchin.

    PubMed Central

    Ohama, T; Hori, H; Osawa, S

    1983-01-01

    The nucleotide sequences of 5S rRNA from three echinoderms, a sea-cucumber Stichopus oshimae, a starfish Asterina pectinifera and a sea-urchin Hemicentrotus pulcherrimus have been determined. These 5S rRNAs are all 120 nucleotides long. The echinoderm sequences are more related to the sequences of proterostomes animals such as mollusc, annelids and some others (87% identity on average) than to those of vertebrates (82% identity on average). PMID:6878041

  2. Catalytic asymmetric synthesis of butane diacetal-protected (4S,5S)-dihydroxycyclohexen-1-one and use in natural product synthesis.

    PubMed

    Burns, David J; Hachisu, Shuji; O'Brien, Peter; Taylor, Richard J K

    2012-10-14

    Due to the lack of availability of unnatural (+)-quinic acid as a starting material, a 6-step synthesis of butane diacetal-protected (4S,5S)-dihydroxycyclohexen-1-one (formally derived from (+)-quinic acid) has been devised. The key catalytic asymmetric step involves a chiral Co-salen-catalysed epoxide ring-opening reaction. (4S,5S)-Dihydroxycyclohexen-1-one was utilised in the synthesis of two cyclohexenone natural products isolated from the mycelia of Lasiodiplodia theobromae. PMID:22930235

  3. Chromosomal Locations of 5S and 45S rDNA in Gossypium Genus and Its Phylogenetic Implications Revealed by FISH.

    PubMed

    Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo

    2013-01-01

    We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G. incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G. raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution.

  4. Mutant forms of Escherichia coli protein L25 unable to bind to 5S rRNA are incorporated efficiently into the ribosome in vivo.

    PubMed

    Anikaev, A Y; Korepanov, A P; Korobeinikova, A V; Kljashtorny, V G; Piendl, W; Nikonov, S V; Garber, M B; Gongadze, G M

    2014-08-01

    5S rRNA-binding ribosomal proteins of the L25 family are an evolutional acquisition of bacteria. Earlier we showed that (i) single replacements in the RNA-binding module of the protein of this family result in destabilization or complete impossibility to form a complex with 5S rRNA in vitro; (ii) ΔL25 ribosomes of Escherichia coli are less efficient in protein synthesis in vivo than the control ribosomes. In the present work, the efficiency of incorporation of the E. coli protein L25 with mutations in the 5S rRNA-binding region into the ribosome in vivo was studied. It was found that the mutations in L25 that abolish its ability to form the complex with free 5S rRNA do not prevent its correct and efficient incorporation into the ribosome. This is supported by the fact that even the presence of a very weakly retained mutant form of the protein in the ribosome has a positive effect on the activity of the translational machinery in vivo. All this suggests the existence of an alternative incorporation pathway for this protein into the ribosome, excluding the preliminary formation of the complex with 5S rRNA. At the same time, the stable L25-5S rRNA contact is important for the retention of the protein within the ribosome, and the conservative amino acid residues of the RNA-binding module play a key role in this.

  5. Chromosomal localization of rDNA genes and genomic organization of 5S rDNA in Oreochromis mossambicus, O. urolepis hornorum and their hybrid.

    PubMed

    Zhu, Hua Ping; Lu, Mai Xin; Gao, Feng Ying; Huang, Zhang Han; Yang, Li Ping; Gui, Jian Fang

    2010-08-01

    In this study, classical and molecular cytogenetic analyses were performed in tilapia fishes, Oreochromis mossambicus (XX/XY sex determination system), O. urolepis hornorum (WZ/ZZ sex determination system) and their hybrid by crossing O. mossambicus female x O. u. hornorum male. An identical karyotype ((2n = 44, NF (total number of chromosomal arms) = 50) was obtained from three examined tilapia samples. Genomic organization analysis of 5S rDNA revealed two different types of 5S rDNA sequences, 5S type I and 5S type II. Moreover, fluorescence in situ hybridization (FISH) with 5S rDNA probes showed six positive fluorescence signals on six chromosomes of all the analysed metaphases from the three tilapia samples. Subsequently, 45S rDNA probes were also prepared, and six positive fluorescence signals were observed on three chromosome pairs in all analysed metaphases of the three tilapia samples. The correlation between 45 rDNA localization and nucleolar organizer regions (NORs) was confirmed by silver nitrate staining in tilapia fishes. Further, different chromosomal localizations of 5S rDNA and 45S rDNA were verified by two different colour FISH probes. Briefly, the current data provide an insights for hybridization projects and breeding improvement of tilapias.

  6. One-pot synthesis and visible light photocatalytic activity of monodispersed AgIn{sub 5}S{sub 8} microspheres

    SciTech Connect

    Li, Xiangqing; Wang, Lei; Wei, Dailong; Kang, Shizhao; Mu, Jin

    2013-02-15

    Graphical abstract: Display Omitted Highlights: ► Monodispersed AgIn{sub 5}S{sub 8} microspheres were prepared in a one-pot process. ► The process is environmental friendly. ► The AgIn{sub 5}S{sub 8} microspheres display high photocatalytic activity. -- Abstract: Monodispersed AgIn{sub 5}S{sub 8} microspheres were synthesized using a one-pot solution method and characterized with X-ray diffraction, UV–vis diffuse reflectance spectroscopy, scanning electron microscope, energy dispersive X-ray spectroscopy and N{sub 2} adsorption–desorption isotherm. The results indicated that the AgIn{sub 5}S{sub 8} microspheres were of cubic spinel structure and the mean diameter of about 0.5 μm. In addition, the visible light photocatalytic activity of AgIn{sub 5}S{sub 8} microspheres was also investigated at room temperature. The AgIn{sub 5}S{sub 8} microspheres showed very high photocatalytic activity for the degradation of methyl orange with a degradation efficiency of about 98% under visible light irradiation for 20 min.

  7. Search for B{sub s}{sup 0{yields}}hh decays at the {Upsilon}(5S) resonance

    SciTech Connect

    Peng, C.-C.; Chang, P.; Chao, Y.; Chen, K.-F.; Chen, P.; Chiang, C.-C.; Hou, W.-S.; Shiu, J.-G.; Adachi, I.; Haba, J.; Itoh, R.; Iwasaki, Y.; Krokovny, P.; Nakao, M.; Nishida, S.; Sakai, Y.; Sumisawa, K.; Tanaka, M.; Trabelsi, K.; Uehara, S.

    2010-10-01

    We have searched for B{sub s}{sup 0{yields}}hh decays, where h stands for a charged or neutral kaon, or a charged pion. These results are based on a 23.6 fb{sup -1} data sample collected with the Belle detector on the {Upsilon}(5S) resonance at the KEKB asymmetric-energy e{sup +}e{sup -} collider, containing 1.25x10{sup 6} B{sub s}{sup (*)}B{sub s}{sup (*)} events. We observe the decay B{sub s}{sup 0{yields}}K{sup +}K{sup -} and measure its branching fraction, B(B{sub s}{sup 0{yields}}K{sup +}K{sup -})=[3.8{sub -0.9}{sup +1.0}(stat){+-}0.5(syst){+-}0.5(f{sub s})]x10{sup -5}. The first error is statistical, the second is systematic, and the third error is due to the uncertainty in the B{sub s}{sup 0} production fraction in e{sup +}e{sup -{yields}}bb events. No significant signals are seen in other decay modes, and we set upper limits at the 90% confidence level: B(B{sub s}{sup 0{yields}}K{sup -{pi}+})<1.2x10{sup -5}, B(B{sub s}{sup 0{yields}{pi}+{pi}-})<2.6x10{sup -5}, and B(B{sub s}{sup 0{yields}}K{sup 0}K{sup 0})<6.6x10{sup -5}.

  8. What does the 5S rRNA multigene family tell us about the origin of the annual Triticeae (Poaceae)?

    PubMed

    Baum, B R; Edwards, T; Johnson, D A

    2013-05-01

    We have investigated the complex relationships among the annual genera within the tribe Triticeae through phylogenetic analyses of the 5S rRNA multigene family. Cloned sequences were assigned to groups of orthologous sequences, called unit classes, that were subjected to several analyses including BLAST (Basic Local Alignment Search Tool) searches to assess possible ancestral relationships with perennial genera; phylogenetic analyses using parsimony (Pars), maximum likelihood (ML), and Bayesian methods; and minimum reticulation networks from the Pars, ML, and Bayesian trees. In this study, we included genera with both annual and perennial species, such as Dasypyrum, Hordeum, and Secale. BLAST pointed to Pseudoroegneria (carrier of the St genome) and possibly Thinopyrum (carrier of the J genome) as the potential next of kin. However, Thinopyrum and Pseudoroegneria have never fallen together on the individual trees with the former generally associated with Crithopsis, Aegilops, Triticum, and Dasypyrum, while the latter is usually associated with the rest of the genera within Triticeae. The "long" unit classes placed Dasypyrum breviaristatum together with Dasypyrum villosum, whereas the "short" unit classes put them far apart on the trees. None of the gene trees alone was able to summarize the complex relationships among the genera, in line with previous results in the Triticeae. However, the application of tools designed to display phylogenetic networks was able to depict the complex links among the genera based on the short and the long gene trees, including the close link between Thinopyrum and Pseudoroegneria suggested by the phylogenetic analyses. In addition, our analyses provide support for the hypothesis that at least some annual Triticeae taxa are derived from their perennial relatives. PMID:23789993

  9. Putative Genes Involved in Saikosaponin Biosynthesis in Bupleurum Species

    PubMed Central

    Lin, Tsai-Yun; Chiou, Chung-Yi; Chiou, Shu-Jiau

    2013-01-01

    Alternative medicinal agents, such as the herb Bupleurum, are increasingly used in modern medicine to supplement synthetic drugs. First, we present a review of the currently known effects of triterpene saponins-saikosaponins of Bupleurum species. The putative biosynthetic pathway of saikosaponins in Bupleurum species is summarized, followed by discussions on identification and characterization of genes involved in the biosynthesis of saikosaponins. The purpose is to provide a brief review of gene extraction, functional characterization of isolated genes and assessment of expression patterns of genes encoding enzymes in the process of saikosaponin production in Bupleurum species, mainly B. kaoi. We focus on the effects of MeJA on saikosaponin production, transcription patterns of genes involved in biosynthesis and on functional depiction. PMID:23783277

  10. Biosynthesis and Function of Polyacetylenes and Allied Natural Products

    PubMed Central

    Minto, Robert E.; Blacklock, Brenda J.

    2008-01-01

    Polyacetylenic natural products are a substantial class of often unstable compounds containing a unique carbon-carbon triple bond functionality, that are intriguing for their wide variety of biochemical and ecological functions, economic potential, and surprising mode of biosynthesis. Isotopic tracer experiments between 1960 and 1990 demonstrated that the majority of these compounds are derived from fatty acid and polyketide precursors. During the past decade, research into the metabolism of polyacetylenes has swiftly advanced, driven by the cloning of the first genes responsible for polyacetylene biosynthesis in plants, moss, fungi, and actinomycetes, and the initial characterization of the gene products. The current state of knowledge of the biochemistry and molecular genetics of polyacetylenic secondary metabolic pathways will be presented together with an up-to-date survey of new terrestrial and marine natural products, their known biological activities, and a discussion of their likely metabolic origins. PMID:18387369

  11. BIOSYNTHESIS OF MYCOBACILLIN, A NEW ANTIFUNGAL PEPTIDE I.

    PubMed Central

    Banerjee, Arun B.; Bose, S. K.

    1964-01-01

    Banerjee, Arun B. (University of Calcutta, Calcutta, India), and S. K. Bose. Biosynthesis of mycobacillin, a new antifungal peptide. I. Role of nucleic acid. J. Bacteriol. 87:1397–1401. 1964.—The biosynthesis of mycobacillin, a cyclic polypeptide antifungal antibiotic, was studied in relation to the effect of chloramphenicol, 6-azathymine, and 5-bromouracil on the process. It was found that chloramphenicol inhibits both mycobacillin synthesis and growth, whereas nucleic acid base analogues inhibit only growth and nucleic acid synthesis but not mycobacillin formation. A change in the concentration of labeled aspartic acid in the general metabolic pool led to a corresponding change in the specific activity of aspartic acid isolated from different peptide fragments of the mycobacillin molecule, suggesting that mycobacillin synthesis occurs by way of linear addition of amino acid to the peptide chain. PMID:14188719

  12. The antimalarial drug quinine interferes with serotonin biosynthesis and action.

    PubMed

    Islahudin, Farida; Tindall, Sarah M; Mellor, Ian R; Swift, Karen; Christensen, Hans E M; Fone, Kevin C F; Pleass, Richard J; Ting, Kang-Nee; Avery, Simon V

    2014-01-01

    The major antimalarial drug quinine perturbs uptake of the essential amino acid tryptophan, and patients with low plasma tryptophan are predisposed to adverse quinine reactions; symptoms of which are similar to indications of tryptophan depletion. As tryptophan is a precursor of the neurotransmitter serotonin (5-HT), here we test the hypothesis that quinine disrupts serotonin function. Quinine inhibited serotonin-induced proliferation of yeast as well as human (SHSY5Y) cells. One possible cause of this effect is through inhibition of 5-HT receptor activation by quinine, as we observed here. Furthermore, cells exhibited marked decreases in serotonin production during incubation with quinine. By assaying activity and kinetics of the rate-limiting enzyme for serotonin biosynthesis, tryptophan hydroxylase (TPH2), we showed that quinine competitively inhibits TPH2 in the presence of the substrate tryptophan. The study shows that quinine disrupts both serotonin biosynthesis and function, giving important new insight to the action of quinine on mammalian cells.

  13. An engineered pathway for the biosynthesis of renewable propane

    PubMed Central

    Kallio, Pauli; Pásztor, András; Thiel, Kati; Akhtar, M. Kalim; Jones, Patrik R.

    2014-01-01

    The deployment of next-generation renewable biofuels can be enhanced by improving their compatibility with the current infrastructure for transportation, storage and utilization. Propane, the bulk component of liquid petroleum gas, is an appealing target as it already has a global market. In addition, it is a gas under standard conditions, but can easily be liquefied. This allows the fuel to immediately separate from the biocatalytic process after synthesis, yet does not preclude energy-dense storage as a liquid. Here we report, for the first time, a synthetic metabolic pathway for producing renewable propane. The pathway is based on a thioesterase specific for butyryl-acyl carrier protein (ACP), which allows native fatty acid biosynthesis of the Escherichia coli host to be redirected towards a synthetic alkane pathway. Propane biosynthesis is markedly stimulated by the introduction of an electron-donating module, optimizing the balance of O2 supply and removal of native aldehyde reductases. PMID:25181600

  14. Ontogenetic taurine biosynthesis ability in rainbow trout (Oncorhynchus mykiss).

    PubMed

    Wang, Xuan; He, Gen; Mai, Kangsen; Xu, Wei; Zhou, Huihui

    2015-07-01

    Taurine (2-aminoethane sulfonic acid) plays important roles in multiple physiological processes including osmoregulation, bile salt conjugation and membrane protection. It is known that taurine biosynthesis varies in different fish species. However, its ontogenetic regulation has not been clear. In the present study, we found that the hepatic concentrations of taurine increased marginally with rainbow trout growth. The mRNA expression, protein levels and enzyme activities of key enzymes involved in taurine biosynthesis, cysteine dioxygenase (CDO) and cysteine sulfinate decarboxylase (CSD), were analyzed. Our results showed that the mRNA levels and protein abundances of CSD increased dramatically with the development of rainbow trout stages while the enzyme activities showed a slight improvement. However, the expression and activities of CDO decreased with rainbow trout growth. These results provide valuable information on defining the exact supplementation of taurine in diets for different stages of rainbow trout and give new insights into elucidating the regulation of taurine metabolism in rainbow trout.

  15. Characterization of three amidinotransferases involved in the biosynthesis of ketomemicins.

    PubMed

    Ogasawara, Yasushi; Fujimori, Michiko; Kawata, Junpei; Dairi, Tohru

    2016-08-01

    We recently reported a novel class of amide bond forming enzymes (peptide ligases) involved in the biosynthesis of pheganomycins, resorcinomycins and ketomemicins. This class of enzymes exclusively utilizes Nα-amidino amino acids as the N-terminal substrate. In this Letter, we characterized three new amidinotransferases involved in the biosynthesis of ketomemicins and showed that l-arginine was the amidino-acceptor of amidinotransferases in both the Micromonospora sp. and Streptomyces mobaraensis clusters, while the Salinispora tropica enzyme recognized l-valine. Unexpectedly, the S. tropica enzyme accepted several different amino acids as amidino acceptors in addition to l-valine. Accordingly, we re-investigated the specific metabolites governed by the gene cluster of S. tropica and identified several minor congeners of ketomemicin C with different N-terminal amidino-amino acids. These results indicate that the amidinotransferase of S. tropica is promiscuous and could be useful to generate new ketomemicin-type natural products.

  16. Structural Framework for Metal Incorporation during Molybdenum Cofactor Biosynthesis.

    PubMed

    Kasaragod, Vikram Babu; Schindelin, Hermann

    2016-05-01

    The molybdenum cofactor (Moco) is essential for the catalytic activity of all molybdenum-containing enzymes with the exception of nitrogenase. Moco biosynthesis follows an evolutionarily highly conserved pathway and genetic deficiencies in the corresponding human enzymes result in Moco deficiency, which manifests itself in severe neurological symptoms and death in childhood. In humans the final steps of Moco biosynthesis are catalyzed by gephyrin, specifically the penultimate adenylation of molybdopterin (MPT) by its N-terminal G domain (GephG) and the final metal incorporation by its C-terminal E domain (GephE). To better understand the poorly defined molecular framework of this final step, we determined high-resolution crystal structures of GephE in the apo state and in complex with ADP, AMP, and molybdate. Our data provide novel insights into the catalytic steps leading to final Moco maturation, namely deadenylation as well as molybdate binding and insertion. PMID:27112598

  17. Altered lignin biosynthesis using biotechnology to improve lignocellulosic biofuel feedstocks.

    PubMed

    Poovaiah, Charleson R; Nageswara-Rao, Madhugiri; Soneji, Jaya R; Baxter, Holly L; Stewart, Charles N

    2014-12-01

    Lignocellulosic feedstocks can be converted to biofuels, which can conceivably replace a large fraction of fossil fuels currently used for transformation. However, lignin, a prominent constituent of secondary cell walls, is an impediment to the conversion of cell walls to fuel: the recalcitrance problem. Biomass pretreatment for removing lignin is the most expensive step in the production of lignocellulosic biofuels. Even though we have learned a great deal about the biosynthesis of lignin, we do not fully understand its role in plant biology, which is needed for the rational design of engineered cell walls for lignocellulosic feedstocks. This review will recapitulate our knowledge of lignin biosynthesis and discuss how lignin has been modified and the consequences for the host plant.

  18. Predicted Roles of the Uncharacterized Clustered Genes in Aflatoxin Biosynthesis

    PubMed Central

    Ehrlich, Kenneth C.

    2009-01-01

    Biosynthesis of the toxic and carcinogenic aflatoxins (AFs) requires the activity of more than 27 enzymes. The roles in biosynthesis of newly described enzymes are discussed in this review. We suggest that HypC catalyzes the oxidation of norsolorinic acid anthrone; AvfA (AflI), the ring-closure step in formation of hydroxyversicolorone; HypB, the second oxidation step in conversion of O-methylsterigmatocystin to AF; and HypE and NorA (AflE), the final two steps in AFB1 formation. HypD, an integral membrane protein, affects fungal development and lowers AF production while AflJ (AflS), has a partial methyltransferase domain that may be important in its function as a transcriptional co-activator. PMID:22069531

  19. Tetrahydrobiopterin biosynthesis as an off-target of sulfa drugs.

    PubMed

    Haruki, Hirohito; Pedersen, Miriam Grønlund; Gorska, Katarzyna Irena; Pojer, Florence; Johnsson, Kai

    2013-05-24

    The introduction of sulfa drugs for the chemotherapy of bacterial infections in 1935 revolutionized medicine. Although their mechanism of action is understood, the molecular bases for most of their side effects remain obscure. Here, we report that sulfamethoxazole and other sulfa drugs interfere with tetrahydrobiopterin biosynthesis through inhibition of sepiapterin reductase. Crystal structures of sepiapterin reductase with bound sulfa drugs reveal how structurally diverse sulfa drugs achieve specific inhibition of the enzyme. The effect of sulfa drugs on tetrahydrobiopterin-dependent neurotransmitter biosynthesis in cell-based assays provides a rationale for some of their central nervous system-related side effects, particularly in high-dose sulfamethoxazole therapy of Pneumocystis pneumonia. Our findings reveal an unexpected aspect of the pharmacology of sulfa drugs and might translate into their improved medical use.

  20. An engineered pathway for the biosynthesis of renewable propane.

    PubMed

    Kallio, Pauli; Pásztor, András; Thiel, Kati; Akhtar, M Kalim; Jones, Patrik R

    2014-01-01

    The deployment of next-generation renewable biofuels can be enhanced by improving their compatibility with the current infrastructure for transportation, storage and utilization. Propane, the bulk component of liquid petroleum gas, is an appealing target as it already has a global market. In addition, it is a gas under standard conditions, but can easily be liquefied. This allows the fuel to immediately separate from the biocatalytic process after synthesis, yet does not preclude energy-dense storage as a liquid. Here we report, for the first time, a synthetic metabolic pathway for producing renewable propane. The pathway is based on a thioesterase specific for butyryl-acyl carrier protein (ACP), which allows native fatty acid biosynthesis of the Escherichia coli host to be redirected towards a synthetic alkane pathway. Propane biosynthesis is markedly stimulated by the introduction of an electron-donating module, optimizing the balance of O2 supply and removal of native aldehyde reductases. PMID:25181600

  1. In-situ glyoxalization during biosynthesis of bacterial cellulose.

    PubMed

    Castro, Cristina; Cordeiro, Nereida; Faria, Marisa; Zuluaga, Robin; Putaux, Jean-Luc; Filpponen, Ilari; Velez, Lina; Rojas, Orlando J; Gañán, Piedad

    2015-08-01

    A novel method to synthesize highly crosslinked bacterial cellulose (BC) is reported. The glyoxalization is started in-situ, in the culture medium during biosynthesis of cellulose by Gluconacetobacter medellensis bacteria. Strong crosslinked networks were formed in the contact areas between extruded cellulose ribbons by reaction with the glyoxal precursors. The crystalline structure of cellulose was preserved while the acidic component of the surface energy was reduced. As a consequence, its predominant acidic character and the relative contribution of the dispersive component increased, endowing the BC network with a higher hydrophobicity. This route for in-situ crosslinking is expected to facilitate other modifications upon biosynthesis of cellulose ribbons by microorganisms and to engineer the strength and surface energy of their networks. PMID:25933519

  2. Studies on the control of hexosamine biosynthesis by glucosamine synthetase

    PubMed Central

    Winterburn, P. J.; Phelps, C. F.

    1971-01-01

    1. The nature of the feedback inhibition of hexosamine biosynthesis on rat liver glucosamine synthetase (l-glutamine–d-fructose 6-phosphate aminotransferase, EC 2.6.1.16) by UDP-N-acetylglucosamine was investigated in detail. 2. Further modifiers of physiological importance are described. Glucose 6-phosphate and AMP potentiated the UDP-N-acetylglucosamine inhibition, and UTP behaved as an activator. These three compounds only exerted their action when the feedback inhibitor was bound to the enzyme. 3. ATP also inhibited the enzyme. 4. The actions of these various effectors are discussed in kinetic terms. 5. An interpretation of these findings with reference to the regulation of hexosamine biosynthesis is presented. PMID:5114979

  3. Biosynthesis of polyamines and polyamine-containing molecules.

    PubMed

    Michael, Anthony J

    2016-08-01

    Polyamines are evolutionarily ancient polycations derived from amino acids and are pervasive in all domains of life. They are essential for cell growth and proliferation in eukaryotes and are essential, important or dispensable for growth in bacteria. Polyamines present a useful scaffold to attach other moieties to, and are often incorporated into specialized metabolism. Life has evolved multiple pathways to synthesize polyamines, and structural variants of polyamines have evolved in bacteria, archaea and eukaryotes. Among the complex biosynthetic diversity, patterns of evolutionary reiteration can be distinguished, revealing evolutionary recycling of particular protein folds and enzyme chassis. The same enzyme activities have evolved from multiple protein folds, suggesting an inevitability of evolution of polyamine biosynthesis. This review discusses the different biosynthetic strategies used in life to produce diamines, triamines, tetra-amines and branched and long-chain polyamines. It also discusses the enzymes that incorporate polyamines into specialized metabolites and attempts to place polyamine biosynthesis in an evolutionary context.

  4. Involvement of snapdragon benzaldehyde dehydrogenase in benzoic acid biosynthesis.

    PubMed

    Long, Michael C; Nagegowda, Dinesh A; Kaminaga, Yasuhisa; Ho, Kwok Ki; Kish, Christine M; Schnepp, Jennifer; Sherman, Debra; Weiner, Henry; Rhodes, David; Dudareva, Natalia

    2009-07-01

    Benzoic acid (BA) is an important building block in a wide spectrum of compounds varying from primary metabolites to secondary products. Benzoic acid biosynthesis from L-phenylalanine requires shortening of the propyl side chain by two carbons, which can occur via a beta-oxidative pathway or a non-beta-oxidative pathway, with benzaldehyde as a key intermediate. The non-beta-oxidative route requires benzaldehyde dehydrogenase (BALDH) to convert benzaldehyde to BA. Using a functional genomic approach, we identified an Antirrhinum majus (snapdragon) BALDH, which exhibits 40% identity to bacterial BALDH. Transcript profiling, biochemical characterization of the purified recombinant protein, molecular homology modeling, in vivo stable isotope labeling, and transient expression in petunia flowers reveal that BALDH is capable of oxidizing benzaldehyde to BA in vivo. GFP localization and immunogold labeling studies show that this biochemical step occurs in the mitochondria, raising a question about the role of subcellular compartmentalization in BA biosynthesis.

  5. The inhibitory components from Artocarpus incisus on melanin biosynthesis.

    PubMed

    Shimizu, K; Kondo, R; Sakai, K; Lee, S H; Sato, H

    1998-06-01

    The inhibitory effects of methanol extracts of heartwood of 23 Papua New Guinean wood species on tyrosinase activity were examined. The extract of Artocarpus incisus showed the strongest tyrosinase inhibitory activity which was equivalent to kojic acid. The extract apparently inhibited melanin biosynthesis of both cultured B16 melanoma cells without any cytotoxicity and in the back of a brown guinea pig without skin irritation. Thus, the potentiality of the extracts of heartwood of A. incisus both as material of a useful skin whitening agent and as a remedy for disturbances in pigmentation is evident. Tyrosinase inhibitory activity-guided fractionation led to the isolation of seven active compounds including a new compound which has been characterized as 6-(3"-methyl-1"-butenyl)-5,7,2',4'-tetrahydroxyflavone, named isoartocarpesin. Other active compounds were (+)-dihydromorin, chlorophorin, (+)-norartocarpanone, 4-prenyloxyresveratrol, artocarbene, and artocarpesin, These compounds are probably responsible for the melanin biosynthesis inhibitory effects.

  6. Biosynthesis and therapeutic properties of Lavandula essential oil constituents.

    PubMed

    Woronuk, Grant; Demissie, Zerihun; Rheault, Mark; Mahmoud, Soheil

    2011-01-01

    Lavenders and their essential oils have been used in alternative medicine for several centuries. The volatile compounds that comprise lavender essential oils, including linalool and linalyl acetate, have demonstrative therapeutic properties, and the relative abundance of these metabolites is greatly influenced by the genetics and environment of the developing plants. With the rapid progress of molecular biology and the genomic sciences, our understanding of essential oil biosynthesis has greatly improved over the past few decades. At the same time, there is a recent surge of interest in the use of natural remedies, including lavender essential oils, in alternative medicine and aromatherapy. This article provides a review of recent developments related to the biosynthesis and medicinal properties of lavender essential oils.

  7. Farnesylation mediates brassinosteroid biosynthesis to regulate abscisic acid responses.

    PubMed

    Northey, Julian G B; Liang, Siyu; Jamshed, Muhammad; Deb, Srijani; Foo, Eloise; Reid, James B; McCourt, Peter; Samuel, Marcus A

    2016-01-01

    Protein farnesylation is a post-translational modification involving the addition of a 15-carbon farnesyl isoprenoid to the carboxy terminus of select proteins(1-3). Although the roles of this lipid modification are clear in both fungal and animal signalling, many of the mechanistic functions of farnesylation in plant signalling are still unknown. Here, we show that CYP85A2, the cytochrome P450 enzyme that performs the last step in brassinosteroid biosynthesis (conversion of castasterone to brassinolide)(4), must be farnesylated to function in Arabidopsis. Loss of either CYP85A2 or CYP85A2 farnesylation results in reduced brassinolide accumulation and increased plant responsiveness to the hormone abscisic acid (ABA) and overall drought tolerance, explaining previous observations(5). This result not only directly links farnesylation to brassinosteroid biosynthesis but also suggests new strategies to maintain crop yield under challenging climatic conditions. PMID:27455172

  8. Haemoglobin biosynthesis site in rabbit embryo erythroid cells.

    PubMed

    Cianciarullo, Aurora M; Bertho, Alvaro L; Soares, Maurilio J; Hosoda, Tânia M; Nogueira-Silva, Simone; Beçak, Willy

    2003-01-01

    Properly metabolized globin synthesis and iron uptake are indispensable for erythroid cell differentiation and maturation. Mitochondrial participation is crucial in the process of haeme synthesis for cytochromes and haemoglobin. We studied the final biosynthesis site of haemoglobin using an ultrastructural approach, with erythroid cells obtained from rabbit embryos, in order to compare these results with those of animals treated with saponine or phenylhydrazine. Our results are similar to those obtained in assays with adult mammals, birds, amphibians, reptiles and fish, after induction of haemolytic anaemia. Therefore, the treatment did not interfere with the process studied, confirming our previous findings. Immunoelectron microscopy showed no labelling of mitochondria or other cellular organelles supposedly involved in the final biosynthesis of haemoglobin molecules, suggesting instead that it occurs free in the cytoplasm immediately after the liberation of haeme from the mitochondria, by electrostatic attraction between haeme and globin chains. PMID:12972280

  9. In-situ glyoxalization during biosynthesis of bacterial cellulose.

    PubMed

    Castro, Cristina; Cordeiro, Nereida; Faria, Marisa; Zuluaga, Robin; Putaux, Jean-Luc; Filpponen, Ilari; Velez, Lina; Rojas, Orlando J; Gañán, Piedad

    2015-08-01

    A novel method to synthesize highly crosslinked bacterial cellulose (BC) is reported. The glyoxalization is started in-situ, in the culture medium during biosynthesis of cellulose by Gluconacetobacter medellensis bacteria. Strong crosslinked networks were formed in the contact areas between extruded cellulose ribbons by reaction with the glyoxal precursors. The crystalline structure of cellulose was preserved while the acidic component of the surface energy was reduced. As a consequence, its predominant acidic character and the relative contribution of the dispersive component increased, endowing the BC network with a higher hydrophobicity. This route for in-situ crosslinking is expected to facilitate other modifications upon biosynthesis of cellulose ribbons by microorganisms and to engineer the strength and surface energy of their networks.

  10. Investigation of Bacterial Cellulose Biosynthesis Mechanism in Gluconoacetobacter hansenii

    PubMed Central

    Mohite, Bhavna V.; Patil, Satish V.

    2014-01-01

    The present study explores the mechanism of cellulose biosynthesis in Gluconoacetobacter hansenii. The cellulose synthase enzyme was purified as membrane fraction and solubilized by treatment with 0.1% digitonin. The enzyme was separated by native-gel electrophoresis and β-D-glucan analysis was carried out using in vitro gel assay. The cellulose synthase has glycoprotein nature and composed two polypeptide subunits of 93 KDa and 85 KDa. The confirmation of β-1,4-glucan (cellulose) was performed in whole and hydrolyzed monomeric sugar form. Tinopal and Congo red were used for cellulose detection on the gel. Thus the in vitro cellulose synthesis assay with cell free enzyme fraction was attempted to improve the understanding of cellulose biosynthesis. PMID:25031880

  11. Biosynthesis of rat enamel matrix components in vivo

    SciTech Connect

    Sasaki, S.; Shimokawa, H.; Tanaka, K.

    1982-12-01

    The biosynthesis of enamel matrix components of developing rat incisors was investigated by measuring the incorporation of /sup 3/H-proline, /sup 32/P-phosphate, and /sup 35/S-sulfate in vivo. /sup 3/H- and /sup 32/P-radioactivity was found in what seemed to be a prototype of enamel proteins. Subsequent shifts in other protein and peptide fractions were observed. /sup 35/S was also incorporated into components other than the above-mentioned proteins.

  12. Cell cycle-dependent regulation of pyrimidine biosynthesis.

    PubMed

    Sigoillot, Frederic D; Berkowski, J Andrew; Sigoillot, Severine M; Kotsis, Damian H; Guy, Hedeel I

    2003-01-31

    De novo pyrimidine biosynthesis is activated in proliferating cells in response to an increased demand for nucleotides needed for DNA synthesis. The pyrimidine biosynthetic pathway in baby hamster kidney cells, synchronized by serum deprivation, was found to be up-regulated 1.9-fold during S phase and subsequently down-regulated as the cells progressed through the cycle. The nucleotide pools were depleted by serum starvation and were not replenished during the first round of cell division, suggesting that the rate of utilization of the newly synthesized nucleotides closely matched their rate of formation. The activation and subsequent down-regulation of the pathway can be attributed to altered allosteric regulation of the carbamoyl-phosphate synthetase activity of CAD (carbamoyl-phosphate synthetase-aspartate carbamoyltransferase-dihydroorotase), a multifunctional protein that initiates mammalian pyrimidine biosynthesis. As the culture approached S-phase there was an increased sensitivity to the allosteric activator, 5-phosphoribosyl-1-pyrophosphate, and a loss of UTP inhibition, changes that were reversed when cells emerged from S phase. The allosteric regulation of CAD is known to be modulated by MAP kinase (MAPK) and protein kinase A (PKA)-mediated phosphorylations as well as by autophosphorylation. CAD was found to be fully autophosphorylated in the synchronized cells, but the level remained invariant throughout the cycle. Although the MAPK activity increased early in G(1), the phosphorylation of the CAD MAPK site was delayed until just before the onset of S phase, probably due to antagonistic phosphorylation by PKA that persisted until late G(1). Once activated, pyrimidine biosynthesis remained elevated until rephosphorylation of CAD by PKA and dephosphorylation of the CAD MAPK site late in S phase. Thus, the cell cycle-dependent regulation of pyrimidine biosynthesis results from the sequential phosphorylation and dephosphorylation of CAD under the control of

  13. Monomethylarsonous acid inhibited endogenous cholesterol biosynthesis in human skin fibroblasts

    SciTech Connect

    Guo, Lei; Xiao, Yongsheng; Wang, Yinsheng

    2014-05-15

    Human exposure to arsenic in drinking water is a widespread public health concern, and such exposure is known to be associated with many human diseases. The detailed molecular mechanisms about how arsenic species contribute to the adverse human health effects, however, remain incompletely understood. Monomethylarsonous acid [MMA(III)] is a highly toxic and stable metabolite of inorganic arsenic. To exploit the mechanisms through which MMA(III) exerts its cytotoxic effect, we adopted a quantitative proteomic approach, by coupling stable isotope labeling by amino acids in cell culture (SILAC) with LC-MS/MS analysis, to examine the variation in the entire proteome of GM00637 human skin fibroblasts following acute MMA(III) exposure. Among the ∼ 6500 unique proteins quantified, ∼ 300 displayed significant changes in expression after exposure with 2 μM MMA(III) for 24 h. Subsequent analysis revealed the perturbation of de novo cholesterol biosynthesis, selenoprotein synthesis and Nrf2 pathways evoked by MMA(III) exposure. Particularly, MMA(III) treatment resulted in considerable down-regulation of several enzymes involved in cholesterol biosynthesis. In addition, real-time PCR analysis showed reduced mRNA levels of select genes in this pathway. Furthermore, MMA(III) exposure contributed to a distinct decline in cellular cholesterol content and significant growth inhibition of multiple cell lines, both of which could be restored by supplementation of cholesterol to the culture media. Collectively, the present study demonstrated that the cytotoxicity of MMA(III) may arise, at least in part, from the down-regulation of cholesterol biosynthesis enzymes and the resultant decrease of cellular cholesterol content. - Highlights: • MMA(III)-induced perturbation of the entire proteome of GM00637 cells is studied. • Quantitative proteomic approach revealed alterations of multiple cellular pathways. • MMA(III) inhibits de novo cholesterol biosynthesis. • MMA

  14. Cholesterol biosynthesis and ER stress in peroxisome deficiency.

    PubMed

    Faust, Phyllis L; Kovacs, Werner J

    2014-03-01

    Cholesterol biosynthesis is a multi-step process involving more than 20 enzymes in several subcellular compartments. The pre-squalene segment of the cholesterol/isoprenoid biosynthetic pathway is localized in peroxisomes. This review intends to highlight recent findings illustrating the important role peroxisomes play in cholesterol biosynthesis and maintenance of cholesterol homeostasis. Disruption of the Pex2 gene leads to peroxisome deficiency and widespread metabolic dysfunction. The Pex2(-/-) mouse model for Zellweger syndrome enabled us to evaluate the role of peroxisomes in cholesterol biosynthesis. These studies have shown that Pex2(-/-) mice exhibit low levels of cholesterol in plasma and liver. Pex2(-/-) mice were unable to maintain normal cholesterol homeostasis despite activation of SREBP-2, the master transcriptional regulator of cholesterol biosynthesis, and increased protein levels and activities of cholesterol biosynthetic enzymes. The SREBP-2 pathway remained activated even after normalization of hepatic cholesterol levels in response to bile acid feeding as well as in extrahepatic tissues and the liver of neonatal and longer surviving Pex2 mutants, where cholesterol levels were normal. Several studies have shown that endoplasmic reticulum (ER) stress can dysregulate lipid metabolism via SREBP activation independently of intracellular cholesterol concentration. We demonstrated that peroxisome deficiency activates endoplasmic reticulum stress pathways in Pex2(-/-) mice, especially the integrated stress response mediated by PERK and ATF4 signaling, and thereby leads to dysregulation of the SREBP-2 pathway. Our findings suggest that functional peroxisomes are necessary to prevent chronic ER stress and dysregulation of the endogenous sterol response pathway. The constitutive activation of ER stress pathways might contribute to organ pathology and metabolic dysfunction in peroxisomal disorder patients.

  15. Dysregulation of cardiolipin biosynthesis in pediatric heart failure.

    PubMed

    Chatfield, Kathryn C; Sparagna, Genevieve C; Sucharov, Carmen C; Miyamoto, Shelley D; Grudis, Jonathan E; Sobus, Rebecca D; Hijmans, Jamie; Stauffer, Brian L

    2014-09-01

    Cardiolipin, a unique phospholipid in the inner mitochondrial membrane, is critical for optimal mitochondrial function. CL abnormalities have been demonstrated in the failing rodent and adult human heart. The aim of this study was to determine whether abnormalities in CL content and the CL biosynthesis and remodeling pathways are present in pediatric idiopathic dilated cardiomyopathy (IDC). A cross-sectional analysis of myocardial tissue from 119 IDC and non-failing (NF) control samples was performed. Electrospray ionizing mass spectrometry was used to measure total CL and CL species content in LV tissue. RT-PCR was employed to measure gene expression of the enzymes in the CL biosynthesis and remodeling pathways in both the adult and pediatric heart. Significantly lower total and (18:2)4CL (the beneficial species) content was demonstrated in myocardium from pediatric patients with IDC compared to NF controls. Analysis of mitochondrial gene transcripts was used to demonstrate that there is no decrease in mitochondrial content. Expression of two biosynthesis enzymes and one remodeling enzyme was significantly lower in pediatric IDC compared to NF controls. Expression of two phospholipases involved in CL degradation were also altered, one up- and one down-regulated. Except for one remodeling enzyme, these changes are unique from those in the failing adult heart. Similar to what has been seen in adults and in a rat model of IDC, total and (18:2)4CL are lower in pediatric IDC. Unique CL species profiles are seen in heart tissue from children with IDC compared to adults. Differences in CL biosynthesis and remodeling enzyme expression likely explain the differences in CL profiles observed in IDC and implicate unique age-related mechanisms of disease.

  16. Elucidating hydroxylation and methylation steps tailoring piericidin A1 biosynthesis.

    PubMed

    Chen, Yaolong; Zhang, Wenjun; Zhu, Yiguang; Zhang, Qingbo; Tian, Xinpeng; Zhang, Si; Zhang, Changsheng

    2014-02-01

    The piericidin A1 (1) gene cluster was identified from the deep-sea derived Streptomyces sp. SCSIO 03032. Our in vivo and in vitro experiments verified PieE as a 4'-hydroxylase and PieB2 as a 4'-O-methyltransferase, allowing the elucidation of the post-PKS modification steps involved in 1 biosynthesis. In addition, the shunt metabolite piericidin E1 (7) was identified as a novel analogue featuring a C-2/C-3 epoxy ring.

  17. Two distinct pathways for essential metabolic precursors for isoprenoid biosynthesis

    PubMed Central

    KUZUYAMA, Tomohisa; SETO, Haruo

    2012-01-01

    Isoprenoids are a diverse group of molecules found in all organisms, where they perform such important biological functions as hormone signaling (e.g., steroids) in mammals, antioxidation (e.g., carotenoids) in plants, electron transport (e.g., ubiquinone), and cell wall biosynthesis intermediates in bacteria. All isoprenoids are synthesized by the consecutive condensation of the five-carbon monomer isopentenyl diphosphate (IPP) to its isomer, dimethylallyl diphosphate (DMAPP). The biosynthetic pathway for the formation of IPP from acetyl-CoA (i.e., the mevalonate pathway) had been established mainly in mice and the budding yeast Saccharomyces cerevisiae. Curiously, most prokaryotic microorganisms lack homologs of the genes in the mevalonate pathway, even though IPP and DMAPP are essential for isoprenoid biosynthesis in bacteria. This observation provided an impetus to search for an alternative pathway to synthesize IPP and DMAPP, ultimately leading to the discovery of the mevalonate-independent 2-C-methyl-d-erythritol 4-phosphate pathway. This review article focuses on our significant contributions to a comprehensive understanding of the biosynthesis of IPP and DMAPP. PMID:22450534

  18. Metabolic engineering of cottonseed oil biosynthesis pathway via RNA interference.

    PubMed

    Xu, Zhongping; Li, Jingwen; Guo, Xiaoping; Jin, Shuangxia; Zhang, Xianlong

    2016-01-01

    Cottonseed oil is recognized as an important oil in food industry for its unique characters: low flavor reversion and the high level of antioxidants (VitaminE) as well as unsaturated fatty acid. However, the cottonseed oil content of cultivated cotton (Gossypium hirsutum) is only around 20%. In this study, we modified the accumulation of oils by the down-regulation of phosphoenolpyruvate carboxylase 1 (GhPEPC1) via RNA interference in transgenic cotton plants. The qRT-PCR and enzyme activity assay revealed that the transcription and expression of GhPEPC1 was dramatically down-regulated in transgenic lines. Consequently, the cottonseed oil content in several transgenic lines showed a significant (P < 0.01) increase (up to 16.7%) without obvious phenotypic changes under filed condition when compared to the control plants. In order to elucidate the molecular mechanism of GhPEPC1 in the regulation of seed oil content, we quantified the expression of the carbon metabolism related genes of transgenic GhPEPC1 RNAi lines by transcriptome analysis. This analysis revealed the decrease of GhPEPC1 expression led to the increase expression of triacylglycerol biosynthesis-related genes, which eventually contributed to the lipid biosynthesis in cotton. This result provides a valuable information for cottonseed oil biosynthesis pathway and shows the potential of creating high cottonseed oil germplasm by RNAi strategy for cotton breeding. PMID:27620452

  19. Next generation sequencing in predicting gene function in podophyllotoxin biosynthesis.

    PubMed

    Marques, Joaquim V; Kim, Kye-Won; Lee, Choonseok; Costa, Michael A; May, Gregory D; Crow, John A; Davin, Laurence B; Lewis, Norman G

    2013-01-01

    Podophyllum species are sources of (-)-podophyllotoxin, an aryltetralin lignan used for semi-synthesis of various powerful and extensively employed cancer-treating drugs. Its biosynthetic pathway, however, remains largely unknown, with the last unequivocally demonstrated intermediate being (-)-matairesinol. Herein, massively parallel sequencing of Podophyllum hexandrum and Podophyllum peltatum transcriptomes and subsequent bioinformatics analyses of the corresponding assemblies were carried out. Validation of the assembly process was first achieved through confirmation of assembled sequences with those of various genes previously established as involved in podophyllotoxin biosynthesis as well as other candidate biosynthetic pathway genes. This contribution describes characterization of two of the latter, namely the cytochrome P450s, CYP719A23 from P. hexandrum and CYP719A24 from P. peltatum. Both enzymes were capable of converting (-)-matairesinol into (-)-pluviatolide by catalyzing methylenedioxy bridge formation and did not act on other possible substrates tested. Interestingly, the enzymes described herein were highly similar to methylenedioxy bridge-forming enzymes from alkaloid biosynthesis, whereas candidates more similar to lignan biosynthetic enzymes were catalytically inactive with the substrates employed. This overall strategy has thus enabled facile further identification of enzymes putatively involved in (-)-podophyllotoxin biosynthesis and underscores the deductive power of next generation sequencing and bioinformatics to probe and deduce medicinal plant biosynthetic pathways.

  20. Biosynthesis of anatoxin-a and analogues (anatoxins) in cyanobacteria.

    PubMed

    Méjean, Annick; Paci, Guillaume; Gautier, Valérie; Ploux, Olivier

    2014-12-01

    Freshwater cyanobacteria produce secondary metabolites that are toxic to humans and animals, the so-called cyanotoxins. Among them, anatoxin-a and homoanatoxin-a are potent neurotoxins that are agonists of the nicotinic acetylcholine receptor. These alkaloids provoke a rapid death if ingested at low doses. Recently, the cluster of genes responsible for the biosynthesis of these toxins, the ana cluster, has been identified in Oscillatoria sp. PCC 6506, and a biosynthetic pathway was proposed. This biosynthesis was reconstituted in vitro using purified enzymes confirming the predicted pathway. One of the enzymes, AnaB a prolyl-acyl carrier protein oxidase, was crystallized and its three dimensional structure solved confirming its reaction mechanism. Three other ana clusters have now been identified and sequenced in other cyanobacteria. These clusters show similarities and some differences suggesting a common evolutionary origin. In particular, the cluster from Cylindrospermum stagnale PCC 7417, possesses an extra gene coding for an F420-dependent oxidoreductase that is likely involved in the biosynthesis of dihydroanatoxin-a. This review summarizes all these new data and discusses them in relation to the production of anatoxins in the environment.