Science.gov

Sample records for 5s clavam biosynthetic

  1. 5S clavam biosynthesis is controlled by an atypical two-component regulatory system in Streptomyces clavuligerus.

    PubMed

    Kwong, Thomas; Zelyas, Nathan J; Cai, Hui; Tahlan, Kapil; Wong, Annie; Jensen, Susan E

    2012-09-01

    Streptomyces clavuligerus produces a collection of five clavam metabolites, including the clinically important β-lactamase inhibitor clavulanic acid, as well as four structurally related metabolites called 5S clavams. The paralogue gene cluster of S. clavuligerus is one of three clusters of genes for the production of these clavam metabolites. A region downstream of the cluster was analyzed, and snk, res1, and res2, encoding elements of an atypical two-component regulatory system, were located. Mutation of any one of the three genes had no effect on clavulanic acid production, but snk and res2 mutants produced no 5S clavams, whereas res1 mutants overproduced 5S clavams. Reverse transcriptase PCR analyses showed that transcription of cvm7p (which encodes a transcriptional activator of 5S clavam biosynthesis) and 5S clavam biosynthetic genes was eliminated in snk and in res2 mutants but that snk and res2 transcription was unaffected in a cvm7p mutant. Both snk and res2 mutants could be complemented by introduction of cvm7p under the control of an independently regulated promoter. In vitro assays showed that Snk can autophosphorylate and transfer its phosphate group to both Res1 and Res2, and Snk-H365, Res1-D52, and Res2-D52 were identified as the phosphorylation sites for the system. Dephosphorylation assays indicated that Res1 stimulates dephosphorylation of Res2∼P. These results suggest a regulatory cascade in which Snk and Res2 form a two-component system controlling cvm7p transcription, with Res1 serving as a checkpoint to modulate phosphorylation levels. Cvm7P then activates transcription of 5S clavam biosynthetic genes.

  2. Inversion of the stereochemical configuration (3S, 5S)-clavaminic acid into (3R, 5R)-clavulanic acid: A computationally-assisted approach based on experimental evidence.

    PubMed

    Ramirez-Malule, Howard; Restrepo, Albeiro; Cardona, Wilson; Junne, Stefan; Neubauer, Peter; Rios-Estepa, Rigoberto

    2016-04-21

    Clavulanic acid (CA), a potent inhibitor of β-lactamase enzymes, is produced by Streptomyces clavuligerus (Sc) cultivation processes, for which low yields are commonly obtained. Improved knowledge of the clavam biosynthetic pathway, especially the steps involved in the inversion of 3S-5S into 3R-5R stereochemical configuration, would help to eventually identify bottlenecks in the pathway. In this work, we studied the role of acetate in CA biosynthesis by a combined continuous culture and computational simulation approach. From this we derived a new model for the synthesis of N-acetyl-glycyl-clavaminic acid (NAG-clavam) by Sc. Acetylated compounds, such as NAG-clavam and N-acetyl-clavaminic acid, have been reported in the clavam pathway. Although the acetyl group is present in the β-lactam intermediate NAG-clavam, it is unknown how this group is incorporated. Hence, under the consideration of the experimentally proven accumulation of acetate during CA biosynthesis, and the fact that an acetyl group is present in the NAG-clavam structure, a computational evaluation of the tentative formation of NAG-clavam was performed for the purpose of providing further understanding. The proposed reaction mechanism consists of two steps: first, acetate reacts with ATP to produce a reactive acylphosphate intermediate; second, a direct nucleophilic attack of the terminal amino group of N-glycyl-clavaminic on the carbonyl carbon of the acylphosphate intermediate leads to a tetrahydral intermediate, which collapses and produces ADP and N-acetyl-glycyl-clavaminic acid. The calculations suggest that for the proposed reaction mechanism, the reaction proceeds until completion of the first step, without the direct action of an enzyme, where acetate and ATP are involved. For this step, the computed activation energy was ≅2.82kcal/mol while the reaction energy was ≅2.38kcal/mol. As this is an endothermic chemical process with a relatively small activation energy, the reaction rate

  3. Inversion of the stereochemical configuration (3S, 5S)-clavaminic acid into (3R, 5R)-clavulanic acid: A computationally-assisted approach based on experimental evidence.

    PubMed

    Ramirez-Malule, Howard; Restrepo, Albeiro; Cardona, Wilson; Junne, Stefan; Neubauer, Peter; Rios-Estepa, Rigoberto

    2016-04-21

    Clavulanic acid (CA), a potent inhibitor of β-lactamase enzymes, is produced by Streptomyces clavuligerus (Sc) cultivation processes, for which low yields are commonly obtained. Improved knowledge of the clavam biosynthetic pathway, especially the steps involved in the inversion of 3S-5S into 3R-5R stereochemical configuration, would help to eventually identify bottlenecks in the pathway. In this work, we studied the role of acetate in CA biosynthesis by a combined continuous culture and computational simulation approach. From this we derived a new model for the synthesis of N-acetyl-glycyl-clavaminic acid (NAG-clavam) by Sc. Acetylated compounds, such as NAG-clavam and N-acetyl-clavaminic acid, have been reported in the clavam pathway. Although the acetyl group is present in the β-lactam intermediate NAG-clavam, it is unknown how this group is incorporated. Hence, under the consideration of the experimentally proven accumulation of acetate during CA biosynthesis, and the fact that an acetyl group is present in the NAG-clavam structure, a computational evaluation of the tentative formation of NAG-clavam was performed for the purpose of providing further understanding. The proposed reaction mechanism consists of two steps: first, acetate reacts with ATP to produce a reactive acylphosphate intermediate; second, a direct nucleophilic attack of the terminal amino group of N-glycyl-clavaminic on the carbonyl carbon of the acylphosphate intermediate leads to a tetrahydral intermediate, which collapses and produces ADP and N-acetyl-glycyl-clavaminic acid. The calculations suggest that for the proposed reaction mechanism, the reaction proceeds until completion of the first step, without the direct action of an enzyme, where acetate and ATP are involved. For this step, the computed activation energy was ≅2.82kcal/mol while the reaction energy was ≅2.38kcal/mol. As this is an endothermic chemical process with a relatively small activation energy, the reaction rate

  4. Alanylclavam Biosynthetic Genes Are Clustered Together with One Group of Clavulanic Acid Biosynthetic Genes in Streptomyces clavuligerus▿ §

    PubMed Central

    Zelyas, Nathan J.; Cai, Hui; Kwong, Thomas; Jensen, Susan E.

    2008-01-01

    Streptomyces clavuligerus produces at least five different clavam metabolites, including clavulanic acid and the methionine antimetabolite, alanylclavam. In vitro transposon mutagenesis was used to analyze a 13-kb region upstream of the known paralogue gene cluster. The paralogue cluster includes one group of clavulanic acid biosynthetic genes in S. clavuligerus. Twelve open reading frames (ORFs) were found in this area, and mutants were generated in each using either in vitro transposon or PCR-targeted mutagenesis. Mutants with defects in any of the genes orfA, orfB, orfC, or orfD were unable to produce alanylclavam but could produce all of the other clavams, including clavulanic acid. orfA encodes a predicted hydroxymethyltransferase, orfB encodes a YjgF/YER057c/UK114-family regulatory protein, orfC encodes an aminotransferase, and orfD encodes a dehydratase. All of these types of proteins are normally involved in amino acid metabolism. Mutants in orfC or orfD also accumulated a novel clavam metabolite instead of alanylclavam, and a complemented orfC mutant was able to produce trace amounts of alanylclavam while still producing the novel clavam. Mass spectrometric analyses, together with consideration of the enzymes involved in its production, led to tentative identification of the novel clavam as 8-OH-alanylclavam, an intermediate in the proposed alanylclavam biosynthetic pathway. PMID:18931110

  5. The Paralogous Pairs of Genes Involved in Clavulanic Acid and Clavam Metabolite Biosynthesis Are Differently Regulated in Streptomyces clavuligerus

    PubMed Central

    Tahlan, Kapil; Anders, Cecilia; Jensen, Susan E.

    2004-01-01

    Carboxyethylarginine synthase, encoded by the paralogous ceaS1 and ceaS2 genes, catalyzes the first reaction in the shared biosynthetic pathway leading to clavulanic acid and the other clavam metabolites in Streptomyces clavuligerus. The nutritional regulation of ceaS1 and ceaS2 expression was analyzed by reverse transcriptase PCR and by the use of the enhanced green fluorescent protein-encoding gene (egfp) as a reporter. ceaS1 was transcribed in complex soy medium only, whereas ceaS2 was transcribed in both soy and defined starch-asparagine (SA) media. The transcriptional start points of the two genes were also mapped to a C residue 98 bp upstream of ceaS1 and a G residue 51 bp upstream of the ceaS2 start codon by S1 nuclease protection and primer extension analyses. Furthermore, transcriptional mapping of the genes encoding the beta-lactam synthetase (bls1) and proclavaminate amidinohydrolase (pah1) isoenzymes from the paralogue gene cluster indicated that a single polycistronic transcript of ∼4.9 kb includes ceaS1, bls1, and pah1. The expression of ceaS1 and ceaS2 in a mutant strain defective in the regulatory protein CcaR was also examined. ceaS1 transcription was not affected in the ccaR mutant, whereas that of ceaS2 was greatly reduced compared to the wild-type strain. Overall, our results suggest that different mechanisms are involved in regulating the expression of ceaS1 and ceaS2, and presumably also of other paralogous genes that encode proteins involved in the early stages of clavulanic acid and clavam metabolite biosynthesis. PMID:15342599

  6. Genes Specific for the Biosynthesis of Clavam Metabolites Antipodal to Clavulanic Acid Are Clustered with the Gene for Clavaminate Synthase 1 in Streptomyces clavuligerus

    PubMed Central

    Mosher, Roy H.; Paradkar, Ashish S.; Anders, Cecilia; Barton, Barry; Jensen, Susan E.

    1999-01-01

    Portions of the Streptomyces clavuligerus chromosome flanking cas1, which encodes the clavaminate synthase 1 isoenzyme (CAS1), have been cloned and sequenced. Mutants of S. clavuligerus disrupted in cvm1, the open reading frame located immediately upstream of cas1, were constructed by a gene replacement procedure. Similar techniques were used to generate S. clavuligerus mutants carrying a deletion that encompassed portions of the two open reading frames, cvm4 and cvm5, located directly downstream of cas1. Both classes of mutants still produced clavulanic acid and cephamycin C but lost the ability to synthesize the antipodal clavam metabolites clavam-2-carboxylate, 2-hydroxymethyl-clavam, and 2-alanylclavam. These results suggested that cas1 is clustered with genes essential and specific for clavam metabolite biosynthesis. When a cas1 mutant of S. clavuligerus was constructed by gene replacement, it produced lower levels of both clavulanic acid and most of the antipodal clavams except for 2-alanylclavam. However, a double mutant of S. clavuligerus disrupted in both cas1 and cas2 produced neither clavulanic acid nor any of the antipodal clavams, including 2-alanylclavam. This outcome was consistent with the contribution of both CAS1 and CAS2 to a common pool of clavaminic acid that is shunted toward clavulanic acid and clavam metabolite biosynthesis. PMID:10223939

  7. Two Sets of Paralogous Genes Encode the Enzymes Involved in the Early Stages of Clavulanic Acid and Clavam Metabolite Biosynthesis in Streptomyces clavuligerus

    PubMed Central

    Tahlan, Kapil; Park, Hyeon Ung; Wong, Annie; Beatty, Perrin H.; Jensen, Susan E.

    2004-01-01

    Recently, a second copy of a gene encoding proclavaminate amidinohydrolase (pah1), an enzyme involved in the early stages of clavulanic acid and clavam metabolite biosynthesis in Streptomyces clavuligerus, was identified and isolated. Using Southern analysis, we have now isolated second copies of the genes encoding the carboxyethylarginine synthase (ceaS) and β-lactam synthetase (bls) enzymes. These new paralogues are given the gene designations ceaS1 and bls1 and are located immediately upstream of pah1 on the chromosome. Furthermore, sequence analysis of the region downstream of pah1 revealed a second copy of a gene encoding ornithine acetyltransferase (oat1), thus indicating the presence of a cluster of paralogue genes. ceaS1, bls1, and oat1 display 73, 60, and 63% identities, respectively, at the nucleotide level to the original ceaS2, bls2, and oat2 genes from the clavulanic acid gene cluster. Single mutants defective in ceaS1, bls1, or oat1 were prepared and characterized and were found to be affected to variable degrees in their ability to produce clavulanic acid and clavam metabolites. Double mutants defective in both copies of the genes were also prepared and tested. The ceaS1/ceaS2 and the bls1/bls2 mutant strains were completely blocked in clavulanic acid and clavam metabolite biosynthesis. On the other hand, oat1/oat2 double mutants still produced some clavulanic acid and clavam metabolites. This may be attributed to the presence of the argJ gene in S. clavuligerus, which encodes yet another ornithine acetyltransferase enzyme that may be able to compensate for the lack of OAT1 and -2 in the double mutants. PMID:14982786

  8. Chemical biology: Biosynthetic interceptors

    NASA Astrophysics Data System (ADS)

    Pryk, Niclas; Schulz, Frank

    2015-02-01

    Mutated enzymes are useful tools for the investigation of the biosynthetic routes to natural products. Now, they are used in a new approach to carry functionalized substrates through the synthesis and produce simplified or modified unnatural compounds with useful properties.

  9. Chaperoning 5S RNA assembly.

    PubMed

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-07-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit.

  10. Chaperoning 5S RNA assembly

    PubMed Central

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-01-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998

  11. Biosynthetic infochemical communication.

    PubMed

    Olsson, S B; Challiss, R A J; Cole, M; Gardeniers, J G E; Gardner, J W; Guerrero, A; Hansson, B S; Pearce, T C

    2015-07-09

    There is an ever-increasing demand for data to be embedded in our environment at ever-decreasing temporal and spatial scales. Whilst current communication and storage technologies generally exploit the electromagnetic properties of media, chemistry offers us a new alternative for nanoscale signaling using molecules as messengers with high information content. Biological systems effectively overcome the challenges of chemical communication using highly specific biosynthetic pathways for signal generation together with specialized protein receptors and nervous systems. Here we consider a new approach for information transmission based upon nature's quintessential example of infochemical communication, the moth pheromone system. To approach the sensitivity, specificity and versatility of infochemical communication seen in nature, we describe an array of biologically-inspired technologies for the production, transmission, detection, and processing of molecular signals. We show how it is possible to implement each step of the moth pheromone pathway for biosynthesis, transmission, receptor protein binding/transduction, and antennal lobe processing of monomolecular and multimolecular signals. For each implemented step, we discuss the value, current limitations, and challenges for the future development and integration of infochemical communication technologies. Together, these building blocks provide a starting point for future technologies that can utilize programmable emission and detection of multimolecular information for a new and robust means of communicating chemical information.

  12. Biosynthetic Pathways of Ergot Alkaloids

    PubMed Central

    Gerhards, Nina; Neubauer, Lisa; Tudzynski, Paul; Li, Shu-Ming

    2014-01-01

    Ergot alkaloids are nitrogen-containing natural products belonging to indole alkaloids. The best known producers are fungi of the phylum Ascomycota, e.g., Claviceps, Epichloë, Penicillium and Aspergillus species. According to their structures, ergot alkaloids can be divided into three groups: clavines, lysergic acid amides and peptides (ergopeptines). All of them share the first biosynthetic steps, which lead to the formation of the tetracyclic ergoline ring system (except the simplest, tricyclic compound: chanoclavine). Different modifications on the ergoline ring by specific enzymes result in an abundance of bioactive natural products, which are used as pharmaceutical drugs or precursors thereof. From the 1950s through to recent years, most of the biosynthetic pathways have been elucidated. Gene clusters from several ergot alkaloid producers have been identified by genome mining and the functions of many of those genes have been demonstrated by knock-out experiments or biochemical investigations of the overproduced enzymes. PMID:25513893

  13. 5S rRNA and ribosome.

    PubMed

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  14. The 5S genes of Drosophila melanogaster.

    PubMed

    Artavanis-Tsakonas, S; Schedl, P; Tschudi, C; Pirrotta, V; Steward, R; Gehring, W J

    1977-12-01

    We have cloned embryonic Drosophila DNA using the poly (dA-DT) connector method (Lobban and Kaiser, 1973) and the ampicillin-resistant plasmid pSF2124 (So, Gill and Falkow, 1975) as a cloning vehicle. Two clones, containing hybrid plasmids with sequences complementary to a 5S RNA probe isolated from Drosophila tissue culture cells, were identified by the Grunstein and Hogness (1975) colony hybridization procedure. One hybrid plasmid has a Drosophila insert which is comprised solely of tandem repeats of the 5S gene plus spacer sequences. The other plasmid contains an insert which has about 20 tandem 5S repeat units plus an additional 4 kilobases of adjacent sequences. The size of the 5S repeat unit was determined by gel electrophoresis and was found to be approximately 375 base pairs. We present a restriction map of both plasmids, and a detailed map of of the5S repeat unit. The 5S repat unit shows slight length and sequence heterogeneity. We present evidence suggesting that the 5S genes in Drosophila melanogaster may be arranged in a single continuous cluster. PMID:413625

  15. Biosynthetic Polymers as Functional Materials

    PubMed Central

    2016-01-01

    The synthesis of functional polymers encoded with biomolecules has been an extensive area of research for decades. As such, a diverse toolbox of polymerization techniques and bioconjugation methods has been developed. The greatest impact of this work has been in biomedicine and biotechnology, where fully synthetic and naturally derived biomolecules are used cooperatively. Despite significant improvements in biocompatible and functionally diverse polymers, our success in the field is constrained by recognized limitations in polymer architecture control, structural dynamics, and biostabilization. This Perspective discusses the current status of functional biosynthetic polymers and highlights innovative strategies reported within the past five years that have made great strides in overcoming the aforementioned barriers. PMID:27375299

  16. Generalized oscillator strengths for 5s, 5s{sup '}, and 5p excitations of krypton

    SciTech Connect

    Li Wenbin; Zhu Linfan; Yuan Zhensheng; Sun Jianmin; Cheng Huadong; Xu Kezun; Zhong Zhiping; Liu Xiaojing

    2003-06-01

    The absolute generalized oscillator strengths (GOSs) for 5s, 5s{sup '}, 5p [5/2]{sub 3,2}, 5p [3/2]{sub 1,2}, and 5p [1/2]{sub 0} transitions of krypton have been determined in a large K{sup 2} region at a high electron-impact energy of 2500 eV. The positions of the minima and maxima of these GOSs have been determined. The present results show that the angular resolution and pressure effect have great influence on the position and the amplitude of the minimum for the GOS of 5s+5s{sup '} transitions. When these effects are considered, the measured minimum position for the GOS of 5s+5s{sup '} transitions is in excellent agreement with the calculation of Chen and Msezane [J. Phys. B 33, 5397 (2000)].

  17. Eukaryotic 5S rRNA biogenesis

    PubMed Central

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  18. Fungal peroxisomes as biosynthetic organelles.

    PubMed

    Stehlik, Thorsten; Sandrock, Björn; Ast, Julia; Freitag, Johannes

    2014-12-01

    Peroxisomes are nearly ubiquitous single-membrane organelles harboring multiple metabolic pathways beside their prominent role in the β-oxidation of fatty acids. Here we review the diverse metabolic functions of peroxisomes in fungi. A variety of fungal metabolites are at least partially synthesized inside peroxisomes. These include the essential co-factor biotin but also different types of secondary metabolites. Peroxisomal metabolites are often derived from acyl-CoA esters for example β-oxidation intermediates. In several ascomycetes a subtype of peroxisomes has been identified that is metabolically inactive but is required to plug the septal pores of wounded hyphae. Thus, peroxisomes are versatile organelles that can adapt their function to the life style of an organism. This remarkable variability suggests that the full extent of the biosynthetic capacity of peroxisomes is still elusive. Moreover, in fungi peroxisomes are non-essential under laboratory conditions making them attractive organelles for biotechnological approaches and the design of novel metabolic pathways in customized peroxisomes.

  19. Analysis of the 5S RNA pool in Arabidopsis thaliana: RNAs are heterogeneous and only two of the genomic 5S loci produce mature 5S RNA.

    PubMed

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5'- and 3'-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array.

  20. {upsilon}(5S) Results from CLEO

    SciTech Connect

    Pavlunin, Victor

    2006-07-11

    Using the CLEO detector at the Cornell Electron Storage Ring, we have observed the Bs meson in e+e- annihilation at the {upsilon}(5S) resonance. We have fully reconstructed 14 candidates consistent with Bs decays into final states with a J/{psi} or a D{sub s}{sup (*)-}. The probability that this is a background fluctuation is less than 8 x 10-10. We have established that Bs production proceeds predominantly through the creation of B{sub s}*B-bar{sub s}* pairs with {sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s}*) =0[ .11{sub -0.03}{sup +0.04}(stat) {+-} 0.02(syst)] nb. The following limits are set: {sigma}(e{sup +}e{sup -} {yields} B{sub s}B-bar{sub s})/{sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s}*) < 0.16 and [{sigma}(e{sup +}e{sup -} {yields} B{sub s}B-bar{sub s}*) + {sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s})]/{sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s}*) < 0.16 (90% CL). In a separate analysis, by comparing production rates of D{sub s}{sup +} mesons in {upsilon}(5S) and {upsilon}(4S) decays, an estimate of the ratio of B{sub s}{sup (*)} B-bar{sub s}{sup (*)} to the total bb-bar quark pair production at the {upsilon}(5S) energy of (16 {+-} 3 {+-} 6)% is obtained.

  1. Biosynthetic engineering of nonribosomal peptide synthetases.

    PubMed

    Kries, Hajo

    2016-09-01

    From the evolutionary melting pot of natural product synthetase genes, microorganisms elicit antibiotics, communication tools, and iron scavengers. Chemical biologists manipulate these genes to recreate similarly diverse and potent biological activities not on evolutionary time scales but within months. Enzyme engineering has progressed considerably in recent years and offers new screening, modelling, and design tools for natural product designers. Here, recent advances in enzyme engineering and their application to nonribosomal peptide synthetases are reviewed. Among the nonribosomal peptides that have been subjected to biosynthetic engineering are the antibiotics daptomycin, calcium-dependent antibiotic, and gramicidin S. With these peptides, incorporation of unnatural building blocks and modulation of bioactivities via various structural modifications have been successfully demonstrated. Natural product engineering on the biosynthetic level is not a reliable method yet. However, progress in the understanding and manipulation of biosynthetic pathways may enable the routine production of optimized peptide drugs in the near future. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd.

  2. Compilation of 5S rRNA and 5S rRNA gene sequences

    PubMed Central

    Specht, Thomas; Wolters, Jörn; Erdmann, Volker A.

    1990-01-01

    The BERLIN RNA DATABANK as of Dezember 31, 1989, contains a total of 667 sequences of 5S rRNAs or their genes, which is an increase of 114 new sequence entries over the last compilation (1). It covers sequences from 44 archaebacteria, 267 eubacteria, 20 plastids, 6 mitochondria, 319 eukaryotes and 11 eukaryotic pseudogenes. The hardcopy shows only the list (Table 1) of those organisms whose sequences have been determined. The BERLIN RNA DATABANK uses the format of the EMBL Nucleotide Sequence Data Library complemented by a Sequence Alignment (SA) field including secondary structure information. PMID:1692116

  3. Biosynthetic route towards saxitoxin and shunt pathway.

    PubMed

    Tsuchiya, Shigeki; Cho, Yuko; Konoki, Keiichi; Nagasawa, Kazuo; Oshima, Yasukatsu; Yotsu-Yamashita, Mari

    2016-02-04

    Saxitoxin, the most potent voltage-gated sodium channel blocker, is one of the paralytic shellfish toxins (PSTs) produced by cyanobacteria and dinoflagellates. Recently, putative biosynthetic genes of PSTs were reported in these microorganisms. We previously synthesized genetically predicted biosynthetic intermediates, Int-A' and Int-C'2, and also Cyclic-C' which was not predicted based on gene, and identified them all in the toxin-producing cyanobacterium Anabaena circinalis (TA04) and the dinoflagellate Alexandrium tamarense (Axat-2). This study examined the incorporation of (15)N-labeled intermediates into PSTs (C1 and C2) in A. circinalis (TA04). Conversions from Int-A' to Int-C'2, from Int-C'2 to Cyclic-C', and from Int-A' and Int-C'2 to C1 and C2 were indicated using high resolution-LC/MS. However, Cyclic-C' was not converted to C1 and C2 and was detected primarily in the extracellular medium. These results suggest that Int-A' and Int-C'2 are genuine precursors of PSTs, but Int-C'2 converts partially to Cyclic-C' which is a shunt product excreted to outside the cells. This paper provides the first direct demonstration of the biosynthetic route towards saxitoxin and a shunt pathway.

  4. Biosynthetic Pathways of Brassinolide in Arabidopsis1

    PubMed Central

    Noguchi, Takahiro; Fujioka, Shozo; Choe, Sunghwa; Takatsuto, Suguru; Tax, Frans E.; Yoshida, Shigeo; Feldmann, Kenneth A.

    2000-01-01

    Our previous studies on the endogenous brassinosteroids (BRs) in Arabidopsis have provided suggestive evidence for the operation of the early C6-oxidation and the late C6-oxidation pathways, leading to brassinolide (BL) in Arabidopsis. However, to date the in vivo operation of these pathways has not been fully confirmed in this species. This paper describes metabolic studies using deuterium-labeled BRs in wild-type and BR-insensitive mutant (bri1) seedlings to establish the intermediates of the biosynthetic pathway of BL in Arabidopsis. The first evidence for the conversion of campestanol to 6-deoxocathasterone and the conversion of 6-deoxocathasterone to 6-deoxoteasterone is provided. The later biosynthetic steps (6-deoxoteasterone → 3-dehydro-6-deoxoteasterone → 6-deoxotyphasterol → 6-deoxocastasterone → 6α-hydroxycastasterone → castasterone → BL) were demonstrated by stepwise metabolic experiments. Therefore, these studies complete the documentation of the late C6-oxidation pathway. The biosynthetic sequence involved in the early C6-oxidation pathway (teasterone → 3-dehydroteasterone → typhasterol → castasterone → BL) was also demonstrated. These results show that both the early and late C6-oxidation pathways are functional in Arabidopsis. In addition we report two new observations: the presence of a new branch in the pathway, C6 oxidation of 6-deoxotyphasterol to typhasterol, and increased metabolic flow in BR-insensitive mutants. PMID:10982435

  5. Tryptophan biosynthetic enzymes of Staphylococcus aureus.

    PubMed

    Proctor, A R; Kloos, W E

    1973-04-01

    Tryptophan biosynthetic enzymes were assayed in various tryptophan mutants of Staphylococcus aureus strain 655 and the wild-type parent. All mutants, except trpB mutants, lacked only the activity corresponding to the particular biosynthetic block, as suggested previously by analysis of accumulated intermediates and auxonography. Tryptophan synthetase A was not detected in extracts of either trpA or trpB mutants but appeared normal in other mutants. Mutants in certain other classes exhibited partial loss of another particular tryptophan enzyme activity. Tryptophan synthetase B activity was not detected in cell extract preparations but was detected in whole cells. The original map order proposed for the S. aureus tryptophan gene cluster was clarified by the definition of trpD (phosphoribosyl transferase(-)) and trpF (phosphoribosyl anthranilate isomerase(-)) mutants. These mutants were previously unresolved and designated as trp(DF) mutants (anthranilate accumulators). Phosphoribosyl anthranilate isomerase and indole-3-glycerol phosphate synthetase enzymes were separable by molecular sieve chromatography, suggesting that these functions are coded by separate loci. Molecular sieve chromatography failed to reveal aggregates involving anthranilate synthetase, phosphoribosyl transferase, phosphoribosyl anthranilate isomerase, and indole-3-glycerol phosphate synthetase, and this procedure provided an estimate of the molecular weights of these enzymes. Tryptophan was shown to repress synthesis of all six tryptophan biosynthetic enzymes, and derepression of all six activities was incident upon tryptophan starvation. Tryptophan inhibited the activity of anthranilate synthetase, the first enzyme of the pathway. PMID:4698207

  6. Biosynthetic engineering of nonribosomal peptide synthetases.

    PubMed

    Kries, Hajo

    2016-09-01

    From the evolutionary melting pot of natural product synthetase genes, microorganisms elicit antibiotics, communication tools, and iron scavengers. Chemical biologists manipulate these genes to recreate similarly diverse and potent biological activities not on evolutionary time scales but within months. Enzyme engineering has progressed considerably in recent years and offers new screening, modelling, and design tools for natural product designers. Here, recent advances in enzyme engineering and their application to nonribosomal peptide synthetases are reviewed. Among the nonribosomal peptides that have been subjected to biosynthetic engineering are the antibiotics daptomycin, calcium-dependent antibiotic, and gramicidin S. With these peptides, incorporation of unnatural building blocks and modulation of bioactivities via various structural modifications have been successfully demonstrated. Natural product engineering on the biosynthetic level is not a reliable method yet. However, progress in the understanding and manipulation of biosynthetic pathways may enable the routine production of optimized peptide drugs in the near future. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd. PMID:27465074

  7. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    NASA Technical Reports Server (NTRS)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  8. Increased 5S rRNA oxidation in Alzheimer's disease.

    PubMed

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  9. Glucosinolate biosynthetic genes in Brassica rapa.

    PubMed

    Wang, Hui; Wu, Jian; Sun, Silong; Liu, Bo; Cheng, Feng; Sun, Rifei; Wang, Xiaowu

    2011-11-10

    Glucosinolates (GS) are a group of amino acid-derived secondary metabolites found throughout the Cruciferae family. Glucosinolates and their degradation products play important roles in pathogen and insect interactions, as well as in human health. In order to elucidate the glucosinolate biosynthetic pathway in Brassica rapa, we conducted comparative genomic analyses of Arabidopsis thaliana and B. rapa on a genome-wide level. We identified 102 putative genes in B. rapa as the orthologs of 52 GS genes in A. thaliana. All but one gene was successfully mapped on 10 chromosomes. Most GS genes exist in more than one copy in B. rapa. A high co-linearity in the glucosinolate biosynthetic pathway between A. thaliana and B. rapa was also established. The homologous GS genes in B. rapa and A. thaliana share 59-91% nucleotide sequence identity and 93% of the GS genes exhibit synteny between B. rapa and A. thaliana. Moreover, the structure and arrangement of the B. rapa GS (BrGS) genes correspond with the known evolutionary divergence of B. rapa, and may help explain the profiles and accumulation of GS in B. rapa.

  10. Cyanobacterial toxins: biosynthetic routes and evolutionary roots.

    PubMed

    Dittmann, Elke; Fewer, David P; Neilan, Brett A

    2013-01-01

    Cyanobacteria produce an unparalleled variety of toxins that can cause severe health problems or even death in humans, and wild or domestic animals. In the last decade, biosynthetic pathways have been assigned to the majority of the known toxin families. This review summarizes current knowledge about the enzymatic basis for the production of the hepatotoxins microcystin and nodularin, the cytotoxin cylindrospermopsin, the neurotoxins anatoxin and saxitoxin, and the dermatotoxin lyngbyatoxin. Elucidation of the biosynthetic pathways of the toxins has paved the way for the development of molecular techniques for the detection and quantification of the producing cyanobacteria in different environments. Phylogenetic analyses of related clusters from a large number of strains has also allowed for the reconstruction of the evolutionary scenarios that have led to the emergence, diversification, and loss of such gene clusters in different strains and genera of cyanobacteria. Advances in the understanding of toxin biosynthesis and evolution have provided new methods for drinking-water quality control and may inspire the development of techniques for the management of bloom formation in the future.

  11. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  12. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces.

  13. [Structural organization of 5S ribosomal DNA of Rosa rugosa].

    PubMed

    Tynkevych, Iu O; Volkov, R A

    2014-01-01

    In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

  14. Cell morphology in injectable nanostructured biosynthetic hydrogels.

    PubMed

    Yom-Tov, Ortal; Seliktar, Dror; Bianco-Peled, Havazelet

    2014-12-01

    Even though inducing structural features on the nanometric scale has been shown to be a powerful tool in tissue engineering, almost all nanostructuring techniques available today cannot be applied to injectable hydrogel scaffolds. The current research explores such a novel technique and its effect on scaffold's properties, cell morphology, and cell-material interaction. Nanostructuring is achieved by covalently binding Pluronic(®) F127 molecules to biosynthetic hydrogels. Analysis of cell morphology revealed spindled cell morphologies at day 4 in culture. The bound Pluronic(®) F127 diminished the swelling ability and enhanced the Young modulus, thus indicating that the bound molecules crosslink the hydrogel. The relation between matrix characteristics and cell morphology was analyzed and the importance of nanostructuring was demonstrated.

  15. The structural biology of biosynthetic megaenzymes.

    PubMed

    Weissman, Kira J

    2015-09-01

    The modular polyketide synthases (PKSs) and nonribosomal peptide synthetases (NRPSs) are among the largest and most complicated enzymes in nature. In these biosynthetic systems, independently folding protein domains, which are organized into units called 'modules', operate in assembly-line fashion to construct polymeric chains and tailor their functionalities. Products of PKSs and NRPSs include a number of blockbuster medicines, and this has motivated researchers to understand how they operate so that they can be modified by genetic engineering. Beginning in the 1990s, structural biology has provided a number of key insights. The emerging picture is one of remarkable dynamics and conformational programming in which the chemical states of individual catalytic domains are communicated to the others, configuring the modules for the next stage in the biosynthesis. This unexpected level of complexity most likely accounts for the low success rate of empirical genetic engineering experiments and suggests ways forward for productive megaenzyme synthetic biology. PMID:26284673

  16. Exploring biosynthetic diversity with trichodiene synthase.

    PubMed

    Vedula, L Sangeetha; Zhao, Yuxin; Coates, Robert M; Koyama, Tanetoshi; Cane, David E; Christianson, David W

    2007-10-15

    Trichodiene synthase is a terpenoid cyclase that catalyzes the cyclization of farnesyl diphosphate (FPP) to form the bicyclic sesquiterpene hydrocarbon trichodiene (89%), at least five sesquiterpene side products (11%), and inorganic pyrophosphate (PP(i)). Incubation of trichodiene synthase with 2-fluorofarnesyl diphosphate or 4-methylfarnesyl diphosphate similarly yields sesquiterpene mixtures despite the electronic effects or steric bulk introduced by substrate derivatization. The versatility of the enzyme is also demonstrated in the 2.85A resolution X-ray crystal structure of the complex with Mg(2+) (3)-PP(i) and the benzyl triethylammonium cation, which is a bulkier mimic of the bisabolyl carbocation intermediate in catalysis. Taken together, these findings show that the active site of trichodiene synthase is sufficiently flexible to accommodate bulkier and electronically-diverse substrates and intermediates, which could indicate additional potential for the biosynthetic utility of this terpenoid cyclase. PMID:17678871

  17. Flavoenzymes: Versatile Catalysts in Biosynthetic Pathways

    PubMed Central

    Walsh, Christopher T.; Wencewicz, Timothy A.

    2012-01-01

    Riboflavin-based coenzymes, tightly bound to enzymes catalyzing substrate oxidations and reductions, enable an enormous range of chemical transformations in biosynthetic pathways. Flavoenzymes catalyze substrate oxidations involving amine and alcohol oxidations and desaturations to olefins, the latter setting up Diels-Alder cyclizations in lovastatin and solanapyrone biosyntheses. Both C4a and N5 of the flavin coenzymes are sites for covalent adduct formation. For example, the reactivity of dihydroflavins with molecular oxygen leads to flavin-4a-OOH adducts which then carry out a diverse range of oxygen transfers, including Baeyer-Villiger type ring expansions, olefin epoxidations, halogenations via transient HOCl generation, and an oxidative Favorskii rerrangement during enterocin assembly. PMID:23051833

  18. The structural biology of biosynthetic megaenzymes.

    PubMed

    Weissman, Kira J

    2015-09-01

    The modular polyketide synthases (PKSs) and nonribosomal peptide synthetases (NRPSs) are among the largest and most complicated enzymes in nature. In these biosynthetic systems, independently folding protein domains, which are organized into units called 'modules', operate in assembly-line fashion to construct polymeric chains and tailor their functionalities. Products of PKSs and NRPSs include a number of blockbuster medicines, and this has motivated researchers to understand how they operate so that they can be modified by genetic engineering. Beginning in the 1990s, structural biology has provided a number of key insights. The emerging picture is one of remarkable dynamics and conformational programming in which the chemical states of individual catalytic domains are communicated to the others, configuring the modules for the next stage in the biosynthesis. This unexpected level of complexity most likely accounts for the low success rate of empirical genetic engineering experiments and suggests ways forward for productive megaenzyme synthetic biology.

  19. [Organization of 5S ribosomal DNA of Melitaea trivia].

    PubMed

    Cherevatov, O V; Volkov, R A

    2011-01-01

    Two length variants of 5S rDNA repeated units were detected in the genome of East European butterfly Melitaea trivia. Both repeat variants contain the 5S rRNA coding region of the same length of 120 bp, but possess the intergenic spacer region (IGS) of different size, 78 and 125 bp, respectively. The level of sequence similarity between the two 5S rDNA variants amounts to 43.9-45.5% in the IGS, whereas the coding region appears to be more conservative. In the IGS, microsatellite sequence motives were found; amplification of these motives could be involved in the evolution of the 5S rDNA.

  20. High-Resolution Infrared Spectroscopy of Carbon-Sulfur Chains: II. C_5S and SC_5S

    NASA Astrophysics Data System (ADS)

    Thorwirth, Sven; Salomon, Thomas; Dudek, John B.

    2016-06-01

    Unbiased high-resolution infrared survey scans of the ablation products from carbon-sulfur targets in the 2100 to 2150 cm-1 regime reveal two bands previously not observed in the gas phase. On the basis of comparison against laboratory matrix-isolation work and new high-level quantum-chemical calculations these bands are attributed to the linear C_5S and SC_5S clusters. While polar C_5S was studied earlier using Fourier-transform microwave techniques, the present work marks the first gas-phase spectroscopic detection of SC_5S. H. Wang, J. Szczepanski, P. Brucat, and M. Vala 2005, Int. J. Quant. Chem. 102, 795 Y. Kasai, K. Obi, Y. Ohshima, Y. Hirahara, Y. Endo, K. Kawaguchi, and A. Murakami 1993, ApJ 410, L45 V. D. Gordon, M. C. McCarthy, A. J. Apponi, and P. Thaddeus 2001, ApJS 134, 311

  1. Enterococcus faecium PBP5-S/R, the missing link between PBP5-S and PBP5-R.

    PubMed

    Pietta, Ester; Montealegre, Maria Camila; Roh, Jung Hyeob; Cocconcelli, Pier Sandro; Murray, Barbara E

    2014-11-01

    During a study to investigate the evolution of ampicillin resistance in Enterococcus faecium, we observed that a number of E. faecium strains, mainly from the recently described subclade A2, showed PBP5 sequences in between PBP5-S and PBP5-R. These hybrid PBP5-S/R patterns reveal a progression of amino acid changes from the S form to the R form of this protein; however, these changes do not strictly correlate with changes in ampicillin MICs.

  2. TFIIIA binds to different domains of 5S RNA and the Xenopus borealis 5S RNA gene.

    PubMed Central

    Sands, M S; Bogenhagen, D F

    1987-01-01

    We have established the conditions for the reassociation of 5S RNA and TFIIIA to form 7S particles. We tested the ability of altered 5S RNAs to bind TFIIIA, taking advantage of the slower mobility of 7S particles compared with free 5S RNA in native polyacrylamide gels. Linker substitution mutants were constructed encompassing the entire gene, including the intragenic control region. In vitro transcripts of the linker substitution mutants were tested for their ability to bind TFIIIA to form 7S ribonucleoprotein particles. Altered 5S RNAs with base changes in or around helices IV and V, which would interfere with the normal base pairing of that region, showed decreased ability to bind TFIIIA. The transcripts of some mutant genes that were efficiently transcribed (greater than 50% of wild-type efficiency) failed to bind TFIIIA in this gel assay. In contrast, the RNA synthesized from a poorly transcribed mutant, LS 86/97, in which residues 87 to 96 of the RNA were replaced in the single-stranded loop at the base of helix V, bound TFIIIA well. The data indicate that TFIIIA binds to different domains in the 5S RNA gene and 5S RNA. Images PMID:3431548

  3. Evolution-guided optimization of biosynthetic pathways

    PubMed Central

    Raman, Srivatsan; Rogers, Jameson K.; Taylor, Noah D.; Church, George M.

    2014-01-01

    Engineering biosynthetic pathways for chemical production requires extensive optimization of the host cellular metabolic machinery. Because it is challenging to specify a priori an optimal design, metabolic engineers often need to construct and evaluate a large number of variants of the pathway. We report a general strategy that combines targeted genome-wide mutagenesis to generate pathway variants with evolution to enrich for rare high producers. We convert the intracellular presence of the target chemical into a fitness advantage for the cell by using a sensor domain responsive to the chemical to control a reporter gene necessary for survival under selective conditions. Because artificial selection tends to amplify unproductive cheaters, we devised a negative selection scheme to eliminate cheaters while preserving library diversity. This scheme allows us to perform multiple rounds of evolution (addressing ∼109 cells per round) with minimal carryover of cheaters after each round. Based on candidate genes identified by flux balance analysis, we used targeted genome-wide mutagenesis to vary the expression of pathway genes involved in the production of naringenin and glucaric acid. Through up to four rounds of evolution, we increased production of naringenin and glucaric acid by 36- and 22-fold, respectively. Naringenin production (61 mg/L) from glucose was more than double the previous highest titer reported. Whole-genome sequencing of evolved strains revealed additional untargeted mutations that likely benefit production, suggesting new routes for optimization. PMID:25453111

  4. Structures of Bacterial Biosynthetic Arginine Decarboxylases

    SciTech Connect

    F Forouhar; S Lew; J Seetharaman; R Xiao; T Acton; G Montelione; L Tong

    2011-12-31

    Biosynthetic arginine decarboxylase (ADC; also known as SpeA) plays an important role in the biosynthesis of polyamines from arginine in bacteria and plants. SpeA is a pyridoxal-5'-phosphate (PLP)-dependent enzyme and shares weak sequence homology with several other PLP-dependent decarboxylases. Here, the crystal structure of PLP-bound SpeA from Campylobacter jejuni is reported at 3.0 {angstrom} resolution and that of Escherichia coli SpeA in complex with a sulfate ion is reported at 3.1 {angstrom} resolution. The structure of the SpeA monomer contains two large domains, an N-terminal TIM-barrel domain followed by a {beta}-sandwich domain, as well as two smaller helical domains. The TIM-barrel and {beta}-sandwich domains share structural homology with several other PLP-dependent decarboxylases, even though the sequence conservation among these enzymes is less than 25%. A similar tetramer is observed for both C. jejuni and E. coli SpeA, composed of two dimers of tightly associated monomers. The active site of SpeA is located at the interface of this dimer and is formed by residues from the TIM-barrel domain of one monomer and a highly conserved loop in the {beta}-sandwich domain of the other monomer. The PLP cofactor is recognized by hydrogen-bonding, {pi}-stacking and van der Waals interactions.

  5. Biosynthetic Studies of Aziridine Formation in Azicemicins

    PubMed Central

    Ogasawara, Yasushi; Liu, Hung-wen

    2009-01-01

    The azicemicins, which are angucycline-type antibiotics produced by the actinomycete, Kibdelosporangium sp. MJ126-NF4, contain an aziridine ring attached to the polyketide core. Feeding experiments using [1-13C]acetate or [1,2-13C2] acetate indicated that the angucycline skeleton is biosynthesized by a type II polyketide synthase. Isotope-tracer experiments using deuterium-labeled amino acids revealed that aspartic acid is the precursor of the aziridine moiety. Subsequent cloning and sequencing efforts led to the identification of the azicemicin (azic) gene cluster spanning ~50 kbp. The cluster harbors genes typical for type II polyketide synthesis. Also contained in the cluster are genes for two adenylyl transferases, a decarboxylase, an additional acyl carrier protein (ACP), and several oxygenases. On the basis of the assigned functions of these genes, a possible pathway for aziridine ring formation in the azecimicins can now be proposed. To obtain support for the proposed biosynthetic pathway, two genes encoding adenylyltransferases were overexpressed and the resulting proteins were purified. Enzyme assays showed that one of the adenylyltransferases specifically recognizes aspartic acid, providing strong evidence, in addition to the feeding experiments, that aspartate is the precursor of the aziridine moiety. The results reported herein set the stage for future biochemical studies of aziridine biosynthesis and assembly. PMID:19928906

  6. Bioretrosynthetic construction of a didanosine biosynthetic pathway

    PubMed Central

    Birmingham, William R.; Starbird, Chrystal A.; Panosian, Timothy D.; Nannemann, David P.; Iverson, T. M.; Bachmann, Brian O.

    2014-01-01

    Concatenation of engineered biocatalysts into multistep pathways dramatically increases their utility, but development of generalizable assembly methods remains a significant challenge. Herein we evaluate ‘bioretrosynthesis’, which is an application of the retrograde evolution hypothesis, for biosynthetic pathway construction. To test bioretrosynthesis, we engineered a pathway for synthesis of the antiretroviral nucleoside analog didanosine (2,3-dideoxyinosine). Applying both directed evolution and structure-based approaches, we began pathway construction with a retro-extension from an engineered purine nucleoside phosphorylase and evolved 1,5-phosphopentomutase to accept the substrate 2,3-dideoxyribose 5-phosphate with a 700-fold change in substrate selectivity and 3-fold increased turnover in cell lysate. A subsequent retrograde pathway extension, via ribokinase engineering, resulted in a didanosine pathway with a 9,500-fold change in nucleoside production selectivity and 50-fold increase in didanosine production. Unexpectedly, the result of this bioretrosynthetic step was not a retro-extension from phosphopentomutase, but rather the discovery of a fortuitous pathway-shortening bypass via the engineered ribokinase. PMID:24657930

  7. Biosynthetic porphyrins and the origin of photosynthesis

    NASA Technical Reports Server (NTRS)

    Mauzerall, D.; Ley, A.; Mercer-Smith, J. A.

    1986-01-01

    Since the prebiotic atmosphere was anaerobic, if not reducing, a useful function of primordial photosynthesis would have been to photooxidize reduced substrates such as Fe(+2), S(-2) or reduced organic molecules and to emit hydrogen. Experiments have shown that the early biogenic pigments uroporphyrin and coproporphyrin do photooxidize organic compounds and emit hydrogen in the presence of a platinum catalyst. These experiments were carried out in dilute aqueous solution near neutral pH under anaerobic atmosphere, and quantum yields near 10-2 were obtained. Thus relevant prebiotic conditions were maintained. Rather then to further optimize conditions, attempts were made to replace the platinum catalyst by a more prebiotically suitable catalyst. Trials with an Fe4S4(SR)4 cluster, in analogy to the present hydrogenase and nitrogenase, were not successful. However, experiments using cobalt complexes to catalyze the formation of hydrogen are promising. In analogy with biological photosynthetic systems which group pigments, electron transfer molecules and enzymes in clusters for efficiency, it was found that binding the biogenic porphyrins to the polyvinyl alcohol used to support the platinum catalyst did increase the quantum yield of the reaction. It was also found that ultraviolet light can serve to photo-oxidize porphyrinogens to porphyrins under anaerobic conditions. Thus the formation of the colorless porphyriogens by the extraordinarily simple biosynthetic pathway would not be a problem because of the prevalence of UV light in the prebiotic, anoxic atmosphere.

  8. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  9. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  10. Identification and absolute configuration of dihydroxy-arachidonic acids formed by oxygenation of 5S-HETE by native and aspirin-acetylated COX-2.

    PubMed

    Mulugeta, Surafel; Suzuki, Takashi; Hernandez, Noemi Tejera; Griesser, Markus; Boeglin, William E; Schneider, Claus

    2010-03-01

    Biosynthesis of the prostaglandin endoperoxide by the cyclooxygenase (COX) enzymes is accompanied by formation of a small amount of 11R-hydroxyeicosatetraenoic acid (HETE), 15R-HETE, and 15S-HETE as by-products. Acetylation of COX-2 by aspirin abrogates prostaglandin synthesis and triggers formation of 15R-HETE as the sole product of oxygenation of arachidonic acid. Here, we investigated the formation of by-products of the transformation of 5S-HETE by native COX-2 and by aspirin-acetylated COX-2 using HPLC-ultraviolet, GC-MS, and LC-MS analysis. 5S,15S- dihydroxy (di)HETE, 5S,15R-diHETE, and 5S,11R-diHETE were identified as by-products of native COX-2, in addition to the previously described di-endoperoxide (5S,15S-dihydroxy-9S,11R,8S,12S-diperoxy-6E,13E-eicosadienoic acid) as the major oxygenation product. 5S,15R-diHETE was the only product formed by aspirin-acetylated COX-2. Both 5,15-diHETE and 5,11-diHETE were detected in CT26 mouse colon carcinoma cells as well as in lipopolysaccharide-activated RAW264.7 cells incubated with 5S-HETE, and their formation was attenuated in the presence of the COX-2 specific inhibitor, NS-398. Aspirin-treated CT26 cells gave 5,15-diHETE as the most prominent product formed from 5S-HETE. 5S,15S-diHETE has been described as a product of the cross-over of 5-lipoxygenase (5-LOX) and 15-LOX activities in elicited rat mononuclear cells and human leukocytes, and our studies implicate cross-over of the 5-LOX and COX-2 pathways as an additional biosynthetic route.

  11. L5-S1 Laparoscopic Anterior Interbody Fusion

    PubMed Central

    Zeni, Tallal M.; Phillips, Frank M.; Mathur, Sameer; Zografakis, John G.; Moore, Ronald M.; Laguna, Luis E.

    2006-01-01

    Objective: We evaluated our experience with laparoscopic L5-S1 anterior lumbar interbody fusion (ALIF). Methods: This represents a retrospective analysis of consecutive patients who underwent L5-S1 laparoscopic ALIF between February 1998 and August 2003. Results: Twenty-eight patients underwent L5-S1 LAIF (15 males and 13 females). The mean age was 43 years (range, 26 to 67). Mean operative time was 225 minutes (range, 137 to 309 minutes). No conversions to an open procedure were necessary. Twenty-four (85.7%) patients underwent successful bilateral cage placement. Four patients (14.3%) in whom only a single cage could be placed underwent supplementary posterior pedicle screw placement. Mean length of stay (LOS) was 4.1 days (range, 2 to 15). Two patients underwent reoperation subacutely secondary to symptomatic lateral displacement of the cage. One patient developed radiculopathy 6 months postoperatively and required reoperation. One patient developed a small bowel obstruction secondary to adhesions to the cage requiring laparoscopic reoperation. Fusion was achieved in all patients. Visual analogue scale scores for back pain were significantly improved from 8.6±0.8 to 2.8±0.8 (P<0.0001) at 1 year. Conclusion: L5-S1 LAIF is feasible and safe with all the advantages of minimally invasive surgery. Fusion rates and pain improvement were comparable to those with an open repair. PMID:17575763

  12. Analyzing Digital Library Initiatives: 5S Theory Perspective

    ERIC Educational Resources Information Center

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko

    2015-01-01

    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  13. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron.

    PubMed Central

    MacKay, R M; Salgado, D; Bonen, L; Stackebrandt, E; Doolittle, W F

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are (formula: see text), respectively. Specific phylogenetic relationships of P. denitrificans with purple non-sulphur bacteria, and of Prochloron with cyanobacteria are demonstrated, and unique features of potential secondary structure are described. PMID:7099971

  14. Functional domains of the Xenopus laevis 5S gene promoter.

    PubMed Central

    Pieler, T; Oei, S L; Hamm, J; Engelke, U; Erdmann, V A

    1985-01-01

    To study the fine structure of the Xenopus laevis somatic 5S gene internal control region, we have created 15 different transversions using mutagenic oligonucleotide primers. The effects of these mutations on 5S DNA transcription in vitro as well as on stable complex formation with transcription factor TF III A and TF III C in crude nuclear extracts were analyzed. Mutations in the common class III 5' promoter element (nucleotides 50-61 in the 5S gene) interfere with transcription activity and stable complex formation whenever they contradict the tDNA box A consensus sequence. The second promoter element is defined by a major sequence block (nucleotides 80-89, box C) and two additional internal residues (70 and 71) at a distance of roughly one helical turn from both the major 3' and 5' control sequences; these two 3' elements contain the primary TF III A binding domain. The remaining nucleotides (62-69 and 71-79) when mutated do not interfere with transcription activity or factor binding and thus they constitute two spacer elements within a symmetrically structured 5S gene promoter. An increase in the relative spacing of box A and box C by insertion of 3 bp between nucleotides 66 and 67 leads to a drastic reduction in transcription activity and the ability to form a stable complex with TF III A and/or TF III C. Thus, accurate spacing is essential for the proper orientation of TF III A on 5S DNA and/or TF III C binding. Images Fig. 1. Fig. 3. Fig. 4. PMID:3004969

  15. Chemical and biosynthetic studies of chlorophylls

    SciTech Connect

    Huster, M.S.

    1988-01-01

    Chlorophyll occurrence, structure, biosynthesis, and degradation are discussed. Degradation and ring cleavage of heme is also discussed. The author examines the formation of dihydrobiliverdins by alkaline hydrolysis of zinc(II) meso-trifluoroacetoxypheophoribides, as a possible model for chlorophyll catabolism. {sup 18}O{sub 2}-labelling experiments show that the dihydrobiliverdin terminal lactam oxygens are derived from two different dioxygen molecules, also analogous to the Two Oxygen Molecular mechanism observed in heme degradation. The initially obtained dihydrobiliverdin readily undergoes an isomeric structural transformation, which is proposed as a model for the P{sub R}-P{sub FR} interconversion of the light sensor pigment phytochrome. The generality of the ring-opening reaction is demonstrated with various chlorophyll-derived zinc(II) trifluoroacetoxychlorins, and side reactions of the isocyclic ring are discussed. The synthesis and properties of a chlorophyll-derived meso-oxochlorin are described. Facile one-electron oxidation, and its inhibition by protonation, is demonstrated by NMR, ESR, and cyclic voltammetry studies. Cyclic voltammetry is also used to measure redox potentials of a range of pheophorbide and meso-trifluoroacetoxypheophorbide metal complexes, including an oxochlorin nickel(II) complex. The results are presented of biosynthetic feeding studies of green sulfur bacteria with {sup 13}C- and {sup 14}C-labelled glutamate, glycine, and methionine. This study examines an unusual oxidation of a bacteriomethylpheophorbide 5-ethyl substituent, and describes attempts to elucidate the mechanism by {sup 18}O-labelling studies. Attempts to similarily derivatize a pyropheophorbide 5-methyl substituent are discussed.

  16. Biosynthetic labeling of diphthamide in Saccharomyces cerevisiae.

    PubMed

    Dunlop, P C; Bodley, J W

    1983-04-25

    Diphthamide, the post-translational amino acid derivative in the diphtheria toxin-modification site of protein synthesis elongation factor 2 (EF-2), has the proposed structure 2-[3-carboxyamido-3-(trimethylammonio)propyl]histidine (Van Ness, B. G., Howard, J. B., and Bodley, J. W. (1980) J. Biol. Chem. 255, 10710-10716). The identification of the biosynthetic precursors of diphthamide would provide a means of evaluating its proposed structure and determining if the amino acid occurs in proteins other than EF-2. Toward this end, yeast were grown on potential radiolabeled precursors and the resulting radiolabeled protein was hydrolyzed in acid. The acid hydrolysates were subjected to amino acid analysis with a program optimized to resolve diphthine, the acid hydrolysis product of diphthamide, from the common amino acids. Radiolabel from [beta-3H]histidine, [alpha-3H]methionine, and [Me-3H] methionine was found to be incorporated into diphthine in a molar ratio of 1:1:3 while that of [35S]methionine was not incorporated. These results are in accord with the proposed structure of diphthamide and suggest that in its biosynthesis the backbone and 3 methyl groups of methionine are added to a histidine residue in the peptide chain of EF-2. These labeling experiments show that diphthine (diphthamide) constitutes approximately 6 X 10(-6) mol fraction of the total amino acids in yeast protein hydrolysates. Estimates of the amount of diphthamide present in the diphtheria toxin-modification site of EF-2 indicate that it constitutes from 4.5 to 9 X 10(-6) mol fraction of the total amino acids in yeast protein. The present evidence suggests that diphthamide occurs only in EF-2. PMID:6339504

  17. Microstructure and composition of biosynthetically synthesised hydroxyapatite.

    PubMed

    Medina Ledo, Hilda; Thackray, Ania C; Jones, Ian P; Marquis, Peter M; Macaskie, Lynne E; Sammons, Rachel L

    2008-11-01

    Biosynthetic hydroxyapatite (HA) manufactured utilising the bacterium Serratia sp. NCIMB40259 was characterised using X-ray diffraction (XRD), Fourier transform infra-red spectroscopy (FTIR), energy dispersive X-ray analysis (EDX) scanning electron microscopy (SEM), transmission electron microscopy (TEM) and electron diffraction (ED). SEM/EDX showed that the non-sintered material consisted mainly of calcium-deficient HA (CDHA) with a Ca/P ratio of 1.61 +/- 0.06 and crystal size (from TEM) of 50 +/- 10 nm. ED analysis of non-sintered powder showed resolvable ring patterns ascribed to (0002), (1122) and (0006) planes of crystalline HA. The crystallinity of the samples improved with heat treatment from approximately 9.4% (non-sintered) to 53% (1,200 degrees C). Samples heated at 600 degrees C and sintered at 1,200 degrees C were identified by XRD and FTIR as mainly CDHA with some sodium calcium phosphate in the sintered samples. Ca/P ratios (SEM/EDX) were 1.62 and 1.52, respectively. Single crystal spot patterns characteristic of HA were seen with commercial HA and Serratia HA heated at 600 degrees C. After sintering at 1,200 degrees C the material consisted of needle-like crystals with a length between 86 and 323 nm (from TEM) or 54-111 nm (from XRD) and lattice parameters of a = 9.441 A and c = 6.875 A. This study indicated that the material produced by Serratia bacteria was initially mainly nanophase calcium deficient hydroxyapatite, which sintered to a more highly crystalline form. With further refinements the method could be used as an inexpensive route for hydroxyapatite production for biomaterials applications.

  18. Tissue-specificity of heparan sulfate biosynthetic machinery in cancer.

    PubMed

    Suhovskih, Anastasia V; Domanitskaya, Natalya V; Tsidulko, Alexandra Y; Prudnikova, Tatiana Y; Kashuba, Vladimir I; Grigorieva, Elvira V

    2015-01-01

    Heparan sulfate (HS) proteoglycans are key components of cell microenvironment and fine structure of their polysaccharide HS chains plays an important role in cell-cell interactions, adhesion, migration and signaling. It is formed on non-template basis, so, structure and functional activity of HS biosynthetic machinery is crucial for correct HS biosynthesis and post-synthetic modification. To reveal cancer-related changes in transcriptional pattern of HS biosynthetic system, the expression of HS metabolism-involved genes (EXT1/2, NDST1/2, GLCE, 3OST1/HS3ST1, SULF1/2, HPSE) in human normal (fibroblasts, PNT2) and cancer (MCF7, LNCaP, PC3, DU145, H157, H647, A549, U2020, U87, HT116, KRC/Y) cell lines and breast, prostate, colon tumors was studied. Real-time RT-PCR and Western-blot analyses revealed specific transcriptional patterns and expression levels of HS biosynthetic system both in different cell lines in vitro and cancers in vivo. Balance between transcriptional activities of elongation- and post-synthetic modification- involved genes was suggested as most informative parameter for HS biosynthetic machinery characterization. Normal human fibroblasts showed elongation-oriented HS biosynthesis, while PNT2 prostate epithelial cells had modification-oriented one. However, cancer epithelial cells demonstrated common tendency to acquire fibroblast-like elongation-oriented mode of HS biosynthetic system. Surprisingly, aggressive metastatic cancer cells (U2020, DU145, KRC/Y) retained modification-oriented HS biosynthesis similar to normal PNT2 cells, possibly enabling the cells to keep like-to-normal cell surface glycosylation pattern to escape antimetastatic control. The obtained results show the cell type-specific changes of HS-biosynthetic machinery in cancer cells in vitro and tissue-specific changes in different cancers in vivo, supporting a close involvement of HS biosynthetic system in carcinogenesis. PMID:26120938

  19. Physical studies of 5S RNA variants at position 66.

    PubMed Central

    Zhang, P; Popieniek, P; Moore, P B

    1989-01-01

    Two variants of the 5S RNA of E. coli have been examined by imino proton NMR spectroscopy, one of them a deletion of A66 (Christiansen, J., Douthwaite, S.R., Christensen, A. and Garrett, R.A. (1985) EMBO J. 4, 1019-1024) and the other a replacement of A66 with a C (Goringer, H.U. and Wagner, R. (1986) Biol. Chem. Hoppe-Seyler 367, 769-780). Both are of interest because the role the bulged A in helix II of 5S RNA is supposed to play in interactions with ribosomal protein L18. The data show that the structural perturbations that result from these mutations are minimal, and assign the resonances of some of the imino protons around position 66. Some mutations at or near position 66 greatly reduce the L18-dependent increase in the circular dichroism of 5S RNA at 267 nm first observed by Bear and coworkers (Bear, D.G., Schleich, T., Noller, H.F. and Garrett, R.A. (1977) Nucl. Acids Res. 4, 2511-2526). PMID:2479908

  20. Natural Product Biosynthetic Diversity and Comparative Genomics of the Cyanobacteria.

    PubMed

    Dittmann, Elke; Gugger, Muriel; Sivonen, Kaarina; Fewer, David P

    2015-10-01

    Cyanobacteria are an ancient lineage of slow-growing photosynthetic bacteria and a prolific source of natural products with intricate chemical structures and potent biological activities. The bulk of these natural products are known from just a handful of genera. Recent efforts have elucidated the mechanisms underpinning the biosynthesis of a diverse array of natural products from cyanobacteria. Many of the biosynthetic mechanisms are unique to cyanobacteria or rarely described from other organisms. Advances in genome sequence technology have precipitated a deluge of genome sequences for cyanobacteria. This makes it possible to link known natural products to biosynthetic gene clusters but also accelerates the discovery of new natural products through genome mining. These studies demonstrate that cyanobacteria encode a huge variety of cryptic gene clusters for the production of natural products, and the known chemical diversity is likely to be just a fraction of the true biosynthetic capabilities of this fascinating and ancient group of organisms.

  1. Ochratoxin A Producing Fungi, Biosynthetic Pathway and Regulatory Mechanisms.

    PubMed

    Wang, Yan; Wang, Liuqing; Liu, Fei; Wang, Qi; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhao, Yueju; Liu, Yang

    2016-03-01

    Ochratoxin A (OTA), mainly produced by Aspergillus and Penicillum species, is one of the most important mycotoxin contaminants in agricultural products. It is detrimental to human health because of its nephrotoxicity, hepatotoxicity, carcinogenicity, teratogenicity, and immunosuppression. OTA structurally consists of adihydrocoumarin moiety linked with l-phenylalanine via an amide bond. OTA biosynthesis has been putatively hypothesized, although several contradictions exist on some processes of the biosynthetic pathway. We discuss recent information on molecular studies of OTA biosynthesis despite insufficient genetic background in detail. Accordingly, genetic regulation has also been explored with regard to the interaction between the regulators and the environmental factors. In this review, we focus on three aspects of OTA: OTA-producing strains, OTA biosynthetic pathway and the regulation mechanisms of OTA production. This can pave the way to assist in protecting food and feed from OTA contamination by understanding OTA biosynthetic pathway and regulatory mechanisms. PMID:27007394

  2. Ochratoxin A Producing Fungi, Biosynthetic Pathway and Regulatory Mechanisms

    PubMed Central

    Wang, Yan; Wang, Liuqing; Liu, Fei; Wang, Qi; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhao, Yueju; Liu, Yang

    2016-01-01

    Ochratoxin A (OTA), mainly produced by Aspergillus and Penicillum species, is one of the most important mycotoxin contaminants in agricultural products. It is detrimental to human health because of its nephrotoxicity, hepatotoxicity, carcinogenicity, teratogenicity, and immunosuppression. OTA structurally consists of adihydrocoumarin moiety linked with l-phenylalanine via an amide bond. OTA biosynthesis has been putatively hypothesized, although several contradictions exist on some processes of the biosynthetic pathway. We discuss recent information on molecular studies of OTA biosynthesis despite insufficient genetic background in detail. Accordingly, genetic regulation has also been explored with regard to the interaction between the regulators and the environmental factors. In this review, we focus on three aspects of OTA: OTA-producing strains, OTA biosynthetic pathway and the regulation mechanisms of OTA production. This can pave the way to assist in protecting food and feed from OTA contamination by understanding OTA biosynthetic pathway and regulatory mechanisms. PMID:27007394

  3. 5S rDNA genome regions of Lens species.

    PubMed

    Fernández, M; Ruiz, M L; Linares, C; Fominaya, A; Pérez de la Vega, M

    2005-10-01

    The length variability of the nontranscribed spacer (NTS) of the 5S rDNA repeats was analyzed in species of the genus Lens by means of PCR amplification. The NTS ranged from approximately 227 to approximately 952 bp. The polymorphism detected was higher than previous NTS polymorphisms described in this genus. Three NTS length variants from Lens culinaris subsp. culinaris and 2 from Lens culinaris subsp. orientalis were sequenced. The culinaris NTS fragment lengths were 239, 371, and 838 bp, whereas the orientalis ones were 472 bp and 506 bp, respectively. As a result of sequence similarities, 2 families of sequences were distinguished, 1 including the sequences of 838 and 506 bp, and others with the sequences of 239, 371, and 472 bp. The 1st family was characterized by the presence of a repeated sequence designated A, whereas the 2nd family showed a single A sequence and other repeated sequences designated B, C, and D. The presence of an (AT)n microsatellite was also observed in the 2nd family of sequences. The fragments, which included the 239-bp and 838-bp NTS sequences, as well as the intergenic spacer (IGS) of the 18S-5.8S-26S ribosomal DNA also from L. culinaris subsp. culinaris, were used to localize the nucleolar organizer region (NOR) and the 5S rDNA loci in the chromosomes of several species of the genus Lens by means of fluorescence in situ hybridization (FISH). The selective hybridization of the 2 NTS probes allowed us to distinguish between different 5S rDNA chromosomal loci.

  4. Mining and engineering natural-product biosynthetic pathways.

    PubMed

    Wilkinson, Barrie; Micklefield, Jason

    2007-07-01

    Natural products continue to fulfill an important role in the development of therapeutic agents. In addition, with the advent of chemical genetics and high-throughput screening platforms, these molecules have become increasingly valuable as tools for interrogating fundamental aspects of biological systems. To access the vast portion of natural-product structural diversity that remains unexploited for these and other applications, genome mining and microbial metagenomic approaches are proving particularly powerful. When these are coupled with recombineering and related genetic tools, large biosynthetic gene clusters that remain intractable or cryptic in the native host can be more efficiently cloned and expressed in a suitable heterologous system. For lead optimization and the further structural diversification of natural-product libraries, combinatorial biosynthetic engineering has also become indispensable. However, our ability to rationally redesign biosynthetic pathways is often limited by our lack of understanding of the structure, dynamics and interplay between the many enzymes involved in complex biosynthetic pathways. Despite this, recent structures of fatty acid synthases should allow a more accurate prediction of the likely architecture of related polyketide synthase and nonribosomal peptide synthetase multienzymes. PMID:17576425

  5. The biosynthetic products of chinese insect medicine, Aspongopus chinensis

    PubMed Central

    Luo, Xiao-Hong; Wang, Xiao-Zheng; Jiang, Hai-Long; Yang, Jun-Li; Crews, Phillip; Valeriote, Frederick A.; Wu, Quan-Xiang

    2012-01-01

    A new oxazole (1) was obtained from chinese insect medicine Aspongopus chinensis, along with three known N-acetyldopamine derivatives (2–4). Their structures were determined on the basis of NMR and ESI-MS analyses. The possible biosynthetic pathways of the isolated compounds are discussed. Cytotoxicities of those compounds against 10 selected cancer cells were measured in vitro. PMID:22430116

  6. Evaluation of Biosynthetic Pathway and Engineered Biosynthesis of Alkaloids.

    PubMed

    Kishimoto, Shinji; Sato, Michio; Tsunematsu, Yuta; Watanabe, Kenji

    2016-01-01

    Varieties of alkaloids are known to be produced by various organisms, including bacteria, fungi and plants, as secondary metabolites that exhibit useful bioactivities. However, understanding of how those metabolites are biosynthesized still remains limited, because most of these compounds are isolated from plants and at a trace level of production. In this review, we focus on recent efforts in identifying the genes responsible for the biosynthesis of those nitrogen-containing natural products and elucidating the mechanisms involved in the biosynthetic processes. The alkaloids discussed in this review are ditryptophenaline (dimeric diketopiperazine alkaloid), saframycin (tetrahydroisoquinoline alkaloid), strictosidine (monoterpene indole alkaloid), ergotamine (ergot alkaloid) and opiates (benzylisoquinoline and morphinan alkaloid). This review also discusses the engineered biosynthesis of these compounds, primarily through heterologous reconstitution of target biosynthetic pathways in suitable hosts, such as Escherichia coli, Saccharomyces cerevisiae and Aspergillus nidulans. Those heterologous biosynthetic systems can be used to confirm the functions of the isolated genes, economically scale up the production of the alkaloids for commercial distributions and engineer the biosynthetic pathways to produce valuable analogs of the alkaloids. In particular, extensive involvement of oxidation reactions catalyzed by oxidoreductases, such as cytochrome P450s, during the secondary metabolite biosynthesis is discussed in details. PMID:27548127

  7. Dysfunction of the cholesterol biosynthetic pathway in Huntington's disease.

    PubMed

    Valenza, Marta; Rigamonti, Dorotea; Goffredo, Donato; Zuccato, Chiara; Fenu, Simone; Jamot, Laure; Strand, Andrew; Tarditi, Alessia; Woodman, Ben; Racchi, Marco; Mariotti, Caterina; Di Donato, Stefano; Corsini, Alberto; Bates, Gillian; Pruss, Rebecca; Olson, James M; Sipione, Simonetta; Tartari, Marzia; Cattaneo, Elena

    2005-10-26

    The expansion of a polyglutamine tract in the ubiquitously expressed huntingtin protein causes Huntington's disease (HD), a dominantly inherited neurodegenerative disease. We show that the activity of the cholesterol biosynthetic pathway is altered in HD. In particular, the transcription of key genes of the cholesterol biosynthetic pathway is severely affected in vivo in brain tissue from HD mice and in human postmortem striatal and cortical tissue; this molecular dysfunction is biologically relevant because cholesterol biosynthesis is reduced in cultured human HD cells, and total cholesterol mass is significantly decreased in the CNS of HD mice and in brain-derived ST14A cells in which the expression of mutant huntingtin has been turned on. The transcription of the genes of the cholesterol biosynthetic pathway is regulated via the activity of sterol regulatory element-binding proteins (SREBPs), and we found an approximately 50% reduction in the amount of the active nuclear form of SREBP in HD cells and mouse brain tissue. As a consequence, mutant huntingtin reduces the transactivation of an SRE-luciferase construct even under conditions of SREBP overexpression or in the presence of an exogenous N-terminal active form of SREBP. Finally, the addition of exogenous cholesterol to striatal neurons expressing mutant huntingtin prevents their death in a dose-dependent manner. We conclude that the cholesterol biosynthetic pathway is impaired in HD cells, mice, and human subjects, and that the search for HD therapies should also consider cholesterol levels as both a potential target and disease biomarker. PMID:16251441

  8. Biosynthetic modularity rules in the bisintercalator family of antitumor compounds.

    PubMed

    Fernández, Javier; Marín, Laura; Alvarez-Alonso, Raquel; Redondo, Saúl; Carvajal, Juan; Villamizar, Germán; Villar, Claudio J; Lombó, Felipe

    2014-05-09

    Diverse actinomycetes produce a family of structurally and biosynthetically related non-ribosomal peptide compounds which belong to the chromodepsipeptide family. These compounds act as bisintercalators into the DNA helix. They give rise to antitumor, antiparasitic, antibacterial and antiviral bioactivities. These compounds show a high degree of conserved modularity (chromophores, number and type of amino acids). This modularity and their high sequence similarities at the genetic level imply a common biosynthetic origin for these pathways. Here, we describe insights about rules governing this modular biosynthesis, taking advantage of the fact that nowadays five of these gene clusters have been made public (thiocoraline, triostin, SW-163 and echinomycin/quinomycin). This modularity has potential application for designing and producing novel genetic engineered derivatives, as well as for developing new chemical synthesis strategies. These would facilitate their clinical development.

  9. YUCCA auxin biosynthetic genes are required for Arabidopsis shade avoidance

    PubMed Central

    Müller-Moulé, Patricia; Nozue, Kazunari; Pytlak, Melissa L.; Palmer, Christine M.; Covington, Michael F.; Wallace, Andreah D.; Harmer, Stacey L.

    2016-01-01

    Plants respond to neighbor shade by increasing stem and petiole elongation. Shade, sensed by phytochrome photoreceptors, causes stabilization of PHYTOCHROME INTERACTING FACTOR proteins and subsequent induction of YUCCA auxin biosynthetic genes. To investigate the role of YUCCA genes in phytochrome-mediated elongation, we examined auxin signaling kinetics after an end-of-day far-red (EOD-FR) light treatment, and found that an auxin responsive reporter is rapidly induced within 2 hours of far-red exposure. YUCCA2, 5, 8, and 9 are all induced with similar kinetics suggesting that they could act redundantly to control shade-mediated elongation. To test this hypothesis we constructed a yucca2, 5, 8, 9 quadruple mutant and found that the hypocotyl and petiole EOD-FR and shade avoidance responses are completely disrupted. This work shows that YUCCA auxin biosynthetic genes are essential for detectable shade avoidance and that YUCCA genes are important for petiole shade avoidance. PMID:27761349

  10. Identification of the Scopularide Biosynthetic Gene Cluster in Scopulariopsis brevicaulis

    PubMed Central

    Lukassen, Mie Bech; Saei, Wagma; Sondergaard, Teis Esben; Tamminen, Anu; Kumar, Abhishek; Kempken, Frank; Wiebe, Marilyn G.; Sørensen, Jens Laurids

    2015-01-01

    Scopularide A is a promising potent anticancer lipopeptide isolated from a marine derived Scopulariopsis brevicaulis strain. The compound consists of a reduced carbon chain (3-hydroxy-methyldecanoyl) attached to five amino acids (glycine, l-valine, d-leucine, l-alanine, and l-phenylalanine). Using the newly sequenced S. brevicaulis genome we were able to identify the putative biosynthetic gene cluster using genetic information from the structurally related emericellamide A from Aspergillus nidulans and W493-B from Fusarium pseudograminearum. The scopularide A gene cluster includes a nonribosomal peptide synthetase (NRPS1), a polyketide synthase (PKS2), a CoA ligase, an acyltransferase, and a transcription factor. Homologous recombination was low in S. brevicaulis so the local transcription factor was integrated randomly under a constitutive promoter, which led to a three to four-fold increase in scopularide A production. This indirectly verifies the identity of the proposed biosynthetic gene cluster. PMID:26184239

  11. Biosynthetic Modularity Rules in the Bisintercalator Family of Antitumor Compounds

    PubMed Central

    Fernández, Javier; Marín, Laura; Álvarez-Alonso, Raquel; Redondo, Saúl; Carvajal, Juan; Villamizar, Germán; Villar, Claudio J.; Lombó, Felipe

    2014-01-01

    Diverse actinomycetes produce a family of structurally and biosynthetically related non-ribosomal peptide compounds which belong to the chromodepsipeptide family. These compounds act as bisintercalators into the DNA helix. They give rise to antitumor, antiparasitic, antibacterial and antiviral bioactivities. These compounds show a high degree of conserved modularity (chromophores, number and type of amino acids). This modularity and their high sequence similarities at the genetic level imply a common biosynthetic origin for these pathways. Here, we describe insights about rules governing this modular biosynthesis, taking advantage of the fact that nowadays five of these gene clusters have been made public (thiocoraline, triostin, SW-163 and echinomycin/quinomycin). This modularity has potential application for designing and producing novel genetic engineered derivatives, as well as for developing new chemical synthesis strategies. These would facilitate their clinical development. PMID:24821625

  12. Urinary excretion of morphine and biosynthetic precursors in mice

    PubMed Central

    Grobe, Nadja; Lamshöft, Marc; Orth, Robert G.; Dräger, Birgit; Kutchan, Toni M.; Zenk, Meinhart H.; Spiteller, Michael

    2010-01-01

    It has been firmly established that humans excrete a small but steady amount of the isoquinoline alkaloid morphine in their urine. It is unclear whether it is of dietary or endogenous origin. There is no doubt that a simple isoquinoline alkaloid, tetrahydropapaveroline (THP), is found in human and rodent brain as well as in human urine. This suggests a potential biogenetic relationship between both alkaloids. Unlabeled THP or [1,3,4-D3]-THP was injected intraperitoneally into mice and the urine was analyzed. This potential precursor was extensively metabolized (96%). Among the metabolites found was the phenol-coupled product salutaridine, the known morphine precursor in the opium poppy plant. Synthetic [7D]-salutaridinol, the biosynthetic reduction product of salutaridine, injected intraperitoneally into live animals led to the formation of [7D]-thebaine, which was excreted in urine. [N-CD3]-thebaine was also administered and yielded [N-CD3]-morphine and the congeners [N-CD3]-codeine and [N-CD3]-oripavine in urine. These results show for the first time that live animals have the biosynthetic capability to convert a normal constituent of rodents, THP, to morphine. Morphine and its precursors are normally not found in tissues or organs, presumably due to metabolic breakdown. Hence, only that portion of the isoquinoline alkaloids excreted in urine unmetabolized can be detected. Analysis of urine by high resolution-mass spectrometry proved to be a powerful method for tracking endogenous morphine and its biosynthetic precursors. PMID:20421505

  13. Urinary excretion of morphine and biosynthetic precursors in mice.

    PubMed

    Grobe, Nadja; Lamshöft, Marc; Orth, Robert G; Dräger, Birgit; Kutchan, Toni M; Zenk, Meinhart H; Spiteller, Michael

    2010-05-01

    It has been firmly established that humans excrete a small but steady amount of the isoquinoline alkaloid morphine in their urine. It is unclear whether it is of dietary or endogenous origin. There is no doubt that a simple isoquinoline alkaloid, tetrahydropapaveroline (THP), is found in human and rodent brain as well as in human urine. This suggests a potential biogenetic relationship between both alkaloids. Unlabeled THP or [1,3,4-D(3)]-THP was injected intraperitoneally into mice and the urine was analyzed. This potential precursor was extensively metabolized (96%). Among the metabolites found was the phenol-coupled product salutaridine, the known morphine precursor in the opium poppy plant. Synthetic [7D]-salutaridinol, the biosynthetic reduction product of salutaridine, injected intraperitoneally into live animals led to the formation of [7D]-thebaine, which was excreted in urine. [N-CD(3)]-thebaine was also administered and yielded [N-CD(3)]-morphine and the congeners [N-CD(3)]-codeine and [N-CD(3)]-oripavine in urine. These results show for the first time that live animals have the biosynthetic capability to convert a normal constituent of rodents, THP, to morphine. Morphine and its precursors are normally not found in tissues or organs, presumably due to metabolic breakdown. Hence, only that portion of the isoquinoline alkaloids excreted in urine unmetabolized can be detected. Analysis of urine by high resolution-mass spectrometry proved to be a powerful method for tracking endogenous morphine and its biosynthetic precursors.

  14. Endoplasmic reticulum localization and activity of maize auxin biosynthetic enzymes.

    PubMed

    Kriechbaumer, Verena; Seo, Hyesu; Park, Woong June; Hawes, Chris

    2015-09-01

    Auxin is a major growth hormone in plants and the first plant hormone to be discovered and studied. Active research over >60 years has shed light on many of the molecular mechanisms of its action including transport, perception, signal transduction, and a variety of biosynthetic pathways in various species, tissues, and developmental stages. The complexity and redundancy of the auxin biosynthetic network and enzymes involved raises the question of how such a system, producing such a potent agent as auxin, can be appropriately controlled at all. Here it is shown that maize auxin biosynthesis takes place in microsomal as well as cytosolic cellular fractions from maize seedlings. Most interestingly, a set of enzymes shown to be involved in auxin biosynthesis via their activity and/or mutant phenotypes and catalysing adjacent steps in YUCCA-dependent biosynthesis are localized to the endoplasmic reticulum (ER). Positioning of auxin biosynthetic enzymes at the ER could be necessary to bring auxin biosynthesis in closer proximity to ER-localized factors for transport, conjugation, and signalling, and allow for an additional level of regulation by subcellular compartmentation of auxin action. Furthermore, it might provide a link to ethylene action and be a factor in hormonal cross-talk as all five ethylene receptors are ER localized.

  15. Endoplasmic reticulum localization and activity of maize auxin biosynthetic enzymes.

    PubMed

    Kriechbaumer, Verena; Seo, Hyesu; Park, Woong June; Hawes, Chris

    2015-09-01

    Auxin is a major growth hormone in plants and the first plant hormone to be discovered and studied. Active research over >60 years has shed light on many of the molecular mechanisms of its action including transport, perception, signal transduction, and a variety of biosynthetic pathways in various species, tissues, and developmental stages. The complexity and redundancy of the auxin biosynthetic network and enzymes involved raises the question of how such a system, producing such a potent agent as auxin, can be appropriately controlled at all. Here it is shown that maize auxin biosynthesis takes place in microsomal as well as cytosolic cellular fractions from maize seedlings. Most interestingly, a set of enzymes shown to be involved in auxin biosynthesis via their activity and/or mutant phenotypes and catalysing adjacent steps in YUCCA-dependent biosynthesis are localized to the endoplasmic reticulum (ER). Positioning of auxin biosynthetic enzymes at the ER could be necessary to bring auxin biosynthesis in closer proximity to ER-localized factors for transport, conjugation, and signalling, and allow for an additional level of regulation by subcellular compartmentation of auxin action. Furthermore, it might provide a link to ethylene action and be a factor in hormonal cross-talk as all five ethylene receptors are ER localized. PMID:26139824

  16. Repumping and spectroscopy of laser-cooled Sr atoms using the (5s5p)3P2-(5s4d)3D2 transition

    NASA Astrophysics Data System (ADS)

    Mickelson, P. G.; Martinez de Escobar, Y. N.; Anzel, P.; De Salvo, B. J.; Nagel, S. B.; Traverso, A. J.; Yan, M.; Killian, T. C.

    2009-12-01

    We describe repumping and spectroscopy of laser-cooled strontium (Sr) atoms using the (5s5p)3P2-(5s4d)3D2 transition. Atom number in a magneto-optical trap is enhanced by driving this transition because Sr atoms that have decayed into the (5s5p)3P2 dark state are repumped back into the (5s2)1S0 ground state. Spectroscopy of 84Sr, 86Sr, 87Sr and 88Sr improves the value of the (5s5p)3P2-(5s4d)3D2 transition frequency and determines the isotope shifts for the transition accurately enough to guide laser-cooling experiments with less abundant isotopes.

  17. D5S351 and D5S1414 located at the spinal muscular atrophy critical region represent novel informative markers in the Iranian population

    PubMed Central

    Sedghi, Maryam; Vallian, Sadeq

    2015-01-01

    Spinal muscular atrophy (SMA) is a degenerative neuromuscular disease associated with progressive symmetric weakness and atrophy of the limb muscles. In view of the involvement of numerous point mutations and deletions associated with the disease, the application of polymorphic markers flanking the SMA critical region could be valuable in molecular diagnosis of the disease. In the present study, D5S351 and D5S1414 polymorphic markers located at the SMA critical region in the Iranian populations were characterized. Genotyping of the markers indicated the presence of six and nine different alleles for D5S351 and D5S1414, respectively. Haplotype frequency estimation in 25 trios families and 75 unrelated individuals indicated the presence of six informative haplotypes with frequency higher than 0.05 in the studied population. Furthermore, the D′ coefficient and the χ2 value for D5S351 and D5S1414 markers revealed the presence of linkage disequilibrium between the two markers in the Iranians. These data suggested that D5S351 and D5S1414 could be suggested as informative markers for linkage analysis and molecular diagnosis of SMA in the Iranian population. PMID:26693404

  18. Deciphering the Biosynthetic Origin of L-allo-Isoleucine.

    PubMed

    Li, Qinglian; Qin, Xiangjing; Liu, Jing; Gui, Chun; Wang, Bo; Li, Jie; Ju, Jianhua

    2016-01-13

    The nonproteinogenic amino acid L-allo-isoleucine (L-allo-Ile) is featured in an assortment of life forms comprised of, but not limited to, bacteria, fungi, plants and mammalian systems including Homo sapiens. Despite its ubiquity and functional importance, the specific origins of this unique amino acid have eluded characterization. In this study, we describe the discovery and characterization of two enzyme pairs consisting of a pyridoxal 5'-phosphate (PLP)-linked aminotransferase and an unprecedented isomerase synergistically responsible for the biosynthesis of L-allo-Ile from L-isoleucine (L-Ile) in natural products. DsaD/DsaE from the desotamide biosynthetic pathway in Streptomyces scopuliridis SCSIO ZJ46, and MfnO/MfnH from the marformycin biosynthetic pathway in Streptomyces drozdowiczii SCSIO 10141 drive L-allo-Ile generation in each respective system. In vivo gene inactivations validated the importance of the DsaD/DsaE pair and MfnO/MfnH pair in L-allo-Ile unit biosynthesis. Inactivation of PLP-linked aminotransferases DsaD and MfnO led to significantly diminished desotamide and marformycin titers, respectively. Additionally, inactivation of the isomerase genes dsaE and mfnH completely abolished production of all L-allo-Ile-containing metabolites in both biosynthetic pathways. Notably, in vitro biochemical assays revealed that DsaD/DsaE and MfnO/MfnH each catalyze a bidirectional reaction between L-allo-Ile and L-Ile. Site-directed mutagenesis experiments revealed that the enzymatic reaction involves a PLP-linked ketimine intermediate and uses an arginine residue from the C-terminus of each isomerase to epimerize the amino acid β-position. Consequently, these data provide important new insight into the origins of L-allo-Ile in natural products with medicinal potential and illuminate new possibilities for biotool development.

  19. Biosynthetic wound coatings as susbtrates for cell growth.

    PubMed

    Davydova, G A; Selezneva, I I; Savintseva, I V; Gavrilyuk, B K

    2008-01-01

    Experimental studies of composite materials formed on the basis of fluorine-containing latex and bioactive polysaccharides showed that physicochemical properties of composite materials and their adhesion characteristics can be modulated by variations of polysaccharide-latex ratio and the nature of polysaccharides. The ratio of components ensuring the formation of biosynthetic films that meet the standards for modern wound coating and maintain adhesion and growth of substrate-dependent mammalian cells was determined. These materials can considerably increase the efficiency of treatment of extensive and deep skin wounds in cases when application of cell cultures is indicated.

  20. Scanning electron microscopy of biosynthetic wound dressings Biocol.

    PubMed

    Pogorelov, A G; Gavriluk, V B; Pogorelova, V N; Gavriluk, B K

    2012-11-01

    The surface of wound dressing Biocol was studied by scanning electron microscopy. This composite system consists of latex matrix with incorporated water-soluble polysaccharide. The peculiarities of the surface are important for manufacturing of the dressing and for modification of its surface upon contact with fluids, e.g. during de novo tissue reconstruction. The method for studying the fine structure of the polymeric film surface was developed. The relief of the wound dressing changes during interaction with the fluid and nanopores appear on the surface. Thus, scanning electron microscopy is an informative method for studying the surface of biosynthetic films. PMID:23330116

  1. Survey of volatile oxylipins and their biosynthetic precursors in bryophytes.

    PubMed

    Croisier, Emmanuel; Rempt, Martin; Pohnert, Georg

    2010-04-01

    Oxylipins are metabolites which are derived from the oxidative fragmentation of polyunsaturated fatty acids. These metabolites play central roles in plant hormonal regulation and defense. Here we survey the production of volatile oxylipins in bryophytes and report the production of a high structural variety of C5, C6, C8 and C9 volatiles of mosses. In liverworts and hornworts oxylipin production was not as pronounced as in the 23 screened mosses. A biosynthetic investigation revealed that both, C18 and C20 fatty acids serve as precursors for the volatile oxylipins that are mainly produced after mechanical wounding of the green tissue of mosses.

  2. Exploring polyamine biosynthetic diversity through comparative and functional genomics.

    PubMed

    Michael, Anthony J

    2011-01-01

    The existence of multiple, alternative pathways for polyamine biosynthesis, and the presence of alternative polyamine structural analogs, is an indication of the physiological importance of polyamines and their long evolutionary history. Polyamine biosynthesis is modular: diamines are synthesized directly or indirectly from amino acids, and triamines are synthesized from diamines by transfer of aminopropyl, carboxyaminopropyl, or aminobutyl groups to the diamine. Diversification of polyamine biosynthesis has depended on gene duplication and functional divergence, on gene fusion, and on horizontal gene transfer. Four examples of polyamine biosynthetic diversification are presented here with a discussion of methodological and conceptual approaches for identification of new pathways.

  3. Identification of the gene encoding the 5S ribosomal RNA maturase in Bacillus subtilis: mature 5S rRNA is dispensable for ribosome function.

    PubMed Central

    Condon, C; Brechemier-Baey, D; Beltchev, B; Grunberg-Manago, M; Putzer, H

    2001-01-01

    Over 25 years ago, Pace and coworkers described an activity called RNase M5 in Bacillus subtilis cell extracts responsible for 5S ribosomal RNA maturation (Sogin & Pace, Nature, 1974, 252:598-600). Here we show that RNase M5 is encoded by a gene of previously unknown function that is highly conserved among the low G + C gram-positive bacteria. We propose that the gene be named rnmV. The rnmV gene is nonessential. B. subtilis strains lacking RNase M5 do not make mature 5S rRNA, indicating that this process is not necessary for ribosome function. 5S rRNA precursors can, however, be found in both free and translating ribosomes. In contrast to RNase E, which cleaves the Escherichia coli 5S precursor in a single-stranded region, which is then trimmed to yield mature 5S RNA, RNase M5 cleaves the B. subtilis equivalent in a double-stranded region to yield mature 5S rRNA in one step. For the most part, eubacteria contain one or the other system for 5S rRNA production, with an imperfect division along gram-negative and gram-positive lines. A potential correlation between the presence of RNase E or RNase M5 and the single- or double-stranded nature of the predicted cleavage sites is explored. PMID:11233981

  4. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.

    PubMed

    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto

    2006-05-01

    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes. PMID:16612546

  5. Heterologous expression of natural product biosynthetic gene clusters in Streptomyces coelicolor: from genome mining to manipulation of biosynthetic pathways.

    PubMed

    Gomez-Escribano, Juan Pablo; Bibb, Mervyn J

    2014-02-01

    Heterologous gene expression is one of the main strategies used to access the full biosynthetic potential of actinomycetes, as well as to study the metabolic pathways of natural product biosynthesis and to create unnatural pathways. Streptomyces coelicolor A3(2) is the most studied member of the actinomycetes, bacteria renowned for their prolific capacity to synthesize a wide range of biologically active specialized metabolites. We review here the use of strains of this species for the heterologous production of structurally diverse actinomycete natural products.

  6. Substrate specificity of the sialic acid biosynthetic pathway

    SciTech Connect

    Jacobs, Christina L.; Goon, Scarlett; Yarema, Kevin J.; Hinderlich, Stephan; Hang, Howard C.; Chai, Diana H.; Bertozzi, Carolyn R.

    2001-07-18

    Unnatural analogs of sialic acid can be delivered to mammalian cell surfaces through the metabolic transformation of unnatural N-acetylmannosamine (ManNAc) derivatives. In previous studies, mannosamine analogs bearing simple N-acyl groups up to five carbon atoms in length were recognized as substrates by the biosynthetic machinery and transformed into cell-surface sialoglycoconjugates [Keppler, O. T., et al. (2001) Glycobiology 11, 11R-18R]. Such structural alterations to cell surface glycans can be used to probe carbohydrate-dependent phenomena. This report describes our investigation into the extent of tolerance of the pathway toward additional structural alterations of the N-acyl substituent of ManNAc. A panel of analogs with ketone-containing N-acyl groups that varied in the lengthor steric bulk was chemically synthesized and tested for metabolic conversion to cell-surface glycans. We found that extension of the N-acyl chain to six, seven, or eight carbon atoms dramatically reduced utilization by the biosynthetic machinery. Likewise, branching from the linear chain reduced metabolic conversion. Quantitation of metabolic intermediates suggested that cellular metabolism is limited by the phosphorylation of the N-acylmannosamines by ManNAc 6-kinase in the first step of the pathway. This was confirmed by enzymatic assay of the partially purified enzyme with unnatural substrates. Identification of ManNAc 6-kinase as a bottleneck for unnatural sialic acid biosynthesis provides a target for expanding the metabolic promiscuity of mammalian cells.

  7. Unique marine derived cyanobacterial biosynthetic genes for chemical diversity.

    PubMed

    Kleigrewe, Karin; Gerwick, Lena; Sherman, David H; Gerwick, William H

    2016-02-01

    Cyanobacteria are a prolific source of structurally unique and biologically active natural products that derive from intriguing biochemical pathways. Advancements in genome sequencing have accelerated the identification of unique modular biosynthetic gene clusters in cyanobacteria and reveal a wealth of unusual enzymatic reactions involved in their construction. This article examines several interesting mechanistic transformations involved in cyanobacterial secondary metabolite biosynthesis with a particular focus on marine derived modular polyketide synthases (PKS), nonribosomal peptide synthetases (NRPS) and combinations thereof to form hybrid natural products. Further, we focus on the cyanobacterial genus Moorea and the co-evolution of its enzyme cassettes that create metabolic diversity. Progress in the development of heterologous expression systems for cyanobacterial gene clusters along with chemoenzymatic synthesis makes it possible to create new analogs. Additionally, phylum-wide genome sequencing projects have enhanced the discovery rate of new natural products and their distinctive enzymatic reactions. Summarizing, cyanobacterial biosynthetic gene clusters encode for a large toolbox of novel enzymes that catalyze unique chemical reactions, some of which may be useful in synthetic biology.

  8. Structural Insights Into the Evolutionary Paths of Oxylipin Biosynthetic Enzymes

    SciTech Connect

    Lee, D.-S.; Nioche, P.; Hamberg, M.; Raman, C.S.

    2009-05-20

    The oxylipin pathway generates not only prostaglandin-like jasmonates but also green leaf volatiles (GLVs), which confer characteristic aromas to fruits and vegetables. Although allene oxide synthase (AOS) and hydroperoxide lyase are atypical cytochrome P450 family members involved in the synthesis of jasmonates and GLVs, respectively, it is unknown how these enzymes rearrange their hydroperoxide substrates into different products. Here we present the crystal structures of Arabidopsis thaliana AOS, free and in complex with substrate or intermediate analogues. The structures reveal an unusual active site poised to control the reactivity of an epoxyallylic radical and its cation by means of interactions with an aromatic {pi}-system. Replacing the amino acid involved in these steps by a non-polar residue markedly reduces AOS activity and, unexpectedly, is both necessary and sufficient for converting AOS into a GLV biosynthetic enzyme. Furthermore, by combining our structural data with bioinformatic and biochemical analyses, we have discovered previously unknown hydroperoxide lyase in plant growth-promoting rhizobacteria, AOS in coral, and epoxyalcohol synthase in amphioxus. These results indicate that oxylipin biosynthetic genes were present in the last common ancestor of plants and animals, but were subsequently lost in all metazoan lineages except Placozoa, Cnidaria and Cephalochordata.

  9. Effect of photoperiod on gibberellin biosynthetic enzymes in spinach

    SciTech Connect

    Gilmour, S.J.; Bleecker, A.B.; Zeevaart, J.A.D.

    1986-04-01

    The photoperiodic control of stem elongation in spinach, a long day (LD) rosette plant, is mediated by gibberellins (GAs). The early 13-hydroxylated GA biosynthetic pathway from GA/sub 12/ to GA/sub 20/ operates in spinach: GA/sub 12/ ..-->.. GA/sub 53/ ..-->.. GA/sub 44/ ..-->.. GA/sub 19/ ..-->.. GA/sub 20/. Two enzymes of this pathway, those converting GA/sub 53/ to GA/sub 44/ (GA/sub 53/ oxidase) and GA/sub 19/ to GA/sub 20/ (GA/sub 19/ oxidase), are regulated by light. The enzyme converting GA/sub 44/ to GA/sub 19/ (GA/sub 44/ oxidase) is not light-regulated. In the light GA/sub 53/ and GA/sub 18/ oxidase activities are increased, therefore causing the GA biosynthetic pathway to be turned on. This leads to the production of an active GA in LD, which causes an increase in stem elongation. Two the enzymes, GA/sub 44/ and GA/sub 53/ oxidases, can be separated from one another by anion exchange HPLC. Estimates of the molecular weights of these two enzymes based on gel filtration HPLC will be reported.

  10. Cloning and characterization of the biosynthetic gene cluster for kutznerides

    PubMed Central

    Fujimori, Danica Galonić; Hrvatin, Siniša; Neumann, Christopher S.; Strieker, Matthias; Marahiel, Mohamed A.; Walsh, Christopher T.

    2007-01-01

    Kutznerides, actinomycete-derived cyclic depsipetides, consist of six nonproteinogenic residues, including a highly oxygenated tricyclic hexahydropyrroloindole, a chlorinated piperazic acid, 2-(1-methylcyclopropyl)-glycine, a β-branched-hydroxy acid, and 3-hydroxy glutamic acid, for which biosynthetic logic has not been elucidated. Herein we describe the biosynthetic gene cluster for the kutzneride family, identified by degenerate primer PCR for halogenating enzymes postulated to be involved in biosyntheses of these unusual monomers. The 56-kb gene cluster encodes a series of six nonribosomal peptide synthetase (NRPS) modules distributed over three proteins and a variety of tailoring enzymes, including both mononuclear nonheme iron and two flavin-dependent halogenases, and an array of oxygen transfer catalysts. The sequence and organization of NRPS genes support incorporation of the unusual monomer units into the densely functionalized scaffold of kutznerides. Our work provides insight into the formation of this intriguing class of compounds and provides a foundation for elucidating the timing and mechanisms of their biosynthesis. PMID:17940045

  11. The biosynthetic pathway of vitamin C in higher plants.

    PubMed

    Wheeler, G L; Jones, M A; Smirnoff, N

    1998-05-28

    Vitamin C (L-ascorbic acid) has important antioxidant and metabolic functions in both plants and animals, but humans, and a few other animal species, have lost the capacity to synthesize it. Plant-derived ascorbate is thus the major source of vitamin C in the human diet. Although the biosynthetic pathway of L-ascorbic acid in animals is well understood, the plant pathway has remained unknown-one of the few primary plant metabolic pathways for which this is the case. L-ascorbate is abundant in plants (found at concentrations of 1-5 mM in leaves and 25 mM in chloroplasts) and may have roles in photosynthesis and transmembrane electron transport. We found that D-mannose and L-galactose are efficient precursors for ascorbate synthesis and are interconverted by GDP-D-mannose-3,5-epimerase. We have identified an enzyme in pea and Arabidopsis thaliana, L-galactose dehydrogenase, that catalyses oxidation of L-galactose to L-galactono-1,4-lactone. We propose an ascorbate biosynthesis pathway involving GDP-D-mannose, GDP-L-galactose, L-galactose and L-galactono-1,4-lactone, and have synthesized ascorbate from GDP-D-mannose by way of these intermediates in vitro. The definition of this biosynthetic pathway should allow engineering of plants for increased ascorbate production, thus increasing their nutritional value and stress tolerance.

  12. Identification of the Herboxidiene Biosynthetic Gene Cluster in Streptomyces chromofuscus ATCC 49982

    PubMed Central

    Shao, Lei; Zi, Jiachen; Zeng, Jia

    2012-01-01

    The 53-kb biosynthetic gene cluster for the novel anticholesterol natural product herboxidiene was identified in Streptomyces chromofuscus ATCC 49982 by genome sequencing and gene inactivation. In addition to herboxidiene, a biosynthetic intermediate, 18-deoxy-herboxidiene, was also isolated from the fermentation broth of S. chromofuscus ATCC 49982 as a minor metabolite. PMID:22247174

  13. Physiological factors affecting transcription of genes involved in the flavonoid biosynthetic pathway in different rice varieties.

    PubMed

    Chen, Xiaoqiong; Itani, Tomio; Wu, Xianjun; Chikawa, Yuuki; Irifune, Kohei

    2013-01-01

    Flavonoids play an important role in the grain color and flavor of rice. Since their characterization in maize, the flavonoid biosynthetic genes have been extensively studied in grape, Arabidopsis, and Petunia. However, we are still a long way from understanding the molecular features and mechanisms underlying the flavonoid biosynthetic pathway. The present study was undertaken to understand the physiological factors affecting the transcription and regulation of these genes. We report that the expression of CHI, CHS, DFR, LAR, and ANS, the 5 flavonoid biosynthetic genes in different rice varieties, differ dramatically with respect to the stage of development, white light, and sugar concentrations. We further demonstrate that white light could induce the transcription of the entire flavonoid biosynthetic gene pathway; however, differences were observed in the degrees of sensitivity and the required illumination time. Our study provides valuable insights into understanding the regulation of the flavonoid biosynthetic pathway. PMID:24389954

  14. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

    2005-01-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  15. Manipulating Natural Product Biosynthetic Pathways via DNA Assembler

    PubMed Central

    Shao, Zengyi; Zhao, Huimin

    2014-01-01

    DNA assembler is an efficient synthetic biology method for constructing and manipulating biochemical pathways. The rapidly increasing number of sequenced genomes provides a rich source for discovery of gene clusters involved in synthesizing new natural products. However, both discovery and economical production are hampered by our limited knowledge in manipulating most organisms and the corresponding pathways. By taking advantage of yeast in vivo homologous recombination, DNA assembler synthesizes an entire expression vector containing the target biosynthetic pathway and the genetic elements needed for DNA maintenance and replication. Here we use the spectinabilin clusters originated from two hosts as examples to illustrate the guidelines of using DNA assembler for cluster characterization and silent cluster activation. Such strategies offer unprecedented versatility in cluster manipulation, bypass the traditional laborious strategies to elicit pathway expression, and provide a new platform for de novo cluster assembly and genome mining for discovering new natural products. PMID:24903884

  16. Toward a biosynthetic route to sclareol and amber odorants.

    PubMed

    Schalk, Michel; Pastore, Laurence; Mirata, Marco A; Khim, Samretthy; Schouwey, Marina; Deguerry, Fabienne; Pineda, Virginia; Rocci, Letizia; Daviet, Laurent

    2012-11-21

    Ambergris, a waxy substance excreted by the intestinal tract of the sperm whale, has been a highly prized fragrance ingredient for millenia. Because of supply shortage and price inflation, a number of ambergris substitutes have been developed by the fragrance industry. One of the key olfactory components and most appreciated substitutes of ambergris, Ambrox is produced industrially by semisynthesis from sclareol, a diterpene-diol isolated from Clary sage. In the present study, we report the cloning and functional characterization of the enzymes responsible for the biosynthesis of sclareol. Furthermore, we reconstructed the sclareol biosynthetic pathway in genetically engineered Escherichia coli and reached sclareol titers of ~1.5 g/L in high-cell-density fermentation. Our work provides a basis for the development of an alternative, sustainable, and cost-efficient route to sclareol and other diterpene analogues.

  17. Regulation of cobalamin biosynthetic operons in Salmonella typhimurium.

    PubMed Central

    Escalante-Semerena, J C; Roth, J R

    1987-01-01

    Transcription of cobalamin (cob) biosynthetic genes in Salmonella typhimurium is repressed by cobalamin and by molecular oxygen. These genes seem to be subject to catabolite repression, and they are maximally expressed under conditions of anaerobic respiration of glycerol-fumarate. A 215-fold increase in the expression of cob genes occurs when S. typhimurium shifts from aerobic growth on glucose to anaerobic respiration of glycerol-fumarate under strictly anoxic growth conditions. Exogenous cyclic AMP substantially stimulates the transcription of cob-lac fusions during aerobic growth. However, cyclic AMP is not absolutely required for the expression of the pathway, nor does it mediate the aerobic control. Cobalamin biosynthesis is not seen under aerobic growth conditions, even when transcription is stimulated by the addition of cyclic AMP. Hence, additional control mechanisms triggered by the presence of molecular oxygen must operate independently from transcription effects on the cob operons. PMID:3032913

  18. Cloning and Heterologous Expression of the Grecocycline Biosynthetic Gene Cluster

    PubMed Central

    Bilyk, Oksana; Sekurova, Olga N.; Zotchev, Sergey B.; Luzhetskyy, Andriy

    2016-01-01

    Transformation-associated recombination (TAR) in yeast is a rapid and inexpensive method for cloning and assembly of large DNA fragments, which relies on natural homologous recombination. Two vectors, based on p15a and F-factor replicons that can be maintained in yeast, E. coli and streptomycetes have been constructed. These vectors have been successfully employed for assembly of the grecocycline biosynthetic gene cluster from Streptomyces sp. Acta 1362. Fragments of the cluster were obtained by PCR and transformed together with the “capture” vector into the yeast cells, yielding a construct carrying the entire gene cluster. The obtained construct was heterologously expressed in S. albus J1074, yielding several grecocycline congeners. Grecocyclines have unique structural moieties such as a dissacharide side chain, an additional amino sugar at the C-5 position and a thiol group. Enzymes from this pathway may be used for the derivatization of known active angucyclines in order to improve their desired biological properties. PMID:27410036

  19. Alkaloids from Pandanus amaryllifolius: Isolation and Their Plausible Biosynthetic Formation.

    PubMed

    Tsai, Yu-Chi; Yu, Meng-Lun; El-Shazly, Mohamed; Beerhues, Ludger; Cheng, Yuan-Bin; Chen, Lei-Chin; Hwang, Tsong-Long; Chen, Hui-Fen; Chung, Yu-Ming; Hou, Ming-Feng; Wu, Yang-Chang; Chang, Fang-Rong

    2015-10-23

    Pandanus amaryllifolius Roxb. (Pandanaceae) is used as a flavor and in folk medicine in Southeast Asia. The ethanolic crude extract of the aerial parts of P. amaryllifolius exhibited antioxidant, antibiofilm, and anti-inflammatory activities in previous studies. In the current investigation, the purification of the ethanolic extract yielded nine new compounds, including N-acetylnorpandamarilactonines A (1) and B (2); pandalizines A (3) and B (4); pandanmenyamine (5); pandamarilactones 2 (6) and 3 (7), and 5(E)-pandamarilactonine-32 (8); and pandalactonine (9). The isolated alkaloids, with either a γ-alkylidene-α,β-unsaturated-γ-lactone or γ-alkylidene-α,β-unsaturated-γ-lactam system, can be classified into five skeletons including norpandamarilactonine, indolizinone, pandanamine, pandamarilactone, and pandamarilactonine. A plausible biosynthetic route toward 1-5, 7, and 9 is proposed. PMID:26461164

  20. Limiting Cholesterol Biosynthetic Flux Spontaneously Engages Type I IFN Signaling.

    PubMed

    York, Autumn G; Williams, Kevin J; Argus, Joseph P; Zhou, Quan D; Brar, Gurpreet; Vergnes, Laurent; Gray, Elizabeth E; Zhen, Anjie; Wu, Nicholas C; Yamada, Douglas H; Cunningham, Cameron R; Tarling, Elizabeth J; Wilks, Moses Q; Casero, David; Gray, David H; Yu, Amy K; Wang, Eric S; Brooks, David G; Sun, Ren; Kitchen, Scott G; Wu, Ting-Ting; Reue, Karen; Stetson, Daniel B; Bensinger, Steven J

    2015-12-17

    Cellular lipid requirements are achieved through a combination of biosynthesis and import programs. Using isotope tracer analysis, we show that type I interferon (IFN) signaling shifts the balance of these programs by decreasing synthesis and increasing import of cholesterol and long chain fatty acids. Genetically enforcing this metabolic shift in macrophages is sufficient to render mice resistant to viral challenge, demonstrating the importance of reprogramming the balance of these two metabolic pathways in vivo. Unexpectedly, mechanistic studies reveal that limiting flux through the cholesterol biosynthetic pathway spontaneously engages a type I IFN response in a STING-dependent manner. The upregulation of type I IFNs was traced to a decrease in the pool size of synthesized cholesterol and could be inhibited by replenishing cells with free cholesterol. Taken together, these studies delineate a metabolic-inflammatory circuit that links perturbations in cholesterol biosynthesis with activation of innate immunity. PMID:26686653

  1. Discovery of a widely distributed toxin biosynthetic gene cluster

    PubMed Central

    Lee, Shaun W.; Mitchell, Douglas A.; Markley, Andrew L.; Hensler, Mary E.; Gonzalez, David; Wohlrab, Aaron; Dorrestein, Pieter C.; Nizet, Victor; Dixon, Jack E.

    2008-01-01

    Bacteriocins represent a large family of ribosomally produced peptide antibiotics. Here we describe the discovery of a widely conserved biosynthetic gene cluster for the synthesis of thiazole and oxazole heterocycles on ribosomally produced peptides. These clusters encode a toxin precursor and all necessary proteins for toxin maturation and export. Using the toxin precursor peptide and heterocycle-forming synthetase proteins from the human pathogen Streptococcus pyogenes, we demonstrate the in vitro reconstitution of streptolysin S activity. We provide evidence that the synthetase enzymes, as predicted from our bioinformatics analysis, introduce heterocycles onto precursor peptides, thereby providing molecular insight into the chemical structure of streptolysin S. Furthermore, our studies reveal that the synthetase exhibits relaxed substrate specificity and modifies toxin precursors from both related and distant species. Given our findings, it is likely that the discovery of similar peptidic toxins will rapidly expand to existing and emerging genomes. PMID:18375757

  2. Cloning and Heterologous Expression of the Grecocycline Biosynthetic Gene Cluster.

    PubMed

    Bilyk, Oksana; Sekurova, Olga N; Zotchev, Sergey B; Luzhetskyy, Andriy

    2016-01-01

    Transformation-associated recombination (TAR) in yeast is a rapid and inexpensive method for cloning and assembly of large DNA fragments, which relies on natural homologous recombination. Two vectors, based on p15a and F-factor replicons that can be maintained in yeast, E. coli and streptomycetes have been constructed. These vectors have been successfully employed for assembly of the grecocycline biosynthetic gene cluster from Streptomyces sp. Acta 1362. Fragments of the cluster were obtained by PCR and transformed together with the "capture" vector into the yeast cells, yielding a construct carrying the entire gene cluster. The obtained construct was heterologously expressed in S. albus J1074, yielding several grecocycline congeners. Grecocyclines have unique structural moieties such as a dissacharide side chain, an additional amino sugar at the C-5 position and a thiol group. Enzymes from this pathway may be used for the derivatization of known active angucyclines in order to improve their desired biological properties. PMID:27410036

  3. Pictet–Spengler reaction-based biosynthetic machinery in fungi

    PubMed Central

    Yan, Wei; Ge, Hui Ming; Wang, Gang; Jiang, Nan; Mei, Ya Ning; Jiang, Rong; Li, Sui Jun; Chen, Chao Jun; Jiao, Rui Hua; Xu, Qiang; Ng, Seik Weng; Tan, Ren Xiang

    2014-01-01

    The Pictet–Spengler (PS) reaction constructs plant alkaloids such as morphine and camptothecin, but it has not yet been noticed in the fungal kingdom. Here, a silent fungal Pictet–Spenglerase (FPS) gene of Chaetomium globosum 1C51 residing in Epinephelus drummondhayi guts is described and ascertained to be activable by 1-methyl-l-tryptophan (1-MT). The activated FPS expression enables the PS reaction between 1-MT and flavipin (fungal aldehyde) to form “unnatural” natural products with unprecedented skeletons, of which chaetoglines B and F are potently antibacterial with the latter inhibiting acetylcholinesterase. A gene-implied enzyme inhibition (GIEI) strategy has been introduced to address the key steps for PS product diversifications. In aggregation, the work designs and validates an innovative approach that can activate the PS reaction-based fungal biosynthetic machinery to produce unpredictable compounds of unusual and novel structure valuable for new biology and biomedicine. PMID:25425666

  4. Pictet-Spengler reaction-based biosynthetic machinery in fungi.

    PubMed

    Yan, Wei; Ge, Hui Ming; Wang, Gang; Jiang, Nan; Mei, Ya Ning; Jiang, Rong; Li, Sui Jun; Chen, Chao Jun; Jiao, Rui Hua; Xu, Qiang; Ng, Seik Weng; Tan, Ren Xiang

    2014-12-23

    The Pictet-Spengler (PS) reaction constructs plant alkaloids such as morphine and camptothecin, but it has not yet been noticed in the fungal kingdom. Here, a silent fungal Pictet-Spenglerase (FPS) gene of Chaetomium globosum 1C51 residing in Epinephelus drummondhayi guts is described and ascertained to be activable by 1-methyl-L-tryptophan (1-MT). The activated FPS expression enables the PS reaction between 1-MT and flavipin (fungal aldehyde) to form "unnatural" natural products with unprecedented skeletons, of which chaetoglines B and F are potently antibacterial with the latter inhibiting acetylcholinesterase. A gene-implied enzyme inhibition (GIEI) strategy has been introduced to address the key steps for PS product diversifications. In aggregation, the work designs and validates an innovative approach that can activate the PS reaction-based fungal biosynthetic machinery to produce unpredictable compounds of unusual and novel structure valuable for new biology and biomedicine. PMID:25425666

  5. Metabolic engineering of biosynthetic pathway for production of renewable biofuels.

    PubMed

    Singh, Vijai; Mani, Indra; Chaudhary, Dharmendra Kumar; Dhar, Pawan Kumar

    2014-02-01

    Metabolic engineering is an important area of research that involves editing genetic networks to overproduce a certain substance by the cells. Using a combination of genetic, metabolic, and modeling methods, useful substances have been synthesized in the past at industrial scale and in a cost-effective manner. Currently, metabolic engineering is being used to produce sufficient, economical, and eco-friendly biofuels. In the recent past, a number of efforts have been made towards engineering biosynthetic pathways for large scale and efficient production of biofuels from biomass. Given the adoption of metabolic engineering approaches by the biofuel industry, this paper reviews various approaches towards the production and enhancement of renewable biofuels such as ethanol, butanol, isopropanol, hydrogen, and biodiesel. We have also identified specific areas where more work needs to be done in the future.

  6. Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

    PubMed

    Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

    2013-11-01

    Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

  7. Resorbable biosynthetic mesh for crural reinforcement during hiatal hernia repair.

    PubMed

    Alicuben, Evan T; Worrell, Stephanie G; DeMeester, Steven R

    2014-10-01

    The use of mesh to reinforce crural closure during hiatal hernia repair is controversial. Although some studies suggest that using synthetic mesh can reduce recurrence, synthetic mesh can erode into the esophagus and in our opinion should be avoided. Studies with absorbable or biologic mesh have not proven to be of benefit for recurrence. The aim of this study was to evaluate the outcome of hiatal hernia repair with modern resorbable biosynthetic mesh in combination with adjunct tension reduction techniques. We retrospectively analyzed all patients who had crural reinforcement during repair of a sliding or paraesophageal hiatal hernia with Gore BioA resorbable mesh. Objective follow-up was by videoesophagram and/or esophagogastroduodenoscopy. There were 114 patients. The majority of operations (72%) were laparoscopic primary repairs with all patients receiving a fundoplication. The crura were closed primarily in all patients and reinforced with a BioA mesh patch. Excessive tension prompted a crural relaxing incision in four per cent and a Collis gastroplasty in 39 per cent of patients. Perioperative morbidity was minor and unrelated to the mesh. Median objective follow-up was one year, but 18 patients have objective follow-up at two or more years. A recurrent hernia was found in one patient (0.9%) three years after repair. The use of crural relaxing incisions and Collis gastroplasty in combination with crural reinforcement with resorbable biosynthetic mesh is associated with a low early hernia recurrence rate and no mesh-related complications. Long-term follow-up will define the role of these techniques for hiatal hernia repair.

  8. A tandem array of 5S ribosomal RNA genes in Pythium irregulare.

    PubMed

    Belkhiri, A; Intengan, H; Klassen, G R

    1997-02-28

    The 5S ribosomal RNA genes of the oomycete Pythium irregulare exist in tandem arrays unlinked to the rDNA repeat unit. A clone with a 9.2-kb insert containing an array of 5S genes was identified in a lambda genomic library and was characterized by restriction mapping and partial sequencing. The array consisted of 9 apparently identical 5S genes and their spacers in tandem, followed by a diverged 5S-like sequence that is likely to be a pseudogene. This gene arrangement, although almost universal in plants and animals, is rare in fungi and protists.

  9. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

    PubMed

    Hori, H; Osawa, S; Iwabuchi, M

    1980-12-11

    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

  10. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  11. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  12. A search for the Bs meson in Υ(5S) decays

    NASA Astrophysics Data System (ADS)

    Shipsey, Ian

    2004-05-01

    The CLEO III detector has recorded approximately 0.5 fb-1 of e^+ e^- annihilation data at the Υ(5S) resonance. Using this data sample, we have searched for fully reconstructed Bs mesons in the reaction Υ(5S) arrow B_s^(*) barB_s^(*)

  13. Discovery and characterization of Acanthamoeba castellanii mitochondrial 5S rRNA.

    PubMed

    Bullerwell, Charles E; Schnare, Murray N; Gray, Michael W

    2003-03-01

    Although 5S rRNA is a highly conserved and universal component of eubacterial, archaeal, chloroplast, and eukaryotic cytoplasmic ribosomes, a mitochondrial DNA-encoded 5S rRNA has so far been identified only in land plants and certain protists. This raises the question of whether 5S rRNA is actually required for and used in mitochondrial translation. In the protist Acanthamoeba castellanii, BLAST searches fail to reveal a 5S rRNA gene in the complete mitochondrial genome sequence, nor is a 5S-sized RNA species detectable in ethidium bromide-stained gels of highly purified mitochondrial RNA preparations. Here we show that an alternative visualization technique, UV shadowing, readily detects a novel, mitochondrion-specific small RNA in A. castellanii mitochondrial RNA preparations, and that this RNA species is, in fact, a 5S rRNA encoded by the A. castellanii mitochondrial genome. These results emphasize the need for caution when interpreting negative results that suggest the absence of 5S rRNA and/or a mitochondrial DNA-encoded 5S rRNA sequence in other (particularly protist) mitochondrial systems.

  14. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  15. Common biosynthetic origins for polycyclic tetramate macrolactams from phylogenetically diverse bacteria

    PubMed Central

    Blodgett, Joshua A. V.; Oh, Dong-Chan; Cao, Shugeng; Currie, Cameron R.; Kolter, Roberto; Clardy, Jon

    2010-01-01

    A combination of small molecule chemistry, biosynthetic analysis, and genome mining has revealed the unexpected conservation of polycyclic tetramate macrolactam biosynthetic loci in diverse bacteria. Initially our chemical analysis of a Streptomyces strain associated with the southern pine beetle led to the discovery of frontalamides A and B, two previously undescribed members of this antibiotic family. Genome analyses and genetic manipulation of the producing organism led to the identification of the frontalamide biosynthetic gene cluster and several biosynthetic intermediates. The biosynthetic locus for the frontalamides’ mixed polyketide/amino acid structure encodes a hybrid polyketide synthase nonribosomal peptide synthetase (PKS-NRPS), which resembles iterative enzymes known in fungi. No such mixed iterative PKS-NRPS enzymes have been characterized in bacteria. Genome-mining efforts revealed strikingly conserved frontalamide-like biosynthetic clusters in the genomes of phylogenetically diverse bacteria ranging from proteobacteria to actinomycetes. Screens for environmental actinomycete isolates carrying frontalamide-like biosynthetic loci led to the isolation of a number of positive strains, the majority of which produced candidate frontalamide-like compounds under suitable growth conditions. These results establish the prevalence of frontalamide-like gene clusters in diverse bacterial types, with medicinally important Streptomyces species being particularly enriched. PMID:20547882

  16. The 5S lean method as a tool of industrial management performances

    NASA Astrophysics Data System (ADS)

    Filip, F. C.; Marascu-Klein, V.

    2015-11-01

    Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

  17. Identifications of 5{{s}_{1/2}}-5{{p}_{3/2}} and 5{{s}^{2}}-5s5p EUV transitions of promethium-like Pt, Ir, Os and Re

    NASA Astrophysics Data System (ADS)

    Bekker, H.; Versolato, O. O.; Windberger, A.; Oreshkina, N. S.; Schupp, R.; Baumann, T. M.; Harman, Z.; Keitel, C. H.; Schmidt, P. O.; Ullrich, J.; Crespo López-Urrutia, J. R.

    2015-07-01

    We investigated Pm-, Nd-, and Pr-like spectra in the extreme ultra-violet region around 20 nm of Pt, Ir, Os, and Re (Z = 78-75) produced in the Heidelberg electron beam ion trap. Identification of the transitions was supported by several theoretical calculations, including collisional radiative modeling of the observed spectra. Special attention is given to the identifications of the alkaline-like 5{{s}1/2}-5{{p}3/2} resonance lines in promethium-like highly charged ions. Previous identifications of these lines have been tentative at best due to disagreements with theory and doubts about the experimental charge state identifications. Our experimental results for the 5{{s}1/2}-5{{p}3/2} wavelengths are accurate at the 0.005%-level. Understanding the level-structure of ions near the 4f-5s level crossing is of particular importance for future searches of a possible fine-structure constant variation, and new optical clocks.

  18. A retro-biosynthetic approach to the prediction of biosynthetic pathways from position-specific isotope analysis as shown for tramadol.

    PubMed

    Romek, Katarzyna M; Nun, Pierrick; Remaud, Gérald S; Silvestre, Virginie; Taïwe, Germain Sotoing; Lecerf-Schmidt, Florine; Boumendjel, Ahcène; De Waard, Michel; Robins, Richard J

    2015-07-01

    Tramadol, previously only known as a synthetic analgesic, has now been found in the bark and wood of roots of the African medicinal tree Nauclea latifolia. At present, no direct evidence is available as to the biosynthetic pathway of its unusual skeleton. To provide guidance as to possible biosynthetic precursors, we have adopted a novel approach of retro-biosynthesis based on the position-specific distribution of isotopes in the extracted compound. Relatively recent developments in isotope ratio monitoring by (13)C NMR spectrometry make possible the measurement of the nonstatistical position-specific natural abundance distribution of (13)C (δ(13)Ci) within the molecule with better than 1‰ precision. Very substantial variation in the (13)C positional distribution is found: between δ(13)Ci = -11 and -53‰. Distribution is not random and it is argued that the pattern observed can substantially be interpreted in relation to known causes of isotope fractionation in natural products. Thus, a plausible biosynthetic scheme based on sound biosynthetic principals of precursor-substrate relationships can be proposed. In addition, data obtained from the (18)O/(16)O ratios in the oxygen atoms of the compound add support to the deductions made from the carbon isotope analysis. This paper shows how the use of (13)C NMR at natural abundance can help with proposing a biosynthetic route to compounds newly found in nature or those difficult to tackle by conventional means.

  19. A retro-biosynthetic approach to the prediction of biosynthetic pathways from position-specific isotope analysis as shown for tramadol

    PubMed Central

    Romek, Katarzyna M.; Nun, Pierrick; Remaud, Gérald S.; Silvestre, Virginie; Taïwe, Germain Sotoing; Lecerf-Schmidt, Florine; Boumendjel, Ahcène; De Waard, Michel; Robins, Richard J.

    2015-01-01

    Tramadol, previously only known as a synthetic analgesic, has now been found in the bark and wood of roots of the African medicinal tree Nauclea latifolia. At present, no direct evidence is available as to the biosynthetic pathway of its unusual skeleton. To provide guidance as to possible biosynthetic precursors, we have adopted a novel approach of retro-biosynthesis based on the position-specific distribution of isotopes in the extracted compound. Relatively recent developments in isotope ratio monitoring by 13C NMR spectrometry make possible the measurement of the nonstatistical position-specific natural abundance distribution of 13C (δ13Ci) within the molecule with better than 1‰ precision. Very substantial variation in the 13C positional distribution is found: between δ13Ci = −11 and −53‰. Distribution is not random and it is argued that the pattern observed can substantially be interpreted in relation to known causes of isotope fractionation in natural products. Thus, a plausible biosynthetic scheme based on sound biosynthetic principals of precursor–substrate relationships can be proposed. In addition, data obtained from the 18O/16O ratios in the oxygen atoms of the compound add support to the deductions made from the carbon isotope analysis. This paper shows how the use of 13C NMR at natural abundance can help with proposing a biosynthetic route to compounds newly found in nature or those difficult to tackle by conventional means. PMID:26106160

  20. Chemical accessibility of the 4.5S RNA in spinach chloroplast ribosomes.

    PubMed Central

    Kumagai, I; Bartsch, M; Subramanian, A R; Erdmann, V A

    1983-01-01

    We have examined the accessibility to diethylpyrocarbonate of spinach chloroplast 4.5S ribosomal RNA when free and when it is part of the ribosomal structure. The modifications in free 4.5S RNA were found mostly in single-stranded regions of the secondary structure model proposed in our previous paper (Kumagai, I. et al. (1982) J.B.C. 257, 12924-28): adenines at positions 17, 19, 33, 36, 54, 55, 60, 64, 68, 72, 77, 86 and 87 were identified as the reactive residues. On the other hand, in 4.5S RNA in 70S ribosomes or 50S subunits, adenine 33 was exclusively modified, and its reactivity was much higher than in free 4.5S RNA. This highly accessible A33 of spinach 4.5S RNA is located within a characteristic seven nucleotide sequence, which is found in the 4.5S rRNAs from spinach, tobacco and a fern but deleted in 4.5S RNAs from maize and wheat. Images PMID:6828382

  1. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    SciTech Connect

    Hirose, Yutaka Harada, Fumio

    2008-01-04

    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus.

  2. Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

    PubMed Central

    Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B

    1978-01-01

    A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

  3. Abundant 5S rRNA-like transcripts encoded by the mitochondrial genome in amoebozoa.

    PubMed

    Bullerwell, Charles E; Burger, Gertraud; Gott, Jonatha M; Kourennaia, Olga; Schnare, Murray N; Gray, Michael W

    2010-05-01

    5S rRNAs are ubiquitous components of prokaryotic, chloroplast, and eukaryotic cytosolic ribosomes but are apparently absent from mitochondrial ribosomes (mitoribosomes) of many eukaryotic groups including animals and fungi. Nevertheless, a clearly identifiable, mitochondrion-encoded 5S rRNA is present in Acanthamoeba castellanii, a member of Amoebozoa. During a search for additional mitochondrial 5S rRNAs, we detected small abundant RNAs in other members of Amoebozoa, namely, in the lobose amoeba Hartmannella vermiformis and in the myxomycete slime mold Physarum polycephalum. These RNAs are encoded by mitochondrial DNA (mtDNA), cosediment with mitoribosomes in glycerol gradients, and can be folded into a secondary structure similar to that of bona fide 5S rRNAs. Further, in the mtDNA of another slime mold, Didymium nigripes, we identified a region that in sequence, potential secondary structure, and genomic location is similar to the corresponding region encoding the Physarum small RNA. A mtDNA-encoded small RNA previously identified in Dictyostelium discoideum is here shown to share several characteristics with known 5S rRNAs. Again, we detected genes encoding potential homologs of this RNA in the mtDNA of three other species of the genus Dictyostelium as well as in a related genus, Polysphondylium. Taken together, our results indicate a widespread occurrence of small, abundant, mtDNA-encoded RNAs with 5S rRNA-like structures that are associated with the mitoribosome in various amoebozoan taxa. Our working hypothesis is that these novel small abundant RNAs represent radically divergent mitochondrial 5S rRNA homologs. We posit that currently unrecognized 5S-like RNAs may exist in other mitochondrial systems in which a conventional 5S rRNA cannot be identified.

  4. Primary structure of the 5 S subunit of transcarboxylase as deduced from the genomic DNA sequence.

    PubMed

    Thornton, C G; Kumar, G K; Shenoy, B C; Haase, F C; Phillips, N F; Park, V M; Magner, W J; Hejlik, D P; Wood, H G; Samols, D

    1993-09-13

    Transcarboxylase from Propionibacterium shermanii is a complex biotin-containing enzyme composed of 30 polypeptides of three different types. It is composed of six dimeric outer subunits associated with a central cylindrical hexameric subunit through 12 biotinyl subunits; three outer subunits on each face of the central hexamer. Each outer dimer is termed a 5 S subunit which associates with two biotinyl subunits. The enzyme catalyzes a two-step reaction in which methylmalonyl-CoA and pyruvate form propionyl-CoA and oxalacetate, the 5 S subunit specifically catalyzing one of these reactions. We report here the cloning, sequencing and expression of the monomer of the 5 S subunit. The gene was identified by matching amino acid sequences derived from isolated authentic 5 S peptides with the deduced sequence of an open reading frame present on a cloned P. shermanii genomic fragment known to contain the gene encoding the 1.3 S biotinyl subunit. The cloned 5 S gene encodes a protein of 519 amino acids, M(r) 57,793. The deduced sequence shows regions of extensive homology with that of pyruvate carboxylase and oxalacetate decarboxylase, two enzymes which catalyze the same or reverse reaction. A fragment was subcloned into pUC19 in an orientation such that the 5 S open reading frame could be expressed from the lac promoter of the vector. Crude extracts prepared from these cells contained an immunoreactive band on Western blots which co-migrated with authentic 5 S and were fully active in catalyzing the 5 S partial reaction. We conclude that we have cloned, sequenced and expressed the monomer of the 5 S subunit and that the expressed product is catalytically active. PMID:8365490

  5. Evolution of the Isoprene Biosynthetic Pathway in Kudzu1[w

    PubMed Central

    Sharkey, Thomas D.; Yeh, Sansun; Wiberley, Amy E.; Falbel, Tanya G.; Gong, Deming; Fernandez, Donna E.

    2005-01-01

    Isoprene synthase converts dimethylallyl diphosphate, derived from the methylerythritol 4-phosphate (MEP) pathway, to isoprene. Isoprene is made by some plants in substantial amounts, which affects atmospheric chemistry, while other plants make no isoprene. As part of our long-term study of isoprene synthesis, the genetics of the isoprene biosynthetic pathway of the isoprene emitter, kudzu (Pueraria montana), was compared with similar genes in Arabidopsis (Arabidopsis thaliana), which does not make isoprene. The MEP pathway genes in kudzu were similar to the corresponding Arabidopsis genes. Isoprene synthase genes of kudzu and aspen (Populus tremuloides) were cloned to compare their divergence with the divergence seen in MEP pathway genes. Phylogenetic analysis of the terpene synthase gene family indicated that isoprene synthases are either within the monoterpene synthase clade or sister to it. In Arabidopsis, the gene most similar to isoprene synthase is a myrcene/ocimene (acyclic monoterpenes) synthase. Two phenylalanine residues found exclusively in isoprene synthases make the active site smaller than other terpene synthase enzymes, possibly conferring specificity for the five-carbon substrate rather than precursors of the larger isoprenoids. Expression of the kudzu isoprene synthase gene in Arabidopsis caused Arabidopsis to emit isoprene, indicating that whether or not a plant emits isoprene depends on whether or not it has a terpene synthase capable of using dimethylallyl diphosphate. PMID:15653811

  6. Overexpression of the riboflavin biosynthetic pathway in Pichia pastoris

    PubMed Central

    Marx, Hans; Mattanovich, Diethard; Sauer, Michael

    2008-01-01

    Background High cell density cultures of Pichia pastoris grown on methanol tend to develop yellow colored supernatants, attributed to the release of free flavins. The potential of P. pastoris for flavin overproduction is therefore given, but not pronounced when the yeast is grown on glucose. The aim of this study is to characterize the relative regulatory impact of each riboflavin synthesis gene. Deeper insight into pathway control and the potential of deregulation is established by overexpression of the single genes as well as a combined deregulation of up to all six riboflavin synthesis genes. Results Overexpression of the first gene of the riboflavin biosynthetic pathway (RIB1) is already sufficient to obtain yellow colonies and the accumulation of riboflavin in the supernatant of shake flask cultures growing on glucose. Sequential deregulation of all the genes, by exchange of their native promoter with the strong and constitutive glyceraldehyde-3-phosphate dehydrogenase promoter (PGAP) increases the riboflavin accumulation significantly. Conclusion The regulation of the pathway is distributed over more than one gene. High cell density cultivations of a P. pastoris strain overexpressing all six RIB genes allow the accumulation of 175 mg/L riboflavin in the supernatant. The basis for rational engineering of riboflavin production in P. pastoris has thus been established. PMID:18664246

  7. Translating biosynthetic gene clusters into fungal armor and weaponry

    PubMed Central

    Keller, Nancy P

    2015-01-01

    Filamentous fungi are renowned for the production of a diverse array of secondary metabolites (SMs) where the genetic material required for synthesis of a SM is typically arrayed in a biosynthetic gene cluster (BGC). These natural products are valued for their bioactive properties stemming from their functions in fungal biology, key among those protection from abiotic and biotic stress and establishment of a secure niche. The producing fungus must not only avoid self-harm from endogenous SMs but also deliver specific SMs at the right time to the right tissue requiring biochemical aid. This review highlights functions of BGCs beyond the enzymatic assembly of SMs, considering the timing and location of SM production and other proteins in the clusters that control SM activity. Specifically, self-protection is provided by both BGC-encoded mechanisms and non-BGC subcellular containment of toxic SM precursors; delivery and timing is orchestrated through cellular trafficking patterns and stress- and developmental-responsive transcriptional programs. PMID:26284674

  8. Reconstruction of cytosolic fumaric acid biosynthetic pathways in Saccharomyces cerevisiae

    PubMed Central

    2012-01-01

    Background Fumaric acid is a commercially important component of foodstuffs, pharmaceuticals and industrial materials, yet the current methods of production are unsustainable and ecologically destructive. Results In this study, the fumarate biosynthetic pathway involving reductive reactions of the tricarboxylic acid cycle was exogenously introduced in S. cerevisiae by a series of simple genetic modifications. First, the Rhizopus oryzae genes for malate dehydrogenase (RoMDH) and fumarase (RoFUM1) were heterologously expressed. Then, expression of the endogenous pyruvate carboxylase (PYC2) was up-regulated. The resultant yeast strain, FMME-001 ↑PYC2 + ↑RoMDH, was capable of producing significantly higher yields of fumarate in the glucose medium (3.18 ± 0.15 g liter-1) than the control strain FMME-001 empty vector. Conclusions The results presented here provide a novel strategy for fumarate biosynthesis, which represents an important advancement in producing high yields of fumarate in a sustainable and ecologically-friendly manner. PMID:22335940

  9. Expanding the product profile of a microbial alkane biosynthetic pathway.

    PubMed

    Harger, Matthew; Zheng, Lei; Moon, Austin; Ager, Casey; An, Ju Hye; Choe, Chris; Lai, Yi-Ling; Mo, Benjamin; Zong, David; Smith, Matthew D; Egbert, Robert G; Mills, Jeremy H; Baker, David; Pultz, Ingrid Swanson; Siegel, Justin B

    2013-01-18

    Microbially produced alkanes are a new class of biofuels that closely match the chemical composition of petroleum-based fuels. Alkanes can be generated from the fatty acid biosynthetic pathway by the reduction of acyl-ACPs followed by decarbonylation of the resulting aldehydes. A current limitation of this pathway is the restricted product profile, which consists of n-alkanes of 13, 15, and 17 carbons in length. To expand the product profile, we incorporated a new part, FabH2 from Bacillus subtilis , an enzyme known to have a broader specificity profile for fatty acid initiation than the native FabH of Escherichia coli . When provided with the appropriate substrate, the addition of FabH2 resulted in an altered alkane product profile in which significant levels of n-alkanes of 14 and 16 carbons in length are produced. The production of even chain length alkanes represents initial steps toward the expansion of this recently discovered microbial alkane production pathway to synthesize complex fuels. This work was conceived and performed as part of the 2011 University of Washington international Genetically Engineered Machines (iGEM) project.

  10. Detection of photoactive siderophore biosynthetic genes in the marine environment.

    PubMed

    Gärdes, Astrid; Triana, Christopher; Amin, Shady A; Green, David H; Romano, Ariel; Trimble, Lyndsay; Carrano, Carl J

    2013-06-01

    Iron is an essential element for oceanic microbial life but its low bioavailability limits microorganisms in large areas of the oceans. To acquire this metal many marine bacteria produce organic chelates that bind and transport iron (siderophores). While it has been hypothesized that the global production of siderophores by heterotrophic bacteria and some cyanobacteria constitutes the bulk of organic ligands binding iron in the ocean because stability constants of siderophores and these organic ligands are similar, and because ligand concentrations rise sharply in response to iron fertilization events, direct evidence for this proposal is lacking. This lack is due to the difficulty in characterizing these ligands due both to their extremely low concentrations and their highly heterogeneous nature. The situation for characterizing photoactive siderophores in situ is more problematic because of their expected short lifetimes in the photic zone. An alternative approach is to make use of high sensitivity molecular technology (qPCR) to search for siderophore biosynthesis genes related to the production of photoactive siderophores. In this way one can access their "biochemical potential" and utilize this information as a proxy for the presence of these siderophores in the marine environment. Here we show, using qPCR primers designed to detect biosynthetic genes for the siderophores vibrioferrin, petrobactin and aerobactin that such genes are widespread and based on their abundance, the "biochemical potential" for photoactive siderophore production is significant. Concurrently we also briefly examine the microbial biodiversity responsible for such production as a function of depth and location across a North Atlantic transect.

  11. Angular distribution of Xe 5s. -->. epsilonp photoelectrons: Disagreement between experiment and theory

    SciTech Connect

    Fahlman, A.; Carlson, T.A.; Krause, M.O.

    1983-04-11

    The angular asymmetry parameter ..beta.. for the Xe 5s..-->..epsilonp photoelectrons has been studied with use of synchrotron radiation (h..nu.. = 28--65 eV). The present results show that the relativistic random-phase approximation theory does not satisfactorily describe the Xe 5s photoionization process close to the Cooper minimum and thus require a renewed theoretical approach. The 5s partial photoionization cross section was obtained over the same photon region and the results agree with experimental values found in the literature.

  12. Abridged 5S rDNA units in sea beet (Beta vulgaris subsp. maritima).

    PubMed

    Turner, Daniel J; Brown, Terence A

    2005-04-01

    Amplification by polymerase chain reaction of the 5S rDNA repeat units of Beta vulgaris subsp. maritima resulted in a 350-bp product corresponding to the full-length 5S unit, but also revealed 4 abridged unit classes, each with a deletion that removed most of the spacer and 12-76 bp of the coding sequence. Each abridged type lacks at least 1 of the conserved elements involved in transcription of the 5S gene, and so appear to be nonfunctional. Network analysis revealed that the abridged units are evolving in the same manner as the full-length versions.

  13. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  14. Nanolipoprotein particles comprising a natural rubber biosynthetic enzyme complex and related products, methods and systems

    DOEpatents

    Hoeprich, Paul D.; Whalen, Maureen

    2016-04-05

    Provided herein are nanolipoprotein particles that comprise a biosynthetic enzyme more particularly an enzyme capable of catalyzing rubber or other rubbers polymerization, and related assemblies, devices, methods and systems.

  15. Coordinated regulation of biosynthetic and regulatory genes coincides with anthocyanin accumulation in developing eggplant fruit

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Violet to black pigmentation of eggplant (Solanum melongena) fruit is attributed to anthocyanin accumulation. Model systems support the interaction of biosynthetic and regulatory genes for anthocyanin biosynthesis. Anthocyanin structural gene transcription requires the expression of at least one m...

  16. Biosynthetic Pathway for Mannopeptimycins, Lipoglycopeptide Antibiotics Active against Drug-Resistant Gram-Positive Pathogens

    PubMed Central

    Magarvey, Nathan A.; Haltli, Brad; He, Min; Greenstein, Michael; Hucul, John A.

    2006-01-01

    The mannopeptimycins are a novel class of lipoglycopeptide antibiotics active against multidrug-resistant pathogens with potential as clinically useful antibacterials. This report is the first to describe the biosynthesis of this novel class of mannosylated lipoglycopeptides. Included here are the cloning, sequencing, annotation, and manipulation of the mannopeptimycin biosynthetic gene cluster from Streptomyces hygroscopicus NRRL 30439. Encoded by genes within the mannopeptimycin biosynthetic gene cluster are enzymes responsible for the generation of the hexapeptide core (nonribosomal peptide synthetases [NRPS]) and tailoring reactions (mannosylation, isovalerylation, hydroxylation, and methylation). The NRPS system is noncanonical in that it has six modules utilizing only five amino acid-specific adenylation domains and it lacks a prototypical NRPS macrocyclizing thioesterase domain. Analysis of the mannopeptimycin gene cluster and its engineering has elucidated the mannopeptimycin biosynthetic pathway and provides the framework to make new and improved mannopeptimycins biosynthetically. PMID:16723579

  17. Pressure broadening and line shifting of atomic strontium 5s{sup 2} {sup 1}S{sub 0}{yields}5s5p {sup 3}P{sub 1} and 5s5p {sup 3}P{sub 0,1,2}{yields}5s6s {sup 3}S{sub 1} absorption transitions induced by noble-gas collisions

    SciTech Connect

    Holtgrave, Jeremy C.; Wolf, Paul J.

    2005-07-15

    The broadening and shifting of spectral lines induced by collisions with the five noble gases in both the intercombination 5s{sup 2} {sup 1}S{sub 0}{yields}5s5p {sup 3}P{sub 1} system and the triplet 5s5p {sup 3}P{sub 0,1,2}{yields}5s6s {sup 3}S{sub 1} manifold of Sr are studied using tunable dye laser absorption spectroscopy. Cross sections for impact broadening and line shifting are determined from an examination of the spectral line profiles. These results are utilized in an analysis to compute difference potentials modeled by the Lennard-Jones (6-12) potential and the coefficients C{sub 6} and C{sub 12} derived from this analysis are reported.

  18. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    NASA Technical Reports Server (NTRS)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  19. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  20. 104. JOB NO. 1347F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    104. JOB NO. 1347-F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD MOTOR COMPANY; LONGITUDINAL SECTION AND TRUSS DETAILS - Ford Motor Company Long Beach Assembly Plant, Assembly Building, 700 Henry Ford Avenue, Long Beach, Los Angeles County, CA

  1. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

    PubMed

    MacKay, R M; Gray, M W; Doolittle, W F

    1980-11-11

    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.

  2. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    PubMed

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p< 0.001). After the implementation of 5S it was observed and determined that facilitating the job and setting up a safe environment created

  3. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    PubMed

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p< 0.001). After the implementation of 5S it was observed and determined that facilitating the job and setting up a safe environment created

  4. Single cell genome amplification accelerates identification of the apratoxin biosynthetic pathway from a complex microbial assemblage.

    PubMed

    Grindberg, Rashel V; Ishoey, Thomas; Brinza, Dumitru; Esquenazi, Eduardo; Coates, R Cameron; Liu, Wei-ting; Gerwick, Lena; Dorrestein, Pieter C; Pevzner, Pavel; Lasken, Roger; Gerwick, William H

    2011-04-12

    Filamentous marine cyanobacteria are extraordinarily rich sources of structurally novel, biomedically relevant natural products. To understand their biosynthetic origins as well as produce increased supplies and analog molecules, access to the clustered biosynthetic genes that encode for the assembly enzymes is necessary. Complicating these efforts is the universal presence of heterotrophic bacteria in the cell wall and sheath material of cyanobacteria obtained from the environment and those grown in uni-cyanobacterial culture. Moreover, the high similarity in genetic elements across disparate secondary metabolite biosynthetic pathways renders imprecise current gene cluster targeting strategies and contributes sequence complexity resulting in partial genome coverage. Thus, it was necessary to use a dual-method approach of single-cell genomic sequencing based on multiple displacement amplification (MDA) and metagenomic library screening. Here, we report the identification of the putative apratoxin. A biosynthetic gene cluster, a potent cancer cell cytotoxin with promise for medicinal applications. The roughly 58 kb biosynthetic gene cluster is composed of 12 open reading frames and has a type I modular mixed polyketide synthase/nonribosomal peptide synthetase (PKS/NRPS) organization and features loading and off-loading domain architecture never previously described. Moreover, this work represents the first successful isolation of a complete biosynthetic gene cluster from Lyngbya bouillonii, a tropical marine cyanobacterium renowned for its production of diverse bioactive secondary metabolites.

  5. Interaction of Xenopus TFIIIC with the TFIIIA.5 S RNA gene complex.

    PubMed

    Keller, H J; Romaniuk, P J; Gottesfeld, J M

    1992-09-01

    The general transcription factor TFIIIC is necessary for transcription initiation by RNA polymerase III. TFIIIC binds predominantly to the B-Block promoter element, which is present in tRNA genes, several viral RNA genes and repetitive DNA elements, and to the TFIIIA.DNA complex on 5 S RNA genes. Here we report a characterization of Xenopus laevis TFIIIC and its interaction with the TFIIIA.5 S RNA gene complex. A polypeptide with apparent molecular mass of 85 kDa was specifically cross-linked to a B-Block oligonucleotide by UV light. This polypeptide was present in the partially purified TFIIIC fraction and in a complex with a B-Block double-stranded oligonucleotide isolated by nondenaturing gel electrophoresis. TFIIIC.TFIIIA.DNA gel mobility shift complexes were obtained using B-Block DNA affinity-purified TFIIIC and buffer conditions employing low Mg2+ (1 mM) and high dithiothreitol (7 mM) concentrations. Three TFIIIC.TFIIIA.5 S RNA gene complexes were observed by gel mobility shift analysis. One of these complexes was resistant to dissociation by the addition of competing DNA, but the formation of all three complexes was prevented by the inclusion of excess specific competitor DNA in the initial binding reactions. The apparent affinity of TFIIIC for the TFIIIA.5 S DNA complex was 5-fold higher for the somatic-type 5 S RNA gene than for the oocyte-type 5 S RNA gene. Mutations near the 5' boundary of the TFIIIA binding site alter the DNase I footprint of the TFIIIA.DNA complex and reduce the affinity of TFIIIA-mutant 5 S gene complexes for TFIIIC. Differences in TFIIIC affinity for the two classes of 5 S RNA genes may play a role in the developmental regulation of these gene families. PMID:1517247

  6. Satellite DNA derived from 5S rDNA in Physalaemus cuvieri (Anura, Leiuperidae).

    PubMed

    Vittorazzi, S E; Lourenço, L B; Del-Grande, M L; Recco-Pimentel, S M

    2011-01-01

    In the present study, we describe for the first time a family of 190-bp satellite DNA related to 5S rDNA in anurans and the existence of 2 forms of 5S rDNA, type I (201 bp) and type II (690 bp). The sequences were obtained from genomic DNA of Physalaemus cuvieri from Palmeiras, State of Bahia, Brazil. Analysis of the nucleotide sequence revealed that the satellite DNA obtained by digestion with EcoRI, called PcP190EcoRI, is 70% similar to the coding region of type I 5S rDNA and 66% similar to the coding region of type II 5S rDNA. Membrane hybridization and PCR amplification of the sequence showed that PcP190EcoRI is tandemly repeated. The satellite DNA as well as type I and type II 5S rDNA were localized in P. cuvieri chromosomes by fluorescent in situ hybridization. The PcP190EcoRI sequence was found in the centromeres of chromosomes 1-5 and in the pericentromeric region of chromosome 3. Type I 5S rDNA was detected in chromosome 3, coincident with the site of PcP190EcoRI. Type II 5S rDNA was located interstitially in the long arm of chromosome 5. None of these sequences co-localized with nucleolar organizer regions. Our data suggests that this satellite DNA originates from the 5S ribosomal multigene family, probably by gene duplication, nucleotide divergence and sequence dispersion in the genome.

  7. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  8. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  9. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  10. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    PubMed

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production.

  11. One-stage surgery through posterior approach-for L5-S1 spondyloptosis

    PubMed Central

    Suslu, Hikmet Turan; Celikoglu, Erhan; Borekcı, Ali; Hıcdonmez, Tufan; Suslu, Hüsnü

    2011-01-01

    Grade 5 spondylolisthesis or spondyloptosis is a rare condition. Generally, the surgical management of spondyloptosis includes multi-staged procedures instead of one-staged procedures. One-stage treatment for spondyloptosis is very rare. A 15-year-old girl with L5-S1 spondyloptosis was admitted with severe low back pain. There was no history of trauma. The patient underwent L5 laminectomy, L5-S1 discectomy, resection of sacral dome, reduction, L3-L4-L5-S1 pedicular screw fixation, and interbody-posterolateral fusion through the posterior approach. The reduction was maintained with bilateral L5-S1 discectomy, resection of the sacral dome, and transpedicular instrumentation from L3 to S1. In this particular case, one-staged approach was adequate for the treatment of L5-S1 spondyloptosis. One-staged surgery using the posterior approach may be adequate for the treatment of L5-S1 spondyloptosis while avoiding the risks inherent in anterior approaches. PMID:23125496

  12. Direct 5S rRNA Assay for Monitoring Mixed-Culture Bioprocesses

    PubMed Central

    Stoner, D. L.; Browning, C. K.; Bulmer, D. K.; Ward, T. E.; MacDonell, M. T.

    1996-01-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species extracted from collected biomass. Separation is based on the unique migration behavior of each 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the genera Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. PMID:16535333

  13. Calcemic Fraction-A: Biosynthetic Peptide Precursor of Parathyroid Hormone

    PubMed Central

    Cohn, David V.; Macgregor, Ronal R.; Chu, Luke L. H.; Kimmel, Joe R.; Hamilton, James W.

    1972-01-01

    Calcemic fraction-A (CF-A) is a biologically active, hypercalcemic and bone resorptive peptide, which was detected in, and isolated from, bovine parathyroid glands [Hamilton et al. (1971) Endocrinology 89, 1440-1447]. It has been further purified, and its relationship to parathyroid hormone clarified. The peptide is present in fresh glands at a concentration of about 3 μg/g (parathyroid hormone, 100 μg/g). It contains 109 amino acids (hormone, 84), each of which is present in equal or greater molar ratio than in the hormone. Its molecular weight, calculated from amino-acid composition, is 12,144; determined by dodecyl sulfate-polyacrylamide gel electrophoresis, it is 12,500 (hormone, 9563). Per mole, it reacts with antiserum to parathyroid hormone to an extent of 7-10% that of the hormone, and is about 50% as active in its hypercalcemic and bone resorptive properties in the appropriate assays. Time course and pulse-chase experiments with parathyroid gland slices, in which the incorporation of amino acid into isolated peptide and hormone were measured, indicate that the hormone is made from a protein precursor; the patterns of incorporation of radioactivity are those that would be predicted from a precursor-product relationship. When the large peptide was incubated with parathyroid gland extracts it was partially converted to a molecule that appeared to be the hormone, as based upon its coelution with marker hormone from ion-exchange columns. Finally, tryptic digestion of the peptide increased the immunoreactivity of the sample in accord with the known greater immunoreactivity of the hormone than the peptide. On the basis of these results, it is proposed that the peptide is a biosynthetic precursor of the hormone in bovine parathyroid gland. PMID:4504366

  14. The Magnesium Branch of the Tetrapyrrole Biosynthetic Pathway

    SciTech Connect

    Beale, S. I.

    2004-05-11

    It should be noted that the focus of the research changed somewhat during the course of the current award. The initial focus is indicated by the title of the current grant, ''The Magnesium Branch of the Chlorophyll Biosynthetic Pathway''. During the current grant period, Dr. Robert Willows, a postdoctoral associate, joined the faculty of McQuarie University in Australia. When he left my lab, we decided that he should independently pursue research on structure/function relationships in Mg chelatase and that our laboratories would collaborate on regulatory studies of this enzyme. Also, during the current award period, I began collaborating with Dr. Ariane Atteia and Mr. Robert van Lis, who were at the time located at the Autonomous University of Mexico. Dr. Atteia has since joined my laboratory and Mr. van Lis will also do so when he obtains his Ph.D. in the near future. These individuals bring to the laboratory their interests and expertise in the respiratory components of Chlamydomonas and their desire to become experts in tetrapyrrole metabolism. Recently, in a collaboration with Dr. David Bollivar, a former postdoctoral associate who is now at Illinois Wesleyan University, and Dr. Caroline Walker, who was at Clemson University but has since left this research area, we recently made a major breakthrough on the oxygen-independent cyclase reaction, which has now become an important component of the current proposal. Finally, our research on phycobilin biosynthesis in Synechucystis has revealed that this organism can grow at very low oxygen concentrations and its genome contains several genes that may encode for enzymes that catalyze alternative oxygen-independent reactions for tetrapyrrole biosynthesis, so characterizing the genes, their enzymes, and regulation of expression have also become parts of the current proposal.

  15. Saturation Mutagenesis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Smith, Maria W.; Meskauskas, Arturas; Wang, Pinger; Sergiev, Petr V.; Dinman, Jonathan D.

    2001-01-01

    rRNAs are the central players in the reactions catalyzed by ribosomes, and the individual rRNAs are actively involved in different ribosome functions. Our previous demonstration that yeast 5S rRNA mutants (called mof9) can impact translational reading frame maintenance showed an unexpected function for this ubiquitous biomolecule. At the time, however, the highly repetitive nature of the genes encoding rRNAs precluded more detailed genetic and molecular analyses. A new genetic system allows all 5S rRNAs in the cell to be transcribed from a small, easily manipulated plasmid. The system is also amenable for the study of the other rRNAs, and provides an ideal genetic platform for detailed structural and functional studies. Saturation mutagenesis reveals regions of 5S rRNA that are required for cell viability, translational accuracy, and virus propagation. Unexpectedly, very few lethal alleles were identified, demonstrating the resilience of this molecule. Superimposition of genetic phenotypes on a physical map of 5S rRNA reveals the existence of phenotypic clusters of mutants, suggesting that specific regions of 5S rRNA are important for specific functions. Mapping these mutants onto the Haloarcula marismortui large subunit reveals that these clusters occur at important points of physical interaction between 5S rRNA and the different functional centers of the ribosome. Our analyses lead us to propose that one of the major functions of 5S rRNA may be to enhance translational fidelity by acting as a physical transducer of information between all of the different functional centers of the ribosome. PMID:11713264

  16. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  17. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    PubMed

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit. PMID:27106499

  18. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    PubMed

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis.

  19. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    PubMed

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  20. Direct 5S rRNA assay for monitoring mixed-culture bioprocesses

    SciTech Connect

    Stoner, D.L.; Bulmer, D.K.; Ward, T.E.

    1996-06-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis in denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the general Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. 40 refs., 12 figs., 1 tab.

  1. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    PubMed

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

  2. Affinity chromatography of Drosophila melanogaster ribosomal proteins to 5S rRNA.

    PubMed

    Stark, B C; Chooi, W Y

    1985-02-20

    The binding of Drosophila melanogaster ribosomal proteins to D. melanogaster 5S rRNA was studied using affinity chromatography of total ribosomal proteins (TP80) on 5S rRNA linked via adipic acid dihydrazide to Sepharose 4B. Ribosomal proteins which bound 5S rRNA at 0.3 M potassium chloride and were eluted at 1 M potassium chloride were identified as proteins 1, L4, 2/3, L14/L16, and S1, S2, S3, S4, S5, by two-dimensional polyacrylamide gel electrophoresis. Using poly A-Sepharose 4B columns as a model of non-specific binding, we found that a subset of TP80 proteins is also bound. This subset, while containing some of the proteins bound by 5S rRNA columns, was distinctly different from the latter subset, indicating that the binding to 5S rRNA was specific for that RNA species. PMID:3923010

  3. 5 S and 5.8 S ribosomal RNA sequences and protist phylogenetics.

    PubMed

    Walker, W F

    1985-01-01

    More than 100 5 S 5.8 S rRNA sequences from protists, including fungi, are known. Through a combination of quantitative treeing and special consideration of "signature' nucleotide combinations, the most significant phylogenetic implications of these data are emphasized. Also, limitations of the data for phylogenetic inferences are discussed and other significant data are brought to bear on the inferences obtained. 5 S sequences from red algae are seen as the most isolated among eukaryotics. A 5 S sequence lineage consisting of oomycetes, euglenoids, most protozoa, most slime molds and perhaps dinoflagellates and mesozoa is defined. Such a lineage is not evident from 5.8 S rRNA or cytochrome c sequence data. 5 S sequences from Ascomycota and Basidiomycota are consistent with the proposal that each is derived from a mycelial form with a haploid yeast phase and simple septal pores, probably most resembling present Taphrinales. 5 S sequences from Chytridiomycota and Zygomycota are not clearly distinct from each other and suggest that a major lineage radiation occurred in the early history of each. Qualitative biochemical data clearly supports a dichotomy between an Ascomycota-Basidiomycota lineage and a Zygomycota-Chytridiomycota lineage.

  4. Diversity of 5S rRNA genes within individual prokaryotic genomes.

    PubMed

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V; Parsons, Tamasha; Yang, Liying; Gerz, Erika A; Lee, Peng; Xiang, Charlie; Nossa, Carlos W; Pei, Zhiheng

    2012-10-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1161 genomes from 779 unique species, 96 species exhibited > 3% diversity. Twenty-seven species with > 10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) of the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there are tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level.

  5. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    NASA Technical Reports Server (NTRS)

    Luehrsen, K. R.; Fox, G. E.

    1981-01-01

    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  6. Characterization of the L4-L5-S1 motion segment using the stepwise reduction method.

    PubMed

    Jaramillo, Héctor Enrique; Puttlitz, Christian M; McGilvray, Kirk; García, José J

    2016-05-01

    The two aims of this study were to generate data for a more accurate calibration of finite element models including the L5-S1 segment, and to find mechanical differences between the L4-L5 and L5-S1 segments. Then, the range of motion (ROM) and facet forces for the L4-S1 segment were measured using the stepwise reduction method. This consists of sequentially testing and reducing each segment in nine stages by cutting the ligaments, facet capsules, and removing the nucleus. Five L4-S1 human segments (median: 65 years, range: 53-84 years, SD=11.0 years) were loaded under a maximum pure moment of 8Nm. The ROM was measured using stereo-photogrammetry via tracking of three markers and the facet contact forces (CF) were measured using a Tekscan system. The ROM for the L4-L5 segment and all stages showed good agreement with published data. The major differences in ROM between the L4-L5 and L5-S1 segments were found for lateral bending and all stages, for which the L4-L5 ROM was about 1.5-3 times higher than that of the L5-S1 segment, consistent with L5-S1 facet CF about 1.3 to 4 times higher than those measured for the L4-L5 segment. For the other movements and few stages, the L4-L5 ROM was significantly lower that of the L5-S1 segment. ROM and CF provide important baseline data for more accurate calibration of FE models and to understand the role that their structures play in lower lumbar spine mechanics.

  7. Characterization of the L4-L5-S1 motion segment using the stepwise reduction method.

    PubMed

    Jaramillo, Héctor Enrique; Puttlitz, Christian M; McGilvray, Kirk; García, José J

    2016-05-01

    The two aims of this study were to generate data for a more accurate calibration of finite element models including the L5-S1 segment, and to find mechanical differences between the L4-L5 and L5-S1 segments. Then, the range of motion (ROM) and facet forces for the L4-S1 segment were measured using the stepwise reduction method. This consists of sequentially testing and reducing each segment in nine stages by cutting the ligaments, facet capsules, and removing the nucleus. Five L4-S1 human segments (median: 65 years, range: 53-84 years, SD=11.0 years) were loaded under a maximum pure moment of 8Nm. The ROM was measured using stereo-photogrammetry via tracking of three markers and the facet contact forces (CF) were measured using a Tekscan system. The ROM for the L4-L5 segment and all stages showed good agreement with published data. The major differences in ROM between the L4-L5 and L5-S1 segments were found for lateral bending and all stages, for which the L4-L5 ROM was about 1.5-3 times higher than that of the L5-S1 segment, consistent with L5-S1 facet CF about 1.3 to 4 times higher than those measured for the L4-L5 segment. For the other movements and few stages, the L4-L5 ROM was significantly lower that of the L5-S1 segment. ROM and CF provide important baseline data for more accurate calibration of FE models and to understand the role that their structures play in lower lumbar spine mechanics. PMID:27017302

  8. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    NASA Technical Reports Server (NTRS)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  9. Strong nondipole effect created by multielectron correlation in 5s photoionization of xenon

    SciTech Connect

    Ricz, S.; Koever, A.; Varga, D.; Ricsoka, T.; Sankari, R.; Jurvansuu, M.; Nikkinen, J.; Aksela, H.; Aksela, S.

    2003-01-01

    The angular distribution of the Xe 5s photoelectrons was measured in the 90-225 eV photon energy range using linearly polarized synchrotron radiation. The experimentally determined angular distribution parameters were compared with theoretical values obtained from calculations based on the random-phase approximation and the time-dependent density-functional theory. Experiment shows that the dipole ({beta}) and nondipole ({gamma}) parameters vary strongly as a function of the photon energy, in accordance with calculations that account for the interchannel coupling. Nondipole effects observed clearly in experiment confirm the role of multielectron correlation in describing the 5s photoionization of Xe far from the ionization threshold.

  10. The radiative lifetime of the 5S(0)2 metastable level of O(2+)

    NASA Technical Reports Server (NTRS)

    Johnson, B. C.; Smith, P. L.; Knight, R. D.

    1984-01-01

    The radiative lifetime of the 5S(0)2 metastable level of O(2+) was measured as 1.22 + or - 0.08 ms at the 90 percent confidence level by observing the time dependence of the spontaneous emission from metastable ions created and stored in a cylindrical radio-frequency ion trap. The intersystem line emission 2s(2)2p(2) 3P - 2s2p(3) 5S(0) was observed at 1660.8 and 1666.2 A. Discrepancies between measured and calculated values indicate that certain calculated transition probabilities for intersystem lines may be less reliable than previously believed.

  11. The nucleotide sequences of 5S rRNAs from three ciliated protozoa.

    PubMed Central

    Kumazaki, T; Hori, H; Osawa, S; Mita, T; Higashinakagawa, T

    1982-01-01

    The nucleotide sequences of 5S rRNAs from three ciliated protozoa, Paramecium tetraurelia, Tetrahymena thermophila and Blepharisma japonicum have been determined. All of them are 120 nucleotides long and the sequence of probable tRNA binding site of position 41-44 is GAAC which is characteristic of the plant 5S rRNAs. The sequence similarity percents are 87% (Paramecium/Tetrahymena), 86% (Paramecium/Blepharisma) and 79% (Tetrahymena/Blepharisma), suggesting a close relationship of these three ciliates. PMID:7122243

  12. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON QSAR

    EPA Science Inventory

    Dyer, S.D., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to predict HC5's Based on QSARs (Abstract). To be presented at the SETAC Europe 14th Annual Meeting: Environmental Science Solution: A Pan-European Perspective, 18-...

  13. Nucleotide sequences of 5S rRNAs from four jellyfishes.

    PubMed

    Hori, H; Ohama, T; Kumazaki, T; Osawa, S

    1982-11-25

    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica.

  14. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON MINIMAL DATA

    EPA Science Inventory

    Dyer, S., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to Predict HC5's Based on Minimal Data (Abstract). To be presented at the SETAC Fourth World Congress, 14-18 November 2004, Portland, OR. 1 p. (ERL,GB R1013).

  15. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules

    PubMed Central

    Valach, Matus; Burger, Gertraud; Gray, Michael W.; Lang, B. Franz

    2014-01-01

    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator. PMID:25429974

  16. Molecular organization of the 5S rDNA gene type II in elasmobranchs

    PubMed Central

    Castro, Sergio I.; Hleap, Jose S.; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    ABSTRACT The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS. PMID:26488198

  17. The 5-S RNA . protein complex from an extreme halophile, Halobacterium cutirubrum. Purification and characterization.

    PubMed

    Smith, N; Matheson, A T; Yaguchi, M; Willick, G E; Nazar, R N

    1978-09-01

    A 5-S RNA . protein complex has been isolated from the 50-S ribosomal subunit of an extreme halophile, Halobacterium cutirubrum. The 50-S ribosomal subunit from the extreme halophile requires 3.4 M K+ and 100 mM Mg2+ for stability. However, if the high K+ concentration is maintained but the Mg2+ concentration lowered to 0.3 mM, the 5-S RNA . protein complex is selectively extracted from the subunit. After being purified on an Agarose 0.5-m column the complex had a molecular weight of about 80000 and contained 5-S RNA and two proteins, HL13 and HL19, with molecular weights (by sedimentation equilibrium) of 18700 and 18000, respectively. No ATPase or GTPase activity could be detected in the 5-S RNA . protein complex. The amino acid composition and electrophoretic mobility on polyacrylamide gels indicated both proteins were much more acidic than the equivalent from Escherichia coli or Bacillus stearothermophilus. Partial amino acid sequence data suggest HL13 is homologous to EL18 and HL19 to EL5.

  18. Characterization of Ffh of Mycobacterium tuberculosis and its interaction with 4.5S RNA.

    PubMed

    Palaniyandi, Kannan; Veerasamy, Malini; Narayanan, Sujatha

    2012-10-12

    Signal recognition particle (SRP) mediates targeting of proteins to appropriate cellular compartments, which is an important process in all living organisms. In prokaryotes, SRP consists of Ffh, a protein, and 4.5S RNA that recognizes signal peptide emerging from ribosomes. The SRP (Ffh) of one the most successful intracellular pathogen, Mycobacterium tuberculosis, has been investigated with respect to biochemical properties. In the present study, Ffh of M. tuberculosis was overexpressed and was confirmed to be a GTPase using thin layer chromatography and malachite green assay. The GTP binding ability was confirmed by GTP overlay assay. The 4.5S RNA sequence of M. tuberculosis was synthesized by in vitro transcription assay. The interaction between Ffh and 4.5S RNA was confirmed by overlay assay and RNA gel shift assay. The results show that the biochemical properties of M. tuberculosis Ffh have been conserved, and this is the first report that shows the interaction of components of SRP in M. tuberculosis, namely Ffh protein and 4.5S RNA.

  19. 10. GIRDER APPROACH ON YORKTOWN SIDE, SHOWING PIERS 8S5S (LEFT ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. GIRDER APPROACH ON YORKTOWN SIDE, SHOWING PIERS 8S-5S (LEFT TO RIGHT), AND FLOORBEAM/STRINGER SYSTEM. VIEW LOOKING NORTH. - George P. Coleman Memorial Bridge, Spanning York River at U.S. Route 17, Yorktown, York County, VA

  20. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules.

    PubMed

    Valach, Matus; Burger, Gertraud; Gray, Michael W; Lang, B Franz

    2014-12-16

    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator.

  1. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    PubMed

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.

  2. Nucleolar association and transcriptional inhibition through 5S rDNA in mammals.

    PubMed

    Fedoriw, Andrew M; Starmer, Joshua; Yee, Della; Magnuson, Terry

    2012-01-01

    Changes in the spatial positioning of genes within the mammalian nucleus have been associated with transcriptional differences and thus have been hypothesized as a mode of regulation. In particular, the localization of genes to the nuclear and nucleolar peripheries is associated with transcriptional repression. However, the mechanistic basis, including the pertinent cis- elements, for such associations remains largely unknown. Here, we provide evidence that demonstrates a 119 bp 5S rDNA can influence nucleolar association in mammals. We found that integration of transgenes with 5S rDNA significantly increases the association of the host region with the nucleolus, and their degree of association correlates strongly with repression of a linked reporter gene. We further show that this mechanism may be functional in endogenous contexts: pseudogenes derived from 5S rDNA show biased conservation of their internal transcription factor binding sites and, in some cases, are frequently associated with the nucleolus. These results demonstrate that 5S rDNA sequence can significantly contribute to the positioning of a locus and suggest a novel, endogenous mechanism for nuclear organization in mammals.

  3. Relativistic effects on interchannel coupling in atomic photoionization: The photoelectron angular distribution of Xe 5s

    SciTech Connect

    Hemmers, O.; Manson, S. T.; Sant'Anna, M. M.; Focke, P.; Wang, H.; Sellin, I. A.; Lindle, D. W.

    2001-08-01

    Measurements of the photoelectron angular-distribution asymmetry parameter {beta} for Xe 5s photoionization have been performed in the 80--200 eV photon-energy region. The results show a substantial deviation from the nonrelativistic value of {beta}=2 and provide a clear signature of significant relativistic effects in interchannel coupling.

  4. 12. PIERS 5S AND 4S, SHOWING TRANSITION AT 4S FROM ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. PIERS 5S AND 4S, SHOWING TRANSITION AT 4S FROM GIRDER SPAN TO 'SUSPENDED' TRUSS SPAN AT U0. VIEW LOOKING WEST. - George P. Coleman Memorial Bridge, Spanning York River at U.S. Route 17, Yorktown, York County, VA

  5. An efficient synthetic approach to 6,5'-(S)- and 6,5'-(R)-cyclouridine.

    PubMed

    Theile, Christopher S; McLaughlin, Larry W

    2012-06-01

    Here we present new routes for the efficient syntheses of 6,5'-(S)- and 6,5'-(R)-cyclouridine. The syntheses utilize readily accessible uridine as a starting material. This route to the R diastereomer is significantly more efficient than previous synthetic efforts, allowing us to obtain large amounts of pure material for future biological testing.

  6. Nucleotide sequences of 5S rRNAs from four jellyfishes.

    PubMed

    Hori, H; Ohama, T; Kumazaki, T; Osawa, S

    1982-11-25

    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica. PMID:6130512

  7. Adaptation of the S-5-S pendulum seismometer for measurement of rotational ground motion

    NASA Astrophysics Data System (ADS)

    Knejzlík, Jaromír; Kaláb, Zdeněk; Rambouský, Zdeněk

    2012-10-01

    The Russian electrodynamic seismometer model S-5-S has been adapted for the measurement of rotational ground motion. The mechanical system of the original S-5-S seismometer consists of electrodynamic sensing and damping transducer coils mounted on an asymmetrical double-arm pendulum. This pendulum is suspended on a footing using two pairs of crossed flat springs, which operate as the axis of rotation. The pendulum is stabilised by an additional spring. The S-5-S can be used either as a vertical or as a horizontal sensor. The adaptation of the S-5-S seismometer described below involves removal of the additional spring and installation of an additional mass on the damping arm. Strain gauge angle sensors are installed on one pair of the crossed flat springs. The main dynamic parameters of the rotational seismometer created in this way, i.e. the natural period and damping, are controlled electronically by feedback currents proportional to the angular displacement and angular velocity, both fed to the damping transducer coil. This new seismometer, named the S-5-SR, enables measurement of the rotational component of ground motion around the horizontal or the vertical axes. The output signal from this S-5-SR seismometer can be proportional either to rotational displacement or rotational velocity.

  8. Biosynthesis of resorcylic acid lactone (5S)-5-hydroxylasiodiplodin in Lasiodiplodia theobromae.

    PubMed

    Kashima, Takasumi; Takahashi, Kosaku; Matsuura, Hideyuki; Nabeta, Kensuke

    2009-11-01

    An administration study of (2)H-labeled precursors showed that the 9-hydroxydecanoyl unit, the acyl intermediate of lasiodiplodin (1), was also the intermediate of (5S)-5-hydroxylasiodiplodin (2) in Lasiodiplodia theobromae. The incorporation of [O-methyl-(2)H(3)]-lasiodiplodin (6) into 2 indicated that hydroxylation at C-5 occurred after cyclization. PMID:19897901

  9. Photodissociation dynamics of superexcited O2: Dissociation channels O(5S) vs. O(3S)

    NASA Astrophysics Data System (ADS)

    Zhou, Yiyong; Meng, Qingnan; Mo, Yuxiang

    2014-07-01

    The photodissociation dynamics of O2, O2 + hυ → O(3P) + O(2p3(4S)3s, 3S/5S), has been studied by combining the XUV laser pump / UV laser probe and velocity map imaging methods in the photon energy range 14.64-15.20 eV. The fragment yield spectra of O(3S) and O(5S) and their velocity map images have been recorded using the state-selective (1+1) REMPI method to detect the fragments. The fragment yield spectra show resolved fine structure that arises from the predissociated Rydberg states I, I' and I″ (3ΠΩ = 0,1,2). The branching ratios between the two decay channels have been measured by one-photon ionization of the fragments O(3S) and O(5S) simultaneously. It is surprising to find that the dissociation cross sections for the production of O(5S) are larger than, or comparable to, those of O(3S) for the I and I' states, while the cross sections for the production of O(5S) are smaller than those of O(3S) for the I″ state. All fragments O(5S) arise from perpendicular transitions, which provides direct experimental evidence about the symmetry assignments of the states I, I' and I″ excited in this energy region. Although most of the fragments O(3S) arise from perpendicular transitions, some of them are from parallel transitions. Based on the calculated ab initio potential energy curves, we propose that the neutral dissociation into O(3P) + O(3S) occurs mainly via the interaction of the Rydberg states I, I', and I″ with the vibrational continuum of the diabatic 83Πu state (1π _u^{ - 1} (a^4 {Π}_u {)3}sσ _g ,^3 Π_u), while the neutral dissociation into O(3P) + O(5S) occurs mainly via the interaction of Rydberg states I, I', and I″ with the diabatic 73Πu (1π _g^{ - 1} (X^2 {Π}_g {)3}p{σ }_u ,^3 Π_u).

  10. Discovery of Unclustered Fungal Indole Diterpene Biosynthetic Pathways through Combinatorial Pathway Reassembly in Engineered Yeast.

    PubMed

    Tang, Man-Cheng; Lin, Hsiao-Ching; Li, Dehai; Zou, Yi; Li, Jian; Xu, Wei; Cacho, Ralph A; Hillenmeyer, Maureen E; Garg, Neil K; Tang, Yi

    2015-11-01

    The structural diversity and biological activities of fungal indole diterpenes (IDTs) are generated in large part by the IDT cyclases (IDTCs). Identifying different IDTCs from IDT biosynthetic pathways is therefore important toward understanding how these enzymes introduce chemical diversity from a common linear precursor. However, IDTCs involved in the cyclization of the well-known aflavinine subgroup of IDTs have not been discovered. Here, using Saccharomyces cerevisiae as a heterologous host and a phylogenetically guided enzyme mining approach, we combinatorially assembled IDT biosynthetic pathways using IDTCs homologues identified from different fungal hosts. We identified the genetically standalone IDTCs involved in the cyclization of aflavinine and anominine and produced new IDTs not previously isolated. The cyclization mechanisms of the new IDTCs were proposed based on the yeast reconstitution results. Our studies demonstrate heterologous pathway assembly is a useful tool in the reconstitution of unclustered biosynthetic pathways.

  11. Localization and interactions between Arabidopsis auxin biosynthetic enzymes in the TAA/YUC-dependent pathway.

    PubMed

    Kriechbaumer, Verena; Botchway, Stanley W; Hawes, Chris

    2016-07-01

    The growth regulator auxin is involved in all key developmental processes in plants. A complex network of a multiplicity of potential biosynthetic pathways as well as transport, signalling plus conjugation and deconjugation lead to a complex and multifaceted system system for auxin function. This raises the question how such a system can be effectively organized and controlled. Here we report that a subset of auxin biosynthetic enzymes in the TAA/YUC route of auxin biosynthesis is localized to the endoplasmic reticulum (ER). ER microsomal fractions also contain a significant percentage of auxin biosynthetic activity. This could point toward a model of auxin function using ER membrane location and subcellular compartmentation for supplementary layers of regulation. Additionally we show specific protein-protein interactions between some of the enzymes in the TAA/YUC route of auxin biosynthesis. PMID:27208541

  12. Use of a biosynthetic intermediate to explore the chemical diversity of pseudo-natural fungal polyketides

    NASA Astrophysics Data System (ADS)

    Asai, Teigo; Tsukada, Kento; Ise, Satomi; Shirata, Naoki; Hashimoto, Makoto; Fujii, Isao; Gomi, Katsuya; Nakagawara, Kosuke; Kodama, Eiichi N.; Oshima, Yoshiteru

    2015-09-01

    The structural complexity and diversity of natural products make them attractive sources for potential drug discovery, with their characteristics being derived from the multi-step combination of enzymatic and non-enzymatic conversions of intermediates in each biosynthetic pathway. Intermediates that exhibit multipotent behaviour have great potential for use as starting points in diversity-oriented synthesis. Inspired by the biosynthetic pathways that form complex metabolites from simple intermediates, we developed a semi-synthetic process that combines heterologous biosynthesis and artificial diversification. The heterologous biosynthesis of fungal polyketide intermediates led to the isolation of novel oligomers and provided evidence for ortho-quinonemethide equivalency in their isochromene form. The intrinsic reactivity of the isochromene polyketide enabled us to access various new chemical entities by modifying and remodelling the polyketide core and through coupling with indole molecules. We thus succeeded in generating exceptionally diverse pseudo-natural polyketides through this process and demonstrated an advanced method of using biosynthetic intermediates.

  13. Assembly of a novel biosynthetic pathway for production of the plant flavonoid fisetin in Escherichia coli.

    PubMed

    Stahlhut, Steen G; Siedler, Solvej; Malla, Sailesh; Harrison, Scott J; Maury, Jérôme; Neves, Ana Rute; Forster, Jochen

    2015-09-01

    Plant secondary metabolites are an underutilized pool of bioactive molecules for applications in the food, pharma and nutritional industries. One such molecule is fisetin, which is present in many fruits and vegetables and has several potential health benefits, including anti-cancer, anti-viral and anti-aging activity. Moreover, fisetin has recently been shown to prevent Alzheimer's disease in mice and to prevent complications associated with diabetes type I. Thus far the biosynthetic pathway of fisetin in plants remains elusive. Here, we present the heterologous assembly of a novel fisetin pathway in Escherichia coli. We propose a novel biosynthetic pathway from the amino acid, tyrosine, utilizing nine heterologous enzymes. The pathway proceeds via the synthesis of two flavanones never produced in microorganisms before--garbanzol and resokaempferol. We show for the first time a functional biosynthetic pathway and establish E. coli as a microbial platform strain for the production of fisetin and related flavonols.

  14. Transcription factor IIIA induced bending of the Xenopus somatic 5S gene promoter.

    PubMed

    Schroth, G P; Cook, G R; Bradbury, E M; Gottesfeld, J M

    1989-08-10

    Transcription factor IIIA (TFIIIA), the canonical zinc-finger protein, is a protein of relative molecular mass 39,000 (39K) that is required for transcription of 5S-ribosomal subunit genes in Xenopus. It binds in a sequence-specific manner to the internal control region of the 5S gene (see Fig. 1) and facilitates transcription of the gene by RNA polymerase III. It also binds to the 5S gene product to form a 7S ribonucleoprotein particle. In oocytes the 7S particle acts as a storage form of the RNA to be utilized later in development. TFIIIA binds to DNA through its 30 K N-terminal domain, which contains nine zinc-fingers. TFIIIA was the first protein described to have this type of DNA binding motif, but numerous other proteins have now been shown to have zinc-finger domains. A structure for a single zinc-finger from the yeast protein ADR1, was recently proposed based on two-dimensional NMR data (ref. 8), and a similar structure was proposed based on comparison with crystal structures of other metalloproteins. Although models for the interaction of TFIIIA with the 5S-ribosomal gene DNA have been proposed, based on nuclease digestion and methylation interference data, little precise structural information is available for TFIIIA and the physical basis for the interaction of zinc-fingers with DNA is not understood. Using both circular permutation and circularization assays we provide convincing biochemical evidence that TFIIIA bends the DNA at the internal promoter of the 5S gene.

  15. Ultraviolet damage and nucleosome folding of the 5S ribosomal RNA gene.

    SciTech Connect

    Liu, X; Mann, David B.; Suquet, C; Springer, David L. ); Smerdon, Michael J.

    2000-01-25

    The Xenopus borealis somatic 5S ribosomal RNA gene was used as a model system to determine the mutual effects of nucleosome folding and formation of ultraviolet (UV) photoproducts (primarily cis-syn cyclobutane pyrimidine dimers, or CPDs) in chromatin. We analyzed the preferred rotational and translational settings of 5S rDNA on the histone octamer surface after induction of up to 0.8 CPD/nucleosome core (2.5 kJ/m(2) UV dose). DNase I and hydroxyl radical footprints indicate that UV damage at these levels does not affect the average rotational setting of the 5S rDNA molecules. Moreover, a combination of nuclease trimming and restriction enzyme digestion indicates the preferred translational positions of the histone octamer are not affected by this level of UV damage. We also did not observe differences in the UV damage patterns of irradiated 5S rDNA before or after nucleosome formation, indicating there is little difference in the inhibition of nucleosome folding by specific CPD sites in the 5S rRNA gene. Conversely, nucleosome folding significantly restricts CPD formation at all sites in the three helical turns of the nontranscribed strand located in the dyad axis region of the nucleosome, where DNA is bound exclusively by the histone H3-H4 tetramer. Finally, modulation of the CPD distribution in a 14 nt long pyrimidine tract correlates with its rotational setting on the histone surface, when the strong sequence bias for CPD formation in this tract is minimized by normalization. These results help establish the mutual roles of histone binding and UV photoproducts on their formation in chromatin.

  16. Comprehensive curation and analysis of fungal biosynthetic gene clusters of published natural products.

    PubMed

    Li, Yong Fuga; Tsai, Kathleen J S; Harvey, Colin J B; Li, James Jian; Ary, Beatrice E; Berlew, Erin E; Boehman, Brenna L; Findley, David M; Friant, Alexandra G; Gardner, Christopher A; Gould, Michael P; Ha, Jae H; Lilley, Brenna K; McKinstry, Emily L; Nawal, Saadia; Parry, Robert C; Rothchild, Kristina W; Silbert, Samantha D; Tentilucci, Michael D; Thurston, Alana M; Wai, Rebecca B; Yoon, Yongjin; Aiyar, Raeka S; Medema, Marnix H; Hillenmeyer, Maureen E; Charkoudian, Louise K

    2016-04-01

    Microorganisms produce a wide range of natural products (NPs) with clinically and agriculturally relevant biological activities. In bacteria and fungi, genes encoding successive steps in a biosynthetic pathway tend to be clustered on the chromosome as biosynthetic gene clusters (BGCs). Historically, "activity-guided" approaches to NP discovery have focused on bioactivity screening of NPs produced by culturable microbes. In contrast, recent "genome mining" approaches first identify candidate BGCs, express these biosynthetic genes using synthetic biology methods, and finally test for the production of NPs. Fungal genome mining efforts and the exploration of novel sequence and NP space are limited, however, by the lack of a comprehensive catalog of BGCs encoding experimentally-validated products. In this study, we generated a comprehensive reference set of fungal NPs whose biosynthetic gene clusters are described in the published literature. To generate this dataset, we first identified NCBI records that included both a peer-reviewed article and an associated nucleotide record. We filtered these records by text and homology criteria to identify putative NP-related articles and BGCs. Next, we manually curated the resulting articles, chemical structures, and protein sequences. The resulting catalog contains 197 unique NP compounds covering several major classes of fungal NPs, including polyketides, non-ribosomal peptides, terpenoids, and alkaloids. The distribution of articles published per compound shows a bias toward the study of certain popular compounds, such as the aflatoxins. Phylogenetic analysis of biosynthetic genes suggests that much chemical and enzymatic diversity remains to be discovered in fungi. Our catalog was incorporated into the recently launched Minimum Information about Biosynthetic Gene cluster (MIBiG) repository to create the largest known set of fungal BGCs and associated NPs, a resource that we anticipate will guide future genome mining and

  17. Plug-and-Play Benzylisoquinoline Alkaloid Biosynthetic Gene Discovery in Engineered Yeast.

    PubMed

    Morris, J S; Dastmalchi, M; Li, J; Chang, L; Chen, X; Hagel, J M; Facchini, P J

    2016-01-01

    Benzylisoquinoline alkaloid (BIA) metabolism has been the focus of a considerable research effort over the past half-century, primarily because of the pharmaceutical importance of several compounds produced by opium poppy (Papaver somniferum). Advancements in genomics technologies have substantially accelerated the rate of gene discovery over the past decade, such that most biosynthetic enzymes involved in the formation of the major alkaloids of opium poppy have now been isolated and partially characterized. Not unexpectedly, the availability of all perceived biosynthetic genes has facilitated the reconstitution of several BIA pathways in microbial hosts, including yeast (Saccharomyces cerevisiae). Product yields are currently insufficient to consider the commercial production of high-value BIAs, such as morphine. However, the rudimentary success demonstrated by the uncomplicated and routine assembly of a multitude of characterized BIA biosynthetic genes provides a valuable gene discovery tool for the rapid functional identification of the plethora of gene candidates available through increasingly accessible genomic, transcriptomic, and proteomic databases. BIA biosynthetic gene discovery represents a substantial research opportunity largely owing to the wealth of existing enzyme data mostly obtained from a single plant species. Functionally novel enzymes and variants with potential metabolic engineering applications can be considered the primary targets. Selection of candidates from sequence repositories is facilitated by the monophyletic relationship among biosynthetic genes belonging to a wide range of enzyme families, such as the numerous cytochromes P450 and AdoMet-dependent O- and N-methyltransferases that operate in BIA metabolism. We describe methods for the rapid functional screening of uncharacterized gene candidates encoding potential BIA biosynthetic enzymes using yeast strains engineered to perform selected metabolic conversions. As an initial

  18. Human Genetic Disorders Caused by Mutations in Genes Encoding Biosynthetic Enzymes for Sulfated Glycosaminoglycans*

    PubMed Central

    Mizumoto, Shuji; Ikegawa, Shiro; Sugahara, Kazuyuki

    2013-01-01

    A number of genetic disorders are caused by mutations in the genes encoding glycosyltransferases and sulfotransferases, enzymes responsible for the synthesis of sulfated glycosaminoglycan (GAG) side chains of proteoglycans, including chondroitin sulfate, dermatan sulfate, and heparan sulfate. The phenotypes of these genetic disorders reflect disturbances in crucial biological functions of GAGs in human. Recent studies have revealed that mutations in genes encoding chondroitin sulfate and dermatan sulfate biosynthetic enzymes cause various disorders of connective tissues. This minireview focuses on growing glycobiological studies of recently described genetic diseases caused by disturbances in biosynthetic enzymes for sulfated GAGs. PMID:23457301

  19. Effects of overexpressing individual lignin biosynthetic enzymes on feeding and growth of corn earworms and fall armyworms

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lignin is an important insect resistance component of plants. Enhancing or disrupting the lignin biosynthetic pathway for different bioenergy uses may alter pest resistance. The lignin biosynthetic pathway is complex, and a number of pathway compounds are also involved in the biosynthesis of simpler...

  20. Complete Genome Sequence of the Filamentous Fungus Aspergillus westerdijkiae Reveals the Putative Biosynthetic Gene Cluster of Ochratoxin A

    PubMed Central

    Chakrabortti, Alolika; Li, Jinming

    2016-01-01

    Ochratoxin A (OTA) is a common mycotoxin that contaminates food and agricultural products. Sequencing of the complete genome of Aspergillus westerdijkiae, a major producer of OTA, reveals more than 50 biosynthetic gene clusters, including a putative OTA biosynthetic gene cluster that encodes a dozen of enzymes, transporters, and regulatory proteins. PMID:27635003

  1. Complete Genome Sequence of the Filamentous Fungus Aspergillus westerdijkiae Reveals the Putative Biosynthetic Gene Cluster of Ochratoxin A.

    PubMed

    Chakrabortti, Alolika; Li, Jinming; Liang, Zhao-Xun

    2016-01-01

    Ochratoxin A (OTA) is a common mycotoxin that contaminates food and agricultural products. Sequencing of the complete genome of Aspergillus westerdijkiae, a major producer of OTA, reveals more than 50 biosynthetic gene clusters, including a putative OTA biosynthetic gene cluster that encodes a dozen of enzymes, transporters, and regulatory proteins. PMID:27635003

  2. Three-step laser excitation of the odd-parity 5s5d 3D → 5s nf 3F states of cadmium

    NASA Astrophysics Data System (ADS)

    Nadeem, Ali; Shah, M.; Haq, S. U.; Shahzada, S.; Mumtaz, M.; Waheed, A.; Nawaz, M.; Ahmed, M.; Baig, M. A.

    2014-07-01

    We report new experimental data on the term energies and effective quantum numbers of the highly excited odd parity states of cadmium in the 71 773-72 500 cm-1 energy range. The experiment was performed using three dye lasers simultaneously pumped by the second harmonic (532 nm) of the Nd;YAG laser. The vapor containment and detection system was a thermionic diode ion detector working in a space charge limited mode. The new observations include the 5snf3F3 (12 ⩽ n ⩽ 52), 5snf3F4 (13 ⩽ n ⩽ 33) and 5snf3F2 (12 ⩽ n ⩽ 22) Rydberg series excited from the 5s5d3D multiplet. A two parameter fit to the transitions energies of the 5snf3F3 series yields the binding energy of the 5snd 2D2 level as 13 042.178 ± 0.02 cm-1 and consequently the first ionization of cadmium is determined as 72 540.05 ± 0.13 cm-1, which is in good agreement with the previously reported value.

  3. Accumulation of Rutin and Betulinic Acid and Expression of Phenylpropanoid and Triterpenoid Biosynthetic Genes in Mulberry (Morus alba L.).

    PubMed

    Zhao, Shicheng; Park, Chang Ha; Li, Xiaohua; Kim, Yeon Bok; Yang, Jingli; Sung, Gyoo Byung; Park, Nam Il; Kim, Soonok; Park, Sang Un

    2015-09-30

    Mulberry (Morus alba L.) is used in traditional Chinese medicine and is the sole food source of the silkworm. Here, 21 cDNAs encoding phenylpropanoid biosynthetic genes and 21 cDNAs encoding triterpene biosynthetic genes were isolated from mulberry. The expression levels of genes involved in these biosynthetic pathways and the accumulation of rutin, betulin, and betulinic acid, important secondary metabolites, were investigated in different plant organs. Most phenylpropanoid and triterpene biosynthetic genes were highly expressed in leaves and/or fruit, and most genes were downregulated during fruit ripening. The accumulation of rutin was more than fivefold higher in leaves than in other organs, and higher levels of betulin and betulinic acid were found in roots and leaves than in fruit. By comparing the contents of these compounds with gene expression levels, we speculate that MaUGT78D1 and MaLUS play important regulatory roles in the rutin and betulin biosynthetic pathways.

  4. Nucleotide excision repair of the 5 S ribosomal RNA gene assembled into a nucleosome.

    PubMed

    Liu, X; Smerdon, M J

    2000-08-01

    A-175-base pair fragment containing the Xenopus borealis somatic 5 S ribosomal RNA gene was used as a model system to determine the effect of nucleosome assembly on nucleotide excision repair (NER) of the major UV photoproduct (cyclobutane pyrimidine dimer (CPD)) in DNA. Xenopus oocyte nuclear extracts were used to carry out repair in vitro on reconstituted, positioned 5 S rDNA nucleosomes. Nucleosome structure strongly inhibits NER at many CPD sites in the 5 S rDNA fragment while having little effect at a few sites. The time course of CPD removal at 35 different sites indicates that >85% of the CPDs in the naked DNA fragment have t(12) values <2 h, whereas <26% of the t(12) values in nucleosomes are <2 h, and 15% are >8 h. Moreover, removal of histone tails from these mononucleosomes has little effect on the repair rates. Finally, nucleosome inhibition of repair shows no correlation with the rotational setting of a 14-nucleotide-long pyrimidine tract located 30 base pairs from the nucleosome dyad. These results suggest that inhibition of NER by mononucleosomes is not significantly influenced by the rotational orientation of CPDs on the histone surface, and histone tails play little (or no) role in this inhibition. PMID:10821833

  5. Analysis of a 5S rRNA gene cloned from Euplotes eurstomus

    SciTech Connect

    Roberson, A.E.; Wolffe, A.; Olins, D.E.

    1987-05-01

    The macronucleus of the hypotrichous ciliated protozoan Euplotes eurystomus lends itself to the study of eukaryotic gene and chromatin structure because native macronuclear DNA exists as linear, gene-sized fragments between 400 and 20,000 bp in length. The macronuclear chromatin, while arranged in a typical nucleosomal structure, is freely soluble in low ionic strength buffers without treatment by nucleases. Thus, specific genes may be enriched as native, intact chromatin molecules. The 5S rRNA gene from Euplotes has been cloned to facilitate investigation of 5S gene-chromatin following characterization of the gene at the DNA level. It has been demonstrated that the gene, while in circular or linear form, can be transcribed in vitro by a Xenopus oocyte nuclear extract. The transcript generated in vitro is 120 nucleotides in length and is synthesized by RNA polymerase III. Anti-Xenopus TFIIIA antibodies recognize a Euplotes macronuclear chromatin-associated protein which is approx. 80 KD in size. It has been established that the sequence of the telomere flanking the 5S gene in Euplotes eurystomus is the same telomeric sequence published for Euplotes aediculatus.

  6. Heterologous stable expression of terpenoid biosynthetic genes using the moss Physcomitrella patens.

    PubMed

    Bach, Søren Spanner; King, Brian Christopher; Zhan, Xin; Simonsen, Henrik Toft; Hamberger, Björn

    2014-01-01

    Heterologous and stable expression of genes encoding terpenoid biosynthetic enzymes in planta is an important tool for functional characterization and is an attractive alternative to expression in microbial hosts for biotechnological production. Despite improvements to the procedure, such as streamlining of large scale Agrobacterium infiltration and upregulation of the upstream pathways, transient in planta heterologous expression quickly reaches limitations when used for production of terpenoids. Stable integration of transgenes into the nuclear genome of the moss Physcomitrella patens has already been widely recognized as a viable alternative for industrial-scale production of biopharmaceuticals. For expression of terpenoid biosynthetic genes, and reconstruction of heterologous pathways, Physcomitrella has unique attributes that makes it a very promising biotechnological host. These features include a high native tolerance to terpenoids, a simple endogenous terpenoid profile, convenient genome editing using homologous recombination, and cultivation techniques that allow up-scaling from single cells in microtiter plates to industrial photo-bioreactors. Beyond its use for functional characterization of terpenoid biosynthetic genes, engineered Physcomitrella can be a green biotechnological platform for production of terpenoids. Here, we describe two complementary and simple procedures for stable nuclear transformation of Physcomitrella with terpenoid biosynthetic genes, selection and cultivation of transgenic lines, and metabolite analysis of terpenoids produced in transgenic moss lines. We also provide tools for metabolic engineering through genome editing using homologous recombination. PMID:24777804

  7. Asymmetric Total Syntheses of (+)- and (−)-Versicolamide B and Biosynthetic Implications

    PubMed Central

    Miller, Kenneth A.; Tsukamoto, Sachiko; Williams, Robert M.

    2010-01-01

    The Diels-Alder reaction is one of the most well-studied, synthetically useful organic transformations. While a significant number of naturally occurring substances are postulated to arise by biosynthetic Diels-Alder reactions, rigorous confirmation of a mechanistically distinct natural Diels-Alderase enzyme remains elusive. Within this context, several related fungi within the Aspergillus genus produce a number of metabolites of opposite absolute configuration including (+)- or (−)-versicolamide B. These alkaloids are hypothesized to arise via biosynthetic Diels-Alder reactions implying that each Aspergillus species possesses enantiomerically distinct Diels-Alderases. Herein, experimental validation of these biosynthetic proposals via deployment of the IMDA reaction as a key step in the asymmetric total syntheses of (+)- and (−)-versicolamide B is described. Laboratory validation of the proposed biosynthetic Diels-Alder construction, coupled with the secondary metabolite profile of the producing fungi, reveals that each Aspergillus species has evolved enantiomerically distinct indole oxidases, as well as enantiomerically distinct Diels-Alderases. PMID:20300443

  8. Sugars as the optimal biosynthetic carbon substrate of aqueous life throughout the universe

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    2000-01-01

    Our previous analysis of the energetics of metabolism showed that both the biosynthesis of amino acids and lipids from sugars, and the fermentation of organic substrates, were energetically driven by electron transfer reactions resulting in carbon redox disproportionation (Weber, 1997). Redox disproportionation--the spontaneous (energetically favorable) direction of carbon group transformation in biosynthesis--is brought about and driven by the energetically downhill transfer of electron pairs from more oxidized carbon groups (with lower half-cell reduction potentials) to more reduced carbon groups (with higher half-cell reduction potentials). In this report, we compare the redox and kinetic properties of carbon groups in order to evaluate the relative biosynthetic capability of organic substrates, and to identify the optimal biosubstrate. This analysis revealed that sugars (monocarbonyl alditols) are the optimal biosynthetic substrate because they contain the maximum number of biosynthetically useful high energy electrons/carbon atom while still containing a single carbonyl group needed to kinetically facilitate their conversion to useful biosynthetic intermediates. This conclusion applies to aqueous life throughout the Universe because it is based on invariant aqueous carbon chemistry--primarily, the universal reduction potentials of carbon groups.

  9. Sugars as the Optimal Biosynthetic Carbon Substrate of Aqueous Life throughout the Universe

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1999-01-01

    Our previous analysis of the energetics of metabolism showed that both the biosynthesis of amino acids and lipids from sugars, and the fermentation of organic substrates, were energetically driven by electron transfer reactions resulting in carbon redox disproportionation (Weber 1997). Redox disproportionation -- the spontaneous (energetically favorable) direction of carbon group transformation in biosynthesis -- is brought about and driven by the energetically downhill transfer of electron pairs from more oxidized carbon groups (with lower half-cell reduction potentials) to more reduced carbon groups (with higher half-cell reduction potentials). In this report, we compare the redox and kinetic properties of carbon groups in order to evaluate the relative biosynthetic capability of organic substrates, and to identify the optimal biosubstrate. This analysis revealed that sugars (monocarbonyl alditols) are the optimal biosynthetic substrate because they contain the maximum number of biosynthetically useful .high energy electrons/carbon atom , while still containing a single carbonyl group needed to kinetically facilitate their conversion to useful biosynthetic intermediates. This conclusion applies to aqueous life throughout the Universe because it is based on invariant aqueous carbon chemistry -- primarily, the universal reduction potentials of carbon groups.

  10. The use of Fusarium secondary metabolite biosynthetic genes in chemotypic and phylogenetic studies.

    PubMed

    Stępień, Lukasz

    2014-05-01

    Fusarium genus contains a large number of species which occur in all climate zones and are pathogenic to agriculturally important crops. The majority of the species produce secondary metabolites, many of which are toxic to plants, animals and humans. The core biosynthetic genes display conserved organization (gene clusters), and a common expression pattern due to synchronized regulation. Although broadly specified enzymatic activities are present in different metabolic paths, the reactions catalyzed by those are limited to a specific step and no compensation effect is observed when the essential gene from one of the clusters is disrupted. Still, inter- and intraspecific diversity of the core biosynthetic genes is consistently higher than that of housekeeping genes, even though the biochemical specificity is maintained. Thus, the core biosynthetic genes of known sequence and structure emerge as good targets for designing tools aimed at the discrimination of closely related (and economically important) Fusarium species. The review covers the present and potential use of sequence analysis and biosynthetic gene-derived molecular markers as applied to taxonomic and chemotype studies, utilizing both toxic (fumonisins, trichothecenes, zearalenone, fusaric acid, fusarins, enniatins and beauvericin) and nontoxic (bikaverin) metabolites produced by Fusarium fungi. PMID:23465044

  11. Diversity in Biosynthetic Pathways of Galactolipids in the Light of Endosymbiotic Origin of Chloroplasts.

    PubMed

    Sato, Naoki; Awai, Koichiro

    2016-01-01

    Cyanobacteria and chloroplasts perform oxygenic photosynthesis, and share a common origin. Galactolipids are present in the photosynthetic membranes of both cyanobacteria and chloroplasts, but the biosynthetic pathways of the galactolipids are significantly different in the two systems. In this minireview, we explain the history of the discovery of the cyanobacterial pathway, and present a probable scenario of the evolution of the two pathways.

  12. Sugars as the optimal biosynthetic carbon substrate of aqueous life throughout the universe.

    PubMed

    Weber, A L

    2000-02-01

    Our previous analysis of the energetics of metabolism showed that both the biosynthesis of amino acids and lipids from sugars, and the fermentation of organic substrates, were energetically driven by electron transfer reactions resulting in carbon redox disproportionation (Weber, 1997). Redox disproportionation--the spontaneous (energetically favorable) direction of carbon group transformation in biosynthesis--is brought about and driven by the energetically downhill transfer of electron pairs from more oxidized carbon groups (with lower half-cell reduction potentials) to more reduced carbon groups (with higher half-cell reduction potentials). In this report, we compare the redox and kinetic properties of carbon groups in order to evaluate the relative biosynthetic capability of organic substrates, and to identify the optimal biosubstrate. This analysis revealed that sugars (monocarbonyl alditols) are the optimal biosynthetic substrate because they contain the maximum number of biosynthetically useful high energy electrons/carbon atom while still containing a single carbonyl group needed to kinetically facilitate their conversion to useful biosynthetic intermediates. This conclusion applies to aqueous life throughout the Universe because it is based on invariant aqueous carbon chemistry--primarily, the universal reduction potentials of carbon groups.

  13. The oxalic acid biosynthetic activity of Burkholderia mallei is encoded by a single locus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Although it is known that oxalic acid provides a selective advantage to the secreting microbe, our understanding of how this acid is biosynthesized remains incomplete. This study reports the identification, cloning, and partial characterization of the oxalic acid biosynthetic enzyme from the animal ...

  14. Dual biosynthetic pathways to phytosterol via cycloartenol and lanosterol in Arabidopsis

    PubMed Central

    Ohyama, Kiyoshi; Suzuki, Masashi; Kikuchi, Jun; Saito, Kazuki; Muranaka, Toshiya

    2009-01-01

    The differences between the biosynthesis of sterols in higher plants and yeast/mammals are believed to originate at the cyclization step of oxidosqualene, which is cyclized to cycloartenol in higher plants and lanosterol in yeast/mammals. Recently, lanosterol synthase genes were identified from dicotyledonous plant species including Arabidopsis, suggesting that higher plants possess dual biosynthetic pathways to phytosterols via lanosterol, and through cycloartenol. To identify the biosynthetic pathway to phytosterol via lanosterol, and to reveal the contributions to phytosterol biosynthesis via each cycloartenol and lanosterol, we performed feeding experiments by using [6-13C2H3]mevalonate with Arabidopsis seedlings. Applying 13C-{1H}{2H} nuclear magnetic resonance (NMR) techniques, the elucidation of deuterium on C-19 behavior of phytosterol provided evidence that small amounts of phytosterol were biosynthesized via lanosterol. The levels of phytosterol increased on overexpression of LAS1, and phytosterols derived from lanosterol were not observed in a LAS1-knockout plant. This is direct evidence to indicate that the biosynthetic pathway for phytosterol via lanosterol exists in plant cells. We designate the biosynthetic pathway to phytosterols via lanosterol “the lanosterol pathway.” LAS1 expression is reported to be induced by the application of jasmonate and is thought to have evolved from an ancestral cycloartenol synthase to a triterpenoid synthase, such as β-amyrin synthase and lupeol synthase. Considering this background, the lanosterol pathway may contribute to the biosynthesis of not only phytosterols, but also steroids as secondary metabolites. PMID:19139393

  15. Conserved biosynthetic pathways for phosalacine, bialaphos and newly discovered phosphonic acid natural products.

    PubMed

    Blodgett, Joshua A V; Zhang, Jun Kai; Yu, Xiaomin; Metcalf, William W

    2016-01-01

    Natural products containing phosphonic or phosphinic acid functionalities often display potent biological activities with applications in medicine and agriculture. The herbicide phosphinothricin-tripeptide (PTT) was the first phosphinate natural product discovered, yet despite numerous studies, questions remain surrounding key transformations required for its biosynthesis. In particular, the enzymology required to convert phosphonoformate to carboxyphosphonoenolpyruvate and the mechanisms underlying phosphorus methylation remain poorly understood. In addition, the model for non-ribosomal peptide synthetase assembly of the intact tripeptide product has undergone numerous revisions that have yet to be experimentally tested. To further investigate the biosynthesis of this unusual natural product, we completely sequenced the PTT biosynthetic locus from Streptomyces hygroscopicus and compared it with the orthologous cluster from Streptomyces viridochromogenes. We also sequenced and analyzed the closely related phosalacine (PAL) biosynthetic locus from Kitasatospora phosalacinea. Using data drawn from the comparative analysis of the PTT and PAL pathways, we also evaluate three related recently discovered phosphonate biosynthetic loci from Streptomyces sviceus, Streptomyces sp. WM6386 and Frankia alni. Our observations address long-standing biosynthetic questions related to PTT and PAL production and suggest that additional members of this pharmacologically important class await discovery. PMID:26328935

  16. Conserved biosynthetic pathways for phosalacine, bialaphos and newly discovered phosphonic acid natural products

    PubMed Central

    Blodgett, Joshua A. V; Zhang, Jun Kai; Yu, Xiaomin; Metcalf, William W.

    2015-01-01

    Natural products containing phosphonic or phosphinic acid functionalities often display potent biological activities with applications in medicine and agriculture. The herbicide phosphinothricin-tripeptide (PTT) was the first phosphinate natural product discovered, yet despite numerous studies, questions remain surrounding key transformations required for its biosynthesis. In particular, the enzymology required to convert phosphonoformate to carboxyphosphonoenolpyruvate and the mechanisms underlying phosphorus-methylation remain poorly understood. In addition, the model for NRPS assembly of the intact tripeptide product has undergone numerous revisions that have yet to be experimentally tested. To further investigate the biosynthesis of this unusual natural product, we completely sequenced the PTT biosynthetic locus from Streptomyces hygroscopicus and compared it to the orthologous cluster from Streptomyces viridochromogenes. We also sequenced and analysed the closely related phosalacine (PAL) biosynthetic locus from Kitasatospora phosalacinea. Using data drawn from the comparative analysis of the PTT and PAL pathways, we also evaluate three related recently discovered phosphonate biosynthetic loci from Streptomyces sviceus, Streptomyces sp. WM6386 and Frankia alni. Our observations address long-standing biosynthetic questions related to PTT and PAL production and suggest that additional members of this pharmacologically important class await discovery. PMID:26328935

  17. Characterization of the fumonisin B2 biosynthetic gene cluster in Aspergillus niger and A. awamori.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aspergillus niger and A. awamori strains isolated from grapes cultivated in Mediterranean basin were examined for fumonisin B2 (FB2) production and presence/absence of sequences within the fumonisin biosynthetic gene (fum) cluster. Presence of 13 regions in the fum cluster was evaluated by PCR assay...

  18. Distinct mechanisms for spiro-carbon formation reveal biosynthetic pathway crosstalk.

    PubMed

    Tsunematsu, Yuta; Ishikawa, Noriyasu; Wakana, Daigo; Goda, Yukihiro; Noguchi, Hiroshi; Moriya, Hisao; Hotta, Kinya; Watanabe, Kenji

    2013-12-01

    Spirotryprostatins, an indole alkaloid class of nonribosomal peptides isolated from Aspergillus fumigatus, are known for their antimitotic activity in tumor cells. Because spirotryprostatins and many other chemically complex spiro-carbon-bearing natural products exhibit useful biological activities, identifying and understanding the mechanism of spiro-carbon biosynthesis is of great interest. Here we report a detailed study of spiro-ring formation in spirotryprostatins from tryprostatins derived from the fumitremorgin biosynthetic pathway, using reactants and products prepared with engineered yeast and fungal strains. Unexpectedly, FqzB, an FAD-dependent monooxygenase from the unrelated fumiquinazoline biosynthetic pathway, catalyzed spiro-carbon formation in spirotryprostatin A via an epoxidation route. Furthermore, FtmG, a cytochrome P450 from the fumitremorgin biosynthetic pathway, was determined to catalyze the spiro-ring formation in spirotryprostatin B. Our results highlight the versatile role of oxygenating enzymes in the biosynthesis of structurally complex natural products and indicate that cross-talk of different biosynthetic pathways allows product diversification in natural product biosynthesis.

  19. The Biosynthetic Pathways of Tanshinones and Phenolic Acids in Salvia miltiorrhiza.

    PubMed

    Ma, Xiao-Hui; Ma, Ying; Tang, Jin-Fu; He, Ya-Li; Liu, Yu-Chen; Ma, Xiao-Jing; Shen, Ye; Cui, Guang-Hong; Lin, Hui-Xin; Rong, Qi-Xian; Guo, Juan; Huang, Lu-Qi

    2015-01-01

    Secondary metabolites from plants play key roles in human medicine and chemical industries. Due to limited accumulation of secondary metabolites in plants and their important roles, characterization of key enzymes involved in biosynthetic pathway will enable metabolic engineering or synthetic biology to improve or produce the compounds in plants or microorganisms, which provides an alternative for production of these valuable compounds. Salvia miltiorrhiza, containing tanshinones and phenolic acids as its active compounds, has been widely used for the treatment of cardiovascular and cerebrovascular diseases. The biosynthetic analysis of secondary metabolites in S. miltiorrhiza has made great progress due to the successful genetic transformation system, simplified hairy roots system, and high-throughput sequencing. The cloned genes in S. miltiorrhiza had provided references for functional characterization of the post-modification steps involved in biosynthesis of tanshinones and phenolic acids, and further utilization of these steps in metabolic engineering. The strategies used in these studies could provide solid foundation for elucidation of biosynthetic pathways of diterpenoids and phenolic acids in other species. The present review systematically summarizes recent advances in biosynthetic pathway analysis of tanshinones and phenolic acids as well as synthetic biology and metabolic engineering applications of the rate-limiting genes involved in the secondary metabolism in S. miltiorrhiza. PMID:26370949

  20. Dothistroma pini, a Forest Pathogen, Contains Homologs of Aflatoxin Biosynthetic Pathway Genes

    PubMed Central

    Bradshaw, Rosie E.; Bhatnagar, Deepak; Ganley, Rebecca J.; Gillman, Carmel J.; Monahan, Brendon J.; Seconi, Janet M.

    2002-01-01

    Homologs of aflatoxin biosynthetic genes have been identified in the pine needle pathogen Dothistroma pini. D. pini produces dothistromin, a difuranoanthraquinone toxin with structural similarity to the aflatoxin precursor versicolorin B. Previous studies with purified dothistromin suggest a possible role for this toxin in pathogenicity. By using an aflatoxin gene as a hybridization probe, a genomic D. pini clone was identified that contained four dot genes with similarity to genes in aflatoxin and sterigmatocystin gene clusters with predicted activities of a ketoreductase (dotA), oxidase (dotB), major facilitator superfamily transporter (dotC), and thioesterase (dotD). A D. pini dotA mutant was made by targeted gene replacement and shown to be severely impaired in dothistromin production, confirming that dotA is involved in dothistromin biosynthesis. Accumulation of versicolorin A (a precursor of aflatoxin) by the dotA mutant confirms that the dotA gene product is involved in an aflatoxin-like biosynthetic pathway. Since toxin genes have been found to be clustered in fungi in every case analyzed so far, it is speculated that the four dot genes may comprise part of a dothistromin biosynthetic gene cluster. A fifth gene, ddhA, is not a homolog of aflatoxin genes and could be at one end of the dothistromin cluster. These genes will allow comparative biochemical and genetic studies of the aflatoxin and dothistromin biosynthetic pathways and may also lead to new ways to control Dothistroma needle blight. PMID:12039746

  1. Poly(vinyl alcohol)-heparin biosynthetic microspheres produced by microfluidics and ultraviolet photopolymerisation.

    PubMed

    Young, Cara; Rozario, Kester; Serra, Christophe; Poole-Warren, Laura; Martens, Penny

    2013-01-01

    Biosynthetic microspheres have the potential to address some of the limitations in cell microencapsulation; however, the generation of biosynthetic hydrogel microspheres has not been investigated or applied to cell encapsulation. Droplet microfluidics has the potential to produce more uniform microspheres under conditions compatible with cell encapsulation. Therefore, the aim of this study was to understand the effect of process parameters on biosynthetic microsphere formation, size, and morphology with a co-flow microfluidic method. Poly(vinyl alcohol) (PVA), a synthetic hydrogel and heparin, a glycosaminoglycan were chosen as the hydrogels for this study. A capillary-based microfluidic droplet generation device was used, and by varying the flow rates of both the polymer and oil phases, the viscosity of the continuous oil phase, and the interfacial surface tension, monodisperse spheres were produced from ∼200 to 800 μm. The size and morphology were unaffected by the addition of heparin. The modulus of spheres was 397 and 335 kPa for PVA and PVA/heparin, respectively, and this was not different from the bulk gel modulus (312 and 365 for PVA and PVA/heparin, respectively). Mammalian cells encapsulated in the spheres had over 90% viability after 24 h in both PVA and PVA/heparin microspheres. After 28 days, viability was still over 90% for PVA-heparin spheres and was significantly higher than in PVA only spheres. The use of biosynthetic hydrogels with microfluidic and UV polymerisation methods offers an improved approach to long-term cell encapsulation.

  2. Heterologous stable expression of terpenoid biosynthetic genes using the moss Physcomitrella patens.

    PubMed

    Bach, Søren Spanner; King, Brian Christopher; Zhan, Xin; Simonsen, Henrik Toft; Hamberger, Björn

    2014-01-01

    Heterologous and stable expression of genes encoding terpenoid biosynthetic enzymes in planta is an important tool for functional characterization and is an attractive alternative to expression in microbial hosts for biotechnological production. Despite improvements to the procedure, such as streamlining of large scale Agrobacterium infiltration and upregulation of the upstream pathways, transient in planta heterologous expression quickly reaches limitations when used for production of terpenoids. Stable integration of transgenes into the nuclear genome of the moss Physcomitrella patens has already been widely recognized as a viable alternative for industrial-scale production of biopharmaceuticals. For expression of terpenoid biosynthetic genes, and reconstruction of heterologous pathways, Physcomitrella has unique attributes that makes it a very promising biotechnological host. These features include a high native tolerance to terpenoids, a simple endogenous terpenoid profile, convenient genome editing using homologous recombination, and cultivation techniques that allow up-scaling from single cells in microtiter plates to industrial photo-bioreactors. Beyond its use for functional characterization of terpenoid biosynthetic genes, engineered Physcomitrella can be a green biotechnological platform for production of terpenoids. Here, we describe two complementary and simple procedures for stable nuclear transformation of Physcomitrella with terpenoid biosynthetic genes, selection and cultivation of transgenic lines, and metabolite analysis of terpenoids produced in transgenic moss lines. We also provide tools for metabolic engineering through genome editing using homologous recombination.

  3. Distinct mechanisms for spiro-carbon formation reveal biosynthetic pathway crosstalk.

    PubMed

    Tsunematsu, Yuta; Ishikawa, Noriyasu; Wakana, Daigo; Goda, Yukihiro; Noguchi, Hiroshi; Moriya, Hisao; Hotta, Kinya; Watanabe, Kenji

    2013-12-01

    Spirotryprostatins, an indole alkaloid class of nonribosomal peptides isolated from Aspergillus fumigatus, are known for their antimitotic activity in tumor cells. Because spirotryprostatins and many other chemically complex spiro-carbon-bearing natural products exhibit useful biological activities, identifying and understanding the mechanism of spiro-carbon biosynthesis is of great interest. Here we report a detailed study of spiro-ring formation in spirotryprostatins from tryprostatins derived from the fumitremorgin biosynthetic pathway, using reactants and products prepared with engineered yeast and fungal strains. Unexpectedly, FqzB, an FAD-dependent monooxygenase from the unrelated fumiquinazoline biosynthetic pathway, catalyzed spiro-carbon formation in spirotryprostatin A via an epoxidation route. Furthermore, FtmG, a cytochrome P450 from the fumitremorgin biosynthetic pathway, was determined to catalyze the spiro-ring formation in spirotryprostatin B. Our results highlight the versatile role of oxygenating enzymes in the biosynthesis of structurally complex natural products and indicate that cross-talk of different biosynthetic pathways allows product diversification in natural product biosynthesis. PMID:24121553

  4. Cytogenetic analysis in Polypterus ornatipinnis (Actinopterygii, Cladistia, Polypteridae) and 5S rDNA.

    PubMed

    Morescalchi, Maria Alessandra; Stingo, Vincenzo; Capriglione, Teresa

    2011-03-01

    Polypteridae is a family of archaic freshwater African fish that constitute an interesting subject for the study of the karyological evolution in vertebrates, on account of their primitive morphological characters and peculiar relationships with lower Osteichthyans. In this paper, a cytogenetic analysis on twenty specimens of both sexes of Polypterus ornatipinnis the ornate "bichir", coming from the Congo River basin, was performed by using both classical and molecular techniques. The karyotypic formula (2n=36; FN=72) was composed of 26 M+10 SM. The Alu I banding, performed to characterize heterochromatin in this species, was mainly centromeric. Both the chromosome location of the ribosomal 5S and 18S rRNA genes were examined by using Ag-NOR, classical C-banding, CMA(3) staining and FISH. CMA(3) marked all centromerical regions and showed the presence of two GC rich regions on the p arm of the chromosome pair n°1 and on the q arm of the pair n°14. Staining with Ag-NOR marked the only telomeric region of the chromosome n°1 p arm. After PCR, the 5S rDNA in this species was cloned, sequenced and analyzed. In the 665bp 5S rDNA sequence of P.ornatipinnis, a conserved 120bp gene region for the 5S rDNA was identified, followed by a non-transcribed variable spacer (NTS) which included simple repeats, microsatellites and a fragment of a non-LTR retrotransposon R-TEX. FISH with 5S rDNA marked the subtelomeric region of the q arm of the chromosome pair n°14, previously marked by CMA(3). FISH with 18S rDNA marked the telomeric region of the p arm of the pair n°1, previously marked both by Ag-NOR and CMA(3). The (GATA)(7) repeats marked the telomeric regions of all chromosome pairs, with the exclusion of the n°1, n°3 and n°14; hybridization with telomeric probes (TTAGGG)(n) showed signals at the end of all chromosomes. Karyotype evolution in Polypterus genus was finally discussed, including the new data obtained.

  5. Cytogenetic analysis in Polypterus ornatipinnis (Actinopterygii, Cladistia, Polypteridae) and 5S rDNA.

    PubMed

    Morescalchi, Maria Alessandra; Stingo, Vincenzo; Capriglione, Teresa

    2011-03-01

    Polypteridae is a family of archaic freshwater African fish that constitute an interesting subject for the study of the karyological evolution in vertebrates, on account of their primitive morphological characters and peculiar relationships with lower Osteichthyans. In this paper, a cytogenetic analysis on twenty specimens of both sexes of Polypterus ornatipinnis the ornate "bichir", coming from the Congo River basin, was performed by using both classical and molecular techniques. The karyotypic formula (2n=36; FN=72) was composed of 26 M+10 SM. The Alu I banding, performed to characterize heterochromatin in this species, was mainly centromeric. Both the chromosome location of the ribosomal 5S and 18S rRNA genes were examined by using Ag-NOR, classical C-banding, CMA(3) staining and FISH. CMA(3) marked all centromerical regions and showed the presence of two GC rich regions on the p arm of the chromosome pair n°1 and on the q arm of the pair n°14. Staining with Ag-NOR marked the only telomeric region of the chromosome n°1 p arm. After PCR, the 5S rDNA in this species was cloned, sequenced and analyzed. In the 665bp 5S rDNA sequence of P.ornatipinnis, a conserved 120bp gene region for the 5S rDNA was identified, followed by a non-transcribed variable spacer (NTS) which included simple repeats, microsatellites and a fragment of a non-LTR retrotransposon R-TEX. FISH with 5S rDNA marked the subtelomeric region of the q arm of the chromosome pair n°14, previously marked by CMA(3). FISH with 18S rDNA marked the telomeric region of the p arm of the pair n°1, previously marked both by Ag-NOR and CMA(3). The (GATA)(7) repeats marked the telomeric regions of all chromosome pairs, with the exclusion of the n°1, n°3 and n°14; hybridization with telomeric probes (TTAGGG)(n) showed signals at the end of all chromosomes. Karyotype evolution in Polypterus genus was finally discussed, including the new data obtained. PMID:21429462

  6. Climatic controls on drainage basin topography - a synopsis of the western Andean flanks between 15.5 S and 41.5 S lat

    NASA Astrophysics Data System (ADS)

    Rehak, K.; Strecker, M. R.; Echtler, H. P.; Bookhagen, B.

    2007-12-01

    Topography in tectonically active mountain ranges is determined by the interplay between tectonics and climate. Due to the complexity of natural systems it is difficult to evaluate tectonic versus climatic contributions to the long- term landscape evolution. Previous studies suggest that rainfall and its variability strongly influence the morphology of river profiles and mountain ranges. However, it is still controversially discussed how drainage basins reflect tectonic and climatic processes. The Andean Cordillera provides a unique natural setting for studying the relationship between climate, tectonics, and topography. The Andes host various climatic zones with pronounced differences in rainfall regimes. In the central to southern western Andes, climate ranges from hyperarid in the Atacama Desert, 22 to 23°S lat, with a mean annual rainfall of ~ 5 mm/yr to year-round humid conditions south of Valdivia, ~ 40°S lat, with more than 2500 mm/yr. This zonation is controlled by hemisphere-scale atmospheric circulation patterns. With the exception of a northward shift of the Southern Hemisphere Westerlies during glacials the overall precipitation pattern has remained stable on the west coast of South America. The shelf width is reasonably constant along the margin. Uplift rate and lithology vary non-systematically and do not correlate with climatic parameters. Here, we present an analysis of 120 drainage basins along the watershed of the western Andean flank between 15.5 S and 41.5 S lat, using SRTMV3-90m data and a high-resolution rainfall dataset (TRMM 5x5 km). The basins comprise drainage areas of 1 to ~ 30 x 103 km2 and were split into subsets according to position and size. For each basin, we extracted 21 geometry, relief, and climate parameters in order to unravel the determinants of drainage-basin morphology. Our data shows that river-profile concavity and slope, hypsometric integral, basin maximum and mean elevation decrease with increasing rainfall and

  7. Characterization of the Promoter Region of Biosynthetic Enzyme Genes Involved in Berberine Biosynthesis in Coptis japonica

    PubMed Central

    Yamada, Yasuyuki; Yoshimoto, Tadashi; Yoshida, Sayumi T.; Sato, Fumihiko

    2016-01-01

    The presence of alkaloids is rather specific to certain plant species. However, berberine, an isoquinoline alkaloid, is relatively broadly distributed in the plant kingdom. Thus, berberine biosynthesis has been intensively investigated, especially using Coptis japonica cell cultures. Almost all biosynthetic enzyme genes have already been characterized at the molecular level. Particularly, two transcription factors (TFs), a plant-specific WRKY-type TF, CjWRKY1, and a basic helix-loop-helix TF, CjbHLH1, were shown to comprehensively regulate berberine biosynthesis in C. japonica cells. In this study, we characterized the promoter region of some biosynthetic enzyme genes and associated cis-acting elements involved in the transcriptional regulation via two TFs. The promoter regions of three berberine biosynthetic enzyme genes (CYP80B2, 4′OMT and CYP719A1) were isolated, and their promoter activities were dissected by a transient assay involving the sequentially truncated promoter::luciferase (LUC) reporter constructs. Furthermore, transactivation activities of CjWRKY1 were determined using the truncated promoter::LUC reporter constructs or constructs with mutated cis-elements. These results suggest the involvement of a putative W-box in the regulation of biosynthetic enzyme genes. Direct binding of CjWRKY1 to the W-box DNA sequence was also confirmed by an electrophoresis mobility shift assay and by a chromatin immunoprecipitation assay. In addition, CjbHLH1 also activated transcription from truncated 4′OMT and CYP719A1 promoters independently of CjWRKY1, suggesting the involvement of a putative E-box. Unexpected transcriptional activation of biosynthetic enzyme genes via a non-W-box sequence and by CjWRKY1 as well as the possible involvement of a GCC-box in berberine biosynthesis in C. japonica are discussed. PMID:27642289

  8. Characterization of the Promoter Region of Biosynthetic Enzyme Genes Involved in Berberine Biosynthesis in Coptis japonica.

    PubMed

    Yamada, Yasuyuki; Yoshimoto, Tadashi; Yoshida, Sayumi T; Sato, Fumihiko

    2016-01-01

    The presence of alkaloids is rather specific to certain plant species. However, berberine, an isoquinoline alkaloid, is relatively broadly distributed in the plant kingdom. Thus, berberine biosynthesis has been intensively investigated, especially using Coptis japonica cell cultures. Almost all biosynthetic enzyme genes have already been characterized at the molecular level. Particularly, two transcription factors (TFs), a plant-specific WRKY-type TF, CjWRKY1, and a basic helix-loop-helix TF, CjbHLH1, were shown to comprehensively regulate berberine biosynthesis in C. japonica cells. In this study, we characterized the promoter region of some biosynthetic enzyme genes and associated cis-acting elements involved in the transcriptional regulation via two TFs. The promoter regions of three berberine biosynthetic enzyme genes (CYP80B2, 4'OMT and CYP719A1) were isolated, and their promoter activities were dissected by a transient assay involving the sequentially truncated promoter::luciferase (LUC) reporter constructs. Furthermore, transactivation activities of CjWRKY1 were determined using the truncated promoter::LUC reporter constructs or constructs with mutated cis-elements. These results suggest the involvement of a putative W-box in the regulation of biosynthetic enzyme genes. Direct binding of CjWRKY1 to the W-box DNA sequence was also confirmed by an electrophoresis mobility shift assay and by a chromatin immunoprecipitation assay. In addition, CjbHLH1 also activated transcription from truncated 4'OMT and CYP719A1 promoters independently of CjWRKY1, suggesting the involvement of a putative E-box. Unexpected transcriptional activation of biosynthetic enzyme genes via a non-W-box sequence and by CjWRKY1 as well as the possible involvement of a GCC-box in berberine biosynthesis in C. japonica are discussed. PMID:27642289

  9. Characterization of the Promoter Region of Biosynthetic Enzyme Genes Involved in Berberine Biosynthesis in Coptis japonica

    PubMed Central

    Yamada, Yasuyuki; Yoshimoto, Tadashi; Yoshida, Sayumi T.; Sato, Fumihiko

    2016-01-01

    The presence of alkaloids is rather specific to certain plant species. However, berberine, an isoquinoline alkaloid, is relatively broadly distributed in the plant kingdom. Thus, berberine biosynthesis has been intensively investigated, especially using Coptis japonica cell cultures. Almost all biosynthetic enzyme genes have already been characterized at the molecular level. Particularly, two transcription factors (TFs), a plant-specific WRKY-type TF, CjWRKY1, and a basic helix-loop-helix TF, CjbHLH1, were shown to comprehensively regulate berberine biosynthesis in C. japonica cells. In this study, we characterized the promoter region of some biosynthetic enzyme genes and associated cis-acting elements involved in the transcriptional regulation via two TFs. The promoter regions of three berberine biosynthetic enzyme genes (CYP80B2, 4′OMT and CYP719A1) were isolated, and their promoter activities were dissected by a transient assay involving the sequentially truncated promoter::luciferase (LUC) reporter constructs. Furthermore, transactivation activities of CjWRKY1 were determined using the truncated promoter::LUC reporter constructs or constructs with mutated cis-elements. These results suggest the involvement of a putative W-box in the regulation of biosynthetic enzyme genes. Direct binding of CjWRKY1 to the W-box DNA sequence was also confirmed by an electrophoresis mobility shift assay and by a chromatin immunoprecipitation assay. In addition, CjbHLH1 also activated transcription from truncated 4′OMT and CYP719A1 promoters independently of CjWRKY1, suggesting the involvement of a putative E-box. Unexpected transcriptional activation of biosynthetic enzyme genes via a non-W-box sequence and by CjWRKY1 as well as the possible involvement of a GCC-box in berberine biosynthesis in C. japonica are discussed.

  10. Two spatially separated phases in semiconducting Rb0.8Fe1.5S2

    DOE PAGES

    Wang, Meng; Tian, Wei; Valdivia, P.; Chi, Songxue; Bourret-Courchesne, E.; Dai, Pengcheng; Birgeneau, R. J.

    2014-09-26

    We report neutron scattering and transport measurements on semiconducting Rb0.8Fe1.5S2, a compound isostructural and isoelectronic to the well-studied A0.8FeySe2(A = K, Rb, Cs, Tl/K) superconducting systems. Both resistivity and DC susceptibility measurements reveal a magnetic phase transition at T = 275 K. Neutron diffraction studies show that the 275 K transition originates from a phase with rhombic iron vacancy order which exhibits an in-plane stripe antiferromagnetic ordering below 275 K. In addition, the stripe antiferromagnetic phase interdigitates mesoscopically with an ubiquitous phase with √5 x√5 iron vacancy order. This phase has a magnetic transition at TN = 425 K andmore » an iron vacancy order-disorder transition at TS = 600 K. These two different structural phases are closely similar to those observed in the isomorphous Se materials. Based on the close similarities of the in-plane antiferromagnetic structures, moments sizes, and ordering temperatures in semiconducting Rb0.8Fe1.5S2 and K0.81Fe1.58Se2, we argue that the in-plane antiferromagnetic order arises from strong coupling between local moments. Superconductivity, previously observed in the A0.8FeySe2₋ zSz system, is absent in A0.8Fe1.5S2, which has a semiconducting ground state. We discuss the implied relationship between stripe and block antiferromagnetism and superconductivity in these materials as well as a strategy for further investigation.« less

  11. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18.

    PubMed

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P; Tarassov, Ivan

    2011-06-15

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes.

  12. Physical mapping of 5S rDNA in two species of Knifefishes: Gymnotus pantanal and Gymnotus paraguensis (Gymnotiformes).

    PubMed

    da Silva, M; Matoso, D A; Vicari, M R; de Almeida, M C; Margarido, V P; Artoni, R F

    2011-01-01

    Physical mapping of 5S rDNA in 2 species of knifefishes, Gymnotuspantanal and G. paraguensis (Gymnotiformes), was performed using fluorescence in situ hybridization with a 5S rDNA probe. The 5S rDNA PCR product from the genomes of both species was also sequenced and aligned to determine non-transcribed spacer sequences (NTS). Both species under study had different patterns of 5S rDNA gene cluster distribution. While in the karyotype of G. pantanal two 5S rDNA-bearing pairs were observed, the karyotype of G. paraguensis possessed as many as 19 such pairs. Such multiplication of 5S rDNA gene clusters might be caused by the involvement of transposable elements because the NTS of G. paraguensis was 400 bp long with high identity (90%) with a mobile transposable element called Tc1-like transposon, described from the cyprinid fish Labeo rohita.

  13. Minimally invasive L5-S1 oblique lumbar interbody fusion with anterior plate.

    PubMed

    Pham, Martin H; Jakoi, Andre M; Hsieh, Patrick C

    2016-07-01

    Lumbar interbody fusion is an important technique for the treatment of degenerative disc disease and degenerative scoliosis. The oblique lumbar interbody fusion (OLIF) establishes a minimally invasive retroperitoneal exposure anterior to the psoas and lumbar plexus. In this video case presentation, the authors demonstrate the techniques of the OLIF at L5-S1 performed on a 69-year-old female with degenerative scoliosis as one component of an overall strategy for her deformity correction. The video can be found here: https://youtu.be/VMUYWKLAl0g . PMID:27364428

  14. Alternative Sigma Factor Over-Expression Enables Heterologous Expression of a Type II Polyketide Biosynthetic Pathway in Escherichia coli

    PubMed Central

    Stevens, David Cole; Conway, Kyle R.; Pearce, Nelson; Villegas-Peñaranda, Luis Roberto; Garza, Anthony G.; Boddy, Christopher N.

    2013-01-01

    Background Heterologous expression of bacterial biosynthetic gene clusters is currently an indispensable tool for characterizing biosynthetic pathways. Development of an effective, general heterologous expression system that can be applied to bioprospecting from metagenomic DNA will enable the discovery of a wealth of new natural products. Methodology We have developed a new Escherichia coli-based heterologous expression system for polyketide biosynthetic gene clusters. We have demonstrated the over-expression of the alternative sigma factor σ54 directly and positively regulates heterologous expression of the oxytetracycline biosynthetic gene cluster in E. coli. Bioinformatics analysis indicates that σ54 promoters are present in nearly 70% of polyketide and non-ribosomal peptide biosynthetic pathways. Conclusions We have demonstrated a new mechanism for heterologous expression of the oxytetracycline polyketide biosynthetic pathway, where high-level pleiotropic sigma factors from the heterologous host directly and positively regulate transcription of the non-native biosynthetic gene cluster. Our bioinformatics analysis is consistent with the hypothesis that heterologous expression mediated by the alternative sigma factor σ54 may be a viable method for the production of additional polyketide products. PMID:23724102

  15. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    PubMed

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  16. Analysis of 5S rDNA organization and variation in polyploid hybrids from crosses of different fish subfamilies.

    PubMed

    Qin, Qinbo; He, Weiguo; Liu, Shaojun; Wang, Jing; Xiao, Jun; Liu, Yun

    2010-07-15

    In this article, sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) were conducted in red crucian carp (RCC), blunt snout bream (BSB), and their polyploid offspring. Three monomeric 5S rDNA classes (designated class I: 203 bp; class II: 340 bp; and class III: 477 bp) of RCC were characterized by distinct NTS types (designated NTS-I, II, and III for the 83, 220, and 357 bp monomers, respectively). In BSB, only one monomeric 5S rDNA was observed (designated class IV: 188 bp), which was characterized by one NTS type (designated NTS-IV: 68 bp). In the polyploid offspring, the tetraploid (4nRB) hybrids partially inherited 5S rDNA classes from their female parent (RCC); however, they also possessed a unique 5S rDNA sequence (designated class I-L: 203 bp) with a novel NTS sequence (designated NTS-I-L: 83 bp). The characteristic paternal 5S rDNA sequences (class IV) were not observed. The 5S rDNA of triploid (3nRB) hybrids was completely inherited from the parental species, and generally preserved the parental 5S rDNA structural organization. These results first revealed the influence of polyploidy on the organization and evolution of the multigene family of 5S rDNA of fish, and are also useful in clarifying aspects of vertebrate genome evolution.

  17. Electron-correlation-induced interchange of lifetime broadenings of 5s{sup -1} multiplet states in atomic Cs

    SciTech Connect

    Partanen, L.; Holappa, M.; Aksela, H.; Aksela, S.; Schulz, J.

    2009-10-15

    The lifetime broadenings of the most intense 5s photolines of Cs were studied. The aim of this study was to understand the origin of the remarkable differences in the lifetime widths of different 5s{sup -1} multiplet states. The 5s photoelectron spectra of the 6s{yields}6p{sub 1/2,3/2} laser-excited states are presented in the binding energy region of 30-34 eV showing the main 5s photolines of the ground state and laser-excited states as well as the 5s5p{sup 6}6p shakeup satellites. The lifetime widths of the states were determined. The Hartree-Fock calculations were carried out to predict the 5s photoelectron spectrum. The lifetime broadenings of the 5s photolines were found to be due to the transition rates of the subsequent Coster-Kronig transitions to the 5s{sup 2}5p{sup 5} states. It was found that a straightforward single-configuration explanation cannot be given for the lifetime differences. Instead, electron correlation plays an essential role and the lifetime broadenings were found to be predicted well only when configuration interaction between the 5s{sup -1} and 5p{sup -2}5d configurations is taking into account.

  18. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    PubMed Central

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-01-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  19. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    NASA Astrophysics Data System (ADS)

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-03-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system.

  20. Bottomonium physics at Υ(4S, 5S, 6S) energies with the Belle detector

    NASA Astrophysics Data System (ADS)

    Tamponi, Umberto

    2016-08-01

    The description of quarkonia as pure quark anti-quark bound states has been recently challenged by the observation of charged states in both the charmonium and bottomonium region and large violations of the heavy quark spin symmetry in hadronic transitions. All these effects can be ascribable to non-negligible contributions from the light quark degrees of freedom in the description of both charmonia and bottomonia. We will report the most recent experimental measurements performed by the Belle collaboration in the Y(4S), Y(5S) and Y(6S) regions, including the measurement of the ratio σ[e+e- → bb̅]/σ[e+e- → μ+ μ- ], the search for neutral states near the B0B̅0 threshold, the first observation of the transition ϒ(4S) → ηhb (lP) and the study of the η transitions at the ϒ(5S) energy. The contribution to the study of the structure of these states coming from the measurement of hadronic transitions will be discussed.

  1. Magnetization reversal phenomena in (Cr0.70Ti0.30)5S6

    NASA Astrophysics Data System (ADS)

    Hashimoto, Satoshi; Matsuda, Yuji; Sato, Tetsuya; Anzai, Shuichiro

    2005-12-01

    Magnetization reversal phenomena (MRP) along magnetic order-order transitions have recently been reported on impurity-doped magnetic systems. Because imperfect long-range magnetic order exists in these systems, it is expected that a systematic investigation of MRP will give physical information on thermomagnetic processes of magnetic systems in the range from the micro- to nanoscales. As a typical order-order transition (a state doubly modulated by helical and canting orders to a collinear ferrimagnetic state) has been known to occur on Cr5S6 at a transition temperature Tt, we investigate the magnetizations of (Cr0.70Ti0.30)5S6 on heating and cooling runs in various magnetic fields. At 20Oe, the field-cooled magnetization just below the Curie temperature has a positive sign; the sign turns negative below the compensation temperature TCM (first step) and finally returns to positive below Tt (second step). The first-step MRP observed in this system is explained by the potential barriers resulting from anisotropy energy when the preferred direction of collinear ferrimagnetic moment reverses. The proposed mechanism for second-step MRP is the pinning effect caused by the impurity atoms (Ti) in the helical long-range-order chains. Comparing other examples of MRPs, we discuss the roles of local impurity centers in the thermomagnetic process in magnetic order-order transitions.

  2. Structural Preservation Percutaneous Endoscopic Lumbar Interlaminar Discectomy for L5-S1 Herniated Nucleus Pulposus

    PubMed Central

    Jang, Jee-Soo; Jang, Il-Tae

    2016-01-01

    Objective. Structures such as ligamentum flavum, annulus, and lamina play an important role in the segmental function. We proposed the surgical technique for achieving the sufficient preservation of segmental structures, in spite of sufficient removal of pathologic disc in the L5-S1 using the ligamentum flavum splitting and sealing technique. Methods. We retrospectively analyzed 80 cases that underwent percutaneous endoscopic lumbar discectomy for L5-S1 herniated nucleus pulposus, using the ligamentum flavum splitting and sealing technique between January 2011 and June 2013. Outcomes were assessed using VAS (leg, back), MacNab's criteria, and the immediate postoperative MRI for all patients. Structural preservation was classified as complete, sufficient, and incomplete. Results. The surgical results are as follows: 65 cases were complete, 15 cases were sufficient, and 0 cases were incomplete. The VAS was decreased at the last follow-up (leg: from 7.91 ± 0.73 to 1.15 ± 0.62; back: from 5.15 ± 0.71 to 1.19 ± 0.75). A favorable outcome (excellent or good outcome by MacNab's criteria) was achieved in 77 patients (96.25%). During the follow-up period, 2 cases (2.5%) of recurrence have occurred. Conclusion. According to the result, we could obtain the favorable clinical and radiological outcomes while simultaneously removing pathologic discs using the ligamentum flavum splitting and annular fissure sealing technique. PMID:27803927

  3. Hybrubins: Bipyrrole Tetramic Acids Obtained by Crosstalk between a Truncated Undecylprodigiosin Pathway and Heterologous Tetramic Acid Biosynthetic Genes.

    PubMed

    Zhao, Zhilong; Shi, Ting; Xu, Min; Brock, Nelson L; Zhao, Yi-Lei; Wang, Yemin; Deng, Zixin; Pang, Xiuhua; Tao, Meifeng

    2016-02-01

    Heterologous expression of bacterial artificial chromosome (BAC) clones from the genomic library of Streptomyces variabilis Snt24 in Streptomyces lividans SBT5 which carried a truncated undecylprodigiosin biosynthetic gene cluster led to the identification of hybrubins A-C. The hybrubins represent a new carbon skeleton in which a tetramic acid moiety is fused to a 2,2'-dipyrrole building block. Gene knockout experiments confirmed that hybrubins are derived from two convergent biosynthetic pathways including the remaining genomic red genes of S. lividans SBT5 as well as the BAC encoded hbn genes for the production of 5-ethylidenetetramic acid. A possible biosynthetic pathway was also proposed.

  4. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro.

    PubMed

    Sharwood, Robert E; Hotto, Amber M; Bollenbach, Thomas J; Stern, David B

    2011-02-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3'-to-5' exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNA(Arg), raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S-AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1.

  5. An eight-step synthesis of epicolactone reveals its biosynthetic origin

    NASA Astrophysics Data System (ADS)

    Ellerbrock, Pascal; Armanino, Nicolas; Ilg, Marina K.; Webster, Robert; Trauner, Dirk

    2015-11-01

    Epicolactone is a recently isolated fungal metabolite that is highly complex for its size, and yet racemic. With its array of quaternary stereocentres, high degree of functionalization and intricate polycyclic structure, it poses a considerable challenge to synthesis, a challenge that can be met by understanding its biosynthetic origin. If drawn in a certain way, epicolactone reveals a pattern that resembles purpurogallin, the archetype of ubiquitous natural colourants formed via oxidative dimerization. Based on this insight, we designed a biomimetic synthesis of epicolactone that proceeds in only eight steps from vanillyl alcohol. We have isolated a key intermediate that supports our biosynthetic hypothesis and anticipate that an isomer of epicolactone stemming from our synthetic efforts could also be found as a natural product.

  6. Insights into secondary metabolism from a global analysis of prokaryotic biosynthetic gene clusters

    PubMed Central

    Cimermancic, Peter; Medema, Marnix H.; Claesen, Jan; Kurita, Kenji; Wieland Brown, Laura C.; Mavrommatis, Konstantinos; Pati, Amrita; Godfrey, Paul A.; Koehrsen, Michael; Clardy, Jon; Birren, Bruce W.; Takano, Eriko; Sali, Andrej; Linington, Roger G.; Fischbach, Michael A.

    2014-01-01

    Summary Although biosynthetic gene clusters (BGCs) have been discovered for hundreds of bacterial metabolites, our knowledge of their diversity remains limited. Here, we used a novel algorithm to systematically identify BGCs in the extensive extant microbial sequencing data. Network analysis of the predicted BGCs revealed large gene cluster families, the vast majority uncharacterized. We experimentally characterized the most prominent family, consisting of two subfamilies of hundreds of BGCs distributed throughout the Proteobacteria; their products are aryl polyenes, lipids with an aryl head group conjugated to a polyene tail. We identified a distant relationship to a third subfamily of aryl polyene BGCs, and together the three subfamilies represent the largest known family of biosynthetic gene clusters, with more than 1,000 members. Although these clusters are widely divergent in sequence, their small molecule products are remarkably conserved, indicating for the first time the important roles these compounds play in Gram-negative cell biology. PMID:25036635

  7. Cellular Localization of Isoprenoid Biosynthetic Enzymes in Marchantia polymorpha. Uncovering a New Role of Oil Bodies

    PubMed Central

    Suire, Claude; Bouvier, Florence; Backhaus, Ralph A.; Bégu, Dominique; Bonneu, Marc; Camara, Bilal

    2000-01-01

    Like seed plants, liverworts synthesize and accumulate a myriad of isoprenoid compounds. Using antibodies raised against several isoprenoid biosynthetic enzymes, we investigated their intracellular compartmentation by in situ immunolocalization from Marchantia polymorpha. The enzymes examined were deoxy-xylulose phosphate synthase, geranyl diphosphate synthase, farnesyl diphosphate synthase, geranylgeranyl diphosphate synthase, monoterpene synthase, geranylgeranyl diphosphate reductase, phytoene synthase, and phytoene desaturase. Our results show that liverwort oil bodies, which are organelles bound by a single unit membrane, possess isoprenoid biosynthetic enzymes similar to those found in plastids and the cytosol. We postulate that oil bodies play a dynamic role in cell metabolism in addition to their role as sites of essential oil accumulation and sequestration. The occurrence of such enzymes in different cellular compartments might be due to multiple targeting of gene products to various organelles. PMID:11080275

  8. Complete biosynthetic pathway of anditomin: nature's sophisticated synthetic route to a complex fungal meroterpenoid.

    PubMed

    Matsuda, Yudai; Wakimoto, Toshiyuki; Mori, Takahiro; Awakawa, Takayoshi; Abe, Ikuro

    2014-10-29

    Anditomin and its precursors, andilesins, are fungal meroterpenoids isolated from Aspergillus variecolor and have unique, highly oxygenated chemical structures with a complex bridged-ring system. Previous isotope-feeding studies revealed their origins as 3,5-dimethylorsellinic acid and farnesyl pyrophosphate and suggested the possible involvement of a Diels-Alder reaction to afford the congested bicyclo[2.2.2]octane core structure of andilesins. Here we report the first identification of the biosynthetic gene cluster of anditomin and the determination of the complete biosynthetic pathway by characterizing the functions of 12 dedicated enzymes. The anditomin pathway actually does not employ a Diels-Alder reaction, but involves the nonheme iron-dependent dioxygenase AndA to synthesize the bridged-ring by an unprecedented skeletal reconstruction. Another dioxygenase, AndF, is also responsible for the structural complexification, generating the end product anditomin by an oxidative rearrangement.

  9. Biosynthetic Pathway for the Epipolythiodioxopiperazine Acetylaranotin in Aspergillus terreus Revealed by Genome-based Deletion Analysis

    SciTech Connect

    Guo, Chun-Jun; Yeh, Hsu-Hua; Chiang, Yi Ming; Sanchez, James F.; Chang, ShuLin; Bruno, Kenneth S.; Wang, Clay C.

    2013-04-15

    Abstract Epipolythiodioxopiperazines (ETPs) are a class of fungal secondary metabolites derived from cyclic peptides. Acetylaranotin belongs to one structural subgroup of ETPs characterized by the presence of a seven-membered dihydrooxepine ring. Defining the genes involved in acetylaranotin biosynthesis should provide a means to increase production of these compounds and facilitate the engineering of second-generation molecules. The filamentous fungus Aspergillus terreus produces acetylaranotin and related natural products. Using targeted gene deletions, we have identified a cluster of 9 genes including one nonribosomal peptide synthase gene, ataP, that is required for acetylaranotin biosynthesis. Chemical analysis of the wild type and mutant strains enabled us to isolate seventeen natural products that are either intermediates in the normal biosynthetic pathway or shunt products that are produced when the pathway is interrupted through mutation. Nine of the compounds identified in this study are novel natural products. Our data allow us to propose a complete biosynthetic pathway for acetylaranotin and related natural products.

  10. Producing the Ethylene Signal: Regulation and Diversification of Ethylene Biosynthetic Enzymes.

    PubMed

    Booker, Matthew A; DeLong, Alison

    2015-09-01

    Strictly controlled production of ethylene gas lies upstream of the signaling activities of this crucial regulator throughout the plant life cycle. Although the biosynthetic pathway is enzymatically simple, the regulatory circuits that modulate signal production are fine tuned to allow integration of responses to environmental and intrinsic cues. Recently identified posttranslational mechanisms that control ethylene production converge on one family of biosynthetic enzymes and overlay several independent reversible phosphorylation events and distinct mediators of ubiquitin-dependent protein degradation. Although the core pathway is conserved throughout seed plants, these posttranslational regulatory mechanisms may represent evolutionarily recent innovations. The evolutionary origins of the pathway and its regulators are not yet clear; outside the seed plants, numerous biochemical and phylogenetic questions remain to be addressed.

  11. The Sphingolipid Biosynthetic Pathway Is a Potential Target for Chemotherapy against Chagas Disease

    PubMed Central

    Koeller, Carolina Macedo; Heise, Norton

    2011-01-01

    The protozoan parasite Trypanosoma cruzi is the causative agent of human Chagas disease, for which there currently is no cure. The life cycle of T. cruzi is complex, including an extracellular phase in the triatomine insect vector and an obligatory intracellular stage inside the vertebrate host. These phases depend on a variety of surface glycosylphosphatidylinositol-(GPI-) anchored glycoconjugates that are synthesized by the parasite. Therefore, the surface expression of GPI-anchored components and the biosynthetic pathways of GPI anchors are attractive targets for new therapies for Chagas disease. We identified new drug targets for chemotherapy by taking the available genome sequence information and searching for differences in the sphingolipid biosynthetic pathways (SBPs) of mammals and T. cruzi. In this paper, we discuss the major steps of the SBP in mammals, yeast and T. cruzi, focusing on the IPC synthase and ceramide remodeling of T. cruzi as potential therapeutic targets for Chagas disease. PMID:21603271

  12. Computational genomic identification and functional reconstitution of plant natural product biosynthetic pathways

    PubMed Central

    2016-01-01

    Covering: 2003 to 2016 The last decade has seen the first major discoveries regarding the genomic basis of plant natural product biosynthetic pathways. Four key computationally driven strategies have been developed to identify such pathways, which make use of physical clustering, co-expression, evolutionary co-occurrence and epigenomic co-regulation of the genes involved in producing a plant natural product. Here, we discuss how these approaches can be used for the discovery of plant biosynthetic pathways encoded by both chromosomally clustered and non-clustered genes. Additionally, we will discuss opportunities to prioritize plant gene clusters for experimental characterization, and end with a forward-looking perspective on how synthetic biology technologies will allow effective functional reconstitution of candidate pathways using a variety of genetic systems. PMID:27321668

  13. Evolution of alternative biosynthetic pathways for vitamin C following plastid acquisition in photosynthetic eukaryotes.

    PubMed

    Wheeler, Glen; Ishikawa, Takahiro; Pornsaksit, Varissa; Smirnoff, Nicholas

    2015-03-13

    Ascorbic acid (vitamin C) is an enzyme co-factor in eukaryotes that also plays a critical role in protecting photosynthetic eukaryotes against damaging reactive oxygen species derived from the chloroplast. Many animal lineages, including primates, have become ascorbate auxotrophs due to the loss of the terminal enzyme in their biosynthetic pathway, L-gulonolactone oxidase (GULO). The alternative pathways found in land plants and Euglena use a different terminal enzyme, L-galactonolactone dehydrogenase (GLDH). The evolutionary processes leading to these differing pathways and their contribution to the cellular roles of ascorbate remain unclear. Here we present molecular and biochemical evidence demonstrating that GULO was functionally replaced with GLDH in photosynthetic eukaryote lineages following plastid acquisition. GULO has therefore been lost repeatedly throughout eukaryote evolution. The formation of the alternative biosynthetic pathways in photosynthetic eukaryotes uncoupled ascorbate synthesis from hydrogen peroxide production and likely contributed to the rise of ascorbate as a major photoprotective antioxidant.

  14. Improved herbivore resistance in cultivated tomato with the sesquiterpene biosynthetic pathway from a wild relative

    PubMed Central

    Bleeker, Petra M.; Mirabella, Rossana; Diergaarde, Paul J.; VanDoorn, Arjen; Tissier, Alain; Kant, Merijn R.; Prins, Marcel; de Vos, Martin; Haring, Michel A.; Schuurink, Robert C.

    2012-01-01

    Tomato breeding has been tremendously efficient in increasing fruit quality and quantity but did not focus on improving herbivore resistance. The biosynthetic pathway for the production of 7-epizingiberene in a wild tomato was introduced into a cultivated greenhouse variety with the aim to obtain herbivore resistance. 7-Epizingiberene is a specific sesquiterpene with toxic and repellent properties that is produced and stored in glandular trichomes. We identified 7-epizingiberene synthase (ShZIS) that belongs to a new class of sesquiterpene synthases, exclusively using Z-Z-farnesyl-diphosphate (zFPP) in plastids, probably arisen through neo-functionalization of a common ancestor. Expression of the ShZIS and zFPP synthases in the glandular trichomes of cultivated tomato resulted in the production of 7-epizingiberene. These tomatoes gained resistance to several herbivores that are pests of tomato. Hence, introduction of this sesquiterpene biosynthetic pathway into cultivated tomatoes resulted in improved herbivore resistance. PMID:23169639

  15. Producing the Ethylene Signal: Regulation and Diversification of Ethylene Biosynthetic Enzymes1

    PubMed Central

    Booker, Matthew A.; DeLong, Alison

    2015-01-01

    Strictly controlled production of ethylene gas lies upstream of the signaling activities of this crucial regulator throughout the plant life cycle. Although the biosynthetic pathway is enzymatically simple, the regulatory circuits that modulate signal production are fine tuned to allow integration of responses to environmental and intrinsic cues. Recently identified posttranslational mechanisms that control ethylene production converge on one family of biosynthetic enzymes and overlay several independent reversible phosphorylation events and distinct mediators of ubiquitin-dependent protein degradation. Although the core pathway is conserved throughout seed plants, these posttranslational regulatory mechanisms may represent evolutionarily recent innovations. The evolutionary origins of the pathway and its regulators are not yet clear; outside the seed plants, numerous biochemical and phylogenetic questions remain to be addressed. PMID:26134162

  16. A biosynthetic pathway for a prominent class of microbiota-derived bile acids

    PubMed Central

    Devlin, A. Sloan; Fischbach, Michael A.

    2015-01-01

    The gut bile acid pool is millimolar in concentration, varies widely in composition among individuals, and is linked to metabolic disease and cancer. Although these molecules derive almost exclusively from the microbiota, remarkably little is known about which bacterial species and genes are responsible for their biosynthesis. Here, we report a biosynthetic pathway for the second most abundant class in the gut, iso (3β-hydroxy) bile acids, whose levels exceed 300 µM in some humans and are absent in others. We show, for the first time, that iso bile acids are produced by Ruminococcus gnavus, a far more abundant commensal than previously known producers; and that the iso bile acid pathway detoxifies deoxycholic acid, favoring the growth of the keystone genus Bacteroides. By revealing the biosynthetic genes for an abundant class of bile acids, our work sets the stage for predicting and rationally altering the composition of the bile acid pool. PMID:26192599

  17. Biosynthetic pathway for acrylic acid from glycerol in recombinant Escherichia coli.

    PubMed

    Tong, Wenhua; Xu, Ying; Xian, Mo; Niu, Wei; Guo, Jiantao; Liu, Huizhou; Zhao, Guang

    2016-06-01

    Acrylic acid is an important industrial feedstock. In this study, a de novo acrylate biosynthetic pathway from inexpensive carbon source glycerol was constructed in Escherichia coli. The acrylic acid was produced from glycerol via 3-hydroxypropionaldehyde, 3-hydroxypropionyl-CoA, and acrylyl-CoA. The acrylate production was improved by screening and site-directed mutagenesis of key enzyme enoyl-CoA hydratase and chromosomal integration of some exogenous genes. Finally, our recombinant strain produced 37.7 mg/L acrylic acid under shaking flask conditions. Although the acrylate production is low, our study shows feasibility of engineering an acrylate biosynthetic pathway from inexpensive carbon source. Furthermore, the reasons for limited acrylate production and further strain optimization that should be performed in the future were also discussed. PMID:26782744

  18. TREX: a universal tool for the transfer and expression of biosynthetic pathways in bacteria.

    PubMed

    Loeschcke, Anita; Markert, Annette; Wilhelm, Susanne; Wirtz, Astrid; Rosenau, Frank; Jaeger, Karl-Erich; Drepper, Thomas

    2013-01-18

    Secondary metabolites represent a virtually inexhaustible source of natural molecules exhibiting a high potential as pharmaceuticals or chemical building blocks. To gain broad access to these compounds, sophisticated expression systems are needed that facilitate the transfer and expression of large chromosomal regions, whose genes encode complex metabolic pathways. Here, we report on the development of the novel system for the transfer and expression of biosynthetic pathways (TREX), which comprises all functional elements necessary for the delivery and concerted expression of clustered pathway genes in different bacteria. TREX employs (i) conjugation for DNA transfer, (ii) randomized transposition for its chromosomal insertion, and (iii) T7 RNA polymerase for unimpeded bidirectional gene expression. The applicability of the TREX system was demonstrated by establishing the biosynthetic pathways of two pigmented secondary metabolites, zeaxanthin and prodigiosin, in bacteria with different metabolic capacities. Thus, TREX represents a valuable tool for accessing natural products by allowing comparative expression studies with clustered genes. PMID:23656323

  19. Activation and Characterization of a Cryptic Polycyclic Tetramate Macrolactam Biosynthetic Gene Cluster

    PubMed Central

    Luo, Yunzi; Huang, Hua; Liang, Jing; Wang, Meng; Lu, Lu; Shao, Zengyi; Cobb, Ryan E.; Zhao, Huimin

    2014-01-01

    Polycyclic tetramate macrolactams (PTMs) are a widely distributed class of natural products with important biological activities. However, many of them have not been characterized. Here we apply a plug and play synthetic biology strategy to activate a cryptic PTM biosynthetic gene cluster SGR810-815 from Streptomyces griseus and discover three potential PTMs. This gene cluster is highly conserved in phylogenetically diverse bacterial strains and contains an unusual hybrid polyketide synthase-nonribosomal peptide synthetase (PKS-NRPS) which resembles iterative PKSs known in fungi. To further characterize this gene cluster, we use the same synthetic biology approach to create a series of gene deletion constructs and elucidate the biosynthetic steps for the formation of the polycyclic system. The strategy we employ bypasses the traditional laborious processes to elicit gene cluster expression and should be generally applicable to many other silent or cryptic gene clusters for discovery and characterization of new natural products. PMID:24305602

  20. Evolution in the block: common elements of 5S rDNA organization and evolutionary patterns in distant fish genera.

    PubMed

    Campo, Daniel; García-Vázquez, Eva

    2012-01-01

    The 5S rDNA is organized in the genome as tandemly repeated copies of a structural unit composed of a coding sequence plus a nontranscribed spacer (NTS). The coding region is highly conserved in the evolution, whereas the NTS vary in both length and sequence. It has been proposed that 5S rRNA genes are members of a gene family that have arisen through concerted evolution. In this study, we describe the molecular organization and evolution of the 5S rDNA in the genera Lepidorhombus and Scophthalmus (Scophthalmidae) and compared it with already known 5S rDNA of the very different genera Merluccius (Merluccidae) and Salmo (Salmoninae), to identify common structural elements or patterns for understanding 5S rDNA evolution in fish. High intra- and interspecific diversity within the 5S rDNA family in all the genera can be explained by a combination of duplications, deletions, and transposition events. Sequence blocks with high similarity in all the 5S rDNA members across species were identified for the four studied genera, with evidences of intense gene conversion within noncoding regions. We propose a model to explain the evolution of the 5S rDNA, in which the evolutionary units are blocks of nucleotides rather than the entire sequences or single nucleotides. This model implies a "two-speed" evolution: slow within blocks (homogenized by recombination) and fast within the gene family (diversified by duplications and deletions).

  1. Strong nondipole effects in low-energy photoionization of the 5s and 5p subshells of xenon

    SciTech Connect

    Johnson, W. R.; Cheng, K. T.

    2001-02-01

    Large nondipole effects are predicted in the angular distribution of photoelectrons from the 5s and 5p subshells of xenon for photon energies below 200 eV. The nondipole parameter {gamma}{sub 5s} exhibits a dispersion-curve variation near the first minimum of the 5s cross section at 35 eV, reaching a minimum value of -0.8 near 40 eV. Rapid variation of {gamma}{sub 5s} is also found near the second minimum of the 5s cross section at 150 eV, where {gamma}{sub 5s} reaches a maximum value of 1.2. Smaller, but significant, nondipole effects are also found in the parameter {zeta}{sub 5p}={gamma}{sub 5p}+3{delta}{sub 5p}, which has a maximum value of 0.15 near 50 eV, and a second maximum value of 0.18 near 160 eV. The higher energy maxima in {gamma}{sub 5s} and {zeta}{sub 5p} arise from correlation enhanced by shape resonances in the 4p{yields}f quadrupole photoionization channels. These predictions are based on relativistic random-phase approximation calculations in which excitations from 5p, 5s, 4d, 4p, and 4s subshells are coupled.

  2. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    PubMed

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-07

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  3. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site

    NASA Astrophysics Data System (ADS)

    Calviño, Fabiola R.; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  4. Investigation of Proposed Ladderane Biosynthetic Genes from Anammox Bacteria by Heterologous Expression in E. coli.

    PubMed

    Javidpour, Pouya; Deutsch, Samuel; Mutalik, Vivek K; Hillson, Nathan J; Petzold, Christopher J; Keasling, Jay D; Beller, Harry R

    2016-01-01

    Ladderanes are hydrocarbon chains with three or five linearly concatenated cyclobutane rings that are uniquely produced as membrane lipid components by anammox (anaerobic ammonia-oxidizing) bacteria. By virtue of their angle and torsional strain, ladderanes are unusually energetic compounds, and if produced biochemically by engineered microbes, could serve as renewable, high-energy-density jet fuel components. The biochemistry and genetics underlying the ladderane biosynthetic pathway are unknown, however, previous studies have identified a pool of 34 candidate genes from the anammox bacterium, Kuenenia stuttgartiensis, some or all of which may be involved with ladderane fatty acid biosynthesis. The goal of the present study was to establish a systematic means of testing the candidate genes from K. stuttgartiensis for involvement in ladderane biosynthesis through heterologous expression in E. coli under anaerobic conditions. This study describes an efficient means of assembly of synthesized, codon-optimized candidate ladderane biosynthesis genes in synthetic operons that allows for changes to regulatory element sequences, as well as modular assembly of multiple operons for simultaneous heterologous expression in E. coli (or potentially other microbial hosts). We also describe in vivo functional tests of putative anammox homologs of the phytoene desaturase CrtI, which plays an important role in the hypothesized ladderane pathway, and a method for soluble purification of one of these enzymes. This study is, to our knowledge, the first experimental effort focusing on the role of specific anammox genes in the production of ladderanes, and lays the foundation for future efforts toward determination of the ladderane biosynthetic pathway. Our substantial, but far from comprehensive, efforts at elucidating the ladderane biosynthetic pathway were not successful. We invite the scientific community to take advantage of the considerable synthetic biology resources and

  5. Investigation of Proposed Ladderane Biosynthetic Genes from Anammox Bacteria by Heterologous Expression in E. coli.

    PubMed

    Javidpour, Pouya; Deutsch, Samuel; Mutalik, Vivek K; Hillson, Nathan J; Petzold, Christopher J; Keasling, Jay D; Beller, Harry R

    2016-01-01

    Ladderanes are hydrocarbon chains with three or five linearly concatenated cyclobutane rings that are uniquely produced as membrane lipid components by anammox (anaerobic ammonia-oxidizing) bacteria. By virtue of their angle and torsional strain, ladderanes are unusually energetic compounds, and if produced biochemically by engineered microbes, could serve as renewable, high-energy-density jet fuel components. The biochemistry and genetics underlying the ladderane biosynthetic pathway are unknown, however, previous studies have identified a pool of 34 candidate genes from the anammox bacterium, Kuenenia stuttgartiensis, some or all of which may be involved with ladderane fatty acid biosynthesis. The goal of the present study was to establish a systematic means of testing the candidate genes from K. stuttgartiensis for involvement in ladderane biosynthesis through heterologous expression in E. coli under anaerobic conditions. This study describes an efficient means of assembly of synthesized, codon-optimized candidate ladderane biosynthesis genes in synthetic operons that allows for changes to regulatory element sequences, as well as modular assembly of multiple operons for simultaneous heterologous expression in E. coli (or potentially other microbial hosts). We also describe in vivo functional tests of putative anammox homologs of the phytoene desaturase CrtI, which plays an important role in the hypothesized ladderane pathway, and a method for soluble purification of one of these enzymes. This study is, to our knowledge, the first experimental effort focusing on the role of specific anammox genes in the production of ladderanes, and lays the foundation for future efforts toward determination of the ladderane biosynthetic pathway. Our substantial, but far from comprehensive, efforts at elucidating the ladderane biosynthetic pathway were not successful. We invite the scientific community to take advantage of the considerable synthetic biology resources and

  6. Biosynthetic Study on Antihypercholesterolemic Agent Phomoidride: General Biogenesis of Fungal Dimeric Anhydrides.

    PubMed

    Fujii, Ryuya; Matsu, Yusuke; Minami, Atsushi; Nagamine, Shota; Takeuchi, Ichiro; Gomi, Katsuya; Oikawa, Hideaki

    2015-11-20

    To elucidate the general biosynthetic pathway of fungal dimeric anhydrides, a gene cluster for the biosynthesis of the antihy-percholesterolemic agent phomoidride was identified by heterologous expression of candidate genes encoding the highly reducing polyketide synthase, alkylcitrate synthase (ACS), and alkylcitrate dehydratase (ACDH). An in vitro analysis of ACS and ACDH revealed that they give rise to anhydride monomers. Based on the established monomer biosynthesis, we propose a general biogenesis of dimeric anhydrides involving a single donor unit and four acceptor units.

  7. Diversity in Biosynthetic Pathways of Galactolipids in the Light of Endosymbiotic Origin of Chloroplasts

    PubMed Central

    Sato, Naoki; Awai, Koichiro

    2016-01-01

    Cyanobacteria and chloroplasts perform oxygenic photosynthesis, and share a common origin. Galactolipids are present in the photosynthetic membranes of both cyanobacteria and chloroplasts, but the biosynthetic pathways of the galactolipids are significantly different in the two systems. In this minireview, we explain the history of the discovery of the cyanobacterial pathway, and present a probable scenario of the evolution of the two pathways. PMID:26904079

  8. Investigation of Proposed Ladderane Biosynthetic Genes from Anammox Bacteria by Heterologous Expression in E. coli

    PubMed Central

    Javidpour, Pouya; Deutsch, Samuel; Mutalik, Vivek K.; Hillson, Nathan J.; Petzold, Christopher J.; Keasling, Jay D.; Beller, Harry R.

    2016-01-01

    Ladderanes are hydrocarbon chains with three or five linearly concatenated cyclobutane rings that are uniquely produced as membrane lipid components by anammox (anaerobic ammonia-oxidizing) bacteria. By virtue of their angle and torsional strain, ladderanes are unusually energetic compounds, and if produced biochemically by engineered microbes, could serve as renewable, high-energy-density jet fuel components. The biochemistry and genetics underlying the ladderane biosynthetic pathway are unknown, however, previous studies have identified a pool of 34 candidate genes from the anammox bacterium, Kuenenia stuttgartiensis, some or all of which may be involved with ladderane fatty acid biosynthesis. The goal of the present study was to establish a systematic means of testing the candidate genes from K. stuttgartiensis for involvement in ladderane biosynthesis through heterologous expression in E. coli under anaerobic conditions. This study describes an efficient means of assembly of synthesized, codon-optimized candidate ladderane biosynthesis genes in synthetic operons that allows for changes to regulatory element sequences, as well as modular assembly of multiple operons for simultaneous heterologous expression in E. coli (or potentially other microbial hosts). We also describe in vivo functional tests of putative anammox homologs of the phytoene desaturase CrtI, which plays an important role in the hypothesized ladderane pathway, and a method for soluble purification of one of these enzymes. This study is, to our knowledge, the first experimental effort focusing on the role of specific anammox genes in the production of ladderanes, and lays the foundation for future efforts toward determination of the ladderane biosynthetic pathway. Our substantial, but far from comprehensive, efforts at elucidating the ladderane biosynthetic pathway were not successful. We invite the scientific community to take advantage of the considerable synthetic biology resources and

  9. Comment on Asymmetric Syntheses of Sceptrin and Massadine and Evidence for Biosynthetic Enantiodivergence*

    PubMed Central

    Sherman, David H.; Tsukamoto, Sachiko; Williams, Robert M.

    2015-01-01

    Ma, et al. (Reports, 10 October 2014, p. 219) report asymmetric syntheses of Sceptrin and Massadine and through a stereochemical reassignment, claim to “..uncover enantiodivergence as a new biosynthetic paradigm for natural products.” This Technical Comment challenges and clarifies this claim with relevant examples from the literature of this well-known phenomenon of enantiodivergent congener biosynthesis within the same producing organism. PMID:26160938

  10. Structure of Nampt/PBEF/visfatin, a mammalian NAD[superscript +]biosynthetic enzyme

    SciTech Connect

    Wang, Tao; Zhang, Xiangbin; Bheda, Poonam; Revollo, Javier R.; Imai, Shin-ichiro; Wolberger, Cynthia

    2010-07-22

    Nicotinamide phosphoribosyltransferase (Nampt) synthesizes nicotinamide mononucleotide (NMN) from nicotinamide in a mammalian NAD{sup +} biosynthetic pathway and is required for SirT1 activity in vivo. Nampt has also been presumed to be a cytokine (PBEF) or a hormone (visfatin). The crystal structure of Nampt in the presence and absence of NMN shows that Nampt is a dimeric type II phosphoribosyltransferase and provides insights into the enzymatic mechanism.

  11. Contribution of trehalose biosynthetic pathway to drought stress tolerance of Capparis ovata Desf.

    PubMed

    Ilhan, S; Ozdemir, F; Bor, M

    2015-03-01

    Trehalose and the trehalose biosynthetic pathway are important contributors and regulators of stress responses in plants. Among recent findings for trehalose and its metabolism, the role of signalling in the regulation of growth and development and its potential for use as a storage energy source can be listed. The xerophytic plant Capparis ovata (caper) is well adapted to drought and high temperature stress in arid and semi-arid regions of the Mediterranean. The contribution of trehalose and the trehalose biosynthetic pathway to drought stress responses and tolerance in C. ovata are not known. We investigated the effects of PEG-mediated drought stress in caper plants and analysed physiological parameters and trehalose biosynthetic pathway components, trehalose-6-phosphate synthase (TPS), trehalose-6-phosphate phosphatase (TPP), trehalase activity, trehalose and proline content in drought stress-treated and untreated plants. Our results indicated that trehalose and the trehalose biosynthetic pathway contributed to drought stress tolerance of C. ovata. Overall growth and leaf water status were not dramatically affected by drought, as both high relative growth rate and relative water content were recorded even after 14 days of drought stress. Trehalose accumulation increased in parallel to induced TPS and TPP activities and decreased trehalase activity in caper plants on day 14. Constitutive trehalose levels were 28.75 to 74.75 μg·g·FW(-1) , and drought stress significantly induced trehalose accumulation (385.25 μg·g·FW(-1) on day 14) in leaves of caper. On day 14 of drought, proline levels were lower than on day 7. Under drought stress the discrepancy between trehalose and proline accumulation trends might result from the mode of action of these osmoprotectant molecules in C. ovata.

  12. Studies Towards the Leucetta-derived Alkaloids Spirocalcaridine A and B – Possible Biosynthetic Implications

    PubMed Central

    Koswatta, Panduka B.; Das, Jayanta; Yousufuddin, Muhammed; Lovely, Carl J.

    2015-01-01

    An exploration of an abiotic approach to spirocalcaridines A and B is described centered on electrophile-induced dearomatizing spirocyclization of aryl enyne derivatives. Elaboration of the α–iodoenone via an Ullmann-like, copper-catalyzed amidation provided a formamide which upon treatment with methylamine undergoes a dienol-arene rearrangement, providing the corresponding kealiinine-like framework. This observation suggests a possible biosynthetic links between the spirocalcaridines and the naphthimidazole group of Leucetta alkaloids. PMID:26257576

  13. Plantago lagopus B Chromosome Is Enriched in 5S rDNA-Derived Satellite DNA.

    PubMed

    Kumke, Katrin; Macas, Jiří; Fuchs, Jörg; Altschmied, Lothar; Kour, Jasmeet; Dhar, Manoj K; Houben, Andreas

    2016-01-01

    B chromosomes are supernumerary dispensable parts of the karyotype which appear in some individuals of some populations in some species. Using advanced sequencing technology, we in silico characterized the high-copy DNA composition of Plantago lagopus with and without B chromosomes. The nuclear genome (2.46 pg/2C) was found to be relatively rich in repetitive sequences, with highly and moderately repeated elements making up 68% of the genome. Besides a centromere-specific marker, we identified a B-specific satellite and a repeat enriched in polymorphic A chromosome segments. The B-specific tandem repeat PLsatB originated from sequence amplification including 5S rDNA fragments. PMID:27173804

  14. The FERRUM project: Experimental transition probabilities from highly excited even 5s levels in Cr ii

    NASA Astrophysics Data System (ADS)

    Engström, L.; Lundberg, H.; Nilsson, H.; Hartman, H.; Bäckström, E.

    2014-10-01

    We report lifetime measurements of the five levels in the 3d4(a5D)5s e6D term in Cr ii at an energy around 83 000 cm-1, and log(gf) values for 38 transitions from the investigated levels. The lifetimes are obtained using time-resolved, laser-induced fluorescence on ions from a laser-produced plasma. Since the levels have the same parity as the low-lying states directly populated in the plasma, we used a two-photon excitation scheme. This process is greatly facilitated by the presence of the 3d4(a5D)4p z6F levels at roughly half the energy difference. The f-values are obtained by combining the experimental lifetimes with branching fractions derived using relative intensities from a hollow cathode lamp recorded with a Fourier transform spectrometer.

  15. Taxonomy of 5 S ribosomal RNA by the linguistic technique: probing with mitochondrial and mammalian sequences.

    PubMed

    Guimarães, R C; Trifonov, E N; Lagunez-Otero, J

    1997-09-01

    Linguistic similarities and dissimilarities between 5 S rRNA sequences allowed taxonomical separation of species and classes. Comparisons with the molecule from mammals distinguished fungi and plants from protists and animals. Similarities to mammalians progressively increased from protists to invertebrates and to somatic-type molecules of the vertebrates lineage. In this, deviations were detected in avian, oocyte type, and pseudogene sequences. Among bacteria, actinobacteria were most similar to the mammalians, which could be related to the high frequency of associations among members of these groups. Some archaebacterial species most similar to the mammalians belonged to the Thermoproteales and Halobacteria groups. Comparisons with the soybean mitochondrial molecule revealed high internal homogeneity among plant mitochondria. The eubacterial groups most similar to it were Thermus and Rhodobacteria gamma-1 and alpha-2. Other procedures have already indicated similarities of Rhodobacteria alpha to mitochondria but the linguistic similarities were on the average higher with the first two groups.

  16. Direct lateral interbody fusion (DLIF) at the lumbosacral junction L5-S1.

    PubMed

    Shirzadi, Ali; Birch, Kurtis; Drazin, Doniel; Liu, John C; Acosta, Frank

    2012-07-01

    The direct lateral interbody fusion (DLIF), a minimally invasive lateral approach for placement of an interbody fusion device, does not require nerve root retraction or any contact with the great vessels and can lead to short operative times with little blood loss. Due to anatomical restrictions, this procedure has not been used at the lumbosacral (L5-S1) junction. Lumbosacral transitional vertebrae (LSTV), a structural anomaly of the lumbosacral spine associated with low back pain, can result in a level being wrongly identified pre-operatively due to misnumbering of the vertebral levels. To our knowledge, use of the DLIF graft in this patient is the first report of an interbody fusion graft being placed at the disc space between the LSTV and S1 via the transpsoas route. We present a review of the literature regarding the LSTV variation as well as the lateral placement of interbody fusion grafts at the lumbosacral junction.

  17. Electric-dipole 5s - 5p Transitions in Promethiumlike Ions

    SciTech Connect

    Vilkas, M J; Ishikawa, Y; Trabert, E

    2008-02-29

    The 5s-5p electric-dipole resonance transitions in highly ionized promethiumlike ions have been studied applying relativistic multi-reference Moeller-Plesset second-order perturbation theory. The transition wavelengths are determined to within 0.2 {angstrom} in the more highly charged ions, where the level degeneracies are small. For somewhat lighter ions a very large reference space was used in order to account for the many degeneracies. In order to calculate transition probabilities and lifetimes, correlation corrections have been added to the transition operator in the next order. The contributions from the higher orders of the theory, that is, frequency-dependent Breit correction, Lamb shift, and mass shifts, have been estimated. The results are used to re-assess spectroscopic data from beam-foil, electron beam ion trap, and tokamak observations.

  18. Phylogenetic relationships among diploid Aegilops species inferred from 5S rDNA units.

    PubMed

    Baum, B R; Edwards, T; Johnson, D A

    2009-10-01

    Relationships among the currently recognized 11 diploid species within the genus Aegilops have been investigated. Sequence similarity analysis, based upon 363 sequenced 5S rDNA clones from 44 accessions plus 15 sequences retrieved from GenBank, depicted two unit classes labeled the long AE1 and short AE1. Several different analytical methods were applied to infer relationships within haplomes, between haplomes and among the species, including maximum parsimony and maximum likelihood analyses of consensus sequences, "total evidence" phylogeny analysis and "matrix representation with parsimony" analysis. None were able to depict suites of markers or unit classes that could discern among the seven haplomes as is observed among established haplomes in other genera within the tribe Triticeae; however, most species could be separated when displayed on gene trees. These results suggest that the haplomes currently recognized are so refined that they may be relegated as sub-haplomes or haplome variants. Amblyopyrum shares the same 5S rDNA unit classes with the diploid Aegilops species suggesting that it belongs within the latter. Comparisons of the Aegilops sequences with those of Triticum showed that the long AE1 unit class of Ae. tauschii shared the clade with the equivalent long D1 unit class, i.e., the putative D haplome donor, but the short AE1 unit class did not. The long AE1 unit class but not the short, of Ae. speltoides and Ae. searsii both share the clade with the previously identified long {S1 and long G1 unit classes meaning that both Aegilops species can be equally considered putative B haplome donors to tetraploid Triticum species. The semiconserved nature of the nontranscribed spacer in Aegilops and in Triticeae in general is discussed in view that it may have originated by processes of incomplete gene conversion or biased gene conversion or birth-and-death evolution.

  19. Measurement of {Upsilon}(5S) decays to B{sup 0} and B{sup +} mesons

    SciTech Connect

    Drutskoy, A.; Kinoshita, K.; Schwartz, A. J.; Adachi, I.; Haba, J.; Itoh, R.; Iwasaki, Y.; Katayama, N.; Kichimi, H.; Krokovny, P.; Nakao, M.; Nishida, S.; Sakai, Y.; Sumisawa, K.; Trabelsi, K.; Tsuboyama, T.; Uno, S.; Wicht, J.; Aihara, H.; Aulchenko, V.

    2010-06-01

    Decays of the {Upsilon}(5S) resonance to channels with B{sup +} and B{sup 0} mesons are studied using a 23.6 fb{sup -1} data sample collected with the Belle detector at the KEKB asymmetric-energy e{sup +}e{sup -} collider. Fully reconstructed B{sup +{yields}}J/{psi}K{sup +}, B{sup 0{yields}}J/{psi}K*{sup 0}, B{sup +{yields}}D{sup 0{pi}+}, and B{sup 0{yields}}D{sup -{pi}+} decays are used to obtain the charged and neutral B production rates per bb event, f(B{sup +})=(72.1{sub -3.8}{sup +3.9{+-}}5.0)% and f(B{sup 0})=(77.0{sub -5.6}{sup +5.8{+-}}6.1)%. Assuming equal rates to B{sup +} and B{sup 0} mesons in all channels produced at the {Upsilon}(5S) energy, we measure the fractions for transitions to two-body and three-body channels with B meson pairs, f(BB)=(5.5{sub -0.9}{sup +1.0{+-}}0.4)%, f(BB*+B*B)=(13.7{+-}1.3{+-}1.1)%, f(B*B*)=(37.5{sub -1.9}{sup +2.1{+-}}3.0)%, f(BB{pi})=(0.0{+-}1.2{+-}0.3)%, f(BB*{pi}+B*B{pi})=(7.3{sub -2.1}{sup +2.3{+-}}0.8)%, and f(B*B*{pi})=(1.0{sub -1.3}{sup +1.4{+-}}0.4)%. The latter three fractions are obtained assuming isospin conservation.

  20. Measuring B{sub s} width difference at the {Upsilon}(5s) using quantum entanglement

    SciTech Connect

    Atwood, David; Soni, Amarjit

    2010-08-01

    About 90% of B{sub s}B{sub s} pairs produced at the {Upsilon}(5s) resonance are initially B{sub s}{sup *}B{sub s}{sup *} pairs which decay radiatively to B{sub s}B{sub s}. This implies that the B{sub s}B{sub s} pair will then be in an eigenstate of charge conjugation (i.e. C=-1) and therefore in an entangled state. This allows for a determination of {Delta}{Gamma}{sub s}/{Gamma}{sub s} and the CP phase using a number of possible correlations between the decays of the two B{sub s} mesons. In particular, we consider the time integrated correlation, the time ordering asymmetry, and the time ordering-charge asymmetry, which in addition to time ordering distinguishes B{sub s} from B{sub s}, for various combinations of final states. With the statistics of about O(10{sup 7}-10{sup 8}) {Upsilon}(5s) events available at B factories, we find that the time ordering asymmetry between suitably defined hadronic and flavor specific (tagging) decays offers a promising method for determining the width difference. The corresponding time ordering-charge asymmetry can also bound the mixing phase. Similar observables involving exclusive decays are also considered. At the super B factories with O(50) times greater luminosity time ordering and time ordering-charge asymmetries between inclusive and exclusive modes may also provide additional bounds on the phases in those decays.

  1. Observation of B{sub s} Production at the {upsilon}(5S) Resonance

    SciTech Connect

    Bonvicini, G.; Cinabro, D.; Dubrovin, M.; Lincoln, A.; Bornheim, A.; Pappas, S.P.; Weinstein, A.; Asner, D.M.; Edwards, K.W.; Briere, R.A.; Chen, G.P.; Chen, J.; Ferguson, T.; Tatishvili, G.; Vogel, H.; Watkins, M.E.; Rosner, J.L.; Adam, N.E.; Alexander, J.P.; Berkelman, K.

    2006-01-20

    Using the CLEO detector at the Cornell Electron Storage Ring, we have observed the B{sub s} meson in e{sup +}e{sup -} annihilation at the {upsilon}(5S) resonance. We find 14 candidates consistent with B{sub s} decays into final states with a J/{psi} or a D{sub s}{sup (*)-}. The probability that we have observed a background fluctuation is less than 8x10{sup -10}. We have established that at the energy of the {upsilon}(5S) resonance B{sub s} production proceeds predominantly through the creation of B{sub s}*B{sub s}* pairs. We find {sigma}(e{sup +}e{sup -}{yields}B{sub s}*B{sub s}*)=[0.11{sub -0.03}{sup +0.04}(stat){+-}0.02(syst)] nb, and set the following limits: {sigma}(e{sup +}e{sup -}{yields}B{sub s}B{sub s})/{sigma}(e{sup +}e{sup -}{yields}B{sub s}*B{sub s}*)<0.16 and [{sigma}(e{sup +}e{sup -}{yields}B{sub s}B{sub s}*)+{sigma}(e{sup +}e{sup -}{yields}B{sub s}*B{sub s})]/{sigma}(e{sup +}e{sup -}{yields}B{sub s}*= B{sub s}*)<0.16 (90% C.L.). The mass of the B{sub s}* meson is measured to be M{sub B{sub s}}{sub *}=[5.414{+-}0.001(stat){+-}0.003(syst)] GeV/c{sup 2}.

  2. Classification of 5-S Epileptic EEG Recordings Using Distribution Entropy and Sample Entropy.

    PubMed

    Li, Peng; Karmakar, Chandan; Yan, Chang; Palaniswami, Marimuthu; Liu, Changchun

    2016-01-01

    Epilepsy is an electrophysiological disorder of the brain, the hallmark of which is recurrent and unprovoked seizures. Electroencephalogram (EEG) measures electrical activity of the brain that is commonly applied as a non-invasive technique for seizure detection. Although a vast number of publications have been published on intelligent algorithms to classify interictal and ictal EEG, it remains an open question whether they can be detected using short-length EEG recordings. In this study, we proposed three protocols to select 5 s EEG segment for classifying interictal and ictal EEG from normal. We used the publicly-accessible Bonn database, which consists of normal, interical, and ictal EEG signals with a length of 4097 sampling points (23.6 s) per record. In this study, we selected three segments of 868 points (5 s) length from each recordings and evaluated results for each of them separately. The well-studied irregularity measure-sample entropy (SampEn)-and a more recently proposed complexity measure-distribution entropy (DistEn)-were used as classification features. A total of 20 combinations of input parameters m and τ for the calculation of SampEn and DistEn were selected for compatibility. Results showed that SampEn was undefined for half of the used combinations of input parameters and indicated a large intra-class variance. Moreover, DistEn performed robustly for short-length EEG data indicating relative independence from input parameters and small intra-class fluctuations. In addition, it showed acceptable performance for all three classification problems (interictal EEG from normal, ictal EEG from normal, and ictal EEG from interictal) compared to SampEn, which showed better results only for distinguishing normal EEG from interictal and ictal. Both SampEn and DistEn showed good reproducibility and consistency, as evidenced by the independence of results on analysing protocol.

  3. Classification of 5-S Epileptic EEG Recordings Using Distribution Entropy and Sample Entropy

    PubMed Central

    Li, Peng; Karmakar, Chandan; Yan, Chang; Palaniswami, Marimuthu; Liu, Changchun

    2016-01-01

    Epilepsy is an electrophysiological disorder of the brain, the hallmark of which is recurrent and unprovoked seizures. Electroencephalogram (EEG) measures electrical activity of the brain that is commonly applied as a non-invasive technique for seizure detection. Although a vast number of publications have been published on intelligent algorithms to classify interictal and ictal EEG, it remains an open question whether they can be detected using short-length EEG recordings. In this study, we proposed three protocols to select 5 s EEG segment for classifying interictal and ictal EEG from normal. We used the publicly-accessible Bonn database, which consists of normal, interical, and ictal EEG signals with a length of 4097 sampling points (23.6 s) per record. In this study, we selected three segments of 868 points (5 s) length from each recordings and evaluated results for each of them separately. The well-studied irregularity measure—sample entropy (SampEn)—and a more recently proposed complexity measure—distribution entropy (DistEn)—were used as classification features. A total of 20 combinations of input parameters m and τ for the calculation of SampEn and DistEn were selected for compatibility. Results showed that SampEn was undefined for half of the used combinations of input parameters and indicated a large intra-class variance. Moreover, DistEn performed robustly for short-length EEG data indicating relative independence from input parameters and small intra-class fluctuations. In addition, it showed acceptable performance for all three classification problems (interictal EEG from normal, ictal EEG from normal, and ictal EEG from interictal) compared to SampEn, which showed better results only for distinguishing normal EEG from interictal and ictal. Both SampEn and DistEn showed good reproducibility and consistency, as evidenced by the independence of results on analysing protocol. PMID:27148074

  4. Understanding the carotenoid biosynthetic pathway through observation of four color variants of developing watermelon (Citrullus lanatus (Thunb.) Matsum. & Nanai)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The carotenoid biosynthetic pathway regulatory mechanisms leading to lycopene accumulation are well defined in the model fruit, tomato (Lycopersicon esculentum L.). The regulatory mechanisms leading to accumulation of other carotenoids and flesh colors, however, are poorly understood. The variety ...

  5. Identification and analysis of the paulomycin biosynthetic gene cluster and titer improvement of the paulomycins in Streptomyces paulus NRRL 8115.

    PubMed

    Li, Jine; Xie, Zhoujie; Wang, Min; Ai, Guomin; Chen, Yihua

    2015-01-01

    The paulomycins are a group of glycosylated compounds featuring a unique paulic acid moiety. To locate their biosynthetic gene clusters, the genomes of two paulomycin producers, Streptomyces paulus NRRL 8115 and Streptomyces sp. YN86, were sequenced. The paulomycin biosynthetic gene clusters were defined by comparative analyses of the two genomes together with the genome of the third paulomycin producer Streptomyces albus J1074. Subsequently, the identity of the paulomycin biosynthetic gene cluster was confirmed by inactivation of two genes involved in biosynthesis of the paulomycose branched chain (pau11) and the ring A moiety (pau18) in Streptomyces paulus NRRL 8115. After determining the gene cluster boundaries, a convergent biosynthetic model was proposed for paulomycin based on the deduced functions of the pau genes. Finally, a paulomycin high-producing strain was constructed by expressing an activator-encoding gene (pau13) in S. paulus, setting the stage for future investigations. PMID:25822496

  6. Structural Diversification of Lyngbyatoxin A by Host-Dependent Heterologous Expression of the tleABC Biosynthetic Gene Cluster.

    PubMed

    Zhang, Lihan; Hoshino, Shotaro; Awakawa, Takayoshi; Wakimoto, Toshiyuki; Abe, Ikuro

    2016-08-01

    Natural products have enormous structural diversity, yet little is known about how such diversity is achieved in nature. Here we report the structural diversification of a cyanotoxin-lyngbyatoxin A-and its biosynthetic intermediates by heterologous expression of the Streptomyces-derived tleABC biosynthetic gene cluster in three different Streptomyces hosts: S. lividans, S. albus, and S. avermitilis. Notably, the isolated lyngbyatoxin derivatives, including four new natural products, were biosynthesized by crosstalk between the heterologous tleABC gene cluster and the endogenous host enzymes. The simple strategy described here has expanded the structural diversity of lyngbyatoxin A and its biosynthetic intermediates, and provides opportunities for investigation of the currently underestimated hidden biosynthetic crosstalk.

  7. The Biosynthetic Gene Cluster of Zorbamycin, a Member of the Bleomycin Family of Antitumor Antibiotics, from Streptomyces flavoviridis ATCC 21892

    PubMed Central

    Galm, Ute; Wendt-Pienkowski, Evelyn; Wang, Liyan; George, Nicholas P.; Oh, Tae-Jin; Yi, Fan; Tao, Meifeng; Coughlin, Jane M.; Shen, Ben

    2011-01-01

    The biosynthetic gene cluster for the glycopeptide-derived antitumor antibiotic zorbamycin (ZBM) was cloned by screening a cosmid library of Streptomyces flavoviridis ATCC 21892. Sequence analysis revealed 40 ORFs belonging to the ZBM biosynthetic gene cluster. However, only 23 and 22 ORFs showed striking similarities to the biosynthetic gene clusters for the bleomycins (BLMs) and tallysomycins (TLMs), respectively; the remaining ORFs do not show significant homology to ORFs from the related BLM and TLM clusters. The ZBM gene cluster consists of 16 nonribosomal peptide synthetase (NRPS) genes encoding eight complete NRPS modules, three incomplete didomain NRPS modules, and eight freestanding single NRPS domains or associated enzymes, a polyketide synthase (PKS) gene encoding one PKS module, six sugar biosynthesis genes, as well as genes encoding other biosynthesis and resistance proteins. A genetic system using Escherichia coli-Streptomyces flavoviridis intergeneric conjugation was developed to enable ZBM gene cluster boundary determinations and biosynthetic pathway manipulations. PMID:19081934

  8. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    NASA Technical Reports Server (NTRS)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  9. A Genomics Based Discovery of Secondary Metabolite Biosynthetic Gene Clusters in Aspergillus ustus

    PubMed Central

    Pi, Borui; Yu, Dongliang; Dai, Fangwei; Song, Xiaoming; Zhu, Congyi; Li, Hongye; Yu, Yunsong

    2015-01-01

    Secondary metabolites (SMs) produced by Aspergillus have been extensively studied for their crucial roles in human health, medicine and industrial production. However, the resulting information is almost exclusively derived from a few model organisms, including A. nidulans and A. fumigatus, but little is known about rare pathogens. In this study, we performed a genomics based discovery of SM biosynthetic gene clusters in Aspergillus ustus, a rare human pathogen. A total of 52 gene clusters were identified in the draft genome of A. ustus 3.3904, such as the sterigmatocystin biosynthesis pathway that was commonly found in Aspergillus species. In addition, several SM biosynthetic gene clusters were firstly identified in Aspergillus that were possibly acquired by horizontal gene transfer, including the vrt cluster that is responsible for viridicatumtoxin production. Comparative genomics revealed that A. ustus shared the largest number of SM biosynthetic gene clusters with A. nidulans, but much fewer with other Aspergilli like A. niger and A. oryzae. These findings would help to understand the diversity and evolution of SM biosynthesis pathways in genus Aspergillus, and we hope they will also promote the development of fungal identification methodology in clinic. PMID:25706180

  10. Prolonged starvation drives reversible sequestration of lipid biosynthetic enzymes and organelle reorganization in Saccharomyces cerevisiae.

    PubMed

    Suresh, Harsha Garadi; da Silveira Dos Santos, Aline Xavier; Kukulski, Wanda; Tyedmers, Jens; Riezman, Howard; Bukau, Bernd; Mogk, Axel

    2015-05-01

    Cells adapt to changing nutrient availability by modulating a variety of processes, including the spatial sequestration of enzymes, the physiological significance of which remains controversial. These enzyme deposits are claimed to represent aggregates of misfolded proteins, protein storage, or complexes with superior enzymatic activity. We monitored spatial distribution of lipid biosynthetic enzymes upon glucose depletion in Saccharomyces cerevisiae. Several different cytosolic-, endoplasmic reticulum-, and mitochondria-localized lipid biosynthetic enzymes sequester into distinct foci. Using the key enzyme fatty acid synthetase (FAS) as a model, we show that FAS foci represent active enzyme assemblies. Upon starvation, phospholipid synthesis remains active, although with some alterations, implying that other foci-forming lipid biosynthetic enzymes might retain activity as well. Thus sequestration may restrict enzymes' access to one another and their substrates, modulating metabolic flux. Enzyme sequestrations coincide with reversible drastic mitochondrial reorganization and concomitant loss of endoplasmic reticulum-mitochondria encounter structures and vacuole and mitochondria patch organelle contact sites that are reflected in qualitative and quantitative changes in phospholipid profiles. This highlights a novel mechanism that regulates lipid homeostasis without profoundly affecting the activity status of involved enzymes such that, upon entry into favorable growth conditions, cells can quickly alter lipid flux by relocalizing their enzymes.

  11. Prolonged starvation drives reversible sequestration of lipid biosynthetic enzymes and organelle reorganization in Saccharomyces cerevisiae

    PubMed Central

    Suresh, Harsha Garadi; da Silveira dos Santos, Aline Xavier; Kukulski, Wanda; Tyedmers, Jens; Riezman, Howard; Bukau, Bernd; Mogk, Axel

    2015-01-01

    Cells adapt to changing nutrient availability by modulating a variety of processes, including the spatial sequestration of enzymes, the physiological significance of which remains controversial. These enzyme deposits are claimed to represent aggregates of misfolded proteins, protein storage, or complexes with superior enzymatic activity. We monitored spatial distribution of lipid biosynthetic enzymes upon glucose depletion in Saccharomyces cerevisiae. Several different cytosolic-, endoplasmic reticulum–, and mitochondria-localized lipid biosynthetic enzymes sequester into distinct foci. Using the key enzyme fatty acid synthetase (FAS) as a model, we show that FAS foci represent active enzyme assemblies. Upon starvation, phospholipid synthesis remains active, although with some alterations, implying that other foci-forming lipid biosynthetic enzymes might retain activity as well. Thus sequestration may restrict enzymes' access to one another and their substrates, modulating metabolic flux. Enzyme sequestrations coincide with reversible drastic mitochondrial reorganization and concomitant loss of endoplasmic reticulum–mitochondria encounter structures and vacuole and mitochondria patch organelle contact sites that are reflected in qualitative and quantitative changes in phospholipid profiles. This highlights a novel mechanism that regulates lipid homeostasis without profoundly affecting the activity status of involved enzymes such that, upon entry into favorable growth conditions, cells can quickly alter lipid flux by relocalizing their enzymes. PMID:25761633

  12. A simple biosynthetic pathway for large product generation from small substrate amounts

    NASA Astrophysics Data System (ADS)

    Djordjevic, Marko; Djordjevic, Magdalena

    2012-10-01

    A recently emerging discipline of synthetic biology has the aim of constructing new biosynthetic pathways with useful biological functions. A major application of these pathways is generating a large amount of the desired product. However, toxicity due to the possible presence of toxic precursors is one of the main problems for such production. We consider here the problem of generating a large amount of product from a potentially toxic substrate. To address this, we propose a simple biosynthetic pathway, which can be induced in order to produce a large number of the product molecules, by keeping the substrate amount at low levels. Surprisingly, we show that the large product generation crucially depends on fast non-specific degradation of the substrate molecules. We derive an optimal induction strategy, which allows as much as three orders of magnitude increase in the product amount through biologically realistic parameter values. We point to a recently discovered bacterial immune system (CRISPR/Cas in E. coli) as a putative example of the pathway analysed here. We also argue that the scheme proposed here can be used not only as a stand-alone pathway, but also as a strategy to produce a large amount of the desired molecules with small perturbations of endogenous biosynthetic pathways.

  13. Pyrimidine biosynthetic enzymes of Salmonella typhimurium, repressed specifically by growth in the presence of cytidine.

    PubMed Central

    Kelln, R A; Kinahan, J J; Foltermann, K F; O'Donovan, G A

    1975-01-01

    The repressive effects of exogenous cytidine on growing cells was examined in a specially constructed strain in which the pool sizes of endogenous uridine 5'-diphosphate and uridine 5'-triphosphate cannot be varied by the addition of uracil and/or uridine to the medium. Five enzymes of the pyrimidine biosynthetic pathway and one enzyme of the arginine biosynthetic pathway were assayed from cells grown under a variety of conditions. Cytidine repressed the synthesis of dihydroorotase (encoded by pyrC), dihydroorotate dehydrogenase (encoded by pyrD), and ornithine transcarbamylase (encoded by argI). Moreover, aspartate transcarbamylase (encoded by pyrB) became further derepressed upon cytidine addition, whereas no change occurred in the levels of the last two enzymes (encoded by pyrE and pyrF) of the pyrimidine pathway. Quantitative nucleotide pool determinations have provided evidence that any individual ribo- or deoxyribonucleoside mono-, di-, or triphosphate of cytosine or uracil is not a repressing metabolite for the pyrimidine biosynthetic enzymes. Other nucleotide derivatives or ratios must be considered. PMID:1102530

  14. Biosynthesis of 3-hydroxy-5-methyl-o-methyltyrosine in the saframycin/ safracin biosynthetic pathway.

    PubMed

    Fu, Cheng-Yu; Tang, Man-Cheng; Peng, Chao; Li, Lei; He, Yan-Ling; Liu, Wen; Tang, Gong-Li

    2009-05-01

    The biosynthesis study of antibiotics saframycin (SFM) in Streptomyces lavendulae and safracin (SAC) in Pseudomonas fluorescens demonstrated that 3-hydroxy-5-methyl-Omethyltyrosine (3h5mOmTyr), a nonproteinogenic amino acid, is the precursor of the tetrahydroisoquinoline molecular core. In the biosynthetic gene cluster of SAC/SFM, sacD/ sfmD encodes a protein with high homology to each other but no sequence similarity to other known enzymes; sacF/ sfmM2 and sacG/sfmM3 encode methyltransferases for Cmethylation and O-methylation; and sacE/sfmF encodes a small protein with significant sequence similarity to the MbtH-like proteins, which are frequently found in the biosynthetic pathways of nonribosomal peptide antibiotics and siderophores. To address their function, the biosynthetic cassette of 3h5mOmTyr was heterologously expressed in S. coelicolor and P. putida, and an in-frame deletion and complementation in trans were carried out. The results revealed that (i) SfmD catalyzes the hydroxylation of aromatic rings;(ii) sacD/sacF/sacG in the SAC gene cluster and sfmD/sfmM2/sfmM3 in the SFM cluster are sufficient for the biosynthesis of 3h5mOmTyr; and (iii) the mbtH-like gene is not required for the biosynthesis of the 3h5mOmTyr precursor. PMID:19494690

  15. Characterization of two acetyltransferase genes in the pyripyropene biosynthetic gene cluster from Penicillium coprobium

    PubMed Central

    Hu, Jie; Furutani, Ayako; Yamamoto, Kentaro; Oyama, Kazuhiko; Mitomi, Masaaki; Anzai, Hiroyuki

    2014-01-01

    Pyripyropenes potently and selectively inhibit acyl-CoA:cholesterol acyltransferase 2 (ACAT-2). Among multiple isomers of pyripyropene (A to R), pyripyropene A (PyA) has insecticidal properties in addition to its growth inhibition properties against human umbilical vein endothelial cells. Based on the predicted biosynthetic gene cluster of pyripyropene A, two genes (ppb8 and ppb9) encoding two acetyltransferases (ATs) were separately isolated and introduced into the model fungus Aspergillus oryzae, using the protoplast–polyethylene glycol method. The bioconversion of certain predicted intermediates in the transformants revealed the manner by which acetylation occurred in the biosynthetic pathway by the products expressed by these two genes (AT-1 and AT-2). The acetylated products detected by high-performance liquid chromatography (HPLC) in the extracts from AT-1 and AT-2 transformant clones were not present in the extract from the transformant clone with an empty vector. The HLPC charts of each bioconversion study exhibited high peaks at 12, 10.5 and 9 min, respectively. Further ultraviolet absorption and mass spectrometry analyses identified the products as PyE, PyO and PyA, respectively. AT-1 acetylated the C-1 of deacetyl-pyripyropene E (deAc-PyE), while AT-2 played an active role in acetylating the C-11 of 11-deAc-PyO and C-7 of deAc-PyA at two different steps of the biosynthetic pathway. PMID:26019565

  16. Isolation and Characterization of the Gibberellin Biosynthetic Gene Cluster in Sphaceloma manihoticola▿ †

    PubMed Central

    Bömke, Christiane; Rojas, Maria Cecilia; Gong, Fan; Hedden, Peter; Tudzynski, Bettina

    2008-01-01

    Gibberellins (GAs) are tetracyclic diterpenoid phytohormones that were first identified as secondary metabolites of the fungus Fusarium fujikuroi (teleomorph, Gibberella fujikuroi). GAs were also found in the cassava pathogen Sphaceloma manihoticola, but the spectrum of GAs differed from that in F. fujikuroi. In contrast to F. fujikuroi, the GA biosynthetic pathway has not been studied in detail in S. manihoticola, and none of the GA biosynthetic genes have been cloned from the species. Here, we present the identification of the GA biosynthetic gene cluster from S. manihoticola consisting of five genes encoding a bifunctional ent-copalyl/ent-kaurene synthase (CPS/KS), a pathway-specific geranylgeranyl diphosphate synthase (GGS2), and three cytochrome P450 monooxygenases. The functions of all of the genes were analyzed either by a gene replacement approach or by complementing the corresponding F. fujikuroi mutants. The cluster organization and gene functions are similar to those in F. fujikuroi. However, the two border genes in the Fusarium cluster encoding the GA4 desaturase (DES) and the 13-hydroxylase (P450-3) are absent in the S. manihoticola GA gene cluster, consistent with the spectrum of GAs produced by this fungus. The close similarity between the two GA gene clusters, the identical gene functions, and the conserved intron positions suggest a common evolutionary origin despite the distant relatedness of the two fungi. PMID:18567680

  17. Characterization of Enzymes Catalyzing Transformations of Cysteine S-Conjugated Intermediates in the Lincosamide Biosynthetic Pathway.

    PubMed

    Ushimaru, Richiro; Lin, Chia-I; Sasaki, Eita; Liu, Hung-Wen

    2016-09-01

    Lincosamides such as lincomycin A, celesticetin, and Bu-2545, constitute an important group of antibiotics. These natural products are characterized by a thiooctose linked to a l-proline residue, but they differ with regards to modifications of the thioacetal moiety, the pyrrolidine ring, and the octose core. Here we report that the pyridoxal 5'-phosphate-dependent enzyme CcbF (celesticetin biosynthetic pathway) is a decarboxylating deaminase that converts a cysteine S-conjugated intermediate into an aldehyde. In contrast, the homologous enzyme LmbF (lincomycin biosynthetic pathway) catalyzes C-S bond cleavage of the same intermediate to afford a thioglycoside. We show that Ccb4 and LmbG (downstream methyltransferases) convert the aldehyde and thiol intermediates into a variety of methylated lincosamide compounds including Bu-2545. The substrates used in these studies are the β-anomers of the natural substrates. The findings not only provide insight into how the biosynthetic pathway of lincosamide antibiotics can bifurcate to generate different lincosamides, but also reveal the promiscuity of the enzymes involved. PMID:27431934

  18. Retention and loss of amino acid biosynthetic pathways based on analysis of whole-genome sequences.

    PubMed

    Payne, Samuel H; Loomis, William F

    2006-02-01

    Plants and fungi can synthesize each of the 20 amino acids by using biosynthetic pathways inherited from their bacterial ancestors. However, the ability to synthesize nine amino acids (Phe, Trp, Ile, Leu, Val, Lys, His, Thr, and Met) was lost in a wide variety of eukaryotes that evolved the ability to feed on other organisms. Since the biosynthetic pathways and their respective enzymes are well characterized, orthologs can be recognized in whole genomes to understand when in evolution pathways were lost. The pattern of pathway loss and retention was analyzed in the complete genomes of three early-diverging protist parasites, the amoeba Dictyostelium, and six animals. The nine pathways were lost independently in animals, Dictyostelium, Leishmania, Plasmodium, and Cryptosporidium. Seven additional pathways appear to have been lost in one or another parasite, demonstrating that they are dispensable in a nutrition-rich environment. Our predictions of pathways retained and pathways lost based on computational analyses of whole genomes are validated by minimal-medium studies with mammals, fish, worms, and Dictyostelium. The apparent selective advantages of retaining biosynthetic capabilities for amino acids available in the diet are considered.

  19. Cloning and characterization of the goadsporin biosynthetic gene cluster from Streptomyces sp. TP-A0584.

    PubMed

    Onaka, Hiroyasu; Nakaho, Mizuho; Hayashi, Keiko; Igarashi, Yasuhiro; Furumai, Tamotsu

    2005-12-01

    The biosynthetic gene cluster of goadsporin, a polypeptide antibiotic containing thiazole and oxazole rings, was cloned from Streptomyces sp. TP-A0584. The cluster contains a structural gene, godA, and nine god (goadsporin) genes involved in post-translational modification, immunity and transcriptional regulation. Although the gene organization is similar to typical bacteriocin biosynthetic gene clusters, each goadsporin biosynthetic gene shows low homology to these genes. Goadsporin biosynthesis is initiated by the translation of godA, and the subsequent cyclization, dehydration and acetylation are probably catalysed by godD, godE, godF, godG and godH gene products. godI shows high similarity to the 54 kDa subunit of the signal recognition particle and plays an important role in goadsporin immunity. Furthermore, four goadsporin analogues were produced by site-directed mutagenesis of godA, suggesting that this biosynthesis machinery is used for the heterocyclization of peptides. PMID:16339937

  20. Characterization of tiacumicin B biosynthetic gene cluster affording diversified tiacumicin analogues and revealing a tailoring dihalogenase.

    PubMed

    Xiao, Yi; Li, Sumei; Niu, Siwen; Ma, Liang; Zhang, Guangtao; Zhang, Haibo; Zhang, Gaiyun; Ju, Jianhua; Zhang, Changsheng

    2011-02-01

    The RNA polymerase inhibitor tiacumicin B is currently undergoing phase III clinical trial for treatment of Clostridium difficile associated diarrhea with great promise. To understand the biosynthetic logic and to lay a foundation for generating structural analogues via pathway engineering, the tiacumicin B biosynthetic gene cluster was identified and characterized from the producer Dactylosporangium aurantiacum subsp. hamdenensis NRRL 18085. Sequence analysis of a 110,633 bp DNA region revealed the presence of 50 open reading frames (orfs). Functional investigations of 11 orfs by in vivo inactivation experiments, preliminarily outlined the boundaries of the tia-gene cluster and suggested that 31 orfs were putatively involved in tiacumicin B biosynthesis. Functions of a halogenase (TiaM), two glycosyltransferases (TiaG1 and TiaG2), a sugar C-methyltransferase (TiaS2), an acyltransferase (TiaS6), and two cytochrome P450s (TiaP1 and TiaP2) were elucidated by isolation and structural characterization of the metabolites from the corresponding gene-inactivation mutants. Accumulation of 18 tiacumicin B analogues from 7 mutants not only provided experimental evidence to confirm the proposed functions of individual biosynthetic enzymes, but also set an example of accessing microbial natural product diversity via genetic approach. More importantly, biochemical characterization of the FAD-dependent halogenase TiaM reveals a sequentially acting dihalogenation step tailoring tiacumicin B biosynthesis.

  1. Identification and characterization of the biosynthetic gene cluster of polyoxypeptin A, a potent apoptosis inducer

    PubMed Central

    2014-01-01

    Background Polyoxypeptin A was isolated from a culture broth of Streptomyces sp. MK498-98 F14, which has a potent apoptosis-inducing activity towards human pancreatic carcinoma AsPC-1 cells. Structurally, polyoxypeptin A is composed of a C15 acyl side chain and a nineteen-membered cyclodepsipeptide core that consists of six unusual nonproteinogenic amino acid residues (N-hydroxyvaline, 3-hydroxy-3-methylproline, 5-hydroxypiperazic acid, N-hydroxyalanine, piperazic acid, and 3-hydroxyleucine) at high oxidation states. Results A gene cluster containing 37 open reading frames (ORFs) has been sequenced and analyzed for the biosynthesis of polyoxypeptin A. We constructed 12 specific gene inactivation mutants, most of which abolished the production of polyoxypeptin A and only ΔplyM mutant accumulated a dehydroxylated analogue polyoxypeptin B. Based on bioinformatics analysis and genetic data, we proposed the biosynthetic pathway of polyoxypeptin A and biosynthetic models of six unusual amino acid building blocks and a PKS extender unit. Conclusions The identified gene cluster and proposed pathway for the biosynthesis of polyoxypeptin A will pave a way to understand the biosynthetic mechanism of the azinothricin family natural products and provide opportunities to apply combinatorial biosynthesis strategy to create more useful compounds. PMID:24506891

  2. Amplification of the entire kanamycin biosynthetic gene cluster during empirical strain improvement of Streptomyces kanamyceticus.

    PubMed

    Yanai, Koji; Murakami, Takeshi; Bibb, Mervyn

    2006-06-20

    Streptomyces kanamyceticus 12-6 is a derivative of the wild-type strain developed for industrial kanamycin (Km) production. Southern analysis and DNA sequencing revealed amplification of a large genomic segment including the entire Km biosynthetic gene cluster in the chromosome of strain 12-6. At 145 kb, the amplifiable unit of DNA (AUD) is the largest AUD reported in Streptomyces. Striking repetitive DNA sequences belonging to the clustered regularly interspaced short palindromic repeats family were found in the AUD and may play a role in its amplification. Strain 12-6 contains a mixture of different chromosomes with varying numbers of AUDs, sometimes exceeding 36 copies and producing an amplified region >5.7 Mb. The level of Km production depended on the copy number of the Km biosynthetic gene cluster, suggesting that DNA amplification occurred during strain improvement as a consequence of selection for increased Km resistance. Amplification of DNA segments including entire antibiotic biosynthetic gene clusters might be a common mechanism leading to increased antibiotic production in industrial strains.

  3. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells

    PubMed Central

    Cao, Weibiao

    2016-01-01

    Mechanisms of the progression from Barrett’s esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK) inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA. PMID:26901778

  4. Two distinct structural elements of 5S rRNA are needed for its import into human mitochondria.

    PubMed

    Smirnov, Alexandre; Tarassov, Ivan; Mager-Heckel, Anne-Marie; Letzelter, Michel; Martin, Robert P; Krasheninnikov, Igor A; Entelis, Nina

    2008-04-01

    RNA import into mitochondria is a widespread phenomenon. Studied in details for yeast, protists, and plants, it still awaits thorough investigation for human cells, in which the nuclear DNA-encoded 5S rRNA is imported. Only the general requirements for this pathway have been described, whereas specific protein factors needed for 5S rRNA delivery into mitochondria and its structural determinants of import remain unknown. In this study, a systematic analysis of the possible role of human 5S rRNA structural elements in import was performed. Our experiments in vitro and in vivo show that two distinct regions of the human 5S rRNA molecule are needed for its mitochondrial targeting. One of them is located in the proximal part of the helix I and contains a conserved uncompensated G:U pair. The second and most important one is associated with the loop E-helix IV region with several noncanonical structural features. Destruction or even destabilization of these sites leads to a significant decrease of the 5S rRNA import efficiency. On the contrary, the beta-domain of the 5S rRNA was proven to be dispensable for import, and thus it can be deleted or substituted without affecting the 5S rRNA importability. This finding was used to demonstrate that the 5S rRNA can function as a vector for delivering heterologous RNA sequences into human mitochondria. 5S rRNA-based vectors containing a substitution of a part of the beta-domain by a foreign RNA sequence were shown to be much more efficiently imported in vivo than the wild-type 5S rRNA.

  5. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

    PubMed

    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

    2012-07-01

    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA.

  6. The nature of Z_b states from a combined analysis of Upsilon (5S)rightarrow h_b(mP) π ^+ π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{(*)}π

    NASA Astrophysics Data System (ADS)

    Huo, Wen-Sheng; Chen, Guo-Ying

    2016-03-01

    With a combined analysis of data on Upsilon (5S)rightarrow h_b(1P,2P)π ^+π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{(*)}π in an effective field theory approach, we determine resonance parameters of Z_b states in two scenarios. In one scenario we assume that Z_b states are pure molecular states, while in the other one we assume that Z_b states contain compact components. We find that the present data favor that there should be some compact components inside Z_b^{(' )} associated with the molecular components. By fitting the invariant mass spectra of Upsilon (5S)rightarrow h_b(1P,2P)π ^+π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{*}π , we determine that the probability of finding the compact components in Z_b states may be as large as about 40 %.

  7. Two sequence classes of kinetoplastid 5S ribosomal RNA gene revealed among bodonid spliced leader RNA gene arrays.

    PubMed

    Santana, D M; Lukes, J; Sturm, N R; Campbell, D A

    2001-11-13

    The spliced leader RNA genes of Bodo saltans, Cryptobia helicis and Dimastigella trypaniformis were analyzed as molecular markers for additional taxa within the suborder Bodonina. The non-transcribed spacer regions were distinctive for each organism, and 5S rRNA genes were present in Bodo and Dimastigella but not in C. helicis. Two sequence classes of 5S rRNA were evident from analysis of the bodonid genes. The two classes of 5S rRNA genes were found in other Kinetoplastids independent of co-localization with the spliced leader RNA gene.

  8. Evolution of green plants as deduced from 5S rRNA sequences.

    PubMed

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other.

  9. Evolution of green plants as deduced from 5S rRNA sequences

    PubMed Central

    Hori, Hiroshi; Lim, Byung-Lak; Osawa, Syozo

    1985-01-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  10. Evolution of green plants as deduced from 5S rRNA sequences.

    PubMed

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  11. Hard X-ray XAFS beamline, BL5S1, at AichiSR

    NASA Astrophysics Data System (ADS)

    Tabuchi, M.; Asakura, H.; Morimoto, H.; Watanabe, N.; Takeda, Y.

    2016-05-01

    A XAFS beamline, BL5S1, had been operated at Aichi Synchrotron Radiation Center, Japan since March 2013. The beamline was designed for the measurements in the energy range from 5 to 20 keV. The photon flux of 6 x 1010 at around 9 keV and beam spot size of 0.5 x 0.3 mm at sample position are as good as designed. For the standard transmission XAFS measurement, both of the step- and quick- scan modes are available. Energy resolution at around 9keV is good enough to discuss the energy shift of the order of 0.1 eV or higher even when the measurements are conducted in the quick-scan mode. With several kinds of detectors for fluorescence and/or CEY detection mode measurements, and various kinds of sample holders which are supported by the XAFS measurement software, users easily obtain spectra for their samples. Such a standard, well operated and easy to access XAFS beamline must be very important to broaden the base of the XAFS society further.

  12. Potentials for modeling cold collisions between Na (3S) and Rb (5S) atoms

    SciTech Connect

    Pashov, A.; Docenko, O.; Tamanis, M.; Ferber, R.; Knoeckel, H.; Tiemann, E.

    2005-12-15

    The experimental characterization of the electronic states correlated to the asymptote of ground state Na (3S) and Rb (5S) atoms was expanded by spectroscopic data on a {sup 3}{sigma}{sup +} state levels using a high resolution Fourier transform spectroscopy technique. The hyperfine splitting of the a {sup 3}{sigma}{sup +} state levels was partially resolved and analyzed for both Na {sup 85}Rb and Na {sup 87}Rb isotopomers. Transitions to high lying levels of the a {sup 3}{sigma}{sup +} and X {sup 1}{sigma}{sup +} states were recorded simultaneously which enables one to determine long range parameters of the molecular potentials. Coupled channels calculations based on the Fourier grid method were finally applied for deriving accurate potential energy curves of the a {sup 3}{sigma}{sup +} and X {sup 1}{sigma}{sup +} states capable of a reliable description of cold collisions between Na and Rb atoms in their ground states. Scattering lengths and Feshbach resonances were calculated for some quantum states.

  13. Design and performance of a 1 MW-5 s high temperature superconductor magnetic energy storage system

    NASA Astrophysics Data System (ADS)

    Morandi, Antonio; Gholizad, Babak; Fabbri, Massimo

    2016-01-01

    The feasibility of a 1 MW-5 s superconducting magnetic energy storage (SMES) system based on state-of-the-art high-temperature superconductor (HTS) materials is investigated in detail. Both YBCO coated conductors and MgB2 are considered. A procedure for the electromagnetic design of the coil is introduced and the final layout is arrived at and compared for the two materials. The choice of the inductance of the coil is carried out as part of the design procedure. Both low-field (3 T) and high-field (8 T) designs are considered for the YBCO. AC losses during a complete charge/discharge cycle at full power are estimated and the cooling power needed for continuous operation is derived. The power conditioning system and control algorithms needed to carry out various operations are discussed in detail. Performances of the SMES system during voltage sag compensation, load leveling and power factor correction are investigated by means of numerical simulation.

  14. Eukaryotic origins: string analysis of 5S ribosomal RNA sequences from some relevant organisms.

    PubMed

    Nanney, D L; Mobley, D O; Preparata, R M; Meyer, E B; Simon, E M

    1991-04-01

    Using the PHYLOGEN tree-forming programs, we evaluate the published 5S rRNA sequences in certain of the files in the Berlin DataBank in an attempt to identify the connection between archaebacteria and the eukaryotic protists. These programs are based on methods of string analysis developed by Sankoff and others. Their discriminatory power is derived from their continuous realignment of sequences through repeated assessment of insertions and deletions as well as substitutions. The programs demonstrate that even these small molecules (ca. 120 bases) retain substantial records of evolutionary events that occurred over a billion years ago. The eukaryotes seem to have been derived from ancestors near the common origins of the halobacterial and Methanococcales groups. Identifying what might have been a primordial eukaryote is more difficult because several of the species considered as early derivatives from the common root are isolated species with large genetic differences from each other and from all other extant forms that have been sequenced. The ameboid, flagellated, and ciliated protists seem to have emerged nearly simultaneously from an ancient cluster, but the sarcodinid protozoa have preference as the group of most ancient origin. The euglenozoa and the ciliates are of later derivation. Our ability to tease plausible trees from such small molecules suggests that the mode of analysis rather than the size of the molecule is often a major limitation in the reconstruction of acceptable ancient phylogenics.(ABSTRACT TRUNCATED AT 250 WORDS)

  15. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    PubMed

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus. PMID:26959315

  16. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    PubMed

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus.

  17. Chromosomal localization and molecular characterization of three different 5S ribosomal DNA clusters in the sea urchin Paracentrotus lividus.

    PubMed

    Caradonna, Fabio; Bellavia, Daniele; Clemente, Ann Maria; Sisino, Giorgia; Barbieri, Rainer

    2007-09-01

    In this paper the chromosomal localization and molecular cloning and characterization of three 5S rDNA clusters of 700 bp (base pairs), 900 bp, and 950 bp in the sea urchin Paracentrotus lividus are reported. Southern blot hybridization demonstrated the existence of three 5S rDNA repeats of differing length in the P. lividus genome. Fluorescence in situ hybridization analysis, performed in parallel on both haploid and diploid metaphases and interphase nuclei using different 5S rDNA units as probes, localized these 5S rDNA clusters in 3 different pairs of P. lividus chromosomes. This is the first complete gene mapping not only in a sea urchin but also in the phylum of echinoderms as a whole. PMID:17893727

  18. Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

    PubMed

    Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

    2011-11-01

    Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

  19. Chromosomal localization of 18S and 5S rDNA using FISH in the genus Tor (Pisces, Cyprinidae).

    PubMed

    Singh, Mamta; Kumar, Ravindra; Nagpure, N S; Kushwaha, B; Gond, Indramani; Lakra, W S

    2009-12-01

    Dual color fluorescence in situ hybridization (FISH) was performed to study the simultaneous chromosomal localization of 18S and 5S ribosomal genes in the genus Tor for the first time. The 18S and 5S rDNAs in four Tor species were amplified, sequenced and mapped on the metaphase chromosomes. The number and distribution of 18S and 5S rDNA clusters were examined on metaphase chromosome spreads using FISH. The specimens of T. chelynoides, T. putitora and T. progeneius showed six bright fluorescent signals of 18S rDNA and T. tor exhibited ten such signals. The 5S rDNA signals were present only on one pair of chromosomes in all the four Tor species. Ag-NORs were observed on two pairs of chromosomes in T. chelynoides, T. putitora, T. progeneius and four pairs in T. tor. Comparison of the observed 18S rDNA FISH signals and Ag-NORs strongly suggested a possible inactivation of NORs localized at the telomeres of a subtelocentric and telocentric chromosome pairs in all four species. The 5S rDNA contained an identical 120 bp long coding region and 81 bp long highly divergent non-transcribed spacers in all species examined. 18S and 5S rDNA sequencing and chromosomal localization can be a useful genetic marker in species identification as well as phylogenetic and evolutionary studies.

  20. Phylogenetic origins of the plant mitochondrion based on a comparative analysis of 5S ribosomal RNA sequences

    NASA Technical Reports Server (NTRS)

    Villanueva, E.; Delihas, N.; Luehrsen, K. R.; Fox, G. E.; Gibson, J.

    1985-01-01

    The complete nucleotide sequences of 5S ribosomal RNAs from Rhodocyclus gelatinosa, Rhodobacter sphaeroides, and Pseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains. Rhodobacter sphaeroides is specifically related to Paracoccus denitrificans and Rc. gelatinosa is related to Ps. cepacia. These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found in P. denitrificans are present also in the 5S RNA of Rb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of obtaining these new sequences is that it is possible to clarify the phylogenetic origins of the plant mitochondrion. In particular, a close phylogenetic relationship is found between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely, Rb. sphaeroides, P. denitrificans, and Rhodospirillum rubrum.

  1. Localized frustration and binding-induced conformational change in recognition of 5S RNA by TFIIIA zinc finger.

    PubMed

    Tan, Cheng; Li, Wenfei; Wang, Wei

    2013-12-19

    Protein TFIIIA is composed of nine tandemly arranged Cys2His2 zinc fingers. It can bind either to the 5S RNA gene as a transcription factor or to the 5S RNA transcript as a chaperone. Although structural and biochemical data provided valuable information on the recognition between the TFIIIIA and the 5S DNA/RNA, the involved conformational motions and energetic factors contributing to the binding affinity and specificity remain unclear. In this work, we conducted MD simulations and MM/GBSA calculations to investigate the binding-induced conformational changes in the recognition of the 5S RNA by the central three zinc fingers of TFIIIA and the energetic factors that influence the binding affinity and specificity at an atomistic level. Our results revealed drastic interdomain conformational changes between these three zinc fingers, involving the exposure/burial of several crucial DNA/RNA binding residues, which can be related to the competition between DNA and RNA for the binding of TFIIIA. We also showed that the specific recognition between finger 4/finger 6 and the 5S RNA introduces frustrations to the nonspecific interactions between finger 5 and the 5S RNA, which may be important to achieve optimal binding affinity and specificity.

  2. Spook and Spookier code for stage-specific components of the ecdysone biosynthetic pathway in Diptera.

    PubMed

    Ono, Hajime; Rewitz, Kim F; Shinoda, Tetsuro; Itoyama, Kyo; Petryk, Anna; Rybczynski, Robert; Jarcho, Michael; Warren, James T; Marqués, Guillermo; Shimell, Mary Jane; Gilbert, Lawrence I; O'Connor, Michael B

    2006-10-15

    Ecdysteroids regulate many key developmental events in arthropods including molting and metamorphosis. Recently, members of the Drosophila Halloween group of genes, that are required for embryonic viability and cuticle deposition, have been shown to code for several cytochrome P450 enzymes that catalyze the terminal hydroxylation steps in the conversion of cholesterol to the molting hormone 20-hydroxyecdysone. These P450s are conserved in other insects and each is thought to function throughout development as the sole mediator of a particular biosynthetic step since, where analyzed, each is expressed at all stages of development and shows no closely related homolog in their respective genomes. In contrast, we show here that several dipteran genomes encode two novel, highly related, microsomal P450 enzymes, Cyp307A1 and Cyp307A2, that likely participate as stage-specific components of the ecdysone biosynthetic machinery. This hypothesis comes from the observation that Cyp307A1 is encoded by the Halloween gene spook (spo), but unlike other Halloween class genes, Dmspo is not expressed during the larval stages. In contrast, Cyp307a2, dubbed spookier (spok), is expressed primarily during larval stages within the prothoracic gland cells of the ring gland. RNAi mediated reduction in the expression of this heterochromatin localized gene leads to arrest at the first instar stage which can be rescued by feeding the larva 20E, E or ketodiol but not 7dC. In addition, spok expression is eliminated in larvae carrying mutations in molting defective (mld), a gene encoding a nuclear zinc finger protein that is required for production of ecdysone during Drosophila larval development. Intriguingly, mld is not present in the Bombyx mori genome, and we have identified only one spook homolog in both Bombyx and Manduca that is expressed in both embryos and larva. These studies suggest an evolutionary split between Diptera and Lepidoptera in how the ecdysone biosynthetic pathway is

  3. Divisions of labor in the thiamin biosynthetic pathway among organs of maize.

    PubMed

    Guan, Jiahn-Chou; Hasnain, Ghulam; Garrett, Timothy J; Chase, Christine D; Gregory, Jesse; Hanson, Andrew D; McCarty, Donald R

    2014-01-01

    The B vitamin thiamin is essential for central metabolism in all cellular organisms including plants. While plants synthesize thiamin de novo, organs vary widely in their capacities for thiamin synthesis. We use a transcriptomics approach to appraise the distribution of de novo synthesis and thiamin salvage pathways among organs of maize. We identify at least six developmental contexts in which metabolically active, non-photosynthetic organs exhibit low expression of one or both branches of the de novo thiamin biosynthetic pathway indicating a dependence on inter-cellular transport of thiamin and/or thiamin precursors. Neither the thiazole (THI4) nor pyrimidine (THIC) branches of the pathway are expressed in developing pollen implying a dependence on import of thiamin from surrounding floral and inflorescence organs. Consistent with that hypothesis, organs of the male inflorescence and flowers are shown to have high relative expression of the thiamin biosynthetic pathway and comparatively high thiamin contents. By contrast, divergent patterns of THIC and THI4 expression occur in the shoot apical meristem, embyro sac, embryo, endosperm, and root-tips suggesting that these sink organs acquire significant amounts of thiamin via salvage pathways. In the root and shoot meristems, expression of THIC in the absence of THI4 indicates a capacity for thiamin synthesis via salvage of thiazole, whereas the opposite pattern obtains in embryo and endosperm implying that seed storage organs are poised for pyrimidine salvage. Finally, stable isotope labeling experiments set an upper limit on the rate of de novo thiamin biosynthesis in maize leaf explants. Overall, the observed patterns of thiamin biosynthetic gene expression mirror the strategies for thiamin acquisition that have evolved in bacteria.

  4. Genomics-driven discovery of the pneumocandin biosynthetic gene cluster in the fungus Glarea lozoyensis

    PubMed Central

    2013-01-01

    Background The antifungal therapy caspofungin is a semi-synthetic derivative of pneumocandin B0, a lipohexapeptide produced by the fungus Glarea lozoyensis, and was the first member of the echinocandin class approved for human therapy. The nonribosomal peptide synthetase (NRPS)-polyketide synthases (PKS) gene cluster responsible for pneumocandin biosynthesis from G. lozoyensis has not been elucidated to date. In this study, we report the elucidation of the pneumocandin biosynthetic gene cluster by whole genome sequencing of the G. lozoyensis wild-type strain ATCC 20868. Results The pneumocandin biosynthetic gene cluster contains a NRPS (GLNRPS4) and a PKS (GLPKS4) arranged in tandem, two cytochrome P450 monooxygenases, seven other modifying enzymes, and genes for L-homotyrosine biosynthesis, a component of the peptide core. Thus, the pneumocandin biosynthetic gene cluster is significantly more autonomous and organized than that of the recently characterized echinocandin B gene cluster. Disruption mutants of GLNRPS4 and GLPKS4 no longer produced the pneumocandins (A0 and B0), and the Δglnrps4 and Δglpks4 mutants lost antifungal activity against the human pathogenic fungus Candida albicans. In addition to pneumocandins, the G. lozoyensis genome encodes a rich repertoire of natural product-encoding genes including 24 PKSs, six NRPSs, five PKS-NRPS hybrids, two dimethylallyl tryptophan synthases, and 14 terpene synthases. Conclusions Characterization of the gene cluster provides a blueprint for engineering new pneumocandin derivatives with improved pharmacological properties. Whole genome estimation of the secondary metabolite-encoding genes from G. lozoyensis provides yet another example of the huge potential for drug discovery from natural products from the fungal kingdom. PMID:23688303

  5. Spook and Spookier code for stage-specific components of the ecdysone biosynthetic pathway in Diptera.

    PubMed

    Ono, Hajime; Rewitz, Kim F; Shinoda, Tetsuro; Itoyama, Kyo; Petryk, Anna; Rybczynski, Robert; Jarcho, Michael; Warren, James T; Marqués, Guillermo; Shimell, Mary Jane; Gilbert, Lawrence I; O'Connor, Michael B

    2006-10-15

    Ecdysteroids regulate many key developmental events in arthropods including molting and metamorphosis. Recently, members of the Drosophila Halloween group of genes, that are required for embryonic viability and cuticle deposition, have been shown to code for several cytochrome P450 enzymes that catalyze the terminal hydroxylation steps in the conversion of cholesterol to the molting hormone 20-hydroxyecdysone. These P450s are conserved in other insects and each is thought to function throughout development as the sole mediator of a particular biosynthetic step since, where analyzed, each is expressed at all stages of development and shows no closely related homolog in their respective genomes. In contrast, we show here that several dipteran genomes encode two novel, highly related, microsomal P450 enzymes, Cyp307A1 and Cyp307A2, that likely participate as stage-specific components of the ecdysone biosynthetic machinery. This hypothesis comes from the observation that Cyp307A1 is encoded by the Halloween gene spook (spo), but unlike other Halloween class genes, Dmspo is not expressed during the larval stages. In contrast, Cyp307a2, dubbed spookier (spok), is expressed primarily during larval stages within the prothoracic gland cells of the ring gland. RNAi mediated reduction in the expression of this heterochromatin localized gene leads to arrest at the first instar stage which can be rescued by feeding the larva 20E, E or ketodiol but not 7dC. In addition, spok expression is eliminated in larvae carrying mutations in molting defective (mld), a gene encoding a nuclear zinc finger protein that is required for production of ecdysone during Drosophila larval development. Intriguingly, mld is not present in the Bombyx mori genome, and we have identified only one spook homolog in both Bombyx and Manduca that is expressed in both embryos and larva. These studies suggest an evolutionary split between Diptera and Lepidoptera in how the ecdysone biosynthetic pathway is

  6. Coibacins A-D, Anti-leishmanial Marine Cyanobacterial Polyketides with Intriguing Biosynthetic Origins

    PubMed Central

    Balunas, Marcy J.; Grosso, Manuel F.; Villa, Francisco A.; Engene, Niclas; McPhail, Kerry L.; Tidgewell, Kevin; Pineda, Laura M.; Gerwick, Lena; Spadafora, Carmenza; Kyle, Dennis E.; Gerwick, William H.

    2012-01-01

    Four unsaturated polyketide lactone derivatives, coibacins A-D, were isolated from a Panamanian marine cyanobacterium, cf. Oscillatoria sp. The two different types of termini observed in these co-occurring metabolites, either a methyl cyclopropyl ring as seen in curacin A or a methyl vinyl chloride similar to that observed in the jamaicamides, suggest an intriguing flexibility in the “beta branch” forming biosynthetic process. The coibacins possess selective anti-leishmanial activity as well as potent anti-inflammatory activity. PMID:22794317

  7. Comparison of tryptophan biosynthetic operon regulation in different Gram-positive bacterial species.

    PubMed

    Gutiérrez-Preciado, Ana; Yanofsky, Charles; Merino, Enrique

    2007-09-01

    The tryptophan biosynthetic operon has been widely used as a model system for studying transcription regulation. In Bacillus subtilis, the trp operon is primarily regulated by a tryptophan-activated RNA-binding protein, TRAP. Here we show that in many other Gram-positive species the trp operon is regulated differently, by tRNA(Trp) sensing by the RNA-based T-box mechanism, with T-boxes arranged in tandem. Our analyses reveal an apparent relationship between trp operon organization and the specific regulatory mechanism(s) used. PMID:17555843

  8. Regulation of the cholesterol biosynthetic pathway and its integration with fatty acid biosynthesis in the oleaginous microalga Nannochloropsis oceanica

    PubMed Central

    2014-01-01

    Background Sterols are vital structural and regulatory components in eukaryotic cells; however, their biosynthetic pathways and functional roles in microalgae remain poorly understood. Results In the oleaginous microalga Nannochloropsis oceanica, the sterol biosynthetic pathway produces phytosterols as minor products and cholesterol as the major product. The evidence together with their deduced biosynthetic pathways suggests that N. oceanica exhibits features of both higher plants and mammals. Temporal tracking of sterol profiles and sterol-biosynthetic transcripts in response to changes in light intensity and nitrogen supply reveal that sterols play roles in cell proliferation, chloroplast differentiation, and photosynthesis. Furthermore, the dynamics of fatty acid (FA) and FA-biosynthetic transcripts upon chemical inhibitor-induced sterol depletion reveal possible co-regulation of sterol production and FA synthesis, in that the squalene epoxidase inhibitor terbinafine reduces sterol content yet significantly elevates free FA production. Thus, a feedback regulation of sterol and FA homeostasis is proposed, with the 1-deoxy-D-xylulose 5-phosphate synthase (DXS, the committed enzyme in isoprenoid and sterol biosynthesis) gene potentially subject to feedback regulation by sterols. Conclusion These findings reveal features of sterol function and biosynthesis in microalgae and suggest new genetic engineering or chemical biology approaches for enhanced oil production in microalgae. PMID:24920959

  9. Transcription of the Drosophila melanogaster 5S RNA gene requires an upstream promoter and four intragenic sequence elements

    SciTech Connect

    Sharp, S.J.; Garcia, A.D.

    1988-03-01

    Linker-scanning (LS) mutations were constructed spanning the length of the Drosophila melanogaster 5S RNA gene. In vitro transcription analysis of the LS 5S DNAs revealed five transcription control regions. One control region essential for the transcription initiation was identified in the 5'-flanking sequence. The major sequence determinants of this upstream promoter region were located between coordinates -39 and -26 (-30 region), but important sequences extended to the transcription start site at position 1. Since mutations in the upstream promoter did not alter the ability of 5S DNA to sequester transcription factors into a stable transcription complex, it appears that this control region involved the interaction of RNA polymerase III. Active 5S DNA transcription additionally required the four intragenic control regions (ICRs) located between coordinates 3 and 18 (ICR I), 37 and 44 (ICR II), 48 and 61 (ICR III), and 78 and 98 (ICR IV). LS mutations in each ICR decreased the ability of 5S DNA to sequester transcription factors. ICR III, ICR IV, and the spacer sequence between were similar in sequence and position to the determinant elements of the multipartite ICR of Xenopus 5S DNA. The importance of ICR III and ICR IV in transcription initiation and in sequestering transcription factors suggests the presence of an activity in D. melanogaster similar to transcription factor TFIIIA of Xenopus laevis and HeLa cells. Transcription initiation of Drosophila 5S DNA was not eliminated by LS mutations in the spacer region even though these mutations reduced the ability of the TFIIIA-like activity to bind.

  10. Partial sequence homogenization in the 5S multigene families may generate sequence chimeras and spurious results in phylogenetic reconstructions.

    PubMed

    Galián, José A; Rosato, Marcela; Rosselló, Josep A

    2014-03-01

    Multigene families have provided opportunities for evolutionary biologists to assess molecular evolution processes and phylogenetic reconstructions at deep and shallow systematic levels. However, the use of these markers is not free of technical and analytical challenges. Many evolutionary studies that used the nuclear 5S rDNA gene family rarely used contiguous 5S coding sequences due to the routine use of head-to-tail polymerase chain reaction primers that are anchored to the coding region. Moreover, the 5S coding sequences have been concatenated with independent, adjacent gene units in many studies, creating simulated chimeric genes as the raw data for evolutionary analysis. This practice is based on the tacitly assumed, but rarely tested, hypothesis that strict intra-locus concerted evolution processes are operating in 5S rDNA genes, without any empirical evidence as to whether it holds for the recovered data. The potential pitfalls of analysing the patterns of molecular evolution and reconstructing phylogenies based on these chimeric genes have not been assessed to date. Here, we compared the sequence integrity and phylogenetic behavior of entire versus concatenated 5S coding regions from a real data set obtained from closely related plant species (Medicago, Fabaceae). Our results suggest that within arrays sequence homogenization is partially operating in the 5S coding region, which is traditionally assumed to be highly conserved. Consequently, concatenating 5S genes increases haplotype diversity, generating novel chimeric genotypes that most likely do not exist within the genome. In addition, the patterns of gene evolution are distorted, leading to incorrect haplotype relationships in some evolutionary reconstructions.

  11. Contrasting patterns of the 5S and 45S rDNA evolutions in the Byblis liniflora complex (Byblidaceae).

    PubMed

    Fukushima, Kenji; Imamura, Kaori; Nagano, Katsuya; Hoshi, Yoshikazu

    2011-03-01

    To clarify the evolutionary dynamics of ribosomal RNA genes (rDNAs) in the Byblis liniflora complex (Byblidaceae), we investigated the 5S and 45S rDNA genes through (1) chromosomal physical mapping by fluorescence in situ hybridization (FISH) and (2) phylogenetic analyses using the nontranscribed spacer of 5S rDNA (5S-NTS) and the internal transcribed spacer of 45S rDNA (ITS). In addition, we performed phylogenetic analyses based on rbcL and trnK intron. The complex was divided into 2 clades: B. aquatica-B. filifolia and B. guehoi-B. liniflora-B. rorida. Although members of the complex had conservative symmetric karyotypes, they were clearly differentiated on chromosomal rDNA distribution patterns. The sequence data indicated that ITS was almost homogeneous in all taxa in which two or four 45S rDNA arrays were frequently found at distal regions of chromosomes in the somatic karyotype. ITS homogenization could have been prompted by relatively distal 45S rDNA positions. In contrast, 2-12 5S rDNA arrays were mapped onto proximal/interstitial regions of chromosomes, and some paralogous 5S-NTS were found in the genomes harboring 4 or more arrays. 5S-NTS sequence type-specific FISH analysis showed sequence heterogeneity within and between some 5S rDNA arrays. Interlocus homogenization may have been hampered by their proximal location on chromosomes. Chromosomal location may have affected the contrasting evolutionary dynamics of rDNAs in the B. liniflora complex.

  12. Seasonal dynamics of bacterioplankton community structure in a eutrophic lake as determined by 5S rRNA analysis.

    PubMed

    Höfle, M G; Haas, H; Dominik, K

    1999-07-01

    Community structure of bacterioplankton was studied during the major growth season for phytoplankton (April to October) in the epilimnion of a temperate eutrophic lake (Lake Plusssee, northern Germany) by using comparative 5S rRNA analysis. Estimates of the relative abundances of single taxonomic groups were made on the basis of the amounts of single 5S rRNA bands obtained after high-resolution electrophoresis of RNA directly from the bacterioplankton. Full-sequence analysis of single environmental 5S rRNAs enabled the identification of single taxonomic groups of bacteria. Comparison of partial 5S rRNA sequences allowed the detection of changes of single taxa over time. Overall, the whole bacterioplankton community showed two to eight abundant (>4% of the total 5S rRNA) taxa. A distinctive seasonal succession was observed in the taxonomic structure of this pelagic community. A rather-stable community structure, with seven to eight different taxonomic units, was observed beginning in April during the spring phytoplankton bloom. A strong reduction in this diversity occurred at the beginning of the clear-water phase (early May), when only two to four abundant taxa were observed, with one taxon dominating (up to 72% of the total 5S rRNA). The community structure during summer stagnation (June and July) was characterized by frequent changes of different dominating taxa. During late summer, a dinoflagellate bloom (Ceratium hirudinella) occurred, with Comamonas acidovorans (beta-subclass of the class Proteobacteria) becoming the dominant bacterial species (average abundance of 43% of the total 5S rRNA). Finally, the seasonal dynamics of the community structure of bacterioplankton were compared with the abundances of other major groups of the aquatic food web, such as phyto- and zooplankton, revealing that strong grazing pressure by zooplankton can reduce microbial diversity substantially in pelagic environments.

  13. Scalar resonance contributions to the dipion transition rates of {upsilon}(4S,5S) in the rescattering model

    SciTech Connect

    Meng Ce; Chao, K.-T.

    2008-04-01

    In order to explain the observed unusually large dipion transition rates of {upsilon}(10870), the scalar resonance contributions in the rescattering model to the dipion transitions of {upsilon}(4S) and {upsilon}(5S) are studied. Since the imaginary part of the rescattering amplitude is expected to be dominant, the large ratios of the transition rates of {upsilon}(10870), which is identified with {upsilon}(5S), to that of {upsilon}(4S) can be understood as mainly coming from the difference between the p values in their decays into open bottom channels, and the ratios are estimated numerically to be about 200-600 with reasonable choices of parameters. The absolute and relative rates of {upsilon}(5S){yields}{upsilon}(1S,2S,3S){pi}{sup +}{pi}{sup -} and {upsilon}(5S){yields}{upsilon}(1S)K{sup +}K{sup -} are roughly consistent with data. We emphasize that the dipion transitions observed for some of the newly discovered Y states associated with charmonia may have similar features to the dipion transitions of {upsilon}(5S). Measurements on the dipion transitions of {upsilon}(6S) could provide further tests for this mechanism.

  14. Binding site for Xenopus ribosomal protein L5 and accompanying structural changes in 5S rRNA.

    PubMed

    Scripture, J Benjamin; Huber, Paul W

    2011-05-10

    The structure of the eukaryotic L5-5S rRNA complex was investigated in protection and interference experiments and is compared with the corresponding structure (L18-5S rRNA) in the Haloarcula marismortui 50S subunit. In close correspondence with the archaeal structure, the contact sites for the eukaryotic ribosomal protein are located primarily in helix III and loop C and secondarily in loop A and helix V. While the former is unique to L5, the latter is also a critical contact site for transcription factor IIIA (TFIIIA), accounting for the mutually exclusive binding of these two proteins to 5S RNA. The binding of L5 causes structural changes in loops B and C that expose nucleotides that contact the Xenopus L11 ortholog in H. marismortui. This induced change in the structure of the RNA reveals the origins of the cooperative binding to 5S rRNA that has been observed for the bacterial counterparts of these proteins. The native structure of helix IV and loop D antagonizes binding of L5, indicating that this region of the RNA is dynamic and also influenced by the protein. Examination of the crystal structures of Thermus thermophilus ribosomes in the pre- and post-translocation states identified changes in loop D and in the surrounding region of 23S rRNA that support the proposal that 5S rRNA acts to transmit information between different functional domains of the large subunit.

  15. Biosynthetic Potential of Phylogenetically Unique Endophytic Actinomycetes from Tropical Plants▿ †

    PubMed Central

    Janso, Jeffrey E.; Carter, Guy T.

    2010-01-01

    The culturable diversity of endophytic actinomycetes associated with tropical, native plants is essentially unexplored. In this study, 123 endophytic actinomycetes were isolated from tropical plants collected from several locations in Papua New Guinea and Mborokua Island, Solomon Islands. Isolates were found to be prevalent in roots but uncommon in leaves. Initially, isolates were dereplicated to the strain level by ribotyping. Subsequent characterization of 105 unique strains by 16S rRNA gene sequence analysis revealed that 17 different genera were represented, and rare genera, such as Sphaerisporangium and Planotetraspora, which have never been previously reported to be endophytic, were quite prevalent. Phylogenetic analyses grouped many of the strains into clades distinct from known genera within Thermomonosporaceae and Micromonosporaceae, indicating that they may be unique genera. Bioactivity testing and liquid chromatography-mass spectrometry (LC-MS) profiling of crude fermentation extracts were performed on 91 strains. About 60% of the extracts exhibited bioactivity or displayed LC-MS profiles with spectra indicative of secondary metabolites. The biosynthetic potential of 29 nonproductive strains was further investigated by the detection of putative polyketide synthase (PKS) and nonribosomal peptide synthetase (NRPS) genes. Despite their lack of detectable secondary metabolite production in fermentation, most were positive for type I (66%) and type II (79%) PKS genes, and all were positive for NRPS genes. These results suggest that tropical plants from New Guinea and the adjacent archipelago are hosts to unique endophytic actinomycetes that possess significant biosynthetic potential. PMID:20472734

  16. Genome Sequence of Thermofilum pendens Reveals an Exceptional Loss of Biosynthetic Pathways without Genome Reduction

    SciTech Connect

    Anderson, Iain; Rodriquez, Jason; Susanti, Dwi; Porat, I.; Reich, Claudia; Ulrich, Luke; Elkins, James G; Mavromatis, K; Lykidis, A; Kim, Edwin; Thompson, Linda S; Nolan, Matt; Land, Miriam L; Copeland, A; Lapidus, Alla L.; Lucas, Susan; Detter, J C; Zhulin, Igor B; Olsen, Gary; Whitman, W. B.; Mukhopadhyay, Biswarup; Bristow, James; Kyrpides, Nikos C

    2008-01-01

    We report the complete genome of Thermofilum pendens, a deep-branching member of class Thermoproteales of Crenarchaeota. T. pendens is a sulfur-dependent, anaerobic heterotroph isolated from a solfatara in Iceland. It was known to utilize peptides as an energy source, but the genome reveals substantial ability to grow on carbohydrates. T. pendens is the first Crenarchaeote and only the second archaeon found to have transporters of the phosphotransferase system. T. pendens is known to require an extract of Thermoproteus tenax for growth, and the genome sequence reveals that biosynthetic pathways for purines, most amino acids, and most cofactors are absent. T. pendens has fewer biosynthetic enzymes than any other free-living organism. In addition to heterotrophy, T. pendens may gain energy from sulfur reduction with hydrogen and formate as electron donors. It may also be capable of sulfur-independent growth on formate with formate hydrogenlyase. Additional novel features are the presence of a monomethylamine:corrinoid methyltransferase, the first time this enzyme has been found outside of Methanosarcinales, and a presenilin-related protein from a new subfamily. Predicted highly expressed proteins include ABC transporters for carbohydrates and peptides, and CRISPR-associated proteins, suggesting that defense against viruses is a high priority.

  17. Indole-3-acetic acid in Fusarium graminearum: Identification of biosynthetic pathways and characterization of physiological effects.

    PubMed

    Luo, Kun; Rocheleau, Hélène; Qi, Peng-Fei; Zheng, You-Liang; Zhao, Hui-Yan; Ouellet, Thérèse

    2016-09-01

    Fusarium graminearum is a devastating pathogenic fungus causing fusarium head blight (FHB) of wheat. This fungus can produce indole-3-acetic acid (IAA) and a very large amount of IAA accumulates in wheat head tissues during the first few days of infection by F. graminearum. Using liquid culture conditions, we have determined that F. graminearum can use tryptamine (TAM) and indole-3-acetonitrile (IAN) as biosynthetic intermediates to produce IAA. It is the first time that F. graminearum is shown to use the l-tryptophan-dependent TAM and IAN pathways rather than the indole-3-acetamide or indole-3-pyruvic acid pathways to produce IAA. Our experiments also showed that exogenous IAA was metabolized by F. graminearum. Exogenous IAA, TAM, and IAN inhibited mycelial growth; IAA and IAN also affected the hyphae branching pattern and delayed macroconidium germination. IAA and TAM had a small positive effect on the production of the mycotoxin 15-ADON while IAN inhibited its production. Our results showed that IAA and biosynthetic intermediates had a significant effect on F. graminearum physiology and suggested a new area of exploration for fungicidal compounds. PMID:27567719

  18. Identification and developmental expression profiling of putative alkaloid biosynthetic genes in Corydalis yanhusuo bulbs

    PubMed Central

    Liao, Dengqun; Wang, Pengfei; Jia, Chan; Sun, Peng; Qi, Jianjun; Zhou, Lili; Li, Xian’en

    2016-01-01

    Alkaloids in bulbs of Corydalis (C.) yanhusuo are the major pharmacologically active compounds in treatment of blood vessel diseases, tumors and various pains. However, due to the absence of gene sequences in C. yanhusuo, the genes involved in alkaloid biosynthesis and their expression during bulb development remain unknown. We therefore established the first transcriptome database of C. yanhusuo via Illumina mRNA-Sequencing of a RNA composite sample collected at Bulb initiation (Day 0), early enlargement (Day 10) and maturation (Day 30). 25,013,630 clean 90 bp paired-end reads were de novo assembled into 47,081 unigenes with an average length of 489 bp, among which 30,868 unigenes (65.56%) were annotated in four protein databases. Of 526 putative unigenes involved in biosynthesis o f various alkaloids, 187 were identified as the candidate genes involved in the biosynthesis of benzylisoquinoline alkaloids (BIAs), the only alkaloid type reported in C. yanhusuo untill now. BIAs biosynthetic genes were highly upregulated in the overall pathway during bulb development. Identification of alkaloid biosynthetic genes in C. yanhusuo provide insights on pathways and molecular regulation of alkaloid biosynthesis, to initiate metabolic engineering in order to improve the yield of interesting alkaloids and to identify potentially new alkaloids predicted from the transcriptomic information. PMID:26777987

  19. Transcriptome and Metabolite analysis reveal candidate genes of the cardiac glycoside biosynthetic pathway from Calotropis procera

    PubMed Central

    Pandey, Akansha; Swarnkar, Vishakha; Pandey, Tushar; Srivastava, Piush; Kanojiya, Sanjeev; Mishra, Dipak Kumar; Tripathi, Vineeta

    2016-01-01

    Calotropis procera is a medicinal plant of immense importance due to its pharmaceutical active components, especially cardiac glycosides (CG). As genomic resources for this plant are limited, the genes involved in CG biosynthetic pathway remain largely unknown till date. Our study on stage and tissue specific metabolite accumulation showed that CG’s were maximally accumulated in stems of 3 month old seedlings. De novo transcriptome sequencing of same was done using high throughput Illumina HiSeq platform generating 44074 unigenes with average mean length of 1785 base pair. Around 66.6% of unigenes were annotated by using various public databases and 5324 unigenes showed significant match in the KEGG database involved in 133 different pathways of plant metabolism. Further KEGG analysis resulted in identification of 336 unigenes involved in cardenolide biosynthesis. Tissue specific expression analysis of 30 putative transcripts involved in terpenoid, steroid and cardenolide pathways showed a positive correlation between metabolite and transcript accumulation. Wound stress elevated CG levels as well the levels of the putative transcripts involved in its biosynthetic pathways. This result further validated the involvement of identified transcripts in CGs biosynthesis. The identified transcripts will lay a substantial foundation for further research on metabolic engineering and regulation of cardiac glycosides biosynthesis pathway genes. PMID:27703261

  20. Variation in oxygen isotope fractionation during cellulose synthesis: intramolecular and biosynthetic effects.

    PubMed

    Sternberg, Leonel; Pinzon, Maria Camila; Anderson, William T; Jahren, A Hope

    2006-10-01

    The oxygen isotopic composition of plant cellulose is commonly used for the interpretations of climate, ecophysiology and dendrochronology in both modern and palaeoenvironments. Further applications of this analytical tool depends on our in-depth knowledge of the isotopic fractionations associated with the biochemical pathways leading to cellulose. Here, we test two important assumptions regarding isotopic effects resulting from the location of oxygen in the carbohydrate moiety and the biosynthetic pathway towards cellulose synthesis. We show that the oxygen isotopic fractionation of the oxygen attached to carbon 2 of the glucose moieties differs from the average fractionation of the oxygens attached to carbons 3-6 from cellulose by at least 9%, for cellulose synthesized within seedlings of two different species (Triticum aestivum L. and Ricinus communis L.). The fractionation for a given oxygen in cellulose synthesized by the Triticum seedlings, which have starch as their primary carbon source, is different than the corresponding fractionation in Ricinus seedlings, within which lipids are the primary carbon source. This observation shows that the biosynthetic pathway towards cellulose affects oxygen isotope partitioning, a fact heretofore undemonstrated. Our findings may explain the species-dependent variability in the overall oxygen isotope fractionation during cellulose synthesis, and may provide much-needed insight for palaeoclimate reconstruction using fossil cellulose.

  1. Two Cytochrome P450 Monooxygenases Catalyze Early Hydroxylation Steps in the Potato Steroid Glycoalkaloid Biosynthetic Pathway.

    PubMed

    Umemoto, Naoyuki; Nakayasu, Masaru; Ohyama, Kiyoshi; Yotsu-Yamashita, Mari; Mizutani, Masaharu; Seki, Hikaru; Saito, Kazuki; Muranaka, Toshiya

    2016-08-01

    α-Solanine and α-chaconine, steroidal glycoalkaloids (SGAs) found in potato (Solanum tuberosum), are among the best-known secondary metabolites in food crops. At low concentrations in potato tubers, SGAs are distasteful; however, at high concentrations, SGAs are harmful to humans and animals. Here, we show that POTATO GLYCOALKALOID BIOSYNTHESIS1 (PGA1) and PGA2, two genes that encode cytochrome P450 monooxygenases (CYP72A208 and CYP72A188), are involved in the SGA biosynthetic pathway, respectively. The knockdown plants of either PGA1 or PGA2 contained very little SGA, yet vegetative growth and tuber production were not affected. Analyzing metabolites that accumulated in the plants and produced by in vitro enzyme assays revealed that PGA1 and PGA2 catalyzed the 26- and 22-hydroxylation steps, respectively, in the SGA biosynthetic pathway. The PGA-knockdown plants had two unique phenotypic characteristics: The plants were sterile and tubers of these knockdown plants did not sprout during storage. Functional analyses of PGA1 and PGA2 have provided clues for controlling both potato glycoalkaloid biosynthesis and tuber sprouting, two traits that can significantly impact potato breeding and the industry. PMID:27307258

  2. Sioxanthin, a novel glycosylated carotenoid reveals an unusual subclustered biosynthetic pathway

    PubMed Central

    Richter, Taylor K.S.; Hughes, Chambers C.; Moore, Bradley S.

    2016-01-01

    Summary Members of the marine actinomycete genus Salinispora constitutively produce a characteristic orange pigment during vegetative growth. Contrary to the understanding of widespread carotenoid biosynthesis pathways in bacteria, Salinispora carotenoid biosynthesis genes are not confined to a single cluster. Instead, bioinformatic and genetic investigations confirm that four regions of the S. tropica CNB-440 genome, consisting of two gene clusters and two independent genes, contribute to the in vivo production of a single carotenoid. This compound, namely (2’S)-1’-(β-D-glucopyranosyloxy)-3’,4’-didehydro-1’,2’-dihydro-φ,ψ-caroten-2’-ol, is novel and has been given the trivial name “sioxanthin”. Sioxanthin is a C40-carotenoid, glycosylated on one end of the molecule and containing an aryl moiety on the opposite end. Glycosylation is unusual amongst actinomycete carotenoids, and sioxanthin joins a rare group of carotenoids with polar and non-polar head groups. Gene sequence homology predicts that the sioxanthin biosynthetic pathway is present in all of the Salinispora as well as other members of the family Micromonosporaceae. Additionally, this study’s investigations of clustering of carotenoid biosynthetic genes in heterotrophic bacteria show that a non-clustered genome arrangement is more common than previously suggested, with nearly half of the investigated genomes showing a non-clustered architecture. PMID:25329237

  3. Structure Determination and Interception of Biosynthetic Intermediates for the Plantazolicin Class of Highly Discriminating Antibiotics

    PubMed Central

    Molohon, Katie J.; Melby, Joel O.; Lee, Jaeheon; Evans, Bradley S.; Dunbar, Kyle L.; Bumpus, Stefanie B.; Kelleher, Neil L.; Mitchell, Douglas A.

    2011-01-01

    The soil dwelling, plant-growth promoting bacterium, Bacillus amyloliquefaciens FZB42, is a prolific producer of complex natural products. Recently, a new FZB42 metabolite, plantazolicin (PZN), has been described as a member of the growing thiazole/oxazole-modified microcin (TOMM) family. TOMMs are biosynthesized from inactive, ribosomal peptides and undergo a series of cyclodehydrations, dehydrogenations, and other modifications to become bioactive natural products. Using high-resolution mass spectrometry, chemoselective modification, genetic interruptions, and other spectroscopic tools, we have determined the molecular structure of PZN. In addition to two conjugated polyazole moieties, the amino-terminus of PZN has been modified to Nα,Nα-dimethylarginine. PZN exhibited a highly selective antibiotic activity towards Bacillus anthracis, but no other tested human pathogen. By altering oxygenation levels during fermentation, PZN analogs were produced that bear variability in their heterocycle content, which yielded insight into the order of biosynthetic events. Lastly, genome-mining has revealed the existence of four additional PZN-like biosynthetic gene clusters. Given their structural uniqueness and intriguing antimicrobial specificity, the PZN class of antibiotics may hold pharmacological value. PMID:21950656

  4. exo-Brevicomin biosynthetic pathway enzymes from the Mountain Pine Beetle, Dendroctonus ponderosae.

    PubMed

    Song, Minmin; Delaplain, Patrick; Nguyen, Trang T; Liu, Xibei; Wickenberg, Leah; Jeffrey, Christopher; Blomquist, Gary J; Tittiger, Claus

    2014-10-01

    exoBrevicomin (exo-7-ethyl-5-methyl-6,8-dioxabicyclo[3.2.1]octane) is an important semiochemical for a number of beetle species, including the highly destructive Mountain Pine Beetle (Dendroctonus ponderosae). It is also found in other insects and the African elephant. Despite its significance, very little is known about its biosynthesis. A recent microarray analysis implicated a small cluster of three D. ponderosae genes in exo-brevicomin biosynthesis, two of which had identifiable open reading frames (Aw et al., 2010; BMC Genomics 11:215). Here we report further expression profiling of two genes in that cluster and functional analysis of their recombinantly-produced enzymes. One encodes a short-chain dehydrogenase that used NAD(P)(+) as a co-factor to catalyze the oxidation of (Z)-6-nonen-2-ol to (Z)-6-nonen-2-one. We therefore named the enzyme (Z)-6-nonen-2-ol dehydrogenase (ZnoDH). The other encodes the cytochrome P450, CYP6CR1, which epoxidized (Z)-6-nonen-2-one to 6,7-epoxynonan-2-one with very high specificity and substrate selectivity. Both the substrates and products of the two enzymes are intermediates in the exo-brevicomin biosynthetic pathway. Thus, ZnoDH and CYP6CR1 are enzymes that apparently catalyze the antepenultimate and penultimate steps in the exo-brevicomin biosynthetic pathway, respectively. PMID:25138711

  5. Genome sequence of Thermofilum pendens reveals an exceptional loss of biosynthetic pathways without genome reduction

    SciTech Connect

    Kyrpides, Nikos; Anderson, Iain; Rodriguez, Jason; Susanti, Dwi; Porat, Iris; Reich, Claudia; Ulrich, Luke E.; Elkins, James G.; Mavromatis, Kostas; Lykidis, Athanasios; Kim, Edwin; Thompson, Linda S.; Nolan, Matt; Land, Miriam; Copeland, Alex; Lapidus, Alla; Lucas, Susan; Detter, Chris; Zhulin, Igor B.; Olsen, Gary J.; Whitman, William; Mukhopadhyay, Biswarup; Bristow, James; Kyrpides, Nikos

    2008-01-01

    We report the complete genome of Thermofilum pendens, a deep-branching, hyperthermophilic member of the order Thermoproteales within the archaeal kingdom Crenarchaeota. T. pendens is a sulfur-dependent, anaerobic heterotroph isolated from a solfatara in Iceland. It is an extracellular commensal, requiring an extract of Thermoproteus tenax for growth, and the genome sequence reveals that biosynthetic pathways for purines, most amino acids, and most cofactors are absent. In fact T. pendens has fewer biosynthetic enzymes than obligate intracellular parasites, although it does not display other features common among obligate parasites and thus does not appear to be in the process of becoming a parasite. It appears that T. pendens has adapted to life in an environment rich in nutrients. T. pendens was known to utilize peptides as an energy source, but the genome reveals substantial ability to grow on carbohydrates. T. pendens is the first crenarchaeote and only the second archaeon found to have a transporter of the phosphotransferase system. In addition to fermentation, T. pendens may gain energy from sulfur reduction with hydrogen and formate as electron donors. It may also be capable of sulfur-independent growth on formate with formate hydrogenlyase. Additional novel features are the presence of a monomethylamine:corrinoid methyltransferase, the first time this enzyme has been found outside of Methanosarcinales, and a presenilin-related protein. Predicted highly expressed proteins do not include housekeeping genes, and instead include ABC transporters for carbohydrates and peptides, and CRISPR-associated proteins.

  6. Cellular and nerve regeneration within a biosynthetic extracellular matrix for corneal transplantation

    NASA Astrophysics Data System (ADS)

    Li, Fengfu; Carlsson, David; Lohmann, Chris; Suuronen, Erik; Vascotto, Sandy; Kobuch, Karin; Sheardown, Heather; Munger, Rejean; Nakamura, Masatsugu; Griffith, May

    2003-12-01

    Our objective was to determine whether key properties of extracellular matrix (ECM) macromolecules can be replicated within tissue-engineered biosynthetic matrices to influence cellular properties and behavior. To achieve this, hydrated collagen and N-isopropylacrylamide copolymer-based ECMs were fabricated and tested on a corneal model. The structural and immunological simplicity of the cornea and importance of its extensive innervation for optimal functioning makes it an ideal test model. In addition, corneal failure is a clinically significant problem. Matrices were therefore designed to have the optical clarity and the proper dimensions, curvature, and biomechanical properties for use as corneal tissue replacements in transplantation. In vitro studies demonstrated that grafting of the laminin adhesion pentapeptide motif, YIGSR, to the hydrogels promoted epithelial stratification and neurite in-growth. Implants into pigs' corneas demonstrated successful in vivo regeneration of host corneal epithelium, stroma, and nerves. In particular, functional nerves were observed to rapidly regenerate in implants. By comparison, nerve regeneration in allograft controls was too slow to be observed during the experimental period, consistent with the behavior of human cornea transplants. Other corneal substitutes have been produced and tested, but here we report an implantable matrix that performs as a physiologically functional tissue substitute and not simply as a prosthetic device. These biosynthetic ECM replacements should have applicability to many areas of tissue engineering and regenerative medicine, especially where nerve function is required. regenerative medicine | tissue engineering | cornea | implantation | innervation

  7. Identification of a novel sesquiterpene biosynthetic machinery involved in astellolide biosynthesis

    PubMed Central

    Shinohara, Yasutomo; Takahashi, Shunji; Osada, Hiroyuki; Koyama, Yasuji

    2016-01-01

    Esterified drimane-type sesquiterpene lactones such as astellolides display various biological activities and are widely produced by plants and fungi. Given their low homology to known sesquiterpene cyclases, the genes responsible for their biosynthesis have not been uncovered yet. Here, we identified the astellolide gene cluster from Aspergillus oryzae and discovered a novel sesquiterpene biosynthetic machinery consisting of AstC, AstI, and AstK. All these enzymes are annotated as haloacid dehalogenase-like hydrolases, whereas AstC also contains a DxDTT motif conserved in class II diterpene cyclases. Based on enzyme reaction analyses, we found that AstC catalysed the protonation-initiated cyclisation of farnesyl pyrophosphate into drimanyl pyrophosphate. This was successively dephosphorylated by AstI and AstK to produce drim-8-ene-11-ol. Moreover, we also identified and characterised a unique non-ribosomal peptide synthetase, AstA, responsible for esterifying aryl acids to drimane-type sesquiterpene lactones. In this study, we highlight a new biosynthetic route for producing sesquiterpene and its esterified derivative. Our findings shed light on the identification of novel sesquiterpenes via genome mining. PMID:27628599

  8. Independent evolutionary origins of functional polyamine biosynthetic enzyme fusions catalyzing de novo diamine to triamine formation

    PubMed Central

    Green, Robert; Hanfrey, Colin C.; Elliott, Katherine A.; McCloskey, Diane E.; Wang, Xiaojing; Kanugula, Sreenivas; Pegg, Anthony E.; Michael, Anthony J.

    2011-01-01

    Summary We have identified gene fusions of polyamine biosynthetic enzymes S-adenosylmethionine decarboxylase (AdoMetDC, speD) and aminopropyltransferase (speE) orthologues in diverse bacterial phyla. Both domains are functionally active and we demonstrate the novel de novo synthesis of the triamine spermidine from the diamine putrescine by fusion enzymes from β-proteobacterium Delftia acidovorans and δ-proteobacterium Syntrophus aciditrophicus, in a ΔspeDE gene deletion strain of Salmonella enterica sv. Typhimurium. Fusion proteins from marine α-proteobacterium Candidatus Pelagibacter ubique, actinobacterium Nocardia farcinica, chlorobi species Chloroherpeton thalassium, and β-proteobacterium Delftia acidovorans each produce a different profile of non-native polyamines including sym-norspermidine when expressed in Escherichia coli. The different aminopropyltransferase activities together with phylogenetic analysis confirm independent evolutionary origins for some fusions. Comparative genomic analysis strongly indicates that gene fusions arose by merger of adjacent open reading frames. Independent fusion events, and horizontal and vertical gene transfer contributed to the scattered phyletic distribution of the gene fusions. Surprisingly, expression of fusion genes in E. coli and S. Typhimurium revealed novel latent spermidine catabolic activity producing non-native 1,3-diaminopropane in these species. We have also identified fusions of polyamine biosynthetic enzymes agmatine deiminase and N-carbamoylputrescine amidohydrolase in archaea, and of S-adenosylmethionine decarboxylase and ornithine decarboxylase in the single-celled green alga Micromonas. PMID:21762220

  9. Expression of parsley flavone synthase I establishes the flavone biosynthetic pathway in Arabidopsis thaliana.

    PubMed

    Yun, Choong-Soo; Yamamoto, Tomio; Nozawa, Akira; Tozawa, Yuzuru

    2008-04-01

    Arabidopsis thaliana lacks the flavone biosynthetic pathway, probably because of a lack or low activity of a flavone synthase. To establish this biosynthetic pathway in Arabidopsis, we subjected this model plant to transformation with the parsley gene for flavone synthase type I (FNS-I). Transgenic seedlings expressing FNS-I were cultured in liquid medium with or without naringenin, and plant extracts were then analyzed by high-performance liquid chromatography. In contrast to wild-type seedlings, the transgenic seedlings accumulated substantial amounts of apigenin, which is produced from naringenin by FNS-I, and the apigenin level correlated with the abundance of FNS-I mRNA in three different transgenic lines. These results indicate that the FNS-I transgene produces a functional enzyme that catalyzes the conversion of naringenin to apigenin in Arabidopsis. These FNS-I transgenic lines should prove useful in investigating the in vivo functions of enzymes that mediate the synthesis of the wide variety of flavones found in other plants.

  10. Detection of biosynthetic intermediates in proteoglycan-deficient mutants of Chinese hamster ovary cells

    SciTech Connect

    Montgomery, R.I.; Esko, J.D.

    1987-05-01

    Chinese hamster ovary cell mutants lacking xylosyltransferase or galactosyltransferase I do not synthesize mature proteoglycans. The authors predicted that the mutants would accumulate biosynthetic intermediates upstream from the block imposed by mutation. Using the fusogenic properties of vesicular stomatitis virus, the authors fused monolayers composed of galactosyltransferase I-deficient cells with virus-infected xylosyltransferase-deficient cells. Immediately following fusion the cells were pulse-labelled with /sup 35/SO/sub 4/ for one hour. Quantification of radioactive products showed that the mutants contained biosynthetically active intermediates that proceeded to mature glycosaminoglycans. The production of glycosaminoglycan was dependent on fusion, and fusion of each mutant to itself did not result in radioactive product. Analysis of the newly made glycosaminoglycans through HPLC anion-exchange chromatography showed that the fused cells synthesized heparan sulfate and chondroitin sulfate in about the same proportion as wildtype cells. These findings suggest that the mutants accumulate precursors to both families of proteoglycans. They also found that progeny virus from infected CHO cells contain proteoglycans, presumably derived from the plasma membrane. This observation suggests that the virus can be used to isolate intermediates accumulating in the mutants.

  11. Comparative genomics of actinomycetes with a focus on natural product biosynthetic genes

    PubMed Central

    2013-01-01

    Background Actinomycetes are a diverse group of medically, industrially and ecologically important bacteria, studied as much for the diseases they cause as for the cures they hold. The genomes of actinomycetes revealed that these bacteria have a large number of natural product gene clusters, although many of these are difficult to tie to products in the laboratory. Large scale comparisons of these clusters are difficult to perform due to the presence of highly similar repeated domains in the most common biosynthetic machinery: polyketide synthases (PKSs) and nonribosomal peptide synthetases (NRPSs). Results We have used comparative genomics to provide an overview of the genomic features of a set of 102 closed genomes from this important group of bacteria with a focus on natural product biosynthetic genes. We have focused on well-represented genera and determine the occurrence of gene cluster families therein. Conservation of natural product gene clusters within Mycobacterium, Streptomyces and Frankia suggest crucial roles for natural products in the biology of each genus. The abundance of natural product classes is also found to vary greatly between genera, revealing underlying patterns that are not yet understood. Conclusions A large-scale analysis of natural product gene clusters presents a useful foundation for hypothesis formulation that is currently underutilized in the field. Such studies will be increasingly necessary to study the diversity and ecology of natural products as the number of genome sequences available continues to grow. PMID:24020438

  12. Variation in oxygen isotope fractionation during cellulose synthesis: intramolecular and biosynthetic effects.

    PubMed

    Sternberg, Leonel; Pinzon, Maria Camila; Anderson, William T; Jahren, A Hope

    2006-10-01

    The oxygen isotopic composition of plant cellulose is commonly used for the interpretations of climate, ecophysiology and dendrochronology in both modern and palaeoenvironments. Further applications of this analytical tool depends on our in-depth knowledge of the isotopic fractionations associated with the biochemical pathways leading to cellulose. Here, we test two important assumptions regarding isotopic effects resulting from the location of oxygen in the carbohydrate moiety and the biosynthetic pathway towards cellulose synthesis. We show that the oxygen isotopic fractionation of the oxygen attached to carbon 2 of the glucose moieties differs from the average fractionation of the oxygens attached to carbons 3-6 from cellulose by at least 9%, for cellulose synthesized within seedlings of two different species (Triticum aestivum L. and Ricinus communis L.). The fractionation for a given oxygen in cellulose synthesized by the Triticum seedlings, which have starch as their primary carbon source, is different than the corresponding fractionation in Ricinus seedlings, within which lipids are the primary carbon source. This observation shows that the biosynthetic pathway towards cellulose affects oxygen isotope partitioning, a fact heretofore undemonstrated. Our findings may explain the species-dependent variability in the overall oxygen isotope fractionation during cellulose synthesis, and may provide much-needed insight for palaeoclimate reconstruction using fossil cellulose. PMID:16930314

  13. Examination of Triacylglycerol Biosynthetic Pathways via De Novo Transcriptomic and Proteomic Analyses in an Unsequenced Microalga

    PubMed Central

    Guarnieri, Michael T.; Nag, Ambarish; Smolinski, Sharon L.; Darzins, Al; Seibert, Michael; Pienkos, Philip T.

    2011-01-01

    Biofuels derived from algal lipids represent an opportunity to dramatically impact the global energy demand for transportation fuels. Systems biology analyses of oleaginous algae could greatly accelerate the commercialization of algal-derived biofuels by elucidating the key components involved in lipid productivity and leading to the initiation of hypothesis-driven strain-improvement strategies. However, higher-level systems biology analyses, such as transcriptomics and proteomics, are highly dependent upon available genomic sequence data, and the lack of these data has hindered the pursuit of such analyses for many oleaginous microalgae. In order to examine the triacylglycerol biosynthetic pathway in the unsequenced oleaginous microalga, Chlorella vulgaris, we have established a strategy with which to bypass the necessity for genomic sequence information by using the transcriptome as a guide. Our results indicate an upregulation of both fatty acid and triacylglycerol biosynthetic machinery under oil-accumulating conditions, and demonstrate the utility of a de novo assembled transcriptome as a search model for proteomic analysis of an unsequenced microalga. PMID:22043295

  14. Bacterial Long-Chain Polyunsaturated Fatty Acids: Their Biosynthetic Genes, Functions, and Practical Use

    PubMed Central

    Yoshida, Kiyohito; Hashimoto, Mikako; Hori, Ryuji; Adachi, Takumi; Okuyama, Hidetoshi; Orikasa, Yoshitake; Nagamine, Tadashi; Shimizu, Satoru; Ueno, Akio; Morita, Naoki

    2016-01-01

    The nutritional and pharmaceutical values of long-chain polyunsaturated fatty acids (LC-PUFAs) such as arachidonic, eicosapentaenoic and docosahexaenoic acids have been well recognized. These LC-PUFAs are physiologically important compounds in bacteria and eukaryotes. Although little is known about the biosynthetic mechanisms and functions of LC-PUFAs in bacteria compared to those in higher organisms, a combination of genetic, bioinformatic, and molecular biological approaches to LC-PUFA-producing bacteria and some eukaryotes have revealed the notably diverse organization of the pfa genes encoding a polyunsaturated fatty acid synthase complex (PUFA synthase), the LC-PUFA biosynthetic processes, and tertiary structures of the domains of this enzyme. In bacteria, LC-PUFAs appear to take part in specific functions facilitating individual membrane proteins rather than in the adjustment of the physical fluidity of the whole cell membrane. Very long chain polyunsaturated hydrocarbons (LC-HCs) such as hentriacontanonaene are considered to be closely related to LC-PUFAs in their biosynthesis and function. The possible role of LC-HCs in strictly anaerobic bacteria under aerobic and anaerobic environments and the evolutionary relationships of anaerobic and aerobic bacteria carrying pfa-like genes are also discussed. PMID:27187420

  15. Genetic engineering and heterologous expression of the disorazol biosynthetic gene cluster via Red/ET recombineering

    PubMed Central

    Tu, Qiang; Herrmann, Jennifer; Hu, Shengbiao; Raju, Ritesh; Bian, Xiaoying; Zhang, Youming; Müller, Rolf

    2016-01-01

    Disorazol, a macrocyclic polykitide produced by the myxobacterium Sorangium cellulosum So ce12 and it is reported to have potential cytotoxic activity towards several cancer cell lines, including multi-drug resistant cells. The disorazol biosynthetic gene cluster (dis) from Sorangium cellulosum (So ce12) was identified by transposon mutagenesis and cloned in a bacterial artificial chromosome (BAC) library. The 58-kb dis core gene cluster was reconstituted from BACs via Red/ET recombineering and expressed in Myxococcus xanthus DK1622. For the first time ever, a myxobacterial trans-AT polyketide synthase has been expressed heterologously in this study. Expression in M. xanthus allowed us to optimize the yield of several biosynthetic products using promoter engineering. The insertion of an artificial synthetic promoter upstream of the disD gene encoding a discrete acyl transferase (AT), together with an oxidoreductase (Or), resulted in 7-fold increase in disorazol production. The successful reconstitution and expression of the genetic sequences encoding for these promising cytotoxic compounds will allow combinatorial biosynthesis to generate novel disorazol derivatives for further bioactivity evaluation. PMID:26875499

  16. GIP2, a Putative Transcription Factor That Regulates the Aurofusarin Biosynthetic Gene Cluster in Gibberella zeae

    PubMed Central

    Kim, Jung-Eun; Jin, Jianming; Kim, Hun; Kim, Jin-Cheol; Yun, Sung-Hwan; Lee, Yin-Won

    2006-01-01

    Gibberella zeae (anamorph: Fusarium graminearum) is an important pathogen of maize, wheat, and rice. Colonies of G. zeae produce yellow-to-tan mycelia with the white-to-carmine red margins. In this study, we focused on nine putative open reading frames (ORFs) closely linked to PKS12 and GIP1, which are required for aurofusarin biosynthesis in G. zeae. Among them is an ORF designated GIP2 (for Gibberella zeae pigment gene 2), which encodes a putative protein of 398 amino acids that carries a Zn(II)2Cys6 binuclear cluster DNA-binding domain commonly found in transcription factors of yeasts and filamentous fungi. Targeted gene deletion and complementation analyses confirmed that GIP2 is required for aurofusarin biosynthesis. Expression of GIP2 in carrot medium correlated with aurofusarin production by G. zeae and was restricted to vegetative mycelia. Inactivation of the 10 contiguous genes in the ΔGIP2 strain delineates an aurofusarin biosynthetic gene cluster. Overexpression of GIP2 in both the ΔGIP2 and the wild-type strains increases aurofusarin production and reduces mycelial growth. Thus, GIP2 is a putative positive regulator of the aurofusarin biosynthetic gene cluster, and aurofusarin production is negatively correlated with vegetative growth by G. zeae. PMID:16461721

  17. Evolution of alternative biosynthetic pathways for vitamin C following plastid acquisition in photosynthetic eukaryotes

    PubMed Central

    Wheeler, Glen; Ishikawa, Takahiro; Pornsaksit, Varissa; Smirnoff, Nicholas

    2015-01-01

    Ascorbic acid (vitamin C) is an enzyme co-factor in eukaryotes that also plays a critical role in protecting photosynthetic eukaryotes against damaging reactive oxygen species derived from the chloroplast. Many animal lineages, including primates, have become ascorbate auxotrophs due to the loss of the terminal enzyme in their biosynthetic pathway, l-gulonolactone oxidase (GULO). The alternative pathways found in land plants and Euglena use a different terminal enzyme, l-galactonolactone dehydrogenase (GLDH). The evolutionary processes leading to these differing pathways and their contribution to the cellular roles of ascorbate remain unclear. Here we present molecular and biochemical evidence demonstrating that GULO was functionally replaced with GLDH in photosynthetic eukaryote lineages following plastid acquisition. GULO has therefore been lost repeatedly throughout eukaryote evolution. The formation of the alternative biosynthetic pathways in photosynthetic eukaryotes uncoupled ascorbate synthesis from hydrogen peroxide production and likely contributed to the rise of ascorbate as a major photoprotective antioxidant. DOI: http://dx.doi.org/10.7554/eLife.06369.001 PMID:25768426

  18. exo-Brevicomin biosynthetic pathway enzymes from the Mountain Pine Beetle, Dendroctonus ponderosae.

    PubMed

    Song, Minmin; Delaplain, Patrick; Nguyen, Trang T; Liu, Xibei; Wickenberg, Leah; Jeffrey, Christopher; Blomquist, Gary J; Tittiger, Claus

    2014-10-01

    exoBrevicomin (exo-7-ethyl-5-methyl-6,8-dioxabicyclo[3.2.1]octane) is an important semiochemical for a number of beetle species, including the highly destructive Mountain Pine Beetle (Dendroctonus ponderosae). It is also found in other insects and the African elephant. Despite its significance, very little is known about its biosynthesis. A recent microarray analysis implicated a small cluster of three D. ponderosae genes in exo-brevicomin biosynthesis, two of which had identifiable open reading frames (Aw et al., 2010; BMC Genomics 11:215). Here we report further expression profiling of two genes in that cluster and functional analysis of their recombinantly-produced enzymes. One encodes a short-chain dehydrogenase that used NAD(P)(+) as a co-factor to catalyze the oxidation of (Z)-6-nonen-2-ol to (Z)-6-nonen-2-one. We therefore named the enzyme (Z)-6-nonen-2-ol dehydrogenase (ZnoDH). The other encodes the cytochrome P450, CYP6CR1, which epoxidized (Z)-6-nonen-2-one to 6,7-epoxynonan-2-one with very high specificity and substrate selectivity. Both the substrates and products of the two enzymes are intermediates in the exo-brevicomin biosynthetic pathway. Thus, ZnoDH and CYP6CR1 are enzymes that apparently catalyze the antepenultimate and penultimate steps in the exo-brevicomin biosynthetic pathway, respectively.

  19. Identification of a plastidial phenylalanine exporter that influences flux distribution through the phenylalanine biosynthetic network.

    PubMed

    Widhalm, Joshua R; Gutensohn, Michael; Yoo, Heejin; Adebesin, Funmilayo; Qian, Yichun; Guo, Longyun; Jaini, Rohit; Lynch, Joseph H; McCoy, Rachel M; Shreve, Jacob T; Thimmapuram, Jyothi; Rhodes, David; Morgan, John A; Dudareva, Natalia

    2015-01-01

    In addition to proteins, L-phenylalanine is a versatile precursor for thousands of plant metabolites. Production of phenylalanine-derived compounds is a complex multi-compartmental process using phenylalanine synthesized predominantly in plastids as precursor. The transporter(s) exporting phenylalanine from plastids, however, remains unknown. Here, a gene encoding a Petunia hybrida plastidial cationic amino-acid transporter (PhpCAT) functioning in plastidial phenylalanine export is identified based on homology to an Escherichia coli phenylalanine transporter and co-expression with phenylalanine metabolic genes. Radiolabel transport assays show that PhpCAT exports all three aromatic amino acids. PhpCAT downregulation and overexpression result in decreased and increased levels, respectively, of phenylalanine-derived volatiles, as well as phenylalanine, tyrosine and their biosynthetic intermediates. Metabolic flux analysis reveals that flux through the plastidial phenylalanine biosynthetic pathway is reduced in PhpCAT RNAi lines, suggesting that the rate of phenylalanine export from plastids contributes to regulating flux through the aromatic amino-acid network. PMID:26356302

  20. Identification of a Pantoea Biosynthetic Cluster That Directs the Synthesis of an Antimicrobial Natural Product

    PubMed Central

    Walterson, Alyssa M.; Smith, Derek D. N.; Stavrinides, John

    2014-01-01

    Fire Blight is a destructive disease of apple and pear caused by the enteric bacterial pathogen, Erwinia amylovora. E. amylovora initiates infection by colonizing the stigmata of apple and pear trees, and entering the plants through natural openings. Epiphytic populations of the related enteric bacterium, Pantoea, reduce the incidence of disease through competition and antibiotic production. In this study, we identify an antibiotic from Pantoea ananatis BRT175, which is effective against E. amylovora and select species of Pantoea. We used transposon mutagenesis to create a mutant library, screened approximately 5,000 mutants for loss of antibiotic production, and recovered 29 mutants. Sequencing of the transposon insertion sites of these mutants revealed multiple independent disruptions of an 8.2 kb cluster consisting of seven genes, which appear to be coregulated. An analysis of the distribution of this cluster revealed that it was not present in any other of our 115 Pantoea isolates, or in any of the fully sequenced Pantoea genomes, and is most closely related to antibiotic biosynthetic clusters found in three different species of Pseudomonas. This identification of this biosynthetic cluster highlights the diversity of natural products produced by Pantoea. PMID:24796857

  1. Coordinate regulation of the tryptophan biosynthetic pathway and indolic phytoalexin accumulation in Arabidopsis.

    PubMed Central

    Zhao, J; Last, R L

    1996-01-01

    Little is known about the mechanisms that couple regulation of secondary metabolic pathways to the synthesis of primary metabolic precursors. Camalexin, an indolic secondary metabolite, appears to be the major phytoalexin in Arabidopsis. It was previously shown that camalexin accumulation is caused by infection with plant pathogens, by abiotic elicitors, and in spontaneous lesions in the accelerated cell death mutant acd2. We demonstrate that the accumulation of this phytoalexin is accompanied by the induction of the mRNAs and proteins for all of the tryptophan biosynthetic enzymes tested. A strong correlation was observed between the magnitude of camalexin accumulation and the induction of tryptophan biosynthetic proteins, indicating coordinate regulation of these processes. Production of disease symptoms is not sufficient for the response because systemic infection with cauliflower mosaic virus or cucumber mosaic virus did not induce the tryptophan pathway enzymes or camalexin accumulation. Salicylic acid appears to be required, but unlike other documented pathogenesis-related proteins, it is not sufficient for the coordinate induction. Results with trp mutants suggest that the tryptophan pathway is not rate limiting for camalexin accumulation. Taken together, these results are consistent with the hypothesis that the regulation of the tryptophan pathway in plants responds to needs for biosynthesis of secondary metabolites. PMID:8989880

  2. Evolution of tryptophan biosynthetic pathway in microbial genomes: a comparative genetic study.

    PubMed

    Priya, V K; Sarkar, Susmita; Sinha, Somdatta

    2014-03-01

    Biosynthetic pathway evolution needs to consider the evolution of a group of genes that code for enzymes catalysing the multiple chemical reaction steps leading to the final end product. Tryptophan biosynthetic pathway has five chemical reaction steps that are highly conserved in diverse microbial genomes, though the genes of the pathway enzymes show considerable variations in arrangements, operon structure (gene fusion and splitting) and regulation. We use a combined bioinformatic and statistical analyses approach to address the question if the pathway genes from different microbial genomes, belonging to a wide range of groups, show similar evolutionary relationships within and between them. Our analyses involved detailed study of gene organization (fusion/splitting events), base composition, relative synonymous codon usage pattern of the genes, gene expressivity, amino acid usage, etc. to assess inter- and intra-genic variations, between and within the pathway genes, in diverse group of microorganisms. We describe these genetic and genomic variations in the tryptophan pathway genes in different microorganisms to show the similarities across organisms, and compare the same genes across different organisms to find the possible variability arising possibly due to horizontal gene transfers. Such studies form the basis for moving from single gene evolution to pathway evolutionary studies that are important steps towards understanding the systems biology of intracellular pathways. PMID:24592292

  3. Crystallization and preliminary X-ray analysis of the ergothioneine-biosynthetic methyltransferase EgtD

    PubMed Central

    Vit, Allegra; Misson, Laëtitia; Blankenfeldt, Wulf; Seebeck, Florian Peter

    2014-01-01

    Ergothioneine is an amino-acid betaine derivative of histidine that was discovered more than one century ago. Despite significant research pointing to a function in oxidative stress defence, the exact mechanisms of action of ergothioneine remain elusive. Although both humans and bacterial pathogens such as Mycobacterium tuberculosis seem to depend on ergothioneine, humans are devoid of the corresponding biosynthetic enzymes. Therefore, its biosyn­thesis may emerge as potential drug target in the development of novel therapeutics against tuberculosis. The recent identification of ergothioneine-biosynthetic genes in M. smegmatis enables a more systematic study of its biology. The pathway is initiated by EgtD, a SAM-dependent methyltransferase that catalyzes a trimethylation reaction of histidine to give N(α),N(α),N(α)-trimethylhistidine. Here, the recombinant production, purification and crystallization of EgtD are reported. Crystals of native EgtD diffracted to 2.35 Å resolution at a synchrotron beamline, whereas crystals of seleno-l-methionine-labelled protein diffracted to 1.75 Å resolution and produced a significant anomalous signal to 2.77 Å resolution at the K edge. All of the crystals belonged to space group P212121, with two EgtD monomers in the asymmetric unit. PMID:24817736

  4. Metabolic and functional diversity of saponins, biosynthetic intermediates and semi-synthetic derivatives

    PubMed Central

    Moses, Tessa; Papadopoulou, Kalliope K.

    2014-01-01

    Saponins are widely distributed plant natural products with vast structural and functional diversity. They are typically composed of a hydrophobic aglycone, which is extensively decorated with functional groups prior to the addition of hydrophilic sugar moieties, to result in surface-active amphipathic compounds. The saponins are broadly classified as triterpenoids, steroids or steroidal glycoalkaloids, based on the aglycone structure from which they are derived. The saponins and their biosynthetic intermediates display a variety of biological activities of interest to the pharmaceutical, cosmetic and food sectors. Although their relevance in industrial applications has long been recognized, their role in plants is underexplored. Recent research on modulating native pathway flux in saponin biosynthesis has demonstrated the roles of saponins and their biosynthetic intermediates in plant growth and development. Here, we review the literature on the effects of these molecules on plant physiology, which collectively implicate them in plant primary processes. The industrial uses and potential of saponins are discussed with respect to structure and activity, highlighting the undoubted value of these molecules as therapeutics. PMID:25286183

  5. Identification of a plastidial phenylalanine exporter that influences flux distribution through the phenylalanine biosynthetic network.

    PubMed

    Widhalm, Joshua R; Gutensohn, Michael; Yoo, Heejin; Adebesin, Funmilayo; Qian, Yichun; Guo, Longyun; Jaini, Rohit; Lynch, Joseph H; McCoy, Rachel M; Shreve, Jacob T; Thimmapuram, Jyothi; Rhodes, David; Morgan, John A; Dudareva, Natalia

    2015-09-10

    In addition to proteins, L-phenylalanine is a versatile precursor for thousands of plant metabolites. Production of phenylalanine-derived compounds is a complex multi-compartmental process using phenylalanine synthesized predominantly in plastids as precursor. The transporter(s) exporting phenylalanine from plastids, however, remains unknown. Here, a gene encoding a Petunia hybrida plastidial cationic amino-acid transporter (PhpCAT) functioning in plastidial phenylalanine export is identified based on homology to an Escherichia coli phenylalanine transporter and co-expression with phenylalanine metabolic genes. Radiolabel transport assays show that PhpCAT exports all three aromatic amino acids. PhpCAT downregulation and overexpression result in decreased and increased levels, respectively, of phenylalanine-derived volatiles, as well as phenylalanine, tyrosine and their biosynthetic intermediates. Metabolic flux analysis reveals that flux through the plastidial phenylalanine biosynthetic pathway is reduced in PhpCAT RNAi lines, suggesting that the rate of phenylalanine export from plastids contributes to regulating flux through the aromatic amino-acid network.

  6. Identification of a plastidial phenylalanine exporter that influences flux distribution through the phenylalanine biosynthetic network

    PubMed Central

    Widhalm, Joshua R.; Gutensohn, Michael; Yoo, Heejin; Adebesin, Funmilayo; Qian, Yichun; Guo, Longyun; Jaini, Rohit; Lynch, Joseph H.; McCoy, Rachel M.; Shreve, Jacob T.; Thimmapuram, Jyothi; Rhodes, David; Morgan, John A.; Dudareva, Natalia

    2015-01-01

    In addition to proteins, L-phenylalanine is a versatile precursor for thousands of plant metabolites. Production of phenylalanine-derived compounds is a complex multi-compartmental process using phenylalanine synthesized predominantly in plastids as precursor. The transporter(s) exporting phenylalanine from plastids, however, remains unknown. Here, a gene encoding a Petunia hybrida plastidial cationic amino-acid transporter (PhpCAT) functioning in plastidial phenylalanine export is identified based on homology to an Escherichia coli phenylalanine transporter and co-expression with phenylalanine metabolic genes. Radiolabel transport assays show that PhpCAT exports all three aromatic amino acids. PhpCAT downregulation and overexpression result in decreased and increased levels, respectively, of phenylalanine-derived volatiles, as well as phenylalanine, tyrosine and their biosynthetic intermediates. Metabolic flux analysis reveals that flux through the plastidial phenylalanine biosynthetic pathway is reduced in PhpCAT RNAi lines, suggesting that the rate of phenylalanine export from plastids contributes to regulating flux through the aromatic amino-acid network. PMID:26356302

  7. New features of triacylglycerol biosynthetic pathways of peanut seeds in early developmental stages.

    PubMed

    Yu, Mingli; Liu, Fengzhen; Zhu, Weiwei; Sun, Meihong; Liu, Jiang; Li, Xinzheng

    2015-11-01

    The peanut (Arachis hypogaea L.) is one of the three most important oil crops in the world due to its high average oil content (50 %). To reveal the biosynthetic pathways of seed oil in the early developmental stages of peanut pods with the goal of improving the oil quality, we presented a method combining deep sequencing analysis of the peanut pod transcriptome and quantitative real-time PCR (RT-PCR) verification of seed oil-related genes. From the sequencing data, approximately 1500 lipid metabolism-associated Unigenes were identified. The RT-PCR results quantified the different expression patterns of these triacylglycerol (TAG) synthesis-related genes in the early developmental stages of peanut pods. Based on these results and analysis, we proposed a novel construct of the metabolic pathways involved in the biosynthesis of TAG, including the Kennedy pathway, acyl-CoA-independent pathway and proposed monoacylglycerol pathway. It showed that the biosynthetic pathways of TAG in the early developmental stages of peanut pods were much more complicated than a simple, unidirectional, linear pathway.

  8. Identification of a novel sesquiterpene biosynthetic machinery involved in astellolide biosynthesis.

    PubMed

    Shinohara, Yasutomo; Takahashi, Shunji; Osada, Hiroyuki; Koyama, Yasuji

    2016-01-01

    Esterified drimane-type sesquiterpene lactones such as astellolides display various biological activities and are widely produced by plants and fungi. Given their low homology to known sesquiterpene cyclases, the genes responsible for their biosynthesis have not been uncovered yet. Here, we identified the astellolide gene cluster from Aspergillus oryzae and discovered a novel sesquiterpene biosynthetic machinery consisting of AstC, AstI, and AstK. All these enzymes are annotated as haloacid dehalogenase-like hydrolases, whereas AstC also contains a DxDTT motif conserved in class II diterpene cyclases. Based on enzyme reaction analyses, we found that AstC catalysed the protonation-initiated cyclisation of farnesyl pyrophosphate into drimanyl pyrophosphate. This was successively dephosphorylated by AstI and AstK to produce drim-8-ene-11-ol. Moreover, we also identified and characterised a unique non-ribosomal peptide synthetase, AstA, responsible for esterifying aryl acids to drimane-type sesquiterpene lactones. In this study, we highlight a new biosynthetic route for producing sesquiterpene and its esterified derivative. Our findings shed light on the identification of novel sesquiterpenes via genome mining. PMID:27628599

  9. Detection of polyketide synthase and nonribosomal peptide synthetase biosynthetic genes from antimicrobial coral-associated actinomycetes.

    PubMed

    Li, Jie; Dong, Jun-De; Yang, Jian; Luo, Xiong-Ming; Zhang, Si

    2014-10-01

    The diversity and properties of actinobacteria, predominant residents in coral holobionts, have been rarely documented. In this study, we aimed to explore the species diversity, antimicrobial activities and biosynthetic potential of culturable actinomycetes within the tissues of the scleractinian corals Porites lutea, Galaxea fascicularis and Acropora millepora from the South China Sea. A total of 70 strains representing 13 families and 15 genera of actinobacteria were isolated. The antimicrobial activity and biosynthetic potential of fifteen representative filamentous actinomycetes were estimated. Crude fermentation extracts of 6 strains exhibited comparable or greater activities against Vibrio alginolyticus than ciprofloxacin. Seven of the 15 actinomycetes strains possess type I polyketide synthases (PKS-I) and/or nonribosomal peptide synthetases (NRPS) genes. Nine tested strains possess type II polyketide synthases (PKS-II). Phylogenetic analysis based on 16S rRNA gene sequences indicated that these PKS and NRPS gene screening positive strains belong to genera Nocardiopsis, Pseudonocardia, Streptomyces, Micromonospora, Amycolatopsis and Prauserella. One PKS-I and four NRPS fragments showed <70% similarity to their closest relatives, which suggested the novelty of these genes. This study helps uncover the genetic capacity of stony coral-associated actinomycetes to produce bioactive molecules.

  10. Identification of the biosynthetic gene cluster for the pacidamycin group of peptidyl nucleoside antibiotics

    PubMed Central

    Zhang, Wenjun; Ostash, Bohdan; Walsh, Christopher T.

    2010-01-01

    Pacidamycins are a family of uridyl tetra/pentapeptide antibiotics that act on the translocase MraY to block bacterial cell wall assembly. To elucidate the biosynthetic logic of pacidamcyins, a putative gene cluster was identified by 454 shotgun genome sequencing of the producer Streptomyces coeruleorubidus NRRL 18370. The 31-kb gene cluster encodes 22 proteins (PacA-V), including highly dissociated nonribosomal peptide synthetase (NRPS) modules and a variety of tailoring enzymes. Gene deletions confirmed that two NRPSs, PacP and PacO, are required for the biosynthesis of pacidamycins. Heterologous expression and in vitro assays of PacL, PacO, and PacP established reversible formation of m-Tyr-AMP, l-Ala-AMP, and diaminopropionyl-AMP, respectively, consistent with the amino acids found in pacidamycin scaffolds. The unusual Ala4-Phe5 dipeptidyl ureido linkage was formed during in vitro assays containing purified PacL, PacJ, PacN, and PacO. Both the genetic and enzymatic studies validate identification of the biosynthetic genes for this subclass of uridyl peptide antibiotics and provide the basis for future mechanistic study of their biosynthesis. PMID:20826445

  11. Analysis of Polygala tenuifolia Transcriptome and Description of Secondary Metabolite Biosynthetic Pathways by Illumina Sequencing

    PubMed Central

    Tian, Hongling; Xu, Xiaoshuang; Zhang, Fusheng; Wang, Yaoqin; Guo, Shuhong; Qin, Xuemei; Du, Guanhua

    2015-01-01

    Radix polygalae, the dried roots of Polygala tenuifolia and P. sibirica, is one of the most well-known traditional Chinese medicinal plants. Radix polygalae contains various saponins, xanthones, and oligosaccharide esters and these compounds are responsible for several pharmacological properties. To provide basic breeding information, enhance molecular biological analysis, and determine secondary metabolite biosynthetic pathways of P. tenuifolia, we applied Illumina sequencing technology and de novo assembly. We also applied this technique to gain an overview of P. tenuifolia transcriptome from samples with different years. Using Illumina sequencing, approximately 67.2% of unique sequences were annotated by basic local alignment search tool similarity searches against public sequence databases. We classified the annotated unigenes by using Nr, Nt, GO, COG, and KEGG databases compared with NCBI. We also obtained many candidates CYP450s and UGTs by the analysis of genes in the secondary metabolite biosynthetic pathways, including putative terpenoid backbone and phenylpropanoid biosynthesis pathway. With this transcriptome sequencing, future genetic and genomics studies related to the molecular mechanisms associated with the chemical composition of P. tenuifolia may be improved. Genes involved in the enrichment of secondary metabolite biosynthesis-related pathways could enhance the potential applications of P. tenuifolia in pharmaceutical industries. PMID:26543847

  12. Coordinate regulation of the tryptophan biosynthetic pathway and indolic phytoalexin accumulation in Arabidopsis.

    PubMed

    Zhao, J; Last, R L

    1996-12-01

    Little is known about the mechanisms that couple regulation of secondary metabolic pathways to the synthesis of primary metabolic precursors. Camalexin, an indolic secondary metabolite, appears to be the major phytoalexin in Arabidopsis. It was previously shown that camalexin accumulation is caused by infection with plant pathogens, by abiotic elicitors, and in spontaneous lesions in the accelerated cell death mutant acd2. We demonstrate that the accumulation of this phytoalexin is accompanied by the induction of the mRNAs and proteins for all of the tryptophan biosynthetic enzymes tested. A strong correlation was observed between the magnitude of camalexin accumulation and the induction of tryptophan biosynthetic proteins, indicating coordinate regulation of these processes. Production of disease symptoms is not sufficient for the response because systemic infection with cauliflower mosaic virus or cucumber mosaic virus did not induce the tryptophan pathway enzymes or camalexin accumulation. Salicylic acid appears to be required, but unlike other documented pathogenesis-related proteins, it is not sufficient for the coordinate induction. Results with trp mutants suggest that the tryptophan pathway is not rate limiting for camalexin accumulation. Taken together, these results are consistent with the hypothesis that the regulation of the tryptophan pathway in plants responds to needs for biosynthesis of secondary metabolites.

  13. Molecular basis for chloronium-mediated meroterpene cyclization: cloning, sequencing, and heterologous expression of the napyradiomycin biosynthetic gene cluster.

    PubMed

    Winter, Jaclyn M; Moffitt, Michelle C; Zazopoulos, Emmanuel; McAlpine, James B; Dorrestein, Pieter C; Moore, Bradley S

    2007-06-01

    Structural inspection of the bacterial meroterpenoid antibiotics belonging to the napyradiomycin family of chlorinated dihydroquinones suggests that the biosynthetic cyclization of their terpenoid subunits is initiated via a chloronium ion. The vanadium-dependent haloperoxidases that catalyze such reactions are distributed in fungi and marine algae and have yet to be characterized from bacteria. The cloning and sequence analysis of the 43-kb napyradiomycin biosynthetic cluster (nap) from Streptomyces aculeolatus NRRL 18422 and from the undescribed marine sediment-derived Streptomyces sp. CNQ-525 revealed 33 open reading frames, three of which putatively encode vanadium-dependent chloroperoxidases. Heterologous expression of the CNQ-525-based nap biosynthetic cluster in Streptomyces albus produced at least seven napyradiomycins, including the new analog 2-deschloro-2-hydroxy-A80915C. These data not only revealed the molecular basis behind the biosynthesis of these novel meroterpenoid natural products but also resulted in the first in vivo verification of vanadium-dependent haloperoxidases.

  14. Structures and comparative characterization of biosynthetic gene clusters for cyanosporasides, enediyne-derived natural products from marine actinomycetes.

    PubMed

    Lane, Amy L; Nam, Sang-Jip; Fukuda, Takashi; Yamanaka, Kazuya; Kauffman, Christopher A; Jensen, Paul R; Fenical, William; Moore, Bradley S

    2013-03-20

    Cyanosporasides are marine bacterial natural products containing a chlorinated cyclopenta[a]indene core of suspected enediyne polyketide biosynthetic origin. Herein, we report the isolation and characterization of novel cyanosporasides C-F (3-6) from the marine actinomycetes Salinispora pacifica CNS-143 and Streptomyces sp. CNT-179, highlighted by the unprecedented C-2' N-acetylcysteamine functionalized hexose group of 6. Cloning, sequencing, and mutagenesis of homologous ~50 kb cyanosporaside biosynthetic gene clusters from both bacteria afforded the first genetic evidence supporting cyanosporaside's enediyne, and thereby p-benzyne biradical, biosynthetic origin and revealed the molecular basis for nitrile and glycosyl functionalization. This study provides new opportunities for bioengineering of enediyne derivatives and expands the structural diversity afforded by enediyne gene clusters.

  15. Structures and comparative characterization of biosynthetic gene clusters for cyanosporasides, enediyne-derived natural products from marine actinomycetes

    PubMed Central

    Lane, Amy L.; Nam, Sang Jip; Fukuda, Takashi; Yamanaka, Kazuya; Kauffman, Christopher A.; Jensen, Paul R.; Fenical, William; Moore, Bradley S.

    2013-01-01

    Cyanosporasides are marine bacterial natural products containing a chlorinated cyclopenta[a]indene core of suspected enediyne polyketide biosynthetic origin. Herein, we report the isolation and characterization of novel cyanosporasides C–F (3–6) from the marine actinomycetes “Salinispora pacifica” CNS-143 and Streptomyces sp. CNT-179, highlighted by the unprecedented C-2' N-acetylcysteamine functionalized hexose group of 6. Cloning, sequencing, and mutagenesis of homologous ~50 kb cyanosporaside biosynthetic gene clusters from both bacteria afforded the first genetic evidence supporting cyanosporaside's enediyne, and thereby p-benzyne biradical, biosynthetic origin and revealed the molecular basis for nitrile and glycosyl functionalization. This study provides new opportunities for bioengineering of enediyne derivatives and expands the structural diversity afforded by enediyne gene clusters. PMID:23458364

  16. Application of PRECEDE-PROCEED model to tackle problems identified with diarrhoea burden among under-5s in Botswana.

    PubMed

    Popoola, Tosin; Mchunu, Gugu

    2015-05-01

    Diarrhoea has been identified as the second leading cause of mortality among under-5s and also claims more life than HIV, measles and malaria combined together in the same category of population. This article is a combination of literature review and personal experience of lessons learnt from past diarrhoea outbreaks in Botswana that caused significant rate of mortality among under-5s. The paper used literature review to identify contributory factors to diarrhoea burden among under-5s in Botswana and applied a community health nursing framework (PRECEDE-PROCEED) to tackle the problems identified. The study revealed that Botswana mothers are lacking in knowledge related to exclusive breastfeeding, prevention and treatment of diarrhoea disease. The paper recommends that health-care workers in Botswana be sensitized on current diarrhoea management to tailor their health education methods appropriately. PMID:26125574

  17. Triphosphate residues at the 5' ends of rRNA precursor and 5S RNA from Dictyostelium discoideum.

    PubMed Central

    Batts-Young, B; Lodish, H F

    1978-01-01

    We present here direct evidence for the preservation of a transcriptional initiation sequence in a eukaryotic rRNA precursor: the 5'-end group for precursor to 17S rRNA (p17S RNA) from Dictyostelium discoideum is identified as the triphosphate residue pppA-. We also show that mature 5S RNA form Dictyostelium bears a different triphosphate residue, pppG-. In contrast, we find no evidence for more than one phosphate at the 5' end of the 25S rRNA precursor (p25S RNA). These observations indicate that synthesis of the large ribosomal RNAs of Dictyostelium begins with the 5'-terminal sequence of the p17S RNA, and that 5S RNA transcription must be initiated independently, despite the close association of the 5S and rRNA coding segments. Images PMID:204930

  18. Xe 5s,5p correlation satellites in the region of strong interchannel interactions, 28--75 eV

    SciTech Connect

    Fahlman, A.; Krause, M.O.; Carlson, T.A.; Svensson, A.

    1984-08-01

    The Xe 5s,5p photoelectron satellite spectrum has been studied in the photon-energy range from 28 to 75 eV with the aid of synchrotron radiation. This range includes the Xe 5s Cooper minimum, and the cross sections and angular distribution data demonstrate the importance of the strong two-electron channels in the region where the 5s cross section is small. Although the behavior of the satellites was not recorded over the 4d maximum, the data near 75 eV show an enhancement in the cross section in that region. The data underline the need of including the two-electron channels explicitly in the theory over a wide photon-energy range.

  19. Characterization of a novel association between two trypanosome-specific proteins and 5S rRNA.

    PubMed

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    P34 and P37 are two previously identified RNA binding proteins in the flagellate protozoan Trypanosoma brucei. RNA interference studies have determined that the proteins are essential and are involved in ribosome biogenesis. Here, we show that these proteins interact in vitro with the 5S rRNA with nearly identical binding characteristics in the absence of other cellular factors. The T. brucei 5S rRNA has a complex secondary structure and presents four accessible loops (A to D) for interactions with RNA-binding proteins. In other eukaryotes, loop C is bound by the L5 ribosomal protein and loop A mainly by TFIIIA. The binding of P34 and P37 to T. brucei 5S rRNA involves the LoopA region of the RNA, but these proteins also protect the L5 binding site located on LoopC.

  20. Application of PRECEDE-PROCEED model to tackle problems identified with diarrhoea burden among under-5s in Botswana.

    PubMed

    Popoola, Tosin; Mchunu, Gugu

    2015-05-01

    Diarrhoea has been identified as the second leading cause of mortality among under-5s and also claims more life than HIV, measles and malaria combined together in the same category of population. This article is a combination of literature review and personal experience of lessons learnt from past diarrhoea outbreaks in Botswana that caused significant rate of mortality among under-5s. The paper used literature review to identify contributory factors to diarrhoea burden among under-5s in Botswana and applied a community health nursing framework (PRECEDE-PROCEED) to tackle the problems identified. The study revealed that Botswana mothers are lacking in knowledge related to exclusive breastfeeding, prevention and treatment of diarrhoea disease. The paper recommends that health-care workers in Botswana be sensitized on current diarrhoea management to tailor their health education methods appropriately.

  1. Dissociative excitation of the N(+)(5S) state by electron impact on N2 - Excitation function and quenching

    NASA Technical Reports Server (NTRS)

    Erdman, P. W.; Zipf, E. C.

    1986-01-01

    Metastable N(+)(5S) ions were produced in the laboratory by dissociative excitation of N2 with energetic electrons. The resulting radiative decay of the N(+)(5S) state was observed with sufficient resolution to completely resolve the doublet from the nearby N2 molecular radiation. The excitation function was measured from threshold to 500 eV. The cross section peaks at a high electron energy and also exhibits a high threshold energy both of which are typical of dissociative excitation-ionization processes. This finding complicates the explanation of electron impact on N2 as the mechanism for the source of the 2145 A 'auroral mystery feature' by further increasing the required peak cross section. It is suggested that the apparent N(+)(5S) quenching in auroras may be an artifact due to the softening of the electron energy spectrum in the auroral E region.

  2. Functional variants of 5S rRNA in the ribosomes of common sea urchin Paracentrotus lividus.

    PubMed

    Dimarco, Eufrosina; Cascone, Eleonora; Bellavia, Daniele; Caradonna, Fabio

    2012-10-15

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus; this study, performed at DNA level only, lends itself as starting point to verify that these clusters could contain transcribed genes, then, to demonstrate the presence of heterogeneity at functional RNA level, also. In the present work we report in P. lividus ribosomes the existence of several transcribed variants of the 5S rRNA and we associate all transcribed variants to the cluster to which belong. Our finding is the first demonstration of the presence of high heterogeneity in functional 5S rRNA molecules in animal ribosomes, a feature that had been considered a peculiarity of some plants. PMID:22967708

  3. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    PubMed

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location. PMID:27334092

  4. D5S2500 is an ambiguously characterized STR: Identification and description of forensic microsatellites in the genomics age.

    PubMed

    Phillips, C; Parson, W; Amigo, J; King, J L; Coble, M D; Steffen, C R; Vallone, P M; Gettings, K B; Butler, J M; Budowle, B

    2016-07-01

    In the process of establishing short tandem repeat (STR) sequence variant nomenclature guidelines in anticipation of expanded forensic multiplexes for massively parallel sequencing (MPS), it was discovered that the STR D5S2500 has multiple positions and genomic characteristics reported. This ambiguity is because the marker named D5S2500 consists of two different microsatellites forming separate components in the capillary electrophoresis multiplexes of Qiagen's HDplex (Hilden, Germany) and AGCU ScienTech's non-CODIS STR 21plex (Wuxi, Jiangsu, China). This study outlines the genomic details used to identify each microsatellite and reveals the D5S2500 marker in HDplex has the correctly assigned STR name, while the D5S2500 marker in the AGCU 21plex, closely positioned a further 1643 nucleotides in the human reference sequence, is an unnamed microsatellite. The fact that the D5S2500 marker has existed as two distinct STR loci undetected for almost ten years, even with reported discordant genotypes for the standard control DNA, underlines the need for careful scrutiny of the genomic properties of forensic STRs, as they become adapted for sequence analysis with MPS systems. We make the recommendation that precise chromosome location data must be reported for any forensic marker under development but not in common use, so that the genomic characteristics of the locus are validated to the same level of accuracy as its allelic variation and forensic performance. To clearly differentiate each microsatellite, we propose the name D5S2800 be used to identify the Chromosome-5 STR in the AGCU 21plex.

  5. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    PubMed

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location.

  6. D5S2500 is an ambiguously characterized STR: Identification and description of forensic microsatellites in the genomics age.

    PubMed

    Phillips, C; Parson, W; Amigo, J; King, J L; Coble, M D; Steffen, C R; Vallone, P M; Gettings, K B; Butler, J M; Budowle, B

    2016-07-01

    In the process of establishing short tandem repeat (STR) sequence variant nomenclature guidelines in anticipation of expanded forensic multiplexes for massively parallel sequencing (MPS), it was discovered that the STR D5S2500 has multiple positions and genomic characteristics reported. This ambiguity is because the marker named D5S2500 consists of two different microsatellites forming separate components in the capillary electrophoresis multiplexes of Qiagen's HDplex (Hilden, Germany) and AGCU ScienTech's non-CODIS STR 21plex (Wuxi, Jiangsu, China). This study outlines the genomic details used to identify each microsatellite and reveals the D5S2500 marker in HDplex has the correctly assigned STR name, while the D5S2500 marker in the AGCU 21plex, closely positioned a further 1643 nucleotides in the human reference sequence, is an unnamed microsatellite. The fact that the D5S2500 marker has existed as two distinct STR loci undetected for almost ten years, even with reported discordant genotypes for the standard control DNA, underlines the need for careful scrutiny of the genomic properties of forensic STRs, as they become adapted for sequence analysis with MPS systems. We make the recommendation that precise chromosome location data must be reported for any forensic marker under development but not in common use, so that the genomic characteristics of the locus are validated to the same level of accuracy as its allelic variation and forensic performance. To clearly differentiate each microsatellite, we propose the name D5S2800 be used to identify the Chromosome-5 STR in the AGCU 21plex. PMID:26974236

  7. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    PubMed

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.

  8. Release of ribosome-bound 5S rRNA upon cleavage of the phosphodiester bond between nucleotides A54 and A55 in 5S rRNA.

    PubMed

    Holmberg, L; Nygård, O

    2000-11-01

    Reticulocyte lysates contain ribosome-bound and free populations of 5S RNA. The free population is sensitive to nuclease cleavage in the internal loop B, at the phosphodiester bond connecting nucleotides A54 and A55. Similar cleavage sites were detected in 5S rRNA in 60S subunits and 80S ribosomes. However, 5S rRNA in reticulocyte polysomes is insensitive to cleavage unless ribosomes are salt-washed. This suggests that a translational factor protects the backbone surrounding A54 from cleavage in polysomes. Upon nuclease treatment of mouse 60S subunits or reticulocyte lysates a small population of ribosomes released its 5S rRNA together with ribosomal protein L5. Furthermore, rRNA sequences from 5.8S, 28S and 18S rRNA were released. In 18S rRNA the sequences mainly originate from the 630 loop and stem (helix 18) in the 5' domain, whereas in 28S rRNA a majority of fragments is derived from helices 47 and 81 in domains III and V, respectively. We speculate that this type of rRNA-fragmentation may mimic a ribosome degradation pathway.

  9. Phenylpropanoids Accumulation in Eggplant Fruit: Characterization of Biosynthetic Genes and Regulation by a MYB Transcription Factor

    PubMed Central

    Docimo, Teresa; Francese, Gianluca; Ruggiero, Alessandra; Batelli, Giorgia; De Palma, Monica; Bassolino, Laura; Toppino, Laura; Rotino, Giuseppe L.; Mennella, Giuseppe; Tucci, Marina

    2016-01-01

    Phenylpropanoids are major secondary metabolites in eggplant (Solanum melongena) fruits. Chlorogenic acid (CGA) accounts for 70–90% of total phenolics in flesh tissues, while anthocyanins are mainly present in the fruit skin. As a contribution to the understanding of the peculiar accumulation of these health-promoting metabolites in eggplant, we report on metabolite abundance, regulation of CGA and anthocyanin biosynthesis, and characterization of candidate CGA biosynthetic genes in S. melongena. Higher contents of CGA, Delphinidin 3-rutinoside, and rutin were found in eggplant fruits compared to other tissues, associated to an elevated transcript abundance of structural genes such as PAL, HQT, DFR, and ANS, suggesting that active in situ biosynthesis contributes to anthocyanin and CGA accumulation in fruit tissues. Putative orthologs of the two CGA biosynthetic genes PAL and HQT, as well as a variant of a MYB1 transcription factor showing identity with group six MYBs, were isolated from an Occidental S. melongena traditional variety and demonstrated to differ from published sequences from Asiatic varieties. In silico analysis of the isolated SmPAL1, SmHQT1, SmANS, and SmMyb1 promoters revealed the presence of several Myb regulatory elements for the biosynthetic genes and unique elements for the TF, suggesting its involvement in other physiological roles beside phenylpropanoid biosynthesis regulation. Transient overexpression in Nicotiana benthamiana leaves of SmMyb1 and of a C-terminal SmMyb1 truncated form (SmMyb1Δ9) resulted in anthocyanin accumulation only of SmMyb1 agro-infiltrated leaves. A yeast two-hybrid assay confirmed the interaction of both SmMyb1 and SmMyb1Δ9 with an anthocyanin-related potato bHLH1 TF. Interestingly, a doubled amount of CGA was detected in both SmMyb1 and SmMyb1Δ9 agro-infiltrated leaves, thus suggesting that the N-terminal region of SmMyb1 is sufficient to activate its synthesis. These data suggest that a deletion of the C

  10. Biochemical Analysis of the Biosynthetic Pathway of an Anticancer Tetracycline SF2575

    PubMed Central

    Pickens, Lauren B.; Kim, Woncheol; Wang, Peng; Zhou, Hui; Watanabe, Kenji; Gomi, Shuichi; Tang, Yi

    2009-01-01

    SF2575 1 is a tetracycline polyketide produced by Streptomyces sp. SF2575 and displays exceptionally potent anticancer activity towards a broad range of cancer cell lines. The structure of SF2575 is characterized by a highly substituted tetracycline aglycon. The modifications include methylation of the C-6 and C-12a hydroxyl groups, acylation of the 4-(S)-hydroxyl with salicylic acid, C-glycosylation of the C-9 of the D-ring with d-olivose and further acylation of the C4′-hydroxyl of d-olivose with the unusual angelic acid. Understanding the biosynthesis of SF2575 can therefore expand the repertoire of enzymes that can modify tetracyclines, and facilitate engineered biosynthesis of SF2575 analogs. In this study, we identified, sequenced and functionally analyzed the ssf biosynthetic gene cluster which contains 40 putative open reading frames. Genes encoding enzymes that can assemble the tetracycline aglycon, as well as installing these unique structural features are found in the gene cluster. Biosynthetic intermediates were isolated from the SF2575 culture extract to suggest the order of pendant groups addition is C-9 glycosylation, C-4 salicylation and O-4′ angelycylation. Using in vitro assays, two enzymes that are responsible for C-4 acylation of salicylic acid were identified. These enzymes include an ATP-dependent salicylyl-CoA ligase SsfL1 and a putative GDSL family acyltransferase SsfX3, both of which were shown to have relaxed substrate specificity towards substituted benzoic acids. Since the salicylic acid moiety is critically important for the anticancer properties of SF2575, verification of the activities of SsfL1 and SsfX3 sets the stage for biosynthetic modification of the C-4 group towards structural-activity relationship studies of SF2575. Using heterologous biosynthesis in Streptomyces lividans, we also determined that biosynthesis of the SF2575 tetracycline aglycon 8 parallels that of oxytetracycline 4 and diverges after the assembly of 4-keto

  11. Phenylpropanoids Accumulation in Eggplant Fruit: Characterization of Biosynthetic Genes and Regulation by a MYB Transcription Factor.

    PubMed

    Docimo, Teresa; Francese, Gianluca; Ruggiero, Alessandra; Batelli, Giorgia; De Palma, Monica; Bassolino, Laura; Toppino, Laura; Rotino, Giuseppe L; Mennella, Giuseppe; Tucci, Marina

    2015-01-01

    Phenylpropanoids are major secondary metabolites in eggplant (Solanum melongena) fruits. Chlorogenic acid (CGA) accounts for 70-90% of total phenolics in flesh tissues, while anthocyanins are mainly present in the fruit skin. As a contribution to the understanding of the peculiar accumulation of these health-promoting metabolites in eggplant, we report on metabolite abundance, regulation of CGA and anthocyanin biosynthesis, and characterization of candidate CGA biosynthetic genes in S. melongena. Higher contents of CGA, Delphinidin 3-rutinoside, and rutin were found in eggplant fruits compared to other tissues, associated to an elevated transcript abundance of structural genes such as PAL, HQT, DFR, and ANS, suggesting that active in situ biosynthesis contributes to anthocyanin and CGA accumulation in fruit tissues. Putative orthologs of the two CGA biosynthetic genes PAL and HQT, as well as a variant of a MYB1 transcription factor showing identity with group six MYBs, were isolated from an Occidental S. melongena traditional variety and demonstrated to differ from published sequences from Asiatic varieties. In silico analysis of the isolated SmPAL1, SmHQT1, SmANS, and SmMyb1 promoters revealed the presence of several Myb regulatory elements for the biosynthetic genes and unique elements for the TF, suggesting its involvement in other physiological roles beside phenylpropanoid biosynthesis regulation. Transient overexpression in Nicotiana benthamiana leaves of SmMyb1 and of a C-terminal SmMyb1 truncated form (SmMyb1Δ9) resulted in anthocyanin accumulation only of SmMyb1 agro-infiltrated leaves. A yeast two-hybrid assay confirmed the interaction of both SmMyb1 and SmMyb1Δ9 with an anthocyanin-related potato bHLH1 TF. Interestingly, a doubled amount of CGA was detected in both SmMyb1 and SmMyb1Δ9 agro-infiltrated leaves, thus suggesting that the N-terminal region of SmMyb1 is sufficient to activate its synthesis. These data suggest that a deletion of the C

  12. A methylated Neurospora 5S rRNA pseudogene contains a transposable element inactivated by repeat-induced point mutation.

    PubMed Central

    Margolin, B S; Garrett-Engele, P W; Stevens, J N; Fritz, D Y; Garrett-Engele, C; Metzenberg, R L; Selker, E U

    1998-01-01

    In an analysis of 22 of the roughly 100 dispersed 5S rRNA genes in Neurospora crassa, a methylated 5S rRNA pseudogene, Psi63, was identified. We characterized the Psi63 region to better understand the control and function of DNA methylation. The 120-bp 5S rRNA-like region of Psi63 is interrupted by a 1.9-kb insertion that has characteristics of sequences that have been modified by repeat-induced point mutation (RIP). We found sequences related to this insertion in wild-type strains of N. crassa and other Neurospora species. Most showed evidence of RIP; but one, isolated from the N. crassa host of Psi63, showed no evidence of RIP. A deletion from near the center of this sequence apparently rendered it incapable of participating in RIP with the related full-length copies. The Psi63 insertion and the related sequences have features of transposons and are related to the Fot1 class of fungal transposable elements. Apparently Psi63 was generated by insertion of a previously unrecognized Neurospora transposable element into a 5S rRNA gene, followed by RIP. We name the resulting inactivated Neurospora transposon PuntRIP1 and the related sequence showing no evidence of RIP, but harboring a deletion that presumably rendered it defective for transposition, dPunt. PMID:9691037

  13. Chromosomal localization of 5S rRNA gene loci and the implications for relationships within the Allium complex.

    PubMed

    Lee, S H; Do, G S; Seo, B B

    1999-01-01

    Chromosomal localizations and distribution patterns of the 5S rRNA genes by means of fluorescence in-situ hybridization in diploid Allium species could help to classify species into chromosome types and aid in determining relationships among genomes. All eleven diploid species were classified into five types, A to E. Species of type A showed a pair of 5S rRNA signals on the short arm of chromosome 5 and two pairs of signals on both arms of chromosome 7. Species of types B and C showed one pair and two pairs of signals on the short arm of chromosome 7, respectively. Type D species showed two pairs of signals on the satellite region of the short arm and a pair of signals on the long arm of chromosome 7. Type E species showed three distinct 5S rRNA gene loci signals on the short arm of chromosome 7. Information on chromosomal localization of 5S rRNA gene loci and distribution patterns within chromosomes in diploid Allium species could help to infer the pathway of origin of the three kinds of alloploid species. Data indicate that A. wakegi is an allopolyploid with genomes of types B and C, and A. deltoide-fistulosum is an allotetraploid derived from a natural hybridization between different species within chromosome type A. Results indicate that A. senescens is an allopolyploid with type B chromosomes and an unidentified chromosomal type. PMID:10328620

  14. snoU6 and 5S RNAs are not reliable miRNA reference genes in neuronal differentiation.

    PubMed

    Lim, Q E; Zhou, L; Ho, Y K; Wan, G; Too, H P

    2011-12-29

    Accurate profiling of microRNAs (miRNAs) is an essential step for understanding the functional significance of these small RNAs in both physiological and pathological processes. Quantitative real-time PCR (qPCR) has gained acceptance as a robust and reliable transcriptomic method to profile subtle changes in miRNA levels and requires reference genes for accurate normalization of gene expression. 5S and snoU6 RNAs are commonly used as reference genes in microRNA quantification. It is currently unknown if these small RNAs are stably expressed during neuronal differentiation. Panels of miRNAs have been suggested as alternative reference genes to 5S and snoU6 in various physiological contexts. To test the hypothesis that miRNAs may serve as stable references during neuronal differentiation, the expressions of eight miRNAs, 5S and snoU6 RNAs in five differentiating neuronal cell types were analyzed using qPCR. The stabilities of the expressions were evaluated using two complementary statistical approaches (geNorm and Normfinder). Expressions of 5S and snoU6 RNAs were stable under some but not all conditions of neuronal differentiation and thus are not suitable reference genes. In contrast, a combination of three miRNAs (miR-103, miR-106b and miR-26b) allowed accurate expression normalization across different models of neuronal differentiation.

  15. Peak shifts due to B{sup (*)}-B{sup (*)} rescattering in {upsilon}(5S) dipion transitions

    SciTech Connect

    Meng Ce; Chao Kuangta

    2008-08-01

    We study the energy distributions of dipion transitions {upsilon}(5S) to {upsilon}(1S,2S,3S){pi}{sup +}{pi}{sup -} in the final-state rescattering model. Since the {upsilon}(5S) is well above the open bottom thresholds, the dipion transitions are expected to mainly proceed through the real processes {upsilon}(5S){yields}B{sup (*)}B{sup (*)} and B{sup (*)}B{sup (*)}{yields}{upsilon}(1S,2S,3S){pi}{sup +}{pi}{sup -}. We find that the energy distributions of {upsilon}(1S,2S,3S){pi}{sup +}{pi}{sup -} markedly differ from that of {upsilon}(5S){yields}B{sup (*)}B{sup (*)}. In particular, the resonance peak will be pushed up by about 7-20 MeV for these dipion transitions relative to the main hadronic decay modes. These predictions can be used to test the final-state rescattering mechanism in hadronic transitions for heavy quarkonia above the open flavor thresholds.

  16. Perturbation of ribosome biogenesis drives cells into senescence through 5S RNP-mediated p53 activation.

    PubMed

    Nishimura, Kazuho; Kumazawa, Takuya; Kuroda, Takao; Katagiri, Naohiro; Tsuchiya, Mai; Goto, Natsuka; Furumai, Ryohei; Murayama, Akiko; Yanagisawa, Junn; Kimura, Keiji

    2015-03-01

    The 5S ribonucleoprotein particle (RNP) complex, consisting of RPL11, RPL5, and 5S rRNA, is implicated in p53 regulation under ribotoxic stress. Here, we show that the 5S RNP contributes to p53 activation and promotes cellular senescence in response to oncogenic or replicative stress. Oncogenic stress accelerates rRNA transcription and replicative stress delays rRNA processing, resulting in RPL11 and RPL5 accumulation in the ribosome-free fraction, where they bind MDM2. Experimental upregulation of rRNA transcription or downregulation of rRNA processing, mimicking the nucleolus under oncogenic or replicative stress, respectively, also induces RPL11-mediated p53 activation and cellular senescence. We demonstrate that exogenous expression of certain rRNA-processing factors rescues the processing defect, attenuates p53 accumulation, and increases replicative lifespan. To summarize, the nucleolar-5S RNP-p53 pathway functions as a senescence inducer in response to oncogenic and replicative stresses.

  17. Contralateral interlaminar approach for intraforaminal lumbar degenerative disease with special emphasis on L5-S1 level: A technical note

    PubMed Central

    Zekaj, Edvin; Menghetti, Claudia; Saleh, Christian; Isidori, Alessandra; Bona, Alberto R.; Aimar, Enrico; Servello, Domenico

    2016-01-01

    Background: Intraforaminal disc herniations at the L5-S1 level are extremely surgically challenging lesions. Intracanal approaches frequently require partial or total facetectomy, which may lead to instability. Solely extraforaminal approaches may offer limited visualization of the more medial superiorly exiting and inferiorly exiting nerve roots; this approach is also more complicated at L5-S1 due to the often large L5 transverse process and the iliac wing. Methods: Nine patients with intraforaminal L5-S1 disc herniations, foraminal stenosis, or synovial cysts underwent contralateral interlaminar approaches for lesion resection. Preoperative and postoperative visual analog scale scores were evaluated, and complications were reviewed. Results: All 9 patients demonstrated immediate postoperative clinical improvement. None of the patients exhibited complications and none developed instability or neuropathic disorders. Conclusions: Although the number of cases in our sample was very small (9 in total), the contralateral interlaminar approach appeared to effectively address multiple degenerative L5-S1 foraminal pathologies. Large studies are needed to further evaluate the pros and cons of this approach. PMID:27713854

  18. Distribution of 5-methylcytosine residues in 5S rRNA genes in Arabidopsis thaliana and Secale cereale.

    PubMed

    Fulnecek, J; Matyásek, R; Kovarík, A

    2002-12-01

    Bisulfite genomic sequencing was used to localise 5-methylcytosine residues (mC) in 5S rRNA genes of Arabidopsis thaliana and Secale cereale. The maps of mC distribution were compared with the previously published map of the corresponding region in Nicotiana tabacum. In all three species, the level of methylation of 5S rRNA genes was generally higher than the average for the entire genome. The ratio of 5S rDNA methylation to average overall methylation was 44%/30-33% for N. tabacum, 27%/4-6% for A. thaliana and 24%/20-22% for S. cereale. With the exception of one clone from S. cereale, no methylation-free 5S rDNA was detected. The level of methylation at different sequence motifs in 5S rDNA was calculated for N. tabacum/A. thaliana/ S. cereale, and this analysis yielded the following values (expressed as a percentage of total C): mCG 90%/78%/85%, mCWG 89%/41%/53%, mCmCG 72%/32%/16%, mCCG 4%/2%/0%, mCHH 15%/6%/1%, where W=A or T, and H=A or C or T. Non-symmetrical methylation was almost negligible in the large genome of S. cereale but relatively frequent in N. tabacum and A. thaliana, suggesting that the strict correlation between genome size and cytosine methylation might be violated for this type of methylation. Among non-symmetrical motifs the mCWA triplets were significantly over-represented in Arabidopsis, while in tobacco this preference was not as pronounced. The differences in methylation levels in different sequence contexts might be of phylogenetic significance, but further species in related and different taxa need to be studied before firm conclusions can be drawn. PMID:12471448

  19. Unexpected Accumulation of ncm5U and ncm5s2U in a trm9 Mutant Suggests an Additional Step in the Synthesis of mcm5U and mcm5s2U

    PubMed Central

    Chen, Changchun; Huang, Bo; Anderson, James T.; Byström, Anders S.

    2011-01-01

    Background Transfer RNAs are synthesized as a primary transcript that is processed to produce a mature tRNA. As part of the maturation process, a subset of the nucleosides are modified. Modifications in the anticodon region often modulate the decoding ability of the tRNA. At position 34, the majority of yeast cytosolic tRNA species that have a uridine are modified to 5-carbamoylmethyluridine (ncm5U), 5-carbamoylmethyl-2′-O-methyluridine (ncm5Um), 5-methoxycarbonylmethyl-uridine (mcm5U) or 5-methoxycarbonylmethyl-2-thiouridine (mcm5s2U). The formation of mcm5 and ncm5 side chains involves a complex pathway, where the last step in formation of mcm5 is a methyl esterification of cm5 dependent on the Trm9 and Trm112 proteins. Methodology and Principal Findings Both Trm9 and Trm112 are required for the last step in formation of mcm5 side chains at wobble uridines. By co-expressing a histidine-tagged Trm9p together with a native Trm112p in E. coli, these two proteins purified as a complex. The presence of Trm112p dramatically improves the methyltransferase activity of Trm9p in vitro. Single tRNA species that normally contain mcm5U or mcm5s2U nucleosides were isolated from trm9Δ or trm112Δ mutants and the presence of modified nucleosides was analyzed by HPLC. In both mutants, mcm5U and mcm5s2U nucleosides are absent in tRNAs and the major intermediates accumulating were ncm5U and ncm5s2U, not the expected cm5U and cm5s2U. Conclusions Trm9p and Trm112p function together at the final step in formation of mcm5U in tRNA by using the intermediate cm5U as a substrate. In tRNA isolated from trm9Δ and trm112Δ strains, ncm5U and ncm5s2U nucleosides accumulate, questioning the order of nucleoside intermediate formation of the mcm5 side chain. We propose two alternative explanations for this observation. One is that the intermediate cm5U is generated from ncm5U by a yet unknown mechanism and the other is that cm5U is formed before ncm5U and mcm5U. PMID:21687733

  20. Biosynthetic studies on the botcinolide skeleton: new hydroxylated lactones from Botrytis cinerea.

    PubMed

    Reino, José L; Durán-Patrón, Rosa M; Daoubi, Mourad; Collado, Isidro G; Hernández-Galán, Rosario

    2006-01-20

    [reaction: see text] The biosynthetic origin of the botcinolide skeleton was investigated by means of feeding 13C- and 2H-labeled precursors to Botrytis cinerea. Three new compounds, two homobotcinolide derivatives, 3-O-acetylhomobotcinolide (5) and 8-methylhomobotcinolide (6), and a new 11-membered lactone (7), were isolated. Their structures were elucidated on the basis of spectroscopic data, including one-bond and long-range 1H-13C correlations. The relative stereochemistries were determined by combined analyses of NOE data and 1H-1H coupling constants. According to the results of feeding experiments with 13C- and 2H-labeled acetate and l-S-methylmethionine, 5 is an acetate-derived polyketide whose methyl groups originate from l-S-methylmethionine. This is a rare example of the incorporation of a methyl from methionine into a supposed C3 starter unit of the polyketide synthesis.

  1. Nutrient shortage triggers the hexosamine biosynthetic pathway via the GCN2-ATF4 signalling pathway.

    PubMed

    Chaveroux, Cédric; Sarcinelli, Carmen; Barbet, Virginie; Belfeki, Sofiane; Barthelaix, Audrey; Ferraro-Peyret, Carole; Lebecque, Serge; Renno, Toufic; Bruhat, Alain; Fafournoux, Pierre; Manié, Serge N

    2016-06-03

    The hexosamine biosynthetic pathway (HBP) is a nutrient-sensing metabolic pathway that produces the activated amino sugar UDP-N-acetylglucosamine, a critical substrate for protein glycosylation. Despite its biological significance, little is known about the regulation of HBP flux during nutrient limitation. Here, we report that amino acid or glucose shortage increase GFAT1 production, the first and rate-limiting enzyme of the HBP. GFAT1 is a transcriptional target of the activating transcription factor 4 (ATF4) induced by the GCN2-eIF2α signalling pathway. The increased production of GFAT1 stimulates HBP flux and results in an increase in O-linked β-N-acetylglucosamine protein modifications. Taken together, these findings demonstrate that ATF4 provides a link between nutritional stress and the HBP for the regulation of the O-GlcNAcylation-dependent cellular signalling.

  2. Complete set of glycosyltransferase structures in the calicheamicin biosynthetic pathway reveals the origin of regiospecificity

    SciTech Connect

    Chang, Aram; Singh, Shanteri; Helmich, Kate E.; Goff, Randal D.; Bingman, Craig A.; Thorson, Jon S.; Phillips, Jr., George N.

    2012-03-15

    Glycosyltransferases are useful synthetic catalysts for generating natural products with sugar moieties. Although several natural product glycosyltransferase structures have been reported, design principles of glycosyltransferase engineering for the generation of glycodiversified natural products has fallen short of its promise, partly due to a lack of understanding of the relationship between structure and function. Here, we report structures of all four calicheamicin glycosyltransferases (CalG1, CalG2, CalG3, and CalG4), whose catalytic functions are clearly regiospecific. Comparison of these four structures reveals a conserved sugar donor binding motif and the principles of acceptor binding region reshaping. Among them, CalG2 possesses a unique catalytic motif for glycosylation of hydroxylamine. Multiple glycosyltransferase structures in a single natural product biosynthetic pathway are a valuable resource for understanding regiospecific reactions and substrate selectivities and will help future glycosyltransferase engineering.

  3. Environmental and biosynthetic influences on carbon and hydrogen isotope ratios of leaf wax n-alkanes

    NASA Astrophysics Data System (ADS)

    McInerney, F. A.; Freeman, K. H.; Polissar, P. J.; Feakins, S. J.

    2013-12-01

    Both carbon and hydrogen isotope ratios of leaf-wax n-alkanes are influenced by the availability of water in a plant's growth environment. Carbon isotope ratios of bulk tissues in C3 plants demonstrate a strong inverse relationship with measures of available moisture (e.g. mean annual precipitation and precipitation/evaporation). Similarly, hydrogen isotope ratios of leaf wax n-alkanes (δDl) can be enriched relative to precipitation (δDw) by transpiration, which is related to relative humidity and the leaf-to-air vapor pressure deficit. Thus, D-enrichment of leaf-wax n-alkanes relative to precipitation, termed the apparent fractionation (2ɛl/w), becomes more positive with increasing aridity. In theory, more positive values of leaf-wax δ13C (δ13Cl) and 2ɛl/w of leaf-wax n-alkanes should both correspond to more arid conditions in C3 plants. Here we review published and unpublished data on over 100 plants to examine this relationship. Contrary to expectations, C3 dicots show no clear relationship between δ13Cl and 2ɛl/w. This global lack of correlation is surprising given our understanding of aridity related isotopic effects in C3 plants. One possibility is that the implicit assumption of constant fractionation between lipid and bulk tissue is flawed due to the effects of different biosynthetic carriers and reaction pathways. We explore this possibility by examining the offset of leaf-wax carbon isotopes from the bulk leaf tissue (13ɛl/bulk). Different offsets would indicate additional biosynthetic processes are affecting δ13Cl in addition to any direct effects from aridity. We find that 13ɛl/bulk is highly variable, ranging from -1 to -16‰, which could explain the lack of correlation between δ13Cl and 2ɛl/w. In addition, 13ɛl/bulk values for C3 and C4 monocots (averages of -10.6 and -11.4‰ respectively) represent significantly greater offset between leaf wax and bulk tissue than in C3 dicots (average of -4.3‰), which is consistent with previous

  4. Biosynthetic preparation of selectively deuterated phosphatidylcholine in genetically modified Escherichia coli

    PubMed Central

    Maric, Selma; Thygesen, Mikkel B.; Schiller, Jürgen; Marek, Magdalena; Moulin, Martine; Haertlein, Michael; Forsyth, V. Trevor; Bogdanov, Mikhail; Dowhan, William; Arleth, Lise

    2014-01-01

    Phosphatidylcholine (PC) is a major component of eukaryotic cell membranes and one of the most commonly used phospholipids for reconstitution of membrane proteins into carrier systems such as lipid vesicles, micelles and nanodiscs. Selectively deuterated versions of this lipid have many applications, especially in structural studies using techniques such as NMR, neutron reflectivity and small-angle neutron scattering. Here we present a comprehensive study of selective deuteration of phosphatidylcholine through biosynthesis in a genetically modified strain of Escherichia coli. By carefully tuning the deuteration level in E. coli growth media and varying the deuteration of supplemented carbon sources, we show that it is possible to achieve a controlled deuteration for three distinct parts of the PC lipid molecule, namely the (a) lipid head group, (b) glycerol backbone and (c) fatty acyl tail. This biosynthetic approach paves the way for the synthesis of specifically deuterated, physiologically relevant phospholipid species which remain difficult to obtain through standard chemical synthesis. PMID:25301578

  5. Trehalose Polyphleates Are Produced by a Glycolipid Biosynthetic Pathway Conserved across Phylogenetically Distant Mycobacteria.

    PubMed

    Burbaud, Sophie; Laval, Françoise; Lemassu, Anne; Daffé, Mamadou; Guilhot, Christophe; Chalut, Christian

    2016-02-18

    Mycobacteria synthesize a variety of structurally related glycolipids with major biological functions. Common themes have emerged for the biosynthesis of these glycolipids, including several families of proteins. Genes encoding these proteins are usually clustered on bacterial chromosomal islets dedicated to the synthesis of one glycolipid family. Here, we investigated the function of a cluster of five genes widely distributed across non-tuberculous mycobacteria. Using defined mutant analysis and in-depth structural characterization of glycolipids from wild-type or mutant strains of Mycobacterium smegmatis and Mycobacterium abscessus, we established that they are involved in the formation of trehalose polyphleates (TPP), a family of compounds originally described in Mycobacterium phlei. Comparative genomics and lipid analysis of strains distributed along the mycobacterial phylogenetic tree revealed that TPP is synthesized by a large number of non-tuberculous mycobacteria. This work unravels a novel glycolipid biosynthetic pathway in mycobacteria and extends the spectrum of bacteria that produce TPP. PMID:27028886

  6. A Unique Tryptophan C-Prenyltransferase from the Kawaguchipeptin Biosynthetic Pathway.

    PubMed

    Parajuli, Anirudra; Kwak, Daniel H; Dalponte, Luca; Leikoski, Niina; Galica, Tomas; Umeobika, Ugochukwu; Trembleau, Laurent; Bent, Andrew; Sivonen, Kaarina; Wahlsten, Matti; Wang, Hao; Rizzi, Ermanno; De Bellis, Gianluca; Naismith, James; Jaspars, Marcel; Liu, Xinyu; Houssen, Wael; Fewer, David Peter

    2016-03-01

    Cyanobactins are a rapidly growing family of linear and cyclic peptides produced by cyanobacteria. Kawaguchipeptins A and B, two macrocyclic undecapeptides reported earlier from Microcystis aeruginosa NIES-88, are shown to be products of the cyanobactin biosynthetic pathway. The 9 kb kawaguchipeptin (kgp) gene cluster was identified in a 5.26 Mb draft genome of Microcystis aeruginosa NIES-88. We verified that this gene cluster is responsible for the production of the kawaguchipeptins through heterologous expression of the kgp gene cluster in Escherichia coli. The KgpF prenyltransferase was overexpressed and was shown to prenylate C-3 of Trp residues in both linear and cyclic peptides in vitro. Our findings serve to further enhance the structural diversity of cyanobactins to include tryptophan-prenylated cyclic peptides. PMID:26846478

  7. Identification of a new diterpene biosynthetic gene cluster that produces O-methylkolavelool in Herpetosiphon aurantiacus.

    PubMed

    Nakano, Chiaki; Oshima, Misaki; Kurashima, Nodoka; Hoshino, Tsutomu

    2015-03-23

    Diterpenoids are usually found in plants and fungi, but are rare in bacteria. We have previously reported new diterpenes, named tuberculosinol and isotuberculosinol, which are generated from the Mycobacterium tuberculosis gene products Rv3377c and Rv3378c. No homologous gene was found at that time, but we recently found highly homologous proteins in the Herpetosiphon aurantiacus ATCC 23779 genome. Haur_2145 was a class II diterpene cyclase responsible for the conversion of geranylgeranyl diphosphate into kolavenyl diphosphate. Haur_2146, homologous to Rv3378c, synthesized (+)-kolavelool through the nucleophilic addition of a water molecule to the incipient cation formed after the diphosphate moiety was released. Haur_2147 afforded (+)-O-methylkolavelool from (+)-kolavelool, so this enzyme was an O-methyltransferase. This new diterpene was indeed detected in H. aurantiacus cells. This is the first report of the identification of a (+)-O-methylkolavelool biosynthetic gene cluster.

  8. First Biosynthetic pathway of 1-hepten-3-one in Iporangaia pustulosa (Opiliones)

    PubMed Central

    Rocha, Daniele F. O.; Wouters, Felipe C.; Machado, Glauco; Marsaioli, Anita J.

    2013-01-01

    Arthropods produce a great variety of natural compounds, many of which have unexplored biosynthesis. Among the armored harvestmen (Arachnida: Opiliones) of the suborder Laniatores, the defensive gland exudates contain vinyl ketones and other constituents of supposed polyketide origin. We have studied the biosynthesis of 1-hepten-3-one in the Neotropical harvestman Iporangaia pustulosa by feeding individuals with 13C-labeled precursors, demonstrating its mixed acetate/propionate origin. 13C NMR spectroscopy showed an unusual labeling pattern suggesting different propionate sources for starting and extender units. Our analysis also indicates the presence of methylmalonyl-CoA mutase, converting acetate into propionyl-CoA via succinyl-CoA, together with other C3 unit routes. This is the first biosynthetic study of alkyl vinyl ketones in arthropods. Our results shed light on the origin and diversification of chemical compounds in a major arthropod group. PMID:24193576

  9. Water splitting-biosynthetic system with CO₂ reduction efficiencies exceeding photosynthesis.

    PubMed

    Liu, Chong; Colón, Brendan C; Ziesack, Marika; Silver, Pamela A; Nocera, Daniel G

    2016-06-01

    Artificial photosynthetic systems can store solar energy and chemically reduce CO2 We developed a hybrid water splitting-biosynthetic system based on a biocompatible Earth-abundant inorganic catalyst system to split water into molecular hydrogen and oxygen (H2 and O2) at low driving voltages. When grown in contact with these catalysts, Ralstonia eutropha consumed the produced H2 to synthesize biomass and fuels or chemical products from low CO2 concentration in the presence of O2 This scalable system has a CO2 reduction energy efficiency of ~50% when producing bacterial biomass and liquid fusel alcohols, scrubbing 180 grams of CO2 per kilowatt-hour of electricity. Coupling this hybrid device to existing photovoltaic systems would yield a CO2 reduction energy efficiency of ~10%, exceeding that of natural photosynthetic systems. PMID:27257255

  10. Sex pheromone biosynthetic pathways are conserved between moths and the butterfly Bicyclus anynana

    PubMed Central

    Liénard, Marjorie A; Wang, Hong-Lei; Lassance, Jean-Marc; Löfstedt, Christer

    2014-01-01

    Although phylogenetically nested within the moths, butterflies have diverged extensively in a number of life history traits. Whereas moths rely greatly on chemical signals, visual advertisement is the hallmark of mate finding in butterflies. In the context of courtship, however, male chemical signals are widespread in both groups although they likely have multiple evolutionary origins. Here, we report that in males of the butterfly Bicyclus anynana, courtship scents are produced de novo via biosynthetic pathways shared with females of many moth species. We show that two of the pheromone components that play a major role in mate choice, namely the (Z)-9-tetradecenol and hexadecanal, are produced through the activity of a fatty acyl Δ11-desaturase and two specialized alcohol-forming fatty acyl reductases. Our study provides the first evidence of conservation and sharing of ancestral genetic modules for the production of FA-derived pheromones over a long evolutionary timeframe thereby reconciling mate communication in moths and butterflies. PMID:24862548

  11. First Biosynthetic pathway of 1-hepten-3-one in Iporangaia pustulosa (Opiliones)

    NASA Astrophysics Data System (ADS)

    Rocha, Daniele F. O.; Wouters, Felipe C.; Machado, Glauco; Marsaioli, Anita J.

    2013-11-01

    Arthropods produce a great variety of natural compounds, many of which have unexplored biosynthesis. Among the armored harvestmen (Arachnida: Opiliones) of the suborder Laniatores, the defensive gland exudates contain vinyl ketones and other constituents of supposed polyketide origin. We have studied the biosynthesis of 1-hepten-3-one in the Neotropical harvestman Iporangaia pustulosa by feeding individuals with 13C-labeled precursors, demonstrating its mixed acetate/propionate origin. 13C NMR spectroscopy showed an unusual labeling pattern suggesting different propionate sources for starting and extender units. Our analysis also indicates the presence of methylmalonyl-CoA mutase, converting acetate into propionyl-CoA via succinyl-CoA, together with other C3 unit routes. This is the first biosynthetic study of alkyl vinyl ketones in arthropods. Our results shed light on the origin and diversification of chemical compounds in a major arthropod group.

  12. Nutrient shortage triggers the hexosamine biosynthetic pathway via the GCN2-ATF4 signalling pathway

    PubMed Central

    Chaveroux, Cédric; Sarcinelli, Carmen; Barbet, Virginie; Belfeki, Sofiane; Barthelaix, Audrey; Ferraro-Peyret, Carole; Lebecque, Serge; Renno, Toufic; Bruhat, Alain; Fafournoux, Pierre; Manié, Serge N.

    2016-01-01

    The hexosamine biosynthetic pathway (HBP) is a nutrient-sensing metabolic pathway that produces the activated amino sugar UDP-N-acetylglucosamine, a critical substrate for protein glycosylation. Despite its biological significance, little is known about the regulation of HBP flux during nutrient limitation. Here, we report that amino acid or glucose shortage increase GFAT1 production, the first and rate-limiting enzyme of the HBP. GFAT1 is a transcriptional target of the activating transcription factor 4 (ATF4) induced by the GCN2-eIF2α signalling pathway. The increased production of GFAT1 stimulates HBP flux and results in an increase in O-linked β-N-acetylglucosamine protein modifications. Taken together, these findings demonstrate that ATF4 provides a link between nutritional stress and the HBP for the regulation of the O-GlcNAcylation-dependent cellular signalling. PMID:27255611

  13. Molecular Cloning and Heterologous Expression of the Dehydrophos Biosynthetic Gene Cluster

    PubMed Central

    Circello, Benjamin T.; Eliot, Andrew C.; Lee, Jin-Hee; van der Donk, Wilfred A.; Metcalf, William W.

    2010-01-01

    Summary Dehydrophos is a vinyl phosphonate tripeptide produced by Streptomyces luridus with demonstrated broad spectrum antibiotic activity. To identify genes necessary for biosynthesis of this unusual compound we screened a fosmid library of S. luridus for the presence of the phosphoenolpyruvate mutase gene, which is required for biosynthesis of most phosphonates. Integration of one such fosmid clone into the chromosome of Streptomyces lividans led to heterologous production of dehydrophos. Deletion analysis of this clone allowed identification of the minimal contiguous dehydrophos cluster, which contained 17 open reading frames (ORFs). Bioinformatic analyses of these ORFs are consistent with a proposed biosynthetic pathway that generates dehydrophos from phosphoenolpyruvate. The early steps of this pathway are supported by analysis of intermediates accumulated by blocked mutants and in vitro biochemical experiments. PMID:20416511

  14. Elongating internodes of Zea mays (maize): Early steps in the GA biosynthetic pathway

    SciTech Connect

    Suzuki, Y.; Phinney, B.O. ); Gaskin, P.; MacMillan, J. )

    1989-04-01

    The early steps in the gibberellin (GA) biosynthetic pathway have yet to be defined for tissues that show a growth response to GAs. To this end we have synthesized the ({sup 13}C,{sup 3}H)-ent-kaurenoids, ent-kaurenol, ent-kaurenal ent-kaukenoic acid. We also have double-labeled ent-kaurene and double-labeled GA{sub 12}-aldehyde. We feed 1 - 10{mu}g of each substrate, individually, to 1.0g diced internodes in the appropriate buffer plus cofactors. We have observed up to 80% metabolism. We have identified (full scan GC-MS) 7{beta}-hydroxy-ent-kaurenoic acid as the major metabolite from double-labeled ent-kaurenoic acid feeds, thus defining the step ent-kaurenoic acid to 7{beta}-hydroxy-ent-kaurenoic acid.

  15. Integrative genomic mining for enzyme function to enable engineering of a non-natural biosynthetic pathway

    PubMed Central

    Mak, Wai Shun; Tran, Stephen; Marcheschi, Ryan; Bertolani, Steve; Thompson, James; Baker, David; Liao, James C.; Siegel, Justin B.

    2015-01-01

    The ability to biosynthetically produce chemicals beyond what is commonly found in Nature requires the discovery of novel enzyme function. Here we utilize two approaches to discover enzymes that enable specific production of longer-chain (C5–C8) alcohols from sugar. The first approach combines bioinformatics and molecular modelling to mine sequence databases, resulting in a diverse panel of enzymes capable of catalysing the targeted reaction. The median catalytic efficiency of the computationally selected enzymes is 75-fold greater than a panel of naively selected homologues. This integrative genomic mining approach establishes a unique avenue for enzyme function discovery in the rapidly expanding sequence databases. The second approach uses computational enzyme design to reprogramme specificity. Both approaches result in enzymes with >100-fold increase in specificity for the targeted reaction. When enzymes from either approach are integrated in vivo, longer-chain alcohol production increases over 10-fold and represents >95% of the total alcohol products. PMID:26598135

  16. Biosynthetic pathway of the phytohormone auxin in insects and screening of its inhibitors.

    PubMed

    Suzuki, Hiroyoshi; Yokokura, Junpei; Ito, Tsukasa; Arai, Ryoma; Yokoyama, Chiaki; Toshima, Hiroaki; Nagata, Shinji; Asami, Tadao; Suzuki, Yoshihito

    2014-10-01

    Insect galls are abnormal plant tissues induced by galling insects. The galls are used for food and habitation, and the phytohormone auxin, produced by the insects, may be involved in their formation. We found that the silkworm, a non-galling insect, also produces an active form of auxin, indole-3-acetic acid (IAA), by de novo synthesis from tryptophan (Trp). A detailed metabolic analysis of IAA using IAA synthetic enzymes from silkworms indicated an IAA biosynthetic pathway composed of a three-step conversion: Trp → indole-3-acetaldoxime → indole-3-acetaldehyde (IAAld) → IAA, of which the first step is limiting IAA production. This pathway was shown to also operate in gall-inducing sawfly. Screening of a chemical library identified two compounds that showed strong inhibitory activities on the conversion step IAAld → IAA. The inhibitors can be efficiently used to demonstrate the importance of insect-synthesized auxin in gall formation in the future.

  17. A general stereocontrolled, convergent synthesis of oligoprenols that parallels the biosynthetic pathway.

    PubMed

    Radetich, Branko; Corey, E J

    2002-03-20

    A solution is reported to the classic unsolved problem of stereoselective synthesis of all-E oligoprenols, such as E-farnesylfarnesol, by a cationic coupling analogous to the biosynthetic pathway. The simplicity and efficacy of the method, which is outlined in Scheme 1, are demonstrated by the synthesis of a series of all-E oligoprenols from C(20) to C(35) in uniformly excellent overall yield. The success of the approach is due not only to the highly E-stereoselective C-C coupling that forms the oligoprenyl chain but also to the development of efficient syntheses of allylic secondary silanes and E-oligoprenal acetals, and to a selective allylic demethoxylation reaction.

  18. Taking the Scenic Route: Biosynthetic Traffic to the Plasma Membrane in Polarized Epithelial Cells

    PubMed Central

    Fölsch, Heike; Mattila, Polly E.; Weisz, Ora A.

    2009-01-01

    The maintenance of epithelial cell function requires the establishment and continuous renewal of differentiated apical and basolateral plasma membrane domains with distinct lipid and protein compositions. Newly synthesized proteins destined for either surface domain are processed along the biosynthetic pathway and segregated into distinct subsets of transport carriers emanating from the trans-Golgi network. Recent studies have illuminated additional complexities in the subsequent delivery of these proteins to the cell surface. In particular, multiple routes to the apical and basolateral cell surfaces have been uncovered, and many of these involve indirect passage through endocytic compartments. This review summarizes our current understanding of these routes and discusses open issues that remain to be clarified. PMID:19453969

  19. Revision of the stereochemistry of elisabethatriene, a putative biosynthetic intermediate of pseudopterosins.

    PubMed

    Nasuda, Masayuki; Ohmori, Miho; Ohyama, Kiyoshi; Fujimoto, Yoshinori

    2012-01-01

    In the past, we have questioned the accuracy of the stereochemistry of elisabethatriene, a putative biosynthetic intermediate of pseudopterosins, in light of the configuration of elisabethatrienol isolated from Pseudopterogorgia elisabethae, which was represented as 1S,4R,9S,11S. We have reinvestigated the stereochemistry of elisabethatriene. Elisabethatriene with the reported 1S,4R,9R,11S configuration was synthesized starting from (-)-isopulegol in its enantiomeric form. The (1)H- and (13)C-NMR data of the synthesized compound differed from those reported for elisabethatriene. In addition to the fact that elisabethatriene is converted into pseudopterosins, this finding has allowed us to propose that elisabethatriene should have the 1S,4R,9S,11S stereochemistry, which is identical to that of elisabethatrienol. PMID:22689408

  20. Water splitting-biosynthetic system with CO₂ reduction efficiencies exceeding photosynthesis.

    PubMed

    Liu, Chong; Colón, Brendan C; Ziesack, Marika; Silver, Pamela A; Nocera, Daniel G

    2016-06-01

    Artificial photosynthetic systems can store solar energy and chemically reduce CO2 We developed a hybrid water splitting-biosynthetic system based on a biocompatible Earth-abundant inorganic catalyst system to split water into molecular hydrogen and oxygen (H2 and O2) at low driving voltages. When grown in contact with these catalysts, Ralstonia eutropha consumed the produced H2 to synthesize biomass and fuels or chemical products from low CO2 concentration in the presence of O2 This scalable system has a CO2 reduction energy efficiency of ~50% when producing bacterial biomass and liquid fusel alcohols, scrubbing 180 grams of CO2 per kilowatt-hour of electricity. Coupling this hybrid device to existing photovoltaic systems would yield a CO2 reduction energy efficiency of ~10%, exceeding that of natural photosynthetic systems.

  1. Horizontal gene transfer and redundancy of tryptophan biosynthetic enzymes in dinotoms.

    PubMed

    Imanian, Behzad; Keeling, Patrick J

    2014-02-01

    A tertiary endosymbiosis between a dinoflagellate host and diatom endosymbiont gave rise to "dinotoms," cells with a unique nuclear and mitochondrial redundancy derived from two evolutionarily distinct eukaryotic lineages. To examine how this unique redundancy might have affected the evolution of metabolic systems, we investigated the transcription of genes involved in biosynthesis of the amino acid tryptophan in three species, Durinskia baltica, Kryptoperidinium foliaceum, and Glenodinium foliaceum. From transcriptome sequence data, we recovered two distinct sets of protein-coding transcripts covering the entire tryptophan biosynthetic pathway. Phylogenetic analyses suggest a diatom origin for one set of the proteins, which we infer to be expressed in the endosymbiont, and that the other arose from multiple horizontal gene transfer events to the dinoflagellate ancestor of the host lineage. This is the first indication that these cells retain redundant sets of transcripts and likely metabolic pathways for the biosynthesis of small molecules and extend their redundancy to their two distinct nuclear genomes. PMID:24448981

  2. Integrative genomic mining for enzyme function to enable engineering of a non-natural biosynthetic pathway.

    PubMed

    Mak, Wai Shun; Tran, Stephen; Marcheschi, Ryan; Bertolani, Steve; Thompson, James; Baker, David; Liao, James C; Siegel, Justin B

    2015-11-24

    The ability to biosynthetically produce chemicals beyond what is commonly found in Nature requires the discovery of novel enzyme function. Here we utilize two approaches to discover enzymes that enable specific production of longer-chain (C5-C8) alcohols from sugar. The first approach combines bioinformatics and molecular modelling to mine sequence databases, resulting in a diverse panel of enzymes capable of catalysing the targeted reaction. The median catalytic efficiency of the computationally selected enzymes is 75-fold greater than a panel of naively selected homologues. This integrative genomic mining approach establishes a unique avenue for enzyme function discovery in the rapidly expanding sequence databases. The second approach uses computational enzyme design to reprogramme specificity. Both approaches result in enzymes with >100-fold increase in specificity for the targeted reaction. When enzymes from either approach are integrated in vivo, longer-chain alcohol production increases over 10-fold and represents >95% of the total alcohol products.

  3. Conservation of the pyrrolnitrin biosynthetic gene cluster among six pyrrolnitrin-producing strains.

    PubMed

    Hammer, P E; Burd, W; Hill, D S; Ligon, J M; van Pée, K

    1999-11-01

    The prnABCD gene cluster from Pseudomonas fluorescens encodes the biosynthetic pathway for pyrrolnitrin, a secondary metabolite derived from tryptophan which has strong anti-fungal activity. We used the prn genes from P. fluorescens strain BL915 as a probe to clone and sequence homologous genes from three other Pseudomonas strains, Burkholderia cepacia and Myxococcus fulvus. With the exception of the prnA gene from M. fulvus59% similar among the strains, indicating that the biochemical pathway for pyrrolnitrin biosynthesis is highly conserved. The prnA gene from M. fulvus is about 45% similar to prnA from the other strains and contains regions which are highly conserved among all six strains.

  4. Identification and Characterization of the Pyridomycin Biosynthetic Gene Cluster of Streptomyces pyridomyceticus NRRL B-2517*

    PubMed Central

    Huang, Tingting; Wang, Yemin; Yin, Jun; Du, Yanhua; Tao, Meifeng; Xu, Jing; Chen, Wenqing; Lin, Shuangjun; Deng, Zixin

    2011-01-01

    Pyridomycin is a structurally unique antimycobacterial cyclodepsipeptide containing rare 3-(3-pyridyl)-l-alanine and 2-hydroxy-3-methylpent-2-enoic acid moieties. The biosynthetic gene cluster for pyridomycin has been cloned and identified from Streptomyces pyridomyceticus NRRL B-2517. Sequence analysis of a 42.5-kb DNA region revealed 26 putative open reading frames, including two nonribosomal peptide synthetase (NRPS) genes and a polyketide synthase gene. A special feature is the presence of a polyketide synthase-type ketoreductase domain embedded in an NRPS. Furthermore, we showed that PyrA functioned as an NRPS adenylation domain that activates 3-hydroxypicolinic acid and transfers it to a discrete peptidyl carrier protein, PyrU, which functions as a loading module that initiates pyridomycin biosynthesis in vivo and in vitro. PyrA could also activate other aromatic acids, generating three pyridomycin analogues in vivo. PMID:21454714

  5. Characterization of the Tautomycetin Biosynthetic Gene Cluster from Streptomyces griseochromogenes Provides New Insight into Dialkylmaleic Anhydride Biosynthesis#

    PubMed Central

    Li, Wenli; Luo, Yinggang; Ju, Jianhua; Rajski, Scott R.; Osada, Hiroyuki; Shen, Ben

    2010-01-01

    Tautomycetin (TTN) is a highly potent and specific protein phosphatase inhibitor isolated from Streptomyces griseochromogenes. The biological activity of TTN makes it an important lead for drug discovery, whereas its rare dialkylmaleic anhydride moiety and structural similarity to tautomycin (TTM), another potent phosphatase inhibitor with tremendous medicinal potential, draws attention to novel biosynthetic chemistries responsible for its production. To elucidate the biosynthetic machinery associated with TTN production, the ttn biosynthetic gene cluster from S. griseochromogenes was isolated and characterized, and its involvement in TTN biosynthesis confirmed by gene inactivation and complementation experiments. The ttn cluster was localized to a 79 kb DNA region, consisting of 19 open reading frames that encode two modular type I polyketide synthases (TtnAB), one type II thioesterase (TtnH), eight proteins for dialkylmaleic anhydride biosynthesis (TtnKLMNOPRS), four tailoring enzymes (TtnCDFI), two regulatory proteins (TtnGQ), and one resistance protein (TtnJ). A model for TTN biosynthesis is proposed on the basis of functional assignments from sequence analysis, which agrees well with previous feeding experiments, has been supported by in vivo gene inactivation experiments, and is supported by analogy to the recently reported ttm cluster. These findings set the stage to fully investigate TTN biosynthesis and to biosynthetically engineer new TTN analogues. PMID:19191560

  6. Multiplex PCR analysis of fumonisin biosynthetic genes in fumonisin-nonproducing Aspergillus niger and A. awamori strains

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In order to determine the genetic basis for loss of fumonisin B¬2 (FB2) biosynthesis in FB2 non-producing A. niger strains, we developed multiplex PCR primer sets to amplify fragments of eight fumonisin biosynthetic pathway (fum) genes. Fragments of all eight fum genes were amplified in FB2-produci...

  7. Identification of Coq11, a New Coenzyme Q Biosynthetic Protein in the CoQ-Synthome in Saccharomyces cerevisiae*

    PubMed Central

    Allan, Christopher M.; Awad, Agape M.; Johnson, Jarrett S.; Shirasaki, Dyna I.; Wang, Charles; Blaby-Haas, Crysten E.; Merchant, Sabeeha S.; Loo, Joseph A.; Clarke, Catherine F.

    2015-01-01

    Coenzyme Q (Q or ubiquinone) is a redox active lipid composed of a fully substituted benzoquinone ring and a polyisoprenoid tail and is required for mitochondrial electron transport. In the yeast Saccharomyces cerevisiae, Q is synthesized by the products of 11 known genes, COQ1–COQ9, YAH1, and ARH1. The function of some of the Coq proteins remains unknown, and several steps in the Q biosynthetic pathway are not fully characterized. Several of the Coq proteins are associated in a macromolecular complex on the matrix face of the inner mitochondrial membrane, and this complex is required for efficient Q synthesis. Here, we further characterize this complex via immunoblotting and proteomic analysis of tandem affinity-purified tagged Coq proteins. We show that Coq8, a putative kinase required for the stability of the Q biosynthetic complex, is associated with a Coq6-containing complex. Additionally Q6 and late stage Q biosynthetic intermediates were also found to co-purify with the complex. A mitochondrial protein of unknown function, encoded by the YLR290C open reading frame, is also identified as a constituent of the complex and is shown to be required for efficient de novo Q biosynthesis. Given its effect on Q synthesis and its association with the biosynthetic complex, we propose that the open reading frame YLR290C be designated COQ11. PMID:25631044

  8. Ethylene biosynthetic genes are differentially expressed during carnation (Dianthus caryophyllus L.) flower senescence.

    PubMed

    ten Have, A; Woltering, E J

    1997-05-01

    Ethylene production and expression patterns of an 1-aminocyclopropane-1-carboxylic acid (ACC) oxidase (CARAO1) and of two ACC synthase (EC 4.4.1.14) genes (CARACC3 and CARAS1) were studied in floral organs of cut carnation flowers (Dianthus caryophyllus L.) cv. White Sim. During the vase life and after treatment of fresh flowers with ethylene, production of ethylene and expression of ethylene biosynthetic genes first started in the ovary followed by the styles and the petals. ACC oxidase was expressed in all the floral organs whereas, during the vase life, tissue-specific expression of the two ACC synthase genes was observed. After treatment with a high ethylene concentration, tissue specificity of the two ACC synthase genes was lost and only a temporal difference in expression remained. In styles, poor correlation between ethylene production and ACC synthase (CARAS1) gene expression was observed suggesting that either activity is regulated at the translational level or that the CARAS1 gene product requires an additional factor for activity. Isolated petals showed no increase in ethylene production and expression of ethylene biosynthetic genes when excised from the flower before the increase in petal ethylene production (before day 7); showed rapid cessation of ethylene production and gene expression when excised during the early phase of petal ethylene production (day 7) and showed a pattern of ethylene production and gene expression similar to the pattern observed in the attached petals when isolated at day 8. The interorgan regulation of gene expression and ethylene as a signal molecule in flower senescence are discussed.

  9. Distribution of. delta. -aminolevulinic acid biosynthetic pathways among phototrophic and related bacteria

    SciTech Connect

    Avissar, Y.J.; Beale, S.I. ); Ormerod, J.G. )

    1989-04-01

    Two biosynthetic pathways are known for the universal tetrapyrrole precursor, {delta}-aminolevulinic acid (ALA): condensation of glycine and succinyl-CoA to form ALA with the loss of C-1 of glycine as CO{sub 2}, and conversion of the intact carbon skeleton of glutamate to ALA in a process requiring tRNA{sup Glu}, ATP, Mg{sup 2+}, NADPH, and pyridoxal phosphate. The distribution of the two ALA biosynthetic pathways among various bacterial genera was determined, using cell-free extracts obtained from representative organisms. Evidence for the operation of the glutamate pathway was obtained by the measurement of RNase-sensitive label incorporation from glutamate into ALA using 3,4-({sup 3}H)glutamate and 1-({sup 14}C)glutamate as substrate. The glycine pathway was indicated by RNase-insensitive incorporation of level from 2-({sup 14}C)glycine into ALA. The distribution of the two pathways among the bacteria tested was in general agreement with their previously phylogenetic relationships and clearly indicates that the glutamate pathway is the more ancient process, whereas the glycine pathway probably evolved much later. The glutamate pathway is the more widely utilized one among bacteria, while the glycine pathway is apparently limited to the {alpha} subgroup of purple bacteria (including Rhodobacter, Rhodospirillum, and Rhizobium). E. coli was found ALA via the glutamate pathway. The ALA-requiring hemA mutant of E. coli was determined to lack the dehydrogenase activity that utilizes glutamyl-tRNA as a substrate.

  10. Role of a Microcin-C–like biosynthetic gene cluster in allelopathic interactions in marine Synechococcus

    PubMed Central

    Paz-Yepes, Javier; Brahamsha, Bianca; Palenik, Brian

    2013-01-01

    Competition between phytoplankton species for nutrients and light has been studied for many years, but allelopathic interactions between them have been more difficult to characterize. We used liquid and plate assays to determine whether these interactions occur between marine unicellular cyanobacteria of the genus Synechococcus. We have found a clear growth impairment of Synechococcus sp. CC9311 and Synechococcus sp. WH8102 when they are cultured in the presence of Synechococcus sp. CC9605. The genome of CC9605 contains a region showing homology to genes of the Escherichia coli Microcin C (McC) biosynthetic pathway. McC is a ribosome-synthesized peptide that inhibits translation in susceptible strains. We show that the CC9605 McC gene cluster is expressed and that three genes (mccD, mccA, and mccB) are further induced by coculture with CC9311. CC9605 was resistant to McC purified from E. coli, whereas strains CC9311 and WH8102 were sensitive. Cloning the CC9605 McC biosynthetic gene cluster into sensitive CC9311 led this strain to become resistant to both purified E. coli McC and Synechococcus sp. CC9605. A CC9605 mutant lacking mccA1, mccA2, and the N-terminal domain of mccB did not inhibit CC9311 growth, whereas the inhibition of WH8102 was reduced. Our results suggest that an McC-like molecule is involved in the allelopathic interactions with CC9605. PMID:23818639

  11. Determining the Biochemical Properties of the Oxalate Biosynthetic Component (Obc)1 from Burkholderia mallei

    PubMed Central

    Lambert, Peter M.

    2016-01-01

    Oxalic acid is produced by a variety of organisms ranging from simple microbes to complex animals. This acid has been proposed to fulfill various physiological and pathological functions which vary between organisms. In bacteria from the Burkholderia genus, oxalate secretion has been shown to be quorum sensing dependent and to support pathogenicity and cell viability. In light of the critical roles of oxalate in Burkholderia as well as other organisms, it is surprising that our understanding of how this simple dicarboxylate is biosynthesized remains incomplete. Here we report the expression, purification, and partial characterization of the first intact bacterial oxalate biosynthetic enzyme, Obc1, from B. mallei. An N-terminal His-tagged Bmobc1 was cloned into pDUET, expressed in E. coli BLR (DE3), and the recombinant enzyme purified by affinity chromatography. Oxalate biosynthetic enzyme assays coupled with HPLC analysis revealed that BmObc1 catalyzed the biosynthesis of oxalate, acetoacetate, and free CoA from oxaloacetate and a short chain acyl-CoA following Michaelis-Menten kinetics. Optimal enzyme activity was measured at pH 8.0 and a temperature around 44°C. Kinetic analysis conducted under conditions of saturating acetyl-CoA and varying oxaloacetate concentrations resulted in a calculated Km value for oxaloacetate of 94.3± 9.2 μM (mean ± SE). Under conditions of saturating oxaloacetate concentration and varying acyl-CoA (acetyl- or propionyl-CoA) concentrations kinetic analysis generated a calculated Km value of 26.8 ± 2.3 μM (mean ± SE) for acetyl-CoA and 104.4 ± 12.7 μM for propionyl-CoA. The significantly lower Km for acetyl-CoA suggests that it is strongly favored as a substrate over propionyl-CoA. PMID:27643499

  12. Evolutionary Conservation of Xylan Biosynthetic Genes in Selaginella moellendorffii and Physcomitrella patens.

    PubMed

    Haghighat, Marziyeh; Teng, Quincy; Zhong, Ruiqin; Ye, Zheng-Hua

    2016-08-01

    Xylan is a major cross-linking hemicellulose in secondary walls of vascular tissues, and the recruitment of xylan as a secondary wall component was suggested to be a pivotal event for the evolution of vascular tissues. To decipher the evolution of xylan structure and xylan biosynthetic genes, we analyzed xylan substitution patterns and characterized genes mediating methylation of glucuronic acid (GlcA) side chains in xylan of the model seedless vascular plant, Selaginella moellendorffii, and investigated GT43 genes from S. moellendorffii and the model non-vascular plant, Physcomitrella patens, for their roles in xylan biosynthesis. Using nuclear magentic resonance spectroscopy, we have demonstrated that S. moellendorffii xylan consists of β-1,4-linked xylosyl residues subsituted solely with methylated GlcA residues and that xylans from both S. moellendorffii and P. patens are acetylated at O-2 and O-3. To investigate genes responsible for GlcA methylation of xylan, we identified two DUF579 genes in the S. moellendorffii genome and showed that one of them, SmGXM, encodes a glucuronoxylan methyltransferase capable of adding the methyl group onto the GlcA side chain of xylooligomers. Furthermore, we revealed that the two GT43 genes in S. moellendorffii, SmGT43A and SmGT43B, are functional orthologs of the Arabidopsis xylan backbone biosynthetic genes IRX9 and IRX14, respectively, indicating the evolutionary conservation of the involvement of two functionally non-redundant groups of GT43 genes in xylan backbone biosynthesis between seedless and seed vascular plants. Among the five GT43 genes in P. patens, PpGT43A was found to be a functional ortholog of Arabidopsis IRX9, suggesting that the recruitment of GT43 genes in xylan backbone biosynthesis occurred when non-vascular plants appeared on land. PMID:27345025

  13. Amylopectin biosynthetic enzymes from developing rice seed form enzymatically active protein complexes

    PubMed Central

    Crofts, Naoko; Abe, Natsuko; Oitome, Naoko F.; Matsushima, Ryo; Hayashi, Mari; Tetlow, Ian J.; Emes, Michael J.; Nakamura, Yasunori; Fujita, Naoko

    2015-01-01

    Amylopectin is a highly branched, organized cluster of glucose polymers, and the major component of rice starch. Synthesis of amylopectin requires fine co-ordination between elongation of glucose polymers by soluble starch synthases (SSs), generation of branches by branching enzymes (BEs), and removal of misplaced branches by debranching enzymes (DBEs). Among the various isozymes having a role in amylopectin biosynthesis, limited numbers of SS and BE isozymes have been demonstrated to interact via protein–protein interactions in maize and wheat amyloplasts. This study investigated whether protein–protein interactions are also found in rice endosperm, as well as exploring differences between species. Gel permeation chromatography of developing rice endosperm extracts revealed that all 10 starch biosynthetic enzymes analysed were present at larger molecular weights than their respective monomeric sizes. SSIIa, SSIIIa, SSIVb, BEI, BEIIb, and PUL co-eluted at mass sizes >700kDa, and SSI, SSIIa, BEIIb, ISA1, PUL, and Pho1 co-eluted at 200–400kDa. Zymogram analyses showed that SSI, SSIIIa, BEI, BEIIa, BEIIb, ISA1, PUL, and Pho1 eluted in high molecular weight fractions were active. Comprehensive co-immunoprecipitation analyses revealed associations of SSs–BEs, and, among BE isozymes, BEIIa–Pho1, and pullulanase-type DBE–BEI interactions. Blue-native-PAGE zymogram analyses confirmed the glucan-synthesizing activity of protein complexes. These results suggest that some rice starch biosynthetic isozymes are physically associated with each other and form active protein complexes. Detailed analyses of these complexes will shed light on the mechanisms controlling the unique branch and cluster structure of amylopectin, and the physicochemical properties of starch. PMID:25979995

  14. Characterization of the CDP-2-Glycerol Biosynthetic Pathway in Streptococcus pneumoniae▿ †

    PubMed Central

    Wang, Quan; Xu, Yanli; Perepelov, Andrei V.; Xiong, Wei; Wei, Dongmei; Shashkov, Alexander S.; Knirel, Yuriy A.; Feng, Lu; Wang, Lei

    2010-01-01

    Capsule polysaccharide (CPS) plays an important role in the virulence of Streptococcus pneumoniae and is usually used as the pneumococcal vaccine target. Glycerol-2-phosphate is found in the CPS of S. pneumoniae types 15A and 23F and is rarely found in the polysaccharides of other bacteria. The biosynthetic pathway of the nucleotide-activated form of glycerol-2-phosphate (NDP-2-glycerol) has never been identified. In this study, three genes (gtp1, gtp2, and gtp3) from S. pneumoniae 23F that have been proposed to be involved in the synthesis of NDP-2-glycerol were cloned and the enzyme products were expressed, purified, and assayed for their respective activities. Capillary electrophoresis was used to detect novel products from the enzyme-substrate reactions, and the structure of the product was elucidated using electrospray ionization mass spectrometry and nuclear magnetic resonance spectroscopy. Gtp1 was identified as a reductase that catalyzes the conversion of 1,3-dihydroxyacetone to glycerol, Gtp3 was identified as a glycerol-2-phosphotransferase that catalyzes the conversion of glycerol to glycerol-2-phosphate, and Gtp2 was identified as a cytidylyltransferase that transfers CTP to glycerol-2-phosphate to form CDP-2-glycerol as the final product. The kinetic parameters of Gtp1 and Gtp2 were characterized in depth, and the effects of temperature, pH, and cations on these two enzymes were analyzed. This is the first time that the biosynthetic pathway of CDP-2-glycerol has been identified biochemically; this pathway provides a method to enzymatically synthesize this compound. PMID:20729354

  15. Regulation of Pyrimidine Biosynthetic Gene Expression in Bacteria: Repression without Repressors

    PubMed Central

    Turnbough, Charles L.; Switzer, Robert L.

    2008-01-01

    Summary: DNA-binding repressor proteins that govern transcription initiation in response to end products generally regulate bacterial biosynthetic genes, but this is rarely true for the pyrimidine biosynthetic (pyr) genes. Instead, bacterial pyr gene regulation generally involves mechanisms that rely only on regulatory sequences embedded in the leader region of the operon, which cause premature transcription termination or translation inhibition in response to nucleotide signals. Studies with Escherichia coli and Bacillus subtilis pyr genes reveal a variety of regulatory mechanisms. Transcription attenuation via UTP-sensitive coupled transcription and translation regulates expression of the pyrBI and pyrE operons in enteric bacteria, whereas nucleotide effects on binding of the PyrR protein to pyr mRNA attenuation sites control pyr operon expression in most gram-positive bacteria. Nucleotide-sensitive reiterative transcription underlies regulation of other pyr genes. With the E. coli pyrBI, carAB, codBA, and upp-uraA operons, UTP-sensitive reiterative transcription within the initially transcribed region (ITR) leads to nonproductive transcription initiation. CTP-sensitive reiterative transcription in the pyrG ITRs of gram-positive bacteria, which involves the addition of G residues, results in the formation of an antiterminator RNA hairpin and suppression of transcription attenuation. Some mechanisms involve regulation of translation rather than transcription. Expression of the pyrC and pyrD operons of enteric bacteria is controlled by nucleotide-sensitive transcription start switching that produces transcripts with different potentials for translation. In Mycobacterium smegmatis and other bacteria, PyrR modulates translation of pyr genes by binding to their ribosome binding site. Evidence supporting these conclusions, generalizations for other bacteria, and prospects for future research are presented. PMID:18535147

  16. Determining the Biochemical Properties of the Oxalate Biosynthetic Component (Obc)1 from Burkholderia mallei.

    PubMed

    Lambert, Peter M; Nakata, Paul A

    2016-01-01

    Oxalic acid is produced by a variety of organisms ranging from simple microbes to complex animals. This acid has been proposed to fulfill various physiological and pathological functions which vary between organisms. In bacteria from the Burkholderia genus, oxalate secretion has been shown to be quorum sensing dependent and to support pathogenicity and cell viability. In light of the critical roles of oxalate in Burkholderia as well as other organisms, it is surprising that our understanding of how this simple dicarboxylate is biosynthesized remains incomplete. Here we report the expression, purification, and partial characterization of the first intact bacterial oxalate biosynthetic enzyme, Obc1, from B. mallei. An N-terminal His-tagged Bmobc1 was cloned into pDUET, expressed in E. coli BLR (DE3), and the recombinant enzyme purified by affinity chromatography. Oxalate biosynthetic enzyme assays coupled with HPLC analysis revealed that BmObc1 catalyzed the biosynthesis of oxalate, acetoacetate, and free CoA from oxaloacetate and a short chain acyl-CoA following Michaelis-Menten kinetics. Optimal enzyme activity was measured at pH 8.0 and a temperature around 44°C. Kinetic analysis conducted under conditions of saturating acetyl-CoA and varying oxaloacetate concentrations resulted in a calculated Km value for oxaloacetate of 94.3± 9.2 μM (mean ± SE). Under conditions of saturating oxaloacetate concentration and varying acyl-CoA (acetyl- or propionyl-CoA) concentrations kinetic analysis generated a calculated Km value of 26.8 ± 2.3 μM (mean ± SE) for acetyl-CoA and 104.4 ± 12.7 μM for propionyl-CoA. The significantly lower Km for acetyl-CoA suggests that it is strongly favored as a substrate over propionyl-CoA. PMID:27643499

  17. Assembly of Lipoic Acid on Its Cognate Enzymes: an Extraordinary and Essential Biosynthetic Pathway.

    PubMed

    Cronan, John E

    2016-06-01

    Although the structure of lipoic acid and its role in bacterial metabolism were clear over 50 years ago, it is only in the past decade that the pathways of biosynthesis of this universally conserved cofactor have become understood. Unlike most cofactors, lipoic acid must be covalently bound to its cognate enzyme proteins (the 2-oxoacid dehydrogenases and the glycine cleavage system) in order to function in central metabolism. Indeed, the cofactor is assembled on its cognate proteins rather than being assembled and subsequently attached as in the typical pathway, like that of biotin attachment. The first lipoate biosynthetic pathway determined was that of Escherichia coli, which utilizes two enzymes to form the active lipoylated protein from a fatty acid biosynthetic intermediate. Recently, a more complex pathway requiring four proteins was discovered in Bacillus subtilis, which is probably an evolutionary relic. This pathway requires the H protein of the glycine cleavage system of single-carbon metabolism to form active (lipoyl) 2-oxoacid dehydrogenases. The bacterial pathways inform the lipoate pathways of eukaryotic organisms. Plants use the E. coli pathway, whereas mammals and fungi probably use the B. subtilis pathway. The lipoate metabolism enzymes (except those of sulfur insertion) are members of PFAM family PF03099 (the cofactor transferase family). Although these enzymes share some sequence similarity, they catalyze three markedly distinct enzyme reactions, making the usual assignment of function based on alignments prone to frequent mistaken annotations. This state of affairs has possibly clouded the interpretation of one of the disorders of human lipoate metabolism. PMID:27074917

  18. Role of a microcin-C-like biosynthetic gene cluster in allelopathic interactions in marine Synechococcus.

    PubMed

    Paz-Yepes, Javier; Brahamsha, Bianca; Palenik, Brian

    2013-07-16

    Competition between phytoplankton species for nutrients and light has been studied for many years, but allelopathic interactions between them have been more difficult to characterize. We used liquid and plate assays to determine whether these interactions occur between marine unicellular cyanobacteria of the genus Synechococcus. We have found a clear growth impairment of Synechococcus sp. CC9311 and Synechococcus sp. WH8102 when they are cultured in the presence of Synechococcus sp. CC9605. The genome of CC9605 contains a region showing homology to genes of the Escherichia coli Microcin C (McC) biosynthetic pathway. McC is a ribosome-synthesized peptide that inhibits translation in susceptible strains. We show that the CC9605 McC gene cluster is expressed and that three genes (mccD, mccA, and mccB) are further induced by coculture with CC9311. CC9605 was resistant to McC purified from E. coli, whereas strains CC9311 and WH8102 were sensitive. Cloning the CC9605 McC biosynthetic gene cluster into sensitive CC9311 led this strain to become resistant to both purified E. coli McC and Synechococcus sp. CC9605. A CC9605 mutant lacking mccA1, mccA2, and the N-terminal domain of mccB did not inhibit CC9311 growth, whereas the inhibition of WH8102 was reduced. Our results suggest that an McC-like molecule is involved in the allelopathic interactions with CC9605. PMID:23818639

  19. Exopolysaccharide biosynthetic glycoside hydrolases can be utilized to disrupt and prevent Pseudomonas aeruginosa biofilms.

    PubMed

    Baker, Perrin; Hill, Preston J; Snarr, Brendan D; Alnabelseya, Noor; Pestrak, Matthew J; Lee, Mark J; Jennings, Laura K; Tam, John; Melnyk, Roman A; Parsek, Matthew R; Sheppard, Donald C; Wozniak, Daniel J; Howell, P Lynne

    2016-05-01

    Bacterial biofilms present a significant medical challenge because they are recalcitrant to current therapeutic regimes. A key component of biofilm formation in the opportunistic human pathogen Pseudomonas aeruginosa is the biosynthesis of the exopolysaccharides Pel and Psl, which are involved in the formation and maintenance of the structural biofilm scaffold and protection against antimicrobials and host defenses. Given that the glycoside hydrolases PelAh and PslGh encoded in the pel and psl biosynthetic operons, respectively, are utilized for in vivo exopolysaccharide processing, we reasoned that these would provide specificity to target P. aeruginosa biofilms. Evaluating these enzymes as potential therapeutics, we demonstrate that these glycoside hydrolases selectively target and degrade the exopolysaccharide component of the biofilm matrix. PelAh and PslGh inhibit biofilm formation over a 24-hour period with a half maximal effective concentration (EC50) of 69.3 ± 1.2 and 4.1 ± 1.1 nM, respectively, and are capable of disrupting preexisting biofilms in 1 hour with EC50 of 35.7 ± 1.1 and 12.9 ± 1.1 nM, respectively. This treatment was effective against clinical and environmental P. aeruginosa isolates and reduced biofilm biomass by 58 to 94%. These noncytotoxic enzymes potentiated antibiotics because the addition of either enzyme to a sublethal concentration of colistin reduced viable bacterial counts by 2.5 orders of magnitude when used either prophylactically or on established 24-hour biofilms. In addition, PelAh was able to increase neutrophil killing by ~50%. This work illustrates the feasibility and benefits of using bacterial exopolysaccharide biosynthetic glycoside hydrolases to develop novel antibiofilm therapeutics. PMID:27386527

  20. Tracing the biosynthetic source of essential amino acids in marine turtles using delta13C fingerprints.

    PubMed

    Arthur, Karen E; Kelez, Shaleyla; Larsen, Thomas; Choy, C Anela; Popp, Brian N

    2014-05-01

    Plants, bacteria, and fungi produce essential amino acids (EAAs) with distinctive patterns of delta13C values that can be used as naturally occurring fingerprints of biosynthetic origin of EAAs in a food web. Because animals cannot synthesize EAAs and must obtain them from food, their tissues reflect delta13C(EAA) patterns found in diet, but it is not known how microbes responsible for hindgut fermentation in some herbivores influence the delta13C values of EAAs in their hosts' tissues. We examined whether distinctive delta13C fingerprints of hindgut flora are evident in the tissues of green turtles (Chelonia mydas), which are known to be facultative hindgut fermenters. We determined delta13C(EAA) values in tissues of green turtles foraging herbivorously in neritic habitats of Hawaii and compared them with those from green, olive ridley, and loggerhead turtles foraging carnivorously in oceanic environments of the central and southeast Pacific Ocean. Results of multivariate statistical analysis revealed two distinct groups that could be distinguished based on unique delta13C(EAA) patterns. A three-end-member predictive linear discriminant model indicated that delta13C(EAA) fingerprints existed in the tissues of carnivorous turtles that resembled patterns found in microalgae, which form the base of an oceanic food web, whereas herbivorous turtles derive EAAs from a bacterial or seagrass source. This study demonstrates the capacity for delta13C fingerprinting to establish the biosynthetic origin of EAAs in higher consumers, and that marine turtles foraging on macroalgal diets appear to receive nutritional supplementation from bacterial symbionts in their digestive system. PMID:25000760

  1. Exopolysaccharide biosynthetic glycoside hydrolases can be utilized to disrupt and prevent Pseudomonas aeruginosa biofilms

    PubMed Central

    Baker, Perrin; Hill, Preston J.; Snarr, Brendan D.; Alnabelseya, Noor; Pestrak, Matthew J.; Lee, Mark J.; Jennings, Laura K.; Tam, John; Melnyk, Roman A.; Parsek, Matthew R.; Sheppard, Donald C.; Wozniak, Daniel J.; Howell, P. Lynne

    2016-01-01

    Bacterial biofilms present a significant medical challenge because they are recalcitrant to current therapeutic regimes. A key component of biofilm formation in the opportunistic human pathogen Pseudomonas aeruginosa is the biosynthesis of the exopolysaccharides Pel and Psl, which are involved in the formation and maintenance of the structural biofilm scaffold and protection against antimicrobials and host defenses. Given that the glycoside hydrolases PelAh and PslGh encoded in the pel and psl biosynthetic operons, respectively, are utilized for in vivo exopolysaccharide processing, we reasoned that these would provide specificity to target P. aeruginosa biofilms. Evaluating these enzymes as potential therapeutics, we demonstrate that these glycoside hydrolases selectively target and degrade the exopolysaccharide component of the biofilm matrix. PelAh and PslGh inhibit biofilm formation over a 24-hour period with a half maximal effective concentration (EC50) of 69.3 ± 1.2 and 4.1 ± 1.1 nM, respectively, and are capable of disrupting preexisting biofilms in 1 hour with EC50 of 35.7 ± 1.1 and 12.9 ± 1.1 nM, respectively. This treatment was effective against clinical and environmental P. aeruginosa isolates and reduced biofilm biomass by 58 to 94%. These noncytotoxic enzymes potentiated antibiotics because the addition of either enzyme to a sublethal concentration of colistin reduced viable bacterial counts by 2.5 orders of magnitude when used either prophylactically or on established 24-hour biofilms. In addition, PelAh was able to increase neutrophil killing by ~50%. This work illustrates the feasibility and benefits of using bacterial exopolysaccharide biosynthetic glycoside hydrolases to develop novel antibiofilm therapeutics. PMID:27386527

  2. Recent advances in the transcriptional regulation of the flavonoid biosynthetic pathway.

    PubMed

    Hichri, Imène; Barrieu, François; Bogs, Jochen; Kappel, Christian; Delrot, Serge; Lauvergeat, Virginie

    2011-05-01

    Flavonoids are secondary metabolites involved in several aspects of plant development and defence. They colour fruits and flowers, favouring seed and pollen dispersal, and contribute to plant adaptation to environmental conditions such as cold or UV stresses, and pathogen attacks. Because they affect the quality of flowers (for horticulture), fruits and vegetables, and their derivatives (colour, aroma, stringency, etc.), flavonoids have a high economic value. Furthermore, these compounds possess pharmaceutical properties extremely attractive for human health. Thanks to easily detectable mutant phenotypes, such as modification of petal pigmentation and seeds exhibiting transparent testa, the enzymes involved in the flavonoid biosynthetic pathway have been characterized in several plant species. Conserved features as well as specific differences have been described. Regulation of structural gene expression appears tightly organized in a spatial and temporal way during plant development, and is orchestrated by a ternary complex involving transcription factors from the R2R3-MYB, basic helix-loop-helix (bHLH), and WD40 classes. This MYB-bHLH-WD40 (MBW) complex regulates the genes that encode enzymes specifically involved in the late steps of the pathway leading to the biosynthesis of anthocyanins and condensed tannins. Although several genes encoding transcription factors from these three families have been identified, many gaps remain in our understanding of the regulation of this biosynthetic pathway, especially about the respective roles of bHLH and WD40 proteins. A better knowledge of the regulatory mechanisms of the flavonoid pathway is likely to favour the development of new biotechnological tools for the generation of value-added plants with optimized flavonoid content.

  3. The biosynthetic pathway for myxol-2' fucoside (myxoxanthophyll) in the cyanobacterium Synechococcus sp. strain PCC 7002.

    PubMed

    Graham, Joel E; Bryant, Donald A

    2009-05-01

    Synechococcus sp. strain PCC 7002 produces a variety of carotenoids, which comprise predominantly dicylic beta-carotene and two dicyclic xanthophylls, zeaxanthin and synechoxanthin. However, this cyanobacterium also produces a monocyclic myxoxanthophyll, which was identified as myxol-2' fucoside. Compared to the carotenoid glycosides produced by diverse microorganisms, cyanobacterial myxoxanthophyll and closely related compounds are unusual because they are glycosylated on the 2'-OH rather than on the 1'-OH position of the psi end of the molecule. In this study, the genes encoding two enzymes that modify the psi end of myxoxanthophyll in Synechococcus sp. strain PCC 7002 were identified. Mutational and biochemical studies showed that open reading frame SynPCC7002_A2032, renamed cruF, encodes a 1',2'-hydroxylase [corrected] and that open reading frame SynPCC7002_A2031, renamed cruG, encodes a 2'-O-glycosyltransferase. The enzymatic activity of CruF was verified by chemical characterization of the carotenoid products synthesized when cruF was expressed in a lycopene-producing strain of Escherichia coli. Database searches showed that homologs of cruF and cruG occur in the genomes of all sequenced cyanobacterial strains that are known to produce myxol or the acylic xanthophyll oscillaxanthin. The genomes of many other bacteria that produce hydroxylated carotenoids but do not contain crtC homologs also contain cruF orthologs. Based upon observable intermediates, a complete biosynthetic pathway for myxoxanthophyll is proposed. This study expands the suite of enzymes available for metabolic engineering of carotenoid biosynthetic pathways for biotechnological applications.

  4. Metabolic engineering of the omega-3 long chain polyunsaturated fatty acid biosynthetic pathway into transgenic plants.

    PubMed

    Ruiz-López, Noemi; Sayanova, Olga; Napier, Johnathan A; Haslam, Richard P

    2012-04-01

    Omega-3 (ω-3) very long chain polyunsaturated fatty acids (VLC-PUFAs) such as eicosapentaenoic acid (EPA; 20:5 Δ5,8,11,14,17) and docosahexaenoic acid (DHA; 22:6 Δ4,7,10,13,16,19) have been shown to have significant roles in human health. Currently the primary dietary source of these fatty acids are marine fish; however, the increasing demand for fish and fish oil (in particular the expansion of the aquaculture industry) is placing enormous pressure on diminishing marine stocks. Such overfishing and concerns related to pollution in the marine environment have directed research towards the development of a viable alternative sustainable source of VLC-PUFAs. As a result, the last decade has seen many genes encoding the primary VLC-PUFA biosynthetic activities identified and characterized. This has allowed the reconstitution of the VLC-PUFA biosynthetic pathway in oilseed crops, producing transgenic plants engineered to accumulate ω-3 VLC-PUFAs at levels approaching those found in native marine organisms. Moreover, as a result of these engineering activities, knowledge of the fundamental processes surrounding acyl exchange and lipid remodelling has progressed. The application of new technologies, for example lipidomics and next-generation sequencing, is providing a better understanding of seed oil biosynthesis and opportunities for increasing the production of unusual fatty acids. Certainly, it is now possible to modify the composition of plant oils successfully, and, in this review, the most recent developments in this field and the challenges of producing VLC-PUFAs in the seed oil of higher plants will be described.

  5. Betacyanin Biosynthetic Genes and Enzymes Are Differentially Induced by (a)biotic Stress in Amaranthus hypochondriacus

    PubMed Central

    Casique-Arroyo, Gabriela; Martínez-Gallardo, Norma; González de la Vara, Luis; Délano-Frier, John P.

    2014-01-01

    An analysis of key genes and enzymes of the betacyanin biosynthetic pathway in Amaranthus hypochondriacus (Ah) was performed. Complete cDNA sequence of Ah genes coding for cyclo-DOPA 5-O glucosyltransferase (AhcDOPA5-GT), two 4, 5-DOPA-extradiol-dioxygenase isoforms (AhDODA-1 and AhDODA-2, respectively), and a betanidin 5-O-glucosyltransferase (AhB5-GT), plus the partial sequence of an orthologue of the cytochrome P-450 R gene (CYP76AD1) were obtained. With the exception AhDODA-2, which had a closer phylogenetic relationship to DODA-like genes in anthocyanin-synthesizing plants, all genes analyzed closely resembled those reported in related Caryophyllales species. The measurement of basal gene expression levels, in addition to the DOPA oxidase tyrosinase (DOT) activity, in different tissues of three Ah genotypes having contrasting pigmentation levels (green to red-purple) was determined. Additional analyses were performed in Ah plants subjected to salt and drought stress and to two different insect herbivory regimes. Basal pigmentation accumulation in leaves, stems and roots of betacyanic plants correlated with higher expression levels of AhDODA-1 and AhB5-GT, whereas DOT activity levels coincided with pigment accumulation in stems and roots and with the acyanic nature of green plants, respectively, but not with pigmentation in leaves. Although the abiotic stress treatments tested produced changes in pigment levels in different tissues, pigment accumulation was the highest in leaves and stems of drought stressed betacyanic plants, respectively. However, tissue pigment accumulation in stressed Ah plants did not always correlate with betacyanin biosynthetic gene expression levels and/or DOT activity. This effect was tissue- and genotype-dependent, and further suggested that other unexamined factors were influencing pigment content in stressed Ah. The results obtained from the insect herbivory assays, particularly in acyanic plants, also support the proposal that

  6. Betacyanin biosynthetic genes and enzymes are differentially induced by (a)biotic stress in Amaranthus hypochondriacus.

    PubMed

    Casique-Arroyo, Gabriela; Martínez-Gallardo, Norma; González de la Vara, Luis; Délano-Frier, John P

    2014-01-01

    An analysis of key genes and enzymes of the betacyanin biosynthetic pathway in Amaranthus hypochondriacus (Ah) was performed. Complete cDNA sequence of Ah genes coding for cyclo-DOPA 5-O glucosyltransferase (AhcDOPA5-GT), two 4, 5-DOPA-extradiol-dioxygenase isoforms (AhDODA-1 and AhDODA-2, respectively), and a betanidin 5-O-glucosyltransferase (AhB5-GT), plus the partial sequence of an orthologue of the cytochrome P-450 R gene (CYP76AD1) were obtained. With the exception AhDODA-2, which had a closer phylogenetic relationship to DODA-like genes in anthocyanin-synthesizing plants, all genes analyzed closely resembled those reported in related Caryophyllales species. The measurement of basal gene expression levels, in addition to the DOPA oxidase tyrosinase (DOT) activity, in different tissues of three Ah genotypes having contrasting pigmentation levels (green to red-purple) was determined. Additional analyses were performed in Ah plants subjected to salt and drought stress and to two different insect herbivory regimes. Basal pigmentation accumulation in leaves, stems and roots of betacyanic plants correlated with higher expression levels of AhDODA-1 and AhB5-GT, whereas DOT activity levels coincided with pigment accumulation in stems and roots and with the acyanic nature of green plants, respectively, but not with pigmentation in leaves. Although the abiotic stress treatments tested produced changes in pigment levels in different tissues, pigment accumulation was the highest in leaves and stems of drought stressed betacyanic plants, respectively. However, tissue pigment accumulation in stressed Ah plants did not always correlate with betacyanin biosynthetic gene expression levels and/or DOT activity. This effect was tissue- and genotype-dependent, and further suggested that other unexamined factors were influencing pigment content in stressed Ah. The results obtained from the insect herbivory assays, particularly in acyanic plants, also support the proposal that

  7. Analysis of Occludin Trafficking, Demonstrating Continuous Endocytosis, Degradation, Recycling and Biosynthetic Secretory Trafficking

    PubMed Central

    Fletcher, Sarah J.; Iqbal, Mudassar; Jabbari, Sara; Stekel, Dov; Rappoport, Joshua Z.

    2014-01-01

    Tight junctions (TJs) link adjacent cells and are critical for maintenance of apical-basolateral polarity in epithelial monolayers. The TJ protein occludin functions in disparate processes, including wound healing and Hepatitis C Virus infection. Little is known about steady-state occludin trafficking into and out of the plasma membrane. Therefore, we determined the mechanisms responsible for occludin turnover in confluent Madin-Darby canine kidney (MDCK) epithelial monolayers. Using various biotin-based trafficking assays we observed continuous and rapid endocytosis of plasma membrane localised occludin (the majority internalised within 30 minutes). By 120 minutes a significant reduction in internalised occludin was observed. Inhibition of lysosomal function attenuated the reduction in occludin signal post-endocytosis and promoted co-localisation with the late endocytic system. Using a similar method we demonstrated that ∼20% of internalised occludin was transported back to the cell surface. Consistent with these findings, significant co-localisation between internalised occludin and recycling endosomal compartments was observed. We then quantified the extent to which occludin synthesis and transport to the plasma membrane contributes to plasma membrane occludin homeostasis, identifying inhibition of protein synthesis led to decreased plasma membrane localised occludin. Significant co-localisation between occludin and the biosynthetic secretory pathway was demonstrated. Thus, under steady-state conditions occludin undergoes turnover via a continuous cycle of endocytosis, recycling and degradation, with degradation compensated for by biosynthetic exocytic trafficking. We developed a mathematical model to describe the endocytosis, recycling and degradation of occludin, utilising experimental data to provide quantitative estimates for the rates of these processes. PMID:25422932

  8. A novel interaction linking the FAS-II and phthiocerol dimycocerosate (PDIM) biosynthetic pathways.

    PubMed

    Kruh, Nicole A; Borgaro, Janine G; Ruzsicska, Béla P; Xu, Hua; Tonge, Peter J

    2008-11-14

    The fatty acid biosynthesis (FAS-II) pathway in Mycobacterium tuberculosis generates long chain fatty acids that serve as the precursors to mycolic acids, essential components of the mycobacterial cell wall. Enzymes in the FAS-II pathway are thought to form one or more noncovalent multi-enzyme complexes within the cell, and a bacterial two-hybrid screen was used to search for missing components of the pathway and to furnish additional data on interactions involving these enzymes in vivo. Using the FAS-II beta-ketoacyl synthase, KasA, as bait, an extensive bacterial two-hybrid screen of a M. tuberculosis genome fragment library unexpectedly revealed a novel interaction between KasA and PpsB as well as PpsD, two polyketide modules involved in the biosynthesis of the virulence lipid phthiocerol dimycocerosate (PDIM). Sequence analysis revealed that KasA interacts with PpsB and PpsD in the region of the acyl carrier domain of each protein, raising the possibility that lipids could be transferred between the FAS-II and PDIM biosynthetic pathways. Subsequent studies utilizing purified proteins and radiolabeled lipids revealed that fatty acids loaded onto PpsB were transferred to KasA and also incorporated into long chain fatty acids synthesized using a Mycobacterium smegmatis lysate. These data suggest that in addition to producing PDIMs, the growing phthiocerol product can also be shuttled into the FAS-II pathway via KasA as an entry point for further elongation. Interactions between these biosynthetic pathways may exist as a simple means to increase mycobacterial lipid diversity, enhancing functionality and the overall complexity of the cell wall. PMID:18703500

  9. Tracing the biosynthetic source of essential amino acids in marine turtles using delta13C fingerprints.

    PubMed

    Arthur, Karen E; Kelez, Shaleyla; Larsen, Thomas; Choy, C Anela; Popp, Brian N

    2014-05-01

    Plants, bacteria, and fungi produce essential amino acids (EAAs) with distinctive patterns of delta13C values that can be used as naturally occurring fingerprints of biosynthetic origin of EAAs in a food web. Because animals cannot synthesize EAAs and must obtain them from food, their tissues reflect delta13C(EAA) patterns found in diet, but it is not known how microbes responsible for hindgut fermentation in some herbivores influence the delta13C values of EAAs in their hosts' tissues. We examined whether distinctive delta13C fingerprints of hindgut flora are evident in the tissues of green turtles (Chelonia mydas), which are known to be facultative hindgut fermenters. We determined delta13C(EAA) values in tissues of green turtles foraging herbivorously in neritic habitats of Hawaii and compared them with those from green, olive ridley, and loggerhead turtles foraging carnivorously in oceanic environments of the central and southeast Pacific Ocean. Results of multivariate statistical analysis revealed two distinct groups that could be distinguished based on unique delta13C(EAA) patterns. A three-end-member predictive linear discriminant model indicated that delta13C(EAA) fingerprints existed in the tissues of carnivorous turtles that resembled patterns found in microalgae, which form the base of an oceanic food web, whereas herbivorous turtles derive EAAs from a bacterial or seagrass source. This study demonstrates the capacity for delta13C fingerprinting to establish the biosynthetic origin of EAAs in higher consumers, and that marine turtles foraging on macroalgal diets appear to receive nutritional supplementation from bacterial symbionts in their digestive system.

  10. Cloning, mutagenesis, and nucleotide sequence of a siderophore biosynthetic gene (amoA) from Aeromonas hydrophila.

    PubMed Central

    Barghouthi, S; Payne, S M; Arceneaux, J E; Byers, B R

    1991-01-01

    Many isolates of the Aeromonas species produce amonabactin, a phenolate siderophore containing 2,3-dihydroxybenzoic acid (2,3-DHB). An amonabactin biosynthetic gene (amoA) was identified (in a Sau3A1 gene library of Aeromonas hydrophila 495A2 chromosomal DNA) by its complementation of the requirement of Escherichia coli SAB11 for exogenous 2,3-DHB to support siderophore (enterobactin) synthesis. The gene amoA was subcloned as a SalI-HindIII 3.4-kb DNA fragment into pSUP202, and the complete nucleotide sequence of amoA was determined. A putative iron-regulatory sequence resembling the Fur repressor protein-binding site overlapped a possible promoter region. A translational reading frame, beginning with valine and encoding 396 amino acids, was open for 1,188 bp. The C-terminal portion of the deduced amino acid sequence showed 58% identity and 79% similarity with the E. coli EntC protein (isochorismate synthetase), the first enzyme in the E. coli 2,3-DHB biosynthetic pathway, suggesting that amoA probably encodes a step in 2,3-DHB biosynthesis and is the A. hydrophila equivalent of the E. coli entC gene. An isogenic amonabactin-negative mutant, A. hydrophila SB22, was isolated after marker exchange mutagenesis with Tn5-inactivated amoA (amoA::Tn5). The mutant excreted neither 2,3-DHB nor amonabactin, was more sensitive than the wild-type to growth inhibition by iron restriction, and used amonabactin to overcome iron starvation. Images PMID:1830579

  11. Narrow-spectrum inhibitors targeting an alternative menaquinone biosynthetic pathway of Helicobacter pylori.

    PubMed

    Yamamoto, Tsuyoshi; Matsui, Hidenori; Yamaji, Kenzaburo; Takahashi, Tetsufumi; Øverby, Anders; Nakamura, Masahiko; Matsumoto, Atsuko; Nonaka, Kenichi; Sunazuka, Toshiaki; Ōmura, Satoshi; Nakano, Hirofumi

    2016-09-01

    We aimed to identify narrow-spectrum natural compounds that specifically inhibit an alternative menaquinone (MK; vitamin K2) biosynthetic pathway (the futalosine pathway) of Helicobacter pylori. Culture broth samples of 6183 microbes were examined using the paper disc method with different combinations of 2 of the following 3 indicator microorganisms: Bacillus halodurans C-125 and Kitasatospora setae KM-6054(T), which have only the futalosine pathway of MK biosynthesis, and Bacillus subtilis H17, which has only the canonical MK biosynthetic pathway. Most of the active compounds isolated from culture broth samples were from the families of polyunsaturated fatty acids (PUFAs). Only one compound isolated from the culture broth of Streptomyces sp. K12-1112, siamycin I (a 21-residue lasso peptide antibiotic), targeted the futalosine pathway. The inhibitory activities of representative PUFAs and siamycin I against the growth of B. halodurans or K. setae were abrogated by supplementation with MK. Thereafter, the growth of H. pylori strains SS1 and TN2GF4 in broth cultures was dose-dependently suppressed by eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), or siamycin I, and these inhibitory effects were reduced by supplementation with MK. Daily administration of EPA (100 μM), DHA (100 μM), or siamycin I (2.5 μM) in drinking water reduced the H. pylori SS1 colonization in the gastric mucosa of C57BL/6 mice by 96%, 78%, and 68%, respectively. These data suggest that EPA, DHA, and siamycin I prevented H. pylori infection by inhibiting the futalosine pathway of MK biosynthesis. PMID:27346378

  12. Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection

    PubMed Central

    2011-01-01

    Background The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. Results The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. Conclusions These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection. PMID:22004418

  13. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed Central

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-01-01

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  14. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-06-25

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period.

  15. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-06-25

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  16. Chromosomal location of 18S and 5S rDNA sites in Triportheus fish species (Characiformes, Characidae)

    PubMed Central

    2009-01-01

    The location of 18S and 5S rDNA sites was determined in eight species and populations of the fish genus Triportheus by using fluorescent in situ hybridization (FISH). The males and females of all species had 2n = 52 chromosomes and a ZZ/ZW sex chromosome system. A single 18S rDNA site that was roughly equivalent to an Ag-NOR was detected on the short arms of a submetacentric pair in nearly all species, and up to two additional sites were also observed in some species. In addition, another 18S rDNA cluster was identified in a distal region on the long arms of the W chromosome; this finding corroborated previous evidence that this cluster would be a shared feature amongst Triportheus species. In T. angulatus, a heterozygotic paracentric inversion involving the short arms of one homolog of a metacentric pair was associated with NORs. The 5S rDNA sites were located on the short arms of a single submetacentric chromosomal pair, close to the centromeres, except in T. auritus, which had up to ten 5S rDNA sites. The 18S and 5S rDNA sites were co-localized and adjacent on the short arms of a chromosomal pair in two populations of T. nematurus. Although all Triportheus species have a similar karyotypic macrostructure, the results of this work show that in some species ribosomal genes may serve as species-specific markers when used in conjunction with other putatively synapomorphic features. PMID:21637644

  17. Theoretical study on the adsorption of carbon dioxide on individual and alkali-metal doped MOF-5s

    NASA Astrophysics Data System (ADS)

    Ha, Nguyen Thi Thu; Lefedova, O. V.; Ha, Nguyen Ngoc

    2016-01-01

    Density functional theory (DFT) calculations were performed to investigate the adsorption of carbon dioxide (CO2) on metal-organic framework (MOF-5) and alkali-metal (Li, K, Na) doped MOF-5s. The adsorption energy calculation showed that metal atom adsorption is exothermic in MOF-5 system. Moreover, alkali-metal doping can significantly improve the adsorption ability of carbon dioxide on MOF-5. The best influence is observed for Li-doping.

  18. A Tale of Two Lines: Searching for the 5s - 5p Resonance Lines in Pm-like Ion Spectra

    SciTech Connect

    Trabert, E; Vilkas, M J; Ishikawa, Y

    2008-10-24

    Highly charged ions in the promethium sequence have been suggested to show spectral features resembling the alkali sequence ions. Guided by calculations, the 5s-5p resonance lines have been sought in a variety of experiments. In the light of the most extensive calculations of Pm-like ions yet, applying relativistic multi-reference Moeller-Plesset second-order perturbation theory, the experimental evidence is reviewed and the line identification problem assessed.

  19. Foraminoplastic transfacet epidural endoscopic approach for removal of intraforaminal disc herniation at the L5-S1 level

    PubMed Central

    Kaczmarczyk, Jacek; Nowakowski, Andrzej; Sulewski, Adam

    2014-01-01

    Transforaminal endoscopic disc removal in the L5-S1 motion segment of the lumbar spine creates a technical challenge due to anatomical reasons and individual variability. The majority of surgeons prefer a posterior classical or minimally invasive approach. There is only one foraminoplastic modification of the technique in the literature so far. In this paper we present a new technique with a foraminoplastic transfacet approach that may be suitable in older patients with advanced degenerative disease of the spine. PMID:24729817

  20. The nuclear 5S RNAs from chicken, rat and man. U5 RNAs are encoded by multiple genes.

    PubMed

    Krol, A; Gallinaro, H; Lazar, E; Jacob, M; Branlant, C

    1981-02-25

    Preparations of chicken, rat and human nuclear 5S RNA contain two sets of molecules. The set with the lowest electrophoretic mobility (5Sa) contains RNAs identical or closely related to ribosomal 5S RNA from the corresponding animal species. In HeLa cells and rat brain, we only detected an RNA identical to the ribosomal 5S RNA. In hen brain and liver, we found other species differing by a limited number of substitutions. The results suggest that mutated 5S genes may be expressed differently according to the cell type. The set with the highest mobility corresponds to U5 RNA. In both rat brain and HeLa cells, U5 RNA was found to be composed of 4 and 5 different molecules respectively (U5A, U5B1-4) differing by a small number of substitutions or insertions. In hen brain, no U5B was detected but U5A' differing from U5A by the absence of the 3'-terminal adenosine. All the U5 RNAs contain the same set of modified nucleotides. They also have the same secondary structure which consists of two hairpins joined together by a 17 nucleotide long single-stranded region. The 3' half of the molecule has a compact conformation. Together, the results suggest that U5 RNAs are transcribed from a multigene family and that mutated genes may be expressed as far as secondary structure is conserved. The conformation of U5 RNA is likely to be related to its function and it is of interest to mention that several similarities of structure are found between U5 and U1A RNA.

  1. Describing a new syndrome in L5-S1 disc herniation: Sexual and sphincter dysfunction without pain and muscle weakness

    PubMed Central

    Akca, Nezih; Ozdemir, Bulent; Kanat, Ayhan; Batcik, Osman Ersagun; Yazar, Ugur; Zorba, Orhan Unal

    2014-01-01

    Context: Little seems to be known about the sexual dysfunction (SD) in lumbar intervertebral disc herniation. Aims: Investigation of sexual and sphincter dysfunction in patient with lumbar disc hernitions. Settings and Design: A retrospective analysis. Materials and Methods: Sexual and sphincter dysfunction in patients admitted with lumbar disc herniations between September 2012-March 2014. Statistical Analysis Used: Statistical analysis was performed using the Predictive Analytics SoftWare (PASW) Statistics 18.0 for Windows (Statistical Package for the Social Sciences, SPSS Inc., Chicago, Illinois). The statistical significance was set at P < 0.05. The Wilcoxon signed ranks test was used to evaluate the difference between patients. Results: Four patients with sexual and sphincter dysfunction were found, including two women and two men, aged between 20 and 52 years. All of them admitted without low back pain. In addition, on neurological examination, reflex and motor deficit were not found. However, almost all patients had perianal sensory deficit and sexual and sphincter dysfunction. Magnetic resonance imaging (MRI) of three patients displayed a large extruded disc fragment at L5-S1 level on the left side. In fourth patient, there were not prominent disc herniations. There was not statistically significant difference between pre-operative and post-operative sexual function, anal-urethral sphincter function, and perianal sensation score. A syndrome in L5-S1 disc herniation with sexual and sphincter dysfunction without pain and muscle weakness was noted. We think that it is crucial for neurosurgeons to early realise that paralysis of the sphincter and sexual dysfunction are possible in patients with lumbar L5-S1 disc disease. Conclusion: A syndrome with perianal sensory deficit, paralysis of the sphincter, and sexual dysfunction may occur in patients with lumbar L5-S1 disc disease. The improvement of perianal sensory deficit after surgery was counteracted by a trend

  2. Minimally Invasive Transforaminal Lumbar Interbody Fusion at L5-S1 through a Unilateral Approach: Technical Feasibility and Outcomes.

    PubMed

    Choi, Won-Suh; Kim, Jin-Sung; Ryu, Kyeong-Sik; Hur, Jung-Woo; Seong, Ji-Hoon

    2016-01-01

    Background. Minimally invasive spinal transforaminal lumbar interbody fusion (MIS-TLIF) at L5-S1 is technically more demanding than it is at other levels because of the anatomical and biomechanical traits. Objective. To determine the clinical and radiological outcomes of MIS-TLIF for treatment of single-level spinal stenosis low-grade isthmic or degenerative spondylolisthesis at L5-S1. Methods. Radiological data and electronic medical records of patients who underwent MIS-TLIF between May 2012 and December 2014 were reviewed. Fusion rate, cage position, disc height (DH), disc angle (DA), disc slope angle, segmental lordotic angle (SLA), lumbar lordotic angle (LLA), and pelvic parameters were assessed. For functional assessment, the visual analogue scale (VAS), Oswestry disability index (ODI), and patient satisfaction rate (PSR) were utilized. Results. A total of 21 levels in 21 patients were studied. DH, DA, SLA, and LLA had increased from their preoperative measures at the final follow-up. Fusion rate was 86.7% (18/21) at 12 months' follow-up. The most common cage position was anteromedial (15/21). The mean VAS scores for back and leg pain mean ODI scores improved significantly at the final follow-up. PSR was 88%. Cage subsidence was observed in 33.3% (7/21). Conclusions. The clinical and radiologic outcomes after MIS-TLIF at L5-S1 in patients with spinal stenosis or spondylolisthesis are generally favorable. PMID:27433472

  3. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    PubMed

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  4. Erythromycin and 5S rRNA binding properties of the spinach chloroplast ribosomal protein CL22.

    PubMed Central

    Carol, P; Rozier, C; Lazaro, E; Ballesta, J P; Mache, R

    1993-01-01

    The spinach chloroplast ribosomal protein (r-protein) CL22 contains a central region homologous to the Escherichia coli r-protein L22 plus long N- and C-terminal extensions. We show in this study that the CL22 combines two properties which in E. coli ribosome are split between two separate proteins. The CL22 which binds to the 5S rRNA can also be linked to an erythromycin derivative added to the 50S ribosomal subunit. This latter property is similar to that of the E. coli L22 and suggests a similar localization in the 50S subunit. We have overproduced the r-protein CL22 and deleted forms of this protein in E. coli. We show that the overproduced CL22 binds to the chloroplast 5S rRNA and that the deleted protein containing the N- and C-terminal extensions only has lost the 5S rRNA binding property. We suggest that the central homologous regions of the CL22 contains the RNA binding domain. Images PMID:8441674

  5. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    PubMed

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease.

  6. Minimally Invasive Transforaminal Lumbar Interbody Fusion at L5-S1 through a Unilateral Approach: Technical Feasibility and Outcomes

    PubMed Central

    Choi, Won-Suh; Kim, Jin-Sung; Ryu, Kyeong-Sik; Hur, Jung-Woo; Seong, Ji-Hoon

    2016-01-01

    Background. Minimally invasive spinal transforaminal lumbar interbody fusion (MIS-TLIF) at L5-S1 is technically more demanding than it is at other levels because of the anatomical and biomechanical traits. Objective. To determine the clinical and radiological outcomes of MIS-TLIF for treatment of single-level spinal stenosis low-grade isthmic or degenerative spondylolisthesis at L5-S1. Methods. Radiological data and electronic medical records of patients who underwent MIS-TLIF between May 2012 and December 2014 were reviewed. Fusion rate, cage position, disc height (DH), disc angle (DA), disc slope angle, segmental lordotic angle (SLA), lumbar lordotic angle (LLA), and pelvic parameters were assessed. For functional assessment, the visual analogue scale (VAS), Oswestry disability index (ODI), and patient satisfaction rate (PSR) were utilized. Results. A total of 21 levels in 21 patients were studied. DH, DA, SLA, and LLA had increased from their preoperative measures at the final follow-up. Fusion rate was 86.7% (18/21) at 12 months' follow-up. The most common cage position was anteromedial (15/21). The mean VAS scores for back and leg pain mean ODI scores improved significantly at the final follow-up. PSR was 88%. Cage subsidence was observed in 33.3% (7/21). Conclusions. The clinical and radiologic outcomes after MIS-TLIF at L5-S1 in patients with spinal stenosis or spondylolisthesis are generally favorable. PMID:27433472

  7. Characterization and physical mapping of 18S and 5S ribosomal genes in Indian major carps (Pisces, Cyprinidae).

    PubMed

    Ravindra Kumar; Kushwaha, Basdeo; Nagpure, Naresh S

    2013-06-01

    Characterization of the major (18S) and minor (5S) ribosomal RNA genes were carried out in three commercially important Indian major carp (IMC) species, viz. Catla catla, Labeo rohita and Cirrhinus mrigala along with their physical localizations using dual colour fluorescence in situ hybridization. The diploid chromosome number in the above carps was confirmed to be 50 with inter-species karyo-morphological variations. The 18S rDNA signals were observed on 3 pair of chromosomes in C. catla and L. rohita, and two pairs in C. mrigala. The 5S rDNA signal was found on single pair of chromosome in all the species with variation in their position on chromosomes. The sequencing of 18S rDNA generated 1804, 1805 and 1805 bp long fragments, respectively, in C. catla, L. rohita and C. mrigala with more than 98% sequence identity among them. Similarly, sequencing of 5S rDNA generated 191 bp long fragments in the three species with 100% identity in coding region and 23.2% overall variability in non-transcribed spacer region. Thus, these molecular markers could be used as species-specific markers for taxonomic identification and might help in understanding the genetic diversity, genome organization and karyotype evolution of these species.

  8. The importance of ribosome production, and the 5S RNP–MDM2 pathway, in health and disease

    PubMed Central

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J.

    2016-01-01

    Ribosomes are abundant, large RNA–protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  9. Diversity of Culturable Thermophilic Actinobacteria in Hot Springs in Tengchong, China and Studies of their Biosynthetic Gene Profiles.

    PubMed

    Liu, Lan; Salam, Nimaichand; Jiao, Jian-Yu; Jiang, Hong-Chen; Zhou, En-Min; Yin, Yi-Rui; Ming, Hong; Li, Wen-Jun

    2016-07-01

    The class Actinobacteria has been a goldmine for the discovery of antibiotics and has attracted interest from both academics and industries. However, an absence of novel approaches during the last few decades has limited the discovery of new microbial natural products useful for industries. Scientists are now focusing on the ecological aspects of diverse environments including unexplored or underexplored habitats and extreme environments in the search for new metabolites. This paper reports on the diversity of culturable actinobacteria associated with hot springs located in Tengchong County, Yunnan Province, southwestern China. A total of 58 thermophilic actinobacterial strains were isolated from the samples collected from ten hot springs distributed over three geothermal fields (e.g., Hehua, Rehai, and Ruidian). Phylogenetic positions and their biosynthetic profiles were analyzed by sequencing 16S rRNA gene and three biosynthetic gene clusters (KS domain of PKS-I, KSα domain of PKS-II and A domain of NRPS). On the basis of 16S rRNA gene phylogenetic analysis, the 58 strains were affiliated with 12 actinobacterial genera: Actinomadura Micromonospora, Microbispora, Micrococcus, Nocardiopsis, Nonomuraea, Promicromonospora, Pseudonocardia, Streptomyces, Thermoactinospora, Thermocatellispora, and Verrucosispora, of which the two novel genera Thermoactinospora and Thermocatellisopora were recently described from among these strains. Considering the biosynthetic potential of these actinobacterial strains, 22 were positive for PCR amplification of at least one of the three biosynthetic gene clusters (PKS-I, PKS-II, and NRPS). These actinobacteria were further subjected to antimicrobial assay against five opportunistic human pathogens (Acinetobacter baumannii, Escherichia coli, Micrococcus luteus, Staphylococcus aureus and Streptococcus faecalis). All of the 22 strains that were positive for PCR amplification of at least one of the biosynthetic gene domains exhibited

  10. Diversity of Culturable Thermophilic Actinobacteria in Hot Springs in Tengchong, China and Studies of their Biosynthetic Gene Profiles.

    PubMed

    Liu, Lan; Salam, Nimaichand; Jiao, Jian-Yu; Jiang, Hong-Chen; Zhou, En-Min; Yin, Yi-Rui; Ming, Hong; Li, Wen-Jun

    2016-07-01

    The class Actinobacteria has been a goldmine for the discovery of antibiotics and has attracted interest from both academics and industries. However, an absence of novel approaches during the last few decades has limited the discovery of new microbial natural products useful for industries. Scientists are now focusing on the ecological aspects of diverse environments including unexplored or underexplored habitats and extreme environments in the search for new metabolites. This paper reports on the diversity of culturable actinobacteria associated with hot springs located in Tengchong County, Yunnan Province, southwestern China. A total of 58 thermophilic actinobacterial strains were isolated from the samples collected from ten hot springs distributed over three geothermal fields (e.g., Hehua, Rehai, and Ruidian). Phylogenetic positions and their biosynthetic profiles were analyzed by sequencing 16S rRNA gene and three biosynthetic gene clusters (KS domain of PKS-I, KSα domain of PKS-II and A domain of NRPS). On the basis of 16S rRNA gene phylogenetic analysis, the 58 strains were affiliated with 12 actinobacterial genera: Actinomadura Micromonospora, Microbispora, Micrococcus, Nocardiopsis, Nonomuraea, Promicromonospora, Pseudonocardia, Streptomyces, Thermoactinospora, Thermocatellispora, and Verrucosispora, of which the two novel genera Thermoactinospora and Thermocatellisopora were recently described from among these strains. Considering the biosynthetic potential of these actinobacterial strains, 22 were positive for PCR amplification of at least one of the three biosynthetic gene clusters (PKS-I, PKS-II, and NRPS). These actinobacteria were further subjected to antimicrobial assay against five opportunistic human pathogens (Acinetobacter baumannii, Escherichia coli, Micrococcus luteus, Staphylococcus aureus and Streptococcus faecalis). All of the 22 strains that were positive for PCR amplification of at least one of the biosynthetic gene domains exhibited

  11. Identification of flavonoids and expression of flavonoid biosynthetic genes in two coloured tree peony flowers.

    PubMed

    Zhao, Daqiu; Tang, Wenhui; Hao, Zhaojun; Tao, Jun

    2015-04-10

    Tree peony (Paeonia suffruticosa Andr.) has been named the "king of flowers" because of its elegant and gorgeous flower colour. Among these colours, the molecular mechanisms of white formation and how white turned to red in P. suffruticosa is little known. In this study, flower colour variables, flavonoid accumulation and expression of flavonoid biosynthetic genes of white ('Xueta') and red ('Caihui') P. suffruticosa were investigated. The results showed that the flower colours of both cultivars were gradually deepened with the development of flowers. Moreover, two anthoxanthin compositions apigenin 7-O-glucoside together with apigenin deoxyheso-hexoside were identified in 'Xueta' and 'Caihui', but one main anthocyanin composition peonidin 3,5-di-O-glucoside (Pn3G5G) was only found in 'Caihui'. Total contents of anthocyanins in 'Caihui' was increased during flower development, and the same trend was presented in anthoxanthins and flavonoids of these two cultivars, but the contents of these two category flavonoid in 'Caihui' were always higher than those in 'Xueta'. Furthermore, nine structural genes in flavonoid biosynthetic pathway were isolated including the full-length cDNAs of phenylalanine ammonialyase gene (PAL), chalcone synthase gene (CHS) and chalcone isomerase gene (CHI), together with the partial-length cDNAs of flavanone 3-hydroxylase gene (F3H), flavonoid 3'-hydroxylase gene (F3'H), dihydroflavonol 4-reductase gene (DFR), anthocyanidin synthase gene (ANS), UDP-glucose: flavonoid 3-O-glucosyltransferase gene (UF3GT) and UDP-glucose: flavonoid 5-O-glucosyltransferase gene (UF5GT), and PAL, UF3GT and UF5GT were reported in P. suffruticosa for the first time. Their expression patterns showed that transcription levels of downstream genes in 'Caihui' were basically higher than those in 'Xueta', especially PsDFR and PsANS, suggesting that these two genes may play a key role in the anthocyanin biosynthesis which resulted in the shift from white to red in

  12. Identification of flavonoids and expression of flavonoid biosynthetic genes in two coloured tree peony flowers.

    PubMed

    Zhao, Daqiu; Tang, Wenhui; Hao, Zhaojun; Tao, Jun

    2015-04-10

    Tree peony (Paeonia suffruticosa Andr.) has been named the "king of flowers" because of its elegant and gorgeous flower colour. Among these colours, the molecular mechanisms of white formation and how white turned to red in P. suffruticosa is little known. In this study, flower colour variables, flavonoid accumulation and expression of flavonoid biosynthetic genes of white ('Xueta') and red ('Caihui') P. suffruticosa were investigated. The results showed that the flower colours of both cultivars were gradually deepened with the development of flowers. Moreover, two anthoxanthin compositions apigenin 7-O-glucoside together with apigenin deoxyheso-hexoside were identified in 'Xueta' and 'Caihui', but one main anthocyanin composition peonidin 3,5-di-O-glucoside (Pn3G5G) was only found in 'Caihui'. Total contents of anthocyanins in 'Caihui' was increased during flower development, and the same trend was presented in anthoxanthins and flavonoids of these two cultivars, but the contents of these two category flavonoid in 'Caihui' were always higher than those in 'Xueta'. Furthermore, nine structural genes in flavonoid biosynthetic pathway were isolated including the full-length cDNAs of phenylalanine ammonialyase gene (PAL), chalcone synthase gene (CHS) and chalcone isomerase gene (CHI), together with the partial-length cDNAs of flavanone 3-hydroxylase gene (F3H), flavonoid 3'-hydroxylase gene (F3'H), dihydroflavonol 4-reductase gene (DFR), anthocyanidin synthase gene (ANS), UDP-glucose: flavonoid 3-O-glucosyltransferase gene (UF3GT) and UDP-glucose: flavonoid 5-O-glucosyltransferase gene (UF5GT), and PAL, UF3GT and UF5GT were reported in P. suffruticosa for the first time. Their expression patterns showed that transcription levels of downstream genes in 'Caihui' were basically higher than those in 'Xueta', especially PsDFR and PsANS, suggesting that these two genes may play a key role in the anthocyanin biosynthesis which resulted in the shift from white to red in

  13. Metabolic capabilities of Escherichia coli: I. synthesis of biosynthetic precursors and cofactors.

    PubMed

    Varma, A; Palsson, B O

    1993-12-21

    Metabolism of living cells converts substrates into metabolic energy, redox potential and metabolic end products that are essential to maintain cellular function. The flux distribution among the various biochemical pathways is determined by the kinetic properties of enzymes which are subject to strict regulatory control. Simulation of metabolic behavior therefore requires the complete knowledge of biochemical pathways, enzyme kinetics as well as their regulation. Unfortunately, complete kinetic and regulatory information is not available for microbial cells, thus preventing accurate dynamic simulation of their metabolic behavior. However, it is possible to define wider limits on metabolic behavior based solely on flux balances of biochemical pathways. We present here comprehensive information about the catabolic pathways of the bacterium Escherichia coli. Using this biochemical database, we formulate a stoichiometric model of the bacterial network of fueling reactions. After logical structural reduction, the network consists of 53 metabolic fluxes and 30 metabolites. The solution space of this under-determined system of equations presents the bounds of metabolic flux distribution that the bacterial cell can achieve. We use specific objective functions and linear optimization to investigate the capability of E. coli catabolism to maximally produce the 12 biosynthetic precursors and three key cofactors within this solution space. For the three cofactors, the maximum yields are calculated to be 18.67 ATP, 11.6 NADH and 11 NADPH per glucose molecule, respectively. The yields of NADH and NADPH are less than 12 owing to the energy costs of importing glucose. These constraints are made explicit by the interpretation of shadow prices. The optimal yields of the 12 biosynthetic precursors are computed. Four of the 12 precursors (3-phosphoglycerate, phosphoenolpyruvate, pyruvate and oxaloacetate) can be made by E. coli with complete carbon conversion. Conversely, none of the

  14. Dual Role of a Biosynthetic Enzyme, CysK, in Contact Dependent Growth Inhibition in Bacteria

    PubMed Central

    Kaundal, Soni; Uttam, Manju; Thakur, Krishan Gopal

    2016-01-01

    Contact dependent growth inhibition (CDI) is the phenomenon where CDI+ bacterial strain (inhibitor) inhibits the growth of CDI−strain (target) by direct cell to cell contact. CDI is mediated by cdiBAI gene cluster where CdiB facilitates the export of CdiA, an exotoxin, on the cell surface and CdiI acts as an immunity protein to protect CDI+ cells from autoinhibition. CdiA-CT, the C-terminal region of the toxin CdiA, from uropathogenic Escherichia coli strain 536 (UPEC536) is a latent tRNase that requires binding of a biosynthetic enzyme CysK (O-acetylserine sulfyhydrylase) for activation in the target cells. CdiA-CT can also interact simultaneously with CysK and immunity protein, CdiI, to form a ternary complex in UPEC536. But the role of CysK in the ternary complex is not clear. We studied the hydrodynamic, thermodynamic and kinetic parameters of binary and ternary complexes using AUC, ITC and SPR respectively, to investigate the role of CysK in UPEC536. We report that CdiA-CT binds CdiI and CysK with nanomolar range affinity. We further report that binding of CysK to CdiA-CT improves its affinity towards CdiI by ~40 fold resulting in the formation of a more stable complex with over ~130 fold decrease in dissociation rate. Thermal melting experiments also suggest the role of CysK in stabilizing CdiA-CT/CdiI complex as Tm of the binary complex shifts ~10°C upon binding CysK. Hence, CysK acts a modulator of CdiA-CT/CdiI interactions by stabilizing CdiA-CT/CdiI complex and may play a crucial role in preventing autoinhibition in UPEC536. This study reports a new moonlighting function of a biosynthetic enzyme, CysK, as a modulator of toxin/immunity interactions in UPEC536 inhibitor cells. PMID:27458806

  15. Evidence for land plant cell wall biosynthetic mechanisms in charophyte green algae

    PubMed Central

    Mikkelsen, Maria D.; Harholt, Jesper; Ulvskov, Peter; Johansen, Ida E.; Fangel, Jonatan U.; Doblin, Monika S.; Bacic, Antony; Willats, William G. T.

    2014-01-01

    Background and Aims The charophyte green algae (CGA) are thought to be the closest living relatives to the land plants, and ancestral CGA were unique in giving rise to the land plant lineage. The cell wall has been suggested to be a defining structure that enabled the green algal ancestor to colonize land. These cell walls provide support and protection, are a source of signalling molecules, and provide developmental cues for cell differentiation and elongation. The cell wall of land plants is a highly complex fibre composite, characterized by cellulose cross-linked by non-cellulosic polysaccharides, such as xyloglucan, embedded in a matrix of pectic polysaccharides. How the land plant cell wall evolved is currently unknown: early-divergent chlorophyte and prasinophyte algae genomes contain a low number of glycosyl transferases (GTs), while land plants contain hundreds. The number of GTs in CGA is currently unknown, as no genomes are available, so this study sought to give insight into the evolution of the biosynthetic machinery of CGA through an analysis of available transcriptomes. Methods Available CGA transcriptomes were mined for cell wall biosynthesis GTs and compared with GTs characterized in land plants. In addition, gene cloning was employed in two cases to answer important evolutionary questions. Key Results Genetic evidence was obtained indicating that many of the most important core cell wall polysaccharides have their evolutionary origins in the CGA, including cellulose, mannan, xyloglucan, xylan and pectin, as well as arabino-galactan protein. Moreover, two putative cellulose synthase-like D family genes (CSLDs) from the CGA species Coleochaete orbicularis and a fragment of a putative CSLA/K-like sequence from a CGA Spirogyra species were cloned, providing the first evidence that all the cellulose synthase/-like genes present in early-divergent land plants were already present in CGA. Conclusions The results provide new insights into the evolution of

  16. Comprehensive Analysis of the Triterpenoid Saponins Biosynthetic Pathway in Anemone flaccida by Transcriptome and Proteome Profiling

    PubMed Central

    Zhan, Chuansong; Li, Xiaohua; Zhao, Zeying; Yang, Tewu; Wang, Xuekui; Luo, Biaobiao; Zhang, Qiyun; Hu, Yanru; Hu, Xuebo

    2016-01-01

    Background: Anemone flaccida Fr. Shmidt (Ranunculaceae), commonly known as ‘Di Wu’ in China, is a perennial herb with limited distribution. The rhizome of A. flaccida has long been used to treat arthritis as a tradition in China. Studies disclosed that the plant contains a rich source of triterpenoid saponins. However, little is known about triterpenoid saponins biosynthesis in A. flaccida. Results: In this study, we conducted the tandem transcriptome and proteome profiling of a non-model medicinal plant, A. flaccida. Using Illumina HiSeq 2000 sequencing and iTRAQ technique, a total of 46,962 high-quality unigenes were obtained with an average sequence length of 1,310 bp, along with 1473 unique proteins from A. flaccida. Among the A. flaccida transcripts, 36,617 (77.97%) showed significant similarity (E-value < 1e-5) to the known proteins in the public database. Of the total 46,962 unigenes, 36,617 open reading frame (ORFs) were predicted. By the fragments per kilobases per million reads (FPKM) statistics, 14,004 isoforms/unigenes were found to be upregulated, and 14,090 isoforms/unigenes were down-regulated in the rhizomes as compared to those in the leaves. Based on the bioinformatics analysis, all possible enzymes involved in the triterpenoid saponins biosynthetic pathway of A. flaccida were identified, including cytosolic mevalonate pathway (MVA) and the plastidial methylerythritol pathway (MEP). Additionally, a total of 126 putative cytochrome P450 (CYP450) and 32 putative UDP glycosyltransferases were selected as the candidates of triterpenoid saponins modifiers. Among them, four of them were annotated as the gene of CYP716A subfamily, the key enzyme in the oleanane-type triterpenoid saponins biosynthetic pathway. Furthermore, based on RNA-Seq and proteome analysis, as well as quantitative RT-PCR verification, the expression level of gene and protein committed to triterpenoids biosynthesis in the leaf versus the rhizome was compared. Conclusion: A

  17. Two linear regression models predicting cumulative dynamic L5/S1 joint moment during a range of lifting tasks based on static postures.

    PubMed

    Xu, Xu; Chang, Chien-Chi; Lu, Ming-Lun

    2012-01-01

    Previous studies have indicated that cumulative L5/S1 joint load is a potential risk factor for low back pain. The assessment of cumulative L5/S1 joint load during a field study is challenging due to the difficulty of continuously monitoring the dynamic joint load. This study proposes two regression models predicting cumulative dynamic L5/S1 joint moment based on the static L5/S1 joint moment of a lifting task at lift-off and set-down and the lift duration. Twelve men performed lifting tasks at varying lifting ranges and asymmetric angles in a laboratory environment. The cumulative L5/S1 joint moment was calculated from continuous dynamic L5/S1 moments as the reference for comparison. The static L5/S1 joint moments at lift-off and set-down were measured for the two regression models. The prediction error of the cumulative L5/S1 joint moment was 21 ± 14 Nm × s (12% of the measured cumulative L5/S1 joint moment) and 14 ± 9 Nm × s (8%) for the first and the second models, respectively. Practitioner Summary: The proposed regression models may provide a practical approach for predicting the cumulative dynamic L5/S1 joint loading of a lifting task for field studies since it requires only the lifting duration and the static moments at the lift-off and/or set-down instants of the lift.

  18. Microdecompression for Extraforaminal L5-S1 Disc Herniation; The Significance of Concomitant Foraminal Disc Herniation for Postoperative Leg Pain

    PubMed Central

    Lee, Dong Yeob

    2008-01-01

    Objective To analyze the relationship of concomitant foraminal lumbar disc herniation (FLDH) with postoperative leg pain after microdecompression for extraforaminal lumbar disc herniation (EFLDH) at the L5-S1 level. Methods Sixty-five patients who underwent microdecompression for symptomatic EFLDH at the L5-S1 level were enrolled. According to the severity of accompanying FLDH, EFLDH was classified into four categories (Class I : no FLDH; Class II : mild to moderate FLDH confined within a lateral foraminal zone; Class III : severe FLDH extending to a medial foraminal zone; Class IV : Class III with intracanalicular disc herniation). The incidence of postoperative leg pain, dysesthesia, analgesic medication, epidural block, and requirement for revision surgery due to leg pain were evaluated and compared at three months after initial surgery. Results The incidences of postoperative leg pain and dysesthesia were 36.9% and 26.1%, respectively. Pain medication and epidural block was performed on 40% and 41.5%, respectively. Revision surgery was recommended in six patients (9.2%) due to persistent leg pain. The incidences of leg pain, dysesthesia, and requirement for epidural block were higher in Class III/IV, compared with Class I/II. The incidence of requirement for analgesic medication was significantly higher in Class III/IV, compared with Class I/II (p=0.02, odds ratio=9.82). All patients who required revision surgery due to persistent leg pain were included in Class III/IV. Conclusion Concomitant FLDH seems related to postoperative residual leg pain after microdecompression for EFLDH at the L5-S1 level. PMID:19096652

  19. Heterologous production of glidobactins/luminmycins in Escherichia coli Nissle containing the glidobactin biosynthetic gene cluster from Burkholderia DSM7029.

    PubMed

    Bian, Xiaoying; Huang, Fan; Wang, Hailong; Klefisch, Thorsten; Müller, Rolf; Zhang, Youming

    2014-10-13

    Natural product peptide-based proteasome inhibitors show great potential as anticancer drugs. Here we have cloned the biosynthetic gene cluster of a potent proteasome inhibitor-glidobactin from Burkholderia DSM7029-and successfully detected glidobactins/luminmycins in E. coli Nissle. We have also improved the yield of glidobactin A tenfold by promoter change in a heterologous host. In addition, two new biosynthetic intermediates were identified by comparative MS/MS fragmentation analysis. Identification of acyclic luminmycin E implies substrate specificity of the TE domain for cyclization. The establishment of a heterologous expression system for syrbactins provided the basis for the generation of new syrbactins as proteasome inhibitors by molecular engineering, but the TE domain's specificity cannot be ignored. PMID:25147087

  20. Recombinational cloning of the antibiotic biosynthetic gene clusters in linear plasmid SCP1 of Streptomyces coelicolor A3(2).

    PubMed

    Zhang, Ran; Xia, Haiyang; Xu, Qingyu; Dang, Fujun; Qin, Zhongjun

    2013-08-01

    The model organism Streptomyces coelicolor A3(2) harbors a 356-kb linear plasmid, SCP1. We report here development of a recombinational cloning method for deleting large segment from one telomere of SCP1 followed by replacing with the telomere of pSLA2 and sequentially inserting with the overlapping cosmids in vivo. The procedure depends on homologous recombination coupled with cleavage at telomere termini by telomere terminal protein. Using this procedure, we cloned the 81-kb avermectin and the 76-kb spinosad biosynthetic gene clusters into SCP1. Heterologous expression of avermectin production in S. coelicolor was detected. These results demonstrate the utility of SCP1 for cloning large DNA segments such as antibiotic biosynthetic gene clusters.

  1. Enhancement of artemisinin content in tetraploid Artemisia annua plants by modulating the expression of genes in artemisinin biosynthetic pathway.

    PubMed

    Lin, Xiuyan; Zhou, Yin; Zhang, Jianjun; Lu, Xu; Zhang, Fangyuan; Shen, Qian; Wu, Shaoyan; Chen, Yunfei; Wang, Tao; Tang, Kexuan

    2011-01-01

    Tetraploid Artemisia annua plants were successfully inducted by using colchicine, and their ploidy was confirmed by flow cytometry. Higher stomatal length but lower frequency in tetraploids were revealed and could be considered as indicators of polyploidy. The average level of artemisinin in tetraploids was increased from 39% to 56% than that of the diploids during vegetation period, as detected by high-performance liquid chromatography-evaporative light scattering detector. Gene expressions of 10 key enzymes related to artemisinin biosynthetic pathway in different ploidy level were analyzed by semiquantitative polymerase chain reaction and significant upregulation of FPS, HMGR, and artemisinin metabolite-specific Aldh1 genes were revealed in tetraploids. Slight increased expression of ADS was also detected. Our results suggest that higher artemisinin content in tetraploid A. annua may result from the upregulated expression of some key enzyme genes related to artemisinin biosynthetic pathway. PMID:21446959

  2. PQQ: Biosynthetic studies in Methylobacterium AM1 and Hyphomicrobium X using specific TC labeling and NMR. [Pyrroloquinoline quinones

    SciTech Connect

    Houck, D.R.; Hanners, J.L.; Unkefer, C.J.; van Kleef, M.A.G.; Duine, J.A.

    1988-01-01

    Using TC labeling and NMR spectroscopy we have determined biosynthetic precursors of pyrroloquinoline quinone (PQQ) in two closely related serine-type methylotrophs, Methylobacterium AM1 and Hyphomicrobium X. Analysis of the TC-labeling data revealed that PQQ is constructed from two amino acids: the portion containing N-6, C-7,8,9 and the two carboxylic acid groups, C-7' and 9', is derived-intact-from glutamate. The remaining portion is derived from tyrosine; the phenol side chain provides the six carbons of the ring containing the orthoquinone, whereas internal cyclization of the amino acid backbone forms the pyrrole-2-carboxylic acid moiety. This is analogous to the cyclization of dopaquinone to form dopachrome. Dopaquinone is a product of the oxidation of tyrosine (via dopa) in reactions catalyzed by monophenol monooxygenase (EC 1.14.18.1). Starting with tyrosine and glutamate, we will discuss possible biosynthetic routes to PQQ. 29 refs., 4 figs., 2 tabs.

  3. Transcriptional Regulation of Tetrapyrrole Biosynthetic Genes Explains Abscisic Acid-Induced Heme Accumulation in the Unicellular Red Alga Cyanidioschyzon merolae

    PubMed Central

    Kobayashi, Yuki; Tanaka, Kan

    2016-01-01

    Abscisic acid (ABA), a pivotal phytohormone that is synthesized in response to abiotic stresses and other environmental changes, induces various physiological responses. Heme, in its unbound form, has a positive signaling role in cell-cycle initiation in Cyanidioschyzon merolae. ABA induces heme accumulation, but also prevents cell-cycle initiation through the titration of the unbound heme by inducing the heme scavenging protein tryptophan-rich sensory protein-related protein O. In this study, we analyzed the accumulation of tetrapyrrole biosynthetic gene transcripts after the addition of ABA to the medium and found that transcripts of a ferrochelatase and a magnesium-chelatase subunit increased, while other examined transcripts decreased. Under the same conditions, the heme and magnesium-protoporphyrin IX contents increased, while the protoporphyrin IX content decreased. Thus, ABA may regulate the intracellular heme and other tetrapyrrole contents through the transcriptional regulation of biosynthetic genes.

  4. IMG-ABC: An Atlas of Biosynthetic Gene Clusters to Fuel the Discovery of Novel Secondary Metabolites

    SciTech Connect

    Chen, I-Min; Chu, Ken; Ratner, Anna; Palaniappan, Krishna; Huang, Jinghua; Reddy, T. B.K.; Cimermancic, Peter; Fischbach, Michael; Ivanova, Natalia; Markowitz, Victor; Kyrpides, Nikos; Pati, Amrita

    2014-10-28

    In the discovery of secondary metabolites (SMs), large-scale analysis of sequence data is a promising exploration path that remains largely underutilized due to the lack of relevant computational resources. We present IMG-ABC (https://img.jgi.doe.gov/abc/) -- An Atlas of Biosynthetic gene Clusters within the Integrated Microbial Genomes (IMG) system1. IMG-ABC is a rich repository of both validated and predicted biosynthetic clusters (BCs) in cultured isolates, single-cells and metagenomes linked with the SM chemicals they produce and enhanced with focused analysis tools within IMG. The underlying scalable framework enables traversal of phylogenetic dark matter and chemical structure space -- serving as a doorway to a new era in the discovery of novel molecules.

  5. Higher transcription levels in ascorbic acid biosynthetic and recycling genes were associated with higher ascorbic acid accumulation in blueberry.

    PubMed

    Liu, Fenghong; Wang, Lei; Gu, Liang; Zhao, Wei; Su, Hongyan; Cheng, Xianhao

    2015-12-01

    In our preliminary study, the ripe fruits of two highbush blueberry (Vaccinium corymbosum L.) cultivars, cv 'Berkeley' and cv 'Bluecrop', were found to contain different levels of ascorbic acid. However, factors responsible for these differences are still unknown. In the present study, ascorbic acid content in fruits was compared with expression profiles of ascorbic acid biosynthetic and recycling genes between 'Bluecrop' and 'Berkeley' cultivars. The results indicated that the l-galactose pathway was the predominant route of ascorbic acid biosynthesis in blueberry fruits. Moreover, higher expression levels of the ascorbic acid biosynthetic genes GME, GGP, and GLDH, as well as the recycling genes MDHAR and DHAR, were associated with higher ascorbic acid content in 'Bluecrop' compared with 'Berkeley', which indicated that a higher efficiency ascorbic acid biosynthesis and regeneration was likely to be responsible for the higher ascorbic acid accumulation in 'Bluecrop'.

  6. Transcriptional Regulation of Tetrapyrrole Biosynthetic Genes Explains Abscisic Acid-Induced Heme Accumulation in the Unicellular Red Alga Cyanidioschyzon merolae

    PubMed Central

    Kobayashi, Yuki; Tanaka, Kan

    2016-01-01

    Abscisic acid (ABA), a pivotal phytohormone that is synthesized in response to abiotic stresses and other environmental changes, induces various physiological responses. Heme, in its unbound form, has a positive signaling role in cell-cycle initiation in Cyanidioschyzon merolae. ABA induces heme accumulation, but also prevents cell-cycle initiation through the titration of the unbound heme by inducing the heme scavenging protein tryptophan-rich sensory protein-related protein O. In this study, we analyzed the accumulation of tetrapyrrole biosynthetic gene transcripts after the addition of ABA to the medium and found that transcripts of a ferrochelatase and a magnesium-chelatase subunit increased, while other examined transcripts decreased. Under the same conditions, the heme and magnesium-protoporphyrin IX contents increased, while the protoporphyrin IX content decreased. Thus, ABA may regulate the intracellular heme and other tetrapyrrole contents through the transcriptional regulation of biosynthetic genes. PMID:27621743

  7. Genome mining of the hitachimycin biosynthetic gene cluster: involvement of a phenylalanine-2,3-aminomutase in biosynthesis.

    PubMed

    Kudo, Fumitaka; Kawamura, Koichi; Uchino, Asuka; Miyanaga, Akimasa; Numakura, Mario; Takayanagi, Ryuichi; Eguchi, Tadashi

    2015-04-13

    Hitachimycin is a macrolactam antibiotic with (S)-β-phenylalanine (β-Phe) at the starter position of its polyketide skeleton. To understand the incorporation mechanism of β-Phe and the modification mechanism of the unique polyketide skeleton, the biosynthetic gene cluster for hitachimycin in Streptomyces scabrisporus was identified by genome mining. The identified gene cluster contains a putative phenylalanine-2,3-aminomutase (PAM), five polyketide synthases, four β-amino-acid-carrying enzymes, and a characteristic amidohydrolase. A hitA knockout mutant showed no hitachimycin production, but antibiotic production was restored by feeding with (S)-β-Phe. We also confirmed the enzymatic activity of the HitA PAM. The results suggest that the identified gene cluster is responsible for the biosynthesis of hitachimycin. A plausible biosynthetic pathway for hitachimycin, including a unique polyketide skeletal transformation mechanism, is proposed.

  8. Engineered Production of Tryprostatins in E. coli through Reconstitution of a Partial ftm Biosynthetic Gene Cluster from Aspergillus sp.

    PubMed Central

    Shah, Gopitkumar R; Wesener, Shane R.; Cheng, Yi-Qiang

    2015-01-01

    Tryprostatin A and B are indole alkaloid-based fungal products that inhibit mammalian cell cycle at the G2/M phase. They are biosynthetic intermediates of fumitremorgins produced by a complex pathway involving a nonribosomal peptide synthetase (FtmA), a prenyltransferase (FtmB), a cytochrome P450 hydroxylase (FtmC), an O-methyltransferase (FtmD), and several additional enzymes. A partial fumitremorgin biosynthetic gene cluster (ftmABCD) from Aspergillus sp. was reconstituted in Escherichia coli BL21(DE3) cells, with or without the co-expression of an Sfp-type phosphopantetheinyltransferase gene (Cv_sfp) from Chromobacterium violaceum No. 968. Several recombinant E. coli strains produced tryprostatin B up to 106 mg/l or tryprostatin A up to 76 mg/l in the fermentation broth under aerobic condition, providing an effective way to prepare those pharmaceutically important natural products biologically. PMID:26640821

  9. Transcriptional Regulation of Tetrapyrrole Biosynthetic Genes Explains Abscisic Acid-Induced Heme Accumulation in the Unicellular Red Alga Cyanidioschyzon merolae.

    PubMed

    Kobayashi, Yuki; Tanaka, Kan

    2016-01-01

    Abscisic acid (ABA), a pivotal phytohormone that is synthesized in response to abiotic stresses and other environmental changes, induces various physiological responses. Heme, in its unbound form, has a positive signaling role in cell-cycle initiation in Cyanidioschyzon merolae. ABA induces heme accumulation, but also prevents cell-cycle initiation through the titration of the unbound heme by inducing the heme scavenging protein tryptophan-rich sensory protein-related protein O. In this study, we analyzed the accumulation of tetrapyrrole biosynthetic gene transcripts after the addition of ABA to the medium and found that transcripts of a ferrochelatase and a magnesium-chelatase subunit increased, while other examined transcripts decreased. Under the same conditions, the heme and magnesium-protoporphyrin IX contents increased, while the protoporphyrin IX content decreased. Thus, ABA may regulate the intracellular heme and other tetrapyrrole contents through the transcriptional regulation of biosynthetic genes. PMID:27621743

  10. Measurement of the photoionization cross section of the 5S{sub 1/2} state of rubidium

    SciTech Connect

    Lowell, J.R.; Northup, T.; Patterson, B.M.; Takekoshi, T.; Knize, R.J.

    2002-12-01

    We report the measurement of the photoionization cross section for the 5S{sub 1/2} state of rubidium, using atoms confined in a magneto-optical trap. A single-photon rate at {lambda}=266 nm was found by monitoring the decay of trap fluorescence after exposure to ionizing radiation from a quadrupled Nd:YVO{sub 4} laser. In order to eliminate excited-state ionization, the photoionization and trapping lasers were alternately chopped, so that only ground-state atoms were ionized. We determine that the photoionization cross section at {lambda}=266 nm is {sigma}=1.7(2)x10{sup -20} cm{sup 2}.

  11. In Vivo Production of Small Recombinant RNAs Embedded in a 5S rRNA-Derived Protective Scaffold.

    PubMed

    Stepanov, Victor G; Fox, George E

    2015-01-01

    Preparative synthesis of RNA is a challenging task that is usually accomplished using either chemical or enzymatic polymerization of ribonucleotides in vitro. Herein, we describe an alternative approach in which RNAs of interest are expressed as a fusion with a 5S rRNA-derived scaffold. The scaffold provides protection against cellular ribonucleases resulting in cellular accumulations comparable to those of regular ribosomal RNAs. After isolation of the chimeric RNA from the cells, the scaffold can be removed if necessary by deoxyribozyme-catalyzed cleavage followed by preparative electrophoretic separation of the cleavage reaction products. The protocol is designed for sustained production of high quality RNA on the milligram scale.

  12. Identification of prostamides, fatty acyl ethanolamines, and their biosynthetic precursors in rabbit cornea[S

    PubMed Central

    Urquhart, Paula; Wang, Jenny; Woodward, David F.; Nicolaou, Anna

    2015-01-01

    Arachidonoyl ethanolamine (anandamide) and pros­taglandin ethanolamines (prostamides) are biologically active derivatives of arachidonic acid. Although available through different precursor phospholipids, there is considerable overlap between the biosynthetic pathways of arachidonic acid-derived eicosanoids and anandamide-derived prostamides. Prostamides exhibit physiological actions and are involved in ocular hypotension, smooth muscle contraction, and inflammatory pain. Although topical application of bimatoprost, a structural analog of prostaglandin F2α ethanolamide (PGF2α-EA), is currently a first-line treatment for ocular hypertension, the endogenous production of prostamides and their biochemical precursors in corneal tissue has not yet been reported. In this study, we report the presence of anandamide, palmitoyl-, stearoyl-, α-linolenoyl docosahexaenoyl-, linoleoyl-, and oleoyl-ethanolamines in rabbit cornea, and following treatment with anandamide, the formation of PGF2α-EA, PGE2-EA, PGD2-EA by corneal extracts (all analyzed by LC/ESI-MS/MS). A number of N-acyl phosphatidylethanolamines, precursors of anandamide and other fatty acyl ethanolamines, were also identified in corneal lipid extracts using ESI-MS/MS. These findings suggest that the prostamide and fatty acid ethanolamine pathways are operational in the cornea and may provide valuable insight into corneal physiology and their potential influence on adjacent tissues and the aqueous humor. PMID:26031663

  13. Production of wax esters in plant seed oils by oleosomal cotargeting of biosynthetic enzymes[S

    PubMed Central

    Heilmann, Mareike; Iven, Tim; Ahmann, Katharina; Hornung, Ellen; Stymne, Sten; Feussner, Ivo

    2012-01-01

    Wax esters are neutral lipids exhibiting desirable properties for lubrication. Natural sources have traditionally been whales. Additionally some plants produce wax esters in their seed oil. Currently there is no biological source available for long chain length monounsaturated wax esters that are most suited for industrial applications. This study aimed to identify enzymatic requirements enabling their production in oilseed plants. Wax esters are generated by the action of fatty acyl-CoA reductase (FAR), generating fatty alcohols and wax synthases (WS) that esterify fatty alcohols and acyl-CoAs to wax esters. Based on their substrate preference, a FAR and a WS from Mus musculus were selected for this study (MmFAR1 and MmWS). MmWS resides in the endoplasmic reticulum (ER), whereas MmFAR1 associates with peroxisomes. The elimination of a targeting signal and the fusion to an oil body protein yielded variants of MmFAR1 and MmWS that were cotargeted and enabled wax ester production when coexpressed in yeast or Arabidopsis. In the fae1 fad2 double mutant, rich in oleate, the cotargeted variants of MmFAR1 and MmWS enabled formation of wax esters containing >65% oleyl-oleate. The data suggest that cotargeting of unusual biosynthetic enzymes can result in functional interplay of heterologous partners in transgenic plants. PMID:22878160

  14. The effects of some polyamine biosynthetic inhibitors on growth and morphology of phytopathogenic fungi

    NASA Technical Reports Server (NTRS)

    Rajam, M. V.; Galston, A. W.

    1985-01-01

    We have studied the effects of two polyamine biosynthetic inhibitors, alpha-difluoromethylornithine (DFMO) and alpha-difluoromethylarginine (DFMA), and of polyamines (PAs), alone and in combination, on mycelial growth and morphology of four phytopathogenic fungi: Botrytis sp, B. cinerea, Rhizoctonia solani and Monilinia fructicola. The inhibitors were added to a Czapek agar medium to get final concentrations of 0.1, 0.5 and 1.0 mM. DFMO and DFMA, suicide inhibitors of ornithine decarboxylase (ODC) and arginine decarboxylase (ADC) respectively, inhibited mycelial growth strongly; the effect was generally more pronounced with DFMA than with DFMO, but each fungus had its own response pattern. The addition of the PAs putrescine (Put) and spermidine (Spd) to the culture medium resulted in a promotion of growth. In Botrytis sp and Monilinia fructicola exposed to inhibitors plus PAs, mycelial growth was actually increased above control values. Mycelial morphology was altered and cell size dramatically reduced in plates containing inhibitors alone, whereas with PAs alone, or in combination with inhibitors, morphology was normal, but cell length and diameters increased considerably. These results suggest that PAs are essential for growth in fungal mycelia. The inhibition caused by DFMA may be due to its arginase-mediated conversion to DFMO.

  15. The lysine biosynthetic enzyme Lys4 influences iron metabolism, mitochondrial function and virulence in Cryptococcus neoformans.

    PubMed

    Do, Eunsoo; Park, Minji; Hu, Guanggan; Caza, Mélissa; Kronstad, James W; Jung, Won Hee

    2016-09-01

    The lysine biosynthesis pathway via α-aminoadipate in fungi is considered an attractive target for antifungal drugs due to its absence in mammalian hosts. The iron-sulfur cluster-containing enzyme homoaconitase converts homocitrate to homoisocitrate in the lysine biosynthetic pathway, and is encoded by LYS4 in the model yeast Saccharomyces cerevisiae. In this study, we identified the ortholog of LYS4 in the human fungal pathogen, Cryptococcus neoformans, and found that LYS4 expression is regulated by iron levels and by the iron-related transcription factors Hap3 and HapX. Deletion of the LYS4 gene resulted in lysine auxotrophy suggesting that Lys4 is essential for lysine biosynthesis. Our study also revealed that lysine uptake was mediated by two amino acid permeases, Aap2 and Aap3, and influenced by nitrogen catabolite repression (NCR). Furthermore, the lys4 mutant showed increased sensitivity to oxidative stress, agents that challenge cell wall/membrane integrity, and azole antifungal drugs. We showed that these phenotypes were due in part to impaired mitochondrial function as a result of LYS4 deletion, which we propose disrupts iron homeostasis in the organelle. The combination of defects are consistent with our observation that the lys4 mutant was attenuated virulence in a mouse inhalation model of cryptococcosis. PMID:27353379

  16. Functional consequences of sequence variation in the pheromone biosynthetic gene pgFAR for Ostrinia moths.

    PubMed

    Lassance, Jean-Marc; Liénard, Marjorie A; Antony, Binu; Qian, Shuguang; Fujii, Takeshi; Tabata, Jun; Ishikawa, Yukio; Löfstedt, Christer

    2013-03-01

    Pheromones are central to the mating systems of a wide range of organisms, and reproductive isolation between closely related species is often achieved by subtle differences in pheromone composition. In insects and moths in particular, the use of structurally similar components in different blend ratios is usually sufficient to impede gene flow between taxa. To date, the genetic changes associated with variation and divergence in pheromone signals remain largely unknown. Using the emerging model system Ostrinia, we show the functional consequences of mutations in the protein-coding region of the pheromone biosynthetic fatty-acyl reductase gene pgFAR. Heterologous expression confirmed that pgFAR orthologs encode enzymes exhibiting different substrate specificities that are the direct consequences of extensive nonsynonymous substitutions. When taking natural ratios of pheromone precursors into account, our data reveal that pgFAR substrate preference provides a good explanation of how species-specific ratios of pheromone components are obtained among Ostrinia species. Moreover, our data indicate that positive selection may have promoted the observed accumulation of nonsynonymous amino acid substitutions. Site-directed mutagenesis experiments substantiate the idea that amino acid polymorphisms underlie subtle or drastic changes in pgFAR substrate preference. Altogether, this study identifies the reduction step as a potential source of variation in pheromone signals in the moth genus Ostrinia and suggests that selection acting on particular mutations provides a mechanism allowing pheromone reductases to evolve new functional properties that may contribute to variation in the composition of pheromone signals.

  17. Inhibition of the hexosamine biosynthetic pathway promotes castration-resistant prostate cancer.

    PubMed

    Kaushik, Akash K; Shojaie, Ali; Panzitt, Katrin; Sonavane, Rajni; Venghatakrishnan, Harene; Manikkam, Mohan; Zaslavsky, Alexander; Putluri, Vasanta; Vasu, Vihas T; Zhang, Yiqing; Khan, Ayesha S; Lloyd, Stacy; Szafran, Adam T; Dasgupta, Subhamoy; Bader, David A; Stossi, Fabio; Li, Hangwen; Samanta, Susmita; Cao, Xuhong; Tsouko, Efrosini; Huang, Shixia; Frigo, Daniel E; Chan, Lawrence; Edwards, Dean P; Kaipparettu, Benny A; Mitsiades, Nicholas; Weigel, Nancy L; Mancini, Michael; McGuire, Sean E; Mehra, Rohit; Ittmann, Michael M; Chinnaiyan, Arul M; Putluri, Nagireddy; Palapattu, Ganesh S; Michailidis, George; Sreekumar, Arun

    2016-01-01

    The precise molecular alterations driving castration-resistant prostate cancer (CRPC) are not clearly understood. Using a novel network-based integrative approach, here, we show distinct alterations in the hexosamine biosynthetic pathway (HBP) to be critical for CRPC. Expression of HBP enzyme glucosamine-phosphate N-acetyltransferase 1 (GNPNAT1) is found to be significantly decreased in CRPC compared with localized prostate cancer (PCa). Genetic loss-of-function of GNPNAT1 in CRPC-like cells increases proliferation and aggressiveness, in vitro and in vivo. This is mediated by either activation of the PI3K-AKT pathway in cells expressing full-length androgen receptor (AR) or by specific protein 1 (SP1)-regulated expression of carbohydrate response element-binding protein (ChREBP) in cells containing AR-V7 variant. Strikingly, addition of the HBP metabolite UDP-N-acetylglucosamine (UDP-GlcNAc) to CRPC-like cells significantly decreases cell proliferation, both in-vitro and in animal studies, while also demonstrates additive efficacy when combined with enzalutamide in-vitro. These observations demonstrate the therapeutic value of targeting HBP in CRPC. PMID:27194471

  18. Isobutanol production in engineered Saccharomyces cerevisiae by overexpression of 2-ketoisovalerate decarboxylase and valine biosynthetic enzymes.

    PubMed

    Lee, Won-Heong; Seo, Seung-Oh; Bae, Yi-Hyun; Nan, Hong; Jin, Yong-Su; Seo, Jin-Ho

    2012-11-01

    Engineering of Saccharomyces cerevisiae to produce advanced biofuels such as isobutanol has received much attention because this yeast has a natural capacity to produce higher alcohols. In this study, construction of isobutanol production systems was attempted by overexpression of effective 2-keto acid decarboxylase (KDC) and combinatorial overexpression of valine biosynthetic enzymes in S. cerevisiae D452-2. Among the six putative KDC enzymes from various microorganisms, 2-ketoisovalerate decarboxylase (Kivd) from L. lactis subsp. lactis KACC 13877 was identified as the most suitable KDC for isobutanol production in the yeast. Isobutanol production by the engineered S. cerevisiae was assessed in micro-aerobic batch fermentations using glucose as a sole carbon source. 93 mg/L isobutanol was produced in the Kivd overexpressing strain, which corresponds to a fourfold improvement as compared with the control strain. Isobutanol production was further enhanced to 151 mg/L by additional overexpression of acetolactate synthase (Ilv2p), acetohydroxyacid reductoisomerase (Ilv5p), and dihydroxyacid dehydratase (Ilv3p) in the cytosol.

  19. Bioactivity-guided genome mining reveals the lomaiviticin biosynthetic gene cluster in Salinispora tropica.

    PubMed

    Kersten, Roland D; Lane, Amy L; Nett, Markus; Richter, Taylor K S; Duggan, Brendan M; Dorrestein, Pieter C; Moore, Bradley S

    2013-05-27

    The use of genome sequences has become routine in guiding the discovery and identification of microbial natural products and their biosynthetic pathways. In silico prediction of molecular features, such as metabolic building blocks, physico-chemical properties or biological functions, from orphan gene clusters has opened up the characterization of many new chemo- and genotypes in genome mining approaches. Here, we guided our genome mining of two predicted enediyne pathways in Salinispora tropica CNB-440 by a DNA interference bioassay to isolate DNA-targeting enediyne polyketides. An organic extract of S. tropica showed DNA-interference activity that surprisingly was not abolished in genetic mutants of the targeted enediyne pathways, ST_pks1 and spo. Instead we showed that the product of the orphan type II polyketide synthase pathway, ST_pks2, is solely responsible for the DNA-interfering activity of the parent strain. Subsequent comparative metabolic profiling revealed the lomaiviticins, glycosylated diazofluorene polyketides, as the ST_pks2 products. This study marks the first report of the 59 open reading frame lomaiviticin gene cluster (lom) and supports the biochemical logic of their dimeric construction through a pathway related to the kinamycin monomer.

  20. Two of a Kind--The Biosynthetic Pathways of Chlorotonil and Anthracimycin.

    PubMed

    Jungmann, Katrin; Jansen, Rolf; Gerth, Klaus; Huch, Volker; Krug, Daniel; Fenical, William; Müller, Rolf

    2015-11-20

    Chlorotonil A is a novel polyketide isolated from the myxobacterium Sorangium cellulosum So ce1525 that features a unique gem-dichloro-1,3-dione moiety. It exhibits potent bioactivity, most notably against the problematic malaria pathogen Plasmodium falciparum in the nanomolar range. In addition, strong antibacterial and moderate antifungal activity were determined. The outstanding biological activity of chlorotonil A as well as its unusual chemical structure triggered our interest in elucidating its biosynthesis, a prerequisite for alteration of the scaffold by synthetic biology approaches. This endeavor was facilitated by a recent report describing the strikingly similar structure of anthracimycin from a marine streptomycete, a compound of considerable interest due to its potent antibacterial activity. In this study, we report the identification and characterization of the chlorotonil A biosynthetic gene cluster from So ce1525 and compare it with that for anthracimycin biosynthesis. Access to both gene clusters allowed us to highlight commonalities between the two pathways and revealed striking differences, some of which can plausibly explain the structural differences observed between these intriguing natural products.