Science.gov

Sample records for 5s clavam biosynthetic

  1. 5S Clavam Biosynthesis Is Controlled by an Atypical Two-Component Regulatory System in Streptomyces clavuligerus

    PubMed Central

    Kwong, Thomas; Zelyas, Nathan J.; Cai, Hui; Tahlan, Kapil; Wong, Annie

    2012-01-01

    Streptomyces clavuligerus produces a collection of five clavam metabolites, including the clinically important β-lactamase inhibitor clavulanic acid, as well as four structurally related metabolites called 5S clavams. The paralogue gene cluster of S. clavuligerus is one of three clusters of genes for the production of these clavam metabolites. A region downstream of the cluster was analyzed, and snk, res1, and res2, encoding elements of an atypical two-component regulatory system, were located. Mutation of any one of the three genes had no effect on clavulanic acid production, but snk and res2 mutants produced no 5S clavams, whereas res1 mutants overproduced 5S clavams. Reverse transcriptase PCR analyses showed that transcription of cvm7p (which encodes a transcriptional activator of 5S clavam biosynthesis) and 5S clavam biosynthetic genes was eliminated in snk and in res2 mutants but that snk and res2 transcription was unaffected in a cvm7p mutant. Both snk and res2 mutants could be complemented by introduction of cvm7p under the control of an independently regulated promoter. In vitro assays showed that Snk can autophosphorylate and transfer its phosphate group to both Res1 and Res2, and Snk-H365, Res1-D52, and Res2-D52 were identified as the phosphorylation sites for the system. Dephosphorylation assays indicated that Res1 stimulates dephosphorylation of Res2∼P. These results suggest a regulatory cascade in which Snk and Res2 form a two-component system controlling cvm7p transcription, with Res1 serving as a checkpoint to modulate phosphorylation levels. Cvm7P then activates transcription of 5S clavam biosynthetic genes. PMID:22751548

  2. Inversion of the stereochemical configuration (3S, 5S)-clavaminic acid into (3R, 5R)-clavulanic acid: A computationally-assisted approach based on experimental evidence.

    PubMed

    Ramirez-Malule, Howard; Restrepo, Albeiro; Cardona, Wilson; Junne, Stefan; Neubauer, Peter; Rios-Estepa, Rigoberto

    2016-04-21

    Clavulanic acid (CA), a potent inhibitor of β-lactamase enzymes, is produced by Streptomyces clavuligerus (Sc) cultivation processes, for which low yields are commonly obtained. Improved knowledge of the clavam biosynthetic pathway, especially the steps involved in the inversion of 3S-5S into 3R-5R stereochemical configuration, would help to eventually identify bottlenecks in the pathway. In this work, we studied the role of acetate in CA biosynthesis by a combined continuous culture and computational simulation approach. From this we derived a new model for the synthesis of N-acetyl-glycyl-clavaminic acid (NAG-clavam) by Sc. Acetylated compounds, such as NAG-clavam and N-acetyl-clavaminic acid, have been reported in the clavam pathway. Although the acetyl group is present in the β-lactam intermediate NAG-clavam, it is unknown how this group is incorporated. Hence, under the consideration of the experimentally proven accumulation of acetate during CA biosynthesis, and the fact that an acetyl group is present in the NAG-clavam structure, a computational evaluation of the tentative formation of NAG-clavam was performed for the purpose of providing further understanding. The proposed reaction mechanism consists of two steps: first, acetate reacts with ATP to produce a reactive acylphosphate intermediate; second, a direct nucleophilic attack of the terminal amino group of N-glycyl-clavaminic on the carbonyl carbon of the acylphosphate intermediate leads to a tetrahydral intermediate, which collapses and produces ADP and N-acetyl-glycyl-clavaminic acid. The calculations suggest that for the proposed reaction mechanism, the reaction proceeds until completion of the first step, without the direct action of an enzyme, where acetate and ATP are involved. For this step, the computed activation energy was ≅2.82kcal/mol while the reaction energy was ≅2.38kcal/mol. As this is an endothermic chemical process with a relatively small activation energy, the reaction rate

  3. Biosynthetic Anthracycline Variants

    NASA Astrophysics Data System (ADS)

    Niemi, Jarmo; Metsä-Ketelä, Mikko; Schneider, Gunter; Mäntsälä, Pekka

    In addition to synthetic and semisynthetic methods, new anthracycline structures have been generated by biosynthetic methods: genetic engineering of Streptomyces production strains, bioconversion and chemoenzymatic synthesis. In this review, we discuss the set of molecules potentially producible by biosynthetic methods and which structures have so far been realized. Biosynthetic variation in the anthracycline molecule manifests itself either as structure changes in the tetracyclic aglycone, or as variation in glycosylation. Understanding the biosynthetic sequence and knowledge of the substrate specificities of the enzymes participating in it enable rational generation of new anthracycline diversity. Future possibilities include protein engineering of the biosynthetic enzymes to improve the production of new structural combinations.

  4. Chaperoning 5S RNA assembly

    PubMed Central

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-01-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998

  5. Biosynthetic pathways of ergot alkaloids.

    PubMed

    Gerhards, Nina; Neubauer, Lisa; Tudzynski, Paul; Li, Shu-Ming

    2014-01-01

    Ergot alkaloids are nitrogen-containing natural products belonging to indole alkaloids. The best known producers are fungi of the phylum Ascomycota, e.g., Claviceps, Epichloë, Penicillium and Aspergillus species. According to their structures, ergot alkaloids can be divided into three groups: clavines, lysergic acid amides and peptides (ergopeptines). All of them share the first biosynthetic steps, which lead to the formation of the tetracyclic ergoline ring system (except the simplest, tricyclic compound: chanoclavine). Different modifications on the ergoline ring by specific enzymes result in an abundance of bioactive natural products, which are used as pharmaceutical drugs or precursors thereof. From the 1950s through to recent years, most of the biosynthetic pathways have been elucidated. Gene clusters from several ergot alkaloid producers have been identified by genome mining and the functions of many of those genes have been demonstrated by knock-out experiments or biochemical investigations of the overproduced enzymes. PMID:25513893

  6. Biosynthetic Pathways of Ergot Alkaloids

    PubMed Central

    Gerhards, Nina; Neubauer, Lisa; Tudzynski, Paul; Li, Shu-Ming

    2014-01-01

    Ergot alkaloids are nitrogen-containing natural products belonging to indole alkaloids. The best known producers are fungi of the phylum Ascomycota, e.g., Claviceps, Epichloë, Penicillium and Aspergillus species. According to their structures, ergot alkaloids can be divided into three groups: clavines, lysergic acid amides and peptides (ergopeptines). All of them share the first biosynthetic steps, which lead to the formation of the tetracyclic ergoline ring system (except the simplest, tricyclic compound: chanoclavine). Different modifications on the ergoline ring by specific enzymes result in an abundance of bioactive natural products, which are used as pharmaceutical drugs or precursors thereof. From the 1950s through to recent years, most of the biosynthetic pathways have been elucidated. Gene clusters from several ergot alkaloid producers have been identified by genome mining and the functions of many of those genes have been demonstrated by knock-out experiments or biochemical investigations of the overproduced enzymes. PMID:25513893

  7. Biosynthetic Polymers as Functional Materials

    PubMed Central

    2016-01-01

    The synthesis of functional polymers encoded with biomolecules has been an extensive area of research for decades. As such, a diverse toolbox of polymerization techniques and bioconjugation methods has been developed. The greatest impact of this work has been in biomedicine and biotechnology, where fully synthetic and naturally derived biomolecules are used cooperatively. Despite significant improvements in biocompatible and functionally diverse polymers, our success in the field is constrained by recognized limitations in polymer architecture control, structural dynamics, and biostabilization. This Perspective discusses the current status of functional biosynthetic polymers and highlights innovative strategies reported within the past five years that have made great strides in overcoming the aforementioned barriers. PMID:27375299

  8. Two thraustochytrid 5S ribosomal RNAs.

    PubMed Central

    MacKay, R M; Doolittle, W F

    1982-01-01

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  9. Two thraustochytrid 5S ribosomal RNAs.

    PubMed

    MacKay, R M; Doolittle, W F

    1982-12-20

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  10. The 5S genes of Drosophila melanogaster.

    PubMed

    Artavanis-Tsakonas, S; Schedl, P; Tschudi, C; Pirrotta, V; Steward, R; Gehring, W J

    1977-12-01

    We have cloned embryonic Drosophila DNA using the poly (dA-DT) connector method (Lobban and Kaiser, 1973) and the ampicillin-resistant plasmid pSF2124 (So, Gill and Falkow, 1975) as a cloning vehicle. Two clones, containing hybrid plasmids with sequences complementary to a 5S RNA probe isolated from Drosophila tissue culture cells, were identified by the Grunstein and Hogness (1975) colony hybridization procedure. One hybrid plasmid has a Drosophila insert which is comprised solely of tandem repeats of the 5S gene plus spacer sequences. The other plasmid contains an insert which has about 20 tandem 5S repeat units plus an additional 4 kilobases of adjacent sequences. The size of the 5S repeat unit was determined by gel electrophoresis and was found to be approximately 375 base pairs. We present a restriction map of both plasmids, and a detailed map of of the5S repeat unit. The 5S repat unit shows slight length and sequence heterogeneity. We present evidence suggesting that the 5S genes in Drosophila melanogaster may be arranged in a single continuous cluster. PMID:413625

  11. A biosynthetic pathway for anandamide

    PubMed Central

    Liu, Jie; Wang, Lei; Harvey-White, Judith; Osei-Hyiaman, Douglas; Razdan, Raj; Gong, Qian; Chan, Andrew C.; Zhou, Zhifeng; Huang, Bill X.; Kim, Hee-Yong; Kunos, George

    2006-01-01

    The endocannabinoid arachidonoyl ethanolamine (anandamide) is a lipid transmitter synthesized and released “on demand” by neurons in the brain. Anandamide is also generated by macrophages where its endotoxin (LPS)-induced synthesis has been implicated in the hypotension of septic shock and advanced liver cirrhosis. Anandamide can be generated from its membrane precursor, N-arachidonoyl phosphatidylethanolamine (NAPE) through cleavage by a phospholipase D (NAPE–PLD). Here we document a biosynthetic pathway for anandamide in mouse brain and RAW264.7 macrophages that involves the phospholipase C (PLC)-catalyzed cleavage of NAPE to generate a lipid, phosphoanandamide, which is subsequently dephosphorylated by phosphatases, including PTPN22, previously described as a protein tyrosine phosphatase. Bacterial endotoxin (LPS)-induced synthesis of anandamide in macrophages is mediated exclusively by the PLC/phosphatase pathway, which is up-regulated by LPS, whereas NAPE–PLD is down-regulated by LPS and functions as a salvage pathway of anandamide synthesis when the PLC/phosphatase pathway is compromised. Both PTPN22 and endocannabinoids have been implicated in autoimmune diseases, suggesting that the PLC/phosphatase pathway of anandamide synthesis may be a pharmacotherapeutic target. PMID:16938887

  12. Analysis of the 5S RNA pool in Arabidopsis thaliana: RNAs are heterogeneous and only two of the genomic 5S loci produce mature 5S RNA.

    PubMed

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5'- and 3'-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array. PMID:11779838

  13. Diversifying Carotenoid Biosynthetic Pathways by Directed Evolution

    PubMed Central

    Umeno, Daisuke; Tobias, Alexander V.; Arnold, Frances H.

    2005-01-01

    Microorganisms and plants synthesize a diverse array of natural products, many of which have proven indispensable to human health and well-being. Although many thousands of these have been characterized, the space of possible natural products—those that could be made biosynthetically—remains largely unexplored. For decades, this space has largely been the domain of chemists, who have synthesized scores of natural product analogs and have found many with improved or novel functions. New natural products have also been made in recombinant organisms, via engineered biosynthetic pathways. Recently, methods inspired by natural evolution have begun to be applied to the search for new natural products. These methods force pathways to evolve in convenient laboratory organisms, where the products of new pathways can be identified and characterized in high-throughput screening programs. Carotenoid biosynthetic pathways have served as a convenient experimental system with which to demonstrate these ideas. Researchers have mixed, matched, and mutated carotenoid biosynthetic enzymes and screened libraries of these “evolved” pathways for the emergence of new carotenoid products. This has led to dozens of new pathway products not previously known to be made by the assembled enzymes. These new products include whole families of carotenoids built from backbones not found in nature. This review details the strategies and specific methods that have been employed to generate new carotenoid biosynthetic pathways in the laboratory. The potential application of laboratory evolution to other biosynthetic pathways is also discussed. PMID:15755953

  14. Analysis of the 5S RNA Pool in Arabidopsis thaliana: RNAs Are Heterogeneous and Only Two of the Genomic 5S Loci Produce Mature 5S RNA

    PubMed Central

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5′- and 3′-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array. [EMBL accession nos: AF330825-AF331032; AF335777-AF335873.] PMID:11779838

  15. Biosynthetic engineering of nonribosomal peptide synthetases.

    PubMed

    Kries, Hajo

    2016-09-01

    From the evolutionary melting pot of natural product synthetase genes, microorganisms elicit antibiotics, communication tools, and iron scavengers. Chemical biologists manipulate these genes to recreate similarly diverse and potent biological activities not on evolutionary time scales but within months. Enzyme engineering has progressed considerably in recent years and offers new screening, modelling, and design tools for natural product designers. Here, recent advances in enzyme engineering and their application to nonribosomal peptide synthetases are reviewed. Among the nonribosomal peptides that have been subjected to biosynthetic engineering are the antibiotics daptomycin, calcium-dependent antibiotic, and gramicidin S. With these peptides, incorporation of unnatural building blocks and modulation of bioactivities via various structural modifications have been successfully demonstrated. Natural product engineering on the biosynthetic level is not a reliable method yet. However, progress in the understanding and manipulation of biosynthetic pathways may enable the routine production of optimized peptide drugs in the near future. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd. PMID:27465074

  16. Biosynthetic route towards saxitoxin and shunt pathway

    PubMed Central

    Tsuchiya, Shigeki; Cho, Yuko; Konoki, Keiichi; Nagasawa, Kazuo; Oshima, Yasukatsu; Yotsu-Yamashita, Mari

    2016-01-01

    Saxitoxin, the most potent voltage-gated sodium channel blocker, is one of the paralytic shellfish toxins (PSTs) produced by cyanobacteria and dinoflagellates. Recently, putative biosynthetic genes of PSTs were reported in these microorganisms. We previously synthesized genetically predicted biosynthetic intermediates, Int-A’ and Int-C’2, and also Cyclic-C’ which was not predicted based on gene, and identified them all in the toxin-producing cyanobacterium Anabaena circinalis (TA04) and the dinoflagellate Alexandrium tamarense (Axat-2). This study examined the incorporation of 15N-labeled intermediates into PSTs (C1 and C2) in A. circinalis (TA04). Conversions from Int-A’ to Int-C’2, from Int-C’2 to Cyclic-C’, and from Int-A’ and Int-C’2 to C1 and C2 were indicated using high resolution-LC/MS. However, Cyclic-C’ was not converted to C1 and C2 and was detected primarily in the extracellular medium. These results suggest that Int-A’ and Int-C’2 are genuine precursors of PSTs, but Int-C’2 converts partially to Cyclic-C’ which is a shunt product excreted to outside the cells. This paper provides the first direct demonstration of the biosynthetic route towards saxitoxin and a shunt pathway. PMID:26842222

  17. Tryptophan biosynthetic enzymes of Staphylococcus aureus.

    PubMed

    Proctor, A R; Kloos, W E

    1973-04-01

    Tryptophan biosynthetic enzymes were assayed in various tryptophan mutants of Staphylococcus aureus strain 655 and the wild-type parent. All mutants, except trpB mutants, lacked only the activity corresponding to the particular biosynthetic block, as suggested previously by analysis of accumulated intermediates and auxonography. Tryptophan synthetase A was not detected in extracts of either trpA or trpB mutants but appeared normal in other mutants. Mutants in certain other classes exhibited partial loss of another particular tryptophan enzyme activity. Tryptophan synthetase B activity was not detected in cell extract preparations but was detected in whole cells. The original map order proposed for the S. aureus tryptophan gene cluster was clarified by the definition of trpD (phosphoribosyl transferase(-)) and trpF (phosphoribosyl anthranilate isomerase(-)) mutants. These mutants were previously unresolved and designated as trp(DF) mutants (anthranilate accumulators). Phosphoribosyl anthranilate isomerase and indole-3-glycerol phosphate synthetase enzymes were separable by molecular sieve chromatography, suggesting that these functions are coded by separate loci. Molecular sieve chromatography failed to reveal aggregates involving anthranilate synthetase, phosphoribosyl transferase, phosphoribosyl anthranilate isomerase, and indole-3-glycerol phosphate synthetase, and this procedure provided an estimate of the molecular weights of these enzymes. Tryptophan was shown to repress synthesis of all six tryptophan biosynthetic enzymes, and derepression of all six activities was incident upon tryptophan starvation. Tryptophan inhibited the activity of anthranilate synthetase, the first enzyme of the pathway. PMID:4698207

  18. Compilation of 5S rRNA and 5S rRNA gene sequences

    PubMed Central

    Specht, Thomas; Wolters, Jörn; Erdmann, Volker A.

    1990-01-01

    The BERLIN RNA DATABANK as of Dezember 31, 1989, contains a total of 667 sequences of 5S rRNAs or their genes, which is an increase of 114 new sequence entries over the last compilation (1). It covers sequences from 44 archaebacteria, 267 eubacteria, 20 plastids, 6 mitochondria, 319 eukaryotes and 11 eukaryotic pseudogenes. The hardcopy shows only the list (Table 1) of those organisms whose sequences have been determined. The BERLIN RNA DATABANK uses the format of the EMBL Nucleotide Sequence Data Library complemented by a Sequence Alignment (SA) field including secondary structure information. PMID:1692116

  19. Emergent Biosynthetic Capacity in Simple Microbial Communities

    PubMed Central

    Chiu, Hsuan-Chao; Levy, Roie; Borenstein, Elhanan

    2014-01-01

    Microbes have an astonishing capacity to transform their environments. Yet, the metabolic capacity of a single species is limited and the vast majority of microorganisms form complex communities and join forces to exhibit capabilities far exceeding those achieved by any single species. Such enhanced metabolic capacities represent a promising route to many medical, environmental, and industrial applications and call for the development of a predictive, systems-level understanding of synergistic microbial capacity. Here we present a comprehensive computational framework, integrating high-quality metabolic models of multiple species, temporal dynamics, and flux variability analysis, to study the metabolic capacity and dynamics of simple two-species microbial ecosystems. We specifically focus on detecting emergent biosynthetic capacity – instances in which a community growing on some medium produces and secretes metabolites that are not secreted by any member species when growing in isolation on that same medium. Using this framework to model a large collection of two-species communities on multiple media, we demonstrate that emergent biosynthetic capacity is highly prevalent. We identify commonly observed emergent metabolites and metabolic reprogramming patterns, characterizing typical mechanisms of emergent capacity. We further find that emergent secretion tends to occur in two waves, the first as soon as the two organisms are introduced, and the second when the medium is depleted and nutrients become limited. Finally, aiming to identify global community determinants of emergent capacity, we find a marked association between the level of emergent biosynthetic capacity and the functional/phylogenetic distance between community members. Specifically, we demonstrate a “Goldilocks” principle, where high levels of emergent capacity are observed when the species comprising the community are functionally neither too close, nor too distant. Taken together, our results

  20. Regulation of Arabidopsis thaliana 5S rRNA Genes.

    PubMed

    Vaillant, Isabelle; Tutois, Sylvie; Cuvillier, Claudine; Schubert, Ingo; Tourmente, Sylvette

    2007-05-01

    The Arabidopsis thaliana genome comprises around 1,000 copies of 5S rRNA genes encoding both major and minor 5S rRNAs. In mature wild-type leaves, the minor 5S rRNA genes are silent. Using different mutants of DNA methyltransferases (met1, cmt3 and met1 cmt3), components of the RNAi pathway (ago4) or post-translational histone modifier (hda6/sil1), we show that the corresponding proteins are needed to maintain proper methylation patterns at heterochromatic 5S rDNA repeats. Using reverse transcription-PCR and cytological analyses, we report that a decrease of 5S rDNA methylation at CG or CNG sites in these mutants leads to the release of 5S rRNA gene silencing which occurred without detectable changes of the 5S rDNA chromatin structure. In spite of severely reduced DNA methylation, the met1 cmt3 double mutant revealed no increase in minor 5S rRNA transcripts. Furthermore, the release of silencing of minor 5S rDNAs can be achieved without increased formation of euchromatic loops by 5S rDNA, and is independent from the global heterochromatin content. Additionally, fluorescence in situ hybridization with centromeric 180 bp repeats confirmed that these highly repetitive sequences, in spite of their elevated transcriptional activity in the DNA methyltransferase mutants (met1, cmt3 and met1 cmt3), remain within chromocenters of the mutant nuclei. PMID:17412735

  1. Cyanobacterial toxins: biosynthetic routes and evolutionary roots.

    PubMed

    Dittmann, Elke; Fewer, David P; Neilan, Brett A

    2013-01-01

    Cyanobacteria produce an unparalleled variety of toxins that can cause severe health problems or even death in humans, and wild or domestic animals. In the last decade, biosynthetic pathways have been assigned to the majority of the known toxin families. This review summarizes current knowledge about the enzymatic basis for the production of the hepatotoxins microcystin and nodularin, the cytotoxin cylindrospermopsin, the neurotoxins anatoxin and saxitoxin, and the dermatotoxin lyngbyatoxin. Elucidation of the biosynthetic pathways of the toxins has paved the way for the development of molecular techniques for the detection and quantification of the producing cyanobacteria in different environments. Phylogenetic analyses of related clusters from a large number of strains has also allowed for the reconstruction of the evolutionary scenarios that have led to the emergence, diversification, and loss of such gene clusters in different strains and genera of cyanobacteria. Advances in the understanding of toxin biosynthesis and evolution have provided new methods for drinking-water quality control and may inspire the development of techniques for the management of bloom formation in the future. PMID:23051004

  2. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    NASA Technical Reports Server (NTRS)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  3. Mouse Oocytes Transcribe Injected Xenopus 5S RNA Gene

    PubMed Central

    Brinster, Ralph L.; Chen, Howard Y.; Trumbauer, Myrna E.

    2016-01-01

    Transcripts produced after injection of the Xenopus 5S RNA gene into oocyte germinal vesicles of mice migrate electrophoretically with the 5S RNA marker, an indication that the gene is transcribed and processed with considerable accuracy, Approximately two 5S RNA molecules are transcribed per gene per hour. This system may be useful in studying DNA processing and gene regulation by the mammalian ovum and might be modified to allow permanent incorporation of specific genes into mice. PMID:7194505

  4. Flavoenzymes: Versatile Catalysts in Biosynthetic Pathways

    PubMed Central

    Walsh, Christopher T.; Wencewicz, Timothy A.

    2012-01-01

    Riboflavin-based coenzymes, tightly bound to enzymes catalyzing substrate oxidations and reductions, enable an enormous range of chemical transformations in biosynthetic pathways. Flavoenzymes catalyze substrate oxidations involving amine and alcohol oxidations and desaturations to olefins, the latter setting up Diels-Alder cyclizations in lovastatin and solanapyrone biosyntheses. Both C4a and N5 of the flavin coenzymes are sites for covalent adduct formation. For example, the reactivity of dihydroflavins with molecular oxygen leads to flavin-4a-OOH adducts which then carry out a diverse range of oxygen transfers, including Baeyer-Villiger type ring expansions, olefin epoxidations, halogenations via transient HOCl generation, and an oxidative Favorskii rerrangement during enterocin assembly. PMID:23051833

  5. A C35 Carotenoid Biosynthetic Pathway

    PubMed Central

    Umeno, Daisuke; Arnold, Frances H.

    2003-01-01

    Upon coexpression with Erwinia geranylgeranyldiphosphate (GGDP) synthase in Escherichia coli, C30 carotenoid synthase CrtM from Staphylococcus aureus produces novel carotenoids with the asymmetrical C35 backbone. The products of condensation of farnesyldiphosphate and GDP, C35 structures comprise 40 to 60% of total carotenoid accumulated. Carotene desaturases and carotene cyclases from C40 or C30 pathways accepted and converted the C35 substrate, thus creating a C35 carotenoid biosynthetic pathway in E. coli. Directed evolution to modulate desaturase step number, together with combinatorial expression of the desaturase variants with lycopene cyclases, allowed us to produce at least 10 compounds not previously described. This result highlights the plastic and expansible nature of carotenoid pathways and illustrates how combinatorial biosynthesis coupled with directed evolution can rapidly access diverse chemical structures. PMID:12788765

  6. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  7. 5SRNAdb: an information resource for 5S ribosomal RNAs

    PubMed Central

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A.; Karlowski, Wojciech M.

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA–protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  8. 5S RNA sequence from the Philosamia silkworm: evidence for variable evolutionary rates in insect 5S RNA.

    PubMed Central

    Xian-Rong, G; Nicoghosian, K; Cedergren, R J

    1982-01-01

    The primary structure of 5S RNA isolated from the posterior silkgland of Philosamia cynthia ricini was determined using three in vitro labelling techniques. The derived sequence consists of 119 nucleotides and can be folded into the secondary structure model proposed for eukaryotic 5S RNAs. This 5S RNA differs from the Bombyx mori molecule in 9 positions and from the Drosophila melanogaster sequence in 14 positions. The comparison of evolutionary rates in insect 5S RNA with inferred rates in other eukaryotic phyla leads to the conclusion that 5S RNA evolution is not constant in different eukaryotic branches, a condition which must be taken into account in phylogenetic tree constructions. Images PMID:7145713

  9. [Organization of 5S ribosomal DNA of Melitaea trivia].

    PubMed

    Cherevatov, O V; Volkov, R A

    2011-01-01

    Two length variants of 5S rDNA repeated units were detected in the genome of East European butterfly Melitaea trivia. Both repeat variants contain the 5S rRNA coding region of the same length of 120 bp, but possess the intergenic spacer region (IGS) of different size, 78 and 125 bp, respectively. The level of sequence similarity between the two 5S rDNA variants amounts to 43.9-45.5% in the IGS, whereas the coding region appears to be more conservative. In the IGS, microsatellite sequence motives were found; amplification of these motives could be involved in the evolution of the 5S rDNA. PMID:21574431

  10. Evolution-guided optimization of biosynthetic pathways

    PubMed Central

    Raman, Srivatsan; Rogers, Jameson K.; Taylor, Noah D.; Church, George M.

    2014-01-01

    Engineering biosynthetic pathways for chemical production requires extensive optimization of the host cellular metabolic machinery. Because it is challenging to specify a priori an optimal design, metabolic engineers often need to construct and evaluate a large number of variants of the pathway. We report a general strategy that combines targeted genome-wide mutagenesis to generate pathway variants with evolution to enrich for rare high producers. We convert the intracellular presence of the target chemical into a fitness advantage for the cell by using a sensor domain responsive to the chemical to control a reporter gene necessary for survival under selective conditions. Because artificial selection tends to amplify unproductive cheaters, we devised a negative selection scheme to eliminate cheaters while preserving library diversity. This scheme allows us to perform multiple rounds of evolution (addressing ∼109 cells per round) with minimal carryover of cheaters after each round. Based on candidate genes identified by flux balance analysis, we used targeted genome-wide mutagenesis to vary the expression of pathway genes involved in the production of naringenin and glucaric acid. Through up to four rounds of evolution, we increased production of naringenin and glucaric acid by 36- and 22-fold, respectively. Naringenin production (61 mg/L) from glucose was more than double the previous highest titer reported. Whole-genome sequencing of evolved strains revealed additional untargeted mutations that likely benefit production, suggesting new routes for optimization. PMID:25453111

  11. Biosynthetic Studies of Aziridine Formation in Azicemicins

    PubMed Central

    Ogasawara, Yasushi; Liu, Hung-wen

    2009-01-01

    The azicemicins, which are angucycline-type antibiotics produced by the actinomycete, Kibdelosporangium sp. MJ126-NF4, contain an aziridine ring attached to the polyketide core. Feeding experiments using [1-13C]acetate or [1,2-13C2] acetate indicated that the angucycline skeleton is biosynthesized by a type II polyketide synthase. Isotope-tracer experiments using deuterium-labeled amino acids revealed that aspartic acid is the precursor of the aziridine moiety. Subsequent cloning and sequencing efforts led to the identification of the azicemicin (azic) gene cluster spanning ~50 kbp. The cluster harbors genes typical for type II polyketide synthesis. Also contained in the cluster are genes for two adenylyl transferases, a decarboxylase, an additional acyl carrier protein (ACP), and several oxygenases. On the basis of the assigned functions of these genes, a possible pathway for aziridine ring formation in the azecimicins can now be proposed. To obtain support for the proposed biosynthetic pathway, two genes encoding adenylyltransferases were overexpressed and the resulting proteins were purified. Enzyme assays showed that one of the adenylyltransferases specifically recognizes aspartic acid, providing strong evidence, in addition to the feeding experiments, that aspartate is the precursor of the aziridine moiety. The results reported herein set the stage for future biochemical studies of aziridine biosynthesis and assembly. PMID:19928906

  12. Biosynthetic porphyrins and the origin of photosynthesis

    NASA Technical Reports Server (NTRS)

    Mauzerall, D.; Ley, A.; Mercer-Smith, J. A.

    1986-01-01

    Since the prebiotic atmosphere was anaerobic, if not reducing, a useful function of primordial photosynthesis would have been to photooxidize reduced substrates such as Fe(+2), S(-2) or reduced organic molecules and to emit hydrogen. Experiments have shown that the early biogenic pigments uroporphyrin and coproporphyrin do photooxidize organic compounds and emit hydrogen in the presence of a platinum catalyst. These experiments were carried out in dilute aqueous solution near neutral pH under anaerobic atmosphere, and quantum yields near 10-2 were obtained. Thus relevant prebiotic conditions were maintained. Rather then to further optimize conditions, attempts were made to replace the platinum catalyst by a more prebiotically suitable catalyst. Trials with an Fe4S4(SR)4 cluster, in analogy to the present hydrogenase and nitrogenase, were not successful. However, experiments using cobalt complexes to catalyze the formation of hydrogen are promising. In analogy with biological photosynthetic systems which group pigments, electron transfer molecules and enzymes in clusters for efficiency, it was found that binding the biogenic porphyrins to the polyvinyl alcohol used to support the platinum catalyst did increase the quantum yield of the reaction. It was also found that ultraviolet light can serve to photo-oxidize porphyrinogens to porphyrins under anaerobic conditions. Thus the formation of the colorless porphyriogens by the extraordinarily simple biosynthetic pathway would not be a problem because of the prevalence of UV light in the prebiotic, anoxic atmosphere.

  13. Structures of Bacterial Biosynthetic Arginine Decarboxylases

    SciTech Connect

    F Forouhar; S Lew; J Seetharaman; R Xiao; T Acton; G Montelione; L Tong

    2011-12-31

    Biosynthetic arginine decarboxylase (ADC; also known as SpeA) plays an important role in the biosynthesis of polyamines from arginine in bacteria and plants. SpeA is a pyridoxal-5'-phosphate (PLP)-dependent enzyme and shares weak sequence homology with several other PLP-dependent decarboxylases. Here, the crystal structure of PLP-bound SpeA from Campylobacter jejuni is reported at 3.0 {angstrom} resolution and that of Escherichia coli SpeA in complex with a sulfate ion is reported at 3.1 {angstrom} resolution. The structure of the SpeA monomer contains two large domains, an N-terminal TIM-barrel domain followed by a {beta}-sandwich domain, as well as two smaller helical domains. The TIM-barrel and {beta}-sandwich domains share structural homology with several other PLP-dependent decarboxylases, even though the sequence conservation among these enzymes is less than 25%. A similar tetramer is observed for both C. jejuni and E. coli SpeA, composed of two dimers of tightly associated monomers. The active site of SpeA is located at the interface of this dimer and is formed by residues from the TIM-barrel domain of one monomer and a highly conserved loop in the {beta}-sandwich domain of the other monomer. The PLP cofactor is recognized by hydrogen-bonding, {pi}-stacking and van der Waals interactions.

  14. Deciphering the late biosynthetic steps of antimalarial compound FR-900098.

    PubMed

    Johannes, Tyler W; DeSieno, Matthew A; Griffin, Benjamin M; Thomas, Paul M; Kelleher, Neil L; Metcalf, William W; Zhao, Huimin

    2010-01-29

    FR-900098 is a potent chemotherapeutic agent for the treatment of malaria. Here we report the heterologous production of this compound in Escherichia coli by reconstructing the entire biosynthetic pathway using a three-plasmid system. Based on this system, whole-cell feeding assays in combination with in vitro enzymatic activity assays reveal an unusual functional role of nucleotide conjugation and lead to the complete elucidation of the previously unassigned late biosynthetic steps. These studies also suggest a biosynthetic route to a second phosphonate antibiotic, FR-33289. A thorough understanding of the FR-900098 biosynthetic pathway now opens possibilities for metabolic engineering in E. coli to increase production of the antimalarial antibiotic and combinatorial biosynthesis to generate novel derivatives of FR-900098. PMID:20142041

  15. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  16. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  17. Analyzing Digital Library Initiatives: 5S Theory Perspective

    ERIC Educational Resources Information Center

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko

    2015-01-01

    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  18. Biosynthetic pathway of terpenoid indole alkaloids in Catharanthus roseus.

    PubMed

    Zhu, Xiaoxuan; Zeng, Xinyi; Sun, Chao; Chen, Shilin

    2014-09-01

    Catharanthus roseus is one of the most extensively investigated medicinal plants, which can produce more than 130 alkaloids, including the powerful antitumor drugs vinblastine and vincristine. Here we review the recent advances in the biosynthetic pathway of terpenoid indole alkaloids (TIAs) in C. roseus, and the identification and characterization of the corresponding enzymes involved in this pathway. Strictosidine is the central intermediate in the biosynthesis of different TIAs, which is formed by the condensation of secologanin and tryptamine. Secologanin is derived from terpenoid (isoprenoid) biosynthetic pathway, while tryptamine is derived from indole biosynthetic pathway. Then various specific end products are produced by different routes during downstream process. Although many genes and corresponding enzymes have been characterized in this pathway, our knowledge on the whole TIA biosynthetic pathway still remains largely unknown up to date. Full elucidation of TIA biosynthetic pathway is an important prerequisite to understand the regulation of the TIA biosynthesis in the medicinal plant and to produce valuable TIAs by synthetic biological technology. PMID:25159992

  19. Ochratoxin A Producing Fungi, Biosynthetic Pathway and Regulatory Mechanisms.

    PubMed

    Wang, Yan; Wang, Liuqing; Liu, Fei; Wang, Qi; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhao, Yueju; Liu, Yang

    2016-03-01

    Ochratoxin A (OTA), mainly produced by Aspergillus and Penicillum species, is one of the most important mycotoxin contaminants in agricultural products. It is detrimental to human health because of its nephrotoxicity, hepatotoxicity, carcinogenicity, teratogenicity, and immunosuppression. OTA structurally consists of adihydrocoumarin moiety linked with l-phenylalanine via an amide bond. OTA biosynthesis has been putatively hypothesized, although several contradictions exist on some processes of the biosynthetic pathway. We discuss recent information on molecular studies of OTA biosynthesis despite insufficient genetic background in detail. Accordingly, genetic regulation has also been explored with regard to the interaction between the regulators and the environmental factors. In this review, we focus on three aspects of OTA: OTA-producing strains, OTA biosynthetic pathway and the regulation mechanisms of OTA production. This can pave the way to assist in protecting food and feed from OTA contamination by understanding OTA biosynthetic pathway and regulatory mechanisms. PMID:27007394

  20. Ochratoxin A Producing Fungi, Biosynthetic Pathway and Regulatory Mechanisms

    PubMed Central

    Wang, Yan; Wang, Liuqing; Liu, Fei; Wang, Qi; Selvaraj, Jonathan Nimal; Xing, Fuguo; Zhao, Yueju; Liu, Yang

    2016-01-01

    Ochratoxin A (OTA), mainly produced by Aspergillus and Penicillum species, is one of the most important mycotoxin contaminants in agricultural products. It is detrimental to human health because of its nephrotoxicity, hepatotoxicity, carcinogenicity, teratogenicity, and immunosuppression. OTA structurally consists of adihydrocoumarin moiety linked with l-phenylalanine via an amide bond. OTA biosynthesis has been putatively hypothesized, although several contradictions exist on some processes of the biosynthetic pathway. We discuss recent information on molecular studies of OTA biosynthesis despite insufficient genetic background in detail. Accordingly, genetic regulation has also been explored with regard to the interaction between the regulators and the environmental factors. In this review, we focus on three aspects of OTA: OTA-producing strains, OTA biosynthetic pathway and the regulation mechanisms of OTA production. This can pave the way to assist in protecting food and feed from OTA contamination by understanding OTA biosynthetic pathway and regulatory mechanisms. PMID:27007394

  1. Physical studies of 5S RNA variants at position 66.

    PubMed Central

    Zhang, P; Popieniek, P; Moore, P B

    1989-01-01

    Two variants of the 5S RNA of E. coli have been examined by imino proton NMR spectroscopy, one of them a deletion of A66 (Christiansen, J., Douthwaite, S.R., Christensen, A. and Garrett, R.A. (1985) EMBO J. 4, 1019-1024) and the other a replacement of A66 with a C (Goringer, H.U. and Wagner, R. (1986) Biol. Chem. Hoppe-Seyler 367, 769-780). Both are of interest because the role the bulged A in helix II of 5S RNA is supposed to play in interactions with ribosomal protein L18. The data show that the structural perturbations that result from these mutations are minimal, and assign the resonances of some of the imino protons around position 66. Some mutations at or near position 66 greatly reduce the L18-dependent increase in the circular dichroism of 5S RNA at 267 nm first observed by Bear and coworkers (Bear, D.G., Schleich, T., Noller, H.F. and Garrett, R.A. (1977) Nucl. Acids Res. 4, 2511-2526). PMID:2479908

  2. Variation in the Trichothecene Mycotoxin Biosynthetic Gene Cluster in Fusarium

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Trichothecene mycotoxins are produced by some plant pathogenic species of the fungus Fusarium and can contribute to its virulence on some plants. In Fusarium graminearum and F. sporotrichioides trichothecene biosynthetic enzymes are encoded at three loci: the single-gene TRI101 locus; the two-gene ...

  3. Evaluation of Biosynthetic Pathway and Engineered Biosynthesis of Alkaloids.

    PubMed

    Kishimoto, Shinji; Sato, Michio; Tsunematsu, Yuta; Watanabe, Kenji

    2016-01-01

    Varieties of alkaloids are known to be produced by various organisms, including bacteria, fungi and plants, as secondary metabolites that exhibit useful bioactivities. However, understanding of how those metabolites are biosynthesized still remains limited, because most of these compounds are isolated from plants and at a trace level of production. In this review, we focus on recent efforts in identifying the genes responsible for the biosynthesis of those nitrogen-containing natural products and elucidating the mechanisms involved in the biosynthetic processes. The alkaloids discussed in this review are ditryptophenaline (dimeric diketopiperazine alkaloid), saframycin (tetrahydroisoquinoline alkaloid), strictosidine (monoterpene indole alkaloid), ergotamine (ergot alkaloid) and opiates (benzylisoquinoline and morphinan alkaloid). This review also discusses the engineered biosynthesis of these compounds, primarily through heterologous reconstitution of target biosynthetic pathways in suitable hosts, such as Escherichia coli, Saccharomyces cerevisiae and Aspergillus nidulans. Those heterologous biosynthetic systems can be used to confirm the functions of the isolated genes, economically scale up the production of the alkaloids for commercial distributions and engineer the biosynthetic pathways to produce valuable analogs of the alkaloids. In particular, extensive involvement of oxidation reactions catalyzed by oxidoreductases, such as cytochrome P450s, during the secondary metabolite biosynthesis is discussed in details. PMID:27548127

  4. Natural Product Biosynthetic Gene Diversity in Geographically Distinct Soil Microbiomes

    PubMed Central

    Reddy, Boojala Vijay B.; Kallifidas, Dimitris; Kim, Jeffrey H.; Charlop-Powers, Zachary; Feng, Zhiyang

    2012-01-01

    The number of bacterial species estimated to exist on Earth has increased dramatically in recent years. This newly recognized species diversity has raised the possibility that bacterial natural product biosynthetic diversity has also been significantly underestimated by previous culture-based studies. Here, we compare 454-pyrosequenced nonribosomal peptide adenylation domain, type I polyketide ketosynthase domain, and type II polyketide ketosynthase alpha gene fragments amplified from cosmid libraries constructed using DNA isolated from three different arid soils. While 16S rRNA gene sequence analysis indicates these cloned metagenomes contain DNA from similar distributions of major bacterial phyla, we found that they contain almost completely distinct collections of secondary metabolite biosynthetic gene sequences. When grouped at 85% identity, only 1.5% of the adenylation domain, 1.2% of the ketosynthase, and 9.3% of the ketosynthase alpha sequence clusters contained sequences from all three metagenomes. Although there is unlikely to be a simple correlation between biosynthetic gene sequence diversity and the diversity of metabolites encoded by the gene clusters in which these genes reside, our analysis further suggests that sequences in one soil metagenome are so distantly related to sequences in another metagenome that they are, in many cases, likely to arise from functionally distinct gene clusters. The marked differences observed among collections of biosynthetic genes found in even ecologically similar environments suggest that prokaryotic natural product biosynthesis diversity is, like bacterial species diversity, potentially much larger than appreciated from culture-based studies. PMID:22427492

  5. Regulation of Flavonoid Biosynthetic Genes in Germinating Arabidopsis Seedlings.

    PubMed Central

    Kubasek, WL; Shirley, BW; McKillop, A; Goodman, HM; Briggs, W; Ausubel, FM

    1992-01-01

    Many higher plants, including Arabidopsis, transiently display purple anthocyanin pigments just after seed germination. We observed that steady state levels of mRNAs encoded by four flavonoid biosynthetic genes, PAL1 (encoding phenylalanine ammonia-lyase 1), CHS (encoding chalcone synthase), CHI (encoding chalcone isomerase), and DFR (encoding dihydroflavonol reductase), were temporally regulated, peaking in 3-day-old seedlings grown in continuous white light. Except for the case of PAL1 mRNA, mRNA levels for these flavonoid genes were very low in seedlings grown in darkness. Light induction studies using seedlings grown in darkness showed that PAL1 mRNA began to accumulate before CHS and CHI mRNAs, which, in turn, began to accumulate before DFR mRNA. This order of induction is the same as the order of the biosynthetic steps in flavonoid biosynthesis. Our results suggest that the flavonoid biosynthetic pathway is coordinately regulated by a developmental timing mechanism during germination. Blue light and UVB light induction experiments using red light- and dark-grown seedlings showed that the flavonoid biosynthetic genes are induced most effectively by UVB light and that blue light induction is mediated by a specific blue light receptor. PMID:12297632

  6. Discovery of the lomaiviticin biosynthetic gene cluster in Salinispora pacifica

    PubMed Central

    Janso, Jeffrey E.; Haltli, Brad A.; Eustáquio, Alessandra S.; Kulowski, Kerry; Waldman, Abraham J.; Zha, Li; Nakamura, Hitomi; Bernan, Valerie S.; He, Haiyin; Carter, Guy T.; Koehn, Frank E.; Balskus, Emily P.

    2014-01-01

    The lomaiviticins are a family of cytotoxic marine natural products that have captured the attention of both synthetic and biological chemists due to their intricate molecular scaffolds and potent biological activities. Here we describe the identification of the gene cluster responsible for lomaiviticin biosynthesis in Salinispora pacifica strains DPJ-0016 and DPJ-0019 using a combination of molecular approaches and genome sequencing. The link between the lom gene cluster and lomaiviticin production was confirmed using bacterial genetics, and subsequent analysis and annotation of this cluster revealed the biosynthetic basis for the core polyketide scaffold. Additionally, we have used comparative genomics to identify candidate enzymes for several unusual tailoring events, including diazo formation and oxidative dimerization. These findings will allow further elucidation of the biosynthetic logic of lomaiviticin assembly and provide useful molecular tools for application in biocatalysis and synthetic biology. PMID:25045187

  7. Identification of the Scopularide Biosynthetic Gene Cluster in Scopulariopsis brevicaulis.

    PubMed

    Lukassen, Mie Bech; Saei, Wagma; Sondergaard, Teis Esben; Tamminen, Anu; Kumar, Abhishek; Kempken, Frank; Wiebe, Marilyn G; Sørensen, Jens Laurids

    2015-07-01

    Scopularide A is a promising potent anticancer lipopeptide isolated from a marine derived Scopulariopsis brevicaulis strain. The compound consists of a reduced carbon chain (3-hydroxy-methyldecanoyl) attached to five amino acids (glycine, l-valine, d-leucine, l-alanine, and l-phenylalanine). Using the newly sequenced S. brevicaulis genome we were able to identify the putative biosynthetic gene cluster using genetic information from the structurally related emericellamide A from Aspergillus nidulans and W493-B from Fusarium pseudograminearum. The scopularide A gene cluster includes a nonribosomal peptide synthetase (NRPS1), a polyketide synthase (PKS2), a CoA ligase, an acyltransferase, and a transcription factor. Homologous recombination was low in S. brevicaulis so the local transcription factor was integrated randomly under a constitutive promoter, which led to a three to four-fold increase in scopularide A production. This indirectly verifies the identity of the proposed biosynthetic gene cluster. PMID:26184239

  8. Identification of the Scopularide Biosynthetic Gene Cluster in Scopulariopsis brevicaulis

    PubMed Central

    Lukassen, Mie Bech; Saei, Wagma; Sondergaard, Teis Esben; Tamminen, Anu; Kumar, Abhishek; Kempken, Frank; Wiebe, Marilyn G.; Sørensen, Jens Laurids

    2015-01-01

    Scopularide A is a promising potent anticancer lipopeptide isolated from a marine derived Scopulariopsis brevicaulis strain. The compound consists of a reduced carbon chain (3-hydroxy-methyldecanoyl) attached to five amino acids (glycine, l-valine, d-leucine, l-alanine, and l-phenylalanine). Using the newly sequenced S. brevicaulis genome we were able to identify the putative biosynthetic gene cluster using genetic information from the structurally related emericellamide A from Aspergillus nidulans and W493-B from Fusarium pseudograminearum. The scopularide A gene cluster includes a nonribosomal peptide synthetase (NRPS1), a polyketide synthase (PKS2), a CoA ligase, an acyltransferase, and a transcription factor. Homologous recombination was low in S. brevicaulis so the local transcription factor was integrated randomly under a constitutive promoter, which led to a three to four-fold increase in scopularide A production. This indirectly verifies the identity of the proposed biosynthetic gene cluster. PMID:26184239

  9. Accessing natural product biosynthetic processes by mass spectrometry.

    PubMed

    Bumpus, Stefanie B; Kelleher, Neil L

    2008-10-01

    Two important classes of natural products are made by nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs). With most biosynthetic intermediates covalently tethered during biogenesis, protein mass spectrometry (MS) has proven invaluable for their interrogation. New mass spectrometric assay formats (such as selective cofactor ejection and proteomics style LC-MS) are showcased here in the context of functional insights into new breeds of NRPS/PKS enzymes, including the first characterization of an 'iterative' PKS, the biosynthesis of the enediyne antitumor antibiotics, the study of a new strategy for PKS initiation via a GNAT-like mechanism, and the analysis of branching strategies in the so-called 'AT-less' NRPS/PKS hybrid systems. The future of MS analysis of NRPS and PKS biosynthetic pathways lies in adoption and development of methods that continue bridging enzymology with proteomics as both fields continue their post-genomic acceleration. PMID:18706516

  10. Biosynthetic Modularity Rules in the Bisintercalator Family of Antitumor Compounds

    PubMed Central

    Fernández, Javier; Marín, Laura; Álvarez-Alonso, Raquel; Redondo, Saúl; Carvajal, Juan; Villamizar, Germán; Villar, Claudio J.; Lombó, Felipe

    2014-01-01

    Diverse actinomycetes produce a family of structurally and biosynthetically related non-ribosomal peptide compounds which belong to the chromodepsipeptide family. These compounds act as bisintercalators into the DNA helix. They give rise to antitumor, antiparasitic, antibacterial and antiviral bioactivities. These compounds show a high degree of conserved modularity (chromophores, number and type of amino acids). This modularity and their high sequence similarities at the genetic level imply a common biosynthetic origin for these pathways. Here, we describe insights about rules governing this modular biosynthesis, taking advantage of the fact that nowadays five of these gene clusters have been made public (thiocoraline, triostin, SW-163 and echinomycin/quinomycin). This modularity has potential application for designing and producing novel genetic engineered derivatives, as well as for developing new chemical synthesis strategies. These would facilitate their clinical development. PMID:24821625

  11. Heterologous Expression and Manipulation of Three Tetracycline Biosynthetic Pathways**

    PubMed Central

    Wang, Peng; Kim, Woncheol; Pickens, Lauren B.; Gao, Xue; Tang, Yi

    2014-01-01

    Three and one: Three tetracycline biosynthetic pathways have been overexpressed and manipulated in heterologous host Streptomyces lividans K4-114. New tetracycline modifying enzymes have been identified through a series of gene inactivation and intermediate characterization. The collection of newly discovered tailoring enzyme and the heterologous platform will promote our understanding of tetracycline biosynthesis, as well as our performance to engineer tetracycline biosynthesis in an efficient manner. PMID:23024027

  12. Endoplasmic reticulum localization and activity of maize auxin biosynthetic enzymes.

    PubMed

    Kriechbaumer, Verena; Seo, Hyesu; Park, Woong June; Hawes, Chris

    2015-09-01

    Auxin is a major growth hormone in plants and the first plant hormone to be discovered and studied. Active research over >60 years has shed light on many of the molecular mechanisms of its action including transport, perception, signal transduction, and a variety of biosynthetic pathways in various species, tissues, and developmental stages. The complexity and redundancy of the auxin biosynthetic network and enzymes involved raises the question of how such a system, producing such a potent agent as auxin, can be appropriately controlled at all. Here it is shown that maize auxin biosynthesis takes place in microsomal as well as cytosolic cellular fractions from maize seedlings. Most interestingly, a set of enzymes shown to be involved in auxin biosynthesis via their activity and/or mutant phenotypes and catalysing adjacent steps in YUCCA-dependent biosynthesis are localized to the endoplasmic reticulum (ER). Positioning of auxin biosynthetic enzymes at the ER could be necessary to bring auxin biosynthesis in closer proximity to ER-localized factors for transport, conjugation, and signalling, and allow for an additional level of regulation by subcellular compartmentation of auxin action. Furthermore, it might provide a link to ethylene action and be a factor in hormonal cross-talk as all five ethylene receptors are ER localized. PMID:26139824

  13. Biosynthetic Gene Cluster for the Polyenoyltetramic Acid α-Lipomycin

    PubMed Central

    Bihlmaier, C.; Welle, E.; Hofmann, C.; Welzel, K.; Vente, A.; Breitling, E.; Müller, M.; Glaser, S.; Bechthold, A.

    2006-01-01

    The gram-positive bacterium Streptomyces aureofaciens Tü117 produces the acyclic polyene antibiotic α-lipomycin. The entire biosynthetic gene cluster (lip gene cluster) was cloned and characterized. DNA sequence analysis of a 74-kb region revealed the presence of 28 complete open reading frames (ORFs), 22 of them belonging to the biosynthetic gene cluster. Central to the cluster is a polyketide synthase locus that encodes an eight-module system comprised of four multifunctional proteins. In addition, one ORF shows homology to those for nonribosomal peptide synthetases, indicating that α-lipomycin belongs to the classification of hybrid peptide-polyketide natural products. Furthermore, the lip cluster includes genes responsible for the formation and attachment of d-digitoxose as well as ORFs that resemble those for putative regulatory and export functions. We generated biosynthetic mutants by insertional gene inactivation. By analysis of culture extracts of these mutants, we could prove that, indeed, the genes involved in the biosynthesis of lipomycin had been cloned, and additionally we gained insight into an unusual biosynthesis pathway. PMID:16723573

  14. Biosynthetic Chlorination of the Piperazate Residue in Kutzneride Biosynthesis by KthP

    PubMed Central

    2011-01-01

    Kutznerides 2 and 8 of the cyclic hexadepsipeptide family of antifungal natural products from the soil actinomycete Kutzneria sp. 744 contain two sets of chlorinated residues, a 6,7-dichlorohexahydropyrroloindole moiety derived from dichlorotryptophan and a 5-chloropiperazate moiety, as well as a methylcyclopropylglycine residue that may arise from isoleucine via a cryptic chlorination pathway. Previous studies identified KtzD, KtzQ, and KtzR as three halogenases in the kutzneride pathway but left no candidate for installing the C5 chlorine on piperazate. On the basis of analysis of the complete genome sequence of Kutzneria, we now identify a fourth halogenase in the pathway whose gene is separated from the defined kutzneride cluster by 12 open reading frames. KthP (kutzneride halogenase for piperazate) is a mononuclear nonheme iron halogenase that acts on the piperazyl ring tethered by a thioester linkage to the holo forms of thiolation domains. MS analysis of the protein-bound product confirmed chlorination of the piperazate framework from the (3S)- but not the (3R)-piperazyl-S-pantetheinyl thiolation proteins. After thioesterase-mediated release, nuclear magnetic resonance was used to assign the free imino acid as (3S,5S)-5-chloropiperazate, distinct from the 3S,5R stereoisomer reported in the mature kutznerides. These results demonstrate that a fourth halogenase, KthP, is active in the kutzneride biosynthetic pathway and suggest further processing of the (3S,5S)-5-chloropiperazate during subsequent incorporation into the kutzneride depsipeptide frameworks. PMID:21648411

  15. Biosynthetic chlorination of the piperazate residue in kutzneride biosynthesis by KthP.

    PubMed

    Jiang, Wei; Heemstra, John R; Forseth, Ry R; Neumann, Christopher S; Manaviazar, Soraya; Schroeder, Frank C; Hale, Karl J; Walsh, Christopher T

    2011-07-12

    Kutznerides 2 and 8 of the cyclic hexadepsipeptide family of antifungal natural products from the soil actinomycete Kutzneria sp. 744 contain two sets of chlorinated residues, a 6,7-dichlorohexahydropyrroloindole moiety derived from dichlorotryptophan and a 5-chloropiperazate moiety, as well as a methylcyclopropylglycine residue that may arise from isoleucine via a cryptic chlorination pathway. Previous studies identified KtzD, KtzQ, and KtzR as three halogenases in the kutzneride pathway but left no candidate for installing the C5 chlorine on piperazate. On the basis of analysis of the complete genome sequence of Kutzneria, we now identify a fourth halogenase in the pathway whose gene is separated from the defined kutzneride cluster by 12 open reading frames. KthP (kutzneride halogenase for piperazate) is a mononuclear nonheme iron halogenase that acts on the piperazyl ring tethered by a thioester linkage to the holo forms of thiolation domains. MS analysis of the protein-bound product confirmed chlorination of the piperazate framework from the (3S)- but not the (3R)-piperazyl-S-pantetheinyl thiolation proteins. After thioesterase-mediated release, nuclear magnetic resonance was used to assign the free imino acid as (3S,5S)-5-chloropiperazate, distinct from the 3S,5R stereoisomer reported in the mature kutznerides. These results demonstrate that a fourth halogenase, KthP, is active in the kutzneride biosynthetic pathway and suggest further processing of the (3S,5S)-5-chloropiperazate during subsequent incorporation into the kutzneride depsipeptide frameworks. PMID:21648411

  16. Diversity and abundance of phosphonate biosynthetic genes in nature

    PubMed Central

    Yu, Xiaomin; Doroghazi, James R.; Janga, Sarath C.; Zhang, Jun Kai; Circello, Benjamin; Griffin, Benjamin M.; Labeda, David P.; Metcalf, William W.

    2013-01-01

    Phosphonates, molecules containing direct carbon–phosphorus bonds, compose a structurally diverse class of natural products with interesting and useful biological properties. Although their synthesis in protozoa was discovered more than 50 y ago, the extent and diversity of phosphonate production in nature remains poorly characterized. The rearrangement of phosphoenolpyruvate (PEP) to phosphonopyruvate, catalyzed by the enzyme PEP mutase (PepM), is shared by the vast majority of known phosphonate biosynthetic pathways. Thus, the pepM gene can be used as a molecular marker to examine the occurrence and abundance of phosphonate-producing organisms. Based on the presence of this gene, phosphonate biosynthesis is common in microbes, with ∼5% of sequenced bacterial genomes and 7% of genome equivalents in metagenomic datasets carrying pepM homologs. Similarly, we detected the pepM gene in ∼5% of random actinomycete isolates. The pepM-containing gene neighborhoods from 25 of these isolates were cloned, sequenced, and compared with those found in sequenced genomes. PEP mutase sequence conservation is strongly correlated with conservation of other nearby genes, suggesting that the diversity of phosphonate biosynthetic pathways can be predicted by examining PEP mutase diversity. We used this approach to estimate the range of phosphonate biosynthetic pathways in nature, revealing dozens of discrete groups in pepM amplicons from local soils, whereas hundreds were observed in metagenomic datasets. Collectively, our analyses show that phosphonate biosynthesis is both diverse and relatively common in nature, suggesting that the role of phosphonate molecules in the biosphere may be more important than is often recognized. PMID:24297932

  17. Characterization of an orphan diterpenoid biosynthetic operon from Salinispora arenicola.

    PubMed

    Xu, Meimei; Hillwig, Matthew L; Lane, Amy L; Tiernan, Mollie S; Moore, Bradley S; Peters, Reuben J

    2014-09-26

    While more commonly associated with plants than microbes, diterpenoid natural products have been reported to have profound effects in marine microbe-microbe interactions. Intriguingly, the genome of the marine bacterium Salinispora arenicola CNS-205 contains a putative diterpenoid biosynthetic operon, terp1. Here recombinant expression studies are reported, indicating that this three-gene operon leads to the production of isopimara-8,15-dien-19-ol (4). Although 4 is not observed in pure cultures of S. arenicola, it is plausible that the terp1 operon is only expressed under certain physiologically relevant conditions such as in the presence of other marine organisms. PMID:25203741

  18. Characterization of an Orphan Diterpenoid Biosynthetic Operon from Salinispora arenicola

    PubMed Central

    2015-01-01

    While more commonly associated with plants than microbes, diterpenoid natural products have been reported to have profound effects in marine microbe–microbe interactions. Intriguingly, the genome of the marine bacterium Salinispora arenicola CNS-205 contains a putative diterpenoid biosynthetic operon, terp1. Here recombinant expression studies are reported, indicating that this three-gene operon leads to the production of isopimara-8,15-dien-19-ol (4). Although 4 is not observed in pure cultures of S. arenicola, it is plausible that the terp1 operon is only expressed under certain physiologically relevant conditions such as in the presence of other marine organisms. PMID:25203741

  19. Survey of volatile oxylipins and their biosynthetic precursors in bryophytes.

    PubMed

    Croisier, Emmanuel; Rempt, Martin; Pohnert, Georg

    2010-04-01

    Oxylipins are metabolites which are derived from the oxidative fragmentation of polyunsaturated fatty acids. These metabolites play central roles in plant hormonal regulation and defense. Here we survey the production of volatile oxylipins in bryophytes and report the production of a high structural variety of C5, C6, C8 and C9 volatiles of mosses. In liverworts and hornworts oxylipin production was not as pronounced as in the 23 screened mosses. A biosynthetic investigation revealed that both, C18 and C20 fatty acids serve as precursors for the volatile oxylipins that are mainly produced after mechanical wounding of the green tissue of mosses. PMID:20079505

  20. EXPANSION OF BISINDOLE BIOSYNTHETIC PATHWAYS BY COMBINATORIAL CONSTRUCTION

    PubMed Central

    Du, Yi-Ling; Ryan, Katherine S.

    2015-01-01

    Cladoniamides are indolotryptoline natural products that derive from indolocarbazole precursors. Here, we present a microbial platform to artificially redirect the cladoniamide pathway to generate unnatural bisindoles for drug discovery. Specifically, we target glycosyltransferase, halogenase, and oxidoreductase genes from the phylogenetically-related indolocarbazole rebeccamycin and staurosporine pathways. We generate a series of novel compounds, reveal details about the substrate specificities of a number of enzymes, and set the stage for future efforts to develop new catalysts and compounds by engineering of bisindole genes. The strategy for structural diversification we use here could furthermore be applied to other natural product families with known biosynthetic genes. PMID:25548949

  1. D5S351 and D5S1414 located at the spinal muscular atrophy critical region represent novel informative markers in the Iranian population

    PubMed Central

    Sedghi, Maryam; Vallian, Sadeq

    2015-01-01

    Spinal muscular atrophy (SMA) is a degenerative neuromuscular disease associated with progressive symmetric weakness and atrophy of the limb muscles. In view of the involvement of numerous point mutations and deletions associated with the disease, the application of polymorphic markers flanking the SMA critical region could be valuable in molecular diagnosis of the disease. In the present study, D5S351 and D5S1414 polymorphic markers located at the SMA critical region in the Iranian populations were characterized. Genotyping of the markers indicated the presence of six and nine different alleles for D5S351 and D5S1414, respectively. Haplotype frequency estimation in 25 trios families and 75 unrelated individuals indicated the presence of six informative haplotypes with frequency higher than 0.05 in the studied population. Furthermore, the D′ coefficient and the χ2 value for D5S351 and D5S1414 markers revealed the presence of linkage disequilibrium between the two markers in the Iranians. These data suggested that D5S351 and D5S1414 could be suggested as informative markers for linkage analysis and molecular diagnosis of SMA in the Iranian population. PMID:26693404

  2. Cloning and characterization of the biosynthetic gene cluster for kutznerides

    PubMed Central

    Fujimori, Danica Galonić; Hrvatin, Siniša; Neumann, Christopher S.; Strieker, Matthias; Marahiel, Mohamed A.; Walsh, Christopher T.

    2007-01-01

    Kutznerides, actinomycete-derived cyclic depsipetides, consist of six nonproteinogenic residues, including a highly oxygenated tricyclic hexahydropyrroloindole, a chlorinated piperazic acid, 2-(1-methylcyclopropyl)-glycine, a β-branched-hydroxy acid, and 3-hydroxy glutamic acid, for which biosynthetic logic has not been elucidated. Herein we describe the biosynthetic gene cluster for the kutzneride family, identified by degenerate primer PCR for halogenating enzymes postulated to be involved in biosyntheses of these unusual monomers. The 56-kb gene cluster encodes a series of six nonribosomal peptide synthetase (NRPS) modules distributed over three proteins and a variety of tailoring enzymes, including both mononuclear nonheme iron and two flavin-dependent halogenases, and an array of oxygen transfer catalysts. The sequence and organization of NRPS genes support incorporation of the unusual monomer units into the densely functionalized scaffold of kutznerides. Our work provides insight into the formation of this intriguing class of compounds and provides a foundation for elucidating the timing and mechanisms of their biosynthesis. PMID:17940045

  3. Unique marine derived cyanobacterial biosynthetic genes for chemical diversity.

    PubMed

    Kleigrewe, Karin; Gerwick, Lena; Sherman, David H; Gerwick, William H

    2016-02-01

    Cyanobacteria are a prolific source of structurally unique and biologically active natural products that derive from intriguing biochemical pathways. Advancements in genome sequencing have accelerated the identification of unique modular biosynthetic gene clusters in cyanobacteria and reveal a wealth of unusual enzymatic reactions involved in their construction. This article examines several interesting mechanistic transformations involved in cyanobacterial secondary metabolite biosynthesis with a particular focus on marine derived modular polyketide synthases (PKS), nonribosomal peptide synthetases (NRPS) and combinations thereof to form hybrid natural products. Further, we focus on the cyanobacterial genus Moorea and the co-evolution of its enzyme cassettes that create metabolic diversity. Progress in the development of heterologous expression systems for cyanobacterial gene clusters along with chemoenzymatic synthesis makes it possible to create new analogs. Additionally, phylum-wide genome sequencing projects have enhanced the discovery rate of new natural products and their distinctive enzymatic reactions. Summarizing, cyanobacterial biosynthetic gene clusters encode for a large toolbox of novel enzymes that catalyze unique chemical reactions, some of which may be useful in synthetic biology. PMID:26758451

  4. THE CAROTENOID BIOSYNTHETIC PATHWAY: THINKING IN ALL DIMENSIONS

    PubMed Central

    Shumskaya, Maria; Wurtzel, Eleanore T.

    2013-01-01

    The carotenoid biosynthetic pathway serves manifold roles in plants related to photosynthesis, photoprotection, development, stress hormones, and various volatiles and signalling apocarotenoids. The pathway also produces compounds that impact human nutrition and metabolic products that contribute to fragrance and flavour of food and non-food crops. It is no surprise that the pathway has been a target of metabolic engineering, most prominently in the case of Golden Rice. The future success and predictability of metabolic engineering of carotenoids rests in the ability to target carotenoids for specific physiological purposes as well as to simultaneously modify carotenoids along with other desired traits. Here, we ask whether predictive metabolic engineering of the carotenoid pathway is indeed possible. Despite a long history of research on the pathway, at this point in time we can only describe the pathway as a parts list and have almost no knowledge of the location of the complete pathway, how it is assembled, and whether there exists any trafficking of the enzymes or the carotenoids themselves. We discuss the current state of knowledge regarding the “complete” pathway and make the argument that predictive metabolic engineering of the carotenoid pathway (and other pathways) will require investigation of the three dimensional state of the pathway as it may exist in plastids of different ultrastructures. Along with this message we point out the need to develop new types of visualization tools and resources that better reflect the dynamic nature of biosynthetic pathways. PMID:23683930

  5. Analysis of Heme Biosynthetic Pathways in a Recombinant Escherichia coli.

    PubMed

    Pranawidjaja, Stephanie; Choi, Su-In; Lay, Bibiana W; Kim, Pil

    2015-06-01

    Bacterial heme was produced from a genetic-engineered Escherichia coli via the porphyrin pathway and it was useful as an iron resource for animal feed. The amount of the E. colisynthesized heme, however, was only few milligrams in a culture broth and it was not enough for industrial applications. To analyze heme biosynthetic pathways, an engineered E. coli artificially overexpressing ALA synthase (hemA from Rhodobacter sphaeroides) and pantothenate kinase (coaA gene from self geneome) was constructed as a bacterial heme-producing strain, and both the transcription levels of pathway genes and the intermediates concentrations were determined from batch and continuous cultures. Transcription levels of the pathway genes were not significantly changed among the tested conditions. Intracellular intermediate concentrations indicated that aminolevulinic acid (ALA) and coenzyme A (CoA) were enhanced by the hemA-coaA co-expression. Intracellular coproporphyrinogen I and protoporphyrin IX accumulation suggested that the bottleneck steps in the heme biosynthetic pathway could be the spontaneous conversion of HMB to coproporphyrinogen I and the limited conversion of protoporphyrin IX to heme, respectively. A strategy to increase the conversion of ALA to heme is discussed based on the results. PMID:25537720

  6. The carotenoid biosynthetic pathway: thinking in all dimensions.

    PubMed

    Shumskaya, Maria; Wurtzel, Eleanore T

    2013-07-01

    The carotenoid biosynthetic pathway serves manifold roles in plants related to photosynthesis, photoprotection, development, stress hormones, and various volatiles and signaling apocarotenoids. The pathway also produces compounds that impact human nutrition and metabolic products that contribute to fragrance and flavor of food and non-food crops. It is no surprise that the pathway has been a target of metabolic engineering, most prominently in the case of Golden Rice. The future success and predictability of metabolic engineering of carotenoids rests in the ability to target carotenoids for specific physiological purposes as well as to simultaneously modify carotenoids along with other desired traits. Here, we ask whether predictive metabolic engineering of the carotenoid pathway is indeed possible. Despite a long history of research on the pathway, at this point in time we can only describe the pathway as a parts list and have almost no knowledge of the location of the complete pathway, how it is assembled, and whether there exists any trafficking of the enzymes or the carotenoids themselves. We discuss the current state of knowledge regarding the "complete" pathway and make the argument that predictive metabolic engineering of the carotenoid pathway (and other pathways) will require investigation of the three dimensional state of the pathway as it may exist in plastids of different ultrastructures. Along with this message we point out the need to develop new types of visualization tools and resources that better reflect the dynamic nature of biosynthetic pathways. PMID:23683930

  7. Deuterium NMR spectroscopy of biosynthetically deuterated mammalian tissues

    SciTech Connect

    Curatolo, W.; Jungalwala, F.B.; Sears, B.; Tuck, L.; Neuringer, L.J.

    1985-07-30

    The choline-containing phospholipids of mammalian membranes have been biosynthetically deuterated by raising rats on a diet supplemented with (HOCH2CH2N(CD3)3) Cl or (HOCD2CH2N(CH3)3) Cl . Deuterium NMR spectra have been obtained from excised deuterated brain, sciatic nerve, heart, and lung, from isolated brain myelin and brain microsomes, and from aqueous dispersions of lipid extracts. Measurements of residual quadrupole splittings for excised deuterated neural tissues demonstrate that the orientational order of the choline head group is similar to that observed in model membranes. The spin-lattice relaxation time of the choline head group in deuterated neural tissue is indistinguishable from that observed in model membranes. These results support the proposal that the conformation and motional dynamics of the choline head groups of the bulk choline-containing lipids of neural tissue are similar to those in model membranes. Spectra of biosynthetically deuterated brain myelin and brain microsomes exhibit similar quadrupole splittings. Since these membranes have significantly different protein contents, these results indicate that no strong polar interactions exist between membrane proteins and the choline head groups of choline-containing membrane lipids. Spectra of intact deuterated heart and lung exhibit broad lines and a range of quadrupole splittings.

  8. Substrate specificity of the sialic acid biosynthetic pathway

    SciTech Connect

    Jacobs, Christina L.; Goon, Scarlett; Yarema, Kevin J.; Hinderlich, Stephan; Hang, Howard C.; Chai, Diana H.; Bertozzi, Carolyn R.

    2001-07-18

    Unnatural analogs of sialic acid can be delivered to mammalian cell surfaces through the metabolic transformation of unnatural N-acetylmannosamine (ManNAc) derivatives. In previous studies, mannosamine analogs bearing simple N-acyl groups up to five carbon atoms in length were recognized as substrates by the biosynthetic machinery and transformed into cell-surface sialoglycoconjugates [Keppler, O. T., et al. (2001) Glycobiology 11, 11R-18R]. Such structural alterations to cell surface glycans can be used to probe carbohydrate-dependent phenomena. This report describes our investigation into the extent of tolerance of the pathway toward additional structural alterations of the N-acyl substituent of ManNAc. A panel of analogs with ketone-containing N-acyl groups that varied in the lengthor steric bulk was chemically synthesized and tested for metabolic conversion to cell-surface glycans. We found that extension of the N-acyl chain to six, seven, or eight carbon atoms dramatically reduced utilization by the biosynthetic machinery. Likewise, branching from the linear chain reduced metabolic conversion. Quantitation of metabolic intermediates suggested that cellular metabolism is limited by the phosphorylation of the N-acylmannosamines by ManNAc 6-kinase in the first step of the pathway. This was confirmed by enzymatic assay of the partially purified enzyme with unnatural substrates. Identification of ManNAc 6-kinase as a bottleneck for unnatural sialic acid biosynthesis provides a target for expanding the metabolic promiscuity of mammalian cells.

  9. Effect of photoperiod on gibberellin biosynthetic enzymes in spinach

    SciTech Connect

    Gilmour, S.J.; Bleecker, A.B.; Zeevaart, J.A.D.

    1986-04-01

    The photoperiodic control of stem elongation in spinach, a long day (LD) rosette plant, is mediated by gibberellins (GAs). The early 13-hydroxylated GA biosynthetic pathway from GA/sub 12/ to GA/sub 20/ operates in spinach: GA/sub 12/ ..-->.. GA/sub 53/ ..-->.. GA/sub 44/ ..-->.. GA/sub 19/ ..-->.. GA/sub 20/. Two enzymes of this pathway, those converting GA/sub 53/ to GA/sub 44/ (GA/sub 53/ oxidase) and GA/sub 19/ to GA/sub 20/ (GA/sub 19/ oxidase), are regulated by light. The enzyme converting GA/sub 44/ to GA/sub 19/ (GA/sub 44/ oxidase) is not light-regulated. In the light GA/sub 53/ and GA/sub 18/ oxidase activities are increased, therefore causing the GA biosynthetic pathway to be turned on. This leads to the production of an active GA in LD, which causes an increase in stem elongation. Two the enzymes, GA/sub 44/ and GA/sub 53/ oxidases, can be separated from one another by anion exchange HPLC. Estimates of the molecular weights of these two enzymes based on gel filtration HPLC will be reported.

  10. Structural Insights Into the Evolutionary Paths of Oxylipin Biosynthetic Enzymes

    SciTech Connect

    Lee, D.-S.; Nioche, P.; Hamberg, M.; Raman, C.S.

    2009-05-20

    The oxylipin pathway generates not only prostaglandin-like jasmonates but also green leaf volatiles (GLVs), which confer characteristic aromas to fruits and vegetables. Although allene oxide synthase (AOS) and hydroperoxide lyase are atypical cytochrome P450 family members involved in the synthesis of jasmonates and GLVs, respectively, it is unknown how these enzymes rearrange their hydroperoxide substrates into different products. Here we present the crystal structures of Arabidopsis thaliana AOS, free and in complex with substrate or intermediate analogues. The structures reveal an unusual active site poised to control the reactivity of an epoxyallylic radical and its cation by means of interactions with an aromatic {pi}-system. Replacing the amino acid involved in these steps by a non-polar residue markedly reduces AOS activity and, unexpectedly, is both necessary and sufficient for converting AOS into a GLV biosynthetic enzyme. Furthermore, by combining our structural data with bioinformatic and biochemical analyses, we have discovered previously unknown hydroperoxide lyase in plant growth-promoting rhizobacteria, AOS in coral, and epoxyalcohol synthase in amphioxus. These results indicate that oxylipin biosynthetic genes were present in the last common ancestor of plants and animals, but were subsequently lost in all metazoan lineages except Placozoa, Cnidaria and Cephalochordata.

  11. Variability in mycotoxin biosynthetic genes in Fusarium and its effect on mycotoxin contamination of crops

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Fusarium metabolites fumonisins and trichothecenes are among the mycotoxins of greatest concern to food and feed safety worldwide. As is the case for other fungal secondary metabolite biosynthetic genes, mycotoxin biosynthetic genes are often located adjacent to one another in gene clusters. Thu...

  12. Identification and functional analysis of brassicicene C biosynthetic gene cluster in Alternaria brassicicola.

    PubMed

    Minami, Atsushi; Tajima, Naoto; Higuchi, Yusuke; Toyomasu, Tomonobu; Sassa, Takeshi; Kato, Nobuo; Dairi, Tohru

    2009-02-01

    The biosynthetic gene cluster of brassicicene C was identified in Alternaria brassicicola strain ATCC 96836 from genome database search. In vivo and in vitro study clearly revealed the function of Orf8 and Orf6 as a fusicoccadiene synthase and methyltransferase, respectively. The understanding toward the biosynthetic pathway promises construction of this type of diterpene compounds with genetic engineering. PMID:19097780

  13. Stereoselective synthesis of deuterium-labeled (2S)-cyclohexenyl alanines, biosynthetic intermediates of cinnabaramide.

    PubMed

    Barbie, Philipp; Huo, Liujie; Müller, Rolf; Kazmaier, Uli

    2012-12-01

    Dideuterated β-cyclohexenylalanines, proposed biosynthetic intermediates of the cinnabaramides, can be obtained from chiral alkynols via a sequence of Irland-Claisen rearrangement, ring closing metathesis, and radical decarboxylation. Feeding experiments indicate that both (2S)-β-cyclohexenylalanines can be incorporated into cinnabaramide, while the configuration at the cyclohexenyl ring does not restrict biosynthetic processing. PMID:23163839

  14. Identification of the Herboxidiene Biosynthetic Gene Cluster in Streptomyces chromofuscus ATCC 49982

    PubMed Central

    Shao, Lei; Zi, Jiachen; Zeng, Jia

    2012-01-01

    The 53-kb biosynthetic gene cluster for the novel anticholesterol natural product herboxidiene was identified in Streptomyces chromofuscus ATCC 49982 by genome sequencing and gene inactivation. In addition to herboxidiene, a biosynthetic intermediate, 18-deoxy-herboxidiene, was also isolated from the fermentation broth of S. chromofuscus ATCC 49982 as a minor metabolite. PMID:22247174

  15. Detection of additional genes of the patulin biosynthetic pathway in Penicillium griseofulvum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genes in the patulin biosynthetic pathway are likely to be arranged in a cluster as has been found for biosynthetic pathways of other mycotoxins. The mycotoxin patulin, common in apples and apple juice, is most often associated with Penicillium expansum. However, of 15 fungal species capable of sy...

  16. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.

    PubMed

    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto

    2006-05-01

    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes. PMID:16612546

  17. Toward a biosynthetic route to sclareol and amber odorants.

    PubMed

    Schalk, Michel; Pastore, Laurence; Mirata, Marco A; Khim, Samretthy; Schouwey, Marina; Deguerry, Fabienne; Pineda, Virginia; Rocci, Letizia; Daviet, Laurent

    2012-11-21

    Ambergris, a waxy substance excreted by the intestinal tract of the sperm whale, has been a highly prized fragrance ingredient for millenia. Because of supply shortage and price inflation, a number of ambergris substitutes have been developed by the fragrance industry. One of the key olfactory components and most appreciated substitutes of ambergris, Ambrox is produced industrially by semisynthesis from sclareol, a diterpene-diol isolated from Clary sage. In the present study, we report the cloning and functional characterization of the enzymes responsible for the biosynthesis of sclareol. Furthermore, we reconstructed the sclareol biosynthetic pathway in genetically engineered Escherichia coli and reached sclareol titers of ~1.5 g/L in high-cell-density fermentation. Our work provides a basis for the development of an alternative, sustainable, and cost-efficient route to sclareol and other diterpene analogues. PMID:23113661

  18. Crystallographic Trapping in the Rebeccamycin Biosynthetic Enzyme RebC

    SciTech Connect

    Ryan, K.S.; Howard-Jones, A.R.; Hamill, M.J.; Elliott, S.J.; Walsh, C.T.; Drennan, C.L.

    2009-06-04

    The biosynthesis of rebeccamycin, an antitumor compound, involves the remarkable eight-electron oxidation of chlorinated chromopyrrolic acid. Although one rebeccamycin biosynthetic enzyme is capable of generating low levels of the eight-electron oxidation product on its own, a second protein, RebC, is required to accelerate product formation and eliminate side reactions. However, the mode of action of RebC was largely unknown. Using crystallography, we have determined a likely function for RebC as a flavin hydroxylase, captured two snapshots of its dynamic catalytic cycle, and trapped a reactive molecule, a putative substrate, in its binding pocket. These studies strongly suggest that the role of RebC is to sequester a reactive intermediate produced by its partner protein and to react with it enzymatically, preventing its conversion to a suite of degradation products that includes, at low levels, the desired product.

  19. Manipulating Natural Product Biosynthetic Pathways via DNA Assembler

    PubMed Central

    Shao, Zengyi; Zhao, Huimin

    2014-01-01

    DNA assembler is an efficient synthetic biology method for constructing and manipulating biochemical pathways. The rapidly increasing number of sequenced genomes provides a rich source for discovery of gene clusters involved in synthesizing new natural products. However, both discovery and economical production are hampered by our limited knowledge in manipulating most organisms and the corresponding pathways. By taking advantage of yeast in vivo homologous recombination, DNA assembler synthesizes an entire expression vector containing the target biosynthetic pathway and the genetic elements needed for DNA maintenance and replication. Here we use the spectinabilin clusters originated from two hosts as examples to illustrate the guidelines of using DNA assembler for cluster characterization and silent cluster activation. Such strategies offer unprecedented versatility in cluster manipulation, bypass the traditional laborious strategies to elicit pathway expression, and provide a new platform for de novo cluster assembly and genome mining for discovering new natural products. PMID:24903884

  20. Discovery of a widely distributed toxin biosynthetic gene cluster

    PubMed Central

    Lee, Shaun W.; Mitchell, Douglas A.; Markley, Andrew L.; Hensler, Mary E.; Gonzalez, David; Wohlrab, Aaron; Dorrestein, Pieter C.; Nizet, Victor; Dixon, Jack E.

    2008-01-01

    Bacteriocins represent a large family of ribosomally produced peptide antibiotics. Here we describe the discovery of a widely conserved biosynthetic gene cluster for the synthesis of thiazole and oxazole heterocycles on ribosomally produced peptides. These clusters encode a toxin precursor and all necessary proteins for toxin maturation and export. Using the toxin precursor peptide and heterocycle-forming synthetase proteins from the human pathogen Streptococcus pyogenes, we demonstrate the in vitro reconstitution of streptolysin S activity. We provide evidence that the synthetase enzymes, as predicted from our bioinformatics analysis, introduce heterocycles onto precursor peptides, thereby providing molecular insight into the chemical structure of streptolysin S. Furthermore, our studies reveal that the synthetase exhibits relaxed substrate specificity and modifies toxin precursors from both related and distant species. Given our findings, it is likely that the discovery of similar peptidic toxins will rapidly expand to existing and emerging genomes. PMID:18375757

  1. Pictet–Spengler reaction-based biosynthetic machinery in fungi

    PubMed Central

    Yan, Wei; Ge, Hui Ming; Wang, Gang; Jiang, Nan; Mei, Ya Ning; Jiang, Rong; Li, Sui Jun; Chen, Chao Jun; Jiao, Rui Hua; Xu, Qiang; Ng, Seik Weng; Tan, Ren Xiang

    2014-01-01

    The Pictet–Spengler (PS) reaction constructs plant alkaloids such as morphine and camptothecin, but it has not yet been noticed in the fungal kingdom. Here, a silent fungal Pictet–Spenglerase (FPS) gene of Chaetomium globosum 1C51 residing in Epinephelus drummondhayi guts is described and ascertained to be activable by 1-methyl-l-tryptophan (1-MT). The activated FPS expression enables the PS reaction between 1-MT and flavipin (fungal aldehyde) to form “unnatural” natural products with unprecedented skeletons, of which chaetoglines B and F are potently antibacterial with the latter inhibiting acetylcholinesterase. A gene-implied enzyme inhibition (GIEI) strategy has been introduced to address the key steps for PS product diversifications. In aggregation, the work designs and validates an innovative approach that can activate the PS reaction-based fungal biosynthetic machinery to produce unpredictable compounds of unusual and novel structure valuable for new biology and biomedicine. PMID:25425666

  2. Alkaloids from Pandanus amaryllifolius: Isolation and Their Plausible Biosynthetic Formation.

    PubMed

    Tsai, Yu-Chi; Yu, Meng-Lun; El-Shazly, Mohamed; Beerhues, Ludger; Cheng, Yuan-Bin; Chen, Lei-Chin; Hwang, Tsong-Long; Chen, Hui-Fen; Chung, Yu-Ming; Hou, Ming-Feng; Wu, Yang-Chang; Chang, Fang-Rong

    2015-10-23

    Pandanus amaryllifolius Roxb. (Pandanaceae) is used as a flavor and in folk medicine in Southeast Asia. The ethanolic crude extract of the aerial parts of P. amaryllifolius exhibited antioxidant, antibiofilm, and anti-inflammatory activities in previous studies. In the current investigation, the purification of the ethanolic extract yielded nine new compounds, including N-acetylnorpandamarilactonines A (1) and B (2); pandalizines A (3) and B (4); pandanmenyamine (5); pandamarilactones 2 (6) and 3 (7), and 5(E)-pandamarilactonine-32 (8); and pandalactonine (9). The isolated alkaloids, with either a γ-alkylidene-α,β-unsaturated-γ-lactone or γ-alkylidene-α,β-unsaturated-γ-lactam system, can be classified into five skeletons including norpandamarilactonine, indolizinone, pandanamine, pandamarilactone, and pandamarilactonine. A plausible biosynthetic route toward 1-5, 7, and 9 is proposed. PMID:26461164

  3. Cloning and Heterologous Expression of the Grecocycline Biosynthetic Gene Cluster.

    PubMed

    Bilyk, Oksana; Sekurova, Olga N; Zotchev, Sergey B; Luzhetskyy, Andriy

    2016-01-01

    Transformation-associated recombination (TAR) in yeast is a rapid and inexpensive method for cloning and assembly of large DNA fragments, which relies on natural homologous recombination. Two vectors, based on p15a and F-factor replicons that can be maintained in yeast, E. coli and streptomycetes have been constructed. These vectors have been successfully employed for assembly of the grecocycline biosynthetic gene cluster from Streptomyces sp. Acta 1362. Fragments of the cluster were obtained by PCR and transformed together with the "capture" vector into the yeast cells, yielding a construct carrying the entire gene cluster. The obtained construct was heterologously expressed in S. albus J1074, yielding several grecocycline congeners. Grecocyclines have unique structural moieties such as a dissacharide side chain, an additional amino sugar at the C-5 position and a thiol group. Enzymes from this pathway may be used for the derivatization of known active angucyclines in order to improve their desired biological properties. PMID:27410036

  4. Cloning and Heterologous Expression of the Grecocycline Biosynthetic Gene Cluster

    PubMed Central

    Bilyk, Oksana; Sekurova, Olga N.; Zotchev, Sergey B.; Luzhetskyy, Andriy

    2016-01-01

    Transformation-associated recombination (TAR) in yeast is a rapid and inexpensive method for cloning and assembly of large DNA fragments, which relies on natural homologous recombination. Two vectors, based on p15a and F-factor replicons that can be maintained in yeast, E. coli and streptomycetes have been constructed. These vectors have been successfully employed for assembly of the grecocycline biosynthetic gene cluster from Streptomyces sp. Acta 1362. Fragments of the cluster were obtained by PCR and transformed together with the “capture” vector into the yeast cells, yielding a construct carrying the entire gene cluster. The obtained construct was heterologously expressed in S. albus J1074, yielding several grecocycline congeners. Grecocyclines have unique structural moieties such as a dissacharide side chain, an additional amino sugar at the C-5 position and a thiol group. Enzymes from this pathway may be used for the derivatization of known active angucyclines in order to improve their desired biological properties. PMID:27410036

  5. Metabolic Profiling of Alternative NAD Biosynthetic Routes in Mouse Tissues

    PubMed Central

    Mori, Valerio; Amici, Adolfo; Mazzola, Francesca; Di Stefano, Michele; Conforti, Laura; Magni, Giulio; Ruggieri, Silverio; Raffaelli, Nadia; Orsomando, Giuseppe

    2014-01-01

    NAD plays essential redox and non-redox roles in cell biology. In mammals, its de novo and recycling biosynthetic pathways encompass two independent branches, the “amidated” and “deamidated” routes. Here we focused on the indispensable enzymes gating these two routes, i.e. nicotinamide mononucleotide adenylyltransferase (NMNAT), which in mammals comprises three distinct isozymes, and NAD synthetase (NADS). First, we measured the in vitro activity of the enzymes, and the levels of all their substrates and products in a number of tissues from the C57BL/6 mouse. Second, from these data, we derived in vivo estimates of enzymes'rates and quantitative contributions to NAD homeostasis. The NMNAT activity, mainly represented by nuclear NMNAT1, appears to be high and nonrate-limiting in all examined tissues, except in blood. The NADS activity, however, appears rate-limiting in lung and skeletal muscle, where its undetectable levels parallel a relative accumulation of the enzyme's substrate NaAD (nicotinic acid adenine dinucleotide). In all tissues, the amidated NAD route was predominant, displaying highest rates in liver and kidney, and lowest in blood. In contrast, the minor deamidated route showed higher relative proportions in blood and small intestine, and higher absolute values in liver and small intestine. Such results provide the first comprehensive picture of the balance of the two alternative NAD biosynthetic routes in different mammalian tissues under physiological conditions. This fills a gap in the current knowledge of NAD biosynthesis, and provides a crucial information for the study of NAD metabolism and its role in disease. PMID:25423279

  6. Resorbable biosynthetic mesh for crural reinforcement during hiatal hernia repair.

    PubMed

    Alicuben, Evan T; Worrell, Stephanie G; DeMeester, Steven R

    2014-10-01

    The use of mesh to reinforce crural closure during hiatal hernia repair is controversial. Although some studies suggest that using synthetic mesh can reduce recurrence, synthetic mesh can erode into the esophagus and in our opinion should be avoided. Studies with absorbable or biologic mesh have not proven to be of benefit for recurrence. The aim of this study was to evaluate the outcome of hiatal hernia repair with modern resorbable biosynthetic mesh in combination with adjunct tension reduction techniques. We retrospectively analyzed all patients who had crural reinforcement during repair of a sliding or paraesophageal hiatal hernia with Gore BioA resorbable mesh. Objective follow-up was by videoesophagram and/or esophagogastroduodenoscopy. There were 114 patients. The majority of operations (72%) were laparoscopic primary repairs with all patients receiving a fundoplication. The crura were closed primarily in all patients and reinforced with a BioA mesh patch. Excessive tension prompted a crural relaxing incision in four per cent and a Collis gastroplasty in 39 per cent of patients. Perioperative morbidity was minor and unrelated to the mesh. Median objective follow-up was one year, but 18 patients have objective follow-up at two or more years. A recurrent hernia was found in one patient (0.9%) three years after repair. The use of crural relaxing incisions and Collis gastroplasty in combination with crural reinforcement with resorbable biosynthetic mesh is associated with a low early hernia recurrence rate and no mesh-related complications. Long-term follow-up will define the role of these techniques for hiatal hernia repair. PMID:25264654

  7. Common biosynthetic origins for polycyclic tetramate macrolactams from phylogenetically diverse bacteria

    PubMed Central

    Blodgett, Joshua A. V.; Oh, Dong-Chan; Cao, Shugeng; Currie, Cameron R.; Kolter, Roberto; Clardy, Jon

    2010-01-01

    A combination of small molecule chemistry, biosynthetic analysis, and genome mining has revealed the unexpected conservation of polycyclic tetramate macrolactam biosynthetic loci in diverse bacteria. Initially our chemical analysis of a Streptomyces strain associated with the southern pine beetle led to the discovery of frontalamides A and B, two previously undescribed members of this antibiotic family. Genome analyses and genetic manipulation of the producing organism led to the identification of the frontalamide biosynthetic gene cluster and several biosynthetic intermediates. The biosynthetic locus for the frontalamides’ mixed polyketide/amino acid structure encodes a hybrid polyketide synthase nonribosomal peptide synthetase (PKS-NRPS), which resembles iterative enzymes known in fungi. No such mixed iterative PKS-NRPS enzymes have been characterized in bacteria. Genome-mining efforts revealed strikingly conserved frontalamide-like biosynthetic clusters in the genomes of phylogenetically diverse bacteria ranging from proteobacteria to actinomycetes. Screens for environmental actinomycete isolates carrying frontalamide-like biosynthetic loci led to the isolation of a number of positive strains, the majority of which produced candidate frontalamide-like compounds under suitable growth conditions. These results establish the prevalence of frontalamide-like gene clusters in diverse bacterial types, with medicinally important Streptomyces species being particularly enriched. PMID:20547882

  8. Common biosynthetic origins for polycyclic tetramate macrolactams from phylogenetically diverse bacteria.

    PubMed

    Blodgett, Joshua A V; Oh, Dong-Chan; Cao, Shugeng; Currie, Cameron R; Kolter, Roberto; Clardy, Jon

    2010-06-29

    A combination of small molecule chemistry, biosynthetic analysis, and genome mining has revealed the unexpected conservation of polycyclic tetramate macrolactam biosynthetic loci in diverse bacteria. Initially our chemical analysis of a Streptomyces strain associated with the southern pine beetle led to the discovery of frontalamides A and B, two previously undescribed members of this antibiotic family. Genome analyses and genetic manipulation of the producing organism led to the identification of the frontalamide biosynthetic gene cluster and several biosynthetic intermediates. The biosynthetic locus for the frontalamides' mixed polyketide/amino acid structure encodes a hybrid polyketide synthase nonribosomal peptide synthetase (PKS-NRPS), which resembles iterative enzymes known in fungi. No such mixed iterative PKS-NRPS enzymes have been characterized in bacteria. Genome-mining efforts revealed strikingly conserved frontalamide-like biosynthetic clusters in the genomes of phylogenetically diverse bacteria ranging from proteobacteria to actinomycetes. Screens for environmental actinomycete isolates carrying frontalamide-like biosynthetic loci led to the isolation of a number of positive strains, the majority of which produced candidate frontalamide-like compounds under suitable growth conditions. These results establish the prevalence of frontalamide-like gene clusters in diverse bacterial types, with medicinally important Streptomyces species being particularly enriched. PMID:20547882

  9. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

    2005-01-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  10. Strain identification and 5S rRNA gene characterization of the hyperthermophilic archaebacterium Sulfolobus acidocaldarius.

    PubMed Central

    Durovic, P; Kutay, U; Schleper, C; Dennis, P P

    1994-01-01

    A commonly used laboratory Sulfolobus strain has been unambiguously identified as Sulfolobus acidocaldarius DSM639. The 5S rRNA gene from this strain was cloned and sequenced. It differs at 17 of 124 positions from the identical 5S rRNA sequences from Sulfolobus solfataricus and a strain apparently misidentified as S. acidocaldarius. Analysis of the transcripts from the 5S rRNA gene failed to identify any precursor extending a significant distance beyond the 5' or 3' boundary of the 5S rRNA-coding sequence. This result suggests that the primary transcript of the 5S rRNA gene corresponds in length (within 1 or 2 nucleotides) to the mature 5S rRNA sequence found in 50S ribosomal subunits. Images PMID:8288546

  11. A retro-biosynthetic approach to the prediction of biosynthetic pathways from position-specific isotope analysis as shown for tramadol

    PubMed Central

    Romek, Katarzyna M.; Nun, Pierrick; Remaud, Gérald S.; Silvestre, Virginie; Taïwe, Germain Sotoing; Lecerf-Schmidt, Florine; Boumendjel, Ahcène; De Waard, Michel; Robins, Richard J.

    2015-01-01

    Tramadol, previously only known as a synthetic analgesic, has now been found in the bark and wood of roots of the African medicinal tree Nauclea latifolia. At present, no direct evidence is available as to the biosynthetic pathway of its unusual skeleton. To provide guidance as to possible biosynthetic precursors, we have adopted a novel approach of retro-biosynthesis based on the position-specific distribution of isotopes in the extracted compound. Relatively recent developments in isotope ratio monitoring by 13C NMR spectrometry make possible the measurement of the nonstatistical position-specific natural abundance distribution of 13C (δ13Ci) within the molecule with better than 1‰ precision. Very substantial variation in the 13C positional distribution is found: between δ13Ci = −11 and −53‰. Distribution is not random and it is argued that the pattern observed can substantially be interpreted in relation to known causes of isotope fractionation in natural products. Thus, a plausible biosynthetic scheme based on sound biosynthetic principals of precursor–substrate relationships can be proposed. In addition, data obtained from the 18O/16O ratios in the oxygen atoms of the compound add support to the deductions made from the carbon isotope analysis. This paper shows how the use of 13C NMR at natural abundance can help with proposing a biosynthetic route to compounds newly found in nature or those difficult to tackle by conventional means. PMID:26106160

  12. Identification and characterization of a welwitindolinone alkaloid biosynthetic gene cluster in the stigonematalean Cyanobacterium Hapalosiphon welwitschii.

    PubMed

    Hillwig, Matthew L; Fuhrman, Heather A; Ittiamornkul, Kuljira; Sevco, Tyler J; Kwak, Daniel H; Liu, Xinyu

    2014-03-21

    The identification of a 36 kb welwitindolinone (wel) biosynthetic gene cluster in Hapalosiphon welwitschii UTEX B1830 is reported. Characterization of the enzymes responsible for assembling the early biosynthetic intermediates geranyl pyrophosphate and 3-((Z)-2′-isocyanoethenyl)indole as well as a dedicated N-methyltransferase in the maturation of N-methylwelwitindolinone C isothiocyanate solidified the link between the wel pathway and welwitindolinone biosynthesis. Comparative analysis of the ambiguine and welwitindolinone biosynthetic pathways in two different organisms provided insights into the origins of diverse structures within hapalindole-type molecules. PMID:24677572

  13. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  14. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  15. A search for the Bs meson in Υ(5S) decays

    NASA Astrophysics Data System (ADS)

    Shipsey, Ian

    2004-05-01

    The CLEO III detector has recorded approximately 0.5 fb-1 of e^+ e^- annihilation data at the Υ(5S) resonance. Using this data sample, we have searched for fully reconstructed Bs mesons in the reaction Υ(5S) arrow B_s^(*) barB_s^(*)

  16. Identification and analysis of the resorcinomycin biosynthetic gene cluster.

    PubMed

    Ooya, Koichi; Ogasawara, Yasushi; Noike, Motoyoshi; Dairi, Tohru

    2015-01-01

    Resorcinomycin (1) is composed of a nonproteinogenic amino acid, (S)-2-(3,5-dihydroxy-4-isopropylphenyl)-2-guanidinoacetic acid (2), and glycine. A biosynthetic gene cluster was identified in a genome database of Streptoverticillium roseoverticillatum by searching for orthologs of the genes responsible for biosynthesis of pheganomycin (3), which possesses a (2)-derivative at its N-terminus. The cluster contained a gene encoding an ATP-grasp-ligase (res5), which was suggested to catalyze the peptide bond formation between 2 and glycine. A res5-deletion mutant lost 1 productivity but accumulated 2 in the culture broth. However, recombinant RES5 did not show catalytic activity to form 1 with 2 and glycine as substrates. Moreover, heterologous expression of the cluster resulted in accumulation of only 2 and no production of 1 was observed. These results suggested that a peptide with glycine at its N-terminus may be used as a nucleophile and then maturated by a peptidase encoded by a gene outside of the cluster. PMID:26034896

  17. Reconstruction of cytosolic fumaric acid biosynthetic pathways in Saccharomyces cerevisiae

    PubMed Central

    2012-01-01

    Background Fumaric acid is a commercially important component of foodstuffs, pharmaceuticals and industrial materials, yet the current methods of production are unsustainable and ecologically destructive. Results In this study, the fumarate biosynthetic pathway involving reductive reactions of the tricarboxylic acid cycle was exogenously introduced in S. cerevisiae by a series of simple genetic modifications. First, the Rhizopus oryzae genes for malate dehydrogenase (RoMDH) and fumarase (RoFUM1) were heterologously expressed. Then, expression of the endogenous pyruvate carboxylase (PYC2) was up-regulated. The resultant yeast strain, FMME-001 ↑PYC2 + ↑RoMDH, was capable of producing significantly higher yields of fumarate in the glucose medium (3.18 ± 0.15 g liter-1) than the control strain FMME-001 empty vector. Conclusions The results presented here provide a novel strategy for fumarate biosynthesis, which represents an important advancement in producing high yields of fumarate in a sustainable and ecologically-friendly manner. PMID:22335940

  18. Flg22-Triggered Immunity Negatively Regulates Key BR Biosynthetic Genes

    PubMed Central

    Jiménez-Góngora, Tamara; Kim, Seong-Ki; Lozano-Durán, Rosa; Zipfel, Cyril

    2015-01-01

    In plants, activation of growth and activation of immunity are opposing processes that define a trade-off. In the past few years, the growth-promoting hormones brassinosteroids (BR) have emerged as negative regulators of pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI), promoting growth at the expense of defense. The crosstalk between BR and PTI signaling was described as negative and unidirectional, since activation of PTI does not affect several analyzed steps in the BR signaling pathway. In this work, we describe that activation of PTI by the bacterial PAMP flg22 results in the reduced expression of BR biosynthetic genes. This effect does not require BR perception or signaling, and occurs within 15 min of flg22 treatment. Since the described PTI-induced repression of gene expression may result in a reduction in BR biosynthesis, the crosstalk between PTI and BR could actually be negative and bidirectional, a possibility that should be taken into account when considering the interaction between these two pathways. PMID:26617621

  19. Functions Encoded by Pyrrolnitrin Biosynthetic Genes from Pseudomonas fluorescens

    PubMed Central

    Kirner, Sabine; Hammer, Philip E.; Hill, D. Steven; Altmann, Annett; Fischer, Ilona; Weislo, Laura J.; Lanahan, Mike; van Pée, Karl-Heinz; Ligon, James M.

    1998-01-01

    Pyrrolnitrin is a secondary metabolite derived from tryptophan and has strong antifungal activity. Recently we described four genes, prnABCD, from Pseudomonas fluorescens that encode the biosynthesis of pyrrolnitrin. In the work presented here, we describe the function of each prn gene product. The four genes encode proteins identical in size and serology to proteins present in wild-type Pseudomonas fluorescens, but absent from a mutant from which the entire prn gene region had been deleted. The prnA gene product catalyzes the chlorination of l-tryptophan to form 7-chloro-l-tryptophan. The prnB gene product catalyzes a ring rearrangement and decarboxylation to convert 7-chloro-l-tryptophan to monodechloroaminopyrrolnitrin. The prnC gene product chlorinates monodechloroaminopyrrolnitrin at the 3 position to form aminopyrrolnitrin. The prnD gene product catalyzes the oxidation of the amino group of aminopyrrolnitrin to a nitro group to form pyrrolnitrin. The organization of the prn genes in the operon is identical to the order of the reactions in the biosynthetic pathway. PMID:9537395

  20. Extending the biosynthetic repertoires of cyanobacteria and chloroplasts.

    PubMed

    Nielsen, Agnieszka Zygadlo; Mellor, Silas Busck; Vavitsas, Konstantinos; Wlodarczyk, Artur Jacek; Gnanasekaran, Thiyagarajan; Perestrello Ramos H de Jesus, Maria; King, Brian Christopher; Bakowski, Kamil; Jensen, Poul Erik

    2016-07-01

    Chloroplasts in plants and algae and photosynthetic microorganisms such as cyanobacteria are emerging hosts for sustainable production of valuable biochemicals, using only inorganic nutrients, water, CO2 and light as inputs. In the past decade, many bioengineering efforts have focused on metabolic engineering and synthetic biology in the chloroplast or in cyanobacteria for the production of fuels, chemicals and complex, high-value bioactive molecules. Biosynthesis of all these compounds can be performed in photosynthetic organelles/organisms by heterologous expression of the appropriate pathways, but this requires optimization of carbon flux and reducing power, and a thorough understanding of regulatory pathways. Secretion or storage of the compounds produced can be exploited for the isolation or confinement of the desired compounds. In this review, we explore the use of chloroplasts and cyanobacteria as biosynthetic compartments and hosts, and we estimate the levels of production to be expected from photosynthetic hosts in light of the fraction of electrons and carbon that can potentially be diverted from photosynthesis. The supply of reducing power, in the form of electrons derived from the photosynthetic light reactions, appears to be non-limiting, but redirection of the fixed carbon via precursor molecules presents a challenge. We also discuss the available synthetic biology tools and the need to expand the molecular toolbox to facilitate cellular reprogramming for increased production yields in both cyanobacteria and chloroplasts. PMID:27005523

  1. The bifurcation of the cyanogenic glucoside and glucosinolate biosynthetic pathways.

    PubMed

    Clausen, Mette; Kannangara, Rubini M; Olsen, Carl E; Blomstedt, Cecilia K; Gleadow, Roslyn M; Jørgensen, Kirsten; Bak, Søren; Motawie, Mohammed S; Møller, Birger Lindberg

    2015-11-01

    The biosynthetic pathway for the cyanogenic glucoside dhurrin in sorghum has previously been shown to involve the sequential production of (E)- and (Z)-p-hydroxyphenylacetaldoxime. In this study we used microsomes prepared from wild-type and mutant sorghum or transiently transformed Nicotiana benthamiana to demonstrate that CYP79A1 catalyzes conversion of tyrosine to (E)-p-hydroxyphenylacetaldoxime whereas CYP71E1 catalyzes conversion of (E)-p-hydroxyphenylacetaldoxime into the corresponding geometrical Z-isomer as required for its dehydration into a nitrile, the next intermediate in cyanogenic glucoside synthesis. Glucosinolate biosynthesis is also initiated by the action of a CYP79 family enzyme, but the next enzyme involved belongs to the CYP83 family. We demonstrate that CYP83B1 from Arabidopsis thaliana cannot convert the (E)-p-hydroxyphenylacetaldoxime to the (Z)-isomer, which blocks the route towards cyanogenic glucoside synthesis. Instead CYP83B1 catalyzes the conversion of the (E)-p-hydroxyphenylacetaldoxime into an S-alkyl-thiohydroximate with retention of the configuration of the E-oxime intermediate in the final glucosinolate core structure. Numerous microbial plant pathogens are able to detoxify Z-oximes but not E-oximes. The CYP79-derived E-oximes may play an important role in plant defense. PMID:26361733

  2. Overexpression of the riboflavin biosynthetic pathway in Pichia pastoris

    PubMed Central

    Marx, Hans; Mattanovich, Diethard; Sauer, Michael

    2008-01-01

    Background High cell density cultures of Pichia pastoris grown on methanol tend to develop yellow colored supernatants, attributed to the release of free flavins. The potential of P. pastoris for flavin overproduction is therefore given, but not pronounced when the yeast is grown on glucose. The aim of this study is to characterize the relative regulatory impact of each riboflavin synthesis gene. Deeper insight into pathway control and the potential of deregulation is established by overexpression of the single genes as well as a combined deregulation of up to all six riboflavin synthesis genes. Results Overexpression of the first gene of the riboflavin biosynthetic pathway (RIB1) is already sufficient to obtain yellow colonies and the accumulation of riboflavin in the supernatant of shake flask cultures growing on glucose. Sequential deregulation of all the genes, by exchange of their native promoter with the strong and constitutive glyceraldehyde-3-phosphate dehydrogenase promoter (PGAP) increases the riboflavin accumulation significantly. Conclusion The regulation of the pathway is distributed over more than one gene. High cell density cultivations of a P. pastoris strain overexpressing all six RIB genes allow the accumulation of 175 mg/L riboflavin in the supernatant. The basis for rational engineering of riboflavin production in P. pastoris has thus been established. PMID:18664246

  3. Characterization of sophorolipid biosynthetic enzymes from Starmerella bombicola.

    PubMed

    Saerens, Karen M J; Van Bogaert, Inge N A; Soetaert, Wim

    2015-11-01

    Altering glycolipid structure by genetic engineering of Starmerella bombicola is a recently started research topic and worthy alternative to the unsuccessful selective feeding strategies conventionally applied to reach this goal. One question to be addressed when expressing heterologous proteins in S. bombicola is the activity of the subsequent biosynthetic enzymes toward such modified substrates. In this scope, we studied the substrate specificity of the UDP-glucosyltransferases UgtA1 and UgtB1, responsible for the stepwise synthesis of sophorolipids from a hydroxylated fatty acid, and that of the acetyltransferase, responsible for acetylation of the sophorolipid molecule. All enzymes showed specificity toward a C18:1 chained acceptor and both glucosyltransferases were highly selective toward the UDP-glucose donor. Severe product inhibition of the glucosyltransferases explains the limited accumulation of sophorolipid intermediates by earlier created single deletion mutants of S. bombicola. Finally, a more detailed study of the acetylation of sophorolipid intermediates sheds light on the enzymatic cascade during synthesis. PMID:26298016

  4. Absolute and relative quantification of RNA modifications via biosynthetic isotopomers

    PubMed Central

    Kellner, Stefanie; Ochel, Antonia; Thüring, Kathrin; Spenkuch, Felix; Neumann, Jennifer; Sharma, Sunny; Entian, Karl-Dieter; Schneider, Dirk; Helm, Mark

    2014-01-01

    In the resurging field of RNA modifications, quantification is a bottleneck blocking many exciting avenues. With currently over 150 known nucleoside alterations, detection and quantification methods must encompass multiple modifications for a comprehensive profile. LC–MS/MS approaches offer a perspective for comprehensive parallel quantification of all the various modifications found in total RNA of a given organism. By feeding 13C-glucose as sole carbon source, we have generated a stable isotope-labeled internal standard (SIL-IS) for bacterial RNA, which facilitates relative comparison of all modifications. While conventional SIL-IS approaches require the chemical synthesis of single modifications in weighable quantities, this SIL-IS consists of a nucleoside mixture covering all detectable RNA modifications of Escherichia coli, yet in small and initially unknown quantities. For absolute in addition to relative quantification, those quantities were determined by a combination of external calibration and sample spiking of the biosynthetic SIL-IS. For each nucleoside, we thus obtained a very robust relative response factor, which permits direct conversion of the MS signal to absolute amounts of substance. The application of the validated SIL-IS allowed highly precise quantification with standard deviations <2% during a 12-week period, and a linear dynamic range that was extended by two orders of magnitude. PMID:25129236

  5. The cobalamin (coenzyme B12) biosynthetic genes of Escherichia coli.

    PubMed Central

    Lawrence, J G; Roth, J R

    1995-01-01

    The enteric bacterium Escherichia coli synthesizes cobalamin (coenzyme B12) only when provided with the complex intermediate cobinamide. Three cobalamin biosynthetic genes have been cloned from Escherichia coli K-12, and their nucleotide sequences have been determined. The three genes form an operon (cob) under the control of several promoters and are induced by cobinamide, a precursor of cobalamin. The cob operon of E. coli comprises the cobU gene, encoding the bifunctional cobinamide kinase-guanylyltransferase; the cobS gene, encoding cobalamin synthetase; and the cobT gene, encoding dimethylbenzimidazole phosphoribosyltransferase. The physiological roles of these sequences were verified by the isolation of Tn10 insertion mutations in the cobS and cobT genes. All genes were named after their Salmonella typhimurium homologs and are located at the corresponding positions on the E. coli genetic map. Although the nucleotide sequences of the Salmonella cob genes and the E. coli cob genes are homologous, they are too divergent to have been derived from an operon present in their most recent common ancestor. On the basis of comparisons of G+C content, codon usage bias, dinucleotide frequencies, and patterns of synonymous and nonsynonymous substitutions, we conclude that the cob operon was introduced into the Salmonella genome from an exogenous source. The cob operon of E. coli may be related to cobalamin synthetic genes now found among non-Salmonella enteric bacteria. PMID:7592411

  6. Translating biosynthetic gene clusters into fungal armor and weaponry

    PubMed Central

    Keller, Nancy P

    2015-01-01

    Filamentous fungi are renowned for the production of a diverse array of secondary metabolites (SMs) where the genetic material required for synthesis of a SM is typically arrayed in a biosynthetic gene cluster (BGC). These natural products are valued for their bioactive properties stemming from their functions in fungal biology, key among those protection from abiotic and biotic stress and establishment of a secure niche. The producing fungus must not only avoid self-harm from endogenous SMs but also deliver specific SMs at the right time to the right tissue requiring biochemical aid. This review highlights functions of BGCs beyond the enzymatic assembly of SMs, considering the timing and location of SM production and other proteins in the clusters that control SM activity. Specifically, self-protection is provided by both BGC-encoded mechanisms and non-BGC subcellular containment of toxic SM precursors; delivery and timing is orchestrated through cellular trafficking patterns and stress- and developmental-responsive transcriptional programs. PMID:26284674

  7. Biosynthetic pathway for mannopeptimycins, lipoglycopeptide antibiotics active against drug-resistant gram-positive pathogens.

    PubMed

    Magarvey, Nathan A; Haltli, Brad; He, Min; Greenstein, Michael; Hucul, John A

    2006-06-01

    The mannopeptimycins are a novel class of lipoglycopeptide antibiotics active against multidrug-resistant pathogens with potential as clinically useful antibacterials. This report is the first to describe the biosynthesis of this novel class of mannosylated lipoglycopeptides. Included here are the cloning, sequencing, annotation, and manipulation of the mannopeptimycin biosynthetic gene cluster from Streptomyces hygroscopicus NRRL 30439. Encoded by genes within the mannopeptimycin biosynthetic gene cluster are enzymes responsible for the generation of the hexapeptide core (nonribosomal peptide synthetases [NRPS]) and tailoring reactions (mannosylation, isovalerylation, hydroxylation, and methylation). The NRPS system is noncanonical in that it has six modules utilizing only five amino acid-specific adenylation domains and it lacks a prototypical NRPS macrocyclizing thioesterase domain. Analysis of the mannopeptimycin gene cluster and its engineering has elucidated the mannopeptimycin biosynthetic pathway and provides the framework to make new and improved mannopeptimycins biosynthetically. PMID:16723579

  8. Identification of early fumonisin biosynthetic intermediates by inactivation of the FUM6 gene in Fusarium verticillioides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fumonisins are polyketide mycotoxins produced by the maize pathogen Fusarium verticillioides and are associated with multiple human and animal diseases. A fumonisin biosynthetic pathway has been proposed, but structures of early pathway intermediates have not been demonstrated. The F. verticillioide...

  9. Nanolipoprotein particles comprising a natural rubber biosynthetic enzyme complex and related products, methods and systems

    DOEpatents

    Hoeprich, Paul D.; Whalen, Maureen

    2016-04-05

    Provided herein are nanolipoprotein particles that comprise a biosynthetic enzyme more particularly an enzyme capable of catalyzing rubber or other rubbers polymerization, and related assemblies, devices, methods and systems.

  10. Coordinated regulation of biosynthetic and regulatory genes coincides with anthocyanin accumulation in developing eggplant fruit

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Violet to black pigmentation of eggplant (Solanum melongena) fruit is attributed to anthocyanin accumulation. Model systems support the interaction of biosynthetic and regulatory genes for anthocyanin biosynthesis. Anthocyanin structural gene transcription requires the expression of at least one m...

  11. Fumonisin-nonproducing mutants exhibit differential expression of putative polyketide biosynthetic gene clusters in Fusarium verticillioides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The maize pathogen Fusarium verticillioides produces a group of polyketide derived secondary metabolites called fumonisins. Fumonisins can cause diseases in animals, and have been correlated epidemiologically with esophageal cancer and birth defects in humans. The fumonisin biosynthetic gene clust...

  12. Biosynthetic Pathway for Mannopeptimycins, Lipoglycopeptide Antibiotics Active against Drug-Resistant Gram-Positive Pathogens

    PubMed Central

    Magarvey, Nathan A.; Haltli, Brad; He, Min; Greenstein, Michael; Hucul, John A.

    2006-01-01

    The mannopeptimycins are a novel class of lipoglycopeptide antibiotics active against multidrug-resistant pathogens with potential as clinically useful antibacterials. This report is the first to describe the biosynthesis of this novel class of mannosylated lipoglycopeptides. Included here are the cloning, sequencing, annotation, and manipulation of the mannopeptimycin biosynthetic gene cluster from Streptomyces hygroscopicus NRRL 30439. Encoded by genes within the mannopeptimycin biosynthetic gene cluster are enzymes responsible for the generation of the hexapeptide core (nonribosomal peptide synthetases [NRPS]) and tailoring reactions (mannosylation, isovalerylation, hydroxylation, and methylation). The NRPS system is noncanonical in that it has six modules utilizing only five amino acid-specific adenylation domains and it lacks a prototypical NRPS macrocyclizing thioesterase domain. Analysis of the mannopeptimycin gene cluster and its engineering has elucidated the mannopeptimycin biosynthetic pathway and provides the framework to make new and improved mannopeptimycins biosynthetically. PMID:16723579

  13. Evidence for the presence of 5S rRNA in mammalian mitochondria.

    PubMed

    Magalhães, P J; Andreu, A L; Schon, E A

    1998-09-01

    Mammalian mitochondrial ribosomes contain two prokaryotic-like rRNAs, 12S and 16S, both encoded by mitochondrial DNA. As opposed to cytosolic ribosomes, however, these ribosomes are not thought to contain 5S rRNA. For this reason, it has been unclear whether 5S rRNA, which can be detected in mitochondrial preparations, is an authentic organellar species imported from the cytosol or is merely a copurifying cytosol-derived contaminant. We now show that 5S rRNA is tightly associated with highly purified mitochondrial fractions of human and rat cells and that 5S rRNA transcripts derived from a synthetic gene transfected transiently into human cells are both expressed in vivo and present in highly purified mitochondria and mitoplasts. We conclude that 5S rRNA is imported into mammalian mitochondria, but its function there still remains to be clarified. PMID:9725900

  14. Sequence and organization of 5S ribosomal RNA-encoding genes of Arabidopsis thaliana.

    PubMed

    Campell, B R; Song, Y; Posch, T E; Cullis, C A; Town, C D

    1992-03-15

    We have isolated a genomic clone containing Arabidopsis thaliana 5S ribosomal RNA (rRNA)-encoding genes (rDNA) by screening an A. thaliana library with a 5S rDNA probe from flax. The clone isolated contains seven repeat units of 497 bp, plus 11 kb of flanking genomic sequence at one border. Sequencing of individual subcloned repeat units shows that the sequence of the 5S rRNA coding region is very similar to that reported for other flowering plants. Four A. thaliana ecotypes were found to contain approx. 1000 copies of 5S rDNA per haploid genome. Southern-blot analysis of genomic DNA indicates that 5S rDNA occurs in long tandem arrays, and shows the presence of numerous restriction-site polymorphisms among the six ecotypes studied. PMID:1348233

  15. The 5S lean method as a tool of industrial management performances

    NASA Astrophysics Data System (ADS)

    Filip, F. C.; Marascu-Klein, V.

    2015-11-01

    Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

  16. Mitochondrial Enzyme Rhodanese Is Essential for 5 S Ribosomal RNA Import into Human Mitochondria*

    PubMed Central

    Smirnov, Alexandre; Comte, Caroline; Mager-Heckel, Anne-Marie; Addis, Vanessa; Krasheninnikov, Igor A.; Martin, Robert P.; Entelis, Nina; Tarassov, Ivan

    2010-01-01

    5 S rRNA is an essential component of ribosomes. In eukaryotic cells, it is distinguished by particularly complex intracellular traffic, including nuclear export and re-import. The finding that in mammalian cells 5 S rRNA can eventually escape its usual circuit toward nascent ribosomes to get imported into mitochondria has made the scheme more complex, and it has raised questions about both the mechanism of 5 S rRNA mitochondrial targeting and its function inside the organelle. Previously, we showed that import of 5 S rRNA into mitochondria requires unknown cytosolic proteins. Here, one of them was identified as mitochondrial thiosulfate sulfurtransferase, rhodanese. Rhodanese in its misfolded form was found to possess a strong and specific 5 S rRNA binding activity, exploiting sites found earlier to function as signals of 5 S rRNA mitochondrial localization. The interaction with 5 S rRNA occurs cotranslationally and results in formation of a stable complex in which rhodanese is preserved in a compact enzymatically inactive conformation. Human 5 S rRNA in a branched Mg2+-free form, upon its interaction with misfolded rhodanese, demonstrates characteristic functional traits of Hsp40 cochaperones implicated in mitochondrial precursor protein targeting, suggesting that it may use this mechanism to ensure its own mitochondrial localization. Finally, silencing of the rhodanese gene caused not only a proportional decrease of 5 S rRNA import but also a general inhibition of mitochondrial translation, indicating the functional importance of the imported 5 S rRNA inside the organelle. PMID:20663881

  17. Recent advances in the heterologous expression of microbial natural product biosynthetic pathways.

    PubMed

    Ongley, Sarah E; Bian, Xiaoying; Neilan, Brett A; Müller, Rolf

    2013-08-01

    The heterologous expression of microbial natural product biosynthetic pathways coupled with advanced DNA engineering enables optimisation of product yields, functional elucidation of cryptic gene clusters, and generation of novel derivatives. This review summarises the recent advances in cloning and maintenance of natural product biosynthetic gene clusters for heterologous expression and the efforts fundamental for discovering novel natural products in the post-genomics era, with a focus on polyketide synthases (PKSs) and non-ribosomal polypeptide synthetases (NRPS). PMID:23832108

  18. Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

    PubMed Central

    Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B

    1978-01-01

    A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

  19. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    SciTech Connect

    Hirose, Yutaka Harada, Fumio

    2008-01-04

    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus.

  20. Mouse nucleolin binds to 4.5S RNAh, a small noncoding RNA.

    PubMed

    Hirose, Yutaka; Harada, Fumio

    2008-01-01

    4.5S RNAh is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAh is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAh-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAhin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAh-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAh recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAh was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus. PMID:17971306

  1. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  2. Detection of photoactive siderophore biosynthetic genes in the marine environment.

    PubMed

    Gärdes, Astrid; Triana, Christopher; Amin, Shady A; Green, David H; Romano, Ariel; Trimble, Lyndsay; Carrano, Carl J

    2013-06-01

    Iron is an essential element for oceanic microbial life but its low bioavailability limits microorganisms in large areas of the oceans. To acquire this metal many marine bacteria produce organic chelates that bind and transport iron (siderophores). While it has been hypothesized that the global production of siderophores by heterotrophic bacteria and some cyanobacteria constitutes the bulk of organic ligands binding iron in the ocean because stability constants of siderophores and these organic ligands are similar, and because ligand concentrations rise sharply in response to iron fertilization events, direct evidence for this proposal is lacking. This lack is due to the difficulty in characterizing these ligands due both to their extremely low concentrations and their highly heterogeneous nature. The situation for characterizing photoactive siderophores in situ is more problematic because of their expected short lifetimes in the photic zone. An alternative approach is to make use of high sensitivity molecular technology (qPCR) to search for siderophore biosynthesis genes related to the production of photoactive siderophores. In this way one can access their "biochemical potential" and utilize this information as a proxy for the presence of these siderophores in the marine environment. Here we show, using qPCR primers designed to detect biosynthetic genes for the siderophores vibrioferrin, petrobactin and aerobactin that such genes are widespread and based on their abundance, the "biochemical potential" for photoactive siderophore production is significant. Concurrently we also briefly examine the microbial biodiversity responsible for such production as a function of depth and location across a North Atlantic transect. PMID:23700243

  3. The Magnesium Branch of the Tetrapyrrole Biosynthetic Pathway

    SciTech Connect

    Beale, S. I.

    2004-05-11

    It should be noted that the focus of the research changed somewhat during the course of the current award. The initial focus is indicated by the title of the current grant, ''The Magnesium Branch of the Chlorophyll Biosynthetic Pathway''. During the current grant period, Dr. Robert Willows, a postdoctoral associate, joined the faculty of McQuarie University in Australia. When he left my lab, we decided that he should independently pursue research on structure/function relationships in Mg chelatase and that our laboratories would collaborate on regulatory studies of this enzyme. Also, during the current award period, I began collaborating with Dr. Ariane Atteia and Mr. Robert van Lis, who were at the time located at the Autonomous University of Mexico. Dr. Atteia has since joined my laboratory and Mr. van Lis will also do so when he obtains his Ph.D. in the near future. These individuals bring to the laboratory their interests and expertise in the respiratory components of Chlamydomonas and their desire to become experts in tetrapyrrole metabolism. Recently, in a collaboration with Dr. David Bollivar, a former postdoctoral associate who is now at Illinois Wesleyan University, and Dr. Caroline Walker, who was at Clemson University but has since left this research area, we recently made a major breakthrough on the oxygen-independent cyclase reaction, which has now become an important component of the current proposal. Finally, our research on phycobilin biosynthesis in Synechucystis has revealed that this organism can grow at very low oxygen concentrations and its genome contains several genes that may encode for enzymes that catalyze alternative oxygen-independent reactions for tetrapyrrole biosynthesis, so characterizing the genes, their enzymes, and regulation of expression have also become parts of the current proposal.

  4. Evolution of a Biosynthetic Temporary Skin Substitute: A Preliminary Study

    PubMed Central

    Phipps, Richard; Woeller, Collynn; Rodeheaver, George; Naughton, Gail K.; Piney, Emmett; Hickerson, William; Branski, Ludwik; Holmes, James H.

    2015-01-01

    Objective: To compare PermeaDerm to first temporary biosynthetic skin substitute (Biobrane, cleared by the Food and Drug Administration in 1979). Methods: Different temporary skin substitutes (Biobrane, PermeaDerm, and PermeaDerm derivatives) were tested for physical differences, impact on healing wounds, inflammatory response, and ability to allow adequate growth of dermal fibroblasts and mesenchymal stem cells without accumulation of excessive scar-forming myofibroblasts. Proliferation of fibroblasts and stem cells on various skin substitutes was measured, and myofibroblast marker accumulation was evaluated by the expression of α-smooth muscle actin and fibronectin. Fibroblast migration was measured by tracking viable cells with MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] dye. Results: In vivo testing shows PermeaDerm works well as a temporary skin substitute, performing better than Biobrane with respect to inflammation and fluid accumulation. Tissue culture techniques revealed that cells on PermeaDerm grow in a more uniform fashion and migrated to a greater extent than cells on Biobrane. Furthermore, cells grown in the presence of PermeaDerm expressed lower levels of the myofibroblast markers α-smooth muscle actin and fibronectin than cells grown on Biobrane. Conclusion: PermeaDerm with variable porosity possesses all attributes and properties known to be important for a successful temporary skin substitute and enables the clinician to control porosity from essentially zero to what the wound requires. The ability of the clinician to minimize wound desiccation without fluid accumulation is related to the reduction of punctate scarring. PMID:26229573

  5. 104. JOB NO. 1347F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    104. JOB NO. 1347-F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD MOTOR COMPANY; LONGITUDINAL SECTION AND TRUSS DETAILS - Ford Motor Company Long Beach Assembly Plant, Assembly Building, 700 Henry Ford Avenue, Long Beach, Los Angeles County, CA

  6. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  7. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    NASA Technical Reports Server (NTRS)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  8. Nucleotide sequence of 5S ribosomal RNA from Aspergillus nidulans and Neurospora crassa.

    PubMed Central

    Piechulla, B; Hahn, U; McLaughlin, L W; Küntzel, H

    1981-01-01

    The nucleotide sequences of 5S rRNA molecules isolated from the cytosol and the mitochondria of the ascomycetes A. nidulans and N. crassa were determined by partial chemical cleavage of 3'-terminally labelled RNA. The sequence identity of the cytosolic and mitochondrial RNA preparations confirms the absence of mitochondrion-specific 5S rRNA in these fungi. The sequences of the two organisms differ in 35 positions, and each sequence differs from yeast 5S rRNA in 44 positions. Both molecules contain the sequence GCUC in place of GAAC or GAUY found in all other 5S rRNAs, indicating that this region is not universally involved in base-pairing to the invariant GTpsiC sequence of tRNAs. Images PMID:6453331

  9. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    PubMed

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p< 0.001). After the implementation of 5S it was observed and determined that facilitating the job and setting up a safe environment created

  10. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  11. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  12. 5 S Rrna Is Involved in Fidelity of Translational Reading Frame

    PubMed Central

    Dinman, J. D.; Wickner, R. B.

    1995-01-01

    Chromosomal mutants (maintenance of frame = mof) in which the efficiency of -1 ribosomal frame-shifting is increased can be isolated using constructs in which lacZ expression is dependent upon a -1 shift of reading frame. We isolate a new mof mutation, mof9, in Saccharomyces cerevisiae and show that it is complemented by both single and multi-copy 5 S rDNA clones. Two independent insertion mutations in the rDNA locus (rDNA::LEU2 and rDNA::URA3) also display the Mof(-) phenotype and are also complemented by single and multi-copy 5 S rDNA clones. Mutant 5 S rRNAs expressed from a plasmid as 20-50% of total 5 S rRNA in a wild-type host also induced the Mof(-) phenotype. The increase in frameshifting is greatest when the lacZ reporter gene is expressed on a high copy, episomal vector. No differences were found in 5 S rRNA copy number or electrophoretic mobilities in mof9 strains. Both mof9 and rDNA::LEU2 increase the efficiency of +1 frameshifting as well but have no effect on readthrough of UAG or UAA termination codons, indicating that not all translational specificity is affected. These data suggest a role for 5 S rRNA in the maintenance of frame in translation. PMID:8536994

  13. Genomic organization and evolution of the 5S ribosomal DNA in Tilapiini fishes.

    PubMed

    Alves-Costa, F A; Wasko, A P; Oliveira, C; Foresti, F; Martins, C

    2006-05-01

    5S rDNA sequences present an intense dynamism and have proved to be valuable as genetic markers to distinguish closed related species and also in the understanding of the evolutionary dynamic of repetitive sequences in the genomes. In order to identify patterns of 5S rDNA organization and their evolution in the genome of fish species, such genomic segment was investigated in the tilapias Oreochromis niloticus and Tilapia rendalli, and in the hybrid O. urolepis hornorum x O. mossambicus. A dual 5S rDNA system was identified in the three analyzed tilapia samples. Although each 5S rDNA class was conserved among the three samples, a distinct 5S rDNA genome organization pattern could be evidenced for each sample. The presence of a dual 5S rDNA system seems to be a general trait among non-related teleost fish orders, suggesting that evolutionary events of duplication have occurred before the divergence of the main groups of teleost fishes. PMID:16850228

  14. One-stage surgery through posterior approach-for L5-S1 spondyloptosis

    PubMed Central

    Suslu, Hikmet Turan; Celikoglu, Erhan; Borekcı, Ali; Hıcdonmez, Tufan; Suslu, Hüsnü

    2011-01-01

    Grade 5 spondylolisthesis or spondyloptosis is a rare condition. Generally, the surgical management of spondyloptosis includes multi-staged procedures instead of one-staged procedures. One-stage treatment for spondyloptosis is very rare. A 15-year-old girl with L5-S1 spondyloptosis was admitted with severe low back pain. There was no history of trauma. The patient underwent L5 laminectomy, L5-S1 discectomy, resection of sacral dome, reduction, L3-L4-L5-S1 pedicular screw fixation, and interbody-posterolateral fusion through the posterior approach. The reduction was maintained with bilateral L5-S1 discectomy, resection of the sacral dome, and transpedicular instrumentation from L3 to S1. In this particular case, one-staged approach was adequate for the treatment of L5-S1 spondyloptosis. One-staged surgery using the posterior approach may be adequate for the treatment of L5-S1 spondyloptosis while avoiding the risks inherent in anterior approaches. PMID:23125496

  15. Direct 5S rRNA Assay for Monitoring Mixed-Culture Bioprocesses

    PubMed Central

    Stoner, D. L.; Browning, C. K.; Bulmer, D. K.; Ward, T. E.; MacDonell, M. T.

    1996-01-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species extracted from collected biomass. Separation is based on the unique migration behavior of each 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the genera Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. PMID:16535333

  16. Biosynthetic Pathway Analysis for Improving the Cordycepin and Cordycepic Acid Production in Hirsutella sinensis.

    PubMed

    Lin, Shan; Liu, Zhi-Qiang; Xue, Ya-Ping; Baker, Peter James; Wu, Hui; Xu, Feng; Teng, Yi; Brathwaite, Mgavi Elombe; Zheng, Yu-Guo

    2016-06-01

    Hirsutella sinensis is considered as the only correct anamorph of Ophiocordyceps sinensis. To improve cordycepin and cordycepic acid production in H. sinensis, the biosynthetic pathways of cordycepin and cordycepic acid were predicted, and verified by cloning and expressing genes involved in these pathways, respectively. Then, 5'-nucleotidase participating in biosynthetic pathway of cordycepin, hexokinase, and glucose phosphate isomerase involved in biosynthetic pathway of cordycepic acid, were demonstrated playing important roles in the corresponding biosynthetic pathway by real-time PCR, accompanying with significantly up-regulated 15.03-, 5.27-, and 3.94-fold, respectively. Moreover, the metabolic regulation of H. sinensis was performed. As expected, cordycepin production reached 1.09 mg/g when additional substrate of 5'-nucleotidase was 4 mg/mL, resulting in an increase of 201.1 % compared with the control. In the same way, cordycepic acid production reached 26.6 and 23.4 % by adding substrate of hexokinase or glucose phosphate isomerase, leading to a rise of 77.3 and 55.1 %, respectively. To date, this is the first time to improve cordycepin and cordycepic acid production through metabolic regulation based on biosynthetic pathway analysis, and metabolic regulation is proved as a simple and effective way to enhance the output of cordycepin and cordycepic acid in submerged cultivation of H. sinensis. PMID:26922724

  17. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  18. Chromosomal localization and sequence variation of 5S rRNA gene in five Capsicum species.

    PubMed

    Park, Y K; Park, K C; Park, C H; Kim, N S

    2000-02-29

    Chromosomal localization and sequence analysis of the 5S rRNA gene were carried out in five Capsicum species. Fluorescence in situ hybridization revealed that chromosomal location of the 5S rRNA gene was conserved in a single locus at a chromosome which was assigned to chromosome 1 by the synteny relationship with tomato. In sequence analysis, the repeating units of the 5S rRNA genes in the Capsicum species were variable in size from 278 bp to 300 bp. In sequence comparison of our results to the results with other Solanaceae plants as published by others, the coding region was highly conserved, but the spacer regions varied in size and sequence. T stretch regions, just after the end of the coding sequences, were more prominant in the Capsicum species than in two other plants. High G x C rich regions, which might have similar functions as that of the GC islands in the genes transcribed by RNA PolII, were observed after the T stretch region. Although we could not observe the TATA like sequences, an AT rich segment at -27 to -18 was detected in the 5S rRNA genes of the Capsicum species. Species relationship among the Capsicum species was also studied by the sequence comparison of the 5S rRNA genes. While C. chinense, C. frutescens, and C. annuum formed one lineage, C. baccatum was revealed to be an intermediate species between the former three species and C. pubescens. PMID:10774742

  19. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    PubMed

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit. PMID:27106499

  20. Affinity chromatography of Drosophila melanogaster ribosomal proteins to 5S rRNA.

    PubMed

    Stark, B C; Chooi, W Y

    1985-02-20

    The binding of Drosophila melanogaster ribosomal proteins to D. melanogaster 5S rRNA was studied using affinity chromatography of total ribosomal proteins (TP80) on 5S rRNA linked via adipic acid dihydrazide to Sepharose 4B. Ribosomal proteins which bound 5S rRNA at 0.3 M potassium chloride and were eluted at 1 M potassium chloride were identified as proteins 1, L4, 2/3, L14/L16, and S1, S2, S3, S4, S5, by two-dimensional polyacrylamide gel electrophoresis. Using poly A-Sepharose 4B columns as a model of non-specific binding, we found that a subset of TP80 proteins is also bound. This subset, while containing some of the proteins bound by 5S rRNA columns, was distinctly different from the latter subset, indicating that the binding to 5S rRNA was specific for that RNA species. PMID:3923010

  1. Biosynthetic origins of the epoxyquinone skeleton in epoxyquinols A and B.

    PubMed

    Fujita, Katsuki; Ishikawa, Fumihiro; Kakeya, Hideaki

    2014-12-26

    The biosynthetic origins of epoxyquinols A (1) and B (2) produced by an unidentified fungus have attracted considerable interest because these compounds could be assembled from a biosynthetic precursor, epoxycyclohexenone aldehyde (3), via an electrocyclization/intermolecular Diels-Alder dimerization cascade reaction. Furthermore, very little is known about the biosynthetic origins of naturally occurring epoxyquinone moieties. We herein describe the incorporation of (13)C at specific positions within the structure of a shunt product, epoxycyclohexenone (4), using stable isotope feeding experiments with sodium [1-(13)C]-acetate and sodium [1,2-(13)C2]-acetate. The results of these experiments strongly suggest that the epoxyquinone skeleton is assembled by a polyketide synthase. PMID:25470317

  2. Assembly of a novel biosynthetic pathway for production of the plant flavonoid fisetin in Escherichia coli.

    PubMed

    Stahlhut, Steen G; Siedler, Solvej; Malla, Sailesh; Harrison, Scott J; Maury, Jérôme; Neves, Ana Rute; Forster, Jochen

    2015-09-01

    Plant secondary metabolites are an underutilized pool of bioactive molecules for applications in the food, pharma and nutritional industries. One such molecule is fisetin, which is present in many fruits and vegetables and has several potential health benefits, including anti-cancer, anti-viral and anti-aging activity. Moreover, fisetin has recently been shown to prevent Alzheimer's disease in mice and to prevent complications associated with diabetes type I. Thus far the biosynthetic pathway of fisetin in plants remains elusive. Here, we present the heterologous assembly of a novel fisetin pathway in Escherichia coli. We propose a novel biosynthetic pathway from the amino acid, tyrosine, utilizing nine heterologous enzymes. The pathway proceeds via the synthesis of two flavanones never produced in microorganisms before--garbanzol and resokaempferol. We show for the first time a functional biosynthetic pathway and establish E. coli as a microbial platform strain for the production of fisetin and related flavonols. PMID:26192693

  3. Localization and interactions between Arabidopsis auxin biosynthetic enzymes in the TAA/YUC-dependent pathway.

    PubMed

    Kriechbaumer, Verena; Botchway, Stanley W; Hawes, Chris

    2016-07-01

    The growth regulator auxin is involved in all key developmental processes in plants. A complex network of a multiplicity of potential biosynthetic pathways as well as transport, signalling plus conjugation and deconjugation lead to a complex and multifaceted system system for auxin function. This raises the question how such a system can be effectively organized and controlled. Here we report that a subset of auxin biosynthetic enzymes in the TAA/YUC route of auxin biosynthesis is localized to the endoplasmic reticulum (ER). ER microsomal fractions also contain a significant percentage of auxin biosynthetic activity. This could point toward a model of auxin function using ER membrane location and subcellular compartmentation for supplementary layers of regulation. Additionally we show specific protein-protein interactions between some of the enzymes in the TAA/YUC route of auxin biosynthesis. PMID:27208541

  4. Volatile terpenes from actinomycetes: a biosynthetic study correlating chemical analyses to genome data.

    PubMed

    Rabe, Patrick; Citron, Christian A; Dickschat, Jeroen S

    2013-11-25

    The volatile terpenes of 24 actinomycetes whose genomes have been sequenced (or are currently being sequenced) were collected by use of a closed-loop stripping apparatus and identified by GC/MS. The analytical data were compared against a phylogenetic analysis of all 192 currently available sequences of bacterial terpene cyclases (excluding geosmin and 2-methylisoborneol synthases). In addition to the several groups of terpenes with known biosynthetic origin, selinadienes were identified as a large group of biosynthetically related sesquiterpenes that are produced by several streptomycetes. The detection of a large number of previously unrecognised side products of known terpene cyclases proved to be particularly important for an in depth understanding of biosynthetic pathways to known terpenes in actinomycetes. Interpretation of the chemical analytical data in the context of the phylogenetic tree of bacterial terpene cyclases pointed to the function of three new enzymes: (E)-β-caryophyllene synthase, selina-3,7(11)-diene synthase and aristolochene synthase. PMID:24243698

  5. Comprehensive curation and analysis of fungal biosynthetic gene clusters of published natural products.

    PubMed

    Li, Yong Fuga; Tsai, Kathleen J S; Harvey, Colin J B; Li, James Jian; Ary, Beatrice E; Berlew, Erin E; Boehman, Brenna L; Findley, David M; Friant, Alexandra G; Gardner, Christopher A; Gould, Michael P; Ha, Jae H; Lilley, Brenna K; McKinstry, Emily L; Nawal, Saadia; Parry, Robert C; Rothchild, Kristina W; Silbert, Samantha D; Tentilucci, Michael D; Thurston, Alana M; Wai, Rebecca B; Yoon, Yongjin; Aiyar, Raeka S; Medema, Marnix H; Hillenmeyer, Maureen E; Charkoudian, Louise K

    2016-04-01

    Microorganisms produce a wide range of natural products (NPs) with clinically and agriculturally relevant biological activities. In bacteria and fungi, genes encoding successive steps in a biosynthetic pathway tend to be clustered on the chromosome as biosynthetic gene clusters (BGCs). Historically, "activity-guided" approaches to NP discovery have focused on bioactivity screening of NPs produced by culturable microbes. In contrast, recent "genome mining" approaches first identify candidate BGCs, express these biosynthetic genes using synthetic biology methods, and finally test for the production of NPs. Fungal genome mining efforts and the exploration of novel sequence and NP space are limited, however, by the lack of a comprehensive catalog of BGCs encoding experimentally-validated products. In this study, we generated a comprehensive reference set of fungal NPs whose biosynthetic gene clusters are described in the published literature. To generate this dataset, we first identified NCBI records that included both a peer-reviewed article and an associated nucleotide record. We filtered these records by text and homology criteria to identify putative NP-related articles and BGCs. Next, we manually curated the resulting articles, chemical structures, and protein sequences. The resulting catalog contains 197 unique NP compounds covering several major classes of fungal NPs, including polyketides, non-ribosomal peptides, terpenoids, and alkaloids. The distribution of articles published per compound shows a bias toward the study of certain popular compounds, such as the aflatoxins. Phylogenetic analysis of biosynthetic genes suggests that much chemical and enzymatic diversity remains to be discovered in fungi. Our catalog was incorporated into the recently launched Minimum Information about Biosynthetic Gene cluster (MIBiG) repository to create the largest known set of fungal BGCs and associated NPs, a resource that we anticipate will guide future genome mining and

  6. Plug-and-Play Benzylisoquinoline Alkaloid Biosynthetic Gene Discovery in Engineered Yeast.

    PubMed

    Morris, J S; Dastmalchi, M; Li, J; Chang, L; Chen, X; Hagel, J M; Facchini, P J

    2016-01-01

    Benzylisoquinoline alkaloid (BIA) metabolism has been the focus of a considerable research effort over the past half-century, primarily because of the pharmaceutical importance of several compounds produced by opium poppy (Papaver somniferum). Advancements in genomics technologies have substantially accelerated the rate of gene discovery over the past decade, such that most biosynthetic enzymes involved in the formation of the major alkaloids of opium poppy have now been isolated and partially characterized. Not unexpectedly, the availability of all perceived biosynthetic genes has facilitated the reconstitution of several BIA pathways in microbial hosts, including yeast (Saccharomyces cerevisiae). Product yields are currently insufficient to consider the commercial production of high-value BIAs, such as morphine. However, the rudimentary success demonstrated by the uncomplicated and routine assembly of a multitude of characterized BIA biosynthetic genes provides a valuable gene discovery tool for the rapid functional identification of the plethora of gene candidates available through increasingly accessible genomic, transcriptomic, and proteomic databases. BIA biosynthetic gene discovery represents a substantial research opportunity largely owing to the wealth of existing enzyme data mostly obtained from a single plant species. Functionally novel enzymes and variants with potential metabolic engineering applications can be considered the primary targets. Selection of candidates from sequence repositories is facilitated by the monophyletic relationship among biosynthetic genes belonging to a wide range of enzyme families, such as the numerous cytochromes P450 and AdoMet-dependent O- and N-methyltransferases that operate in BIA metabolism. We describe methods for the rapid functional screening of uncharacterized gene candidates encoding potential BIA biosynthetic enzymes using yeast strains engineered to perform selected metabolic conversions. As an initial

  7. Polyketide synthase chemistry does not direct biosynthetic divergence between 9- and 10-membered enediynes.

    PubMed

    Horsman, Geoff P; Chen, Yihua; Thorson, Jon S; Shen, Ben

    2010-06-22

    Enediynes are potent antitumor antibiotics that are classified as 9- or 10-membered according to the size of the enediyne core structure. However, almost nothing is known about enediyne core biosynthesis, and the determinants of 9- versus 10-membered enediyne core biosynthetic divergence remain elusive. Previous work identified enediyne-specific polyketide synthases (PKSEs) that can be phylogenetically distinguished as being involved in 9- versus 10-membered enediyne biosynthesis, suggesting that biosynthetic divergence might originate from differing PKSE chemistries. Recent in vitro studies have identified several compounds produced by the PKSE and associated thioesterase (TE), but condition-dependent product profiles make it difficult to ascertain a true catalytic difference between 9- and 10-membered PKSE-TE systems. Here we report that PKSE chemistry does not direct 9- versus 10-membered enediyne core biosynthetic divergence as revealed by comparing the products from three 9-membered and two 10-membered PKSE-TE systems under identical conditions using robust in vivo assays. Three independent experiments support a common catalytic function for 9- and 10-membered PKSEs by the production of a heptaene metabolite from: (i) all five cognate PKSE-TE pairs in Escherichia coli; (ii) the C-1027 and calicheamicin cognate PKSE-TEs in Streptomyces lividans K4-114; and (iii) selected native producers of both 9- and 10-membered enediynes. Furthermore, PKSEs and TEs from different 9- and 10-membered enediyne biosynthetic machineries are freely interchangeable, revealing that 9- versus 10-membered enediyne core biosynthetic divergence occurs beyond the PKSE-TE level. These findings establish a starting point for determining the origins of this biosynthetic divergence. PMID:20534556

  8. Photoionization study of Xe 5s: ionization cross sections and photoelectron angular distributions

    NASA Astrophysics Data System (ADS)

    Aarthi, G.; Jose, J.; Deshmukh, S.; Radojevic, V.; Deshmukh, P. C.; Manson, S. T.

    2014-01-01

    We report studies of photoelectron angular distribution and cross-section for photoionization of xenon 5s electrons using the relativistic multiconfiguration Tamm-Dancoff (MCTD) approximation. We find that MCTD provides a significantly improved agreement with experiment, compared to some of the other relativistic many body approximations such as the relativistic random phase approximation and the relativistic random phase approximation with relaxation, over the entire photon energy region bracketing the near-threshold 5s Cooper minimum, from the 5s threshold up to about 70 eV. The MCTD results in the length form are in much better agreement with the experiment than those in the velocity form, suggesting residual correlations that must be of importance.

  9. 4.5S ribonucleic acid, a novel ribosome component in the chloroplasts of flowering plants.

    PubMed Central

    Bowman, C M; Dyer, T A

    1979-01-01

    A species of low-molecular-weight ribosomal RNA, referred to as '4.5S rRNA', was found in addition to 5S rRNA in the large subunit of chloroplast ribosomes of a wide range of flowering plants. It was shown by sequence analysis that several variants of this RNA may occur in a plant. Furthermore, although in most flowering plants the predominant variant contains about 100 nucleotides, in the broad bean it has less than 80. It seems, therefore, to be much more diverse in size and sequence than the other ribosomal RNA species. Like 5S rRNA , it does not contain modified nucleotides and it is also unusual in having an unphosphorylated 5'-end. It is apparently neither a homologue of cytosol 5.8S rRNA nor a fragment of 23S rRNA. Images Fig. 1. Fig. 3. Fig. 4. PMID:540035

  10. Diversity of 5S rRNA genes within individual prokaryotic genomes

    PubMed Central

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V.; Parsons, Tamasha; Yang, Liying; Gerz, Erika A.; Lee, Peng; Xiang, Charlie; Nossa, Carlos W.; Pei, Zhiheng

    2012-01-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1168 genomes from 779 unique species, 96 species exhibited >3% diversity. Twenty seven species with >10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there were tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level. There is supplementary material. PMID:22765222

  11. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    NASA Technical Reports Server (NTRS)

    Luehrsen, K. R.; Fox, G. E.

    1981-01-01

    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  12. Characterization of the L4-L5-S1 motion segment using the stepwise reduction method.

    PubMed

    Jaramillo, Héctor Enrique; Puttlitz, Christian M; McGilvray, Kirk; García, José J

    2016-05-01

    The two aims of this study were to generate data for a more accurate calibration of finite element models including the L5-S1 segment, and to find mechanical differences between the L4-L5 and L5-S1 segments. Then, the range of motion (ROM) and facet forces for the L4-S1 segment were measured using the stepwise reduction method. This consists of sequentially testing and reducing each segment in nine stages by cutting the ligaments, facet capsules, and removing the nucleus. Five L4-S1 human segments (median: 65 years, range: 53-84 years, SD=11.0 years) were loaded under a maximum pure moment of 8Nm. The ROM was measured using stereo-photogrammetry via tracking of three markers and the facet contact forces (CF) were measured using a Tekscan system. The ROM for the L4-L5 segment and all stages showed good agreement with published data. The major differences in ROM between the L4-L5 and L5-S1 segments were found for lateral bending and all stages, for which the L4-L5 ROM was about 1.5-3 times higher than that of the L5-S1 segment, consistent with L5-S1 facet CF about 1.3 to 4 times higher than those measured for the L4-L5 segment. For the other movements and few stages, the L4-L5 ROM was significantly lower that of the L5-S1 segment. ROM and CF provide important baseline data for more accurate calibration of FE models and to understand the role that their structures play in lower lumbar spine mechanics. PMID:27017302

  13. [Methods of advanced purification-the challenge for biosynthetic antibiotics industry].

    PubMed

    Oniscu, C; Caşcaval, D; Galaction, Anca-Irina

    2002-01-01

    Reactive extraction, permeation through liquid membranes and direct extraction are some of the new techniques applied for separation and advanced purification of biosynthetic antibiotics. Compared with the conventional separation techniques, the main advantages of these extraction methods are: high separation efficiency, the avoidance of antibiotics chemical and thermal inactivation, high purity of obtained antibiotics. Furthermore, using reactive extraction or permeation through liquid membrane, the antibiotics can be selective separated from their biosynthesis precursors or from the secondary biosynthetic compounds. This paper is a review on separation of Penicillins and Erythromycin by means of these extraction techniques, being underlined their advantages, applications and problems concerning the separation process scale-up. PMID:12638304

  14. The development and use of a general route to brassinolide, its biosynthetic precursors, metabolites and analogues.

    PubMed

    Hurski, A L; Ermolovich, Yu V; Zhabinskii, V N; Khripach, V A

    2015-02-01

    A new method for the construction of steroid side chains through the addition of lithium salts of dithianes to a C-22 aldehyde was developed. An efficient one-pot procedure for the preparation of a suitable C-22 aldehyde from commercial epibrassinolide in three steps in 86% isolated yield was described. Enantioselective hydroxymethylation of isovaleraldehyde and Kulinkovich cyclopropanation of silylated Roche esters were used as key steps for the dithiane syntheses. The method was applied for the preparation of brassinolide, its biosynthetic precursors and metabolites. In addition, a number of brassinosteroids with a double bond in the side chain were prepared as precursors for tritiated derivatives for biosynthetic studies. PMID:25473936

  15. Human Genetic Disorders Caused by Mutations in Genes Encoding Biosynthetic Enzymes for Sulfated Glycosaminoglycans*

    PubMed Central

    Mizumoto, Shuji; Ikegawa, Shiro; Sugahara, Kazuyuki

    2013-01-01

    A number of genetic disorders are caused by mutations in the genes encoding glycosyltransferases and sulfotransferases, enzymes responsible for the synthesis of sulfated glycosaminoglycan (GAG) side chains of proteoglycans, including chondroitin sulfate, dermatan sulfate, and heparan sulfate. The phenotypes of these genetic disorders reflect disturbances in crucial biological functions of GAGs in human. Recent studies have revealed that mutations in genes encoding chondroitin sulfate and dermatan sulfate biosynthetic enzymes cause various disorders of connective tissues. This minireview focuses on growing glycobiological studies of recently described genetic diseases caused by disturbances in biosynthetic enzymes for sulfated GAGs. PMID:23457301

  16. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    NASA Technical Reports Server (NTRS)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  17. Variability in mycotoxin biosynthetic genes and gene clusters in Fusarium and its implications for mycotoxin contamination of crops

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Fusarium metabolites fumonisins and trichothecenes are among the mycotoxins of greatest concern to food and feed safety worldwide. As with other fungal secondary metabolites, mycotoxin biosynthetic genes are often located adjacent to one another in gene clusters. Thus, fumonisin biosynthetic gen...

  18. Effects of overexpressing individual lignin biosynthetic enzymes on feeding and growth of corn earworms and fall armyworms

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lignin is an important insect resistance component of plants. Enhancing or disrupting the lignin biosynthetic pathway for different bioenergy uses may alter pest resistance. The lignin biosynthetic pathway is complex, and a number of pathway compounds are also involved in the biosynthesis of simpler...

  19. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON QSAR

    EPA Science Inventory

    Dyer, S.D., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to predict HC5's Based on QSARs (Abstract). To be presented at the SETAC Europe 14th Annual Meeting: Environmental Science Solution: A Pan-European Perspective, 18-...

  20. Sacrum fracture following L5-S1 stand-alone interbody fusion for isthmic spondylolisthesis.

    PubMed

    Phan, Kevin; Mobbs, Ralph J

    2015-11-01

    We report a 72-year-old man with a rare sacral fracture following stand-alone L5-S1 anterior lumbar interbody fusion for isthmic spondylolisthesis. The man underwent a minimally invasive management strategy using posterior percutaneous pedicle fixation and partial reduction of the deformity. We also discuss the current literature on fusion procedures for isthmic spondylolisthesis. PMID:26100158

  1. 5. S U.S. HIGHWAY 34 AND EAST (ILLINOIS) APPROACH TO ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. S U.S. HIGHWAY 34 AND EAST (ILLINOIS) APPROACH TO BRIDGE WITH EAST BRIDGE HOUSE IN RIGHT FOREGROUND. VIEW TO WEST. - MacArthur Bridge, Spanning Mississippi River on Highway 34 between IA & IL, Burlington, Des Moines County, IA

  2. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON MINIMAL DATA

    EPA Science Inventory

    Dyer, S., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to Predict HC5's Based on Minimal Data (Abstract). To be presented at the SETAC Fourth World Congress, 14-18 November 2004, Portland, OR. 1 p. (ERL,GB R1013).

  3. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    PubMed

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-04-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS. PMID:26488198

  4. [Analysis of 5S rDNA changes in synthetic allopolyploids Triticum x Aegilops].

    PubMed

    Shcherban', A B; Sergeeva, E M; Badaeva, E D; Salina, E A

    2008-01-01

    By the example of three synthetic allopolyploids: Aegilops sharonensis x Ae. umbellulata (2n =28), Triticum urartu x Ae. tauschii (2n =28), T. dicoccoides x Ae. tauschii (2n =42) the 5S rDNA changes at the early stage of allopolyploidization were investigated. Using fluorescent in situ hybridization (FISH), the quantitative changes affecting the separate loci of one of the parental genomes were revealed in plants of S3 generation of each hybrid combination. Souther hybridization with genomic DNA of allopolyploid T. urartu x Ae. tauschii (TMU38 x TQ27) revealed lower intensity of the fragments from Ae. tauschii compared with the T. urartu fragments. It may be confirmation of the reduction of signal on 1D chromosome that was revealed in this hybrid using FISH. Both appearance of a new 5S rDNA fragments and full disappearance of fragments from parental species were not showed by Southern hybridization, as well as PCR-analysis of 5-15 plants of S2-S3 generations. The changes were not found under comparison of primary structure of nine 5S rDNA sequences of allopolyploid TMU38 x TQ27 with analogous sequences from parental species genomes. The observable similarity by FISH results of one of the studied synthetic allopolyploids with natural allopolyploid of similar genome composition indicates the early formation of unique for each allopolyploid 5S rDNA organization. PMID:18856060

  5. Nucleotide sequences of 5S rRNAs from four jellyfishes.

    PubMed

    Hori, H; Ohama, T; Kumazaki, T; Osawa, S

    1982-11-25

    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica. PMID:6130512

  6. Adaptation of the S-5-S pendulum seismometer for measurement of rotational ground motion

    NASA Astrophysics Data System (ADS)

    Knejzlík, Jaromír; Kaláb, Zdeněk; Rambouský, Zdeněk

    2012-10-01

    The Russian electrodynamic seismometer model S-5-S has been adapted for the measurement of rotational ground motion. The mechanical system of the original S-5-S seismometer consists of electrodynamic sensing and damping transducer coils mounted on an asymmetrical double-arm pendulum. This pendulum is suspended on a footing using two pairs of crossed flat springs, which operate as the axis of rotation. The pendulum is stabilised by an additional spring. The S-5-S can be used either as a vertical or as a horizontal sensor. The adaptation of the S-5-S seismometer described below involves removal of the additional spring and installation of an additional mass on the damping arm. Strain gauge angle sensors are installed on one pair of the crossed flat springs. The main dynamic parameters of the rotational seismometer created in this way, i.e. the natural period and damping, are controlled electronically by feedback currents proportional to the angular displacement and angular velocity, both fed to the damping transducer coil. This new seismometer, named the S-5-SR, enables measurement of the rotational component of ground motion around the horizontal or the vertical axes. The output signal from this S-5-SR seismometer can be proportional either to rotational displacement or rotational velocity.

  7. Accumulation of Rutin and Betulinic Acid and Expression of Phenylpropanoid and Triterpenoid Biosynthetic Genes in Mulberry (Morus alba L.).

    PubMed

    Zhao, Shicheng; Park, Chang Ha; Li, Xiaohua; Kim, Yeon Bok; Yang, Jingli; Sung, Gyoo Byung; Park, Nam Il; Kim, Soonok; Park, Sang Un

    2015-09-30

    Mulberry (Morus alba L.) is used in traditional Chinese medicine and is the sole food source of the silkworm. Here, 21 cDNAs encoding phenylpropanoid biosynthetic genes and 21 cDNAs encoding triterpene biosynthetic genes were isolated from mulberry. The expression levels of genes involved in these biosynthetic pathways and the accumulation of rutin, betulin, and betulinic acid, important secondary metabolites, were investigated in different plant organs. Most phenylpropanoid and triterpene biosynthetic genes were highly expressed in leaves and/or fruit, and most genes were downregulated during fruit ripening. The accumulation of rutin was more than fivefold higher in leaves than in other organs, and higher levels of betulin and betulinic acid were found in roots and leaves than in fruit. By comparing the contents of these compounds with gene expression levels, we speculate that MaUGT78D1 and MaLUS play important regulatory roles in the rutin and betulin biosynthetic pathways. PMID:26343778

  8. Heterologous stable expression of terpenoid biosynthetic genes using the moss Physcomitrella patens.

    PubMed

    Bach, Søren Spanner; King, Brian Christopher; Zhan, Xin; Simonsen, Henrik Toft; Hamberger, Björn

    2014-01-01

    Heterologous and stable expression of genes encoding terpenoid biosynthetic enzymes in planta is an important tool for functional characterization and is an attractive alternative to expression in microbial hosts for biotechnological production. Despite improvements to the procedure, such as streamlining of large scale Agrobacterium infiltration and upregulation of the upstream pathways, transient in planta heterologous expression quickly reaches limitations when used for production of terpenoids. Stable integration of transgenes into the nuclear genome of the moss Physcomitrella patens has already been widely recognized as a viable alternative for industrial-scale production of biopharmaceuticals. For expression of terpenoid biosynthetic genes, and reconstruction of heterologous pathways, Physcomitrella has unique attributes that makes it a very promising biotechnological host. These features include a high native tolerance to terpenoids, a simple endogenous terpenoid profile, convenient genome editing using homologous recombination, and cultivation techniques that allow up-scaling from single cells in microtiter plates to industrial photo-bioreactors. Beyond its use for functional characterization of terpenoid biosynthetic genes, engineered Physcomitrella can be a green biotechnological platform for production of terpenoids. Here, we describe two complementary and simple procedures for stable nuclear transformation of Physcomitrella with terpenoid biosynthetic genes, selection and cultivation of transgenic lines, and metabolite analysis of terpenoids produced in transgenic moss lines. We also provide tools for metabolic engineering through genome editing using homologous recombination. PMID:24777804

  9. Investigation of Patulin and its Biosynthetic Precursors by Density Functional Methods

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Production of the toxin patulin by fungi that contaminate fruit and vegetable products is a food safety concern, especially for decaying apples. Reducing exposure to this regulated mycotoxin can be complicated by post-harvest biosynthesis during storage and processing. These biosynthetic pathways ...

  10. Localization of the pre-squalene segment of the isoprenoid biosynthetic pathway in mammalian peroxisomes.

    PubMed

    Kovacs, Werner J; Tape, Khanichi N; Shackelford, Janis E; Duan, Xueying; Kasumov, Takhar; Kelleher, Joanne K; Brunengraber, Henri; Krisans, Skaidrite K

    2007-03-01

    Previous studies have indicated that the early steps in the isoprenoid/cholesterol biosynthetic pathway occur in peroxisomes. However, the role of peroxisomes in cholesterol biosynthesis has recently been questioned in several reports concluding that three of the peroxisomal cholesterol biosynthetic enzymes, namely mevalonate kinase, phosphomevalonate kinase, and mevalonate diphosphate decarboxylase, do not localize to peroxisomes in human cells even though they contain consensus peroxisomal targeting signals. We re-investigated the subcellular localization of the cholesterol biosynthetic enzymes of the pre-squalene segment in human cells by using new stable isotopic techniques and data computations with isotopomer spectral analysis, in combination with immunofluorescence and cell permeabilization techniques. Our present findings clearly show and confirm previous studies that the pre-squalene segment of the cholesterol biosynthetic pathway is localized to peroxisomes. In addition, our data are consistent with the hypothesis that acetyl-CoA derived from peroxisomal beta-oxidation of very long-chain fatty acids and medium-chain dicarboxylic acids is preferentially channeled to cholesterol synthesis inside the peroxisomes without mixing with the cytosolic acetyl-CoA pool. PMID:17180682

  11. Sugars as the Optimal Biosynthetic Carbon Substrate of Aqueous Life throughout the Universe

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1999-01-01

    Our previous analysis of the energetics of metabolism showed that both the biosynthesis of amino acids and lipids from sugars, and the fermentation of organic substrates, were energetically driven by electron transfer reactions resulting in carbon redox disproportionation (Weber 1997). Redox disproportionation -- the spontaneous (energetically favorable) direction of carbon group transformation in biosynthesis -- is brought about and driven by the energetically downhill transfer of electron pairs from more oxidized carbon groups (with lower half-cell reduction potentials) to more reduced carbon groups (with higher half-cell reduction potentials). In this report, we compare the redox and kinetic properties of carbon groups in order to evaluate the relative biosynthetic capability of organic substrates, and to identify the optimal biosubstrate. This analysis revealed that sugars (monocarbonyl alditols) are the optimal biosynthetic substrate because they contain the maximum number of biosynthetically useful .high energy electrons/carbon atom , while still containing a single carbonyl group needed to kinetically facilitate their conversion to useful biosynthetic intermediates. This conclusion applies to aqueous life throughout the Universe because it is based on invariant aqueous carbon chemistry -- primarily, the universal reduction potentials of carbon groups.

  12. Quantification of trichothecene biosynthetic genes during the growth cycle of Fusarium sporotrichioides in culture

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Trichothecene mycotoxins are secondary metabolites produced by several species of phytopathogenic fungi, and are potent inhibitors of protein biosynthesis. The genes involved in the biosynthetic pathway of T-2 toxin in Fusarium sporotrichioides have been characterized and are located in four identi...

  13. Asymmetric Total Syntheses of (+)- and (−)-Versicolamide B and Biosynthetic Implications

    PubMed Central

    Miller, Kenneth A.; Tsukamoto, Sachiko; Williams, Robert M.

    2010-01-01

    The Diels-Alder reaction is one of the most well-studied, synthetically useful organic transformations. While a significant number of naturally occurring substances are postulated to arise by biosynthetic Diels-Alder reactions, rigorous confirmation of a mechanistically distinct natural Diels-Alderase enzyme remains elusive. Within this context, several related fungi within the Aspergillus genus produce a number of metabolites of opposite absolute configuration including (+)- or (−)-versicolamide B. These alkaloids are hypothesized to arise via biosynthetic Diels-Alder reactions implying that each Aspergillus species possesses enantiomerically distinct Diels-Alderases. Herein, experimental validation of these biosynthetic proposals via deployment of the IMDA reaction as a key step in the asymmetric total syntheses of (+)- and (−)-versicolamide B is described. Laboratory validation of the proposed biosynthetic Diels-Alder construction, coupled with the secondary metabolite profile of the producing fungi, reveals that each Aspergillus species has evolved enantiomerically distinct indole oxidases, as well as enantiomerically distinct Diels-Alderases. PMID:20300443

  14. Sugars as the optimal biosynthetic carbon substrate of aqueous life throughout the universe

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    2000-01-01

    Our previous analysis of the energetics of metabolism showed that both the biosynthesis of amino acids and lipids from sugars, and the fermentation of organic substrates, were energetically driven by electron transfer reactions resulting in carbon redox disproportionation (Weber, 1997). Redox disproportionation--the spontaneous (energetically favorable) direction of carbon group transformation in biosynthesis--is brought about and driven by the energetically downhill transfer of electron pairs from more oxidized carbon groups (with lower half-cell reduction potentials) to more reduced carbon groups (with higher half-cell reduction potentials). In this report, we compare the redox and kinetic properties of carbon groups in order to evaluate the relative biosynthetic capability of organic substrates, and to identify the optimal biosubstrate. This analysis revealed that sugars (monocarbonyl alditols) are the optimal biosynthetic substrate because they contain the maximum number of biosynthetically useful high energy electrons/carbon atom while still containing a single carbonyl group needed to kinetically facilitate their conversion to useful biosynthetic intermediates. This conclusion applies to aqueous life throughout the Universe because it is based on invariant aqueous carbon chemistry--primarily, the universal reduction potentials of carbon groups.

  15. Altered expression of polyketide biosynthetic gene clusters in fumonisin-deficient mutants of Fusarium verticillioides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Fusarium verticillioides is a pathogen of maize and produces fumonisins, a group of polyketide derived secondary metabolites. Fumonisins cause diseases in animals, and they have been correlated epidemiologically with esophageal cancer and birth defects in humans. Fumonisin biosynthetic genes are c...

  16. Characterization of the fumonisin B2 biosynthetic gene cluster in Aspergillus niger and A. awamori.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aspergillus niger and A. awamori strains isolated from grapes cultivated in Mediterranean basin were examined for fumonisin B2 (FB2) production and presence/absence of sequences within the fumonisin biosynthetic gene (fum) cluster. Presence of 13 regions in the fum cluster was evaluated by PCR assay...

  17. PERTURBATIONS OF THE LIGNIN BIOSYNTHETIC PATHWAY AND THEIR POTENTIAL TO IMPACT PLANT CELL WALL UTILIZATION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The effects on lignification of perturbing most of the genes for enzymes on the monolignol biosynthetic pathway have now been reasonably well studied, particularly in angiosperms. Early studies sought to reduce lignin content with the idea of targeting the key barrier to efficient utilization of pla...

  18. The oxalic acid biosynthetic activity of Burkholderia mallei is encoded by a single locus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Although it is known that oxalic acid provides a selective advantage to the secreting microbe, our understanding of how this acid is biosynthesized remains incomplete. This study reports the identification, cloning, and partial characterization of the oxalic acid biosynthetic enzyme from the animal ...

  19. Variation in the fumonisin biosynthetic gene cluster in fumonisin-producing and nonproducing black aspergilli

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The ability to produce fumonisin mycotoxins varies among members of the black aspergilli. Previously, analyses of selected genes in the fumonisin biosynthetic gene (fum) cluster in black aspergilli from California grapes indicated that fumonisin-nonproducing isolates of Aspergillus welwitschiae lack...

  20. PERTURBATIONS OF THE LIGNIN BIOSYNTHETIC PATHWAY AND THEIR POTENTIAL TO IMPACT PULP AND PAPER PRODUCTION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The effects on lignification of perturbing most of the genes for enzymes on the monolignol biosynthetic pathway have now been reasonably well studied, particularly in angiosperms. Early studies sought to reduce lignin content with the idea of targeting the key barrier to efficient utilization of pla...

  1. Conserved biosynthetic pathways for phosalacine, bialaphos and newly discovered phosphonic acid natural products.

    PubMed

    Blodgett, Joshua A V; Zhang, Jun Kai; Yu, Xiaomin; Metcalf, William W

    2016-01-01

    Natural products containing phosphonic or phosphinic acid functionalities often display potent biological activities with applications in medicine and agriculture. The herbicide phosphinothricin-tripeptide (PTT) was the first phosphinate natural product discovered, yet despite numerous studies, questions remain surrounding key transformations required for its biosynthesis. In particular, the enzymology required to convert phosphonoformate to carboxyphosphonoenolpyruvate and the mechanisms underlying phosphorus methylation remain poorly understood. In addition, the model for non-ribosomal peptide synthetase assembly of the intact tripeptide product has undergone numerous revisions that have yet to be experimentally tested. To further investigate the biosynthesis of this unusual natural product, we completely sequenced the PTT biosynthetic locus from Streptomyces hygroscopicus and compared it with the orthologous cluster from Streptomyces viridochromogenes. We also sequenced and analyzed the closely related phosalacine (PAL) biosynthetic locus from Kitasatospora phosalacinea. Using data drawn from the comparative analysis of the PTT and PAL pathways, we also evaluate three related recently discovered phosphonate biosynthetic loci from Streptomyces sviceus, Streptomyces sp. WM6386 and Frankia alni. Our observations address long-standing biosynthetic questions related to PTT and PAL production and suggest that additional members of this pharmacologically important class await discovery. PMID:26328935

  2. Conserved biosynthetic pathways for phosalacine, bialaphos and newly discovered phosphonic acid natural products

    PubMed Central

    Blodgett, Joshua A. V; Zhang, Jun Kai; Yu, Xiaomin; Metcalf, William W.

    2015-01-01

    Natural products containing phosphonic or phosphinic acid functionalities often display potent biological activities with applications in medicine and agriculture. The herbicide phosphinothricin-tripeptide (PTT) was the first phosphinate natural product discovered, yet despite numerous studies, questions remain surrounding key transformations required for its biosynthesis. In particular, the enzymology required to convert phosphonoformate to carboxyphosphonoenolpyruvate and the mechanisms underlying phosphorus-methylation remain poorly understood. In addition, the model for NRPS assembly of the intact tripeptide product has undergone numerous revisions that have yet to be experimentally tested. To further investigate the biosynthesis of this unusual natural product, we completely sequenced the PTT biosynthetic locus from Streptomyces hygroscopicus and compared it to the orthologous cluster from Streptomyces viridochromogenes. We also sequenced and analysed the closely related phosalacine (PAL) biosynthetic locus from Kitasatospora phosalacinea. Using data drawn from the comparative analysis of the PTT and PAL pathways, we also evaluate three related recently discovered phosphonate biosynthetic loci from Streptomyces sviceus, Streptomyces sp. WM6386 and Frankia alni. Our observations address long-standing biosynthetic questions related to PTT and PAL production and suggest that additional members of this pharmacologically important class await discovery. PMID:26328935

  3. THE ISOAMYL OXIDASE GENE IN PENICILLIUM GRISEOFULVUM IS PART OF THE PATULIN BIOSYNTHETIC PATHWAY

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Genes for the patulin biosynthetic pathway are likely to be arranged in a cluster, as is the case for other mycotoxins. GeneWalking was performed to identify genes both upstream and downstream of the isoepoxydon dehydrogenase (idh) gene in Penicillium griseofulvum NRRL 2159A. A gene with high sequ...

  4. 1s2s2p2 5p3 5S transition in B ii

    NASA Astrophysics Data System (ADS)

    Mannervik, S.; Cederquist, H.; Martinson, I.; Brage, T.; Froese Fischer, C.

    1987-04-01

    An experimental and theoretical study has been made of the 1s2s2p2 5P-1s2p3 5S transition in B ii. The experimental wavelength and lifetime (1323.92+/-0.07 Å and 0.65+/-0.01 ns), determined by beam-foil spectroscopy, are more than five times more accurate than previous experimental results. Our theoretical data, from multiconfiguration Hartree-Fock calculations, 1311.6 Å and 0.601 ns, are in excellent agreement with previous theoretical predictions of Beck and Nicolaides [Phys. Lett. 61A, 227 (1977)]. We have also observed the 1s2p3 5S-1s2p23s 5P transition, at 857.7+/-0.2 Å, in accord with the theoretical value 859.1 Å.

  5. Phylogenetic analysis of the genera Thiobacillus and Thiomicrospira by 5S rRNA sequences.

    PubMed Central

    Lane, D J; Stahl, D A; Olsen, G J; Heller, D J; Pace, N R

    1985-01-01

    5S rRNA nucleotide sequences from Thiobacillus neapolitanus, Thiobacillus ferrooxidans, Thiobacillus thiooxidans, Thiobacillus intermedius, Thiobacillus perometabolis, Thiobacillus thioparus, Thiobacillus versutus, Thiobacillus novellus, Thiobacillus acidophilus, Thiomicrospira pelophila, Thiomicrospira sp. strain L-12, and Acidiphilium cryptum were determined. A phylogenetic tree, based upon comparison of these and other related 5S rRNA sequences, is presented. The results place the thiobacilli, Thiomicrospira spp., and Acidiphilium spp. in the "purple photosynthetic" bacterial grouping which also includes the enteric, vibrio, pseudomonad, and other familiar eubacterial groups in addition to the purple photosynthetic bacteria. The genus Thiobacillus is not an evolutionarily coherent grouping but rather spans the full breadth of the purple photosynthetic bacteria. PMID:3924899

  6. Optical characterization of CuIn5S8 crystals by ellipsometry measurements

    NASA Astrophysics Data System (ADS)

    Isik, Mehmet; Gasanly, Nizami

    2016-04-01

    Optical properties of CuIn5S8 crystals grown by Bridgman method were investigated by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficients were obtained from the analysis of ellipsometry experiments performed in the 1.2-6.2 eV spectral region. Analysis of spectral dependence of the absorption coefficient revealed the existence of direct band gap transitions with energy 1.53 eV. Wemple-DiDomenico and Spitzer-Fan models were used to find the oscillator energy, dispersion energy, zero-frequency refractive index and high-frequency dielectric constant values. Structural properties of the CuIn5S8 crystals were investigated using X-ray diffraction and energy dispersive spectroscopy analysis.

  7. Ellipsometry study of optical parameters of AgIn5S8 crystals

    NASA Astrophysics Data System (ADS)

    Isik, Mehmet; Gasanly, Nizami

    2015-12-01

    AgIn5S8 crystals grown by Bridgman method were characterized for optical properties by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficient were obtained from ellipsometry experiments carried out in the 1.2-6.2 eV range. Direct band gap energy of 1.84 eV was found from the analysis of absorption coefficient vs. photon energy. The oscillator energy, dispersion energy and zero-frequency refractive index, high-frequency dielectric constant values were found from the analysis of the experimental data using Wemple-DiDomenico and Spitzer-Fan models. Crystal structure and atomic composition ratio of the constituent elements in the AgIn5S8 crystal were revealed from structural characterization techniques of X-ray diffraction and energy dispersive spectroscopy.

  8. Three-step laser excitation of the odd-parity 5s5d 3D → 5s nf 3F states of cadmium

    NASA Astrophysics Data System (ADS)

    Nadeem, Ali; Shah, M.; Haq, S. U.; Shahzada, S.; Mumtaz, M.; Waheed, A.; Nawaz, M.; Ahmed, M.; Baig, M. A.

    2014-07-01

    We report new experimental data on the term energies and effective quantum numbers of the highly excited odd parity states of cadmium in the 71 773-72 500 cm-1 energy range. The experiment was performed using three dye lasers simultaneously pumped by the second harmonic (532 nm) of the Nd;YAG laser. The vapor containment and detection system was a thermionic diode ion detector working in a space charge limited mode. The new observations include the 5snf3F3 (12 ⩽ n ⩽ 52), 5snf3F4 (13 ⩽ n ⩽ 33) and 5snf3F2 (12 ⩽ n ⩽ 22) Rydberg series excited from the 5s5d3D multiplet. A two parameter fit to the transitions energies of the 5snf3F3 series yields the binding energy of the 5snd 2D2 level as 13 042.178 ± 0.02 cm-1 and consequently the first ionization of cadmium is determined as 72 540.05 ± 0.13 cm-1, which is in good agreement with the previously reported value.

  9. Interplay of RNA Pol IV and ROS1 during post-embryonic 5S rDNA chromatin remodeling.

    PubMed

    Douet, Julien; Blanchard, Bertrand; Cuvillier, Claudine; Tourmente, Sylvette

    2008-12-01

    We have investigated the chromatin structure of 5S rDNA, a heterochromatic pericentromeric tandemly repeated family, at 2, 3, 4 and 5 days post-germination. Our results revealed a large-scale reorganization of 5S rDNA chromatin that occurs during the first days of development. Unexpectedly, there is a decondensation followed by a 're'condensation of 5S rDNA chromatin, to obtain almost mature nuclei 5 d post-germination. The reorganization of 5S rDNA chromatin is accompanied by a rapid and active demethylation of 5S rDNA mediated by the ROS1 (repressor of silencing 1) demethylase, whereas the plant-specific RNA polymerase IV (Pol IV) is essential to the 5S chromatin 're'condensation. In conclusion, Pol IV and ROS1 collaborate to unlock the 5S rDNA chromatin inherited from the seed, and establish adult features. PMID:18845569

  10. Molecular phylogenetic studies on filarial parasites based on 5S ribosomal spacer sequences.

    PubMed

    Xie, H; Bain, O; Williams, S A

    1994-06-01

    This paper is the first large-scale molecular phylogenetic study on filarial parasites (family Onchocercidae) which includes 16 species of 6 genera: Brugia beaveri Ash et Little, 1962, B. buckleyi Dissanaike et Paramananthan, 1961; B. malayi (Brug, 1927) Buckley, 1960; B. pahangi (Buckley et Edeson, 1956) Buckley, 1960; B. patei (Buckley, Nelson et Heisch, 1958) Buckley, 1960; B. timori Partono et al, 1977; Wuchereria bancrofti (Cobbold, 1877) Seurat, 1921: W. kalimantani Palmieri. Purnomo, Dennis and Marwoto, 1980: Mansonella perstans (Manson, 1891) Eberhard et Orihel, 1984; loa loc, Stiles, 1905; Onchocerca volvulus (Leuckart, 1983) Railliet er Henry, 1910; O. ochengi Bwangamoi, 1969; O. gutturosa Neumann, 1910; Dirofilaria immitis (Leidy, 1856) Railliet e Henry, 1911; Acanthocheilonema viteae (Krepkogorskaya, 1933) Bain, Baker et Chabaud, 1982 and Litomosoides sigmodontis Chandler, 1931. 5S rRNA gene spacer region sequence data were collected by PCR, cloning and dideoxy sequencing. The 5S rRNA gene spacer region sequences were aligned and analyzed by maximum parsimony algorithms, distance methods and maximum likelihood methods to construct phylogenetic trees. Bootstrap analysis was used to test the robustness of the different phylogenetic reconstructions. The data indicated that 5S spacer region sequences are highly conserved within species yet differ significantly between species. Spliced leader sequences were observed in all of the 5S rDNA spacers with no sequence variation, although flanking region sequence and length heterogeneity was observed even within species. All of the various tree-building methods gave very similar results. This study identified four clades which are strongly supported by bootstrap analysis the Brugia clade; the Wuchereria clade; the Brugia-Wuchereria clade and the Onchocerca clade. The analyses indicated that L. sigmodontis and A. viteae may be the most primitive among the 16 species studied. The data did not show any close

  11. Global determinants of mortality in under 5s: 10 year worldwide longitudinal study

    PubMed Central

    Nacher, Mathieu; Guihenneuc, Chantal; Tubert-Bitter, Pascale; Chavance, Michel

    2013-01-01

    Objective To assess at country level the association of mortality in under 5s with a large set of determinants. Design Longitudinal study. Setting 193 United Nations member countries, 2000-09. Methods Yearly data between 2000 and 2009 based on 12 world development indicators were used in a multivariable general additive mixed model allowing for non-linear relations and lag effects. Main outcome measure National rate of deaths in under 5s per 1000 live births Results The model retained the variables: gross domestic product per capita; percentage of the population having access to improved water sources, having access to improved sanitation facilities, and living in urban areas; adolescent fertility rate; public health expenditure per capita; prevalence of HIV; perceived level of corruption and of violence; and mean number of years in school for women of reproductive age. Most of these variables exhibited non-linear behaviours and lag effects. Conclusions By providing a unified framework for mortality in under 5s, encompassing both high and low income countries this study showed non-linear behaviours and lag effects of known or suspected determinants of mortality in this age group. Although some of the determinants presented a linear action on log mortality indicating that whatever the context, acting on them would be a pertinent strategy to effectively reduce mortality, others had a threshold based relation potentially mediated by lag effects. These findings could help designing efficient strategies to achieve maximum progress towards millennium development goal 4, which aims to reduce mortality in under 5s by two thirds between 1990 and 2015. PMID:24212105

  12. Nucleotide excision repair of the 5 S ribosomal RNA gene assembled into a nucleosome.

    PubMed

    Liu, X; Smerdon, M J

    2000-08-01

    A-175-base pair fragment containing the Xenopus borealis somatic 5 S ribosomal RNA gene was used as a model system to determine the effect of nucleosome assembly on nucleotide excision repair (NER) of the major UV photoproduct (cyclobutane pyrimidine dimer (CPD)) in DNA. Xenopus oocyte nuclear extracts were used to carry out repair in vitro on reconstituted, positioned 5 S rDNA nucleosomes. Nucleosome structure strongly inhibits NER at many CPD sites in the 5 S rDNA fragment while having little effect at a few sites. The time course of CPD removal at 35 different sites indicates that >85% of the CPDs in the naked DNA fragment have t(12) values <2 h, whereas <26% of the t(12) values in nucleosomes are <2 h, and 15% are >8 h. Moreover, removal of histone tails from these mononucleosomes has little effect on the repair rates. Finally, nucleosome inhibition of repair shows no correlation with the rotational setting of a 14-nucleotide-long pyrimidine tract located 30 base pairs from the nucleosome dyad. These results suggest that inhibition of NER by mononucleosomes is not significantly influenced by the rotational orientation of CPDs on the histone surface, and histone tails play little (or no) role in this inhibition. PMID:10821833

  13. Analysis of a 5S rRNA gene cloned from Euplotes eurstomus

    SciTech Connect

    Roberson, A.E.; Wolffe, A.; Olins, D.E.

    1987-05-01

    The macronucleus of the hypotrichous ciliated protozoan Euplotes eurystomus lends itself to the study of eukaryotic gene and chromatin structure because native macronuclear DNA exists as linear, gene-sized fragments between 400 and 20,000 bp in length. The macronuclear chromatin, while arranged in a typical nucleosomal structure, is freely soluble in low ionic strength buffers without treatment by nucleases. Thus, specific genes may be enriched as native, intact chromatin molecules. The 5S rRNA gene from Euplotes has been cloned to facilitate investigation of 5S gene-chromatin following characterization of the gene at the DNA level. It has been demonstrated that the gene, while in circular or linear form, can be transcribed in vitro by a Xenopus oocyte nuclear extract. The transcript generated in vitro is 120 nucleotides in length and is synthesized by RNA polymerase III. Anti-Xenopus TFIIIA antibodies recognize a Euplotes macronuclear chromatin-associated protein which is approx. 80 KD in size. It has been established that the sequence of the telomere flanking the 5S gene in Euplotes eurystomus is the same telomeric sequence published for Euplotes aediculatus.

  14. Hybrubins: Bipyrrole Tetramic Acids Obtained by Crosstalk between a Truncated Undecylprodigiosin Pathway and Heterologous Tetramic Acid Biosynthetic Genes.

    PubMed

    Zhao, Zhilong; Shi, Ting; Xu, Min; Brock, Nelson L; Zhao, Yi-Lei; Wang, Yemin; Deng, Zixin; Pang, Xiuhua; Tao, Meifeng

    2016-02-01

    Heterologous expression of bacterial artificial chromosome (BAC) clones from the genomic library of Streptomyces variabilis Snt24 in Streptomyces lividans SBT5 which carried a truncated undecylprodigiosin biosynthetic gene cluster led to the identification of hybrubins A-C. The hybrubins represent a new carbon skeleton in which a tetramic acid moiety is fused to a 2,2'-dipyrrole building block. Gene knockout experiments confirmed that hybrubins are derived from two convergent biosynthetic pathways including the remaining genomic red genes of S. lividans SBT5 as well as the BAC encoded hbn genes for the production of 5-ethylidenetetramic acid. A possible biosynthetic pathway was also proposed. PMID:26800378

  15. Two spatially separated phases in semiconducting Rb0.8Fe1.5S2

    DOE PAGESBeta

    Wang, Meng; Tian, Wei; Valdivia, P.; Chi, Songxue; Bourret-Courchesne, E.; Dai, Pengcheng; Birgeneau, R. J.

    2014-09-26

    We report neutron scattering and transport measurements on semiconducting Rb0.8Fe1.5S2, a compound isostructural and isoelectronic to the well-studied A0.8FeySe2(A = K, Rb, Cs, Tl/K) superconducting systems. Both resistivity and DC susceptibility measurements reveal a magnetic phase transition at T = 275 K. Neutron diffraction studies show that the 275 K transition originates from a phase with rhombic iron vacancy order which exhibits an in-plane stripe antiferromagnetic ordering below 275 K. In addition, the stripe antiferromagnetic phase interdigitates mesoscopically with an ubiquitous phase with √5 x√5 iron vacancy order. This phase has a magnetic transition at TN = 425 K andmore » an iron vacancy order-disorder transition at TS = 600 K. These two different structural phases are closely similar to those observed in the isomorphous Se materials. Based on the close similarities of the in-plane antiferromagnetic structures, moments sizes, and ordering temperatures in semiconducting Rb0.8Fe1.5S2 and K0.81Fe1.58Se2, we argue that the in-plane antiferromagnetic order arises from strong coupling between local moments. Superconductivity, previously observed in the A0.8FeySe2₋ zSz system, is absent in A0.8Fe1.5S2, which has a semiconducting ground state. We discuss the implied relationship between stripe and block antiferromagnetism and superconductivity in these materials as well as a strategy for further investigation.« less

  16. SAXS investigation on the temperature dependence of the conformation of Carcinus aestuarii 5S hemocyanin subunit

    NASA Astrophysics Data System (ADS)

    Beltramini, M.; Di Muro, P.; Favilla, R.; La Monaca, A.; Mariani, P.; Sabatucci, A. L.; Salvato, B.; Solari, P. L.

    1999-01-01

    The small-angle X-ray scattering technique has been used to study the spatial distribution of a subunit isolated from Carcinus hemocyanin, in solution at pH 7.5 in the 20°C-40°C temperature range. From the obtained scattering profiles, two species with different gyration radius have been detected by Guinier approximation: one species with Rg1≈25 Å is assigned to the 75 kDa 5S subunit whereas a second species with Rg2≈48 Å, and accounting for ≈3% of the total protein, is attributed to the 450 kDa 16S hexamer. Whereas Rg2 decreases slightly (≈10%) and reversibly on increasing the temperature, Rg2 decreases more markedly (≈30%), but irreversibly. The scattering data have been analysed also on the basis of the impenetrable spheres model and by means of the distance distribution function: the temperature dependence of the geometrical dimensions of the particles is confirmed. In addition, for the 5S subunit also the cross-section gyration radius decreases appreciably (15%) and reversibly with temperature. These results are interpreted on the basis of temperature induced structural rearrangements among the three domains of 5S subunit leading to an increased compactness of the molecule and a more elongated form. In contrast, the effect on the hexamer is assigned to its irreversible dissociation to monomers. This interpretation agrees with the analysis of the distance distribution functions, calculated from the Fourier's transforms of the scattering curves at the different temperatures.

  17. Magic wavelengths for the 5 s -18 s transition in rubidium

    NASA Astrophysics Data System (ADS)

    Goldschmidt, E. A.; Norris, D. G.; Koller, S. B.; Wyllie, R.; Brown, R. C.; Porto, J. V.; Safronova, U. I.; Safronova, M. S.

    2015-03-01

    Magic wavelengths, for which there is no differential ac Stark shift for the ground and excited state of the atom, allow trapping of excited Rydberg atoms without broadening the optical transition. This is an important tool for implementing quantum gates and other quantum information protocols with Rydberg atoms, and reliable theoretical methods to find such magic wavelengths are thus extremely useful. We use a high-precision all-order method to calculate magic wavelengths for the 5 s -18 s transition of rubidium, and compare the calculation to experiment by measuring the light shift for atoms held in an optical dipole trap at a range of wavelengths near a calculated magic value.

  18. Nucleotide sequences of 5S ribosomal RNA from four oomycete and chytrid water molds.

    PubMed

    Walker, W F; Doolittle, W F

    1982-09-25

    The nucleotide sequences of the 5S rRNAs of the oomycete water molds Saprolegnia ferax and Pythium hydnosporum and of the chytrid water molds Blastocladiella simplex and Phlyctochytrium irregulare were determined by chemical and enzymatic partial degradation of 3' and 5' end-labelled molecules, followed by gel sequence analysis. The two oomycete sequences differed in 24 positions and the two chytrid sequences differed in 27 positions. These pairs differed in a mean of 44 positions. The chytrid sequences clearly most resemble the sequence from the zygomycete Phycomyces, while the oomycete sequences appear to be allied with those from protozoa and slime molds. PMID:6890670

  19. Minimally invasive L5-S1 oblique lumbar interbody fusion with anterior plate.

    PubMed

    Pham, Martin H; Jakoi, Andre M; Hsieh, Patrick C

    2016-07-01

    Lumbar interbody fusion is an important technique for the treatment of degenerative disc disease and degenerative scoliosis. The oblique lumbar interbody fusion (OLIF) establishes a minimally invasive retroperitoneal exposure anterior to the psoas and lumbar plexus. In this video case presentation, the authors demonstrate the techniques of the OLIF at L5-S1 performed on a 69-year-old female with degenerative scoliosis as one component of an overall strategy for her deformity correction. The video can be found here: https://youtu.be/VMUYWKLAl0g . PMID:27364428

  20. Biosynthetic Pathway for the Epipolythiodioxopiperazine Acetylaranotin in Aspergillus terreus Revealed by Genome-based Deletion Analysis

    SciTech Connect

    Guo, Chun-Jun; Yeh, Hsu-Hua; Chiang, Yi Ming; Sanchez, James F.; Chang, ShuLin; Bruno, Kenneth S.; Wang, Clay C.

    2013-04-15

    Abstract Epipolythiodioxopiperazines (ETPs) are a class of fungal secondary metabolites derived from cyclic peptides. Acetylaranotin belongs to one structural subgroup of ETPs characterized by the presence of a seven-membered dihydrooxepine ring. Defining the genes involved in acetylaranotin biosynthesis should provide a means to increase production of these compounds and facilitate the engineering of second-generation molecules. The filamentous fungus Aspergillus terreus produces acetylaranotin and related natural products. Using targeted gene deletions, we have identified a cluster of 9 genes including one nonribosomal peptide synthase gene, ataP, that is required for acetylaranotin biosynthesis. Chemical analysis of the wild type and mutant strains enabled us to isolate seventeen natural products that are either intermediates in the normal biosynthetic pathway or shunt products that are produced when the pathway is interrupted through mutation. Nine of the compounds identified in this study are novel natural products. Our data allow us to propose a complete biosynthetic pathway for acetylaranotin and related natural products.

  1. Computational genomic identification and functional reconstitution of plant natural product biosynthetic pathways.

    PubMed

    Medema, Marnix H; Osbourn, Anne

    2016-08-27

    Covering: 2003 to 2016The last decade has seen the first major discoveries regarding the genomic basis of plant natural product biosynthetic pathways. Four key computationally driven strategies have been developed to identify such pathways, which make use of physical clustering, co-expression, evolutionary co-occurrence and epigenomic co-regulation of the genes involved in producing a plant natural product. Here, we discuss how these approaches can be used for the discovery of plant biosynthetic pathways encoded by both chromosomally clustered and non-clustered genes. Additionally, we will discuss opportunities to prioritize plant gene clusters for experimental characterization, and end with a forward-looking perspective on how synthetic biology technologies will allow effective functional reconstitution of candidate pathways using a variety of genetic systems. PMID:27321668

  2. Producing the Ethylene Signal: Regulation and Diversification of Ethylene Biosynthetic Enzymes.

    PubMed

    Booker, Matthew A; DeLong, Alison

    2015-09-01

    Strictly controlled production of ethylene gas lies upstream of the signaling activities of this crucial regulator throughout the plant life cycle. Although the biosynthetic pathway is enzymatically simple, the regulatory circuits that modulate signal production are fine tuned to allow integration of responses to environmental and intrinsic cues. Recently identified posttranslational mechanisms that control ethylene production converge on one family of biosynthetic enzymes and overlay several independent reversible phosphorylation events and distinct mediators of ubiquitin-dependent protein degradation. Although the core pathway is conserved throughout seed plants, these posttranslational regulatory mechanisms may represent evolutionarily recent innovations. The evolutionary origins of the pathway and its regulators are not yet clear; outside the seed plants, numerous biochemical and phylogenetic questions remain to be addressed. PMID:26134162

  3. A biosynthetic pathway for a prominent class of microbiota-derived bile acids

    PubMed Central

    Devlin, A. Sloan; Fischbach, Michael A.

    2015-01-01

    The gut bile acid pool is millimolar in concentration, varies widely in composition among individuals, and is linked to metabolic disease and cancer. Although these molecules derive almost exclusively from the microbiota, remarkably little is known about which bacterial species and genes are responsible for their biosynthesis. Here, we report a biosynthetic pathway for the second most abundant class in the gut, iso (3β-hydroxy) bile acids, whose levels exceed 300 µM in some humans and are absent in others. We show, for the first time, that iso bile acids are produced by Ruminococcus gnavus, a far more abundant commensal than previously known producers; and that the iso bile acid pathway detoxifies deoxycholic acid, favoring the growth of the keystone genus Bacteroides. By revealing the biosynthetic genes for an abundant class of bile acids, our work sets the stage for predicting and rationally altering the composition of the bile acid pool. PMID:26192599

  4. Biosynthetic pathway for acrylic acid from glycerol in recombinant Escherichia coli.

    PubMed

    Tong, Wenhua; Xu, Ying; Xian, Mo; Niu, Wei; Guo, Jiantao; Liu, Huizhou; Zhao, Guang

    2016-06-01

    Acrylic acid is an important industrial feedstock. In this study, a de novo acrylate biosynthetic pathway from inexpensive carbon source glycerol was constructed in Escherichia coli. The acrylic acid was produced from glycerol via 3-hydroxypropionaldehyde, 3-hydroxypropionyl-CoA, and acrylyl-CoA. The acrylate production was improved by screening and site-directed mutagenesis of key enzyme enoyl-CoA hydratase and chromosomal integration of some exogenous genes. Finally, our recombinant strain produced 37.7 mg/L acrylic acid under shaking flask conditions. Although the acrylate production is low, our study shows feasibility of engineering an acrylate biosynthetic pathway from inexpensive carbon source. Furthermore, the reasons for limited acrylate production and further strain optimization that should be performed in the future were also discussed. PMID:26782744

  5. Cellular Localization of Isoprenoid Biosynthetic Enzymes in Marchantia polymorpha. Uncovering a New Role of Oil Bodies

    PubMed Central

    Suire, Claude; Bouvier, Florence; Backhaus, Ralph A.; Bégu, Dominique; Bonneu, Marc; Camara, Bilal

    2000-01-01

    Like seed plants, liverworts synthesize and accumulate a myriad of isoprenoid compounds. Using antibodies raised against several isoprenoid biosynthetic enzymes, we investigated their intracellular compartmentation by in situ immunolocalization from Marchantia polymorpha. The enzymes examined were deoxy-xylulose phosphate synthase, geranyl diphosphate synthase, farnesyl diphosphate synthase, geranylgeranyl diphosphate synthase, monoterpene synthase, geranylgeranyl diphosphate reductase, phytoene synthase, and phytoene desaturase. Our results show that liverwort oil bodies, which are organelles bound by a single unit membrane, possess isoprenoid biosynthetic enzymes similar to those found in plastids and the cytosol. We postulate that oil bodies play a dynamic role in cell metabolism in addition to their role as sites of essential oil accumulation and sequestration. The occurrence of such enzymes in different cellular compartments might be due to multiple targeting of gene products to various organelles. PMID:11080275

  6. Insights into secondary metabolism from a global analysis of prokaryotic biosynthetic gene clusters

    PubMed Central

    Cimermancic, Peter; Medema, Marnix H.; Claesen, Jan; Kurita, Kenji; Wieland Brown, Laura C.; Mavrommatis, Konstantinos; Pati, Amrita; Godfrey, Paul A.; Koehrsen, Michael; Clardy, Jon; Birren, Bruce W.; Takano, Eriko; Sali, Andrej; Linington, Roger G.; Fischbach, Michael A.

    2014-01-01

    Summary Although biosynthetic gene clusters (BGCs) have been discovered for hundreds of bacterial metabolites, our knowledge of their diversity remains limited. Here, we used a novel algorithm to systematically identify BGCs in the extensive extant microbial sequencing data. Network analysis of the predicted BGCs revealed large gene cluster families, the vast majority uncharacterized. We experimentally characterized the most prominent family, consisting of two subfamilies of hundreds of BGCs distributed throughout the Proteobacteria; their products are aryl polyenes, lipids with an aryl head group conjugated to a polyene tail. We identified a distant relationship to a third subfamily of aryl polyene BGCs, and together the three subfamilies represent the largest known family of biosynthetic gene clusters, with more than 1,000 members. Although these clusters are widely divergent in sequence, their small molecule products are remarkably conserved, indicating for the first time the important roles these compounds play in Gram-negative cell biology. PMID:25036635

  7. Parsing a multifunctional biosynthetic gene cluster from rice: Biochemical characterization of CYP71Z6 & 7.

    PubMed

    Wu, Yisheng; Hillwig, Matthew L; Wang, Qiang; Peters, Reuben J

    2011-11-01

    Rice (Oryza sativa) contains a biosynthetic gene cluster associated with production of at least two groups of diterpenoid phytoalexins, the antifungal phytocassanes and antibacterial oryzalides. While cytochromes P450 (CYP) from this cluster are known to be involved in phytocassane production, such mono-oxygenase activity relevant to oryzalide biosynthesis was unknown. Here we report biochemical characterization demonstrating that CYP71Z6 from this cluster acts as an ent-isokaurene C2-hydroxylase that is presumably involved in the biosynthesis of oryzalides. Our results further suggest that the closely related and co-clustered CYP71Z7 likely acts as a C2-hydroxylase involved in a latter step of phytocassane biosynthesis. Thus, CYP71Z6 & 7 appear to have evolved distinct roles in rice diterpenoid metabolism, offering insight into plant biosynthetic gene cluster evolution. PMID:21985968

  8. Parsing a multifunctional biosynthetic gene cluster from rice: Biochemical characterization of CYP71Z6 & 7

    PubMed Central

    Wu, Yisheng; Hillwig, Matthew L.; Wang, Qiang; Peters, Reuben J.

    2011-01-01

    Rice (Oryza sativa) contains a biosynthetic gene cluster associated with production of at least two groups of diterpenoid phytoalexins, the antifungal phytocassanes and antibacterial oryzalides. While cytochromes P450 (CYP) from this cluster are known to be involved in phytocassane production, such mono-oxygenase activity relevant to oryzalide biosynthesis was unknown. Here we report biochemical characterization demonstrating that CYP71Z6 from this cluster acts as an ent-isokaurene C2-hydroxylase that is presumably involved in the biosynthesis of oryzalides. Our results further suggest that the closely related and co-clustered CYP71Z7 likely acts as a C2-hydroxylase involved in a latter step of phytocassane biosynthesis. Thus, CYP71Z6 & 7 appear to have evolved distinct roles in rice diterpenoid metabolism, offering insight into plant biosynthetic gene cluster evolution. PMID:21985968

  9. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    PubMed Central

    2012-01-01

    Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants. PMID:22883984

  10. Reassembled biosynthetic pathway for large-scale carbohydrate synthesis: alpha-Gal epitope producing "superbug".

    PubMed

    Chen, Xi; Liu, Ziye; Zhang, Jianbo; Zhang, Wei; Kowal, Przemyslaw; Wang, Peng George

    2002-01-01

    A metabolic pathway engineered Escherichia coli strain (superbug) containing one plasmid harboring an artificial gene cluster encoding all the five enzymes in the biosynthetic pathway of Galalpha l,3Lac through galactose metabolism has been developed. The plasmid contains a lambda promoter, a c1857 repressor gene, an ampicillin resistance gene, and a T7 terminator. Each gene was preceded by a Shine - Dalgarno sequence for ribosome binding. In a reaction catalyzed by the recombinant E. coli strain, Galalpha 1,3Lac trisaccharide accumulated at concentrations of 14.2 mM (7.2 gL(-1)) in a reaction mixture containing galactose, glucose, lactose, and a catalytic amount of uridine 5'-diphosphoglucose. This work demonstrates that large-scale synthesis of complex oligosaccharides can be achieved economically and efficiently through a single, biosynthetic pathway engineered microorganism. PMID:17590953

  11. Producing the Ethylene Signal: Regulation and Diversification of Ethylene Biosynthetic Enzymes1

    PubMed Central

    Booker, Matthew A.; DeLong, Alison

    2015-01-01

    Strictly controlled production of ethylene gas lies upstream of the signaling activities of this crucial regulator throughout the plant life cycle. Although the biosynthetic pathway is enzymatically simple, the regulatory circuits that modulate signal production are fine tuned to allow integration of responses to environmental and intrinsic cues. Recently identified posttranslational mechanisms that control ethylene production converge on one family of biosynthetic enzymes and overlay several independent reversible phosphorylation events and distinct mediators of ubiquitin-dependent protein degradation. Although the core pathway is conserved throughout seed plants, these posttranslational regulatory mechanisms may represent evolutionarily recent innovations. The evolutionary origins of the pathway and its regulators are not yet clear; outside the seed plants, numerous biochemical and phylogenetic questions remain to be addressed. PMID:26134162

  12. An eight-step synthesis of epicolactone reveals its biosynthetic origin

    NASA Astrophysics Data System (ADS)

    Ellerbrock, Pascal; Armanino, Nicolas; Ilg, Marina K.; Webster, Robert; Trauner, Dirk

    2015-11-01

    Epicolactone is a recently isolated fungal metabolite that is highly complex for its size, and yet racemic. With its array of quaternary stereocentres, high degree of functionalization and intricate polycyclic structure, it poses a considerable challenge to synthesis, a challenge that can be met by understanding its biosynthetic origin. If drawn in a certain way, epicolactone reveals a pattern that resembles purpurogallin, the archetype of ubiquitous natural colourants formed via oxidative dimerization. Based on this insight, we designed a biomimetic synthesis of epicolactone that proceeds in only eight steps from vanillyl alcohol. We have isolated a key intermediate that supports our biosynthetic hypothesis and anticipate that an isomer of epicolactone stemming from our synthetic efforts could also be found as a natural product.

  13. TREX: a universal tool for the transfer and expression of biosynthetic pathways in bacteria.

    PubMed

    Loeschcke, Anita; Markert, Annette; Wilhelm, Susanne; Wirtz, Astrid; Rosenau, Frank; Jaeger, Karl-Erich; Drepper, Thomas

    2013-01-18

    Secondary metabolites represent a virtually inexhaustible source of natural molecules exhibiting a high potential as pharmaceuticals or chemical building blocks. To gain broad access to these compounds, sophisticated expression systems are needed that facilitate the transfer and expression of large chromosomal regions, whose genes encode complex metabolic pathways. Here, we report on the development of the novel system for the transfer and expression of biosynthetic pathways (TREX), which comprises all functional elements necessary for the delivery and concerted expression of clustered pathway genes in different bacteria. TREX employs (i) conjugation for DNA transfer, (ii) randomized transposition for its chromosomal insertion, and (iii) T7 RNA polymerase for unimpeded bidirectional gene expression. The applicability of the TREX system was demonstrated by establishing the biosynthetic pathways of two pigmented secondary metabolites, zeaxanthin and prodigiosin, in bacteria with different metabolic capacities. Thus, TREX represents a valuable tool for accessing natural products by allowing comparative expression studies with clustered genes. PMID:23656323

  14. Recent advances in Cannabis sativa research: biosynthetic studies and its potential in biotechnology.

    PubMed

    Sirikantaramas, Supaart; Taura, Futoshi; Morimoto, Satoshi; Shoyama, Yukihiro

    2007-08-01

    Cannabinoids, consisting of alkylresorcinol and monoterpene groups, are the unique secondary metabolites that are found only in Cannabis sativa. Tetrahydrocannabinol (THC), cannabidiol (CBD) and cannabichromene (CBC) are well known cannabinoids and their pharmacological properties have been extensively studied. Recently, biosynthetic pathways of these cannabinoids have been successfully established. Several biosynthetic enzymes including geranylpyrophosphate:olivetolate geranyltransferase, tetrahydrocannabinolic acid (THCA) synthase, cannabidiolic acid (CBDA) synthase and cannabichromenic acid (CBCA) synthase have been purified from young rapidly expanding leaves of C. sativa. In addition, molecular cloning, characterization and localization of THCA synthase have been recently reported. THCA and cannabigerolic acid (CBGA), its substrate, were shown to be apoptosis-inducing agents that might play a role in plant defense. Transgenic tobacco hairy roots expressing THCA synthase can produce THCA upon feeding of CBGA. These results open the way for biotechnological production of cannabinoids in the future. PMID:17691992

  15. Evolution of alternative biosynthetic pathways for vitamin C following plastid acquisition in photosynthetic eukaryotes.

    PubMed

    Wheeler, Glen; Ishikawa, Takahiro; Pornsaksit, Varissa; Smirnoff, Nicholas

    2015-01-01

    Ascorbic acid (vitamin C) is an enzyme co-factor in eukaryotes that also plays a critical role in protecting photosynthetic eukaryotes against damaging reactive oxygen species derived from the chloroplast. Many animal lineages, including primates, have become ascorbate auxotrophs due to the loss of the terminal enzyme in their biosynthetic pathway, L-gulonolactone oxidase (GULO). The alternative pathways found in land plants and Euglena use a different terminal enzyme, L-galactonolactone dehydrogenase (GLDH). The evolutionary processes leading to these differing pathways and their contribution to the cellular roles of ascorbate remain unclear. Here we present molecular and biochemical evidence demonstrating that GULO was functionally replaced with GLDH in photosynthetic eukaryote lineages following plastid acquisition. GULO has therefore been lost repeatedly throughout eukaryote evolution. The formation of the alternative biosynthetic pathways in photosynthetic eukaryotes uncoupled ascorbate synthesis from hydrogen peroxide production and likely contributed to the rise of ascorbate as a major photoprotective antioxidant. PMID:25768426

  16. Biosynthetic Machinery Involved in Aberrant Glycosylation: Promising Targets for Developing of Drugs Against Cancer

    PubMed Central

    Vasconcelos-dos-Santos, Andréia; Oliveira, Isadora A.; Lucena, Miguel Clodomiro; Mantuano, Natalia Rodrigues; Whelan, Stephen A.; Dias, Wagner Barbosa; Todeschini, Adriane Regina

    2015-01-01

    Cancer cells depend on altered metabolism and nutrient uptake to generate and keep the malignant phenotype. The hexosamine biosynthetic pathway is a branch of glucose metabolism that produces UDP-GlcNAc and its derivatives, UDP-GalNAc and CMP-Neu5Ac and donor substrates used in the production of glycoproteins and glycolipids. Growing evidence demonstrates that alteration of the pool of activated substrates might lead to different glycosylation and cell signaling. It is already well established that aberrant glycosylation can modulate tumor growth and malignant transformation in different cancer types. Therefore, biosynthetic machinery involved in the assembly of aberrant glycans are becoming prominent targets for anti-tumor drugs. This review describes three classes of glycosylation, O-GlcNAcylation, N-linked, and mucin type O-linked glycosylation, involved in tumor progression, their biosynthesis and highlights the available inhibitors as potential anti-tumor drugs. PMID:26161361

  17. The Methymycin/Pikromycin Biosynthetic Pathway: A Model for Metabolic Diversity in Natural Product Biosynthesis

    PubMed Central

    Kittendorf, Jeffrey D.; Sherman, David H.

    2010-01-01

    The methymycin/pikromycin (Pik) macrolide pathway represents a robust metabolic system for analysis of modular polyketide biosynthesis. The enzymes that comprise this biosynthetic pathway display unprecedented substrate flexibility, combining to produce six structurally diverse macrolide antibiotics in Streptomyces venezuelae. Thus, it is appealing to consider that the pikromycin biosynthetic enzymes could be leveraged for high throughput production of novel macrolide antibiotics. Accordingly, efforts over the past decade have focused on the detailed investigation of the six-module polyketide synthase, desosamine sugar assembly and glycosyl transfer, and the cytochrome P450 monooxygenase that is responsible for hydroxylation. This review summarizes the advances in understanding of pikromycin biosynthesis that have been gained during the course of these investigations. PMID:19027305

  18. Biosynthetic Studies on Water-Soluble Derivative 5c (DTX5c)

    PubMed Central

    Vilches, Tamara S.; Norte, Manuel; Daranas, Antonio Hernández; Fernández, José J.

    2012-01-01

    The dinoflagellate Prorocentrum belizeanum is responsible for the production of several toxins involved in the red tide phenomenon known as Diarrhetic Shellfish Poisoning (DSP). In this paper we report on the biosynthetic origin of an okadaic acid water-soluble ester derivative, DTX5c, on the basis of the spectroscopical analysis of 13C enriched samples obtained by addition of labelled sodium [l-13C], [2-13C] acetate to artificial cultures of this dinoflagellate. PMID:23170080

  19. Structure of Nampt/PBEF/visfatin, a mammalian NAD[superscript +]biosynthetic enzyme

    SciTech Connect

    Wang, Tao; Zhang, Xiangbin; Bheda, Poonam; Revollo, Javier R.; Imai, Shin-ichiro; Wolberger, Cynthia

    2010-07-22

    Nicotinamide phosphoribosyltransferase (Nampt) synthesizes nicotinamide mononucleotide (NMN) from nicotinamide in a mammalian NAD{sup +} biosynthetic pathway and is required for SirT1 activity in vivo. Nampt has also been presumed to be a cytokine (PBEF) or a hormone (visfatin). The crystal structure of Nampt in the presence and absence of NMN shows that Nampt is a dimeric type II phosphoribosyltransferase and provides insights into the enzymatic mechanism.

  20. CrBPF1 overexpression alters transcript levels of terpenoid indole alkaloid biosynthetic and regulatory genes.

    PubMed

    Li, Chun Yao; Leopold, Alex L; Sander, Guy W; Shanks, Jacqueline V; Zhao, Le; Gibson, Susan I

    2015-01-01

    Terpenoid indole alkaloid (TIA) biosynthesis in Catharanthus roseus is a complex and highly regulated process. Understanding the biochemistry and regulation of the TIA pathway is of particular interest as it may allow the engineering of plants to accumulate higher levels of pharmaceutically important alkaloids. Toward this end, we generated a transgenic C. roseus hairy root line that overexpresses the CrBPF1 transcriptional activator under the control of a β-estradiol inducible promoter. CrBPF1 is a MYB-like protein that was previously postulated to help regulate the expression of the TIA biosynthetic gene STR. However, the role of CrBPF1 in regulation of the TIA and related pathways had not been previously characterized. In this study, transcriptional profiling revealed that overexpression of CrBPF1 results in increased transcript levels for genes from both the indole and terpenoid biosynthetic pathways that provide precursors for TIA biosynthesis, as well as for genes in the TIA biosynthetic pathway. In addition, overexpression of CrBPF1 causes increases in the transcript levels for 11 out of 13 genes postulated to act as transcriptional regulators of genes from the TIA and TIA feeder pathways. Interestingly, overexpression of CrBPF1 causes increased transcript levels for both TIA transcriptional activators and repressors. Despite the fact that CrBPF1 overexpression affects transcript levels of a large percentage of TIA biosynthetic and regulatory genes, CrBPF1 overexpression has only very modest effects on the levels of the TIA metabolites analyzed. This finding may be due, at least in part, to the up-regulation of both transcriptional activators and repressors in response to CrBPF1 overexpression, suggesting that CrBPF1 may serve as a "fine-tune" regulator for TIA biosynthesis, acting to help regulate the timing and amplitude of TIA gene expression. PMID:26483828

  1. Comment on Asymmetric Syntheses of Sceptrin and Massadine and Evidence for Biosynthetic Enantiodivergence*

    PubMed Central

    Sherman, David H.; Tsukamoto, Sachiko; Williams, Robert M.

    2015-01-01

    Ma, et al. (Reports, 10 October 2014, p. 219) report asymmetric syntheses of Sceptrin and Massadine and through a stereochemical reassignment, claim to “..uncover enantiodivergence as a new biosynthetic paradigm for natural products.” This Technical Comment challenges and clarifies this claim with relevant examples from the literature of this well-known phenomenon of enantiodivergent congener biosynthesis within the same producing organism. PMID:26160938

  2. Contribution of trehalose biosynthetic pathway to drought stress tolerance of Capparis ovata Desf.

    PubMed

    Ilhan, S; Ozdemir, F; Bor, M

    2015-03-01

    Trehalose and the trehalose biosynthetic pathway are important contributors and regulators of stress responses in plants. Among recent findings for trehalose and its metabolism, the role of signalling in the regulation of growth and development and its potential for use as a storage energy source can be listed. The xerophytic plant Capparis ovata (caper) is well adapted to drought and high temperature stress in arid and semi-arid regions of the Mediterranean. The contribution of trehalose and the trehalose biosynthetic pathway to drought stress responses and tolerance in C. ovata are not known. We investigated the effects of PEG-mediated drought stress in caper plants and analysed physiological parameters and trehalose biosynthetic pathway components, trehalose-6-phosphate synthase (TPS), trehalose-6-phosphate phosphatase (TPP), trehalase activity, trehalose and proline content in drought stress-treated and untreated plants. Our results indicated that trehalose and the trehalose biosynthetic pathway contributed to drought stress tolerance of C. ovata. Overall growth and leaf water status were not dramatically affected by drought, as both high relative growth rate and relative water content were recorded even after 14 days of drought stress. Trehalose accumulation increased in parallel to induced TPS and TPP activities and decreased trehalase activity in caper plants on day 14. Constitutive trehalose levels were 28.75 to 74.75 μg·g·FW(-1) , and drought stress significantly induced trehalose accumulation (385.25 μg·g·FW(-1) on day 14) in leaves of caper. On day 14 of drought, proline levels were lower than on day 7. Under drought stress the discrepancy between trehalose and proline accumulation trends might result from the mode of action of these osmoprotectant molecules in C. ovata. PMID:25294040

  3. Investigation of Proposed Ladderane Biosynthetic Genes from Anammox Bacteria by Heterologous Expression in E. coli

    PubMed Central

    Javidpour, Pouya; Deutsch, Samuel; Mutalik, Vivek K.; Hillson, Nathan J.; Petzold, Christopher J.; Keasling, Jay D.; Beller, Harry R.

    2016-01-01

    Ladderanes are hydrocarbon chains with three or five linearly concatenated cyclobutane rings that are uniquely produced as membrane lipid components by anammox (anaerobic ammonia-oxidizing) bacteria. By virtue of their angle and torsional strain, ladderanes are unusually energetic compounds, and if produced biochemically by engineered microbes, could serve as renewable, high-energy-density jet fuel components. The biochemistry and genetics underlying the ladderane biosynthetic pathway are unknown, however, previous studies have identified a pool of 34 candidate genes from the anammox bacterium, Kuenenia stuttgartiensis, some or all of which may be involved with ladderane fatty acid biosynthesis. The goal of the present study was to establish a systematic means of testing the candidate genes from K. stuttgartiensis for involvement in ladderane biosynthesis through heterologous expression in E. coli under anaerobic conditions. This study describes an efficient means of assembly of synthesized, codon-optimized candidate ladderane biosynthesis genes in synthetic operons that allows for changes to regulatory element sequences, as well as modular assembly of multiple operons for simultaneous heterologous expression in E. coli (or potentially other microbial hosts). We also describe in vivo functional tests of putative anammox homologs of the phytoene desaturase CrtI, which plays an important role in the hypothesized ladderane pathway, and a method for soluble purification of one of these enzymes. This study is, to our knowledge, the first experimental effort focusing on the role of specific anammox genes in the production of ladderanes, and lays the foundation for future efforts toward determination of the ladderane biosynthetic pathway. Our substantial, but far from comprehensive, efforts at elucidating the ladderane biosynthetic pathway were not successful. We invite the scientific community to take advantage of the considerable synthetic biology resources and

  4. Diversity in Biosynthetic Pathways of Galactolipids in the Light of Endosymbiotic Origin of Chloroplasts

    PubMed Central

    Sato, Naoki; Awai, Koichiro

    2016-01-01

    Cyanobacteria and chloroplasts perform oxygenic photosynthesis, and share a common origin. Galactolipids are present in the photosynthetic membranes of both cyanobacteria and chloroplasts, but the biosynthetic pathways of the galactolipids are significantly different in the two systems. In this minireview, we explain the history of the discovery of the cyanobacterial pathway, and present a probable scenario of the evolution of the two pathways. PMID:26904079

  5. Investigation of Proposed Ladderane Biosynthetic Genes from Anammox Bacteria by Heterologous Expression in E. coli.

    PubMed

    Javidpour, Pouya; Deutsch, Samuel; Mutalik, Vivek K; Hillson, Nathan J; Petzold, Christopher J; Keasling, Jay D; Beller, Harry R

    2016-01-01

    Ladderanes are hydrocarbon chains with three or five linearly concatenated cyclobutane rings that are uniquely produced as membrane lipid components by anammox (anaerobic ammonia-oxidizing) bacteria. By virtue of their angle and torsional strain, ladderanes are unusually energetic compounds, and if produced biochemically by engineered microbes, could serve as renewable, high-energy-density jet fuel components. The biochemistry and genetics underlying the ladderane biosynthetic pathway are unknown, however, previous studies have identified a pool of 34 candidate genes from the anammox bacterium, Kuenenia stuttgartiensis, some or all of which may be involved with ladderane fatty acid biosynthesis. The goal of the present study was to establish a systematic means of testing the candidate genes from K. stuttgartiensis for involvement in ladderane biosynthesis through heterologous expression in E. coli under anaerobic conditions. This study describes an efficient means of assembly of synthesized, codon-optimized candidate ladderane biosynthesis genes in synthetic operons that allows for changes to regulatory element sequences, as well as modular assembly of multiple operons for simultaneous heterologous expression in E. coli (or potentially other microbial hosts). We also describe in vivo functional tests of putative anammox homologs of the phytoene desaturase CrtI, which plays an important role in the hypothesized ladderane pathway, and a method for soluble purification of one of these enzymes. This study is, to our knowledge, the first experimental effort focusing on the role of specific anammox genes in the production of ladderanes, and lays the foundation for future efforts toward determination of the ladderane biosynthetic pathway. Our substantial, but far from comprehensive, efforts at elucidating the ladderane biosynthetic pathway were not successful. We invite the scientific community to take advantage of the considerable synthetic biology resources and

  6. Understanding the carotenoid biosynthetic pathway through observation of four color variants of developing watermelon (Citrullus lanatus (Thunb.) Matsum. & Nanai)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The carotenoid biosynthetic pathway regulatory mechanisms leading to lycopene accumulation are well defined in the model fruit, tomato (Lycopersicon esculentum L.). The regulatory mechanisms leading to accumulation of other carotenoids and flesh colors, however, are poorly understood. The variety ...

  7. Identification and Analysis of the Paulomycin Biosynthetic Gene Cluster and Titer Improvement of the Paulomycins in Streptomyces paulus NRRL 8115

    PubMed Central

    Li, Jine; Xie, Zhoujie; Wang, Min; Ai, Guomin; Chen, Yihua

    2015-01-01

    The paulomycins are a group of glycosylated compounds featuring a unique paulic acid moiety. To locate their biosynthetic gene clusters, the genomes of two paulomycin producers, Streptomyces paulus NRRL 8115 and Streptomyces sp. YN86, were sequenced. The paulomycin biosynthetic gene clusters were defined by comparative analyses of the two genomes together with the genome of the third paulomycin producer Streptomyces albus J1074. Subsequently, the identity of the paulomycin biosynthetic gene cluster was confirmed by inactivation of two genes involved in biosynthesis of the paulomycose branched chain (pau11) and the ring A moiety (pau18) in Streptomyces paulus NRRL 8115. After determining the gene cluster boundaries, a convergent biosynthetic model was proposed for paulomycin based on the deduced functions of the pau genes. Finally, a paulomycin high-producing strain was constructed by expressing an activator-encoding gene (pau13) in S. paulus, setting the stage for future investigations. PMID:25822496

  8. Structural Diversification of Lyngbyatoxin A by Host-Dependent Heterologous Expression of the tleABC Biosynthetic Gene Cluster.

    PubMed

    Zhang, Lihan; Hoshino, Shotaro; Awakawa, Takayoshi; Wakimoto, Toshiyuki; Abe, Ikuro

    2016-08-01

    Natural products have enormous structural diversity, yet little is known about how such diversity is achieved in nature. Here we report the structural diversification of a cyanotoxin-lyngbyatoxin A-and its biosynthetic intermediates by heterologous expression of the Streptomyces-derived tleABC biosynthetic gene cluster in three different Streptomyces hosts: S. lividans, S. albus, and S. avermitilis. Notably, the isolated lyngbyatoxin derivatives, including four new natural products, were biosynthesized by crosstalk between the heterologous tleABC gene cluster and the endogenous host enzymes. The simple strategy described here has expanded the structural diversity of lyngbyatoxin A and its biosynthetic intermediates, and provides opportunities for investigation of the currently underestimated hidden biosynthetic crosstalk. PMID:27194569

  9. Atropurpuran – Missing Biosynthetic Link Leading to the Hetidine and Arcutine C20-Diterpenoid Alkaloids or an Oxidative Degradation Product?

    PubMed Central

    Weber, Manuel; Owens, Kyle; Sarpong, Richmond

    2015-01-01

    A possible biosynthetic link between atropurpuran, the hetidine diterpenoid alkaloids and the alkaloid arcutine and congeners is proposed. The feasibility of aspects of this biosynthesis, especially key 1,2-rearrangements, have been examined computationally. PMID:26028789

  10. Identification and analysis of the paulomycin biosynthetic gene cluster and titer improvement of the paulomycins in Streptomyces paulus NRRL 8115.

    PubMed

    Li, Jine; Xie, Zhoujie; Wang, Min; Ai, Guomin; Chen, Yihua

    2015-01-01

    The paulomycins are a group of glycosylated compounds featuring a unique paulic acid moiety. To locate their biosynthetic gene clusters, the genomes of two paulomycin producers, Streptomyces paulus NRRL 8115 and Streptomyces sp. YN86, were sequenced. The paulomycin biosynthetic gene clusters were defined by comparative analyses of the two genomes together with the genome of the third paulomycin producer Streptomyces albus J1074. Subsequently, the identity of the paulomycin biosynthetic gene cluster was confirmed by inactivation of two genes involved in biosynthesis of the paulomycose branched chain (pau11) and the ring A moiety (pau18) in Streptomyces paulus NRRL 8115. After determining the gene cluster boundaries, a convergent biosynthetic model was proposed for paulomycin based on the deduced functions of the pau genes. Finally, a paulomycin high-producing strain was constructed by expressing an activator-encoding gene (pau13) in S. paulus, setting the stage for future investigations. PMID:25822496

  11. The Biosynthetic Gene Cluster of Zorbamycin, a Member of the Bleomycin Family of Antitumor Antibiotics, from Streptomyces flavoviridis ATCC 21892

    PubMed Central

    Galm, Ute; Wendt-Pienkowski, Evelyn; Wang, Liyan; George, Nicholas P.; Oh, Tae-Jin; Yi, Fan; Tao, Meifeng; Coughlin, Jane M.; Shen, Ben

    2011-01-01

    The biosynthetic gene cluster for the glycopeptide-derived antitumor antibiotic zorbamycin (ZBM) was cloned by screening a cosmid library of Streptomyces flavoviridis ATCC 21892. Sequence analysis revealed 40 ORFs belonging to the ZBM biosynthetic gene cluster. However, only 23 and 22 ORFs showed striking similarities to the biosynthetic gene clusters for the bleomycins (BLMs) and tallysomycins (TLMs), respectively; the remaining ORFs do not show significant homology to ORFs from the related BLM and TLM clusters. The ZBM gene cluster consists of 16 nonribosomal peptide synthetase (NRPS) genes encoding eight complete NRPS modules, three incomplete didomain NRPS modules, and eight freestanding single NRPS domains or associated enzymes, a polyketide synthase (PKS) gene encoding one PKS module, six sugar biosynthesis genes, as well as genes encoding other biosynthesis and resistance proteins. A genetic system using Escherichia coli-Streptomyces flavoviridis intergeneric conjugation was developed to enable ZBM gene cluster boundary determinations and biosynthetic pathway manipulations. PMID:19081934

  12. Elucidation of Pseurotin Biosynthetic Pathway Points to Trans-Acting C-Methyltransferase and Source of Chemical Diversity Generation**

    PubMed Central

    Tsunematsu, Yuta; Fukutomi, Manami; Saruwatari, Takayoshi; Noguchi, Hiroshi; Watanabe, Kenji; Hotta, Kinya; Tang, Yi

    2015-01-01

    Pseurotins comprise a family of structurally related Aspergillal natural products having interesting bioactivity. However, little is known about the biosynthetic steps involved in the formation of their complex chemical features. Here, we systematically deleted the pseurotin biosynthetic genes in A. fumigatus and performed in vivo and in vitro characterization of the tailoring enzymes to determine the biosynthetic intermediates and the gene products responsible for the formation of each intermediate. This allowed us to elucidate the main biosynthetic steps leading to the formation of pseurotin A from the predominant precursor, azaspirene. The study revealed the combinatorial nature of the biosynthesis of the pseurotin family of compounds and the intermediates. Most interestingly, we report the first identification of an epoxidase–C-methyltransferase bifunctional fusion protein PsoF that appears to methylate the nascent polyketide backbone carbon atom in trans. PMID:24939566

  13. Refinement of the spinal muscular atrophy locus to the interval between D5S435 and MAP1B

    SciTech Connect

    Soares, V.M.; Brzustowicz, L.M.; Kleyn, P.W.; Knowles, J.A.; Palmer, D.A.; Asokan, S.; Penchaszadeh, G.K.; Gilliam, T.C. ); Munsat, T.L. )

    1993-02-01

    The childhood-onset SMA locus has been mapped to chromosome 5q13, in a region bounded by the proximal locus, D5S6, and the closely linked distal loci, D5S112 and MAP1B. We now describe a highly polymorphic, tightly linked microsatellite marker (D5S435) that is very likely the closet proximal marker to the SMA locus. Multipoint linkage analysis firmly establishes the following order of markers at 5q13; centromere-D5S76-D5S6-D5S435-MAP1B/D5S112-D5S39-telomere. The data indicate that SMA resides in an approximately 0.7-cM (range 01.-2.1) region between D5S435 and MAP1B. This finding reduces by approximately fourfold the genetic region that most likely harbors the SMA locus and will facilitate the physical mapping and cloning of the disease gene region. 24 refs., 3 figs., 1 tab.

  14. A flower-specific Myb protein activates transcription of phenylpropanoid biosynthetic genes.

    PubMed

    Sablowski, R W; Moyano, E; Culianez-Macia, F A; Schuch, W; Martin, C; Bevan, M

    1994-01-01

    Synthesis of flavonoid pigments in flowers requires the co-ordinated expression of genes encoding enzymes in th phenylpropanoid biosynthetic pathway. Some cis-elements involved in the transcriptional control of these genes have been defined. We report binding of petal-specific activities from tobacco and Antirrhinum majus (snapdragon) to an element conserved in promoters of phenylpropanoid biosynthetic genes and implicated in expression in flowers. These binding activities were inhibited by antibodies raised against Myb305, a flower-specific Myb protein previously cloned from Antirrhinum by sequence homology. Myb305 bound to the same element and formed a DNA-protein complex with the same mobility as the Antirrhinum petal protein in electrophoretic mobility shift experiments. Myb305 activated expression from its binding site in yeast and in tobacco protoplasts. In protoplasts, activation also required a G-box-like element, suggesting co-operation with other elements and factors. The results strongly suggest a role for Myb305-related proteins in the activation of phenylpropanoid biosynthetic genes in flowers. This is consistent with the genetically demonstrated role of plant Myb proteins in the regulation of genes involved in flavonoid synthesis. PMID:8306956

  15. Butenyl-spinosyns, a natural example of genetic engineering of antibiotic biosynthetic genes.

    PubMed

    Hahn, Donald R; Gustafson, Gary; Waldron, Clive; Bullard, Brian; Jackson, James D; Mitchell, Jon

    2006-02-01

    Spinosyns, a novel class of insect active macrolides produced by Saccharopolyspora spinosa, are used for insect control in a number of commercial crops. Recently, a new class of spinosyns was discovered from S. pogona NRRL 30141. The butenyl-spinosyns, also called pogonins, are very similar to spinosyns, differing in the length of the side chain at C-21 and in the variety of novel minor factors. The butenyl-spinosyn biosynthetic genes (bus) were cloned on four cosmids covering a contiguous 110-kb region of the NRRL 30141 chromosome. Their function in butenyl-spinosyn biosynthesis was confirmed by a loss-of-function deletion, and subsequent complementation by cloned genes. The coding sequences of the butenyl-spinosyn biosynthetic genes and the spinosyn biosynthetic genes from S. spinosa were highly conserved. In particular, the PKS-coding genes from S. spinosa and S. pogona have 91-94% nucleic acid identity, with one notable exception. The butenyl-spinosyn gene sequence codes for one additional PKS module, which is responsible for the additional two carbons in the C-21 tail. The DNA sequence of spinosyn genes in this region suggested that the S. spinosa spnA gene could have been the result of an in-frame deletion of the S. pogona busA gene. Therefore, the butenyl-spinosyn genes represent the putative parental gene structure that was naturally engineered by deletion to create the spinosyn genes. PMID:16179985

  16. Different Biosynthetic Pathways to Fosfomycin in Pseudomonas syringae and Streptomyces Species

    PubMed Central

    Kim, Seung Young; Ju, Kou-San; Metcalf, William W.; Evans, Bradley S.; Kuzuyama, Tomohisa

    2012-01-01

    Fosfomycin is a wide-spectrum antibiotic that is used clinically to treat acute cystitis in the United States. The compound is produced by several strains of streptomycetes and pseudomonads. We sequenced the biosynthetic gene cluster responsible for fosfomycin production in Pseudomonas syringae PB-5123. Surprisingly, the biosynthetic pathway in this organism is very different from that in Streptomyces fradiae and Streptomyces wedmorensis. The pathways share the first and last steps, involving conversion of phosphoenolpyruvate to phosphonopyruvate (PnPy) and 2-hydroxypropylphosphonate (2-HPP) to fosfomycin, respectively, but the enzymes converting PnPy to 2-HPP are different. The genome of P. syringae PB-5123 lacks a gene encoding the PnPy decarboxylase found in the Streptomyces strains. Instead, it contains a gene coding for a citrate synthase-like enzyme, Psf2, homologous to the proteins that add an acetyl group to PnPy in the biosynthesis of FR-900098 and phosphinothricin. Heterologous expression and purification of Psf2 followed by activity assays confirmed the proposed activity of Psf2. Furthermore, heterologous production of fosfomycin in Pseudomonas aeruginosa from a fosmid encoding the fosfomycin biosynthetic cluster from P. syringae PB-5123 confirmed that the gene cluster is functional. Therefore, two different pathways have evolved to produce this highly potent antimicrobial agent. PMID:22615277

  17. Prolonged starvation drives reversible sequestration of lipid biosynthetic enzymes and organelle reorganization in Saccharomyces cerevisiae

    PubMed Central

    Suresh, Harsha Garadi; da Silveira dos Santos, Aline Xavier; Kukulski, Wanda; Tyedmers, Jens; Riezman, Howard; Bukau, Bernd; Mogk, Axel

    2015-01-01

    Cells adapt to changing nutrient availability by modulating a variety of processes, including the spatial sequestration of enzymes, the physiological significance of which remains controversial. These enzyme deposits are claimed to represent aggregates of misfolded proteins, protein storage, or complexes with superior enzymatic activity. We monitored spatial distribution of lipid biosynthetic enzymes upon glucose depletion in Saccharomyces cerevisiae. Several different cytosolic-, endoplasmic reticulum–, and mitochondria-localized lipid biosynthetic enzymes sequester into distinct foci. Using the key enzyme fatty acid synthetase (FAS) as a model, we show that FAS foci represent active enzyme assemblies. Upon starvation, phospholipid synthesis remains active, although with some alterations, implying that other foci-forming lipid biosynthetic enzymes might retain activity as well. Thus sequestration may restrict enzymes' access to one another and their substrates, modulating metabolic flux. Enzyme sequestrations coincide with reversible drastic mitochondrial reorganization and concomitant loss of endoplasmic reticulum–mitochondria encounter structures and vacuole and mitochondria patch organelle contact sites that are reflected in qualitative and quantitative changes in phospholipid profiles. This highlights a novel mechanism that regulates lipid homeostasis without profoundly affecting the activity status of involved enzymes such that, upon entry into favorable growth conditions, cells can quickly alter lipid flux by relocalizing their enzymes. PMID:25761633

  18. Identification and characterization of the biosynthetic gene cluster of polyoxypeptin A, a potent apoptosis inducer

    PubMed Central

    2014-01-01

    Background Polyoxypeptin A was isolated from a culture broth of Streptomyces sp. MK498-98 F14, which has a potent apoptosis-inducing activity towards human pancreatic carcinoma AsPC-1 cells. Structurally, polyoxypeptin A is composed of a C15 acyl side chain and a nineteen-membered cyclodepsipeptide core that consists of six unusual nonproteinogenic amino acid residues (N-hydroxyvaline, 3-hydroxy-3-methylproline, 5-hydroxypiperazic acid, N-hydroxyalanine, piperazic acid, and 3-hydroxyleucine) at high oxidation states. Results A gene cluster containing 37 open reading frames (ORFs) has been sequenced and analyzed for the biosynthesis of polyoxypeptin A. We constructed 12 specific gene inactivation mutants, most of which abolished the production of polyoxypeptin A and only ΔplyM mutant accumulated a dehydroxylated analogue polyoxypeptin B. Based on bioinformatics analysis and genetic data, we proposed the biosynthetic pathway of polyoxypeptin A and biosynthetic models of six unusual amino acid building blocks and a PKS extender unit. Conclusions The identified gene cluster and proposed pathway for the biosynthesis of polyoxypeptin A will pave a way to understand the biosynthetic mechanism of the azinothricin family natural products and provide opportunities to apply combinatorial biosynthesis strategy to create more useful compounds. PMID:24506891

  19. Characterization of two acetyltransferase genes in the pyripyropene biosynthetic gene cluster from Penicillium coprobium

    PubMed Central

    Hu, Jie; Furutani, Ayako; Yamamoto, Kentaro; Oyama, Kazuhiko; Mitomi, Masaaki; Anzai, Hiroyuki

    2014-01-01

    Pyripyropenes potently and selectively inhibit acyl-CoA:cholesterol acyltransferase 2 (ACAT-2). Among multiple isomers of pyripyropene (A to R), pyripyropene A (PyA) has insecticidal properties in addition to its growth inhibition properties against human umbilical vein endothelial cells. Based on the predicted biosynthetic gene cluster of pyripyropene A, two genes (ppb8 and ppb9) encoding two acetyltransferases (ATs) were separately isolated and introduced into the model fungus Aspergillus oryzae, using the protoplast–polyethylene glycol method. The bioconversion of certain predicted intermediates in the transformants revealed the manner by which acetylation occurred in the biosynthetic pathway by the products expressed by these two genes (AT-1 and AT-2). The acetylated products detected by high-performance liquid chromatography (HPLC) in the extracts from AT-1 and AT-2 transformant clones were not present in the extract from the transformant clone with an empty vector. The HLPC charts of each bioconversion study exhibited high peaks at 12, 10.5 and 9 min, respectively. Further ultraviolet absorption and mass spectrometry analyses identified the products as PyE, PyO and PyA, respectively. AT-1 acetylated the C-1 of deacetyl-pyripyropene E (deAc-PyE), while AT-2 played an active role in acetylating the C-11 of 11-deAc-PyO and C-7 of deAc-PyA at two different steps of the biosynthetic pathway. PMID:26019565

  20. A simple biosynthetic pathway for large product generation from small substrate amounts

    NASA Astrophysics Data System (ADS)

    Djordjevic, Marko; Djordjevic, Magdalena

    2012-10-01

    A recently emerging discipline of synthetic biology has the aim of constructing new biosynthetic pathways with useful biological functions. A major application of these pathways is generating a large amount of the desired product. However, toxicity due to the possible presence of toxic precursors is one of the main problems for such production. We consider here the problem of generating a large amount of product from a potentially toxic substrate. To address this, we propose a simple biosynthetic pathway, which can be induced in order to produce a large number of the product molecules, by keeping the substrate amount at low levels. Surprisingly, we show that the large product generation crucially depends on fast non-specific degradation of the substrate molecules. We derive an optimal induction strategy, which allows as much as three orders of magnitude increase in the product amount through biologically realistic parameter values. We point to a recently discovered bacterial immune system (CRISPR/Cas in E. coli) as a putative example of the pathway analysed here. We also argue that the scheme proposed here can be used not only as a stand-alone pathway, but also as a strategy to produce a large amount of the desired molecules with small perturbations of endogenous biosynthetic pathways.

  1. Pyrimidine biosynthetic enzymes of Salmonella typhimurium, repressed specifically by growth in the presence of cytidine.

    PubMed Central

    Kelln, R A; Kinahan, J J; Foltermann, K F; O'Donovan, G A

    1975-01-01

    The repressive effects of exogenous cytidine on growing cells was examined in a specially constructed strain in which the pool sizes of endogenous uridine 5'-diphosphate and uridine 5'-triphosphate cannot be varied by the addition of uracil and/or uridine to the medium. Five enzymes of the pyrimidine biosynthetic pathway and one enzyme of the arginine biosynthetic pathway were assayed from cells grown under a variety of conditions. Cytidine repressed the synthesis of dihydroorotase (encoded by pyrC), dihydroorotate dehydrogenase (encoded by pyrD), and ornithine transcarbamylase (encoded by argI). Moreover, aspartate transcarbamylase (encoded by pyrB) became further derepressed upon cytidine addition, whereas no change occurred in the levels of the last two enzymes (encoded by pyrE and pyrF) of the pyrimidine pathway. Quantitative nucleotide pool determinations have provided evidence that any individual ribo- or deoxyribonucleoside mono-, di-, or triphosphate of cytosine or uracil is not a repressing metabolite for the pyrimidine biosynthetic enzymes. Other nucleotide derivatives or ratios must be considered. PMID:1102530

  2. Cloning and characterization of the goadsporin biosynthetic gene cluster from Streptomyces sp. TP-A0584.

    PubMed

    Onaka, Hiroyasu; Nakaho, Mizuho; Hayashi, Keiko; Igarashi, Yasuhiro; Furumai, Tamotsu

    2005-12-01

    The biosynthetic gene cluster of goadsporin, a polypeptide antibiotic containing thiazole and oxazole rings, was cloned from Streptomyces sp. TP-A0584. The cluster contains a structural gene, godA, and nine god (goadsporin) genes involved in post-translational modification, immunity and transcriptional regulation. Although the gene organization is similar to typical bacteriocin biosynthetic gene clusters, each goadsporin biosynthetic gene shows low homology to these genes. Goadsporin biosynthesis is initiated by the translation of godA, and the subsequent cyclization, dehydration and acetylation are probably catalysed by godD, godE, godF, godG and godH gene products. godI shows high similarity to the 54 kDa subunit of the signal recognition particle and plays an important role in goadsporin immunity. Furthermore, four goadsporin analogues were produced by site-directed mutagenesis of godA, suggesting that this biosynthesis machinery is used for the heterocyclization of peptides. PMID:16339937

  3. Isolation and Characterization of the Gibberellin Biosynthetic Gene Cluster in Sphaceloma manihoticola▿ †

    PubMed Central

    Bömke, Christiane; Rojas, Maria Cecilia; Gong, Fan; Hedden, Peter; Tudzynski, Bettina

    2008-01-01

    Gibberellins (GAs) are tetracyclic diterpenoid phytohormones that were first identified as secondary metabolites of the fungus Fusarium fujikuroi (teleomorph, Gibberella fujikuroi). GAs were also found in the cassava pathogen Sphaceloma manihoticola, but the spectrum of GAs differed from that in F. fujikuroi. In contrast to F. fujikuroi, the GA biosynthetic pathway has not been studied in detail in S. manihoticola, and none of the GA biosynthetic genes have been cloned from the species. Here, we present the identification of the GA biosynthetic gene cluster from S. manihoticola consisting of five genes encoding a bifunctional ent-copalyl/ent-kaurene synthase (CPS/KS), a pathway-specific geranylgeranyl diphosphate synthase (GGS2), and three cytochrome P450 monooxygenases. The functions of all of the genes were analyzed either by a gene replacement approach or by complementing the corresponding F. fujikuroi mutants. The cluster organization and gene functions are similar to those in F. fujikuroi. However, the two border genes in the Fusarium cluster encoding the GA4 desaturase (DES) and the 13-hydroxylase (P450-3) are absent in the S. manihoticola GA gene cluster, consistent with the spectrum of GAs produced by this fungus. The close similarity between the two GA gene clusters, the identical gene functions, and the conserved intron positions suggest a common evolutionary origin despite the distant relatedness of the two fungi. PMID:18567680

  4. Different biosynthetic pathways to fosfomycin in Pseudomonas syringae and Streptomyces species.

    PubMed

    Kim, Seung Young; Ju, Kou-San; Metcalf, William W; Evans, Bradley S; Kuzuyama, Tomohisa; van der Donk, Wilfred A

    2012-08-01

    Fosfomycin is a wide-spectrum antibiotic that is used clinically to treat acute cystitis in the United States. The compound is produced by several strains of streptomycetes and pseudomonads. We sequenced the biosynthetic gene cluster responsible for fosfomycin production in Pseudomonas syringae PB-5123. Surprisingly, the biosynthetic pathway in this organism is very different from that in Streptomyces fradiae and Streptomyces wedmorensis. The pathways share the first and last steps, involving conversion of phosphoenolpyruvate to phosphonopyruvate (PnPy) and 2-hydroxypropylphosphonate (2-HPP) to fosfomycin, respectively, but the enzymes converting PnPy to 2-HPP are different. The genome of P. syringae PB-5123 lacks a gene encoding the PnPy decarboxylase found in the Streptomyces strains. Instead, it contains a gene coding for a citrate synthase-like enzyme, Psf2, homologous to the proteins that add an acetyl group to PnPy in the biosynthesis of FR-900098 and phosphinothricin. Heterologous expression and purification of Psf2 followed by activity assays confirmed the proposed activity of Psf2. Furthermore, heterologous production of fosfomycin in Pseudomonas aeruginosa from a fosmid encoding the fosfomycin biosynthetic cluster from P. syringae PB-5123 confirmed that the gene cluster is functional. Therefore, two different pathways have evolved to produce this highly potent antimicrobial agent. PMID:22615277

  5. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    NASA Astrophysics Data System (ADS)

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-03-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system.

  6. Intraspecific and Interspecific Variation in 5s RNA Genes Are Decoupled in Diploid Wheat Relatives

    PubMed Central

    Kellogg, E. A.; Appels, R.

    1995-01-01

    5S RNAs form part of the ribosome in most organisms. In some, e.g., prokaryotes and some fungi, the genes are part of the ribosomal operon, but in most eukaryotes they are in tandem arrays of hundreds to thousands of copies separate from the main ribosomal array. 5S RNA genes can be aligned across kingdoms. We were therefore surprised to find that, for 28 diploid species of the wheat tribe (Triticeae), nucleotide diversity within an array is up to 6.2% in the genes, not significantly different from that of the nontranscribed spacers. Rates of concerted evolution must therefore be insufficient to homogenize the entire array. Between species, there are significantly fewer fixed differences in the gene than would be expected, given the high within-species variation. In contrast, the amount of variation between species in the spacer is the same as or greater than that within individuals. This leads to a paradox. High variation within an individual suggests that there is little selection on any particular gene within an array. But conservation of the gene across species implies that polymorphisms are periodically eliminated at a rate approximately equal to or greater than that of speciation. Levels of intraspecific polymorphism and interspecific divergence are thus decoupled. This implies that selective mechanisms exist to eliminate mutations in the gene without also affecting the spacer. PMID:7635297

  7. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure.

    PubMed

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-01-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30-70 K in pressure range of 100-170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50-70 K in pressure range of 100-150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  8. Magnetization reversal phenomena in (Cr0.70Ti0.30)5S6

    NASA Astrophysics Data System (ADS)

    Hashimoto, Satoshi; Matsuda, Yuji; Sato, Tetsuya; Anzai, Shuichiro

    2005-12-01

    Magnetization reversal phenomena (MRP) along magnetic order-order transitions have recently been reported on impurity-doped magnetic systems. Because imperfect long-range magnetic order exists in these systems, it is expected that a systematic investigation of MRP will give physical information on thermomagnetic processes of magnetic systems in the range from the micro- to nanoscales. As a typical order-order transition (a state doubly modulated by helical and canting orders to a collinear ferrimagnetic state) has been known to occur on Cr5S6 at a transition temperature Tt, we investigate the magnetizations of (Cr0.70Ti0.30)5S6 on heating and cooling runs in various magnetic fields. At 20Oe, the field-cooled magnetization just below the Curie temperature has a positive sign; the sign turns negative below the compensation temperature TCM (first step) and finally returns to positive below Tt (second step). The first-step MRP observed in this system is explained by the potential barriers resulting from anisotropy energy when the preferred direction of collinear ferrimagnetic moment reverses. The proposed mechanism for second-step MRP is the pinning effect caused by the impurity atoms (Ti) in the helical long-range-order chains. Comparing other examples of MRPs, we discuss the roles of local impurity centers in the thermomagnetic process in magnetic order-order transitions.

  9. Construction of the mycoplasma evolutionary tree from 5S rRNA sequence data.

    PubMed Central

    Rogers, M J; Simmons, J; Walker, R T; Weisburg, W G; Woese, C R; Tanner, R S; Robinson, I M; Stahl, D A; Olsen, G; Leach, R H

    1985-01-01

    The 5S rRNA sequences of eubacteria and mycoplasmas have been analyzed and a phylogenetic tree constructed. We determined the sequences of 5S rRNA from Clostridium innocuum, Acholeplasma laidlawii, Acholeplasma modicum, Anaeroplasma bactoclasticum, Anaeroplasma abactoclasticum, Ureaplasma urealyticum, Mycoplasma mycoides mycoides, Mycoplasma pneumoniae, and Mycoplasma gallisepticum. Analysis of these and published sequences shows that mycoplasmas form a coherent phylogenetic group that, with C. innocuum, arose as a branch of the low G+C Gram-positive tree, near the lactobacilli and streptococci. The initial event in mycoplasma phylogeny was formation of the Acholeplasma branch; hence, loss of cell wall probably occurred at the time of genome reduction to approximately to 1000 MDa. A subsequent branch produced the Spiroplasma. This branch appears to have been the origin of sterol-requiring mycoplasmas. During development of the Spiroplasma branch there were several independent genome reductions, each to approximately 500 MDa, resulting in Mycoplasma and Ureaplasma species. Mycoplasmas, particularly species with the smallest genomes, have high mutation rates, suggesting that they are in a state of rapid evolution. PMID:2579388

  10. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    PubMed Central

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-01-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  11. Biosynthetic Pathway of the Reduced Polyketide Product Citreoviridin in Aspergillus terreus var. aureus Revealed by Heterologous Expression in Aspergillus nidulans.

    PubMed

    Lin, Tzu-Shyang; Chiang, Yi-Ming; Wang, Clay C C

    2016-03-18

    Citreoviridin (1) belongs to a class of F1-ATPase β-subunit inhibitors that are synthesized by highly reducing polyketide synthases. These potent mycotoxins share an α-pyrone polyene structure, and they include aurovertin, verrucosidin, and asteltoxin. The identification of the citreoviridin biosynthetic gene cluster in Aspergillus terreus var. aureus and its reconstitution using heterologous expression in Aspergillus nidulans are reported. Two intermediates were isolated that allowed the proposal of the biosynthetic pathway of citreoviridin. PMID:26954888

  12. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site

    PubMed Central

    Calviño, Fabiola R.; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-01-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1–RpL5-N–RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1–RpL5–RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP. PMID:25849277

  13. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    PubMed

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-01-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP. PMID:25849277

  14. Electric-dipole 5s - 5p Transitions in Promethiumlike Ions

    SciTech Connect

    Vilkas, M J; Ishikawa, Y; Trabert, E

    2008-02-29

    The 5s-5p electric-dipole resonance transitions in highly ionized promethiumlike ions have been studied applying relativistic multi-reference Moeller-Plesset second-order perturbation theory. The transition wavelengths are determined to within 0.2 {angstrom} in the more highly charged ions, where the level degeneracies are small. For somewhat lighter ions a very large reference space was used in order to account for the many degeneracies. In order to calculate transition probabilities and lifetimes, correlation corrections have been added to the transition operator in the next order. The contributions from the higher orders of the theory, that is, frequency-dependent Breit correction, Lamb shift, and mass shifts, have been estimated. The results are used to re-assess spectroscopic data from beam-foil, electron beam ion trap, and tokamak observations.

  15. Solution-Based Processing of the Phase-Change Material KSb5S8

    SciTech Connect

    Mitzi,D.; Raoux, S.; Schrott, A.; Copel, M.; Kellock, A.; Jordan-Sweet, J.

    2006-01-01

    A hydrazine-based process for solution-depositing phase-change materials (PCMs) is demonstrated, using KSb{sub 5}S{sub 8} (KSS) as an example. The process involves dissolving the elemental metals and chalcogen in hydrazine at room temperature and spin-coating the solution onto a substrate, followed by a short low-temperature (T {<=} 250 C) anneal. The spin-coated KSS films, which range in thickness from 10 to 90 nm, are examined using variable temperature X-ray diffraction, medium energy ion scattering (MEIS), Rutherford backscattering spectroscopy (RBS), and scanning electron microscopy (SEM). The spin-coated KSS films exhibit a reversible amorphous-crystalline transition with a relatively high crystallization temperature ({approx}280 C). Selected other chalcogenide-based PCMs are also expected to be suitable for thin-film deposition using this approach.

  16. Minimally Invasive Approach For Extraforaminal Synovial Cyst L5-S1

    PubMed Central

    Torres Campa-Santamarina, Jose; Towne, Sara; Alimi, Marjan; Härtl, Roger

    2015-01-01

    Symptoms from synovial cysts are produced by neural compression in the spinal canal or the foramen. Few cases of extraforaminal synovial cyst have been published in the literature. This is a case report of a 65-year-old female who presented with a three-month history of sciatic pain and no relief with conservative treatment. MRI showed a left-sided extraforaminal synovial cyst at L5-S1 with compression of the L5 nerve root at the lateral portion of the foramen. Minimally invasive surgery for resection was performed using an extraforaminal tubular microscopic endoscopy-assisted approach. The patient improved clinically and remained symptom-free for the entire follow-up of 30 months. PMID:26623217

  17. Magic wavelengths for the 5 s - 18 s transition in rubidium

    NASA Astrophysics Data System (ADS)

    Goldschmidt, Elizabeth; Norris, David; Koller, Silvio; Wyllie, Robert; Brown, Roger; Porto, Trey; Safronova, Ulyana; Safronova, Marianna

    2015-05-01

    Magic wavelengths, for which there is no differential ac Stark shift for the ground and excited state of the atom, allow trapping of excited Rydberg atoms without broadening the optical transition. This is an important tool for implementing quantum gates and other quantum information protocols with Rydberg atoms, and reliable theoretical methods to find such magic wavelengths are thus extremely useful. We use a high-precision all-order method to calculate magic wavelengths for the 5 s - 18 s transition of rubidium near the 18 s - 6 p resonances. We compare the calculation to experiment by measuring the light shift for atoms held in a crossed optical dipole trap with wavelength tuned around the 18 s - 6p3 / 2 resonance at the experimentally convenient wavelength of 1064 nm.

  18. Phylogenetic tree derived from bacterial, cytosol and organelle 5S rRNA sequences.

    PubMed Central

    Küntzel, H; Heidrich, M; Piechulla, B

    1981-01-01

    A phylogenetic tree was constructed by computer analysis of 47 completely determined 5S rRNA sequences. The wheat mitochondrial sequence is significantly more related to prokaryotic than to eukaryotic sequences, and its affinity to that of the thermophilic Gram-negative bacterium Thermus aquaticus is comparable to the affinity between Anacystis nidulans and chloroplastic sequences. This strongly supports the idea of an endosymbiotic origin of plant mitochondria. A comparison of the plant cytosol and chloroplast sub-trees suggests a similar rate of nucleotide substitution in nuclear genes and chloroplastic genes. Other features of the tree are a common precursor of protozoa and metazoa, which appears to be more related to the fungal than to the plant protosequence, and an early divergence of the archebacterial sequence (Halobacterium cutirubrum) from the prokaryotic branch. PMID:6785727

  19. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    NASA Technical Reports Server (NTRS)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  20. Classification of 5-S Epileptic EEG Recordings Using Distribution Entropy and Sample Entropy

    PubMed Central

    Li, Peng; Karmakar, Chandan; Yan, Chang; Palaniswami, Marimuthu; Liu, Changchun

    2016-01-01

    Epilepsy is an electrophysiological disorder of the brain, the hallmark of which is recurrent and unprovoked seizures. Electroencephalogram (EEG) measures electrical activity of the brain that is commonly applied as a non-invasive technique for seizure detection. Although a vast number of publications have been published on intelligent algorithms to classify interictal and ictal EEG, it remains an open question whether they can be detected using short-length EEG recordings. In this study, we proposed three protocols to select 5 s EEG segment for classifying interictal and ictal EEG from normal. We used the publicly-accessible Bonn database, which consists of normal, interical, and ictal EEG signals with a length of 4097 sampling points (23.6 s) per record. In this study, we selected three segments of 868 points (5 s) length from each recordings and evaluated results for each of them separately. The well-studied irregularity measure—sample entropy (SampEn)—and a more recently proposed complexity measure—distribution entropy (DistEn)—were used as classification features. A total of 20 combinations of input parameters m and τ for the calculation of SampEn and DistEn were selected for compatibility. Results showed that SampEn was undefined for half of the used combinations of input parameters and indicated a large intra-class variance. Moreover, DistEn performed robustly for short-length EEG data indicating relative independence from input parameters and small intra-class fluctuations. In addition, it showed acceptable performance for all three classification problems (interictal EEG from normal, ictal EEG from normal, and ictal EEG from interictal) compared to SampEn, which showed better results only for distinguishing normal EEG from interictal and ictal. Both SampEn and DistEn showed good reproducibility and consistency, as evidenced by the independence of results on analysing protocol. PMID:27148074

  1. Simple detection of the 5S ribosomal RNA of Pneumocystis carinii using in situ hybridisation.

    PubMed Central

    Kobayashi, M; Urata, T; Ikezoe, T; Hakoda, E; Uemura, Y; Sonobe, H; Ohtsuki, Y; Manabe, T; Miyagi, S; Miyoshi, I

    1996-01-01

    AIMS: To investigate the effectiveness of digoxigenin incorporated double stranded DNA probes produced by the polymerase chain reaction (PCR), for the detection of Pneumocystis carinii, using in situ hybridisation (ISH). METHODS: Formalin fixed, paraffin wax embedded sections of 26 human lung samples from 11 patients with P carinii pneumonia (PCP), and 15 with various types of fungal and viral pneumonia, were obtained during necropsy or transbronchial lung biopsy. Three additional PCP induced rat lung samples were also tested. PCR probes were prepared using the digoxigenin labelling mixture, and they were amplified from the DNA of a PCP induced rat lung after administration of dexamethasone, on the basis that 5S ribosomal RNA sequences are identical in human and rat P carinii. ISH was performed using this probe, and visualised using the digoxigenin nucleic acid detection kit. An immunohistochemical study using anti-human Pneumocystis monoclonal antibody was also carried out in parallel. RESULTS: ISH positively stained eight (of eight) lung necropsy specimens from patients with PCP, three (of three) transbronchial lung biopsy specimens from patients with PCP, and none of the three PCP induced rat lung specimens. In contrast, none of the specimens from patients with pneumonia caused by Aspergillus sp (n = 5), Candida sp (n = 4), Cryptococcus sp (n = 2), mucormycosis (n = 2), or cytomegalovirus (n = 2) were positive on ISH or immunohistochemistry. CONCLUSIONS: Using a digoxigenin labelled PCR probe for the entire 5S rRNA sequence in conjunction with conventional staining, ISH is highly reactive and specific for the diagnosis of PCP. Images PMID:9038753

  2. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells

    PubMed Central

    Cao, Weibiao

    2016-01-01

    Mechanisms of the progression from Barrett’s esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK) inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA. PMID:26901778

  3. A Pol V–Mediated Silencing, Independent of RNA–Directed DNA Methylation, Applies to 5S rDNA

    PubMed Central

    Douet, Julien; Tutois, Sylvie; Tourmente, Sylvette

    2009-01-01

    The plant-specific RNA polymerases Pol IV and Pol V are essential to RNA–directed DNA methylation (RdDM), which also requires activities from RDR2 (RNA–Dependent RNA Polymerase 2), DCL3 (Dicer-Like 3), AGO4 (Argonaute), and DRM2 (Domains Rearranged Methyltransferase 2). RdDM is dedicated to the methylation of target sequences which include transposable elements, regulatory regions of several protein-coding genes, and 5S rRNA–encoding DNA (rDNA) arrays. In this paper, we have studied the expression of the 5S-210 transcript, a marker of silencing release at 5S RNA genes, to show a differential impact of RNA polymerases IV and V on 5S rDNA arrays during early development of the plant. Using a combination of molecular and cytological assays, we show that Pol IV, RDR2, DRM2, and Pol V, actors of the RdDM, are required to maintain a transcriptional silencing of 5S RNA genes at chromosomes 4 and 5. Moreover, we have shown a derepression associated to chromatin decondensation specific to the 5S array from chromosome 4 and restricted to the Pol V–loss of function. In conclusion, our results highlight a new role for Pol V on 5S rDNA, which is RdDM–independent and comes specifically at chromosome 4, in addition to the RdDM pathway. PMID:19834541

  4. Analysis of 5S rDNA arrays in Arabidopsis thaliana: physical mapping and chromosome-specific polymorphisms.

    PubMed

    Cloix, C; Tutois, S; Mathieu, O; Cuvillier, C; Espagnol, M C; Picard, G; Tourmente, S

    2000-05-01

    A physical map of a pericentromeric region of chromosome 5 containing a 5S rDNA locus and spanning approximately 1000 kb was established using the CIC YAC clones. Three 5S rDNA arrays were resolved in this YAC contig by PFGE analysis and we have mapped different types of sequences between these three blocks. 5S rDNA units from each of these three arrays of chromosome 5, and from chromosomes 3 and 4, were isolated by PCR. A total of 38 new DNA sequences were obtained. Two types of 5S rDNA repeated units exist: the major variant with 0.5-kb repeats and one with short repeats (251 bp) only detected on YAC 11A3 from chromosome 3. Although the 38 sequences displayed noticeable heterogeneity, we were able to group them according to their 5S array origin. The presence of 5S array-specific variants was confirmed with the restriction polymorphism study of all the YACs carrying 5S units. PMID:10810091

  5. The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure.

    PubMed Central

    Leontis, N B; Westhof, E

    1998-01-01

    A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings

  6. The nature of Z_b states from a combined analysis of Upsilon (5S)rightarrow h_b(mP) π ^+ π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{(*)}π

    NASA Astrophysics Data System (ADS)

    Huo, Wen-Sheng; Chen, Guo-Ying

    2016-03-01

    With a combined analysis of data on Upsilon (5S)rightarrow h_b(1P,2P)π ^+π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{(*)}π in an effective field theory approach, we determine resonance parameters of Z_b states in two scenarios. In one scenario we assume that Z_b states are pure molecular states, while in the other one we assume that Z_b states contain compact components. We find that the present data favor that there should be some compact components inside Z_b^{(' )} associated with the molecular components. By fitting the invariant mass spectra of Upsilon (5S)rightarrow h_b(1P,2P)π ^+π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{*}π , we determine that the probability of finding the compact components in Z_b states may be as large as about 40 %.

  7. Genomics-driven discovery of the pneumocandin biosynthetic gene cluster in the fungus Glarea lozoyensis

    PubMed Central

    2013-01-01

    Background The antifungal therapy caspofungin is a semi-synthetic derivative of pneumocandin B0, a lipohexapeptide produced by the fungus Glarea lozoyensis, and was the first member of the echinocandin class approved for human therapy. The nonribosomal peptide synthetase (NRPS)-polyketide synthases (PKS) gene cluster responsible for pneumocandin biosynthesis from G. lozoyensis has not been elucidated to date. In this study, we report the elucidation of the pneumocandin biosynthetic gene cluster by whole genome sequencing of the G. lozoyensis wild-type strain ATCC 20868. Results The pneumocandin biosynthetic gene cluster contains a NRPS (GLNRPS4) and a PKS (GLPKS4) arranged in tandem, two cytochrome P450 monooxygenases, seven other modifying enzymes, and genes for L-homotyrosine biosynthesis, a component of the peptide core. Thus, the pneumocandin biosynthetic gene cluster is significantly more autonomous and organized than that of the recently characterized echinocandin B gene cluster. Disruption mutants of GLNRPS4 and GLPKS4 no longer produced the pneumocandins (A0 and B0), and the Δglnrps4 and Δglpks4 mutants lost antifungal activity against the human pathogenic fungus Candida albicans. In addition to pneumocandins, the G. lozoyensis genome encodes a rich repertoire of natural product-encoding genes including 24 PKSs, six NRPSs, five PKS-NRPS hybrids, two dimethylallyl tryptophan synthases, and 14 terpene synthases. Conclusions Characterization of the gene cluster provides a blueprint for engineering new pneumocandin derivatives with improved pharmacological properties. Whole genome estimation of the secondary metabolite-encoding genes from G. lozoyensis provides yet another example of the huge potential for drug discovery from natural products from the fungal kingdom. PMID:23688303

  8. Comparison of tryptophan biosynthetic operon regulation in different Gram-positive bacterial species.

    PubMed

    Gutiérrez-Preciado, Ana; Yanofsky, Charles; Merino, Enrique

    2007-09-01

    The tryptophan biosynthetic operon has been widely used as a model system for studying transcription regulation. In Bacillus subtilis, the trp operon is primarily regulated by a tryptophan-activated RNA-binding protein, TRAP. Here we show that in many other Gram-positive species the trp operon is regulated differently, by tRNA(Trp) sensing by the RNA-based T-box mechanism, with T-boxes arranged in tandem. Our analyses reveal an apparent relationship between trp operon organization and the specific regulatory mechanism(s) used. PMID:17555843

  9. Toxicity of a furanocoumarin to armyworms: a case of biosynthetic escape from insect herbivores.

    PubMed

    Berenbaum, M

    1978-08-11

    When the linear furanocoumarin xanthotoxin, found in many plants of the families Rutaceae and Umbelliferae, was administered to larvae of Spodoptera eridania, a generalist insect herbivore, it displayed toxic properties lacking in its biosynthetic precursor umbelliferone. Reduced toxicity observed in the absence of ultraviolet light is consistent with the known mechanism of photoinactivation of DNA by furanocoumarins through ultraviolet-catalyzed cross-linkage of strands. Thus, the ability of a plant to convert umbelliferone to linear furanocoumarins appears to confer broader protection against insect herbivores. PMID:17790440

  10. Biosynthetic Study on Antihypercholesterolemic Agent Phomoidride: General Biogenesis of Fungal Dimeric Anhydrides.

    PubMed

    Fujii, Ryuya; Matsu, Yusuke; Minami, Atsushi; Nagamine, Shota; Takeuchi, Ichiro; Gomi, Katsuya; Oikawa, Hideaki

    2015-11-20

    To elucidate the general biosynthetic pathway of fungal dimeric anhydrides, a gene cluster for the biosynthesis of the antihy-percholesterolemic agent phomoidride was identified by heterologous expression of candidate genes encoding the highly reducing polyketide synthase, alkylcitrate synthase (ACS), and alkylcitrate dehydratase (ACDH). An in vitro analysis of ACS and ACDH revealed that they give rise to anhydride monomers. Based on the established monomer biosynthesis, we propose a general biogenesis of dimeric anhydrides involving a single donor unit and four acceptor units. PMID:26558485

  11. Plant volatile terpenoid metabolism: biosynthetic genes, transcriptional regulation and subcellular compartmentation.

    PubMed

    Nagegowda, Dinesh A

    2010-07-16

    Volatile terpenoids released from different plant parts play crucial roles in pollinator attraction, plant defense, and interaction with the surrounding environment. Two distinct pathways localized in different subcellular compartments are responsible for the biosynthesis of these compounds. Recent advances in the characterization of genes and enzymes responsible for substrate and end product biosynthesis as well as efforts in metabolic engineering have revealed new aspects of volatile terpenoid biosynthesis. This review summarizes recent progress in the characterization of volatile terpenoid biosynthetic genes, their spatio-temporal expression patterns and subcellular localization of corresponding proteins. In addition, recent information obtained from metabolic engineering is discussed. PMID:20553718

  12. Ansalactams B-D Illustrate Further Biosynthetic Plasticity within the Ansamycin Pathway.

    PubMed

    Le, Tu Cam; Yang, Inho; Yoon, Yeo Joon; Nam, Sang-Jip; Fenical, William

    2016-05-01

    Further chemical investigation of a marine-derived bacterium of the genus Streptomyces has led to the isolation of ansalactams B-D (1-3) along with the previously reported metabolite ansalactam A (4). Ansalactams B-D are significantly modified ansamycins, representing three new carbon skeletons and further illustrating the biosynthetic plasticity of the ansalactam class. Unlike ansalactam A, ansalactams B and D are penta- and hexacyclic metabolites, while ansalactam C illustrates an open polyene chain with a terminal carboxylic acid. PMID:27120128

  13. Origin and evolution of organisms as deduced from 5S ribosomal RNA sequences.

    PubMed

    Hori, H; Osawa, S

    1987-09-01

    A phylogenetic tree of most of the major groups of organisms has been constructed from the 352 5S ribosomal RNA sequences now available. The tree suggests that there are several major groups of eubacteria that diverged during the early stages of their evolution. Metabacteria (= archaebacteria) and eukaryotes separated after the emergence of eubacteria. Among eukaryotes, red algae emerged first; and, later, thraustochytrids (a Proctista group), ascomycetes (yeast), green plants (green algae and land plants), "yellow algae" (brown algae, diatoms, and chrysophyte algae), basidiomycetes (mushrooms and rusts), slime- and water molds, various protozoans, and animals emerged, approximately in that order. Three major types of photosynthetic eukaryotes--i.e., red algae (= Chlorophyll a group), green plants (Chl. a + b group) and yellow algae (Chl. a + c)--are remotely related to one another. Other photosynthetic unicellular protozoans--such as Cyanophora (Chl. a), Euglenophyta (Chl. a + b), Cryptophyta (Chl. a + c), and Dinophyta (Chl. a + c)--seem to have separated shortly after the emergence of the yellow algae. PMID:2452957

  14. Evolution of green plants as deduced from 5S rRNA sequences

    PubMed Central

    Hori, Hiroshi; Lim, Byung-Lak; Osawa, Syozo

    1985-01-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  15. Evolution of green plants as deduced from 5S rRNA sequences.

    PubMed

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  16. Hard X-ray XAFS beamline, BL5S1, at AichiSR

    NASA Astrophysics Data System (ADS)

    Tabuchi, M.; Asakura, H.; Morimoto, H.; Watanabe, N.; Takeda, Y.

    2016-05-01

    A XAFS beamline, BL5S1, had been operated at Aichi Synchrotron Radiation Center, Japan since March 2013. The beamline was designed for the measurements in the energy range from 5 to 20 keV. The photon flux of 6 x 1010 at around 9 keV and beam spot size of 0.5 x 0.3 mm at sample position are as good as designed. For the standard transmission XAFS measurement, both of the step- and quick- scan modes are available. Energy resolution at around 9keV is good enough to discuss the energy shift of the order of 0.1 eV or higher even when the measurements are conducted in the quick-scan mode. With several kinds of detectors for fluorescence and/or CEY detection mode measurements, and various kinds of sample holders which are supported by the XAFS measurement software, users easily obtain spectra for their samples. Such a standard, well operated and easy to access XAFS beamline must be very important to broaden the base of the XAFS society further.

  17. Design and performance of a 1 MW-5 s high temperature superconductor magnetic energy storage system

    NASA Astrophysics Data System (ADS)

    Morandi, Antonio; Gholizad, Babak; Fabbri, Massimo

    2016-01-01

    The feasibility of a 1 MW-5 s superconducting magnetic energy storage (SMES) system based on state-of-the-art high-temperature superconductor (HTS) materials is investigated in detail. Both YBCO coated conductors and MgB2 are considered. A procedure for the electromagnetic design of the coil is introduced and the final layout is arrived at and compared for the two materials. The choice of the inductance of the coil is carried out as part of the design procedure. Both low-field (3 T) and high-field (8 T) designs are considered for the YBCO. AC losses during a complete charge/discharge cycle at full power are estimated and the cooling power needed for continuous operation is derived. The power conditioning system and control algorithms needed to carry out various operations are discussed in detail. Performances of the SMES system during voltage sag compensation, load leveling and power factor correction are investigated by means of numerical simulation.

  18. Secondary structure and domain architecture of the 23S and 5S rRNAs

    PubMed Central

    Petrov, Anton S.; Bernier, Chad R.; Hershkovits, Eli; Xue, Yuzhen; Waterbury, Chris C.; Hsiao, Chiaolong; Stepanov, Victor G.; Gaucher, Eric A.; Grover, Martha A.; Harvey, Stephen C.; Hud, Nicholas V.; Wartell, Roger M.; Fox, George E.; Williams, Loren Dean

    2013-01-01

    We present a de novo re-determination of the secondary (2°) structure and domain architecture of the 23S and 5S rRNAs, using 3D structures, determined by X-ray diffraction, as input. In the traditional 2° structure, the center of the 23S rRNA is an extended single strand, which in 3D is seen to be compact and double helical. Accurately assigning nucleotides to helices compels a revision of the 23S rRNA 2° structure. Unlike the traditional 2° structure, the revised 2° structure of the 23S rRNA shows architectural similarity with the 16S rRNA. The revised 2° structure also reveals a clear relationship with the 3D structure and is generalizable to rRNAs of other species from all three domains of life. The 2° structure revision required us to reconsider the domain architecture. We partitioned the 23S rRNA into domains through analysis of molecular interactions, calculations of 2D folding propensities and compactness. The best domain model for the 23S rRNA contains seven domains, not six as previously ascribed. Domain 0 forms the core of the 23S rRNA, to which the other six domains are rooted. Editable 2° structures mapped with various data are provided (http://apollo.chemistry.gatech.edu/RibosomeGallery). PMID:23771137

  19. Regulation of the cholesterol biosynthetic pathway and its integration with fatty acid biosynthesis in the oleaginous microalga Nannochloropsis oceanica

    PubMed Central

    2014-01-01

    Background Sterols are vital structural and regulatory components in eukaryotic cells; however, their biosynthetic pathways and functional roles in microalgae remain poorly understood. Results In the oleaginous microalga Nannochloropsis oceanica, the sterol biosynthetic pathway produces phytosterols as minor products and cholesterol as the major product. The evidence together with their deduced biosynthetic pathways suggests that N. oceanica exhibits features of both higher plants and mammals. Temporal tracking of sterol profiles and sterol-biosynthetic transcripts in response to changes in light intensity and nitrogen supply reveal that sterols play roles in cell proliferation, chloroplast differentiation, and photosynthesis. Furthermore, the dynamics of fatty acid (FA) and FA-biosynthetic transcripts upon chemical inhibitor-induced sterol depletion reveal possible co-regulation of sterol production and FA synthesis, in that the squalene epoxidase inhibitor terbinafine reduces sterol content yet significantly elevates free FA production. Thus, a feedback regulation of sterol and FA homeostasis is proposed, with the 1-deoxy-D-xylulose 5-phosphate synthase (DXS, the committed enzyme in isoprenoid and sterol biosynthesis) gene potentially subject to feedback regulation by sterols. Conclusion These findings reveal features of sterol function and biosynthesis in microalgae and suggest new genetic engineering or chemical biology approaches for enhanced oil production in microalgae. PMID:24920959

  20. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    PubMed

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus. PMID:26959315

  1. Chromosomal localization and molecular characterization of three different 5S ribosomal DNA clusters in the sea urchin Paracentrotus lividus.

    PubMed

    Caradonna, Fabio; Bellavia, Daniele; Clemente, Ann Maria; Sisino, Giorgia; Barbieri, Rainer

    2007-09-01

    In this paper the chromosomal localization and molecular cloning and characterization of three 5S rDNA clusters of 700 bp (base pairs), 900 bp, and 950 bp in the sea urchin Paracentrotus lividus are reported. Southern blot hybridization demonstrated the existence of three 5S rDNA repeats of differing length in the P. lividus genome. Fluorescence in situ hybridization analysis, performed in parallel on both haploid and diploid metaphases and interphase nuclei using different 5S rDNA units as probes, localized these 5S rDNA clusters in 3 different pairs of P. lividus chromosomes. This is the first complete gene mapping not only in a sea urchin but also in the phylum of echinoderms as a whole. PMID:17893727

  2. 5S rRNA sequences from four marine invertebrates and implications for base pairing models of metazoan sequences.

    PubMed

    Walker, W F; Doolittle, W F

    1983-08-11

    The nucleotide sequences of 5S rRNAs from the starfish Asterias vulgaris, the squid Illex illecebrosus, the sipunculid Phascolopsis gouldii and the jellyfish Aurelia aurita were determined. The sequence from Asterias lends support for one of two previous base pairing models for helix E in metazoan sequences. The Aurelia sequence differs by five nucleotides from that previously reported and does not violate the consensus secondary structure model for eukaryotic 5S rRNA. PMID:6136024

  3. Conformation of 4.5S RNA in the signal recognition particle and on the 30S ribosomal subunit

    PubMed Central

    GU, SHAN-QING; JÖCKEL, JOHANNES; BEINKER, PHILIPP; WARNECKE, JENS; SEMENKOV, YURI P.; RODNINA, MARINA V.; WINTERMEYER, WOLFGANG

    2005-01-01

    The signal recognition particle (SRP) from Escherichia coli consists of 4.5S RNA and protein Ffh. It is essential for targeting ribosomes that are translating integral membrane proteins to the translocation pore in the plasma membrane. Independently of Ffh, 4.5S RNA also interacts with elongation factor G (EF-G) and the 30S ribosomal subunit. Here we use a cross-linking approach to probe the conformation of 4.5S RNA in SRP and in the complex with the 30S ribosomal subunit and to map the binding site. The UV-activatable cross-linker p-azidophenacyl bromide (AzP) was attached to positions 1, 21, and 54 of wild-type or modified 4.5S RNA. In SRP, cross-links to Ffh were formed from AzP in all three positions in 4.5S RNA, indicating a strongly bent conformation in which the 5′ end (position 1) and the tetraloop region (including position 54) of the molecule are close to one another and to Ffh. In ribosomal complexes of 4.5S RNA, AzP in both positions 1 and 54 formed cross-links to the 30S ribosomal subunit, independently of the presence of Ffh. The major cross-linking target on the ribosome was protein S7; minor cross-links were formed to S2, S18, and S21. There were no cross-links from 4.5S RNA to the 50S subunit, where the primary binding site of SRP is located close to the peptide exit. The functional role of 4.5S RNA binding to the 30S subunit is unclear, as the RNA had no effect on translation or tRNA translocation on the ribosome. PMID:16043501

  4. Nucleotide sequences of 5S rRNAs from sponge Halichondria japonica and tunicate Halocynthia roretzi and their phylogenetic positions

    PubMed Central

    Komiya, Hiroyuki; Hasegawa, Masami; Takemura, Shosuke

    1983-01-01

    The nucleotide sequences of 5S rRNAs from sponge Halichondria japonica and tunicate Halocynthia roretzi were determined by chemical and enzymatic gel methods. Their phylogenetic positions among metazoans were derived from the 5S rRNA sequences by a computer analysis based on the maximum parsimony principle. It was suggested that the sponge is closely related to several invertebrates and the tunicate has affinity to vertebrates rather than invertebrates. PMID:6835845

  5. Phylogenetic origins of the plant mitochondrion based on a comparative analysis of 5S ribosomal RNA sequences

    NASA Technical Reports Server (NTRS)

    Villanueva, E.; Delihas, N.; Luehrsen, K. R.; Fox, G. E.; Gibson, J.

    1985-01-01

    The complete nucleotide sequences of 5S ribosomal RNAs from Rhodocyclus gelatinosa, Rhodobacter sphaeroides, and Pseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains. Rhodobacter sphaeroides is specifically related to Paracoccus denitrificans and Rc. gelatinosa is related to Ps. cepacia. These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found in P. denitrificans are present also in the 5S RNA of Rb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of obtaining these new sequences is that it is possible to clarify the phylogenetic origins of the plant mitochondrion. In particular, a close phylogenetic relationship is found between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely, Rb. sphaeroides, P. denitrificans, and Rhodospirillum rubrum.

  6. Coordinate regulation of the tryptophan biosynthetic pathway and indolic phytoalexin accumulation in Arabidopsis.

    PubMed Central

    Zhao, J; Last, R L

    1996-01-01

    Little is known about the mechanisms that couple regulation of secondary metabolic pathways to the synthesis of primary metabolic precursors. Camalexin, an indolic secondary metabolite, appears to be the major phytoalexin in Arabidopsis. It was previously shown that camalexin accumulation is caused by infection with plant pathogens, by abiotic elicitors, and in spontaneous lesions in the accelerated cell death mutant acd2. We demonstrate that the accumulation of this phytoalexin is accompanied by the induction of the mRNAs and proteins for all of the tryptophan biosynthetic enzymes tested. A strong correlation was observed between the magnitude of camalexin accumulation and the induction of tryptophan biosynthetic proteins, indicating coordinate regulation of these processes. Production of disease symptoms is not sufficient for the response because systemic infection with cauliflower mosaic virus or cucumber mosaic virus did not induce the tryptophan pathway enzymes or camalexin accumulation. Salicylic acid appears to be required, but unlike other documented pathogenesis-related proteins, it is not sufficient for the coordinate induction. Results with trp mutants suggest that the tryptophan pathway is not rate limiting for camalexin accumulation. Taken together, these results are consistent with the hypothesis that the regulation of the tryptophan pathway in plants responds to needs for biosynthesis of secondary metabolites. PMID:8989880

  7. Increasing antioxidant levels in tomatoes through modification of the flavonoid biosynthetic pathway.

    PubMed

    Verhoeyen, M E; Bovy, A; Collins, G; Muir, S; Robinson, S; de Vos, C H R; Colliver, S

    2002-10-01

    Flavonoids are a diverse group of phenolic secondary metabolites that occur naturally in plants and therefore form an integral component of the human diet. Many of the compounds belonging to this group are potent antioxidants in vitro and epidemiological studies suggest a direct correlation between high flavonoid intake and decreased risk of cardiovascular disease, cancer and other age-related diseases. Enhancing flavonoid biosynthesis in chosen crops may provide new raw materials that have the potential to be used in foods designed for specific benefits to human health. Using genetic modification, it was possible to generate several tomato lines with significantly altered flavonoid content and to probe the role and importance of several key enzymatic steps in the tomato flavonoid biosynthetic pathway. Most notably an up to 78-fold increase in total fruit flavonols was achieved through ectopic expression of a single biosynthetic enzyme, chalcone isomerase. In addition, chalcone synthase and flavonol synthase transgenes were found to act synergistically to up-regulate flavonol biosynthesis significantly in tomato flesh tissues. PMID:12324533

  8. Bacterial Long-Chain Polyunsaturated Fatty Acids: Their Biosynthetic Genes, Functions, and Practical Use.

    PubMed

    Yoshida, Kiyohito; Hashimoto, Mikako; Hori, Ryuji; Adachi, Takumi; Okuyama, Hidetoshi; Orikasa, Yoshitake; Nagamine, Tadashi; Shimizu, Satoru; Ueno, Akio; Morita, Naoki

    2016-01-01

    The nutritional and pharmaceutical values of long-chain polyunsaturated fatty acids (LC-PUFAs) such as arachidonic, eicosapentaenoic and docosahexaenoic acids have been well recognized. These LC-PUFAs are physiologically important compounds in bacteria and eukaryotes. Although little is known about the biosynthetic mechanisms and functions of LC-PUFAs in bacteria compared to those in higher organisms, a combination of genetic, bioinformatic, and molecular biological approaches to LC-PUFA-producing bacteria and some eukaryotes have revealed the notably diverse organization of the pfa genes encoding a polyunsaturated fatty acid synthase complex (PUFA synthase), the LC-PUFA biosynthetic processes, and tertiary structures of the domains of this enzyme. In bacteria, LC-PUFAs appear to take part in specific functions facilitating individual membrane proteins rather than in the adjustment of the physical fluidity of the whole cell membrane. Very long chain polyunsaturated hydrocarbons (LC-HCs) such as hentriacontanonaene are considered to be closely related to LC-PUFAs in their biosynthesis and function. The possible role of LC-HCs in strictly anaerobic bacteria under aerobic and anaerobic environments and the evolutionary relationships of anaerobic and aerobic bacteria carrying pfa-like genes are also discussed. PMID:27187420

  9. Metabolic and functional diversity of saponins, biosynthetic intermediates and semi-synthetic derivatives

    PubMed Central

    Moses, Tessa; Papadopoulou, Kalliope K.

    2014-01-01

    Saponins are widely distributed plant natural products with vast structural and functional diversity. They are typically composed of a hydrophobic aglycone, which is extensively decorated with functional groups prior to the addition of hydrophilic sugar moieties, to result in surface-active amphipathic compounds. The saponins are broadly classified as triterpenoids, steroids or steroidal glycoalkaloids, based on the aglycone structure from which they are derived. The saponins and their biosynthetic intermediates display a variety of biological activities of interest to the pharmaceutical, cosmetic and food sectors. Although their relevance in industrial applications has long been recognized, their role in plants is underexplored. Recent research on modulating native pathway flux in saponin biosynthesis has demonstrated the roles of saponins and their biosynthetic intermediates in plant growth and development. Here, we review the literature on the effects of these molecules on plant physiology, which collectively implicate them in plant primary processes. The industrial uses and potential of saponins are discussed with respect to structure and activity, highlighting the undoubted value of these molecules as therapeutics. PMID:25286183

  10. Biosynthetic Potential of Phylogenetically Unique Endophytic Actinomycetes from Tropical Plants▿ †

    PubMed Central

    Janso, Jeffrey E.; Carter, Guy T.

    2010-01-01

    The culturable diversity of endophytic actinomycetes associated with tropical, native plants is essentially unexplored. In this study, 123 endophytic actinomycetes were isolated from tropical plants collected from several locations in Papua New Guinea and Mborokua Island, Solomon Islands. Isolates were found to be prevalent in roots but uncommon in leaves. Initially, isolates were dereplicated to the strain level by ribotyping. Subsequent characterization of 105 unique strains by 16S rRNA gene sequence analysis revealed that 17 different genera were represented, and rare genera, such as Sphaerisporangium and Planotetraspora, which have never been previously reported to be endophytic, were quite prevalent. Phylogenetic analyses grouped many of the strains into clades distinct from known genera within Thermomonosporaceae and Micromonosporaceae, indicating that they may be unique genera. Bioactivity testing and liquid chromatography-mass spectrometry (LC-MS) profiling of crude fermentation extracts were performed on 91 strains. About 60% of the extracts exhibited bioactivity or displayed LC-MS profiles with spectra indicative of secondary metabolites. The biosynthetic potential of 29 nonproductive strains was further investigated by the detection of putative polyketide synthase (PKS) and nonribosomal peptide synthetase (NRPS) genes. Despite their lack of detectable secondary metabolite production in fermentation, most were positive for type I (66%) and type II (79%) PKS genes, and all were positive for NRPS genes. These results suggest that tropical plants from New Guinea and the adjacent archipelago are hosts to unique endophytic actinomycetes that possess significant biosynthetic potential. PMID:20472734

  11. Identification and developmental expression profiling of putative alkaloid biosynthetic genes in Corydalis yanhusuo bulbs

    PubMed Central

    Liao, Dengqun; Wang, Pengfei; Jia, Chan; Sun, Peng; Qi, Jianjun; Zhou, Lili; Li, Xian’en

    2016-01-01

    Alkaloids in bulbs of Corydalis (C.) yanhusuo are the major pharmacologically active compounds in treatment of blood vessel diseases, tumors and various pains. However, due to the absence of gene sequences in C. yanhusuo, the genes involved in alkaloid biosynthesis and their expression during bulb development remain unknown. We therefore established the first transcriptome database of C. yanhusuo via Illumina mRNA-Sequencing of a RNA composite sample collected at Bulb initiation (Day 0), early enlargement (Day 10) and maturation (Day 30). 25,013,630 clean 90 bp paired-end reads were de novo assembled into 47,081 unigenes with an average length of 489 bp, among which 30,868 unigenes (65.56%) were annotated in four protein databases. Of 526 putative unigenes involved in biosynthesis o f various alkaloids, 187 were identified as the candidate genes involved in the biosynthesis of benzylisoquinoline alkaloids (BIAs), the only alkaloid type reported in C. yanhusuo untill now. BIAs biosynthetic genes were highly upregulated in the overall pathway during bulb development. Identification of alkaloid biosynthetic genes in C. yanhusuo provide insights on pathways and molecular regulation of alkaloid biosynthesis, to initiate metabolic engineering in order to improve the yield of interesting alkaloids and to identify potentially new alkaloids predicted from the transcriptomic information. PMID:26777987

  12. Expression of phenazine biosynthetic genes during the arbuscular mycorrhizal symbiosis of Glomus intraradices

    PubMed Central

    León-Martínez, Dionicia Gloria; Vielle-Calzada, Jean-Philippe; Olalde-Portugal, Víctor

    2012-01-01

    To explore the molecular mechanisms that prevail during the establishment of the arbuscular mycorrhiza symbiosis involving the genus Glomus, we transcriptionally analysed spores of Glomus intraradices BE3 during early hyphal growth. Among 458 transcripts initially identified as being expressed at presymbiotic stages, 20% of sequences had homology to previously characterized eukaryotic genes, 30% were homologous to fungal coding sequences, and 9% showed homology to previously characterized bacterial genes. Among them, GintPbr1a encodes a homolog to Phenazine Biosynthesis Regulator (Pbr) of Burkholderia cenocepacia, an pleiotropic regulatory protein that activates phenazine production through transcriptional activation of the protein D isochorismatase biosynthetic enzyme phzD (Ramos et al., 2010). Whereas GintPbr1a is expressed during the presymbiotic phase, the G. intraradices BE3 homolog of phzD (BGintphzD) is transcriptionally active at the time of the establishment of the arbuscular mycorrhizal symbiosis. DNA from isolated bacterial cultures found in spores of G. intraradices BE3 confirmed that both BGintPbr1a and BGintphzD are present in the genome of its potential endosymbionts. Taken together, our results indicate that spores of G. intraradices BE3 express bacterial phenazine biosynthetic genes at the onset of the fungal-plant symbiotic interaction. PMID:24031884

  13. Identification of a Pantoea biosynthetic cluster that directs the synthesis of an antimicrobial natural product.

    PubMed

    Walterson, Alyssa M; Smith, Derek D N; Stavrinides, John

    2014-01-01

    Fire Blight is a destructive disease of apple and pear caused by the enteric bacterial pathogen, Erwinia amylovora. E. amylovora initiates infection by colonizing the stigmata of apple and pear trees, and entering the plants through natural openings. Epiphytic populations of the related enteric bacterium, Pantoea, reduce the incidence of disease through competition and antibiotic production. In this study, we identify an antibiotic from Pantoea ananatis BRT175, which is effective against E. amylovora and select species of Pantoea. We used transposon mutagenesis to create a mutant library, screened approximately 5,000 mutants for loss of antibiotic production, and recovered 29 mutants. Sequencing of the transposon insertion sites of these mutants revealed multiple independent disruptions of an 8.2 kb cluster consisting of seven genes, which appear to be coregulated. An analysis of the distribution of this cluster revealed that it was not present in any other of our 115 Pantoea isolates, or in any of the fully sequenced Pantoea genomes, and is most closely related to antibiotic biosynthetic clusters found in three different species of Pseudomonas. This identification of this biosynthetic cluster highlights the diversity of natural products produced by Pantoea. PMID:24796857

  14. Structure determination and interception of biosynthetic intermediates for the plantazolicin class of highly discriminating antibiotics.

    PubMed

    Molohon, Katie J; Melby, Joel O; Lee, Jaeheon; Evans, Bradley S; Dunbar, Kyle L; Bumpus, Stefanie B; Kelleher, Neil L; Mitchell, Douglas A

    2011-12-16

    The soil-dwelling, plant growth-promoting bacterium Bacillus amyloliquefaciens FZB42 is a prolific producer of complex natural products. Recently, a new FZB42 metabolite, plantazolicin (PZN), has been described as a member of the growing thiazole/oxazole-modified microcin (TOMM) family. TOMMs are biosynthesized from inactive, ribosomal peptides and undergo a series of cyclodehydrations, dehydrogenations, and other modifications to become bioactive natural products. Using high-resolution mass spectrometry, chemoselective modification, genetic interruptions, and other spectroscopic tools, we have determined the molecular structure of PZN. In addition to two conjugated polyazole moieties, the amino-terminus of PZN has been modified to N(α),N(α)-dimethylarginine. PZN exhibited a highly selective antibiotic activity toward Bacillus anthracis, but no other tested human pathogen. By altering oxygenation levels during fermentation, PZN analogues were produced that bear variability in their heterocycle content, which yielded insight into the order of biosynthetic events. Lastly, genome-mining has revealed the existence of four additional PZN-like biosynthetic gene clusters. Given their structural uniqueness and intriguing antimicrobial specificity, the PZN class of antibiotics may hold pharmacological value. PMID:21950656

  15. Genetic engineering and heterologous expression of the disorazol biosynthetic gene cluster via Red/ET recombineering.

    PubMed

    Tu, Qiang; Herrmann, Jennifer; Hu, Shengbiao; Raju, Ritesh; Bian, Xiaoying; Zhang, Youming; Müller, Rolf

    2016-01-01

    Disorazol, a macrocyclic polykitide produced by the myxobacterium Sorangium cellulosum So ce12 and it is reported to have potential cytotoxic activity towards several cancer cell lines, including multi-drug resistant cells. The disorazol biosynthetic gene cluster (dis) from Sorangium cellulosum (So ce12) was identified by transposon mutagenesis and cloned in a bacterial artificial chromosome (BAC) library. The 58-kb dis core gene cluster was reconstituted from BACs via Red/ET recombineering and expressed in Myxococcus xanthus DK1622. For the first time ever, a myxobacterial trans-AT polyketide synthase has been expressed heterologously in this study. Expression in M. xanthus allowed us to optimize the yield of several biosynthetic products using promoter engineering. The insertion of an artificial synthetic promoter upstream of the disD gene encoding a discrete acyl transferase (AT), together with an oxidoreductase (Or), resulted in 7-fold increase in disorazol production. The successful reconstitution and expression of the genetic sequences encoding for these promising cytotoxic compounds will allow combinatorial biosynthesis to generate novel disorazol derivatives for further bioactivity evaluation. PMID:26875499

  16. Analysis of Polygala tenuifolia Transcriptome and Description of Secondary Metabolite Biosynthetic Pathways by Illumina Sequencing.

    PubMed

    Tian, Hongling; Xu, Xiaoshuang; Zhang, Fusheng; Wang, Yaoqin; Guo, Shuhong; Qin, Xuemei; Du, Guanhua

    2015-01-01

    Radix polygalae, the dried roots of Polygala tenuifolia and P. sibirica, is one of the most well-known traditional Chinese medicinal plants. Radix polygalae contains various saponins, xanthones, and oligosaccharide esters and these compounds are responsible for several pharmacological properties. To provide basic breeding information, enhance molecular biological analysis, and determine secondary metabolite biosynthetic pathways of P. tenuifolia, we applied Illumina sequencing technology and de novo assembly. We also applied this technique to gain an overview of P. tenuifolia transcriptome from samples with different years. Using Illumina sequencing, approximately 67.2% of unique sequences were annotated by basic local alignment search tool similarity searches against public sequence databases. We classified the annotated unigenes by using Nr, Nt, GO, COG, and KEGG databases compared with NCBI. We also obtained many candidates CYP450s and UGTs by the analysis of genes in the secondary metabolite biosynthetic pathways, including putative terpenoid backbone and phenylpropanoid biosynthesis pathway. With this transcriptome sequencing, future genetic and genomics studies related to the molecular mechanisms associated with the chemical composition of P. tenuifolia may be improved. Genes involved in the enrichment of secondary metabolite biosynthesis-related pathways could enhance the potential applications of P. tenuifolia in pharmaceutical industries. PMID:26543847

  17. Analysis of Polygala tenuifolia Transcriptome and Description of Secondary Metabolite Biosynthetic Pathways by Illumina Sequencing

    PubMed Central

    Tian, Hongling; Xu, Xiaoshuang; Zhang, Fusheng; Wang, Yaoqin; Guo, Shuhong; Qin, Xuemei; Du, Guanhua

    2015-01-01

    Radix polygalae, the dried roots of Polygala tenuifolia and P. sibirica, is one of the most well-known traditional Chinese medicinal plants. Radix polygalae contains various saponins, xanthones, and oligosaccharide esters and these compounds are responsible for several pharmacological properties. To provide basic breeding information, enhance molecular biological analysis, and determine secondary metabolite biosynthetic pathways of P. tenuifolia, we applied Illumina sequencing technology and de novo assembly. We also applied this technique to gain an overview of P. tenuifolia transcriptome from samples with different years. Using Illumina sequencing, approximately 67.2% of unique sequences were annotated by basic local alignment search tool similarity searches against public sequence databases. We classified the annotated unigenes by using Nr, Nt, GO, COG, and KEGG databases compared with NCBI. We also obtained many candidates CYP450s and UGTs by the analysis of genes in the secondary metabolite biosynthetic pathways, including putative terpenoid backbone and phenylpropanoid biosynthesis pathway. With this transcriptome sequencing, future genetic and genomics studies related to the molecular mechanisms associated with the chemical composition of P. tenuifolia may be improved. Genes involved in the enrichment of secondary metabolite biosynthesis-related pathways could enhance the potential applications of P. tenuifolia in pharmaceutical industries. PMID:26543847

  18. Sporopollenin biosynthetic enzymes interact and constitute a metabolon localized to the endoplasmic reticulum of tapetum cells.

    PubMed

    Lallemand, Benjamin; Erhardt, Mathieu; Heitz, Thierry; Legrand, Michel

    2013-06-01

    The sporopollenin polymer is the major constituent of exine, the outer pollen wall. Recently fatty acid derivatives have been shown to be the precursors of sporopollenin building units. ACYL-COA SYNTHETASE, POLYKETIDE SYNTHASE A (PKSA) and PKSB, TETRAKETIDE α-PYRONE REDUCTASE1 (TKPR1) and TKPR2 have been demonstrated to be involved in sporopollenin biosynthesis in Arabidopsis (Arabidopsis thaliana). Here all these sporopollenin biosynthetic enzymes but TKPR2 have been immunolocalized to endoplasmic reticulum of anther tapetal cells. Pull-down experiments demonstrated that tagged recombinant proteins interacted to form complexes whose constituents were characterized by immunoblotting. In vivo protein interactions were evidenced by yeast (Saccharomyces cerevisiae) two-hybrid analysis and by fluorescence lifetime imaging microscopy/Förster resonance energy transfer studies in transgenic Nicotiana benthamiana, which were used to test the possibility that the enzymes interact to form a biosynthetic metabolon. Various pairs of proteins fused to two distinct fluorochromes were coexpressed in N. benthamiana leaf tissues and fluorescence lifetime imaging microscopy/Förster resonance energy transfer measurements demonstrated that proteins interacted pairwise in planta. Taken together, these results suggest the existence of a sporopollenin metabolon. PMID:23632852

  19. Evolution of alternative biosynthetic pathways for vitamin C following plastid acquisition in photosynthetic eukaryotes

    PubMed Central

    Wheeler, Glen; Ishikawa, Takahiro; Pornsaksit, Varissa; Smirnoff, Nicholas

    2015-01-01

    Ascorbic acid (vitamin C) is an enzyme co-factor in eukaryotes that also plays a critical role in protecting photosynthetic eukaryotes against damaging reactive oxygen species derived from the chloroplast. Many animal lineages, including primates, have become ascorbate auxotrophs due to the loss of the terminal enzyme in their biosynthetic pathway, l-gulonolactone oxidase (GULO). The alternative pathways found in land plants and Euglena use a different terminal enzyme, l-galactonolactone dehydrogenase (GLDH). The evolutionary processes leading to these differing pathways and their contribution to the cellular roles of ascorbate remain unclear. Here we present molecular and biochemical evidence demonstrating that GULO was functionally replaced with GLDH in photosynthetic eukaryote lineages following plastid acquisition. GULO has therefore been lost repeatedly throughout eukaryote evolution. The formation of the alternative biosynthetic pathways in photosynthetic eukaryotes uncoupled ascorbate synthesis from hydrogen peroxide production and likely contributed to the rise of ascorbate as a major photoprotective antioxidant. DOI: http://dx.doi.org/10.7554/eLife.06369.001 PMID:25768426

  20. Genetic engineering and heterologous expression of the disorazol biosynthetic gene cluster via Red/ET recombineering

    PubMed Central

    Tu, Qiang; Herrmann, Jennifer; Hu, Shengbiao; Raju, Ritesh; Bian, Xiaoying; Zhang, Youming; Müller, Rolf

    2016-01-01

    Disorazol, a macrocyclic polykitide produced by the myxobacterium Sorangium cellulosum So ce12 and it is reported to have potential cytotoxic activity towards several cancer cell lines, including multi-drug resistant cells. The disorazol biosynthetic gene cluster (dis) from Sorangium cellulosum (So ce12) was identified by transposon mutagenesis and cloned in a bacterial artificial chromosome (BAC) library. The 58-kb dis core gene cluster was reconstituted from BACs via Red/ET recombineering and expressed in Myxococcus xanthus DK1622. For the first time ever, a myxobacterial trans-AT polyketide synthase has been expressed heterologously in this study. Expression in M. xanthus allowed us to optimize the yield of several biosynthetic products using promoter engineering. The insertion of an artificial synthetic promoter upstream of the disD gene encoding a discrete acyl transferase (AT), together with an oxidoreductase (Or), resulted in 7-fold increase in disorazol production. The successful reconstitution and expression of the genetic sequences encoding for these promising cytotoxic compounds will allow combinatorial biosynthesis to generate novel disorazol derivatives for further bioactivity evaluation. PMID:26875499

  1. GIP2, a Putative Transcription Factor That Regulates the Aurofusarin Biosynthetic Gene Cluster in Gibberella zeae

    PubMed Central

    Kim, Jung-Eun; Jin, Jianming; Kim, Hun; Kim, Jin-Cheol; Yun, Sung-Hwan; Lee, Yin-Won

    2006-01-01

    Gibberella zeae (anamorph: Fusarium graminearum) is an important pathogen of maize, wheat, and rice. Colonies of G. zeae produce yellow-to-tan mycelia with the white-to-carmine red margins. In this study, we focused on nine putative open reading frames (ORFs) closely linked to PKS12 and GIP1, which are required for aurofusarin biosynthesis in G. zeae. Among them is an ORF designated GIP2 (for Gibberella zeae pigment gene 2), which encodes a putative protein of 398 amino acids that carries a Zn(II)2Cys6 binuclear cluster DNA-binding domain commonly found in transcription factors of yeasts and filamentous fungi. Targeted gene deletion and complementation analyses confirmed that GIP2 is required for aurofusarin biosynthesis. Expression of GIP2 in carrot medium correlated with aurofusarin production by G. zeae and was restricted to vegetative mycelia. Inactivation of the 10 contiguous genes in the ΔGIP2 strain delineates an aurofusarin biosynthetic gene cluster. Overexpression of GIP2 in both the ΔGIP2 and the wild-type strains increases aurofusarin production and reduces mycelial growth. Thus, GIP2 is a putative positive regulator of the aurofusarin biosynthetic gene cluster, and aurofusarin production is negatively correlated with vegetative growth by G. zeae. PMID:16461721

  2. Two Cytochrome P450 Monooxygenases Catalyze Early Hydroxylation Steps in the Potato Steroid Glycoalkaloid Biosynthetic Pathway.

    PubMed

    Umemoto, Naoyuki; Nakayasu, Masaru; Ohyama, Kiyoshi; Yotsu-Yamashita, Mari; Mizutani, Masaharu; Seki, Hikaru; Saito, Kazuki; Muranaka, Toshiya

    2016-08-01

    α-Solanine and α-chaconine, steroidal glycoalkaloids (SGAs) found in potato (Solanum tuberosum), are among the best-known secondary metabolites in food crops. At low concentrations in potato tubers, SGAs are distasteful; however, at high concentrations, SGAs are harmful to humans and animals. Here, we show that POTATO GLYCOALKALOID BIOSYNTHESIS1 (PGA1) and PGA2, two genes that encode cytochrome P450 monooxygenases (CYP72A208 and CYP72A188), are involved in the SGA biosynthetic pathway, respectively. The knockdown plants of either PGA1 or PGA2 contained very little SGA, yet vegetative growth and tuber production were not affected. Analyzing metabolites that accumulated in the plants and produced by in vitro enzyme assays revealed that PGA1 and PGA2 catalyzed the 26- and 22-hydroxylation steps, respectively, in the SGA biosynthetic pathway. The PGA-knockdown plants had two unique phenotypic characteristics: The plants were sterile and tubers of these knockdown plants did not sprout during storage. Functional analyses of PGA1 and PGA2 have provided clues for controlling both potato glycoalkaloid biosynthesis and tuber sprouting, two traits that can significantly impact potato breeding and the industry. PMID:27307258

  3. Cellular and nerve regeneration within a biosynthetic extracellular matrix for corneal transplantation

    NASA Astrophysics Data System (ADS)

    Li, Fengfu; Carlsson, David; Lohmann, Chris; Suuronen, Erik; Vascotto, Sandy; Kobuch, Karin; Sheardown, Heather; Munger, Rejean; Nakamura, Masatsugu; Griffith, May

    2003-12-01

    Our objective was to determine whether key properties of extracellular matrix (ECM) macromolecules can be replicated within tissue-engineered biosynthetic matrices to influence cellular properties and behavior. To achieve this, hydrated collagen and N-isopropylacrylamide copolymer-based ECMs were fabricated and tested on a corneal model. The structural and immunological simplicity of the cornea and importance of its extensive innervation for optimal functioning makes it an ideal test model. In addition, corneal failure is a clinically significant problem. Matrices were therefore designed to have the optical clarity and the proper dimensions, curvature, and biomechanical properties for use as corneal tissue replacements in transplantation. In vitro studies demonstrated that grafting of the laminin adhesion pentapeptide motif, YIGSR, to the hydrogels promoted epithelial stratification and neurite in-growth. Implants into pigs' corneas demonstrated successful in vivo regeneration of host corneal epithelium, stroma, and nerves. In particular, functional nerves were observed to rapidly regenerate in implants. By comparison, nerve regeneration in allograft controls was too slow to be observed during the experimental period, consistent with the behavior of human cornea transplants. Other corneal substitutes have been produced and tested, but here we report an implantable matrix that performs as a physiologically functional tissue substitute and not simply as a prosthetic device. These biosynthetic ECM replacements should have applicability to many areas of tissue engineering and regenerative medicine, especially where nerve function is required. regenerative medicine | tissue engineering | cornea | implantation | innervation

  4. Sioxanthin, a novel glycosylated carotenoid, reveals an unusual subclustered biosynthetic pathway.

    PubMed

    Richter, Taylor K S; Hughes, Chambers C; Moore, Bradley S

    2015-06-01

    Members of the marine actinomycete genus Salinispora constitutively produce a characteristic orange pigment during vegetative growth. Contrary to the understanding of widespread carotenoid biosynthesis pathways in bacteria, Salinispora carotenoid biosynthesis genes are not confined to a single cluster. Instead, bioinformatic and genetic investigations confirm that four regions of the Salinispora tropica CNB-440 genome, consisting of two gene clusters and two independent genes, contribute to the in vivo production of a single carotenoid. This compound, namely (2'S)-1'-(β-D-glucopyranosyloxy)-3',4'-didehydro-1',2'-dihydro-φ,ψ-caroten-2'-ol, is novel and has been given the trivial name 'sioxanthin'. Sioxanthin is a C40 -carotenoid, glycosylated on one end of the molecule and containing an aryl moiety on the opposite end. Glycosylation is unusual among actinomycete carotenoids, and sioxanthin joins a rare group of carotenoids with polar and non-polar head groups. Gene sequence homology predicts that the sioxanthin biosynthetic pathway is present in all of the Salinispora as well as other members of the family Micromonosporaceae. Additionally, this study's investigations of clustering of carotenoid biosynthetic genes in heterotrophic bacteria show that a non-clustered genome arrangement is more common than previously suggested, with nearly half of the investigated genomes showing a non-clustered architecture. PMID:25329237

  5. Direct cloning and refactoring of a silent lipopeptide biosynthetic gene cluster yields the antibiotic taromycin A.

    PubMed

    Yamanaka, Kazuya; Reynolds, Kirk A; Kersten, Roland D; Ryan, Katherine S; Gonzalez, David J; Nizet, Victor; Dorrestein, Pieter C; Moore, Bradley S

    2014-02-01

    Recent developments in next-generation sequencing technologies have brought recognition of microbial genomes as a rich resource for novel natural product discovery. However, owing to the scarcity of efficient procedures to connect genes to molecules, only a small fraction of secondary metabolomes have been investigated to date. Transformation-associated recombination (TAR) cloning takes advantage of the natural in vivo homologous recombination of Saccharomyces cerevisiae to directly capture large genomic loci. Here we report a TAR-based genetic platform that allows us to directly clone, refactor, and heterologously express a silent biosynthetic pathway to yield a new antibiotic. With this method, which involves regulatory gene remodeling, we successfully expressed a 67-kb nonribosomal peptide synthetase biosynthetic gene cluster from the marine actinomycete Saccharomonospora sp. CNQ-490 and produced the dichlorinated lipopeptide antibiotic taromycin A in the model expression host Streptomyces coelicolor. The taromycin gene cluster (tar) is highly similar to the clinically approved antibiotic daptomycin from Streptomyces roseosporus, but has notable structural differences in three amino acid residues and the lipid side chain. With the activation of the tar gene cluster and production of taromycin A, this study highlights a unique "plug-and-play" approach to efficiently gaining access to orphan pathways that may open avenues for novel natural product discoveries and drug development. PMID:24449899

  6. Identification of a plastidial phenylalanine exporter that influences flux distribution through the phenylalanine biosynthetic network.

    PubMed

    Widhalm, Joshua R; Gutensohn, Michael; Yoo, Heejin; Adebesin, Funmilayo; Qian, Yichun; Guo, Longyun; Jaini, Rohit; Lynch, Joseph H; McCoy, Rachel M; Shreve, Jacob T; Thimmapuram, Jyothi; Rhodes, David; Morgan, John A; Dudareva, Natalia

    2015-01-01

    In addition to proteins, L-phenylalanine is a versatile precursor for thousands of plant metabolites. Production of phenylalanine-derived compounds is a complex multi-compartmental process using phenylalanine synthesized predominantly in plastids as precursor. The transporter(s) exporting phenylalanine from plastids, however, remains unknown. Here, a gene encoding a Petunia hybrida plastidial cationic amino-acid transporter (PhpCAT) functioning in plastidial phenylalanine export is identified based on homology to an Escherichia coli phenylalanine transporter and co-expression with phenylalanine metabolic genes. Radiolabel transport assays show that PhpCAT exports all three aromatic amino acids. PhpCAT downregulation and overexpression result in decreased and increased levels, respectively, of phenylalanine-derived volatiles, as well as phenylalanine, tyrosine and their biosynthetic intermediates. Metabolic flux analysis reveals that flux through the plastidial phenylalanine biosynthetic pathway is reduced in PhpCAT RNAi lines, suggesting that the rate of phenylalanine export from plastids contributes to regulating flux through the aromatic amino-acid network. PMID:26356302

  7. Bacterial Long-Chain Polyunsaturated Fatty Acids: Their Biosynthetic Genes, Functions, and Practical Use

    PubMed Central

    Yoshida, Kiyohito; Hashimoto, Mikako; Hori, Ryuji; Adachi, Takumi; Okuyama, Hidetoshi; Orikasa, Yoshitake; Nagamine, Tadashi; Shimizu, Satoru; Ueno, Akio; Morita, Naoki

    2016-01-01

    The nutritional and pharmaceutical values of long-chain polyunsaturated fatty acids (LC-PUFAs) such as arachidonic, eicosapentaenoic and docosahexaenoic acids have been well recognized. These LC-PUFAs are physiologically important compounds in bacteria and eukaryotes. Although little is known about the biosynthetic mechanisms and functions of LC-PUFAs in bacteria compared to those in higher organisms, a combination of genetic, bioinformatic, and molecular biological approaches to LC-PUFA-producing bacteria and some eukaryotes have revealed the notably diverse organization of the pfa genes encoding a polyunsaturated fatty acid synthase complex (PUFA synthase), the LC-PUFA biosynthetic processes, and tertiary structures of the domains of this enzyme. In bacteria, LC-PUFAs appear to take part in specific functions facilitating individual membrane proteins rather than in the adjustment of the physical fluidity of the whole cell membrane. Very long chain polyunsaturated hydrocarbons (LC-HCs) such as hentriacontanonaene are considered to be closely related to LC-PUFAs in their biosynthesis and function. The possible role of LC-HCs in strictly anaerobic bacteria under aerobic and anaerobic environments and the evolutionary relationships of anaerobic and aerobic bacteria carrying pfa-like genes are also discussed. PMID:27187420

  8. Expression of Terpenoid Biosynthetic Genes and Accumulation of Chemical Constituents in Valeriana fauriei.

    PubMed

    Park, Yun Ji; Arasu, Mariadhas Valan; Al-Dhabi, Naif Abdullah; Lim, Soon Sung; Kim, Yeon Bok; Lee, Sang Won; Park, Sang Un

    2016-01-01

    Valeriana fauriei (V. fauriei), which emits a characteristic and unpleasant odor, is important in traditional medicine. In this study, the expression of terpenoid biosynthetic genes was investigated in different organs that were also screened for volatile compounds including valerenic acid and its derivatives. Specific expression patterns from different parts of V. fauriei were observed using quantitative real-time PCR (qRT-PCR). The highest transcript levels of biosynthetic genes involved in mevalonic acid (MVA) and methylerythritol phosphate (MEP) production were found in the stem. Although the amounts of volatile compounds were varied by organ, most of the volatile terpenoids were accumulated in the root. Gas chromatography mass spectrometry (GC-MS) analysis identified 128 volatile compounds, which represented 65.33% to 95.66% of total volatiles. Certain compounds were only found in specific organs. For example, isovalerenic acid and valerenic acid and its derivatives were restricted to the root. Organs with high transcript levels did not necessarily have high levels of the corresponding chemical constituents. According to these results, we hypothesize that translocation may occur between different organs in V. fauriei. PMID:27240331

  9. Artificial Chromosomes to Explore and to Exploit Biosynthetic Capabilities of Actinomycetes

    PubMed Central

    Alduina, Rosa; Gallo, Giuseppe

    2012-01-01

    Actinomycetes are an important source of biologically active compounds, like antibiotics, antitumor agents, and immunosuppressors. Genome sequencing is revealing that this class of microorganisms has larger genomes relative to other bacteria and uses a considerable fraction of its coding capacity (5–10%) for the production of mostly cryptic secondary metabolites. To access actinomycetes biosynthetic capabilities or to improve the pharmacokinetic properties and production yields of these chemically complex compounds, genetic manipulation of the producer strains can be performed. Heterologous expression in amenable hosts can be useful to exploit and to explore the genetic potential of actinomycetes and not cultivable but interesting bacteria. Artificial chromosomes that can be stably integrated into the Streptomyces genome were constructed and demonstrated to be effective for transferring entire biosynthetic gene clusters from intractable actinomycetes into more suitable hosts. In this paper, the construction of several shuttle Escherichia coli-Streptomyces artificial chromosomes is discussed together with old and new strategies applied to improve heterologous production of secondary metabolites. PMID:22919271

  10. Biosynthetic relationship among aflatoxins B1, B2, M1, and M2.

    PubMed Central

    Dutton, M F; Ehrlich, K; Bennett, J W

    1985-01-01

    Aflatoxins are a family of toxic, acetate-derived decaketides that arise biosynthetically through polyhydroxyanthraquinone intermediates. Most studies have assumed that aflatoxin B1 is the biosynthetic precursor of the other aflatoxins. We used a strain of Aspergillus flavus which accumulates aflatoxin B2 to investigate the later stages of aflatoxin biosynthesis. This strain produced aflatoxins B2 and M2 but no detectable aflatoxin B1 when grown over 12 days in a low-salt, defined growth medium containing asparagine. Addition of dichlorvos to this growth medium inhibited aflatoxin production with concomitant accumulation of versiconal hemiacetal acetate. When mycelial pellets were grown for 24, 48, and 72 h in growth medium and then transferred to a replacement medium, only aflatoxin B2 and M2 were recovered after 96 h of incubation. Addition of sterigmatocystin to the replacement medium led to the recovery of higher levels of aflatoxins B2 and M2 than were detected in control cultures, as well as to the formation of aflatoxins B1 and M1 and O-methylsterigmatocystin. These results support the hypothesis that aflatoxins B1 and B2 can arise independently via a branched pathway. PMID:3925881

  11. Indole-3-acetic acid in Fusarium graminearum: Identification of biosynthetic pathways and characterization of physiological effects.

    PubMed

    Luo, Kun; Rocheleau, Hélène; Qi, Peng-Fei; Zheng, You-Liang; Zhao, Hui-Yan; Ouellet, Thérèse

    2016-09-01

    Fusarium graminearum is a devastating pathogenic fungus causing fusarium head blight (FHB) of wheat. This fungus can produce indole-3-acetic acid (IAA) and a very large amount of IAA accumulates in wheat head tissues during the first few days of infection by F. graminearum. Using liquid culture conditions, we have determined that F. graminearum can use tryptamine (TAM) and indole-3-acetonitrile (IAN) as biosynthetic intermediates to produce IAA. It is the first time that F. graminearum is shown to use the l-tryptophan-dependent TAM and IAN pathways rather than the indole-3-acetamide or indole-3-pyruvic acid pathways to produce IAA. Our experiments also showed that exogenous IAA was metabolized by F. graminearum. Exogenous IAA, TAM, and IAN inhibited mycelial growth; IAA and IAN also affected the hyphae branching pattern and delayed macroconidium germination. IAA and TAM had a small positive effect on the production of the mycotoxin 15-ADON while IAN inhibited its production. Our results showed that IAA and biosynthetic intermediates had a significant effect on F. graminearum physiology and suggested a new area of exploration for fungicidal compounds. PMID:27567719

  12. Bacterial Biosynthetic Gene Clusters Encoding the Anti-cancer Haterumalide Class of Molecules

    PubMed Central

    Matilla, Miguel A.; Stöckmann, Henning; Leeper, Finian J.; Salmond, George P. C.

    2012-01-01

    Haterumalides are halogenated macrolides with strong antitumor properties, making them attractive targets for chemical synthesis. Unfortunately, current synthetic routes to these molecules are inefficient. The potent haterumalide, oocydin A, was previously identified from two plant-associated bacteria through its high bioactivity against plant pathogenic fungi and oomycetes. In this study, we describe oocydin A (ooc) biosynthetic gene clusters identified by genome sequencing, comparative genomics, and chemical analysis in four plant-associated enterobacteria of the Serratia and Dickeya genera. Disruption of the ooc gene cluster abolished oocydin A production and bioactivity against fungi and oomycetes. The ooc gene clusters span between 77 and 80 kb and encode five multimodular polyketide synthase (PKS) proteins, a hydroxymethylglutaryl-CoA synthase cassette and three flavin-dependent tailoring enzymes. The presence of two free-standing acyltransferase proteins classifies the oocydin A gene cluster within the growing family of trans-AT PKSs. The amino acid sequences and organization of the PKS domains are consistent with the chemical predictions and functional peculiarities associated with trans-acyltransferase PKS. Based on extensive in silico analysis of the gene cluster, we propose a biosynthetic model for the production of oocydin A and, by extension, for other members of the haterumalide family of halogenated macrolides exhibiting anti-cancer, anti-fungal, and other interesting biological properties. PMID:23012376

  13. Metabolic and functional diversity of saponins, biosynthetic intermediates and semi-synthetic derivatives.

    PubMed

    Moses, Tessa; Papadopoulou, Kalliope K; Osbourn, Anne

    2014-01-01

    Saponins are widely distributed plant natural products with vast structural and functional diversity. They are typically composed of a hydrophobic aglycone, which is extensively decorated with functional groups prior to the addition of hydrophilic sugar moieties, to result in surface-active amphipathic compounds. The saponins are broadly classified as triterpenoids, steroids or steroidal glycoalkaloids, based on the aglycone structure from which they are derived. The saponins and their biosynthetic intermediates display a variety of biological activities of interest to the pharmaceutical, cosmetic and food sectors. Although their relevance in industrial applications has long been recognized, their role in plants is underexplored. Recent research on modulating native pathway flux in saponin biosynthesis has demonstrated the roles of saponins and their biosynthetic intermediates in plant growth and development. Here, we review the literature on the effects of these molecules on plant physiology, which collectively implicate them in plant primary processes. The industrial uses and potential of saponins are discussed with respect to structure and activity, highlighting the undoubted value of these molecules as therapeutics. PMID:25286183

  14. A systematic computational analysis of biosynthetic gene cluster evolution: lessons for engineering biosynthesis.

    PubMed

    Medema, Marnix H; Cimermancic, Peter; Sali, Andrej; Takano, Eriko; Fischbach, Michael A

    2014-12-01

    Bacterial secondary metabolites are widely used as antibiotics, anticancer drugs, insecticides and food additives. Attempts to engineer their biosynthetic gene clusters (BGCs) to produce unnatural metabolites with improved properties are often frustrated by the unpredictability and complexity of the enzymes that synthesize these molecules, suggesting that genetic changes within BGCs are limited by specific constraints. Here, by performing a systematic computational analysis of BGC evolution, we derive evidence for three findings that shed light on the ways in which, despite these constraints, nature successfully invents new molecules: 1) BGCs for complex molecules often evolve through the successive merger of smaller sub-clusters, which function as independent evolutionary entities. 2) An important subset of polyketide synthases and nonribosomal peptide synthetases evolve by concerted evolution, which generates sets of sequence-homogenized domains that may hold promise for engineering efforts since they exhibit a high degree of functional interoperability, 3) Individual BGC families evolve in distinct ways, suggesting that design strategies should take into account family-specific functional constraints. These findings suggest novel strategies for using synthetic biology to rationally engineer biosynthetic pathways. PMID:25474254

  15. The Sesquiterpene Synthase from the Botrydial Biosynthetic Gene Cluster of the Phytopathogen Botrytis cinerea

    PubMed Central

    Pinedo, Cristina; Wang, Chieh-Mei; Pradier, Jean-Marc; Dalmais, Bérengère; Choquer, Mathias; Pêcheur, Pascal Le; Morgant, Guillaume; Collado, Isidro G.; Cane, David E.; Viaud, Muriel

    2009-01-01

    The fungus Botrytis cinerea is the causal agent of the economically important gray mold disease that affects more than 200 ornamental and agriculturally important plant species. B. cinerea is a necrotrophic plant pathogen that secretes nonspecific phytotoxins, including the sesquiterpene botrydial and the polyketide botcinic acid. The region surrounding the previously characterized BcBOT1 gene has now been identified as the botrydial biosynthetic gene cluster. Five genes including BcBOT1 and BcBOT2 were shown by quantitative Reverse Transcription-PCR to be co-regulated through the calcineurin signaling pathway. Inactivation of the BcBOT2 gene, encoding a putative sesquiterpene cyclase, abolished botrydial biosynthesis, which could be restored by in trans complementation. Inactivation of BcBOT2 also resulted in over-production of botcinic acid that was observed to be strain-dependent. Recombinant BcBOT2 protein converted farnesyl diphosphate to the parent sesquiterpene of the botrydial biosynthetic pathway, the tricyclic alcohol presilphiperfolan-8β-ol. PMID:19035644

  16. Genome sequence of Thermofilum pendens reveals an exceptional loss of biosynthetic pathways without genome reduction

    SciTech Connect

    Kyrpides, Nikos; Anderson, Iain; Rodriguez, Jason; Susanti, Dwi; Porat, Iris; Reich, Claudia; Ulrich, Luke E.; Elkins, James G.; Mavromatis, Kostas; Lykidis, Athanasios; Kim, Edwin; Thompson, Linda S.; Nolan, Matt; Land, Miriam; Copeland, Alex; Lapidus, Alla; Lucas, Susan; Detter, Chris; Zhulin, Igor B.; Olsen, Gary J.; Whitman, William; Mukhopadhyay, Biswarup; Bristow, James; Kyrpides, Nikos

    2008-01-01

    We report the complete genome of Thermofilum pendens, a deep-branching, hyperthermophilic member of the order Thermoproteales within the archaeal kingdom Crenarchaeota. T. pendens is a sulfur-dependent, anaerobic heterotroph isolated from a solfatara in Iceland. It is an extracellular commensal, requiring an extract of Thermoproteus tenax for growth, and the genome sequence reveals that biosynthetic pathways for purines, most amino acids, and most cofactors are absent. In fact T. pendens has fewer biosynthetic enzymes than obligate intracellular parasites, although it does not display other features common among obligate parasites and thus does not appear to be in the process of becoming a parasite. It appears that T. pendens has adapted to life in an environment rich in nutrients. T. pendens was known to utilize peptides as an energy source, but the genome reveals substantial ability to grow on carbohydrates. T. pendens is the first crenarchaeote and only the second archaeon found to have a transporter of the phosphotransferase system. In addition to fermentation, T. pendens may gain energy from sulfur reduction with hydrogen and formate as electron donors. It may also be capable of sulfur-independent growth on formate with formate hydrogenlyase. Additional novel features are the presence of a monomethylamine:corrinoid methyltransferase, the first time this enzyme has been found outside of Methanosarcinales, and a presenilin-related protein. Predicted highly expressed proteins do not include housekeeping genes, and instead include ABC transporters for carbohydrates and peptides, and CRISPR-associated proteins.

  17. Genome Sequence of Thermofilum pendens Reveals an Exceptional Loss of Biosynthetic Pathways without Genome Reduction

    SciTech Connect

    Anderson, Iain; Rodriquez, Jason; Susanti, Dwi; Porat, I.; Reich, Claudia; Ulrich, Luke; Elkins, James G; Mavromatis, K; Lykidis, A; Kim, Edwin; Thompson, Linda S; Nolan, Matt; Land, Miriam L; Copeland, A; Lapidus, Alla L.; Lucas, Susan; Detter, J C; Zhulin, Igor B; Olsen, Gary; Whitman, W. B.; Mukhopadhyay, Biswarup; Bristow, James; Kyrpides, Nikos C

    2008-01-01

    We report the complete genome of Thermofilum pendens, a deep-branching member of class Thermoproteales of Crenarchaeota. T. pendens is a sulfur-dependent, anaerobic heterotroph isolated from a solfatara in Iceland. It was known to utilize peptides as an energy source, but the genome reveals substantial ability to grow on carbohydrates. T. pendens is the first Crenarchaeote and only the second archaeon found to have transporters of the phosphotransferase system. T. pendens is known to require an extract of Thermoproteus tenax for growth, and the genome sequence reveals that biosynthetic pathways for purines, most amino acids, and most cofactors are absent. T. pendens has fewer biosynthetic enzymes than any other free-living organism. In addition to heterotrophy, T. pendens may gain energy from sulfur reduction with hydrogen and formate as electron donors. It may also be capable of sulfur-independent growth on formate with formate hydrogenlyase. Additional novel features are the presence of a monomethylamine:corrinoid methyltransferase, the first time this enzyme has been found outside of Methanosarcinales, and a presenilin-related protein from a new subfamily. Predicted highly expressed proteins include ABC transporters for carbohydrates and peptides, and CRISPR-associated proteins, suggesting that defense against viruses is a high priority.

  18. Identification of a plastidial phenylalanine exporter that influences flux distribution through the phenylalanine biosynthetic network

    PubMed Central

    Widhalm, Joshua R.; Gutensohn, Michael; Yoo, Heejin; Adebesin, Funmilayo; Qian, Yichun; Guo, Longyun; Jaini, Rohit; Lynch, Joseph H.; McCoy, Rachel M.; Shreve, Jacob T.; Thimmapuram, Jyothi; Rhodes, David; Morgan, John A.; Dudareva, Natalia

    2015-01-01

    In addition to proteins, L-phenylalanine is a versatile precursor for thousands of plant metabolites. Production of phenylalanine-derived compounds is a complex multi-compartmental process using phenylalanine synthesized predominantly in plastids as precursor. The transporter(s) exporting phenylalanine from plastids, however, remains unknown. Here, a gene encoding a Petunia hybrida plastidial cationic amino-acid transporter (PhpCAT) functioning in plastidial phenylalanine export is identified based on homology to an Escherichia coli phenylalanine transporter and co-expression with phenylalanine metabolic genes. Radiolabel transport assays show that PhpCAT exports all three aromatic amino acids. PhpCAT downregulation and overexpression result in decreased and increased levels, respectively, of phenylalanine-derived volatiles, as well as phenylalanine, tyrosine and their biosynthetic intermediates. Metabolic flux analysis reveals that flux through the plastidial phenylalanine biosynthetic pathway is reduced in PhpCAT RNAi lines, suggesting that the rate of phenylalanine export from plastids contributes to regulating flux through the aromatic amino-acid network. PMID:26356302

  19. Sioxanthin, a novel glycosylated carotenoid reveals an unusual subclustered biosynthetic pathway

    PubMed Central

    Richter, Taylor K.S.; Hughes, Chambers C.; Moore, Bradley S.

    2016-01-01

    Summary Members of the marine actinomycete genus Salinispora constitutively produce a characteristic orange pigment during vegetative growth. Contrary to the understanding of widespread carotenoid biosynthesis pathways in bacteria, Salinispora carotenoid biosynthesis genes are not confined to a single cluster. Instead, bioinformatic and genetic investigations confirm that four regions of the S. tropica CNB-440 genome, consisting of two gene clusters and two independent genes, contribute to the in vivo production of a single carotenoid. This compound, namely (2’S)-1’-(β-D-glucopyranosyloxy)-3’,4’-didehydro-1’,2’-dihydro-φ,ψ-caroten-2’-ol, is novel and has been given the trivial name “sioxanthin”. Sioxanthin is a C40-carotenoid, glycosylated on one end of the molecule and containing an aryl moiety on the opposite end. Glycosylation is unusual amongst actinomycete carotenoids, and sioxanthin joins a rare group of carotenoids with polar and non-polar head groups. Gene sequence homology predicts that the sioxanthin biosynthetic pathway is present in all of the Salinispora as well as other members of the family Micromonosporaceae. Additionally, this study’s investigations of clustering of carotenoid biosynthetic genes in heterotrophic bacteria show that a non-clustered genome arrangement is more common than previously suggested, with nearly half of the investigated genomes showing a non-clustered architecture. PMID:25329237

  20. Structure Determination and Interception of Biosynthetic Intermediates for the Plantazolicin Class of Highly Discriminating Antibiotics

    PubMed Central

    Molohon, Katie J.; Melby, Joel O.; Lee, Jaeheon; Evans, Bradley S.; Dunbar, Kyle L.; Bumpus, Stefanie B.; Kelleher, Neil L.; Mitchell, Douglas A.

    2011-01-01

    The soil dwelling, plant-growth promoting bacterium, Bacillus amyloliquefaciens FZB42, is a prolific producer of complex natural products. Recently, a new FZB42 metabolite, plantazolicin (PZN), has been described as a member of the growing thiazole/oxazole-modified microcin (TOMM) family. TOMMs are biosynthesized from inactive, ribosomal peptides and undergo a series of cyclodehydrations, dehydrogenations, and other modifications to become bioactive natural products. Using high-resolution mass spectrometry, chemoselective modification, genetic interruptions, and other spectroscopic tools, we have determined the molecular structure of PZN. In addition to two conjugated polyazole moieties, the amino-terminus of PZN has been modified to Nα,Nα-dimethylarginine. PZN exhibited a highly selective antibiotic activity towards Bacillus anthracis, but no other tested human pathogen. By altering oxygenation levels during fermentation, PZN analogs were produced that bear variability in their heterocycle content, which yielded insight into the order of biosynthetic events. Lastly, genome-mining has revealed the existence of four additional PZN-like biosynthetic gene clusters. Given their structural uniqueness and intriguing antimicrobial specificity, the PZN class of antibiotics may hold pharmacological value. PMID:21950656

  1. A Systematic Computational Analysis of Biosynthetic Gene Cluster Evolution: Lessons for Engineering Biosynthesis

    PubMed Central

    Sali, Andrej; Takano, Eriko; Fischbach, Michael A.

    2014-01-01

    Bacterial secondary metabolites are widely used as antibiotics, anticancer drugs, insecticides and food additives. Attempts to engineer their biosynthetic gene clusters (BGCs) to produce unnatural metabolites with improved properties are often frustrated by the unpredictability and complexity of the enzymes that synthesize these molecules, suggesting that genetic changes within BGCs are limited by specific constraints. Here, by performing a systematic computational analysis of BGC evolution, we derive evidence for three findings that shed light on the ways in which, despite these constraints, nature successfully invents new molecules: 1) BGCs for complex molecules often evolve through the successive merger of smaller sub-clusters, which function as independent evolutionary entities. 2) An important subset of polyketide synthases and nonribosomal peptide synthetases evolve by concerted evolution, which generates sets of sequence-homogenized domains that may hold promise for engineering efforts since they exhibit a high degree of functional interoperability, 3) Individual BGC families evolve in distinct ways, suggesting that design strategies should take into account family-specific functional constraints. These findings suggest novel strategies for using synthetic biology to rationally engineer biosynthetic pathways. PMID:25474254

  2. Elucidating the biosynthetic and regulatory mechanisms of flavonoid-derived bioactive components in Epimedium sagittatum

    PubMed Central

    Huang, Wenjun; Zeng, Shaohua; Xiao, Gong; Wei, Guoyan; Liao, Sihong; Chen, Jianjun; Sun, Wei; Lv, Haiyan; Wang, Ying

    2015-01-01

    Herba epimedii (Epimedium), a traditional Chinese medicine, has been widely used as a kidney tonic and antirheumatic medicine for thousands of years. In Epimedium, flavonoids have been demonstrated to be the main bioactive components (BCs). However, the molecular biosynthetic and regulatory mechanisms of flavonoid-derived BCs remain obscure. In this study, we isolated 12 structural genes and two putative transcription factors (TFs) in the flavonoid pathway. Phytochemical analysis showed that the total content of four representative BCs (epimedin A, B, C, and icariin) decreased slightly or dramatically in two lines of Epimedium sagittatum during leaf development. Transcriptional analysis revealed that two R2R3-MYB TFs (EsMYBA1 and EsMYBF1), together with a bHLH TF (EsGL3) and WD40 protein (EsTTG1), were supposed to coordinately regulate the anthocyanin and flavonol-derived BCs biosynthesis in leaves. Overexpression of EsFLS (flavonol synthase) in tobacco resulted in increased flavonols content and decreased anthocyanins content in flowers. Moreover, EsMYB12 negatively correlated with the accumulation of the four BCs, and might act as a transcriptional repressor in the flavonoid pathway. Therefore, the anthocyanin pathway may coordinate with the flavonol-derived BCs pathway in Epimedium leaves. A better understanding of the flavonoid biosynthetic and regulatory mechanisms in E. sagittatum will facilitate functional characterization, metabolic engineering, and molecular breeding studies of Epimedium species. PMID:26388888

  3. Evolution of tryptophan biosynthetic pathway in microbial genomes: a comparative genetic study.

    PubMed

    Priya, V K; Sarkar, Susmita; Sinha, Somdatta

    2014-03-01

    Biosynthetic pathway evolution needs to consider the evolution of a group of genes that code for enzymes catalysing the multiple chemical reaction steps leading to the final end product. Tryptophan biosynthetic pathway has five chemical reaction steps that are highly conserved in diverse microbial genomes, though the genes of the pathway enzymes show considerable variations in arrangements, operon structure (gene fusion and splitting) and regulation. We use a combined bioinformatic and statistical analyses approach to address the question if the pathway genes from different microbial genomes, belonging to a wide range of groups, show similar evolutionary relationships within and between them. Our analyses involved detailed study of gene organization (fusion/splitting events), base composition, relative synonymous codon usage pattern of the genes, gene expressivity, amino acid usage, etc. to assess inter- and intra-genic variations, between and within the pathway genes, in diverse group of microorganisms. We describe these genetic and genomic variations in the tryptophan pathway genes in different microorganisms to show the similarities across organisms, and compare the same genes across different organisms to find the possible variability arising possibly due to horizontal gene transfers. Such studies form the basis for moving from single gene evolution to pathway evolutionary studies that are important steps towards understanding the systems biology of intracellular pathways. PMID:24592292

  4. Expression of phenazine biosynthetic genes during the arbuscular mycorrhizal symbiosis of Glomus intraradices.

    PubMed

    León-Martínez, Dionicia Gloria; Vielle-Calzada, Jean-Philippe; Olalde-Portugal, Víctor

    2012-04-01

    To explore the molecular mechanisms that prevail during the establishment of the arbuscular mycorrhiza symbiosis involving the genus Glomus, we transcriptionally analysed spores of Glomus intraradices BE3 during early hyphal growth. Among 458 transcripts initially identified as being expressed at presymbiotic stages, 20% of sequences had homology to previously characterized eukaryotic genes, 30% were homologous to fungal coding sequences, and 9% showed homology to previously characterized bacterial genes. Among them, GintPbr1a encodes a homolog to Phenazine Biosynthesis Regulator (Pbr) of Burkholderia cenocepacia, an pleiotropic regulatory protein that activates phenazine production through transcriptional activation of the protein D isochorismatase biosynthetic enzyme phzD (Ramos et al., 2010). Whereas GintPbr1a is expressed during the presymbiotic phase, the G. intraradices BE3 homolog of phzD (BGintphzD) is transcriptionally active at the time of the establishment of the arbuscular mycorrhizal symbiosis. DNA from isolated bacterial cultures found in spores of G. intraradices BE3 confirmed that both BGintPbr1a and BGintphzD are present in the genome of its potential endosymbionts. Taken together, our results indicate that spores of G. intraradices BE3 express bacterial phenazine biosynthetic genes at the onset of the fungal-plant symbiotic interaction. PMID:24031884

  5. Variation in oxygen isotope fractionation during cellulose synthesis: intramolecular and biosynthetic effects.

    PubMed

    Sternberg, Leonel; Pinzon, Maria Camila; Anderson, William T; Jahren, A Hope

    2006-10-01

    The oxygen isotopic composition of plant cellulose is commonly used for the interpretations of climate, ecophysiology and dendrochronology in both modern and palaeoenvironments. Further applications of this analytical tool depends on our in-depth knowledge of the isotopic fractionations associated with the biochemical pathways leading to cellulose. Here, we test two important assumptions regarding isotopic effects resulting from the location of oxygen in the carbohydrate moiety and the biosynthetic pathway towards cellulose synthesis. We show that the oxygen isotopic fractionation of the oxygen attached to carbon 2 of the glucose moieties differs from the average fractionation of the oxygens attached to carbons 3-6 from cellulose by at least 9%, for cellulose synthesized within seedlings of two different species (Triticum aestivum L. and Ricinus communis L.). The fractionation for a given oxygen in cellulose synthesized by the Triticum seedlings, which have starch as their primary carbon source, is different than the corresponding fractionation in Ricinus seedlings, within which lipids are the primary carbon source. This observation shows that the biosynthetic pathway towards cellulose affects oxygen isotope partitioning, a fact heretofore undemonstrated. Our findings may explain the species-dependent variability in the overall oxygen isotope fractionation during cellulose synthesis, and may provide much-needed insight for palaeoclimate reconstruction using fossil cellulose. PMID:16930314

  6. exo-Brevicomin biosynthetic pathway enzymes from the Mountain Pine Beetle, Dendroctonus ponderosae.

    PubMed

    Song, Minmin; Delaplain, Patrick; Nguyen, Trang T; Liu, Xibei; Wickenberg, Leah; Jeffrey, Christopher; Blomquist, Gary J; Tittiger, Claus

    2014-10-01

    exoBrevicomin (exo-7-ethyl-5-methyl-6,8-dioxabicyclo[3.2.1]octane) is an important semiochemical for a number of beetle species, including the highly destructive Mountain Pine Beetle (Dendroctonus ponderosae). It is also found in other insects and the African elephant. Despite its significance, very little is known about its biosynthesis. A recent microarray analysis implicated a small cluster of three D. ponderosae genes in exo-brevicomin biosynthesis, two of which had identifiable open reading frames (Aw et al., 2010; BMC Genomics 11:215). Here we report further expression profiling of two genes in that cluster and functional analysis of their recombinantly-produced enzymes. One encodes a short-chain dehydrogenase that used NAD(P)(+) as a co-factor to catalyze the oxidation of (Z)-6-nonen-2-ol to (Z)-6-nonen-2-one. We therefore named the enzyme (Z)-6-nonen-2-ol dehydrogenase (ZnoDH). The other encodes the cytochrome P450, CYP6CR1, which epoxidized (Z)-6-nonen-2-one to 6,7-epoxynonan-2-one with very high specificity and substrate selectivity. Both the substrates and products of the two enzymes are intermediates in the exo-brevicomin biosynthetic pathway. Thus, ZnoDH and CYP6CR1 are enzymes that apparently catalyze the antepenultimate and penultimate steps in the exo-brevicomin biosynthetic pathway, respectively. PMID:25138711

  7. Comparative genomics of actinomycetes with a focus on natural product biosynthetic genes

    PubMed Central

    2013-01-01

    Background Actinomycetes are a diverse group of medically, industrially and ecologically important bacteria, studied as much for the diseases they cause as for the cures they hold. The genomes of actinomycetes revealed that these bacteria have a large number of natural product gene clusters, although many of these are difficult to tie to products in the laboratory. Large scale comparisons of these clusters are difficult to perform due to the presence of highly similar repeated domains in the most common biosynthetic machinery: polyketide synthases (PKSs) and nonribosomal peptide synthetases (NRPSs). Results We have used comparative genomics to provide an overview of the genomic features of a set of 102 closed genomes from this important group of bacteria with a focus on natural product biosynthetic genes. We have focused on well-represented genera and determine the occurrence of gene cluster families therein. Conservation of natural product gene clusters within Mycobacterium, Streptomyces and Frankia suggest crucial roles for natural products in the biology of each genus. The abundance of natural product classes is also found to vary greatly between genera, revealing underlying patterns that are not yet understood. Conclusions A large-scale analysis of natural product gene clusters presents a useful foundation for hypothesis formulation that is currently underutilized in the field. Such studies will be increasingly necessary to study the diversity and ecology of natural products as the number of genome sequences available continues to grow. PMID:24020438

  8. Exploring complex pheromone biosynthetic processes in the bumblebee male labial gland by RNA sequencing.

    PubMed

    Buček, A; Brabcová, J; Vogel, H; Prchalová, D; Kindl, J; Valterová, I; Pichová, I

    2016-06-01

    Male marking pheromones (MPs) are used by the majority of bumblebee species (Hymenoptera: Apidae), including a commercially important greenhouse pollinator, the buff-tailed bumblebee (Bombus terrestris), to attract conspecific females. MP biosynthetic processes in the cephalic part of the bumblebee male labial gland (LG) are of extraordinary complexity, involving enzymes of fatty acid and isoprenoid biosynthesis, which jointly produce more than 50 compounds. We employed a differential transcriptomic approach to identify candidate genes involved in MP biosynthesis by sequencing Bombus terrestris LG and fat body (FB) transcriptomes. We identified 12 454 abundantly expressed gene products (reads per kilobase of exon model per million mapped reads value > 1) that had significant hits in the GenBank nonredundant database. Of these, 876 were upregulated in the LG (> 4-fold difference). We identified more than 140 candidate genes potentially involved in MP biosynthesis, including esterases, fatty acid reductases, lipases, enzymes involved in limited fatty acid chain shortening, neuropeptide receptors and enzymes involved in biosynthesis of triacylglycerols, isoprenoids and fatty acids. For selected candidates, we confirmed their abundant expression in LG using quantitative real-time reverse transcription-PCR (qRT-PCR). Our study shows that the Bombus terrestris LG transcriptome reflects both fatty acid and isoprenoid MP biosynthetic processes and identifies rational gene targets for future studies to disentangle the molecular basis of MP biosynthesis. Additionally, LG and FB transcriptomes enrich the available transcriptomic resources for Bombus terrestris. PMID:26945888

  9. Crystallization and preliminary X-ray analysis of the ergothioneine-biosynthetic methyltransferase EgtD

    PubMed Central

    Vit, Allegra; Misson, Laëtitia; Blankenfeldt, Wulf; Seebeck, Florian Peter

    2014-01-01

    Ergothioneine is an amino-acid betaine derivative of histidine that was discovered more than one century ago. Despite significant research pointing to a function in oxidative stress defence, the exact mechanisms of action of ergothioneine remain elusive. Although both humans and bacterial pathogens such as Mycobacterium tuberculosis seem to depend on ergothioneine, humans are devoid of the corresponding biosynthetic enzymes. Therefore, its biosyn­thesis may emerge as potential drug target in the development of novel therapeutics against tuberculosis. The recent identification of ergothioneine-biosynthetic genes in M. smegmatis enables a more systematic study of its biology. The pathway is initiated by EgtD, a SAM-dependent methyltransferase that catalyzes a trimethylation reaction of histidine to give N(α),N(α),N(α)-trimethylhistidine. Here, the recombinant production, purification and crystallization of EgtD are reported. Crystals of native EgtD diffracted to 2.35 Å resolution at a synchrotron beamline, whereas crystals of seleno-l-methionine-labelled protein diffracted to 1.75 Å resolution and produced a significant anomalous signal to 2.77 Å resolution at the K edge. All of the crystals belonged to space group P212121, with two EgtD monomers in the asymmetric unit. PMID:24817736

  10. Identification of a Pantoea Biosynthetic Cluster That Directs the Synthesis of an Antimicrobial Natural Product

    PubMed Central

    Walterson, Alyssa M.; Smith, Derek D. N.; Stavrinides, John

    2014-01-01

    Fire Blight is a destructive disease of apple and pear caused by the enteric bacterial pathogen, Erwinia amylovora. E. amylovora initiates infection by colonizing the stigmata of apple and pear trees, and entering the plants through natural openings. Epiphytic populations of the related enteric bacterium, Pantoea, reduce the incidence of disease through competition and antibiotic production. In this study, we identify an antibiotic from Pantoea ananatis BRT175, which is effective against E. amylovora and select species of Pantoea. We used transposon mutagenesis to create a mutant library, screened approximately 5,000 mutants for loss of antibiotic production, and recovered 29 mutants. Sequencing of the transposon insertion sites of these mutants revealed multiple independent disruptions of an 8.2 kb cluster consisting of seven genes, which appear to be coregulated. An analysis of the distribution of this cluster revealed that it was not present in any other of our 115 Pantoea isolates, or in any of the fully sequenced Pantoea genomes, and is most closely related to antibiotic biosynthetic clusters found in three different species of Pseudomonas. This identification of this biosynthetic cluster highlights the diversity of natural products produced by Pantoea. PMID:24796857

  11. Complete Biosynthetic Pathway of the C50 Carotenoid Bacterioruberin from Lycopene in the Extremely Halophilic Archaeon Haloarcula japonica

    PubMed Central

    Yang, Ying; Ando, Ai; Miyoko, Nobuhiro; Fukui, Toshiaki; Takaichi, Shinichi; Nakamura, Satoshi

    2015-01-01

    ABSTRACT Haloarcula japonica, an extremely halophilic archaeon that requires high concentrations of NaCl for growth, accumulates the C50 carotenoid bacterioruberin (BR). By homology analysis, a gene cluster, including c0507, c0506, and c0505, was found and predicted to be involved in the synthesis of bacterioruberin. To elucidate the function of the encoded enzymes, we constructed Ha. japonica mutants of these genes and analyzed carotenoids produced by the mutants. Our research showed that c0507, c0506, and c0505 encoded a carotenoid 3,4-desaturase (CrtD), a bifunctional lycopene elongase and 1,2-hydratase (LyeJ), and a C50 carotenoid 2″,3″-hydratase (CruF), respectively. The above three carotenoid biosynthetic enzymes catalyze the reactions that convert lycopene to bacterioruberin in Ha. japonica. This is the first identification of functional CrtD and CruF in archaea and elucidation of the complete biosynthetic pathway of bacterioruberin from lycopene. IMPORTANCE Haloarcula japonica, an extremely halophilic archaeon, accumulates the C50 carotenoid bacterioruberin (BR). In this study, we have identified three BR biosynthetic enzymes and have elucidated their functions. Among them, two enzymes were found in an archaeon for the first time. Our results revealed the biosynthetic pathway responsible for production of BR in Ha. japonica and provide a basis for investigating carotenoid biosynthetic pathways in other extremely halophilic archaea. Elucidation of the carotenoid biosynthetic pathway in Ha. japonica may also prove useful for producing the C50 carotenoid BR efficiently by employing genetically modified haloarchaeal strains. PMID:25712483

  12. Phenylpropanoids Accumulation in Eggplant Fruit: Characterization of Biosynthetic Genes and Regulation by a MYB Transcription Factor.

    PubMed

    Docimo, Teresa; Francese, Gianluca; Ruggiero, Alessandra; Batelli, Giorgia; De Palma, Monica; Bassolino, Laura; Toppino, Laura; Rotino, Giuseppe L; Mennella, Giuseppe; Tucci, Marina

    2015-01-01

    Phenylpropanoids are major secondary metabolites in eggplant (Solanum melongena) fruits. Chlorogenic acid (CGA) accounts for 70-90% of total phenolics in flesh tissues, while anthocyanins are mainly present in the fruit skin. As a contribution to the understanding of the peculiar accumulation of these health-promoting metabolites in eggplant, we report on metabolite abundance, regulation of CGA and anthocyanin biosynthesis, and characterization of candidate CGA biosynthetic genes in S. melongena. Higher contents of CGA, Delphinidin 3-rutinoside, and rutin were found in eggplant fruits compared to other tissues, associated to an elevated transcript abundance of structural genes such as PAL, HQT, DFR, and ANS, suggesting that active in situ biosynthesis contributes to anthocyanin and CGA accumulation in fruit tissues. Putative orthologs of the two CGA biosynthetic genes PAL and HQT, as well as a variant of a MYB1 transcription factor showing identity with group six MYBs, were isolated from an Occidental S. melongena traditional variety and demonstrated to differ from published sequences from Asiatic varieties. In silico analysis of the isolated SmPAL1, SmHQT1, SmANS, and SmMyb1 promoters revealed the presence of several Myb regulatory elements for the biosynthetic genes and unique elements for the TF, suggesting its involvement in other physiological roles beside phenylpropanoid biosynthesis regulation. Transient overexpression in Nicotiana benthamiana leaves of SmMyb1 and of a C-terminal SmMyb1 truncated form (SmMyb1Δ9) resulted in anthocyanin accumulation only of SmMyb1 agro-infiltrated leaves. A yeast two-hybrid assay confirmed the interaction of both SmMyb1 and SmMyb1Δ9 with an anthocyanin-related potato bHLH1 TF. Interestingly, a doubled amount of CGA was detected in both SmMyb1 and SmMyb1Δ9 agro-infiltrated leaves, thus suggesting that the N-terminal region of SmMyb1 is sufficient to activate its synthesis. These data suggest that a deletion of the C

  13. Garlic γ-glutamyl transpeptidases that catalyze deglutamylation of biosynthetic intermediate of alliin

    PubMed Central

    Yoshimoto, Naoko; Yabe, Ayami; Sugino, Yuka; Murakami, Soichiro; Sai-ngam, Niti; Sumi, Shin-ichiro; Tsuneyoshi, Tadamitsu; Saito, Kazuki

    2015-01-01

    S-Alk(en)yl-L-cysteine sulfoxides are pharmaceutically important secondary metabolites produced by plants that belong to the genus Allium. Biosynthesis of S-alk(en)yl-L-cysteine sulfoxides is initiated by S-alk(en)ylation of glutathione, which is followed by the removal of glycyl and γ-glutamyl groups and S-oxygenation. However, most of the enzymes involved in the biosynthesis of S-alk(en)yl-L-cysteine sulfoxides in Allium plants have not been identified. In this study, we identified three genes, AsGGT1, AsGGT2, and AsGGT3, from garlic (Allium sativum) that encode γ-glutamyl transpeptidases (GGTs) catalyzing the removal of the γ-glutamyl moiety from a putative biosynthetic intermediate of S-allyl-L-cysteine sulfoxide (alliin). The recombinant proteins of AsGGT1, AsGGT2, and AsGGT3 exhibited considerable deglutamylation activity toward a putative alliin biosynthetic intermediate, γ-glutamyl-S-allyl-L-cysteine, whereas these proteins showed very low deglutamylation activity toward another possible alliin biosynthetic intermediate, γ-glutamyl-S-allyl-L-cysteine sulfoxide. The deglutamylation activities of AsGGT1, AsGGT2, and AsGGT3 toward γ-glutamyl-S-allyl-L-cysteine were elevated in the presence of the dipeptide glycylglycine as a γ-glutamyl acceptor substrate, although these proteins can act as hydrolases in the absence of a proper acceptor substrate, except water. The apparent Km values of AsGGT1, AsGGT2, and AsGGT3 for γ-glutamyl-S-allyl-L-cysteine were 86 μM, 1.1 mM, and 9.4 mM, respectively. Subcellular distribution of GFP-fusion proteins transiently expressed in onion cells suggested that AsGGT2 localizes in the vacuole, whereas AsGGT1 and AsGGT3 possess no apparent transit peptide for localization to intracellular organelles. The different kinetic properties and subcellular localizations of AsGGT1, AsGGT2, and AsGGT3 suggest that these three GGTs may contribute differently to the biosynthesis of alliin in garlic. PMID:25620969

  14. Phenylpropanoids Accumulation in Eggplant Fruit: Characterization of Biosynthetic Genes and Regulation by a MYB Transcription Factor

    PubMed Central

    Docimo, Teresa; Francese, Gianluca; Ruggiero, Alessandra; Batelli, Giorgia; De Palma, Monica; Bassolino, Laura; Toppino, Laura; Rotino, Giuseppe L.; Mennella, Giuseppe; Tucci, Marina

    2016-01-01

    Phenylpropanoids are major secondary metabolites in eggplant (Solanum melongena) fruits. Chlorogenic acid (CGA) accounts for 70–90% of total phenolics in flesh tissues, while anthocyanins are mainly present in the fruit skin. As a contribution to the understanding of the peculiar accumulation of these health-promoting metabolites in eggplant, we report on metabolite abundance, regulation of CGA and anthocyanin biosynthesis, and characterization of candidate CGA biosynthetic genes in S. melongena. Higher contents of CGA, Delphinidin 3-rutinoside, and rutin were found in eggplant fruits compared to other tissues, associated to an elevated transcript abundance of structural genes such as PAL, HQT, DFR, and ANS, suggesting that active in situ biosynthesis contributes to anthocyanin and CGA accumulation in fruit tissues. Putative orthologs of the two CGA biosynthetic genes PAL and HQT, as well as a variant of a MYB1 transcription factor showing identity with group six MYBs, were isolated from an Occidental S. melongena traditional variety and demonstrated to differ from published sequences from Asiatic varieties. In silico analysis of the isolated SmPAL1, SmHQT1, SmANS, and SmMyb1 promoters revealed the presence of several Myb regulatory elements for the biosynthetic genes and unique elements for the TF, suggesting its involvement in other physiological roles beside phenylpropanoid biosynthesis regulation. Transient overexpression in Nicotiana benthamiana leaves of SmMyb1 and of a C-terminal SmMyb1 truncated form (SmMyb1Δ9) resulted in anthocyanin accumulation only of SmMyb1 agro-infiltrated leaves. A yeast two-hybrid assay confirmed the interaction of both SmMyb1 and SmMyb1Δ9 with an anthocyanin-related potato bHLH1 TF. Interestingly, a doubled amount of CGA was detected in both SmMyb1 and SmMyb1Δ9 agro-infiltrated leaves, thus suggesting that the N-terminal region of SmMyb1 is sufficient to activate its synthesis. These data suggest that a deletion of the C

  15. Application of PRECEDE-PROCEED model to tackle problems identified with diarrhoea burden among under-5s in Botswana.

    PubMed

    Popoola, Tosin; Mchunu, Gugu

    2015-05-01

    Diarrhoea has been identified as the second leading cause of mortality among under-5s and also claims more life than HIV, measles and malaria combined together in the same category of population. This article is a combination of literature review and personal experience of lessons learnt from past diarrhoea outbreaks in Botswana that caused significant rate of mortality among under-5s. The paper used literature review to identify contributory factors to diarrhoea burden among under-5s in Botswana and applied a community health nursing framework (PRECEDE-PROCEED) to tackle the problems identified. The study revealed that Botswana mothers are lacking in knowledge related to exclusive breastfeeding, prevention and treatment of diarrhoea disease. The paper recommends that health-care workers in Botswana be sensitized on current diarrhoea management to tailor their health education methods appropriately. PMID:26125574

  16. Functional variants of 5S rRNA in the ribosomes of common sea urchin Paracentrotus lividus.

    PubMed

    Dimarco, Eufrosina; Cascone, Eleonora; Bellavia, Daniele; Caradonna, Fabio

    2012-10-15

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus; this study, performed at DNA level only, lends itself as starting point to verify that these clusters could contain transcribed genes, then, to demonstrate the presence of heterogeneity at functional RNA level, also. In the present work we report in P. lividus ribosomes the existence of several transcribed variants of the 5S rRNA and we associate all transcribed variants to the cluster to which belong. Our finding is the first demonstration of the presence of high heterogeneity in functional 5S rRNA molecules in animal ribosomes, a feature that had been considered a peculiarity of some plants. PMID:22967708

  17. Xenopus transcription factor IIIA binds primarily at junctions between double helical stems and internal loops in oocyte 5S RNA.

    PubMed Central

    Christiansen, J; Brown, R S; Sproat, B S; Garrett, R A

    1987-01-01

    RNases and chemical probes were used to study the accessibility of each nucleotide of 5S RNA in the native and reconstituted 7S particle from Xenopus laevis oocytes. RNase or chemically treated 5S RNA from intact 7S particles was isolated and analysed using an oligodeoxynucleotide primer and reverse transcriptase. The results were superimposed on a cylindrical projection of an RNA double helix and the protection effects were shown to cluster at two regions on the molecular surface. A three-dimensional model is proposed for the 7S particle in which protein-RNA contacts occur mainly in the major groove of 5S RNA. Images Fig. 1. Fig. 2. PMID:3582366

  18. Transsacral transdiscal L5-S1 screws for the management of high-grade spondylolisthesis in an adolescent.

    PubMed

    Palejwala, Ali; Fridley, Jared; Jea, Andrew

    2016-06-01

    The surgical management of high-grade spondylolisthesis in adolescents remains a controversial issue. Because the basic procedure, posterolateral fusion, is associated with a significant rate of pseudarthrosis and listhesis progression, there is a pressing need for alternative surgical techniques. In the present report, the authors describe the case of an adolescent patient with significant low-back pain who was found to have Grade IV spondylolisthesis at L5-S1 that was treated with transsacral transdiscal screw fixation. Bilateral pedicle screws were placed starting from the top of the S-1 pedicle, across the L5-S1 intervertebral disc space, and into the L-5 body. At 14 months after surgery, the patient had considerable improvement in his pain and radiographic fusion across L5-S1. The authors conclude that transsacral transdiscal pedicle screws may serve as an efficacious and safe option for the correction of high-grade spondylolisthesis in adolescent patients. PMID:26894520

  19. Dissociative excitation of the N(+)(5S) state by electron impact on N2 - Excitation function and quenching

    NASA Technical Reports Server (NTRS)

    Erdman, P. W.; Zipf, E. C.

    1986-01-01

    Metastable N(+)(5S) ions were produced in the laboratory by dissociative excitation of N2 with energetic electrons. The resulting radiative decay of the N(+)(5S) state was observed with sufficient resolution to completely resolve the doublet from the nearby N2 molecular radiation. The excitation function was measured from threshold to 500 eV. The cross section peaks at a high electron energy and also exhibits a high threshold energy both of which are typical of dissociative excitation-ionization processes. This finding complicates the explanation of electron impact on N2 as the mechanism for the source of the 2145 A 'auroral mystery feature' by further increasing the required peak cross section. It is suggested that the apparent N(+)(5S) quenching in auroras may be an artifact due to the softening of the electron energy spectrum in the auroral E region.

  20. D5S2500 is an ambiguously characterized STR: Identification and description of forensic microsatellites in the genomics age.

    PubMed

    Phillips, C; Parson, W; Amigo, J; King, J L; Coble, M D; Steffen, C R; Vallone, P M; Gettings, K B; Butler, J M; Budowle, B

    2016-07-01

    In the process of establishing short tandem repeat (STR) sequence variant nomenclature guidelines in anticipation of expanded forensic multiplexes for massively parallel sequencing (MPS), it was discovered that the STR D5S2500 has multiple positions and genomic characteristics reported. This ambiguity is because the marker named D5S2500 consists of two different microsatellites forming separate components in the capillary electrophoresis multiplexes of Qiagen's HDplex (Hilden, Germany) and AGCU ScienTech's non-CODIS STR 21plex (Wuxi, Jiangsu, China). This study outlines the genomic details used to identify each microsatellite and reveals the D5S2500 marker in HDplex has the correctly assigned STR name, while the D5S2500 marker in the AGCU 21plex, closely positioned a further 1643 nucleotides in the human reference sequence, is an unnamed microsatellite. The fact that the D5S2500 marker has existed as two distinct STR loci undetected for almost ten years, even with reported discordant genotypes for the standard control DNA, underlines the need for careful scrutiny of the genomic properties of forensic STRs, as they become adapted for sequence analysis with MPS systems. We make the recommendation that precise chromosome location data must be reported for any forensic marker under development but not in common use, so that the genomic characteristics of the locus are validated to the same level of accuracy as its allelic variation and forensic performance. To clearly differentiate each microsatellite, we propose the name D5S2800 be used to identify the Chromosome-5 STR in the AGCU 21plex. PMID:26974236

  1. Domain rearrangement of SRP protein Ffh upon binding 4.5S RNA and the SRP receptor FtsY

    PubMed Central

    BUSKIEWICZ, IWONA; KUBARENKO, ANDRIY; PESKE, FRANK; RODNINA, MARINA V.; WINTERMEYER, WOLFGANG

    2005-01-01

    The signal recognition particle (SRP) mediates membrane targeting of translating ribosomes displaying a signal-anchor sequence. In Escherichia coli, SRP consists of 4.5S RNA and a protein, Ffh, that recognizes the signal peptide emerging from the ribosome and the SRP receptor at the membrane, FtsY. In the present work, we studied the interactions between the NG and M domains in Ffh and their rearrangements upon complex formation with 4.5S RNA and/or FtsY. In free Ffh, the NG and M domains are facing one another in an orientation that allows cross-linking between positions 231 in the G domain and 377 in the M domain. There are binding interactions between the two domains, as the isolated domains form a strong complex. The interdomain contacts are disrupted upon binding of Ffh to 4.5S RNA, consuming a part of the total binding energy of 4.5S RNA-Ffh association that is roughly equivalent to the free energy of domain binding to each other. In the SRP particle, the NG domain binds to 4.5S RNA in a region adjacent to the binding site of the M domain. Ffh binding to FtsY also requires a reorientation of NG and M domains. These results suggest that in free Ffh, the binding sites for 4.5S RNA and FtsY are occluded by strong domain–domain interactions which must be disrupted for the formation of SRP or the Ffh-FtsY complex. PMID:15923378

  2. Domain rearrangement of SRP protein Ffh upon binding 4.5S RNA and the SRP receptor FtsY.

    PubMed

    Buskiewicz, Iwona; Kubarenko, Andriy; Peske, Frank; Rodnina, Marina V; Wintermeyer, Wolfgang

    2005-06-01

    The signal recognition particle (SRP) mediates membrane targeting of translating ribosomes displaying a signal-anchor sequence. In Escherichia coli, SRP consists of 4.5S RNA and a protein, Ffh, that recognizes the signal peptide emerging from the ribosome and the SRP receptor at the membrane, FtsY. In the present work, we studied the interactions between the NG and M domains in Ffh and their rearrangements upon complex formation with 4.5S RNA and/or FtsY. In free Ffh, the NG and M domains are facing one another in an orientation that allows cross-linking between positions 231 in the G domain and 377 in the M domain. There are binding interactions between the two domains, as the isolated domains form a strong complex. The interdomain contacts are disrupted upon binding of Ffh to 4.5S RNA, consuming a part of the total binding energy of 4.5S RNA-Ffh association that is roughly equivalent to the free energy of domain binding to each other. In the SRP particle, the NG domain binds to 4.5S RNA in a region adjacent to the binding site of the M domain. Ffh binding to FtsY also requires a reorientation of NG and M domains. These results suggest that in free Ffh, the binding sites for 4.5S RNA and FtsY are occluded by strong domain-domain interactions which must be disrupted for the formation of SRP or the Ffh-FtsY complex. PMID:15923378

  3. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    PubMed

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location. PMID:27334092

  4. Trehalose Polyphleates Are Produced by a Glycolipid Biosynthetic Pathway Conserved across Phylogenetically Distant Mycobacteria.

    PubMed

    Burbaud, Sophie; Laval, Françoise; Lemassu, Anne; Daffé, Mamadou; Guilhot, Christophe; Chalut, Christian

    2016-02-18

    Mycobacteria synthesize a variety of structurally related glycolipids with major biological functions. Common themes have emerged for the biosynthesis of these glycolipids, including several families of proteins. Genes encoding these proteins are usually clustered on bacterial chromosomal islets dedicated to the synthesis of one glycolipid family. Here, we investigated the function of a cluster of five genes widely distributed across non-tuberculous mycobacteria. Using defined mutant analysis and in-depth structural characterization of glycolipids from wild-type or mutant strains of Mycobacterium smegmatis and Mycobacterium abscessus, we established that they are involved in the formation of trehalose polyphleates (TPP), a family of compounds originally described in Mycobacterium phlei. Comparative genomics and lipid analysis of strains distributed along the mycobacterial phylogenetic tree revealed that TPP is synthesized by a large number of non-tuberculous mycobacteria. This work unravels a novel glycolipid biosynthetic pathway in mycobacteria and extends the spectrum of bacteria that produce TPP. PMID:27028886

  5. Biosynthetic preparation of selectively deuterated phosphatidylcholine in genetically modified Escherichia coli

    PubMed Central

    Maric, Selma; Thygesen, Mikkel B.; Schiller, Jürgen; Marek, Magdalena; Moulin, Martine; Haertlein, Michael; Forsyth, V. Trevor; Bogdanov, Mikhail; Dowhan, William; Arleth, Lise

    2014-01-01

    Phosphatidylcholine (PC) is a major component of eukaryotic cell membranes and one of the most commonly used phospholipids for reconstitution of membrane proteins into carrier systems such as lipid vesicles, micelles and nanodiscs. Selectively deuterated versions of this lipid have many applications, especially in structural studies using techniques such as NMR, neutron reflectivity and small-angle neutron scattering. Here we present a comprehensive study of selective deuteration of phosphatidylcholine through biosynthesis in a genetically modified strain of Escherichia coli. By carefully tuning the deuteration level in E. coli growth media and varying the deuteration of supplemented carbon sources, we show that it is possible to achieve a controlled deuteration for three distinct parts of the PC lipid molecule, namely the (a) lipid head group, (b) glycerol backbone and (c) fatty acyl tail. This biosynthetic approach paves the way for the synthesis of specifically deuterated, physiologically relevant phospholipid species which remain difficult to obtain through standard chemical synthesis. PMID:25301578

  6. Building Triketide α-Pyrone-Producing Yeast Platform Using Heterologous Expression of Sporopollenin Biosynthetic Genes.

    PubMed

    Kim, Sung Soo

    2015-11-28

    Sporopollenin is a poorly characterized mixed aliphatic and aromatic polymer with ester and ether linkages. Recent studies have reported that α-pyrone polyketide compounds generated by Arabidopsis thaliana, polyketide synthase A (PKSA) and tetraketide α-pyrone reductase 1 (TKPR1), are previously unknown sporopollenin precursors. Here, the yeast Saccharomyces cerevisiae was introduced to test potential sporopollenin biosynthetic pathways in vivo. A PKSA/TKPR1 dual expressor was generated and various chain-length alkyl α-pyrones were identified by GC-MS. The growth rate of the strain containing PKSA/TKPR1 appeared normal. These results indicate that PKSA/TKPR1-expressing yeast would be a starting platform to investigate in vivo sporopollenin metabolism. PMID:26215269

  7. Complete set of glycosyltransferase structures in the calicheamicin biosynthetic pathway reveals the origin of regiospecificity

    SciTech Connect

    Chang, Aram; Singh, Shanteri; Helmich, Kate E.; Goff, Randal D.; Bingman, Craig A.; Thorson, Jon S.; Phillips, Jr., George N.

    2012-03-15

    Glycosyltransferases are useful synthetic catalysts for generating natural products with sugar moieties. Although several natural product glycosyltransferase structures have been reported, design principles of glycosyltransferase engineering for the generation of glycodiversified natural products has fallen short of its promise, partly due to a lack of understanding of the relationship between structure and function. Here, we report structures of all four calicheamicin glycosyltransferases (CalG1, CalG2, CalG3, and CalG4), whose catalytic functions are clearly regiospecific. Comparison of these four structures reveals a conserved sugar donor binding motif and the principles of acceptor binding region reshaping. Among them, CalG2 possesses a unique catalytic motif for glycosylation of hydroxylamine. Multiple glycosyltransferase structures in a single natural product biosynthetic pathway are a valuable resource for understanding regiospecific reactions and substrate selectivities and will help future glycosyltransferase engineering.

  8. Water splitting-biosynthetic system with CO₂ reduction efficiencies exceeding photosynthesis.

    PubMed

    Liu, Chong; Colón, Brendan C; Ziesack, Marika; Silver, Pamela A; Nocera, Daniel G

    2016-06-01

    Artificial photosynthetic systems can store solar energy and chemically reduce CO2 We developed a hybrid water splitting-biosynthetic system based on a biocompatible Earth-abundant inorganic catalyst system to split water into molecular hydrogen and oxygen (H2 and O2) at low driving voltages. When grown in contact with these catalysts, Ralstonia eutropha consumed the produced H2 to synthesize biomass and fuels or chemical products from low CO2 concentration in the presence of O2 This scalable system has a CO2 reduction energy efficiency of ~50% when producing bacterial biomass and liquid fusel alcohols, scrubbing 180 grams of CO2 per kilowatt-hour of electricity. Coupling this hybrid device to existing photovoltaic systems would yield a CO2 reduction energy efficiency of ~10%, exceeding that of natural photosynthetic systems. PMID:27257255

  9. Identification of the active-site lysine residues of two biosynthetic 3-dehydroquinases.

    PubMed Central

    Chaudhuri, S; Duncan, K; Graham, L D; Coggins, J R

    1991-01-01

    The lysine residues involved in Schiff-base formation at the active sites of both the 3-dehydroquinase component of the pentafunctional arom enzyme of Neurospora crassa and of the monofunctional 3-dehydroquinase of Escherichia coli were labelled by treatment with 3-dehydroquinate in the presence of NaB3H4. Radioactive peptides were isolated by h.p.l.c. following digestion with CNBr (and in one case after further digestion with trypsin). The sequence established for the N. crassa peptide was ALQHGDVVKLVVGAR, and that for the E. coli peptide was QSFDADIPKIA. An amended nucleotide sequence for the E. coli gene (aroD) that encode 3-dehydroquinase is also presented, along with a revised alignment of the deduced amino acid sequences for the biosynthetic enzymes. PMID:1826831

  10. Discovery and Reconstitution of the Cycloclavine Biosynthetic Pathway—Enzymatic Formation of a Cyclopropyl Group†

    PubMed Central

    Jakubczyk, Dorota; Caputi, Lorenzo; Hatsch, Anaëlle; Nielsen, Curt A. F.; Diefenbacher, Melanie; Klein, Jens; Molt, Andrea; Schröder, Hartwig; Cheng, Johnathan Z.

    2015-01-01

    Abstract The ergot alkaloids, a class of fungal‐derived natural products with important biological activities, are derived from a common intermediate, chanoclavine‐I, which is elaborated into a set of diverse structures. Herein we report the discovery of the biosynthetic pathway of cycloclavine, a complex ergot alkaloid containing a cyclopropyl moiety. We used a yeast‐based expression platform along with in vitro biochemical experiments to identify the enzyme that catalyzes a rearrangement of the chanoclavine‐I intermediate to form a cyclopropyl moiety. The resulting compound, cycloclavine, was produced in yeast at titers of >500 mg L−1, thus demonstrating the feasibility of the heterologous expression of these complex alkaloids.

  11. Integrative genomic mining for enzyme function to enable engineering of a non-natural biosynthetic pathway

    PubMed Central

    Mak, Wai Shun; Tran, Stephen; Marcheschi, Ryan; Bertolani, Steve; Thompson, James; Baker, David; Liao, James C.; Siegel, Justin B.

    2015-01-01

    The ability to biosynthetically produce chemicals beyond what is commonly found in Nature requires the discovery of novel enzyme function. Here we utilize two approaches to discover enzymes that enable specific production of longer-chain (C5–C8) alcohols from sugar. The first approach combines bioinformatics and molecular modelling to mine sequence databases, resulting in a diverse panel of enzymes capable of catalysing the targeted reaction. The median catalytic efficiency of the computationally selected enzymes is 75-fold greater than a panel of naively selected homologues. This integrative genomic mining approach establishes a unique avenue for enzyme function discovery in the rapidly expanding sequence databases. The second approach uses computational enzyme design to reprogramme specificity. Both approaches result in enzymes with >100-fold increase in specificity for the targeted reaction. When enzymes from either approach are integrated in vivo, longer-chain alcohol production increases over 10-fold and represents >95% of the total alcohol products. PMID:26598135

  12. Biosynthetic pathway of the phytohormone auxin in insects and screening of its inhibitors.

    PubMed

    Suzuki, Hiroyoshi; Yokokura, Junpei; Ito, Tsukasa; Arai, Ryoma; Yokoyama, Chiaki; Toshima, Hiroaki; Nagata, Shinji; Asami, Tadao; Suzuki, Yoshihito

    2014-10-01

    Insect galls are abnormal plant tissues induced by galling insects. The galls are used for food and habitation, and the phytohormone auxin, produced by the insects, may be involved in their formation. We found that the silkworm, a non-galling insect, also produces an active form of auxin, indole-3-acetic acid (IAA), by de novo synthesis from tryptophan (Trp). A detailed metabolic analysis of IAA using IAA synthetic enzymes from silkworms indicated an IAA biosynthetic pathway composed of a three-step conversion: Trp → indole-3-acetaldoxime → indole-3-acetaldehyde (IAAld) → IAA, of which the first step is limiting IAA production. This pathway was shown to also operate in gall-inducing sawfly. Screening of a chemical library identified two compounds that showed strong inhibitory activities on the conversion step IAAld → IAA. The inhibitors can be efficiently used to demonstrate the importance of insect-synthesized auxin in gall formation in the future. PMID:25111299

  13. Subcellular Compartmentalization and Trafficking of the Biosynthetic Machinery for Fungal Melanin.

    PubMed

    Upadhyay, Srijana; Xu, Xinping; Lowry, David; Jackson, Jennifer C; Roberson, Robert W; Lin, Xiaorong

    2016-03-22

    Protection by melanin depends on its subcellular location. Although most filamentous fungi synthesize melanin via a polyketide synthase pathway, where and how melanin biosynthesis occurs and how it is deposited as extracellular granules remain elusive. Using a forward genetic screen in the pathogen Aspergillus fumigatus, we find that mutations in an endosomal sorting nexin abolish melanin cell-wall deposition. We find that all enzymes involved in the early steps of melanin biosynthesis are recruited to endosomes through a non-conventional secretory pathway. In contrast, late melanin enzymes accumulate in the cell wall. Such subcellular compartmentalization of the melanin biosynthetic machinery occurs in both A. fumigatus and A. nidulans. Thus, fungal melanin biosynthesis appears to be initiated in endosomes with exocytosis leading to melanin extracellular deposition, much like the synthesis and trafficking of mammalian melanin in endosomally derived melanosomes. PMID:26972005

  14. Nutrient shortage triggers the hexosamine biosynthetic pathway via the GCN2-ATF4 signalling pathway

    PubMed Central

    Chaveroux, Cédric; Sarcinelli, Carmen; Barbet, Virginie; Belfeki, Sofiane; Barthelaix, Audrey; Ferraro-Peyret, Carole; Lebecque, Serge; Renno, Toufic; Bruhat, Alain; Fafournoux, Pierre; Manié, Serge N.

    2016-01-01

    The hexosamine biosynthetic pathway (HBP) is a nutrient-sensing metabolic pathway that produces the activated amino sugar UDP-N-acetylglucosamine, a critical substrate for protein glycosylation. Despite its biological significance, little is known about the regulation of HBP flux during nutrient limitation. Here, we report that amino acid or glucose shortage increase GFAT1 production, the first and rate-limiting enzyme of the HBP. GFAT1 is a transcriptional target of the activating transcription factor 4 (ATF4) induced by the GCN2-eIF2α signalling pathway. The increased production of GFAT1 stimulates HBP flux and results in an increase in O-linked β-N-acetylglucosamine protein modifications. Taken together, these findings demonstrate that ATF4 provides a link between nutritional stress and the HBP for the regulation of the O-GlcNAcylation-dependent cellular signalling. PMID:27255611

  15. Nutrient shortage triggers the hexosamine biosynthetic pathway via the GCN2-ATF4 signalling pathway.

    PubMed

    Chaveroux, Cédric; Sarcinelli, Carmen; Barbet, Virginie; Belfeki, Sofiane; Barthelaix, Audrey; Ferraro-Peyret, Carole; Lebecque, Serge; Renno, Toufic; Bruhat, Alain; Fafournoux, Pierre; Manié, Serge N

    2016-01-01

    The hexosamine biosynthetic pathway (HBP) is a nutrient-sensing metabolic pathway that produces the activated amino sugar UDP-N-acetylglucosamine, a critical substrate for protein glycosylation. Despite its biological significance, little is known about the regulation of HBP flux during nutrient limitation. Here, we report that amino acid or glucose shortage increase GFAT1 production, the first and rate-limiting enzyme of the HBP. GFAT1 is a transcriptional target of the activating transcription factor 4 (ATF4) induced by the GCN2-eIF2α signalling pathway. The increased production of GFAT1 stimulates HBP flux and results in an increase in O-linked β-N-acetylglucosamine protein modifications. Taken together, these findings demonstrate that ATF4 provides a link between nutritional stress and the HBP for the regulation of the O-GlcNAcylation-dependent cellular signalling. PMID:27255611

  16. Sex pheromone biosynthetic pathways are conserved between moths and the butterfly Bicyclus anynana.

    PubMed

    Liénard, Marjorie A; Wang, Hong-Lei; Lassance, Jean-Marc; Löfstedt, Christer

    2014-01-01

    Although phylogenetically nested within the moths, butterflies have diverged extensively in a number of life history traits. Whereas moths rely greatly on chemical signals, visual advertisement is the hallmark of mate finding in butterflies. In the context of courtship, however, male chemical signals are widespread in both groups although they likely have multiple evolutionary origins. Here, we report that in males of the butterfly Bicyclus anynana, courtship scents are produced de novo via biosynthetic pathways shared with females of many moth species. We show that two of the pheromone components that play a major role in mate choice, namely the (Z)-9-tetradecenol and hexadecanal, are produced through the activity of a fatty acyl Δ11-desaturase and two specialized alcohol-forming fatty acyl reductases. Our study provides the first evidence of conservation and sharing of ancestral genetic modules for the production of FA-derived pheromones over a long evolutionary timeframe thereby reconciling mate communication in moths and butterflies. PMID:24862548

  17. Integrative genomic mining for enzyme function to enable engineering of a non-natural biosynthetic pathway.

    PubMed

    Mak, Wai Shun; Tran, Stephen; Marcheschi, Ryan; Bertolani, Steve; Thompson, James; Baker, David; Liao, James C; Siegel, Justin B

    2015-01-01

    The ability to biosynthetically produce chemicals beyond what is commonly found in Nature requires the discovery of novel enzyme function. Here we utilize two approaches to discover enzymes that enable specific production of longer-chain (C5-C8) alcohols from sugar. The first approach combines bioinformatics and molecular modelling to mine sequence databases, resulting in a diverse panel of enzymes capable of catalysing the targeted reaction. The median catalytic efficiency of the computationally selected enzymes is 75-fold greater than a panel of naively selected homologues. This integrative genomic mining approach establishes a unique avenue for enzyme function discovery in the rapidly expanding sequence databases. The second approach uses computational enzyme design to reprogramme specificity. Both approaches result in enzymes with >100-fold increase in specificity for the targeted reaction. When enzymes from either approach are integrated in vivo, longer-chain alcohol production increases over 10-fold and represents >95% of the total alcohol products. PMID:26598135

  18. Discovery and reconstitution of the cycloclavine biosynthetic pathway--enzymatic formation of a cyclopropyl group.

    PubMed

    Jakubczyk, Dorota; Caputi, Lorenzo; Hatsch, Anaëlle; Nielsen, Curt A F; Diefenbacher, Melanie; Klein, Jens; Molt, Andrea; Schröder, Hartwig; Cheng, Johnathan Z; Naesby, Michael; O'Connor, Sarah E

    2015-04-20

    The ergot alkaloids, a class of fungal-derived natural products with important biological activities, are derived from a common intermediate, chanoclavine-I, which is elaborated into a set of diverse structures. Herein we report the discovery of the biosynthetic pathway of cycloclavine, a complex ergot alkaloid containing a cyclopropyl moiety. We used a yeast-based expression platform along with in vitro biochemical experiments to identify the enzyme that catalyzes a rearrangement of the chanoclavine-I intermediate to form a cyclopropyl moiety. The resulting compound, cycloclavine, was produced in yeast at titers of >500 mg L(-1) , thus demonstrating the feasibility of the heterologous expression of these complex alkaloids. PMID:25712404

  19. First Biosynthetic pathway of 1-hepten-3-one in Iporangaia pustulosa (Opiliones)

    PubMed Central

    Rocha, Daniele F. O.; Wouters, Felipe C.; Machado, Glauco; Marsaioli, Anita J.

    2013-01-01

    Arthropods produce a great variety of natural compounds, many of which have unexplored biosynthesis. Among the armored harvestmen (Arachnida: Opiliones) of the suborder Laniatores, the defensive gland exudates contain vinyl ketones and other constituents of supposed polyketide origin. We have studied the biosynthesis of 1-hepten-3-one in the Neotropical harvestman Iporangaia pustulosa by feeding individuals with 13C-labeled precursors, demonstrating its mixed acetate/propionate origin. 13C NMR spectroscopy showed an unusual labeling pattern suggesting different propionate sources for starting and extender units. Our analysis also indicates the presence of methylmalonyl-CoA mutase, converting acetate into propionyl-CoA via succinyl-CoA, together with other C3 unit routes. This is the first biosynthetic study of alkyl vinyl ketones in arthropods. Our results shed light on the origin and diversification of chemical compounds in a major arthropod group. PMID:24193576

  20. Biosynthetic studies on ansatrienin A. Formation of the cyclohexanecarboxylic acid moiety

    SciTech Connect

    Moore, B.S.; Kennedy, E.; Reynolds, K.A. ); Cho, H.; Mocek, U.; Beale, J.M.; Floss, H.G. Ohio State Univ., Columbus ); Casati, R. )

    1993-06-16

    The formation of the cyclohexanecarboxylic acid moiety in the biosynthesis of ansatrienin (mycotrienin) has been studied. [sup 13]C- and [sup 2]H-labeled samples of shikimic acid were used to probe the stereochemistry of processing the cyclohexane ring of shikimic acid and to establish the fate of all the precursor hydrogens in this transformation. A sample of [2-[sup 13]C]shikimic acid was fed to Streptomyces collinus Tu 1982, and [sup 13]C in the resulting ansatrienin was found to reside exclusively at C-36. The l-cyclohexenecarboxylic acid accompanying the cyclohexanecarboxylic acid in the hydrolysis of the biosynthetic sample of ansatrienin carried the [sup 13]C label not at C-2 but at C-6. Samples of [2-[sup 2]H]-, [3-[sup 2]H]-, [4-[sup 2]H], [2,5-[sup 2]H[sub 2

  1. Biosynthesis of hibarimicins. II. Elucidation of biosynthetic pathway by cosynthesis using blocked mutants.

    PubMed

    Kajiura, Takayuki; Furumai, Tamotsu; Igarashi, Yasuhiro; Hori, Hiroshi; Higashi, Kazuaki; Ishiyama, Tadayuki; Uramoto, Masakazu; Uehara, Yoshimasa; Oki, Toshikazu

    2002-01-01

    The biosynthetic pathway of hibarimicin (HBM) was proposed on the basis of the experimental results obtained by using blocked mutants of Microbispora rosea subsp. hibaria TP-A0121, the HBM producer. In its biosynthesis, the oxidative coupling of the aromatic undecaketide unit generates a symmetrical aglycon HMP-Y1 (hibarimicin-mutant product Y1), which is oxidatively modified to hibarimicinone, the HBM aglycon. The following glycosylation of hibarimicinone gives rise to the HBM complex. We identified that HMP-Y1 prepared by methanolysis of HMP-Y6, a glycosylated metabolite from a blocked mutant, was the key intermediate: transformation of 13C-labeled HMP-Y1 to HBM B was confirmed by NMR measurements. Mutant strain produced another type of aglycon HMP-P1 in which the coupled polyketide units were intramolecularly bridged by the ether bond. This metabolite also arose by the spontaneous elimination of methanol molecule from hibarimicinone. PMID:11918066

  2. Sex pheromone biosynthetic pathways are conserved between moths and the butterfly Bicyclus anynana

    PubMed Central

    Liénard, Marjorie A; Wang, Hong-Lei; Lassance, Jean-Marc; Löfstedt, Christer

    2014-01-01

    Although phylogenetically nested within the moths, butterflies have diverged extensively in a number of life history traits. Whereas moths rely greatly on chemical signals, visual advertisement is the hallmark of mate finding in butterflies. In the context of courtship, however, male chemical signals are widespread in both groups although they likely have multiple evolutionary origins. Here, we report that in males of the butterfly Bicyclus anynana, courtship scents are produced de novo via biosynthetic pathways shared with females of many moth species. We show that two of the pheromone components that play a major role in mate choice, namely the (Z)-9-tetradecenol and hexadecanal, are produced through the activity of a fatty acyl Δ11-desaturase and two specialized alcohol-forming fatty acyl reductases. Our study provides the first evidence of conservation and sharing of ancestral genetic modules for the production of FA-derived pheromones over a long evolutionary timeframe thereby reconciling mate communication in moths and butterflies. PMID:24862548

  3. Molecular Cloning and Heterologous Expression of the Dehydrophos Biosynthetic Gene Cluster

    PubMed Central

    Circello, Benjamin T.; Eliot, Andrew C.; Lee, Jin-Hee; van der Donk, Wilfred A.; Metcalf, William W.

    2010-01-01

    Summary Dehydrophos is a vinyl phosphonate tripeptide produced by Streptomyces luridus with demonstrated broad spectrum antibiotic activity. To identify genes necessary for biosynthesis of this unusual compound we screened a fosmid library of S. luridus for the presence of the phosphoenolpyruvate mutase gene, which is required for biosynthesis of most phosphonates. Integration of one such fosmid clone into the chromosome of Streptomyces lividans led to heterologous production of dehydrophos. Deletion analysis of this clone allowed identification of the minimal contiguous dehydrophos cluster, which contained 17 open reading frames (ORFs). Bioinformatic analyses of these ORFs are consistent with a proposed biosynthetic pathway that generates dehydrophos from phosphoenolpyruvate. The early steps of this pathway are supported by analysis of intermediates accumulated by blocked mutants and in vitro biochemical experiments. PMID:20416511

  4. Requirement of glucose for mycolic acid biosynthetic activity localized in the cell wall of Bacterionema matruchotii.

    PubMed

    Shimakata, T; Tsubokura, K; Kusaka, T

    1986-06-01

    When the localization of mycolic acid biosynthetic activity was examined with Bacterionema matruchotii cells disrupted by the ultrasonic vibration method, activity was detected only in the cell wall fraction, not in the inner membrane nor in the 78,000g supernatant. Either the supernatant or sugar was absolutely required for the incorporation of [14C]palmitate into mycolic acids. Among sugars examined, glucose was most effective, with maltose being second. Unexpectedly, trehalose was inert. As to substrate, the present system utilized free palmitic acid rather than palmitoyl-CoA. The reaction products from palmitate and glucose were glucose mycolate and trehalose monomycolate, in which the label from [14C]palmitate or [14C]glucose was incorporated. Glucose palmitate was also formed. Addition of trehalose resulted in a shift from glucose mycolate to trehalose monomycolate. These data clearly indicate that sugars play an important role in the synthesis of mycolic acids from free fatty acids. PMID:3717946

  5. Comparative structural analysis of eubacterial 5S rRNA by oxidation of adenines in the N-1 position.

    PubMed Central

    Pieler, T; Schreiber, A; Erdmann, V A

    1984-01-01

    Adenines in free 5S rRNA from Escherichia coli, Bacillus stearothermophilus and Thermus thermophilus have been oxidized at their N-1 position using monoperphthalic acid. The determination of the number of adenine 1-N-oxides was on the basis of UV spectroscopic data of the intact molecule. Identification of the most readily accessible nucleotides by sequencing gel analysis reveals that they are located in conserved positions within loops, exposed hairpin loops and single-base bulge loops. Implications for the structure and function of 5S rRNA will be discussed on the basis of this comparative analysis. Images PMID:6201825

  6. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    PubMed

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families. PMID:25315165

  7. Identification of a 5S rDNA spacer type specific Triticum urartu and wheats containing the T. urartu genome.

    PubMed

    Allaby, R G; Brown, T A

    2000-04-01

    A PCR system was designed to amplify 5S spacer rDNA specifically from homeologous chromosome 1 in a variety of species representative of the Aegilops and Triticum genera. Two polymerase chain reaction (PCR) primer combinations were used, one of which appears to be apomorphic in nature and specific to chromosome 1A in Triticum urartu and tetraploid and hexaploid wheats containing the AA genome donated by T. urartu. The value of studying single repeat types to investigate the molecular evolution of 5S-rDNA arrays is considered. PMID:10791812

  8. Identification of a 12-gene fusaric acid biosynthetic gene cluster in Fusarium species through comparative and functional genomics

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In fungi, genes involved in biosynthesis of a secondary metabolite (SM) are often located adjacent to one another in the genome and are coordinately regulated. These SM biosynthetic gene clusters typically encode enzymes, one or more transcription factors, and a transport protein. Fusaric acid is a ...

  9. Identification of Coq11, a New Coenzyme Q Biosynthetic Protein in the CoQ-Synthome in Saccharomyces cerevisiae*

    PubMed Central

    Allan, Christopher M.; Awad, Agape M.; Johnson, Jarrett S.; Shirasaki, Dyna I.; Wang, Charles; Blaby-Haas, Crysten E.; Merchant, Sabeeha S.; Loo, Joseph A.; Clarke, Catherine F.

    2015-01-01

    Coenzyme Q (Q or ubiquinone) is a redox active lipid composed of a fully substituted benzoquinone ring and a polyisoprenoid tail and is required for mitochondrial electron transport. In the yeast Saccharomyces cerevisiae, Q is synthesized by the products of 11 known genes, COQ1–COQ9, YAH1, and ARH1. The function of some of the Coq proteins remains unknown, and several steps in the Q biosynthetic pathway are not fully characterized. Several of the Coq proteins are associated in a macromolecular complex on the matrix face of the inner mitochondrial membrane, and this complex is required for efficient Q synthesis. Here, we further characterize this complex via immunoblotting and proteomic analysis of tandem affinity-purified tagged Coq proteins. We show that Coq8, a putative kinase required for the stability of the Q biosynthetic complex, is associated with a Coq6-containing complex. Additionally Q6 and late stage Q biosynthetic intermediates were also found to co-purify with the complex. A mitochondrial protein of unknown function, encoded by the YLR290C open reading frame, is also identified as a constituent of the complex and is shown to be required for efficient de novo Q biosynthesis. Given its effect on Q synthesis and its association with the biosynthetic complex, we propose that the open reading frame YLR290C be designated COQ11. PMID:25631044

  10. Multiplex PCR analysis of fumonisin biosynthetic genes in fumonisin-nonproducing Aspergillus niger and A. awamori strains

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In order to determine the genetic basis for loss of fumonisin B¬2 (FB2) biosynthesis in FB2 non-producing A. niger strains, we developed multiplex PCR primer sets to amplify fragments of eight fumonisin biosynthetic pathway (fum) genes. Fragments of all eight fum genes were amplified in FB2-produci...

  11. Identification of Coq11, a new coenzyme Q biosynthetic protein in the CoQ-synthome in Saccharomyces cerevisiae.

    PubMed

    Allan, Christopher M; Awad, Agape M; Johnson, Jarrett S; Shirasaki, Dyna I; Wang, Charles; Blaby-Haas, Crysten E; Merchant, Sabeeha S; Loo, Joseph A; Clarke, Catherine F

    2015-03-20

    Coenzyme Q (Q or ubiquinone) is a redox active lipid composed of a fully substituted benzoquinone ring and a polyisoprenoid tail and is required for mitochondrial electron transport. In the yeast Saccharomyces cerevisiae, Q is synthesized by the products of 11 known genes, COQ1-COQ9, YAH1, and ARH1. The function of some of the Coq proteins remains unknown, and several steps in the Q biosynthetic pathway are not fully characterized. Several of the Coq proteins are associated in a macromolecular complex on the matrix face of the inner mitochondrial membrane, and this complex is required for efficient Q synthesis. Here, we further characterize this complex via immunoblotting and proteomic analysis of tandem affinity-purified tagged Coq proteins. We show that Coq8, a putative kinase required for the stability of the Q biosynthetic complex, is associated with a Coq6-containing complex. Additionally Q6 and late stage Q biosynthetic intermediates were also found to co-purify with the complex. A mitochondrial protein of unknown function, encoded by the YLR290C open reading frame, is also identified as a constituent of the complex and is shown to be required for efficient de novo Q biosynthesis. Given its effect on Q synthesis and its association with the biosynthetic complex, we propose that the open reading frame YLR290C be designated COQ11. PMID:25631044

  12. Toxicity of the pyrimidine biosynthetic pathway intermediate carbamyl aspartate in Salmonella typhimurium.

    PubMed Central

    Turnbough, C L; Bochner, B R

    1985-01-01

    Growth of Salmonella typhimurium pyrC or pyrD auxotrophs was severely inhibited in media that caused derepressed pyr gene expression. No such inhibition was observed with derepressed pyrA and pyrB auxotrophs. Growth inhibition was not due to the depletion of essential pyrimidine biosynthetic pathway intermediates or substrates. This result and the pattern of inhibition indicated that the accumulation of the pyrimidine biosynthetic pathway intermediate carbamyl aspartate was toxic. This intermediate is synthesized by the sequential action of the first two enzymes of the pathway encoded by pyrA and pyrB and is a substrate for the pyrC gene product. It should accumulate to high levels in pyrC or pyrD mutants when expression of the pyrA and pyrB genes is elevated. The introduction of either a pyrA or pyrB mutation into a pyrC strain eliminated the observed growth inhibition. Additionally, a direct correlation was shown between the severity of growth inhibition of a pyrC auxotroph and the levels of the enzymes that synthesize carbamyl aspartate. The mechanism of carbamyl aspartate toxicity was not identified, but many potential sites of growth inhibition were excluded. Carbamyl aspartate toxicity was shown to be useful as a phenotypic trait for classifying pyrimidine auxotrophs and may also be useful for positive selection of pyrA or pyrB mutants. Finally, we discuss ways of overcoming growth inhibition of pyrC and pyrD mutants under derepressing conditions. PMID:3894327

  13. Distribution of. delta. -aminolevulinic acid biosynthetic pathways among phototrophic and related bacteria

    SciTech Connect

    Avissar, Y.J.; Beale, S.I. ); Ormerod, J.G. )

    1989-04-01

    Two biosynthetic pathways are known for the universal tetrapyrrole precursor, {delta}-aminolevulinic acid (ALA): condensation of glycine and succinyl-CoA to form ALA with the loss of C-1 of glycine as CO{sub 2}, and conversion of the intact carbon skeleton of glutamate to ALA in a process requiring tRNA{sup Glu}, ATP, Mg{sup 2+}, NADPH, and pyridoxal phosphate. The distribution of the two ALA biosynthetic pathways among various bacterial genera was determined, using cell-free extracts obtained from representative organisms. Evidence for the operation of the glutamate pathway was obtained by the measurement of RNase-sensitive label incorporation from glutamate into ALA using 3,4-({sup 3}H)glutamate and 1-({sup 14}C)glutamate as substrate. The glycine pathway was indicated by RNase-insensitive incorporation of level from 2-({sup 14}C)glycine into ALA. The distribution of the two pathways among the bacteria tested was in general agreement with their previously phylogenetic relationships and clearly indicates that the glutamate pathway is the more ancient process, whereas the glycine pathway probably evolved much later. The glutamate pathway is the more widely utilized one among bacteria, while the glycine pathway is apparently limited to the {alpha} subgroup of purple bacteria (including Rhodobacter, Rhodospirillum, and Rhizobium). E. coli was found ALA via the glutamate pathway. The ALA-requiring hemA mutant of E. coli was determined to lack the dehydrogenase activity that utilizes glutamyl-tRNA as a substrate.

  14. Isolation and characterization of meridamycin biosynthetic gene cluster from Streptomyces sp. NRRL 30748.

    PubMed

    He, Min; Haltli, Bradley; Summers, Mia; Feng, Xidong; Hucul, John

    2006-08-01

    Meridamycin is a non-immunosuppressive, FKBP12-binding natural macrolide with potential therapeutic applications in a variety of medical conditions. To set the stage for structural modification of meridamycin by genetic engineering, we have cloned and completely sequenced approximately 117 kb of DNA encompassing the meridamycin biosynthetic gene cluster from the producing strain, Streptomyces sp. NRRL 30748. Clustered in the center of the cloned DNA stretch are six genes responsible for the construction of the core structure of meridamycin, including merP encoding a non-ribosomal peptide synthase for pipecolate-incorporation, four PKS genes (merA-D) together encoding 1 loading module and 14 extension modules, and merE encoding a cytochrome P450 monooxygenase. A number of genes with potential pathway-specific regulatory or resistance functions have also been identified. The absence of the gene encoding lysine cyclodeaminase in the sequenced gene cluster and the rest of the genome of NRRL 30748 indicated the synthesis of pipecolate in this strain is not through the common lysine cyclodeamination route previously described for rapamycin and FK506/FK520 biosynthesis. An efficient conjugation method has been developed for Streptomyces sp. NRRL 30748 to facilitate the genetic manipulation of meridamycin biosynthetic gene cluster. Disruption of merP resulted in the complete abolition of meridamycin production, proving the identity of the gene cluster. A novel meridamycin analogue, C36-keto-meridamycin, has been successfully generated through deletion of a DNA fragment encoding KR1 domain of MerA from the chromosomal DNA. PMID:16806745

  15. Role of a Microcin-C–like biosynthetic gene cluster in allelopathic interactions in marine Synechococcus

    PubMed Central

    Paz-Yepes, Javier; Brahamsha, Bianca; Palenik, Brian

    2013-01-01

    Competition between phytoplankton species for nutrients and light has been studied for many years, but allelopathic interactions between them have been more difficult to characterize. We used liquid and plate assays to determine whether these interactions occur between marine unicellular cyanobacteria of the genus Synechococcus. We have found a clear growth impairment of Synechococcus sp. CC9311 and Synechococcus sp. WH8102 when they are cultured in the presence of Synechococcus sp. CC9605. The genome of CC9605 contains a region showing homology to genes of the Escherichia coli Microcin C (McC) biosynthetic pathway. McC is a ribosome-synthesized peptide that inhibits translation in susceptible strains. We show that the CC9605 McC gene cluster is expressed and that three genes (mccD, mccA, and mccB) are further induced by coculture with CC9311. CC9605 was resistant to McC purified from E. coli, whereas strains CC9311 and WH8102 were sensitive. Cloning the CC9605 McC biosynthetic gene cluster into sensitive CC9311 led this strain to become resistant to both purified E. coli McC and Synechococcus sp. CC9605. A CC9605 mutant lacking mccA1, mccA2, and the N-terminal domain of mccB did not inhibit CC9311 growth, whereas the inhibition of WH8102 was reduced. Our results suggest that an McC-like molecule is involved in the allelopathic interactions with CC9605. PMID:23818639

  16. Characterization of the CDP-2-Glycerol Biosynthetic Pathway in Streptococcus pneumoniae▿ †

    PubMed Central

    Wang, Quan; Xu, Yanli; Perepelov, Andrei V.; Xiong, Wei; Wei, Dongmei; Shashkov, Alexander S.; Knirel, Yuriy A.; Feng, Lu; Wang, Lei

    2010-01-01

    Capsule polysaccharide (CPS) plays an important role in the virulence of Streptococcus pneumoniae and is usually used as the pneumococcal vaccine target. Glycerol-2-phosphate is found in the CPS of S. pneumoniae types 15A and 23F and is rarely found in the polysaccharides of other bacteria. The biosynthetic pathway of the nucleotide-activated form of glycerol-2-phosphate (NDP-2-glycerol) has never been identified. In this study, three genes (gtp1, gtp2, and gtp3) from S. pneumoniae 23F that have been proposed to be involved in the synthesis of NDP-2-glycerol were cloned and the enzyme products were expressed, purified, and assayed for their respective activities. Capillary electrophoresis was used to detect novel products from the enzyme-substrate reactions, and the structure of the product was elucidated using electrospray ionization mass spectrometry and nuclear magnetic resonance spectroscopy. Gtp1 was identified as a reductase that catalyzes the conversion of 1,3-dihydroxyacetone to glycerol, Gtp3 was identified as a glycerol-2-phosphotransferase that catalyzes the conversion of glycerol to glycerol-2-phosphate, and Gtp2 was identified as a cytidylyltransferase that transfers CTP to glycerol-2-phosphate to form CDP-2-glycerol as the final product. The kinetic parameters of Gtp1 and Gtp2 were characterized in depth, and the effects of temperature, pH, and cations on these two enzymes were analyzed. This is the first time that the biosynthetic pathway of CDP-2-glycerol has been identified biochemically; this pathway provides a method to enzymatically synthesize this compound. PMID:20729354

  17. Betacyanin Biosynthetic Genes and Enzymes Are Differentially Induced by (a)biotic Stress in Amaranthus hypochondriacus

    PubMed Central

    Casique-Arroyo, Gabriela; Martínez-Gallardo, Norma; González de la Vara, Luis; Délano-Frier, John P.

    2014-01-01

    An analysis of key genes and enzymes of the betacyanin biosynthetic pathway in Amaranthus hypochondriacus (Ah) was performed. Complete cDNA sequence of Ah genes coding for cyclo-DOPA 5-O glucosyltransferase (AhcDOPA5-GT), two 4, 5-DOPA-extradiol-dioxygenase isoforms (AhDODA-1 and AhDODA-2, respectively), and a betanidin 5-O-glucosyltransferase (AhB5-GT), plus the partial sequence of an orthologue of the cytochrome P-450 R gene (CYP76AD1) were obtained. With the exception AhDODA-2, which had a closer phylogenetic relationship to DODA-like genes in anthocyanin-synthesizing plants, all genes analyzed closely resembled those reported in related Caryophyllales species. The measurement of basal gene expression levels, in addition to the DOPA oxidase tyrosinase (DOT) activity, in different tissues of three Ah genotypes having contrasting pigmentation levels (green to red-purple) was determined. Additional analyses were performed in Ah plants subjected to salt and drought stress and to two different insect herbivory regimes. Basal pigmentation accumulation in leaves, stems and roots of betacyanic plants correlated with higher expression levels of AhDODA-1 and AhB5-GT, whereas DOT activity levels coincided with pigment accumulation in stems and roots and with the acyanic nature of green plants, respectively, but not with pigmentation in leaves. Although the abiotic stress treatments tested produced changes in pigment levels in different tissues, pigment accumulation was the highest in leaves and stems of drought stressed betacyanic plants, respectively. However, tissue pigment accumulation in stressed Ah plants did not always correlate with betacyanin biosynthetic gene expression levels and/or DOT activity. This effect was tissue- and genotype-dependent, and further suggested that other unexamined factors were influencing pigment content in stressed Ah. The results obtained from the insect herbivory assays, particularly in acyanic plants, also support the proposal that

  18. Evolutionary Conservation of Xylan Biosynthetic Genes in Selaginella moellendorffii and Physcomitrella patens.

    PubMed

    Haghighat, Marziyeh; Teng, Quincy; Zhong, Ruiqin; Ye, Zheng-Hua

    2016-08-01

    Xylan is a major cross-linking hemicellulose in secondary walls of vascular tissues, and the recruitment of xylan as a secondary wall component was suggested to be a pivotal event for the evolution of vascular tissues. To decipher the evolution of xylan structure and xylan biosynthetic genes, we analyzed xylan substitution patterns and characterized genes mediating methylation of glucuronic acid (GlcA) side chains in xylan of the model seedless vascular plant, Selaginella moellendorffii, and investigated GT43 genes from S. moellendorffii and the model non-vascular plant, Physcomitrella patens, for their roles in xylan biosynthesis. Using nuclear magentic resonance spectroscopy, we have demonstrated that S. moellendorffii xylan consists of β-1,4-linked xylosyl residues subsituted solely with methylated GlcA residues and that xylans from both S. moellendorffii and P. patens are acetylated at O-2 and O-3. To investigate genes responsible for GlcA methylation of xylan, we identified two DUF579 genes in the S. moellendorffii genome and showed that one of them, SmGXM, encodes a glucuronoxylan methyltransferase capable of adding the methyl group onto the GlcA side chain of xylooligomers. Furthermore, we revealed that the two GT43 genes in S. moellendorffii, SmGT43A and SmGT43B, are functional orthologs of the Arabidopsis xylan backbone biosynthetic genes IRX9 and IRX14, respectively, indicating the evolutionary conservation of the involvement of two functionally non-redundant groups of GT43 genes in xylan backbone biosynthesis between seedless and seed vascular plants. Among the five GT43 genes in P. patens, PpGT43A was found to be a functional ortholog of Arabidopsis IRX9, suggesting that the recruitment of GT43 genes in xylan backbone biosynthesis occurred when non-vascular plants appeared on land. PMID:27345025

  19. Metabolic engineering of the omega-3 long chain polyunsaturated fatty acid biosynthetic pathway into transgenic plants.

    PubMed

    Ruiz-López, Noemi; Sayanova, Olga; Napier, Johnathan A; Haslam, Richard P

    2012-04-01

    Omega-3 (ω-3) very long chain polyunsaturated fatty acids (VLC-PUFAs) such as eicosapentaenoic acid (EPA; 20:5 Δ5,8,11,14,17) and docosahexaenoic acid (DHA; 22:6 Δ4,7,10,13,16,19) have been shown to have significant roles in human health. Currently the primary dietary source of these fatty acids are marine fish; however, the increasing demand for fish and fish oil (in particular the expansion of the aquaculture industry) is placing enormous pressure on diminishing marine stocks. Such overfishing and concerns related to pollution in the marine environment have directed research towards the development of a viable alternative sustainable source of VLC-PUFAs. As a result, the last decade has seen many genes encoding the primary VLC-PUFA biosynthetic activities identified and characterized. This has allowed the reconstitution of the VLC-PUFA biosynthetic pathway in oilseed crops, producing transgenic plants engineered to accumulate ω-3 VLC-PUFAs at levels approaching those found in native marine organisms. Moreover, as a result of these engineering activities, knowledge of the fundamental processes surrounding acyl exchange and lipid remodelling has progressed. The application of new technologies, for example lipidomics and next-generation sequencing, is providing a better understanding of seed oil biosynthesis and opportunities for increasing the production of unusual fatty acids. Certainly, it is now possible to modify the composition of plant oils successfully, and, in this review, the most recent developments in this field and the challenges of producing VLC-PUFAs in the seed oil of higher plants will be described. PMID:22291131

  20. Assembly of Lipoic Acid on Its Cognate Enzymes: an Extraordinary and Essential Biosynthetic Pathway.

    PubMed

    Cronan, John E

    2016-06-01

    Although the structure of lipoic acid and its role in bacterial metabolism were clear over 50 years ago, it is only in the past decade that the pathways of biosynthesis of this universally conserved cofactor have become understood. Unlike most cofactors, lipoic acid must be covalently bound to its cognate enzyme proteins (the 2-oxoacid dehydrogenases and the glycine cleavage system) in order to function in central metabolism. Indeed, the cofactor is assembled on its cognate proteins rather than being assembled and subsequently attached as in the typical pathway, like that of biotin attachment. The first lipoate biosynthetic pathway determined was that of Escherichia coli, which utilizes two enzymes to form the active lipoylated protein from a fatty acid biosynthetic intermediate. Recently, a more complex pathway requiring four proteins was discovered in Bacillus subtilis, which is probably an evolutionary relic. This pathway requires the H protein of the glycine cleavage system of single-carbon metabolism to form active (lipoyl) 2-oxoacid dehydrogenases. The bacterial pathways inform the lipoate pathways of eukaryotic organisms. Plants use the E. coli pathway, whereas mammals and fungi probably use the B. subtilis pathway. The lipoate metabolism enzymes (except those of sulfur insertion) are members of PFAM family PF03099 (the cofactor transferase family). Although these enzymes share some sequence similarity, they catalyze three markedly distinct enzyme reactions, making the usual assignment of function based on alignments prone to frequent mistaken annotations. This state of affairs has possibly clouded the interpretation of one of the disorders of human lipoate metabolism. PMID:27074917

  1. Characterization of dihydro-A2PE: an Intermediate in the A2E Biosynthetic Pathway†

    PubMed Central

    Kim, So R.; He, Jiangtao; Yanase, Emiko; Jang, Young P.; Berova, Nina; Nakanishi, Koji; Sparrow, Janet R.

    2008-01-01

    Bisretinoid lipofuscin pigments that accumulate in retinal pigment epithelial cells are implicated in the etiology of several forms of macular degeneration including juvenile onset Stargardt disease, Best vitelliform macular degeneration and age-related macular degeneration. One of these compounds, A2E, is generated by phosphate hydrolysis of a phosphatidylpyridinium bisretinoid (A2PE) that forms within photoreceptor outer segments. Here we demonstrate that the formation of the aromatic pyridinium ring of A2PE follows from the oxidation of a dihydropyridinium intermediate. Time-dependent density functional theory calculation, based on the structure of dihydro-A2E, produced a simulated UV-visible absorbance spectrum characterized by maxima of 494 and 344 nm. Subsequently, a compound exhibiting similar UV-visible absorbance maxima (λmax 490 and 330 nm) was identified in the A2E biomimetic reaction mixture. By liquid chromatography-mass spectrometry (LC-MS) this bischromophore had the expected mass of the dihydro-pyridinium bisretinoid. The compound also exhibited the behavior of a biosynthetic intermediate, since it formed in advance of the final product A2E and was consumed as A2E accumulated. Moreover, under deoxygenated conditions, conversion to the aromatic pyridinium bisretinoid was inhibited. Taken together, these findings indicate that A2E biosynthesis involves the oxidation of a dihydropyridinium intermediate dihydro-A2PE. An understanding of the biosynthetic pathways of retinal pigment epithelial lipofuscin pigments is critical to the development of therapies for macular degeneration that are based on limiting the formation of these damaging compounds. PMID:17685561

  2. Analysis and manipulation of amphotericin biosynthetic genes by means of modified phage KC515 transduction techniques.

    PubMed

    Carmody, Maria; Byrne, Barry; Murphy, Barry; Breen, Ciaran; Lynch, Susan; Flood, Elizabeth; Finnan, Shirley; Caffrey, Patrick

    2004-12-01

    Amphotericin B is a medically important antifungal antibiotic that is produced by Streptomyces nodosus. Genetic manipulation of this organism has led to production of the first amphotericin analogues by engineered biosynthesis. Here, these studies were extended by sequencing the chromosomal regions flanking the amphotericin polyketide synthase genes, and by refining the phage KC515 transduction method for disruption and replacement of S. nodosus genes. A hybrid vector was constructed from KC515 DNA and the Escherichia coli plasmid pACYC177. This vector replicated as a plasmid in E. coli and the purified DNA yielded phage plaques on Streptomyces lividans after polyethylene glycol (PEG)-mediated transfection of protoplasts. The left flank of the amphotericin gene cluster was found to include amphRI, RII, RIII and RIV genes that are similar to regulatory genes in other polyene biosynthetic gene clusters. One of these regulatory genes, amphRI, was found to have a homologue, amphRVI, located in the right flank at a distance of 127 kbp along the chromosome. However, disruption of amphRVI using the hybrid vector had no effect on the yield of amphotericin obtained from cultures grown on production medium. The hybrid vector was also used for precise deletion of the DNA coding for two modules of the AmphC polyketide synthase protein. Analysis by UV spectrophotometry revealed that the deletion mutant produced a novel pentaene, with reduced antifungal activity but apparently greater water-solubility than amphotericin B. This shows the potential for use of the new vector in engineering of this and other biosynthetic pathways in Streptomyces. PMID:15563836

  3. Exopolysaccharide biosynthetic glycoside hydrolases can be utilized to disrupt and prevent Pseudomonas aeruginosa biofilms

    PubMed Central

    Baker, Perrin; Hill, Preston J.; Snarr, Brendan D.; Alnabelseya, Noor; Pestrak, Matthew J.; Lee, Mark J.; Jennings, Laura K.; Tam, John; Melnyk, Roman A.; Parsek, Matthew R.; Sheppard, Donald C.; Wozniak, Daniel J.; Howell, P. Lynne

    2016-01-01

    Bacterial biofilms present a significant medical challenge because they are recalcitrant to current therapeutic regimes. A key component of biofilm formation in the opportunistic human pathogen Pseudomonas aeruginosa is the biosynthesis of the exopolysaccharides Pel and Psl, which are involved in the formation and maintenance of the structural biofilm scaffold and protection against antimicrobials and host defenses. Given that the glycoside hydrolases PelAh and PslGh encoded in the pel and psl biosynthetic operons, respectively, are utilized for in vivo exopolysaccharide processing, we reasoned that these would provide specificity to target P. aeruginosa biofilms. Evaluating these enzymes as potential therapeutics, we demonstrate that these glycoside hydrolases selectively target and degrade the exopolysaccharide component of the biofilm matrix. PelAh and PslGh inhibit biofilm formation over a 24-hour period with a half maximal effective concentration (EC50) of 69.3 ± 1.2 and 4.1 ± 1.1 nM, respectively, and are capable of disrupting preexisting biofilms in 1 hour with EC50 of 35.7 ± 1.1 and 12.9 ± 1.1 nM, respectively. This treatment was effective against clinical and environmental P. aeruginosa isolates and reduced biofilm biomass by 58 to 94%. These noncytotoxic enzymes potentiated antibiotics because the addition of either enzyme to a sublethal concentration of colistin reduced viable bacterial counts by 2.5 orders of magnitude when used either prophylactically or on established 24-hour biofilms. In addition, PelAh was able to increase neutrophil killing by ~50%. This work illustrates the feasibility and benefits of using bacterial exopolysaccharide biosynthetic glycoside hydrolases to develop novel antibiofilm therapeutics. PMID:27386527

  4. Amylopectin biosynthetic enzymes from developing rice seed form enzymatically active protein complexes.

    PubMed

    Crofts, Naoko; Abe, Natsuko; Oitome, Naoko F; Matsushima, Ryo; Hayashi, Mari; Tetlow, Ian J; Emes, Michael J; Nakamura, Yasunori; Fujita, Naoko

    2015-08-01

    Amylopectin is a highly branched, organized cluster of glucose polymers, and the major component of rice starch. Synthesis of amylopectin requires fine co-ordination between elongation of glucose polymers by soluble starch synthases (SSs), generation of branches by branching enzymes (BEs), and removal of misplaced branches by debranching enzymes (DBEs). Among the various isozymes having a role in amylopectin biosynthesis, limited numbers of SS and BE isozymes have been demonstrated to interact via protein-protein interactions in maize and wheat amyloplasts. This study investigated whether protein-protein interactions are also found in rice endosperm, as well as exploring differences between species. Gel permeation chromatography of developing rice endosperm extracts revealed that all 10 starch biosynthetic enzymes analysed were present at larger molecular weights than their respective monomeric sizes. SSIIa, SSIIIa, SSIVb, BEI, BEIIb, and PUL co-eluted at mass sizes >700kDa, and SSI, SSIIa, BEIIb, ISA1, PUL, and Pho1 co-eluted at 200-400kDa. Zymogram analyses showed that SSI, SSIIIa, BEI, BEIIa, BEIIb, ISA1, PUL, and Pho1 eluted in high molecular weight fractions were active. Comprehensive co-immunoprecipitation analyses revealed associations of SSs-BEs, and, among BE isozymes, BEIIa-Pho1, and pullulanase-type DBE-BEI interactions. Blue-native-PAGE zymogram analyses confirmed the glucan-synthesizing activity of protein complexes. These results suggest that some rice starch biosynthetic isozymes are physically associated with each other and form active protein complexes. Detailed analyses of these complexes will shed light on the mechanisms controlling the unique branch and cluster structure of amylopectin, and the physicochemical properties of starch. PMID:25979995

  5. A novel interaction linking the FAS-II and phthiocerol dimycocerosate (PDIM) biosynthetic pathways.

    PubMed

    Kruh, Nicole A; Borgaro, Janine G; Ruzsicska, Béla P; Xu, Hua; Tonge, Peter J

    2008-11-14

    The fatty acid biosynthesis (FAS-II) pathway in Mycobacterium tuberculosis generates long chain fatty acids that serve as the precursors to mycolic acids, essential components of the mycobacterial cell wall. Enzymes in the FAS-II pathway are thought to form one or more noncovalent multi-enzyme complexes within the cell, and a bacterial two-hybrid screen was used to search for missing components of the pathway and to furnish additional data on interactions involving these enzymes in vivo. Using the FAS-II beta-ketoacyl synthase, KasA, as bait, an extensive bacterial two-hybrid screen of a M. tuberculosis genome fragment library unexpectedly revealed a novel interaction between KasA and PpsB as well as PpsD, two polyketide modules involved in the biosynthesis of the virulence lipid phthiocerol dimycocerosate (PDIM). Sequence analysis revealed that KasA interacts with PpsB and PpsD in the region of the acyl carrier domain of each protein, raising the possibility that lipids could be transferred between the FAS-II and PDIM biosynthetic pathways. Subsequent studies utilizing purified proteins and radiolabeled lipids revealed that fatty acids loaded onto PpsB were transferred to KasA and also incorporated into long chain fatty acids synthesized using a Mycobacterium smegmatis lysate. These data suggest that in addition to producing PDIMs, the growing phthiocerol product can also be shuttled into the FAS-II pathway via KasA as an entry point for further elongation. Interactions between these biosynthetic pathways may exist as a simple means to increase mycobacterial lipid diversity, enhancing functionality and the overall complexity of the cell wall. PMID:18703500

  6. Narrow-spectrum inhibitors targeting an alternative menaquinone biosynthetic pathway of Helicobacter pylori.

    PubMed

    Yamamoto, Tsuyoshi; Matsui, Hidenori; Yamaji, Kenzaburo; Takahashi, Tetsufumi; Øverby, Anders; Nakamura, Masahiko; Matsumoto, Atsuko; Nonaka, Kenichi; Sunazuka, Toshiaki; Ōmura, Satoshi; Nakano, Hirofumi

    2016-09-01

    We aimed to identify narrow-spectrum natural compounds that specifically inhibit an alternative menaquinone (MK; vitamin K2) biosynthetic pathway (the futalosine pathway) of Helicobacter pylori. Culture broth samples of 6183 microbes were examined using the paper disc method with different combinations of 2 of the following 3 indicator microorganisms: Bacillus halodurans C-125 and Kitasatospora setae KM-6054(T), which have only the futalosine pathway of MK biosynthesis, and Bacillus subtilis H17, which has only the canonical MK biosynthetic pathway. Most of the active compounds isolated from culture broth samples were from the families of polyunsaturated fatty acids (PUFAs). Only one compound isolated from the culture broth of Streptomyces sp. K12-1112, siamycin I (a 21-residue lasso peptide antibiotic), targeted the futalosine pathway. The inhibitory activities of representative PUFAs and siamycin I against the growth of B. halodurans or K. setae were abrogated by supplementation with MK. Thereafter, the growth of H. pylori strains SS1 and TN2GF4 in broth cultures was dose-dependently suppressed by eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), or siamycin I, and these inhibitory effects were reduced by supplementation with MK. Daily administration of EPA (100 μM), DHA (100 μM), or siamycin I (2.5 μM) in drinking water reduced the H. pylori SS1 colonization in the gastric mucosa of C57BL/6 mice by 96%, 78%, and 68%, respectively. These data suggest that EPA, DHA, and siamycin I prevented H. pylori infection by inhibiting the futalosine pathway of MK biosynthesis. PMID:27346378

  7. Amylopectin biosynthetic enzymes from developing rice seed form enzymatically active protein complexes

    PubMed Central

    Crofts, Naoko; Abe, Natsuko; Oitome, Naoko F.; Matsushima, Ryo; Hayashi, Mari; Tetlow, Ian J.; Emes, Michael J.; Nakamura, Yasunori; Fujita, Naoko

    2015-01-01

    Amylopectin is a highly branched, organized cluster of glucose polymers, and the major component of rice starch. Synthesis of amylopectin requires fine co-ordination between elongation of glucose polymers by soluble starch synthases (SSs), generation of branches by branching enzymes (BEs), and removal of misplaced branches by debranching enzymes (DBEs). Among the various isozymes having a role in amylopectin biosynthesis, limited numbers of SS and BE isozymes have been demonstrated to interact via protein–protein interactions in maize and wheat amyloplasts. This study investigated whether protein–protein interactions are also found in rice endosperm, as well as exploring differences between species. Gel permeation chromatography of developing rice endosperm extracts revealed that all 10 starch biosynthetic enzymes analysed were present at larger molecular weights than their respective monomeric sizes. SSIIa, SSIIIa, SSIVb, BEI, BEIIb, and PUL co-eluted at mass sizes >700kDa, and SSI, SSIIa, BEIIb, ISA1, PUL, and Pho1 co-eluted at 200–400kDa. Zymogram analyses showed that SSI, SSIIIa, BEI, BEIIa, BEIIb, ISA1, PUL, and Pho1 eluted in high molecular weight fractions were active. Comprehensive co-immunoprecipitation analyses revealed associations of SSs–BEs, and, among BE isozymes, BEIIa–Pho1, and pullulanase-type DBE–BEI interactions. Blue-native-PAGE zymogram analyses confirmed the glucan-synthesizing activity of protein complexes. These results suggest that some rice starch biosynthetic isozymes are physically associated with each other and form active protein complexes. Detailed analyses of these complexes will shed light on the mechanisms controlling the unique branch and cluster structure of amylopectin, and the physicochemical properties of starch. PMID:25979995

  8. Stress and developmental responses of terpenoid biosynthetic genes in Cistus creticus subsp. creticus.

    PubMed

    Pateraki, Irene; Kanellis, Angelos K

    2010-06-01

    Plants, and specially species adapted in non-friendly environments, produce secondary metabolites that help them to cope with biotic or abiotic stresses. These metabolites could be of great pharmaceutical interest because several of those show cytotoxic, antibacterial or antioxidant activities. Leaves' trichomes of Cistus creticus ssp. creticus, a Mediterranean xerophytic shrub, excrete a resin rich in several labdane-type diterpenes with verified in vitro and in vivo cytotoxic and cytostatic activity against human cancer cell lines. Bearing in mind the properties and possible future exploitation of these natural products, it seemed interesting to study their biosynthesis and its regulation, initially at the molecular level. For this purpose, genes encoding enzymes participating in the early steps of the terpenoids biosynthetic pathways were isolated and their gene expression patterns were investigated in different organs and in response to various stresses and defence signals. The genes studied were the CcHMGR from the mevalonate pathway, CcDXS and CcDXR from the methylerythritol 4-phosphate pathway and the two geranylgeranyl diphosphate synthases (CcGGDPS1 and 2) previously characterized from this species. The present work indicates that the leaf trichomes are very active biosynthetically as far as it concerns terpenoids biosynthesis, and the terpenoid production from this tissue seems to be transcriptionally regulated. Moreover, the CcHMGR and CcDXS genes (the rate-limiting steps of the isoprenoids' pathways) showed an increase during mechanical wounding and application of defence signals (like meJA and SA), which is possible to reflect an increased need of the plant tissues for the corresponding metabolites. PMID:20364257

  9. A methylated Neurospora 5S rRNA pseudogene contains a transposable element inactivated by repeat-induced point mutation.

    PubMed Central

    Margolin, B S; Garrett-Engele, P W; Stevens, J N; Fritz, D Y; Garrett-Engele, C; Metzenberg, R L; Selker, E U

    1998-01-01

    In an analysis of 22 of the roughly 100 dispersed 5S rRNA genes in Neurospora crassa, a methylated 5S rRNA pseudogene, Psi63, was identified. We characterized the Psi63 region to better understand the control and function of DNA methylation. The 120-bp 5S rRNA-like region of Psi63 is interrupted by a 1.9-kb insertion that has characteristics of sequences that have been modified by repeat-induced point mutation (RIP). We found sequences related to this insertion in wild-type strains of N. crassa and other Neurospora species. Most showed evidence of RIP; but one, isolated from the N. crassa host of Psi63, showed no evidence of RIP. A deletion from near the center of this sequence apparently rendered it incapable of participating in RIP with the related full-length copies. The Psi63 insertion and the related sequences have features of transposons and are related to the Fot1 class of fungal transposable elements. Apparently Psi63 was generated by insertion of a previously unrecognized Neurospora transposable element into a 5S rRNA gene, followed by RIP. We name the resulting inactivated Neurospora transposon PuntRIP1 and the related sequence showing no evidence of RIP, but harboring a deletion that presumably rendered it defective for transposition, dPunt. PMID:9691037

  10. Distribution of 5-methylcytosine residues in 5S rRNA genes in Arabidopsis thaliana and Secale cereale.

    PubMed

    Fulnecek, J; Matyásek, R; Kovarík, A

    2002-12-01

    Bisulfite genomic sequencing was used to localise 5-methylcytosine residues (mC) in 5S rRNA genes of Arabidopsis thaliana and Secale cereale. The maps of mC distribution were compared with the previously published map of the corresponding region in Nicotiana tabacum. In all three species, the level of methylation of 5S rRNA genes was generally higher than the average for the entire genome. The ratio of 5S rDNA methylation to average overall methylation was 44%/30-33% for N. tabacum, 27%/4-6% for A. thaliana and 24%/20-22% for S. cereale. With the exception of one clone from S. cereale, no methylation-free 5S rDNA was detected. The level of methylation at different sequence motifs in 5S rDNA was calculated for N. tabacum/A. thaliana/ S. cereale, and this analysis yielded the following values (expressed as a percentage of total C): mCG 90%/78%/85%, mCWG 89%/41%/53%, mCmCG 72%/32%/16%, mCCG 4%/2%/0%, mCHH 15%/6%/1%, where W=A or T, and H=A or C or T. Non-symmetrical methylation was almost negligible in the large genome of S. cereale but relatively frequent in N. tabacum and A. thaliana, suggesting that the strict correlation between genome size and cytosine methylation might be violated for this type of methylation. Among non-symmetrical motifs the mCWA triplets were significantly over-represented in Arabidopsis, while in tobacco this preference was not as pronounced. The differences in methylation levels in different sequence contexts might be of phylogenetic significance, but further species in related and different taxa need to be studied before firm conclusions can be drawn. PMID:12471448

  11. Diversity of Culturable Thermophilic Actinobacteria in Hot Springs in Tengchong, China and Studies of their Biosynthetic Gene Profiles.

    PubMed

    Liu, Lan; Salam, Nimaichand; Jiao, Jian-Yu; Jiang, Hong-Chen; Zhou, En-Min; Yin, Yi-Rui; Ming, Hong; Li, Wen-Jun

    2016-07-01

    The class Actinobacteria has been a goldmine for the discovery of antibiotics and has attracted interest from both academics and industries. However, an absence of novel approaches during the last few decades has limited the discovery of new microbial natural products useful for industries. Scientists are now focusing on the ecological aspects of diverse environments including unexplored or underexplored habitats and extreme environments in the search for new metabolites. This paper reports on the diversity of culturable actinobacteria associated with hot springs located in Tengchong County, Yunnan Province, southwestern China. A total of 58 thermophilic actinobacterial strains were isolated from the samples collected from ten hot springs distributed over three geothermal fields (e.g., Hehua, Rehai, and Ruidian). Phylogenetic positions and their biosynthetic profiles were analyzed by sequencing 16S rRNA gene and three biosynthetic gene clusters (KS domain of PKS-I, KSα domain of PKS-II and A domain of NRPS). On the basis of 16S rRNA gene phylogenetic analysis, the 58 strains were affiliated with 12 actinobacterial genera: Actinomadura Micromonospora, Microbispora, Micrococcus, Nocardiopsis, Nonomuraea, Promicromonospora, Pseudonocardia, Streptomyces, Thermoactinospora, Thermocatellispora, and Verrucosispora, of which the two novel genera Thermoactinospora and Thermocatellisopora were recently described from among these strains. Considering the biosynthetic potential of these actinobacterial strains, 22 were positive for PCR amplification of at least one of the three biosynthetic gene clusters (PKS-I, PKS-II, and NRPS). These actinobacteria were further subjected to antimicrobial assay against five opportunistic human pathogens (Acinetobacter baumannii, Escherichia coli, Micrococcus luteus, Staphylococcus aureus and Streptococcus faecalis). All of the 22 strains that were positive for PCR amplification of at least one of the biosynthetic gene domains exhibited

  12. Identification of flavonoids and expression of flavonoid biosynthetic genes in two coloured tree peony flowers.

    PubMed

    Zhao, Daqiu; Tang, Wenhui; Hao, Zhaojun; Tao, Jun

    2015-04-10

    Tree peony (Paeonia suffruticosa Andr.) has been named the "king of flowers" because of its elegant and gorgeous flower colour. Among these colours, the molecular mechanisms of white formation and how white turned to red in P. suffruticosa is little known. In this study, flower colour variables, flavonoid accumulation and expression of flavonoid biosynthetic genes of white ('Xueta') and red ('Caihui') P. suffruticosa were investigated. The results showed that the flower colours of both cultivars were gradually deepened with the development of flowers. Moreover, two anthoxanthin compositions apigenin 7-O-glucoside together with apigenin deoxyheso-hexoside were identified in 'Xueta' and 'Caihui', but one main anthocyanin composition peonidin 3,5-di-O-glucoside (Pn3G5G) was only found in 'Caihui'. Total contents of anthocyanins in 'Caihui' was increased during flower development, and the same trend was presented in anthoxanthins and flavonoids of these two cultivars, but the contents of these two category flavonoid in 'Caihui' were always higher than those in 'Xueta'. Furthermore, nine structural genes in flavonoid biosynthetic pathway were isolated including the full-length cDNAs of phenylalanine ammonialyase gene (PAL), chalcone synthase gene (CHS) and chalcone isomerase gene (CHI), together with the partial-length cDNAs of flavanone 3-hydroxylase gene (F3H), flavonoid 3'-hydroxylase gene (F3'H), dihydroflavonol 4-reductase gene (DFR), anthocyanidin synthase gene (ANS), UDP-glucose: flavonoid 3-O-glucosyltransferase gene (UF3GT) and UDP-glucose: flavonoid 5-O-glucosyltransferase gene (UF5GT), and PAL, UF3GT and UF5GT were reported in P. suffruticosa for the first time. Their expression patterns showed that transcription levels of downstream genes in 'Caihui' were basically higher than those in 'Xueta', especially PsDFR and PsANS, suggesting that these two genes may play a key role in the anthocyanin biosynthesis which resulted in the shift from white to red in

  13. Dual Role of a Biosynthetic Enzyme, CysK, in Contact Dependent Growth Inhibition in Bacteria

    PubMed Central

    Kaundal, Soni; Uttam, Manju; Thakur, Krishan Gopal

    2016-01-01

    Contact dependent growth inhibition (CDI) is the phenomenon where CDI+ bacterial strain (inhibitor) inhibits the growth of CDI−strain (target) by direct cell to cell contact. CDI is mediated by cdiBAI gene cluster where CdiB facilitates the export of CdiA, an exotoxin, on the cell surface and CdiI acts as an immunity protein to protect CDI+ cells from autoinhibition. CdiA-CT, the C-terminal region of the toxin CdiA, from uropathogenic Escherichia coli strain 536 (UPEC536) is a latent tRNase that requires binding of a biosynthetic enzyme CysK (O-acetylserine sulfyhydrylase) for activation in the target cells. CdiA-CT can also interact simultaneously with CysK and immunity protein, CdiI, to form a ternary complex in UPEC536. But the role of CysK in the ternary complex is not clear. We studied the hydrodynamic, thermodynamic and kinetic parameters of binary and ternary complexes using AUC, ITC and SPR respectively, to investigate the role of CysK in UPEC536. We report that CdiA-CT binds CdiI and CysK with nanomolar range affinity. We further report that binding of CysK to CdiA-CT improves its affinity towards CdiI by ~40 fold resulting in the formation of a more stable complex with over ~130 fold decrease in dissociation rate. Thermal melting experiments also suggest the role of CysK in stabilizing CdiA-CT/CdiI complex as Tm of the binary complex shifts ~10°C upon binding CysK. Hence, CysK acts a modulator of CdiA-CT/CdiI interactions by stabilizing CdiA-CT/CdiI complex and may play a crucial role in preventing autoinhibition in UPEC536. This study reports a new moonlighting function of a biosynthetic enzyme, CysK, as a modulator of toxin/immunity interactions in UPEC536 inhibitor cells. PMID:27458806

  14. Evidence for land plant cell wall biosynthetic mechanisms in charophyte green algae

    PubMed Central

    Mikkelsen, Maria D.; Harholt, Jesper; Ulvskov, Peter; Johansen, Ida E.; Fangel, Jonatan U.; Doblin, Monika S.; Bacic, Antony; Willats, William G. T.

    2014-01-01

    Background and Aims The charophyte green algae (CGA) are thought to be the closest living relatives to the land plants, and ancestral CGA were unique in giving rise to the land plant lineage. The cell wall has been suggested to be a defining structure that enabled the green algal ancestor to colonize land. These cell walls provide support and protection, are a source of signalling molecules, and provide developmental cues for cell differentiation and elongation. The cell wall of land plants is a highly complex fibre composite, characterized by cellulose cross-linked by non-cellulosic polysaccharides, such as xyloglucan, embedded in a matrix of pectic polysaccharides. How the land plant cell wall evolved is currently unknown: early-divergent chlorophyte and prasinophyte algae genomes contain a low number of glycosyl transferases (GTs), while land plants contain hundreds. The number of GTs in CGA is currently unknown, as no genomes are available, so this study sought to give insight into the evolution of the biosynthetic machinery of CGA through an analysis of available transcriptomes. Methods Available CGA transcriptomes were mined for cell wall biosynthesis GTs and compared with GTs characterized in land plants. In addition, gene cloning was employed in two cases to answer important evolutionary questions. Key Results Genetic evidence was obtained indicating that many of the most important core cell wall polysaccharides have their evolutionary origins in the CGA, including cellulose, mannan, xyloglucan, xylan and pectin, as well as arabino-galactan protein. Moreover, two putative cellulose synthase-like D family genes (CSLDs) from the CGA species Coleochaete orbicularis and a fragment of a putative CSLA/K-like sequence from a CGA Spirogyra species were cloned, providing the first evidence that all the cellulose synthase/-like genes present in early-divergent land plants were already present in CGA. Conclusions The results provide new insights into the evolution of

  15. Comprehensive Analysis of the Triterpenoid Saponins Biosynthetic Pathway in Anemone flaccida by Transcriptome and Proteome Profiling

    PubMed Central

    Zhan, Chuansong; Li, Xiaohua; Zhao, Zeying; Yang, Tewu; Wang, Xuekui; Luo, Biaobiao; Zhang, Qiyun; Hu, Yanru; Hu, Xuebo

    2016-01-01

    Background: Anemone flaccida Fr. Shmidt (Ranunculaceae), commonly known as ‘Di Wu’ in China, is a perennial herb with limited distribution. The rhizome of A. flaccida has long been used to treat arthritis as a tradition in China. Studies disclosed that the plant contains a rich source of triterpenoid saponins. However, little is known about triterpenoid saponins biosynthesis in A. flaccida. Results: In this study, we conducted the tandem transcriptome and proteome profiling of a non-model medicinal plant, A. flaccida. Using Illumina HiSeq 2000 sequencing and iTRAQ technique, a total of 46,962 high-quality unigenes were obtained with an average sequence length of 1,310 bp, along with 1473 unique proteins from A. flaccida. Among the A. flaccida transcripts, 36,617 (77.97%) showed significant similarity (E-value < 1e-5) to the known proteins in the public database. Of the total 46,962 unigenes, 36,617 open reading frame (ORFs) were predicted. By the fragments per kilobases per million reads (FPKM) statistics, 14,004 isoforms/unigenes were found to be upregulated, and 14,090 isoforms/unigenes were down-regulated in the rhizomes as compared to those in the leaves. Based on the bioinformatics analysis, all possible enzymes involved in the triterpenoid saponins biosynthetic pathway of A. flaccida were identified, including cytosolic mevalonate pathway (MVA) and the plastidial methylerythritol pathway (MEP). Additionally, a total of 126 putative cytochrome P450 (CYP450) and 32 putative UDP glycosyltransferases were selected as the candidates of triterpenoid saponins modifiers. Among them, four of them were annotated as the gene of CYP716A subfamily, the key enzyme in the oleanane-type triterpenoid saponins biosynthetic pathway. Furthermore, based on RNA-Seq and proteome analysis, as well as quantitative RT-PCR verification, the expression level of gene and protein committed to triterpenoids biosynthesis in the leaf versus the rhizome was compared. Conclusion: A

  16. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-06-25

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  17. The 9S RNA precursor of Escherichia coli 5S RNA has three structural domains: implications for processing.

    PubMed Central

    Christiansen, J

    1988-01-01

    The secondary structure of the 9S RNA precursor to ribosomal 5S RNA in Escherichia coli has been determined using chemical reagents and ribonucleases in combination with a reverse transcription procedure. The 9S RNA precursor was generated in vitro by T7 RNA polymerase, and the rrnB operon terminator, T1, was able to terminate the in vitro transcript. The secondary structure model exhibits three structural domains corresponding to a 5' region, a mature region and a terminator region. The mature domain is structurally identical to 5S RNA, and the ribosomal proteins L18 and L25 are able to bind to the precursor. The processing endoribonuclease RNase E cleaves between the structural domains. Moreover, an intramolecular refolding of the nascent transcript must take place if the current view of RNase III processing stems is correct. Images PMID:3045757

  18. Photocarrier dynamics in transition metal dichalcogenide alloy Mo0.5W0.5S2.

    PubMed

    He, Jiaqi; He, Dawei; Wang, Yongsheng; Zhao, Hui

    2015-12-28

    We report a transient absorption study of photocarrier dynamics in transition metal dichalcogenide alloy, Mo0.5W0.5S2. Photocarriers were injected by a 400-nm pump pulse and detected by a 660-nm probe pulse. We observed a fast energy relaxation process of about 0.7 ps. The photocarrier lifetime is in the range of 50 - 100 ps, which weakly depends on the injected photocarrier density and is a few times shorter than MoS2 and WS2, reflecting the relatively lower crystalline quality of the alloy. Saturable absorption was also observed in Mo0.5W0.5S2, with a saturation energy fluence of 32 μJ cm(-2). These results provide important parameters on photocarrier properties of transition metal dichalcogenide alloys. PMID:26832001

  19. Theoretical study on the adsorption of carbon dioxide on individual and alkali-metal doped MOF-5s

    NASA Astrophysics Data System (ADS)

    Ha, Nguyen Thi Thu; Lefedova, O. V.; Ha, Nguyen Ngoc

    2016-01-01

    Density functional theory (DFT) calculations were performed to investigate the adsorption of carbon dioxide (CO2) on metal-organic framework (MOF-5) and alkali-metal (Li, K, Na) doped MOF-5s. The adsorption energy calculation showed that metal atom adsorption is exothermic in MOF-5 system. Moreover, alkali-metal doping can significantly improve the adsorption ability of carbon dioxide on MOF-5. The best influence is observed for Li-doping.

  20. Foraminoplastic transfacet epidural endoscopic approach for removal of intraforaminal disc herniation at the L5-S1 level

    PubMed Central

    Kaczmarczyk, Jacek; Nowakowski, Andrzej; Sulewski, Adam

    2014-01-01

    Transforaminal endoscopic disc removal in the L5-S1 motion segment of the lumbar spine creates a technical challenge due to anatomical reasons and individual variability. The majority of surgeons prefer a posterior classical or minimally invasive approach. There is only one foraminoplastic modification of the technique in the literature so far. In this paper we present a new technique with a foraminoplastic transfacet approach that may be suitable in older patients with advanced degenerative disease of the spine. PMID:24729817

  1. Chromosomal location of 18S and 5S rDNA sites in Triportheus fish species (Characiformes, Characidae)

    PubMed Central

    2009-01-01

    The location of 18S and 5S rDNA sites was determined in eight species and populations of the fish genus Triportheus by using fluorescent in situ hybridization (FISH). The males and females of all species had 2n = 52 chromosomes and a ZZ/ZW sex chromosome system. A single 18S rDNA site that was roughly equivalent to an Ag-NOR was detected on the short arms of a submetacentric pair in nearly all species, and up to two additional sites were also observed in some species. In addition, another 18S rDNA cluster was identified in a distal region on the long arms of the W chromosome; this finding corroborated previous evidence that this cluster would be a shared feature amongst Triportheus species. In T. angulatus, a heterozygotic paracentric inversion involving the short arms of one homolog of a metacentric pair was associated with NORs. The 5S rDNA sites were located on the short arms of a single submetacentric chromosomal pair, close to the centromeres, except in T. auritus, which had up to ten 5S rDNA sites. The 18S and 5S rDNA sites were co-localized and adjacent on the short arms of a chromosomal pair in two populations of T. nematurus. Although all Triportheus species have a similar karyotypic macrostructure, the results of this work show that in some species ribosomal genes may serve as species-specific markers when used in conjunction with other putatively synapomorphic features. PMID:21637644

  2. A Tale of Two Lines: Searching for the 5s - 5p Resonance Lines in Pm-like Ion Spectra

    SciTech Connect

    Trabert, E; Vilkas, M J; Ishikawa, Y

    2008-10-24

    Highly charged ions in the promethium sequence have been suggested to show spectral features resembling the alkali sequence ions. Guided by calculations, the 5s-5p resonance lines have been sought in a variety of experiments. In the light of the most extensive calculations of Pm-like ions yet, applying relativistic multi-reference Moeller-Plesset second-order perturbation theory, the experimental evidence is reviewed and the line identification problem assessed.

  3. Describing a new syndrome in L5-S1 disc herniation: Sexual and sphincter dysfunction without pain and muscle weakness

    PubMed Central

    Akca, Nezih; Ozdemir, Bulent; Kanat, Ayhan; Batcik, Osman Ersagun; Yazar, Ugur; Zorba, Orhan Unal

    2014-01-01

    Context: Little seems to be known about the sexual dysfunction (SD) in lumbar intervertebral disc herniation. Aims: Investigation of sexual and sphincter dysfunction in patient with lumbar disc hernitions. Settings and Design: A retrospective analysis. Materials and Methods: Sexual and sphincter dysfunction in patients admitted with lumbar disc herniations between September 2012-March 2014. Statistical Analysis Used: Statistical analysis was performed using the Predictive Analytics SoftWare (PASW) Statistics 18.0 for Windows (Statistical Package for the Social Sciences, SPSS Inc., Chicago, Illinois). The statistical significance was set at P < 0.05. The Wilcoxon signed ranks test was used to evaluate the difference between patients. Results: Four patients with sexual and sphincter dysfunction were found, including two women and two men, aged between 20 and 52 years. All of them admitted without low back pain. In addition, on neurological examination, reflex and motor deficit were not found. However, almost all patients had perianal sensory deficit and sexual and sphincter dysfunction. Magnetic resonance imaging (MRI) of three patients displayed a large extruded disc fragment at L5-S1 level on the left side. In fourth patient, there were not prominent disc herniations. There was not statistically significant difference between pre-operative and post-operative sexual function, anal-urethral sphincter function, and perianal sensation score. A syndrome in L5-S1 disc herniation with sexual and sphincter dysfunction without pain and muscle weakness was noted. We think that it is crucial for neurosurgeons to early realise that paralysis of the sphincter and sexual dysfunction are possible in patients with lumbar L5-S1 disc disease. Conclusion: A syndrome with perianal sensory deficit, paralysis of the sphincter, and sexual dysfunction may occur in patients with lumbar L5-S1 disc disease. The improvement of perianal sensory deficit after surgery was counteracted by a trend

  4. The importance of ribosome production, and the 5S RNP–MDM2 pathway, in health and disease

    PubMed Central

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J.

    2016-01-01

    Ribosomes are abundant, large RNA–protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  5. Minimally Invasive Transforaminal Lumbar Interbody Fusion at L5-S1 through a Unilateral Approach: Technical Feasibility and Outcomes

    PubMed Central

    Choi, Won-Suh; Kim, Jin-Sung; Ryu, Kyeong-Sik; Hur, Jung-Woo; Seong, Ji-Hoon

    2016-01-01

    Background. Minimally invasive spinal transforaminal lumbar interbody fusion (MIS-TLIF) at L5-S1 is technically more demanding than it is at other levels because of the anatomical and biomechanical traits. Objective. To determine the clinical and radiological outcomes of MIS-TLIF for treatment of single-level spinal stenosis low-grade isthmic or degenerative spondylolisthesis at L5-S1. Methods. Radiological data and electronic medical records of patients who underwent MIS-TLIF between May 2012 and December 2014 were reviewed. Fusion rate, cage position, disc height (DH), disc angle (DA), disc slope angle, segmental lordotic angle (SLA), lumbar lordotic angle (LLA), and pelvic parameters were assessed. For functional assessment, the visual analogue scale (VAS), Oswestry disability index (ODI), and patient satisfaction rate (PSR) were utilized. Results. A total of 21 levels in 21 patients were studied. DH, DA, SLA, and LLA had increased from their preoperative measures at the final follow-up. Fusion rate was 86.7% (18/21) at 12 months' follow-up. The most common cage position was anteromedial (15/21). The mean VAS scores for back and leg pain mean ODI scores improved significantly at the final follow-up. PSR was 88%. Cage subsidence was observed in 33.3% (7/21). Conclusions. The clinical and radiologic outcomes after MIS-TLIF at L5-S1 in patients with spinal stenosis or spondylolisthesis are generally favorable. PMID:27433472

  6. Secondary structure of Tetrahymena thermophilia 5S ribosomal RNA as revealed by enzymatic digestion and microdensitometric analysis.

    PubMed Central

    Sneath, B; Vary, C; Pavlakis, G; Vournakis, J

    1986-01-01

    The secondary structure of [32P] end-labeled 5S rRNA from Tetrahymena thermophilia (strain B) has been investigated using the enzymes S1 nuclease, cobra venom ribonuclease and T2 ribonuclease. The results, analyzed by scanning microdensitometry and illustrated by three-dimensional computer graphics, support the secondary structure model of Curtiss and Vournakis for 5S rRNA. Aberrent mobility of certain RNA fragments on sequencing gels was observed as regions of band compression. These regions are postulated to be caused by stable internal base-pairing. The molecule was probed with T2 RNase in neutral (pH 7.5) and acidic (pH 4.5) buffers and only minor structural differences were revealed. One of the helices was found to be susceptible to enzymatic attack by both the single-strand and double-strand specific enzymes. These observations are evidence for the existence of dynamic structural equilibria in 5S rRNA. Images PMID:3005972

  7. Erythromycin and 5S rRNA binding properties of the spinach chloroplast ribosomal protein CL22.

    PubMed Central

    Carol, P; Rozier, C; Lazaro, E; Ballesta, J P; Mache, R

    1993-01-01

    The spinach chloroplast ribosomal protein (r-protein) CL22 contains a central region homologous to the Escherichia coli r-protein L22 plus long N- and C-terminal extensions. We show in this study that the CL22 combines two properties which in E. coli ribosome are split between two separate proteins. The CL22 which binds to the 5S rRNA can also be linked to an erythromycin derivative added to the 50S ribosomal subunit. This latter property is similar to that of the E. coli L22 and suggests a similar localization in the 50S subunit. We have overproduced the r-protein CL22 and deleted forms of this protein in E. coli. We show that the overproduced CL22 binds to the chloroplast 5S rRNA and that the deleted protein containing the N- and C-terminal extensions only has lost the 5S rRNA binding property. We suggest that the central homologous regions of the CL22 contains the RNA binding domain. Images PMID:8441674

  8. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    PubMed

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  9. Temporal and tissue specific gene expression patterns of the zebrafish kinesin-1 heavy chain family, kif5s, during development

    PubMed Central

    Campbell, Philip D.; Marlow, Florence L.

    2013-01-01

    Homo- and heterodimers of Kif5 proteins form the motor domain of Kinesin-1, a major plus-end directed microtubule motor. Kif5s have been implicated in the intracellular transport of organelles, vesicles, proteins, and RNAs in many cell types. There are three mammalian KIF5s. KIF5A and KIF5C proteins are strictly neural in mouse whereas, KIF5B is ubiquitously expressed. Mouse knockouts indicate crucial roles for KIF5 in development and human mutations in KIF5A lead to the neurodegenerative disease Hereditary Spastic Paraplegia. However, the developmental functions and the extent to which individual kif5 functions overlap have not been elucidated. Zebrafish possess five kif5 genes: kif5Aa, kif5Ab, kif5Ba, kif5Bb, and kif5C. Here we report their tissue specific expression patterns in embryonic and larval stages. Specifically, we find that kif5As are strictly zygotic and exhibit neural-specific expression. In contrast, kif5Bs exhibit strong maternal contribution and are ubiquitously expressed. Lastly, kif5C exhibits weak maternal expression followed by enrichment in neural populations. In addition, kif5s show distinct expression domains in the larval retina. PMID:23684767

  10. Transcriptional Regulation of Tetrapyrrole Biosynthetic Genes Explains Abscisic Acid-Induced Heme Accumulation in the Unicellular Red Alga Cyanidioschyzon merolae.

    PubMed

    Kobayashi, Yuki; Tanaka, Kan

    2016-01-01

    Abscisic acid (ABA), a pivotal phytohormone that is synthesized in response to abiotic stresses and other environmental changes, induces various physiological responses. Heme, in its unbound form, has a positive signaling role in cell-cycle initiation in Cyanidioschyzon merolae. ABA induces heme accumulation, but also prevents cell-cycle initiation through the titration of the unbound heme by inducing the heme scavenging protein tryptophan-rich sensory protein-related protein O. In this study, we analyzed the accumulation of tetrapyrrole biosynthetic gene transcripts after the addition of ABA to the medium and found that transcripts of a ferrochelatase and a magnesium-chelatase subunit increased, while other examined transcripts decreased. Under the same conditions, the heme and magnesium-protoporphyrin IX contents increased, while the protoporphyrin IX content decreased. Thus, ABA may regulate the intracellular heme and other tetrapyrrole contents through the transcriptional regulation of biosynthetic genes. PMID:27621743

  11. Heterologous production of glidobactins/luminmycins in Escherichia coli Nissle containing the glidobactin biosynthetic gene cluster from Burkholderia DSM7029.

    PubMed

    Bian, Xiaoying; Huang, Fan; Wang, Hailong; Klefisch, Thorsten; Müller, Rolf; Zhang, Youming

    2014-10-13

    Natural product peptide-based proteasome inhibitors show great potential as anticancer drugs. Here we have cloned the biosynthetic gene cluster of a potent proteasome inhibitor-glidobactin from Burkholderia DSM7029-and successfully detected glidobactins/luminmycins in E. coli Nissle. We have also improved the yield of glidobactin A tenfold by promoter change in a heterologous host. In addition, two new biosynthetic intermediates were identified by comparative MS/MS fragmentation analysis. Identification of acyclic luminmycin E implies substrate specificity of the TE domain for cyclization. The establishment of a heterologous expression system for syrbactins provided the basis for the generation of new syrbactins as proteasome inhibitors by molecular engineering, but the TE domain's specificity cannot be ignored. PMID:25147087

  12. Enhancement of artemisinin content in tetraploid Artemisia annua plants by modulating the expression of genes in artemisinin biosynthetic pathway.

    PubMed

    Lin, Xiuyan; Zhou, Yin; Zhang, Jianjun; Lu, Xu; Zhang, Fangyuan; Shen, Qian; Wu, Shaoyan; Chen, Yunfei; Wang, Tao; Tang, Kexuan

    2011-01-01

    Tetraploid Artemisia annua plants were successfully inducted by using colchicine, and their ploidy was confirmed by flow cytometry. Higher stomatal length but lower frequency in tetraploids were revealed and could be considered as indicators of polyploidy. The average level of artemisinin in tetraploids was increased from 39% to 56% than that of the diploids during vegetation period, as detected by high-performance liquid chromatography-evaporative light scattering detector. Gene expressions of 10 key enzymes related to artemisinin biosynthetic pathway in different ploidy level were analyzed by semiquantitative polymerase chain reaction and significant upregulation of FPS, HMGR, and artemisinin metabolite-specific Aldh1 genes were revealed in tetraploids. Slight increased expression of ADS was also detected. Our results suggest that higher artemisinin content in tetraploid A. annua may result from the upregulated expression of some key enzyme genes related to artemisinin biosynthetic pathway. PMID:21446959

  13. Higher transcription levels in ascorbic acid biosynthetic and recycling genes were associated with higher ascorbic acid accumulation in blueberry.

    PubMed

    Liu, Fenghong; Wang, Lei; Gu, Liang; Zhao, Wei; Su, Hongyan; Cheng, Xianhao

    2015-12-01

    In our preliminary study, the ripe fruits of two highbush blueberry (Vaccinium corymbosum L.) cultivars, cv 'Berkeley' and cv 'Bluecrop', were found to contain different levels of ascorbic acid. However, factors responsible for these differences are still unknown. In the present study, ascorbic acid content in fruits was compared with expression profiles of ascorbic acid biosynthetic and recycling genes between 'Bluecrop' and 'Berkeley' cultivars. The results indicated that the l-galactose pathway was the predominant route of ascorbic acid biosynthesis in blueberry fruits. Moreover, higher expression levels of the ascorbic acid biosynthetic genes GME, GGP, and GLDH, as well as the recycling genes MDHAR and DHAR, were associated with higher ascorbic acid content in 'Bluecrop' compared with 'Berkeley', which indicated that a higher efficiency ascorbic acid biosynthesis and regeneration was likely to be responsible for the higher ascorbic acid accumulation in 'Bluecrop'. PMID:26041210

  14. Transcriptional Regulation of Tetrapyrrole Biosynthetic Genes Explains Abscisic Acid-Induced Heme Accumulation in the Unicellular Red Alga Cyanidioschyzon merolae

    PubMed Central

    Kobayashi, Yuki; Tanaka, Kan

    2016-01-01

    Abscisic acid (ABA), a pivotal phytohormone that is synthesized in response to abiotic stresses and other environmental changes, induces various physiological responses. Heme, in its unbound form, has a positive signaling role in cell-cycle initiation in Cyanidioschyzon merolae. ABA induces heme accumulation, but also prevents cell-cycle initiation through the titration of the unbound heme by inducing the heme scavenging protein tryptophan-rich sensory protein-related protein O. In this study, we analyzed the accumulation of tetrapyrrole biosynthetic gene transcripts after the addition of ABA to the medium and found that transcripts of a ferrochelatase and a magnesium-chelatase subunit increased, while other examined transcripts decreased. Under the same conditions, the heme and magnesium-protoporphyrin IX contents increased, while the protoporphyrin IX content decreased. Thus, ABA may regulate the intracellular heme and other tetrapyrrole contents through the transcriptional regulation of biosynthetic genes. PMID:27621743

  15. Engineered Production of Tryprostatins in E. coli through Reconstitution of a Partial ftm Biosynthetic Gene Cluster from Aspergillus sp.

    PubMed Central

    Shah, Gopitkumar R; Wesener, Shane R.; Cheng, Yi-Qiang

    2015-01-01

    Tryprostatin A and B are indole alkaloid-based fungal products that inhibit mammalian cell cycle at the G2/M phase. They are biosynthetic intermediates of fumitremorgins produced by a complex pathway involving a nonribosomal peptide synthetase (FtmA), a prenyltransferase (FtmB), a cytochrome P450 hydroxylase (FtmC), an O-methyltransferase (FtmD), and several additional enzymes. A partial fumitremorgin biosynthetic gene cluster (ftmABCD) from Aspergillus sp. was reconstituted in Escherichia coli BL21(DE3) cells, with or without the co-expression of an Sfp-type phosphopantetheinyltransferase gene (Cv_sfp) from Chromobacterium violaceum No. 968. Several recombinant E. coli strains produced tryprostatin B up to 106 mg/l or tryprostatin A up to 76 mg/l in the fermentation broth under aerobic condition, providing an effective way to prepare those pharmaceutically important natural products biologically. PMID:26640821

  16. [Dependence of the efficiency of cell growth on biosynthetic medical materials on the microstructure of their surface].

    PubMed

    Gavriliuk, V B; Ivanov, V K; Kulikov, A V; Gavriliuk, B K

    2013-01-01

    The efficiency of a novel class of biosynthetic wound dressings in wich natural and synthetic polymeric components are not arranged in layers but are in a unified structure, i. e., form a new composite material, has been studied. In particular, we tried to determine whether the interactions of dressing surface with cells of the injured tissue and/or culture grown in vitro depend on the microstructure of the surface. The efficiency of cell growth was considered in terms of the stimulation of cell growth. The microstructure of the surface was examined using the scanning electron microscopy at high resolution. The results of the study have shown that the structure of biosynthetic dressings depends on the variations in the composition and the ratio of the components. The role of the microstructure of the dressing in the effectiveness has been demonstrated. The factors which have the most significant effect on the regenerating properties of the wound dressings have been revealed. PMID:25486793

  17. IMG-ABC: An Atlas of Biosynthetic Gene Clusters to Fuel the Discovery of Novel Secondary Metabolites

    SciTech Connect

    Chen, I-Min; Chu, Ken; Ratner, Anna; Palaniappan, Krishna; Huang, Jinghua; Reddy, T. B.K.; Cimermancic, Peter; Fischbach, Michael; Ivanova, Natalia; Markowitz, Victor; Kyrpides, Nikos; Pati, Amrita

    2014-10-28

    In the discovery of secondary metabolites (SMs), large-scale analysis of sequence data is a promising exploration path that remains largely underutilized due to the lack of relevant computational resources. We present IMG-ABC (https://img.jgi.doe.gov/abc/) -- An Atlas of Biosynthetic gene Clusters within the Integrated Microbial Genomes (IMG) system1. IMG-ABC is a rich repository of both validated and predicted biosynthetic clusters (BCs) in cultured isolates, single-cells and metagenomes linked with the SM chemicals they produce and enhanced with focused analysis tools within IMG. The underlying scalable framework enables traversal of phylogenetic dark matter and chemical structure space -- serving as a doorway to a new era in the discovery of novel molecules.

  18. Molecular Networking and Pattern-Based Genome Mining Improves discovery of biosynthetic gene clusters and their products from Salinispora species

    PubMed Central

    Duncan, Katherine R.; Crüsemann, Max; Lechner, Anna; Sarkar, Anindita; Li, Jie; Ziemert, Nadine; Wang, Mingxun; Bandeira, Nuno; Moore, Bradley S.; Dorrestein, Pieter C.; Jensen, Paul R.

    2015-01-01

    Summary Genome sequencing has revealed that bacteria contain many more biosynthetic gene clusters than predicted based on the number of secondary metabolites discovered to date. While this biosynthetic reservoir has fostered interest in new tools for natural product discovery, there remains a gap between gene cluster detection and compound discovery. Here we apply molecular networking and the new concept of pattern-based genome mining to 35 Salinispora strains including 30 for which draft genome sequences were either available or obtained for this study. The results provide a method to simultaneously compare large numbers of complex microbial extracts, which facilitated the identification of media components, known compounds and their derivatives, and new compounds that could be prioritized for structure elucidation. These efforts revealed considerable metabolite diversity and led to several molecular family-gene cluster pairings, of which the quinomycin-type depsipeptide retimycin A was characterized and linked to gene cluster NRPS40 using pattern-based bioinformatic approaches. PMID:25865308

  19. PQQ: Biosynthetic studies in Methylobacterium AM1 and Hyphomicrobium X using specific TC labeling and NMR. [Pyrroloquinoline quinones

    SciTech Connect

    Houck, D.R.; Hanners, J.L.; Unkefer, C.J.; van Kleef, M.A.G.; Duine, J.A.

    1988-01-01

    Using TC labeling and NMR spectroscopy we have determined biosynthetic precursors of pyrroloquinoline quinone (PQQ) in two closely related serine-type methylotrophs, Methylobacterium AM1 and Hyphomicrobium X. Analysis of the TC-labeling data revealed that PQQ is constructed from two amino acids: the portion containing N-6, C-7,8,9 and the two carboxylic acid groups, C-7' and 9', is derived-intact-from glutamate. The remaining portion is derived from tyrosine; the phenol side chain provides the six carbons of the ring containing the orthoquinone, whereas internal cyclization of the amino acid backbone forms the pyrrole-2-carboxylic acid moiety. This is analogous to the cyclization of dopaquinone to form dopachrome. Dopaquinone is a product of the oxidation of tyrosine (via dopa) in reactions catalyzed by monophenol monooxygenase (EC 1.14.18.1). Starting with tyrosine and glutamate, we will discuss possible biosynthetic routes to PQQ. 29 refs., 4 figs., 2 tabs.

  20. Saponin determination, expression analysis and functional characterization of saponin biosynthetic genes in Chenopodium quinoa leaves.

    PubMed

    Fiallos-Jurado, Jennifer; Pollier, Jacob; Moses, Tessa; Arendt, Philipp; Barriga-Medina, Noelia; Morillo, Eduardo; Arahana, Venancio; de Lourdes Torres, Maria; Goossens, Alain; Leon-Reyes, Antonio

    2016-09-01

    Quinoa (Chenopodium quinoa Willd.) is a highly nutritious pseudocereal with an outstanding protein, vitamin, mineral and nutraceutical content. The leaves, flowers and seed coat of quinoa contain triterpenoid saponins, which impart bitterness to the grain and make them unpalatable without postharvest removal of the saponins. In this study, we quantified saponin content in quinoa leaves from Ecuadorian sweet and bitter genotypes and assessed the expression of saponin biosynthetic genes in leaf samples elicited with methyl jasmonate. We found saponin accumulation in leaves after MeJA treatment in both ecotypes tested. As no reference genes were available to perform qPCR in quinoa, we mined publicly available RNA-Seq data for orthologs of 22 genes known to be stably expressed in Arabidopsis thaliana using geNorm, NormFinder and BestKeeper algorithms. The quinoa ortholog of At2g28390 (Monensin Sensitivity 1, MON1) was stably expressed and chosen as a suitable reference gene for qPCR analysis. Candidate saponin biosynthesis genes were screened in the quinoa RNA-Seq data and subsequent functional characterization in yeast led to the identification of CqbAS1, CqCYP716A78 and CqCYP716A79. These genes were found to be induced by MeJA, suggesting this phytohormone might also modulate saponin biosynthesis in quinoa leaves. Knowledge of the saponin biosynthesis and its regulation in quinoa may aid the further development of sweet cultivars that do not require postharvest processing. PMID:27457995

  1. Mechanisms for autophagy modulation by isoprenoid biosynthetic pathway inhibitors in multiple myeloma cells

    PubMed Central

    Dykstra, Kaitlyn M.; Allen, Cheryl; Born, Ella J.; Tong, Huaxiang; Holstein, Sarah A.

    2015-01-01

    Multiple myeloma (MM) is characterized by the production of monoclonal protein (MP). We have shown previously that disruption of the isoprenoid biosynthetic pathway (IBP) causes a block in MP secretion through a disruption of Rab GTPase activity, leading to an enhanced unfolded protein response and subsequent apoptosis in MM cells. Autophagy is induced by cellular stressors including nutrient deprivation and ER stress. IBP inhibitors have been shown to have disparate effects on autophagy. Here we define the mechanisms underlying the differential effects of IBP inhibitors on autophagic flux in MM cells utilizing specific pharmacological inhibitors. We demonstrate that IBP inhibition induces a net increase in autophagy as a consequence of disruption of isoprenoid biosynthesis which is not recapitulated by direct geranylgeranyl transferase inhibition. IBP inhibitor-induced autophagy is a cellular defense mechanism as treatment with the autophagy inhibitor bafilomycin A1 enhances the cytotoxic effects of GGPP depletion, but not geranylgeranyl transferase inhibition. Immunofluorescence microscopy studies revealed that IBP inhibitors disrupt ER to Golgi trafficking of monoclonal light chain protein and that this protein is not a substrate for alternative degradative pathways such as aggresomes and autophagosomes. These studies support further development of specific GGTase II inhibitors as anti-myeloma agents. PMID:26595805

  2. A Covalent Linker Allows for Membrane Targeting of An Oxylipin Biosynthetic Complex

    SciTech Connect

    Gilbert, N.C.; Niebuhr, M.; Tsuruta, H.; Bordelon, T.; Ridderbusch, O.; Dassey, A.; Brash, A.R.; Bartlett, S.G.; Newcomer, M.E.

    2009-05-18

    A naturally occurring bifunctional protein from Plexaura homomalla links sequential catalytic activities in an oxylipin biosynthetic pathway. The C-terminal lipoxygenase (LOX) portion of the molecule catalyzes the transformation of arachidonic acid (AA) to the corresponding 8R-hydroperoxide, and the N-terminal allene oxide synthase (AOS) domain promotes the conversion of the hydroperoxide intermediate to the product allene oxide (AO). Small-angle X-ray scattering data indicate that in the absence of a covalent linkage the two catalytic domains that transform AA to AO associate to form a complex that recapitulates the structure of the bifunctional protein. The SAXS data also support a model for LOX and AOS domain orientation in the fusion protein inferred from a low-resolution crystal structure. However, results of membrane binding experiments indicate that covalent linkage of the domains is required for Ca2+-dependent membrane targeting of the sequential activities, despite the noncovalent domain association. Furthermore, membrane targeting is accompanied by a conformational change as monitored by specific proteolysis of the linker that joins the AOS and LOX domains. Our data are consistent with a model in which Ca2+-dependent membrane binding relieves the noncovalent interactions between the AOS and LOX domains and suggests that the C2-like domain of LOX mediates both protein-protein and protein-membrane interactions.

  3. Insights into the pyrimidine biosynthetic pathway of human malaria parasite Plasmodium falciparum as chemotherapeutic target.

    PubMed

    Krungkrai, Sudaratana R; Krungkrai, Jerapan

    2016-06-01

    Malaria is a major cause of morbidity and mortality in humans. Artemisinins remain as the first-line treatment for Plasmodium falciparum (P. falciparum) malaria although drug resistance has already emerged and spread in Southeast Asia. Thus, to fight this disease, there is an urgent need to develop new antimalarial drugs for malaria chemotherapy. Unlike human host cells, P. falciparum cannot salvage preformed pyrimidine bases or nucleosides from the extracellular environment and relies solely on nucleotides synthesized through the de novo biosynthetic pathway. This review presents significant progress on understanding the de novo pyrimidine pathway and the functional enzymes in the human parasite P. falciparum. Current knowledge in genomics and metabolomics are described, particularly focusing on the parasite purine and pyrimidine nucleotide metabolism. These include gene annotation, characterization and molecular mechanism of the enzymes that are different from the human host pathway. Recent elucidation of the three-dimensional crystal structures and the catalytic reactions of three enzymes: dihydroorotate dehydrogenase, orotate phosphoribosyltransferase, and orotidine 5'-monophosphate decarboxylase, as well as their inhibitors are reviewed in the context of their therapeutic potential against malaria. PMID:27262062

  4. A Fivefold Parallelized Biosynthetic Process Secures Chlorination of Armillaria mellea (Honey Mushroom) Toxins.

    PubMed

    Wick, Jonas; Heine, Daniel; Lackner, Gerald; Misiek, Mathias; Tauber, James; Jagusch, Hans; Hertweck, Christian; Hoffmeister, Dirk

    2016-02-01

    The basidiomycetous tree pathogen Armillaria mellea (honey mushroom) produces a large variety of structurally related antibiotically active and phytotoxic natural products, referred to as the melleolides. During their biosynthesis, some members of the melleolide family of compounds undergo monochlorination of the aromatic moiety, whose biochemical and genetic basis was not known previously. This first study on basidiomycete halogenases presents the biochemical in vitro characterization of five flavin-dependent A. mellea enzymes (ArmH1 to ArmH5) that were heterologously produced in Escherichia coli. We demonstrate that all five enzymes transfer a single chlorine atom to the melleolide backbone. A 5-fold, secured biosynthetic step during natural product assembly is unprecedented. Typically, flavin-dependent halogenases are categorized into enzymes acting on free compounds as opposed to those requiring a carrier-protein-bound acceptor substrate. The enzymes characterized in this study clearly turned over free substrates. Phylogenetic clades of halogenases suggest that all fungal enzymes share an ancestor and reflect a clear divergence between ascomycetes and basidiomycetes. PMID:26655762

  5. Harvesting the biosynthetic machineries that cultivate a variety of indispensable plant natural products.

    PubMed

    Vickery, Christopher R; La Clair, James J; Burkart, Michael D; Noel, Joseph P

    2016-04-01

    Plants are a sustainable resource for valuable natural chemicals best illustrated by large-scale farming centered on specific products. Here, we review recent discoveries of plant metabolic pathways producing natural products with unconventional biomolecular structures. Prenylation of polyketides by aromatic prenyltransferases (aPTases) ties together two of the major groups of plant specialized chemicals, terpenoids and polyketides, providing a core modification leading to new bioactivities and downstream metabolic processing. Moreover, PTases that biosynthesize Z-terpenoid precursors for small molecules such as lycosantalene have recently been found in the tomato family. Gaps in our understanding of how economically important compounds such as cannabinoids are produced are being identified using next-generation 'omics' to rapidly advance biochemical breakthroughs at an unprecedented rate. For instance, olivetolic acid cyclase, a polyketide synthase (PKS) co-factor from Cannabis sativa, directs the proper cyclization of a polyketide intermediate. Elucidations of spatial and temporal arrangements of biosynthetic enzymes into metabolons, such as those used to control the efficient production of natural polymers such as rubber and defensive small molecules such as linamarin and lotaustralin, provide blueprints for engineering streamlined production of plant products. PMID:26851514

  6. Spliced X-box binding protein 1 couples the unfolded protein response to hexosamine biosynthetic pathway.

    PubMed

    Wang, Zhao V; Deng, Yingfeng; Gao, Ningguo; Pedrozo, Zully; Li, Dan L; Morales, Cyndi R; Criollo, Alfredo; Luo, Xiang; Tan, Wei; Jiang, Nan; Lehrman, Mark A; Rothermel, Beverly A; Lee, Ann-Hwee; Lavandero, Sergio; Mammen, Pradeep P A; Ferdous, Anwarul; Gillette, Thomas G; Scherer, Philipp E; Hill, Joseph A

    2014-03-13

    The hexosamine biosynthetic pathway (HBP) generates uridine diphosphate N-acetylglucosamine (UDP-GlcNAc) for glycan synthesis and O-linked GlcNAc (O-GlcNAc) protein modifications. Despite the established role of the HBP in metabolism and multiple diseases, regulation of the HBP remains largely undefined. Here, we show that spliced X-box binding protein 1 (Xbp1s), the most conserved signal transducer of the unfolded protein response (UPR), is a direct transcriptional activator of the HBP. We demonstrate that the UPR triggers HBP activation via Xbp1s-dependent transcription of genes coding for key, rate-limiting enzymes. We further establish that this previously unrecognized UPR-HBP axis is triggered in a variety of stress conditions. Finally, we demonstrate a physiologic role for the UPR-HBP axis by showing that acute stimulation of Xbp1s in heart by ischemia/reperfusion confers robust cardioprotection in part through induction of the HBP. Collectively, these studies reveal that Xbp1s couples the UPR to the HBP to protect cells under stress. PMID:24630721

  7. Spliced X-box Binding Protein 1 Couples the Unfolded Protein Response to Hexosamine Biosynthetic Pathway

    PubMed Central

    Wang, Zhao V.; Deng, Yingfeng; Gao, Ningguo; Pedrozo, Zully; Li, Dan L.; Morales, Cyndi R.; Criollo, Alfredo; Luo, Xiang; Tan, Wei; Jiang, Nan; Lehrman, Mark A.; Rothermel, Beverly A.; Lee, Ann-Hwee; Lavandero, Sergio; Mammen, Pradeep P.A.; Ferdous, Anwarul; Gillette, Thomas G.; Scherer, Philipp E.; Hill, Joseph A.

    2014-01-01

    SUMMARY The hexosamine biosynthetic pathway (HBP) generates UDP-GlcNAc (uridine diphosphate N-acetylglucosamine) for glycan synthesis and O-linked GlcNAc (O-GlcNAc) protein modifications. Despite the established role of the HBP in metabolism and multiple diseases, regulation of the HBP remains largely undefined. Here, we show that spliced X-box binding protein 1 (Xbp1s), the most conserved signal transducer of the unfolded protein response (UPR), is a direct transcriptional activator of the HBP. We demonstrate that the UPR triggers HBP activation via Xbp1s-dependent transcription of genes coding for key, rate-limiting enzymes. We further establish that this previously unrecognized UPR-HBP axis is triggered in a variety of stress conditions. Finally, we demonstrate a physiologic role for the UPR-HBP axis, by showing that acute stimulation of Xbp1s in heart by ischemia/reperfusion confers robust cardioprotection in part through induction of the HBP. Collectively, these studies reveal that Xbp1s couples the UPR to the HBP to protect cells under stress. PMID:24630721

  8. Biosynthetic investigation of phomopsins reveals a widespread pathway for ribosomal natural products in Ascomycetes.

    PubMed

    Ding, Wei; Liu, Wan-Qiu; Jia, Youli; Li, Yongzhen; van der Donk, Wilfred A; Zhang, Qi

    2016-03-29

    Production of ribosomally synthesized and posttranslationally modified peptides (RiPPs) has rarely been reported in fungi, even though organisms of this kingdom have a long history as a prolific source of natural products. Here we report an investigation of the phomopsins, antimitotic mycotoxins. We show that phomopsin is a fungal RiPP and demonstrate the widespread presence of a pathway for the biosynthesis of a family of fungal cyclic RiPPs, which we term dikaritins. We characterize PhomM as an S-adenosylmethionine-dependent α-N-methyltransferase that converts phomopsin A to anN,N-dimethylated congener (phomopsin E), and show that the methyltransferases involved in dikaritin biosynthesis have evolved differently and likely have broad substrate specificities. Genome mining studies identified eight previously unknown dikaritins in different strains, highlighting the untapped capacity of RiPP biosynthesis in fungi and setting the stage for investigating the biological activities and unknown biosynthetic transformations of this family of fungal natural products. PMID:26979951

  9. The biosynthetic gene cluster for sophorolipids: a biotechnological interesting biosurfactant produced by Starmerella bombicola.

    PubMed

    Van Bogaert, Inge N A; Holvoet, Kevin; Roelants, Sophie L K W; Li, Bing; Lin, Yao-Cheng; Van de Peer, Yves; Soetaert, Wim

    2013-05-01

    Sophorolipids are promising biological derived surfactants or detergents which find application in household cleaning, personal care and cosmetics. They are produced by specific yeast species and among those, Starmerella bombicola (former Candida bombicola) is the most widely used and studied one. Despite the commercial interest in sophorolipids, the biosynthetic pathway of these secondary metabolites remained hitherto partially unsolved. In this manuscript we present the sophorolipid gene cluster consisting of five genes directly involved in sophorolipid synthesis: a cytochrome P450 monooxygenase, two glucosyltransferases, an acetyltransferase and a transporter. It was demonstrated that disabling the first step of the pathway - cytochrome P450 monooxygenase mediated terminal or subterminal hydroxylation of a common fatty acid - results in complete abolishment of sophorolipid production. This phenotype could be complemented by supplying the yeast with hydroxylated fatty acids. On the other hand, knocking out the transporter gene yields mutants still able to secrete sophorolipids, though only at levels of 10% as compared with the wild type, suggesting alternative routes for secretion. Finally, it was proved that hampering sophorolipid production does not affect cell growth or cell viability in laboratory conditions, as can be expected for secondary metabolites. PMID:23516968

  10. Functional characterization and substrate specificity of spinosyn rhamnosyltransferase by in vitro reconstitution of spinosyn biosynthetic enzymes.

    PubMed

    Chen, Yi-Lin; Chen, Yi-Hsine; Lin, Yu-Chin; Tsai, Kuo-Chung; Chiu, Hsien-Tai

    2009-03-13

    Spinosyn, a potent insecticide, is a novel tetracyclic polyketide decorated with d-forosamine and tri-O-methyl-L-rhamnose. Spinosyn rhamnosyltransferase (SpnG) is a key biocatalyst with unique sequence identity and controls the biosynthetic maturation of spinosyn. The rhamnose is critical for the spinosyn insecticidal activity and cell wall biosynthesis of the spinosyn producer, Saccharopolyspora spinosa. In this study, we have functionally expressed and characterized SpnG and the three enzymes, Gdh, Epi, and Kre, responsible for dTDP-L-rhamnose biosynthesis in S. spinosa by purified enzymes from Escherichia coli. Most notably, the substrate specificity of SpnG was thoroughly characterized by kinetic and inhibition experiments using various NDP sugar analogs made by an in situ combination of NDP-sugar-modifying enzymes. SpnG was found to exhibit striking substrate promiscuity, yielding corresponding glycosylated variants. Moreover, the critical residues presumably involved in catalytic mechanism of Gdh and SpnG were functionally evaluated by site-directed mutagenesis. The information gained from this study has provided important insight into molecular recognition and mechanism of the enzymes, especially SpnG. The results have made possible the structure-activity characterization of SpnG, as well as the use of SpnG or its engineered form to serve as a combinatorial tool to make spinosyn analogs with altered biological activities and potency. PMID:19126547

  11. Duplication of partial spinosyn biosynthetic gene cluster in Saccharopolyspora spinosa enhances spinosyn production.

    PubMed

    Tang, Ying; Xia, Liqiu; Ding, Xuezhi; Luo, Yushuang; Huang, Fan; Jiang, Yuanwei

    2011-12-01

    Spinosyns, the secondary metabolites produced by Saccharopolyspora spinosa, are the active ingredients in a family of insect control agents. Most of the S. spinosa genes involved in spinosyn biosynthesis are found in a contiguous c. 74-kb cluster. To increase the spinosyn production through overexpression of their biosynthetic genes, part of its gene cluster (c. 18 kb) participating in the conversion of the cyclized polyketide to spinosyn was obtained by direct cloning via Red/ET recombination rather than by constructing and screening the genomic library. The resultant plasmid pUCAmT-spn was introduced into S. spinosa CCTCC M206084 from Escherichia coli S17-1 by conjugal transfer. The subsequent single-crossover homologous recombination caused a duplication of the partial gene cluster. Integration of this plasmid enhanced production of spinosyns with a total of 388 (± 25.0) mg L(-1) for spinosyns A and D in the exconjugant S. spinosa trans1 compared with 100 (± 7.7) mg L(-1) in the parental strain. Quantitative real time polymerase chain reaction analysis of three selected genes (spnH, spnI, and spnK) confirmed the positive effect of the overexpression of these genes on the spinosyn production. This study provides a simple avenue for enhancing spinosyn production. The strategies could also be used to improve the yield of other secondary metabolites. PMID:22092858

  12. Production of wax esters in plant seed oils by oleosomal cotargeting of biosynthetic enzymes[S

    PubMed Central

    Heilmann, Mareike; Iven, Tim; Ahmann, Katharina; Hornung, Ellen; Stymne, Sten; Feussner, Ivo

    2012-01-01

    Wax esters are neutral lipids exhibiting desirable properties for lubrication. Natural sources have traditionally been whales. Additionally some plants produce wax esters in their seed oil. Currently there is no biological source available for long chain length monounsaturated wax esters that are most suited for industrial applications. This study aimed to identify enzymatic requirements enabling their production in oilseed plants. Wax esters are generated by the action of fatty acyl-CoA reductase (FAR), generating fatty alcohols and wax synthases (WS) that esterify fatty alcohols and acyl-CoAs to wax esters. Based on their substrate preference, a FAR and a WS from Mus musculus were selected for this study (MmFAR1 and MmWS). MmWS resides in the endoplasmic reticulum (ER), whereas MmFAR1 associates with peroxisomes. The elimination of a targeting signal and the fusion to an oil body protein yielded variants of MmFAR1 and MmWS that were cotargeted and enabled wax ester production when coexpressed in yeast or Arabidopsis. In the fae1 fad2 double mutant, rich in oleate, the cotargeted variants of MmFAR1 and MmWS enabled formation of wax esters containing >65% oleyl-oleate. The data suggest that cotargeting of unusual biosynthetic enzymes can result in functional interplay of heterologous partners in transgenic plants. PMID:22878160

  13. Fluorescent profiling of modular biosynthetic enzymes by complementary metabolic and activity based probes.

    PubMed

    Meier, Jordan L; Mercer, Andrew C; Burkart, Michael D

    2008-04-23

    The study of the enzymes responsible for natural product biosynthesis has proven a valuable source of new enzymatic activities and been applied to a number of biotechnology applications. Protein profiling could prove highly complementary to genetics based approaches by allowing us to understand the activity, transcriptional control, and post-translational modification of these enzymes in their native and dynamic proteomic environments. Here we present a method for the fluorescent profiling of PKS, NRPS, and FAS multidomain modular synthases in their whole proteomes using complementary metabolic and activity based probes. After first examining the reactivity of these activity based probes with a variety of purified recombinant PKS, NRPS, and FAS enzymes in vitro, we apply this duel labeling strategy to the analysis of modular synthases in a human breast cancer cell line and two strains of the natural product producer Bacillus subtilis. Collectively, these studies demonstrate that complementary protein profiling approaches can prove highly useful in the identification and assignment of inhibitor specificity and domain structure of these modular biosynthetic enzymes. PMID:18376827

  14. Application of a Mass Spectrometric Approach to Detect the Presence of Fatty Acid Biosynthetic Phosphopeptides.

    PubMed

    Lau, Benjamin Yii Chung; Clerens, Stefan; Morton, James D; Dyer, Jolon M; Deb-Choudhury, Santanu; Ramli, Umi Salamah

    2016-04-01

    The details of plant lipid metabolism are relatively well known but the regulation of fatty acid production at the protein level is still not understood. Hence this study explores the importance of phosphorylation as a mechanism to control the activity of fatty acid biosynthetic enzymes using low and high oleic acid mesocarps of oil palm fruit (Elaeis guineensis variety of Tenera). Adaptation of neutral loss-triggered tandem mass spectrometry and selected reaction monitoring to detect the neutral loss of phosphoric acid successfully found several phosphoamino acid-containing peptides. These peptides corresponded to the peptides from acetyl-CoA carboxylase and 3-enoyl-acyl carrier protein reductase as identified by their precursor ion masses. These findings suggest that these enzymes were phosphorylated at 20th week after anthesis. Phosphorylation could have reduce their activities towards the end of fatty acid biosynthesis at ripening stage. Implication of phosphorylation in the regulation of fatty acid biosynthesis at protein level has never been reported. PMID:26993480

  15. High-density biosynthetic fuels: the intersection of heterogeneous catalysis and metabolic engineering.

    PubMed

    Harvey, Benjamin G; Meylemans, Heather A; Gough, Raina V; Quintana, Roxanne L; Garrison, Michael D; Bruno, Thomas J

    2014-05-28

    Biosynthetic valencene, premnaspirodiene, and natural caryophyllene were hydrogenated and evaluated as high performance fuels. The parent sesquiterpenes were then isomerized to complex mixtures of hydrocarbons with the heterogeneous acid catalyst Nafion SAC-13. High density fuels with net heats of combustion ranging from 133-141 000 Btu gal(-1), or up to 13% higher than commercial jet fuel could be generated by this approach. The products of caryophyllene isomerization were primarily tricyclic hydrocarbons which after hydrogenation increased the fuel density by 6%. The isomerization of valencene and premnaspirodiene also generated a variety of sesquiterpenes, but in both cases the dominant product was δ-selinene. Ab initio calculations were conducted to determine the total electronic energies for the reactants and products. In all cases the results were in excellent agreement with the experimental distribution of isomers. The cetane numbers for the sesquiterpane fuels ranged from 20-32 and were highly dependent on the isomer distribution. Specific distillation cuts may have the potential to act as high density diesel fuels, while use of these hydrocarbons as additives to jet fuel will increase the range and/or time of flight of aircraft. In addition to the ability to generate high performance renewable fuels, the powerful combination of metabolic engineering and heterogeneous catalysis will allow for the preparation of a variety of sesquiterpenes with potential for pharmaceutical, flavor, and fragrance applications. PMID:24724156

  16. Horizontal Gene Transfer and Redundancy of Tryptophan Biosynthetic Enzymes in Dinotoms

    PubMed Central

    Imanian, Behzad; Keeling, Patrick J.

    2014-01-01

    A tertiary endosymbiosis between a dinoflagellate host and diatom endosymbiont gave rise to “dinotoms,” cells with a unique nuclear and mitochondrial redundancy derived from two evolutionarily distinct eukaryotic lineages. To examine how this unique redundancy might have affected the evolution of metabolic systems, we investigated the transcription of genes involved in biosynthesis of the amino acid tryptophan in three species, Durinskia baltica, Kryptoperidinium foliaceum, and Glenodinium foliaceum. From transcriptome sequence data, we recovered two distinct sets of protein-coding transcripts covering the entire tryptophan biosynthetic pathway. Phylogenetic analyses suggest a diatom origin for one set of the proteins, which we infer to be expressed in the endosymbiont, and that the other arose from multiple horizontal gene transfer events to the dinoflagellate ancestor of the host lineage. This is the first indication that these cells retain redundant sets of transcripts and likely metabolic pathways for the biosynthesis of small molecules and extend their redundancy to their two distinct nuclear genomes. PMID:24448981

  17. Investigation of the Biosynthetic Potential of Endophytes in Traditional Chinese Anticancer Herbs

    PubMed Central

    Miller, Kristin I.; Qing, Chen; Sze, Daniel Man Yuen; Neilan, Brett A.

    2012-01-01

    Traditional Chinese medicine encompasses a rich empirical knowledge of the use of plants for the treatment of disease. In addition, the microorganisms associated with medicinal plants are also of interest as the producers of the compounds responsible for the observed plant bioactivity. The present study has pioneered the use of genetic screening to assess the potential of endophytes to synthesize bioactive compounds, as indicated by the presence of non-ribosomal peptide synthetase (NRPS) and polyketide synthase (PKS) genes. The total DNA extracts of 30 traditional Chinese herbs, were screened for functional genes involved in the biosynthesis of bioactive compounds. The four PCR screens were successful in targeting four bacterial PKS, six bacterial NRPS, ten fungal PKS and three fungal NRPS gene fragments. Analysis of the detected endophyte gene fragments afforded consideration of the possible bioactivity of the natural products produced by endophytes in medicinal herbs. This investigation describes a rapid method for the initial screening of medicinal herbs and has highlighted a subset of those plants that host endophytes with biosynthetic potential. These selected plants can be the focus of more comprehensive endophyte isolation and natural product studies. PMID:22629306

  18. Purification of a 40-kilodalton methyltransferase active in the aflatoxin biosynthetic pathway.

    PubMed Central

    Keller, N P; Dischinger, H C; Bhatnagar, D; Cleveland, T E; Ullah, A H

    1993-01-01

    The penultimate step in the aflatoxin biosynthetic pathway of the filamentous fungi Aspergillus flavus and A. parasiticus involves conversion of sterigmatocystin to O-methylsterigmatocystin. An S-adenosylmethionine-dependent methyltransferase that catalyzes this reaction was purified to homogeneity (> 90%) from 78-h-old mycelia of A. parasiticus SRRC 163. Purification of this soluble enzyme was carried out by five soft-gel chromatographic steps: cell debris remover treatment, QMA ACELL chromatography, hydroxylapatite-Ultrogel chromatography, DEAE-Spherodex chromatography, and Octyl Avidgel chromatography, followed by MA7Q high-performance liquid chromatography. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the protein peak from this step on silver staining identified a single band of approximately 40 kDa. This purified protein was distinct from the dimeric 168-kDa methyltransferase purified from the same fungal strain under identical growth conditions (D. Bhatnagar, A. H. J. Ullah, and T. E. Cleveland, Prep. Biochem. 18:321-349, 1988). The chromatographic behavior and N-terminal sequence of the 40-kDa enzyme were also distinct from those of the 168-kDa methyltransferase. The molar extinction coefficient of the 40-kDa enzyme at 278 nm was estimated to be 4.7 x 10(4) M-1 cm-1 in 50 mM potassium phosphate buffer (pH 7.5). Images PMID:8434913

  19. Cloning, sequencing and characterization of the biosynthetic gene cluster of sanglifehrin A, a potent cyclophilin inhibitor.

    PubMed

    Qu, Xudong; Jiang, Nan; Xu, Fei; Shao, Lei; Tang, Gongli; Wilkinson, Barrie; Liu, Wen

    2011-03-01

    Sanglifehrin A (SFA), a potent cyclophilin inhibitor produced by Streptomyces flaveolus DSM 9954, bears a unique [5.5] spirolactam moiety conjugated with a 22-membered, highly functionalized macrolide through a linear carbon chain. SFA displays a diverse range of biological activities and offers significant therapeutic potential. However, the structural complexity of SFA poses a tremendous challenge for new analogue development via chemical synthesis. Based on a rational prediction of its biosynthetic origin, herein we report the cloning, sequencing and characterization of the gene cluster responsible for SFA biosynthesis. Analysis of the 92 776 bp contiguous DNA region reveals a mixed polyketide synthase (PKS)/non-ribosomal peptide synthetase (NRPS) pathway which includes a variety of unique features for unusual PKS and NRPS building block formation. Our findings suggest that SFA biosynthesis requires a crotonyl-CoA reductase/carboxylase (CCR) for generation of the putative unusual PKS starter unit (2R)-2-ethylmalonamyl-CoA, an iterative type I PKS for the putative atypical extender unit (2S)-2-(2-oxo-butyl)malonyl-CoA and a phenylalanine hydroxylase for the NRPS extender unit (2S)-m-tyrosine. A spontaneous ketalization of significant note, may trigger spirolactam formation in a stereo-selective manner. This study provides a framework for the application of combinatorial biosynthesis methods in order to expand the structural diversity of SFA. PMID:21416665

  20. Auxin Input Pathway Disruptions Are Mitigated by Changes in Auxin Biosynthetic Gene Expression in Arabidopsis.

    PubMed

    Spiess, Gretchen M; Hausman, Amanda; Yu, Peng; Cohen, Jerry D; Rampey, Rebekah A; Zolman, Bethany K

    2014-06-01

    Auxin is a phytohormone involved in cell elongation and division. Levels of indole-3-acetic acid (IAA), the primary auxin, are tightly regulated through biosynthesis, degradation, sequestration, and transport. IAA is sequestered in reversible processes by adding amino acids, polyol or simple alcohols, or sugars, forming IAA conjugates, or through a two-carbon elongation forming indole-3-butyric acid. These sequestered forms of IAA alter hormone activity. To gain a better understanding of how auxin homeostasis is maintained, we have generated Arabidopsis (Arabidopsis thaliana) mutants that combine disruptions in the pathways, converting IAA conjugates and indole-3-butyric acid to free IAA. These mutants show phenotypes indicative of low auxin levels, including delayed germination, abnormal vein patterning, and decreased apical dominance. Root phenotypes include changes in root length, root branching, and root hair growth. IAA levels are reduced in the cotyledon tissue but not meristems or hypocotyls. In the combination mutants, auxin biosynthetic gene expression is increased, particularly in the YUCCA/Tryptophan Aminotransferase of Arabidopsis1 pathway, providing a feedback mechanism that allows the plant to compensate for changes in IAA input pathways and maintain cellular homeostasis. PMID:24891612

  1. Purine biosynthetic genes are required for cadmium tolerance in Schizosaccharomyces pombe

    SciTech Connect

    Speiser, D.M.; Ortiz, D.F.; Kreppel, L.; Scheel, G.; McDonald, G.; Ow, D.W. Univ. of California, Berkeley )

    1992-12-01

    Phytochelatins (PCs) are metal-chelating peptides produced in plants and some fungi in response to heavy metal exposure. A Cd-sensitive mutant of the fission yeast Schizosaccharomyces pombe, defective in production of a PC-Cd-sulfide complex essential for metal tolerance, was found to harbor mutations in specific genes of the purine biosynthetic pathway. Genetic analysis of the link between metal complex accumulation and purine biosynthesis enzymes revealed that genetic lesions blocking two segments of the pathway, before and after the IMP branchpoint, are required to produce the Cd-sensitive phenotype. The biochemical functions of these two segments of the pathway are similar, and a model based on the alternate use of a sulfur analog substrate is presented. The novel participation of purine biosynthesis enzymes in the conversion of the PC-Cd complex to the PC-Cd-sulfide complex in the fission yeast raises an intriguing possibility that these same enzymes might have a role in sulfur metabolism in the fission yeast S. pombe, and perhaps in other biological systems. 41 refs., 8 figs., 2 tabs.

  2. Elucidation of the complete ferrichrome A biosynthetic pathway in Ustilago maydis.

    PubMed

    Winterberg, Britta; Uhlmann, Stefanie; Linne, Uwe; Lessing, Franziska; Marahiel, Mohamed A; Eichhorn, Heiko; Kahmann, Regine; Schirawski, Jan

    2010-03-01

    Iron is an important element for many essential processes in living organisms. To acquire iron, the basidiomycete Ustilago maydis synthesizes the iron-chelating siderophores ferrichrome and ferrichrome A. The chemical structures of these siderophores have been elucidated long time ago but so far only two enzymes involved in their biosynthesis have been described. Sid1, an ornithine monoxygenase, is needed for the biosynthesis of both siderophores, and Sid2, a non-ribosomal peptide synthetase (NRPS), is involved in ferrichrome generation. In this work we identified four novel enzymes, Fer3, Fer4, Fer5 and Hcs1, involved in ferrichrome A biosynthesis in U. maydis. By HPLC-MS analysis of siderophore accumulation in culture supernatants of deletion strains, we show that Fer3, an NRPS, Fer4, an enoyl-coenzyme A (CoA)-hydratase, and Fer5, an acylase, are required for ferrichrome A production. We demonstrate by conditional expression of the hydroxymethyl glutaryl (HMG)-CoA synthase Hcs1 in U. maydis that HMG-CoA is an essential precursor for ferrichrome A. In addition, we heterologously expressed and purified Hcs1, Fer4 and Fer5, and demonstrated the enzymatic activities by in vitro experiments. Thus, we describe the first complete fungal siderophore biosynthetic pathway by functionally characterizing four novel genes responsible for ferrichrome A biosynthesis in U. maydis. PMID:20070524

  3. Cloning of three human multifunctional de novo purine biosynthetic genes by functional complementation of yeast mutations.

    PubMed Central

    Schild, D; Brake, A J; Kiefer, M C; Young, D; Barr, P J

    1990-01-01

    Functional complementation of mutations in the yeast Saccharomyces cerevisiae has been used to clone three multifunctional human genes involved in de novo purine biosynthesis. A HepG2 cDNA library constructed in a yeast expression vector was used to transform yeast strains with mutations in adenine biosynthetic genes. Clones were isolated that complement mutations in the yeast ADE2, ADE3, and ADE8 genes. The cDNA that complemented the ade8 (phosphoribosylglycinamide formyltransferase, GART) mutation, also complemented the ade5 (phosphoribosylglycinamide synthetase) and ade7 [phosphoribosylaminoimidazole synthetase (AIRS; also known as PAIS)] mutations, indicating that it is the human trifunctional GART gene. Supporting data include homology between the AIRS and GART domains of this gene and the published sequence of these domains from other organisms, and localization of the cloned gene to human chromosome 21, where the GART gene has been shown to map. The cDNA that complemented ade2 (phosphoribosylaminoimidazole carboxylase) also complemented ade1 (phosphoribosylaminoimidazole succinocarboxamide synthetase), supporting earlier data suggesting that in some organisms these functions are part of a bifunctional protein. The cDNA that complemented ade3 (formyltetrahydrofolate synthetase) is different from the recently isolated human cDNA encoding this enzyme and instead appears to encode a related mitochondrial enzyme. Images PMID:2183217

  4. Inhibition of the hexosamine biosynthetic pathway promotes castration-resistant prostate cancer

    PubMed Central

    Kaushik, Akash K.; Shojaie, Ali; Panzitt, Katrin; Sonavane, Rajni; Venghatakrishnan, Harene; Manikkam, Mohan; Zaslavsky, Alexander; Putluri, Vasanta; Vasu, Vihas T.; Zhang, Yiqing; Khan, Ayesha S.; Lloyd, Stacy; Szafran, Adam T.; Dasgupta, Subhamoy; Bader, David A.; Stossi, Fabio; Li, Hangwen; Samanta, Susmita; Cao, Xuhong; Tsouko, Efrosini; Huang, Shixia; Frigo, Daniel E.; Chan, Lawrence; Edwards, Dean P.; Kaipparettu, Benny A.; Mitsiades, Nicholas; Weigel, Nancy L.; Mancini, Michael; McGuire, Sean E.; Mehra, Rohit; Ittmann, Michael M.; Chinnaiyan, Arul M.; Putluri, Nagireddy; Palapattu, Ganesh S.; Michailidis, George; Sreekumar, Arun

    2016-01-01

    The precise molecular alterations driving castration-resistant prostate cancer (CRPC) are not clearly understood. Using a novel network-based integrative approach, here, we show distinct alterations in the hexosamine biosynthetic pathway (HBP) to be critical for CRPC. Expression of HBP enzyme glucosamine-phosphate N-acetyltransferase 1 (GNPNAT1) is found to be significantly decreased in CRPC compared with localized prostate cancer (PCa). Genetic loss-of-function of GNPNAT1 in CRPC-like cells increases proliferation and aggressiveness, in vitro and in vivo. This is mediated by either activation of the PI3K-AKT pathway in cells expressing full-length androgen receptor (AR) or by specific protein 1 (SP1)-regulated expression of carbohydrate response element-binding protein (ChREBP) in cells containing AR-V7 variant. Strikingly, addition of the HBP metabolite UDP-N-acetylglucosamine (UDP-GlcNAc) to CRPC-like cells significantly decreases cell proliferation, both in-vitro and in animal studies, while also demonstrates additive efficacy when combined with enzalutamide in-vitro. These observations demonstrate the therapeutic value of targeting HBP in CRPC. PMID:27194471

  5. Identification of prostamides, fatty acyl ethanolamines, and their biosynthetic precursors in rabbit cornea.

    PubMed

    Urquhart, Paula; Wang, Jenny; Woodward, David F; Nicolaou, Anna

    2015-08-01

    Arachidonoyl ethanolamine (anandamide) and pros-taglandin ethanolamines (prostamides) are biologically active derivatives of arachidonic acid. Although available through different precursor phospholipids, there is considerable overlap between the biosynthetic pathways of arachidonic acid-derived eicosanoids and anandamide-derived prostamides. Prostamides exhibit physiological actions and are involved in ocular hypotension, smooth muscle contraction, and inflammatory pain. Although topical application of bimatoprost, a structural analog of prostaglandin F2α ethanolamide (PGF2α-EA), is currently a first-line treatment for ocular hypertension, the endogenous production of prostamides and their biochemical precursors in corneal tissue has not yet been reported. In this study, we report the presence of anandamide, palmitoyl-, stearoyl-, α-linolenoyl docosahexaenoyl-, linoleoyl-, and oleoyl-ethanolamines in rabbit cornea, and following treatment with anandamide, the formation of PGF2α-EA, PGE2-EA, PGD2-EA by corneal extracts (all analyzed by LC/ESI-MS/MS). A number of N-acyl phosphatidylethanolamines, precursors of anandamide and other fatty acyl ethanolamines, were also identified in corneal lipid extracts using ESI-MS/MS. These findings suggest that the prostamide and fatty acid ethanolamine pathways are operational in the cornea and may provide valuable insight into corneal physiology and their potential influence on adjacent tissues and the aqueous humor. PMID:26031663

  6. Identification of prostamides, fatty acyl ethanolamines, and their biosynthetic precursors in rabbit cornea[S

    PubMed Central

    Urquhart, Paula; Wang, Jenny; Woodward, David F.; Nicolaou, Anna

    2015-01-01

    Arachidonoyl ethanolamine (anandamide) and pros­taglandin ethanolamines (prostamides) are biologically active derivatives of arachidonic acid. Although available through different precursor phospholipids, there is considerable overlap between the biosynthetic pathways of arachidonic acid-derived eicosanoids and anandamide-derived prostamides. Prostamides exhibit physiological actions and are involved in ocular hypotension, smooth muscle contraction, and inflammatory pain. Although topical application of bimatoprost, a structural analog of prostaglandin F2α ethanolamide (PGF2α-EA), is currently a first-line treatment for ocular hypertension, the endogenous production of prostamides and their biochemical precursors in corneal tissue has not yet been reported. In this study, we report the presence of anandamide, palmitoyl-, stearoyl-, α-linolenoyl docosahexaenoyl-, linoleoyl-, and oleoyl-ethanolamines in rabbit cornea, and following treatment with anandamide, the formation of PGF2α-EA, PGE2-EA, PGD2-EA by corneal extracts (all analyzed by LC/ESI-MS/MS). A number of N-acyl phosphatidylethanolamines, precursors of anandamide and other fatty acyl ethanolamines, were also identified in corneal lipid extracts using ESI-MS/MS. These findings suggest that the prostamide and fatty acid ethanolamine pathways are operational in the cornea and may provide valuable insight into corneal physiology and their potential influence on adjacent tissues and the aqueous humor. PMID:26031663

  7. Cloning and expression of the tabtoxin biosynthetic region from Pseudomonas syringae.

    PubMed Central

    Kinscherf, T G; Coleman, R H; Barta, T M; Willis, D K

    1991-01-01

    Pseudomonas syringae BR2, a causal agent of bean wildfire, was subjected to Tn5 mutagenesis in an effort to isolate mutants unable to produce the beta-lactam antibiotic tabtoxin. Three of the tabtoxin-minus (Tox-) mutants generated appeared to have physically linked Tn5 insertions and retained their resistance to the active toxin form, tabtoxnine-beta-lactam (T beta L). The wild-type DNA corresponding to the mutated region was cloned and found to restore the Tn5 mutants to toxin production. The use of cloned DNA from the region as hybridization probes revealed that the region is highly conserved among tabtoxin-producing pathovars of P. syringae and that the region deletes at a relatively high frequency (10(-3)/CFU) in BR2. The Tox- deletion mutants also lost resistance to tabtoxinine-beta-lactam. A cosmid designated pRTBL823 restored toxin production and resistance to BR2 deletion mutants. This cosmid also converted the tabtoxin-naive P. syringae epiphyte Cit7 to toxin production and resistance, indicating that pRTBL823 contains a complete set of biosynthetic and resistance genes. Tox- derivatives of BR2 did not produce disease symptoms on bean. Clones that restored toxin production to both insertion and deletion mutants also restored the ability to cause disease. However, tabtoxin-producing Cit7 derivatives remained nonpathogenic on bean and tobacco, suggesting that tabtoxin production alone is not sufficient to cause disease. Images PMID:1648077

  8. Antimicrobial biosynthetic potential and genetic diversity of endophytic actinomycetes associated with medicinal plants.

    PubMed

    Gohain, Anwesha; Gogoi, Animesh; Debnath, Rajal; Yadav, Archana; Singh, Bhim P; Gupta, Vijai K; Sharma, Rajeev; Saikia, Ratul

    2015-10-01

    Endophytic actinomycetes are one of the primary groups that share symbiotic relationships with medicinal plants and are key reservoir of biologically active compounds. In this study, six selective medicinal plants were targeted for the first time for endophytic actinomycetes isolation from Gibbon Wild Life Sanctuary, Assam, India, during winter and summer and 76 isolates were obtained. The isolates were found to be prevalent in roots followed by stem and leaves. 16S rRNA gene sequence analysis revealed 16 genera, including rare genera, Verrucosispora, Isoptericola and Kytococcus, which have never been previously reported as endophytic. The genus Streptomyces (66%) was dominant in both seasons. Shannon's diversity index showed that Azadirachta indica (1.49), Rauwolfia serpentina (1.43) and Emblica officinalis (1.24) were relatively good habitat for endophytic actinomycetes. Antimicrobial strains showed prevalence of polyketide synthase (PKS) type-II (85%) followed by PKS type-I (14%) encoded in the genomes. Expression studies showed 12-fold upregulation of PKSII gene in seventh day of incubation for Streptomyces antibioticus (EAAG90). Our results emphasize that the actinomycetes assemblages within plant tissue exhibited biosynthetic systems encoding for important biologically active compounds. PMID:26347302

  9. Molecular and Biochemical Analysis of Chalcone Synthase from Freesia hybrid in Flavonoid Biosynthetic Pathway

    PubMed Central

    Sun, Wei; Meng, Xiangyu; Liang, Lingjie; Jiang, Wangshu; Huang, Yafei; He, Jing; Hu, Haiyan; Almqvist, Jonas; Gao, Xiang; Wang, Li

    2015-01-01

    Chalcone synthase (CHS) catalyzes the first committed step in the flavonoid biosynthetic pathway. In this study, the cDNA (FhCHS1) encoding CHS from Freesia hybrida was successfully isolated and analyzed. Multiple sequence alignments showed that both the conserved CHS active site residues and CHS signature sequence were found in the deduced amino acid sequence of FhCHS1. Meanwhile, crystallographic analysis revealed that protein structure of FhCHS1 is highly similar to that of alfalfa CHS2, and the biochemical analysis results indicated that it has an enzymatic role in naringenin biosynthesis. Moreover, quantitative real-time PCR was performed to detect the transcript levels of FhCHS1 in flowers and different tissues, and patterns of FhCHS1 expression in flowers showed significant correlation to the accumulation patterns of anthocyanin during flower development. To further characterize the functionality of FhCHS1, its ectopic expression in Arabidopsis thaliana tt4 mutants and Petunia hybrida was performed. The results showed that overexpression of FhCHS1 in tt4 mutants fully restored the pigmentation phenotype of the seed coats, cotyledons and hypocotyls, while transgenic petunia expressing FhCHS1 showed flower color alteration from white to pink. In summary, these results suggest that FhCHS1 plays an essential role in the biosynthesis of flavonoid in Freesia hybrida and may be used to modify the components of flavonoids in other plants. PMID:25742495

  10. Inhibition of the hexosamine biosynthetic pathway promotes castration-resistant prostate cancer.

    PubMed

    Kaushik, Akash K; Shojaie, Ali; Panzitt, Katrin; Sonavane, Rajni; Venghatakrishnan, Harene; Manikkam, Mohan; Zaslavsky, Alexander; Putluri, Vasanta; Vasu, Vihas T; Zhang, Yiqing; Khan, Ayesha S; Lloyd, Stacy; Szafran, Adam T; Dasgupta, Subhamoy; Bader, David A; Stossi, Fabio; Li, Hangwen; Samanta, Susmita; Cao, Xuhong; Tsouko, Efrosini; Huang, Shixia; Frigo, Daniel E; Chan, Lawrence; Edwards, Dean P; Kaipparettu, Benny A; Mitsiades, Nicholas; Weigel, Nancy L; Mancini, Michael; McGuire, Sean E; Mehra, Rohit; Ittmann, Michael M; Chinnaiyan, Arul M; Putluri, Nagireddy; Palapattu, Ganesh S; Michailidis, George; Sreekumar, Arun

    2016-01-01

    The precise molecular alterations driving castration-resistant prostate cancer (CRPC) are not clearly understood. Using a novel network-based integrative approach, here, we show distinct alterations in the hexosamine biosynthetic pathway (HBP) to be critical for CRPC. Expression of HBP enzyme glucosamine-phosphate N-acetyltransferase 1 (GNPNAT1) is found to be significantly decreased in CRPC compared with localized prostate cancer (PCa). Genetic loss-of-function of GNPNAT1 in CRPC-like cells increases proliferation and aggressiveness, in vitro and in vivo. This is mediated by either activation of the PI3K-AKT pathway in cells expressing full-length androgen receptor (AR) or by specific protein 1 (SP1)-regulated expression of carbohydrate response element-binding protein (ChREBP) in cells containing AR-V7 variant. Strikingly, addition of the HBP metabolite UDP-N-acetylglucosamine (UDP-GlcNAc) to CRPC-like cells significantly decreases cell proliferation, both in-vitro and in animal studies, while also demonstrates additive efficacy when combined with enzalutamide in-vitro. These observations demonstrate the therapeutic value of targeting HBP in CRPC. PMID:27194471

  11. Evolution of the Structure and Chromosomal Distribution of Histidine Biosynthetic Genes

    NASA Astrophysics Data System (ADS)

    Fani, Renato; Mori, Elena; Tamburini, Elena; Lazcano, Antonio

    1998-10-01

    A database of more than 100 histidine biosynthetic genes from different organisms belonging to the three primary domains has been analyzed, including those found in the now completely sequenced genomes of Haemophilus influenzae, Mycoplasma genitalium, Synechocystis sp., Methanococcus jannaschii, and Saccharomyces cerevisiae. The ubiquity of his genes suggests that it is a highly conserved pathway that was probably already present in the last common ancestor of all extant life. The chromosomal distribution of the his genes shows that the enterobacterial histidine operon structure is not the only possible organization, and that there is a diversity of gene arrays for the his pathway. Analysis of the available sequences shows that gene fusions (like those involved in the origin of the Escherichia coli and Salmonella typhimurium hisIE and hisB gene structures) are not universal. In contrast, the elongation event that led to the extant hisA gene from two homologous ancestral modules, as well as the subsequent paralogous duplication that originated hisF, appear to be irreversible and are conserved in all known organisms. The available evidence supports the hypothesis that histidine biosynthesis was assembled by a gene recruitment process.

  12. The effects of some polyamine biosynthetic inhibitors on growth and morphology of phytopathogenic fungi

    NASA Technical Reports Server (NTRS)

    Rajam, M. V.; Galston, A. W.

    1985-01-01

    We have studied the effects of two polyamine biosynthetic inhibitors, alpha-difluoromethylornithine (DFMO) and alpha-difluoromethylarginine (DFMA), and of polyamines (PAs), alone and in combination, on mycelial growth and morphology of four phytopathogenic fungi: Botrytis sp, B. cinerea, Rhizoctonia solani and Monilinia fructicola. The inhibitors were added to a Czapek agar medium to get final concentrations of 0.1, 0.5 and 1.0 mM. DFMO and DFMA, suicide inhibitors of ornithine decarboxylase (ODC) and arginine decarboxylase (ADC) respectively, inhibited mycelial growth strongly; the effect was generally more pronounced with DFMA than with DFMO, but each fungus had its own response pattern. The addition of the PAs putrescine (Put) and spermidine (Spd) to the culture medium resulted in a promotion of growth. In Botrytis sp and Monilinia fructicola exposed to inhibitors plus PAs, mycelial growth was actually increased above control values. Mycelial morphology was altered and cell size dramatically reduced in plates containing inhibitors alone, whereas with PAs alone, or in combination with inhibitors, morphology was normal, but cell length and diameters increased considerably. These results suggest that PAs are essential for growth in fungal mycelia. The inhibition caused by DFMA may be due to its arginase-mediated conversion to DFMO.

  13. Rational biosynthetic approaches for the production of new-to-nature compounds in fungi.

    PubMed

    Boecker, Simon; Zobel, Sophia; Meyer, Vera; Süssmuth, Roderich D

    2016-04-01

    Filamentous fungi have the ability to produce a wide range of secondary metabolites some of which are potent toxins whereas others are exploited as food additives or drugs. Fungal natural products still play an important role in the discovery of new chemical entities for potential use as pharmaceuticals. However, in most cases they cannot be directly used as drugs due to toxic side effects or suboptimal pharmacokinetics. To improve drug-like properties, including bioactivity and stability or to produce better precursors for semi-synthetic routes, one needs to generate non-natural derivatives from known fungal secondary metabolites. In this minireview, we describe past and recent biosynthetic approaches for the diversification of fungal natural products, covering examples from precursor-directed biosynthesis, mutasynthesis, metabolic engineering and biocombinatorial synthesis. To illustrate the current state-of-the-art, challenges and pitfalls, we lay particular emphasis on the class of fungal cyclodepsipeptides which have been studied longtime for product diversification and which are of pharmaceutical relevance as drugs. PMID:26872866

  14. Discovery of an unusual biosynthetic origin for circular proteins in legumes.

    PubMed

    Poth, Aaron G; Colgrave, Michelle L; Lyons, Russell E; Daly, Norelle L; Craik, David J

    2011-06-21

    Cyclotides are plant-derived proteins that have a unique cyclic cystine knot topology and are remarkably stable. Their natural function is host defense, but they have a diverse range of pharmaceutically important activities, including uterotonic activity and anti-HIV activity, and have also attracted recent interest as templates in drug design. Here we report an unusual biosynthetic origin of a precursor protein of a cyclotide from the butterfly pea, Clitoria ternatea, a representative member of the Fabaceae plant family. Unlike all previously reported cyclotides, the domain corresponding to the mature cyclotide from this Fabaceae plant is embedded within an albumin precursor protein. We confirmed the expression and correct processing of the cyclotide encoded by the Cter M precursor gene transcript following extraction from C. ternatea leaf and sequencing by tandem mass spectrometry. The sequence was verified by direct chemical synthesis and the peptide was found to adopt a classic knotted cyclotide fold as determined by NMR spectroscopy. Seven additional cyclotide sequences were also identified from C. ternatea leaf and flower, five of which were unique. Cter M displayed insecticidal activity against the cotton budworm Helicoverpa armigera and bound to phospholipid membranes, suggesting its activity is modulated by membrane disruption. The Fabaceae is the third largest family of flowering plants and many Fabaceous plants are of huge significance for human nutrition. Knowledge of Fabaceae cyclotide gene transcripts should enable the production of modified cyclotides in crop plants for a variety of agricultural or pharmaceutical applications, including plant-produced designer peptide drugs. PMID:21593408

  15. Sequencing and Analysis of the Biosynthetic Gene Cluster of the Lipopeptide Antibiotic Friulimicin in Actinoplanes friuliensis▿

    PubMed Central

    Müller, C.; Nolden, S.; Gebhardt, P.; Heinzelmann, E.; Lange, C.; Puk, O.; Welzel, K.; Wohlleben, W.; Schwartz, D.

    2007-01-01

    Actinoplanes friuliensis produces the lipopeptide antibiotic friulimicin, which is a cyclic peptide with one exocyclic amino acid linked to a branched-chain fatty acid acyl residue. The structural relationship to daptomycin and the excellent antibacterial performance of friulimicin make the antibiotic an attractive drug candidate. The complete friulimicin biosynthetic gene cluster of 24 open reading frames from A. friuliensis was sequenced and analyzed. In addition to genes for regulation, self-resistance, and transport, the cluster contains genes encoding peptide synthetases, proteins involved in the synthesis and linkage of the fatty acid component of the antibiotic, and proteins involved in the synthesis of the nonproteinogenic amino acids pipecolinic acid, methylaspartic acid, and 2,3-diaminobutyric acid. By using heterologous gene expression in Escherichia coli, we provide biochemical evidence for the stereoselective synthesis of l-pipecolinic acid by the deduced protein of the lysine cyclodeaminase gene pip. Furthermore, we show the involvement of the dabA and dabB genes in the biosynthesis of 2,3-diaminobutyric acid by gene inactivation and subsequent feeding experiments. PMID:17220414

  16. Interaction with the unfolded protein response reveals a role for stargazin in biosynthetic AMPA receptor transport.

    PubMed

    Vandenberghe, Wim; Nicoll, Roger A; Bredt, David S

    2005-02-01

    The transmembrane protein stargazin enhances levels of functional AMPA receptors at the neuronal plasma membrane and at synapses. To clarify the mechanism for this effect, we studied trafficking of the AMPA receptor subunit glutamate receptor 1 (GluR1) in transfected COS7 cells. GluR1 expressed poorly on the surface of these cells and was primarily retained in the endoplasmic reticulum (ER). Stargazin expression strongly increased the surface fraction of GluR1. This effect was not reduced by a dominant-negative dynamin mutant, suggesting that stargazin does not inhibit AMPA receptor endocytosis. Interestingly, upregulation of ER chaperones as part of the unfolded protein response (UPR) both mimicked and occluded the effect of stargazin, suggesting a role for stargazin in ER processing of AMPA receptors. Consistent with this idea, we detected UPR induction in cerebellar granule cells lacking stargazin. Finally, residual AMPA receptor currents in stargazin-deficient neurons were suppressed by inhibition of the UPR. These findings uncover a role for stargazin in AMPA receptor trafficking through the early compartments of the biosynthetic pathway. Furthermore, they provide evidence for modulation of AMPA receptor trafficking by the UPR. PMID:15689545

  17. Cloning and expression analyses of the anthocyanin biosynthetic genes in mulberry plants.

    PubMed

    Qi, Xiwu; Shuai, Qin; Chen, Hu; Fan, Li; Zeng, Qiwei; He, Ningjia

    2014-10-01

    Anthocyanins are natural food colorants produced by plants that play important roles in their growth and development. Mulberry fruits are rich in anthocyanins, which are the most important active components of mulberry and have many potentially beneficial effects on human health. The study of anthocyanin biosynthesis will bring benefits for quality improvement and industrial exploration of mulberry fruits. In the present study, nine putative genes involved in anthocyanin biosynthesis in mulberry plants were identified and cloned. Sequence analysis revealed that the mulberry anthocyanin biosynthetic genes were conserved and had counterparts in other plants. Spatial transcriptional analysis showed detectable expression of eight of these genes in different tissues. The results of expression and UPLC analyses in two mulberry cultivars with differently colored fruit indicated that anthocyanin concentrations correlated with the expression levels of genes associated with anthocyanin biosynthesis including CHS1, CHI, F3H1, F3'H1, and ANS during the fruit ripening process. The present studies provide insight into anthocyanin biosynthesis in mulberry plants and may facilitate genetic engineering for improvement of the anthocyanin content in mulberry fruit. PMID:24748075

  18. A biosynthetic model of cytochrome c oxidase as an electrocatalyst for oxygen reduction.

    PubMed

    Mukherjee, Sohini; Mukherjee, Arnab; Bhagi-Damodaran, Ambika; Mukherjee, Manjistha; Lu, Yi; Dey, Abhishek

    2015-01-01

    Creating an artificial functional mimic of the mitochondrial enzyme cytochrome c oxidase (CcO) has been a long-term goal of the scientific community as such a mimic will not only add to our fundamental understanding of how CcO works but may also pave the way for efficient electrocatalysts for oxygen reduction in hydrogen/oxygen fuel cells. Here we develop an electrocatalyst for reducing oxygen to water under ambient conditions. We use site-directed mutants of myoglobin, where both the distal Cu and the redox-active tyrosine residue present in CcO are modelled. In situ Raman spectroscopy shows that this catalyst features very fast electron transfer rates, facile oxygen binding and O-O bond lysis. An electron transfer shunt from the electrode circumvents the slow dissociation of a ferric hydroxide species, which slows down native CcO (bovine 500 s(-1)), allowing electrocatalytic oxygen reduction rates of 5,000 s(-1) for these biosynthetic models. PMID:26455726

  19. The lysine biosynthetic enzyme Lys4 influences iron metabolism, mitochondrial function and virulence in Cryptococcus neoformans.

    PubMed

    Do, Eunsoo; Park, Minji; Hu, Guanggan; Caza, Mélissa; Kronstad, James W; Jung, Won Hee

    2016-09-01

    The lysine biosynthesis pathway via α-aminoadipate in fungi is considered an attractive target for antifungal drugs due to its absence in mammalian hosts. The iron-sulfur cluster-containing enzyme homoaconitase converts homocitrate to homoisocitrate in the lysine biosynthetic pathway, and is encoded by LYS4 in the model yeast Saccharomyces cerevisiae. In this study, we identified the ortholog of LYS4 in the human fungal pathogen, Cryptococcus neoformans, and found that LYS4 expression is regulated by iron levels and by the iron-related transcription factors Hap3 and HapX. Deletion of the LYS4 gene resulted in lysine auxotrophy suggesting that Lys4 is essential for lysine biosynthesis. Our study also revealed that lysine uptake was mediated by two amino acid permeases, Aap2 and Aap3, and influenced by nitrogen catabolite repression (NCR). Furthermore, the lys4 mutant showed increased sensitivity to oxidative stress, agents that challenge cell wall/membrane integrity, and azole antifungal drugs. We showed that these phenotypes were due in part to impaired mitochondrial function as a result of LYS4 deletion, which we propose disrupts iron homeostasis in the organelle. The combination of defects are consistent with our observation that the lys4 mutant was attenuated virulence in a mouse inhalation model of cryptococcosis. PMID:27353379

  20. A biosynthetic model of cytochrome c oxidase as an electrocatalyst for oxygen reduction

    PubMed Central

    Mukherjee, Sohini; Mukherjee, Arnab; Bhagi-Damodaran, Ambika; Mukherjee, Manjistha; Lu, Yi; Dey, Abhishek

    2015-01-01

    Creating an artificial functional mimic of the mitochondrial enzyme cytochrome c oxidase (CcO) has been a long-term goal of the scientific community as such a mimic will not only add to our fundamental understanding of how CcO works but may also pave the way for efficient electrocatalysts for oxygen reduction in hydrogen/oxygen fuel cells. Here we develop an electrocatalyst for reducing oxygen to water under ambient conditions. We use site-directed mutants of myoglobin, where both the distal Cu and the redox-active tyrosine residue present in CcO are modelled. In situ Raman spectroscopy shows that this catalyst features very fast electron transfer rates, facile oxygen binding and O–O bond lysis. An electron transfer shunt from the electrode circumvents the slow dissociation of a ferric hydroxide species, which slows down native CcO (bovine 500 s−1), allowing electrocatalytic oxygen reduction rates of 5,000 s−1 for these biosynthetic models. PMID:26455726

  1. Comparison of carotenoid accumulation and biosynthetic gene expression between Valencia and Rohde Red Valencia sweet oranges.

    PubMed

    Wei, Xu; Chen, Chunxian; Yu, Qibin; Gady, Antoine; Yu, Yuan; Liang, Guolu; Gmitter, Frederick G

    2014-10-01

    Carotenoid accumulation and biosynthetic gene expression levels during fruit maturation were compared between ordinary Valencia (VAL) and its more deeply colored mutant Rohde Red Valencia orange (RRV). The two cultivars exhibited different carotenoid profiles and regulatory mechanisms in flavedo and juice sacs, respectively. In flavedo, there was uncoordinated carotenoid accumulation and gene expression in RRV during green stages, which might be related to the expression of certain gene(s) in the MEP (methylerythritol phosphate) pathway. The carotenoid biosynthesis pathway shifting from α,β-xanthophylls to β,β-xanthophylls synthesis occurred in RRV earlier than VAL during orange stages. In juice sacs, the low carotenoid content in both cultivars coincided with low expression of LCYE-Contig03 and LCYE-Contig24 during green stages, suggesting LCYE might be a limiting step for carotenoid accumulation. VAL mainly accumulated violaxanthin, but RRV accumulated β-cryptoxanthin and violaxanthin during orange stages, which corresponded to differences in juice color. Several upstream genes (PDS-Contig17, LCYB-Contig19, and ZDS members) and a downstream gene (ZEP) were expressed at higher levels in RRV than VAL, which might be responsible for greater accumulation of β-cryptoxanthin and violaxanthin in RRV, respectively. PMID:25219303

  2. Bioactivity-guided genome mining reveals the lomaiviticin biosynthetic gene cluster in Salinispora tropica

    PubMed Central

    Kersten, Roland D.; Lane, Amy L.; Nett, Markus; Richter, Taylor K. S.; Duggan, Brendan M.; Dorrestein, Pieter C.

    2013-01-01

    The use of genome sequences has become routine in guiding the discovery and identification of microbial natural products and their biosynthetic pathways. In silico prediction of molecular features, such as metabolic building blocks, physico-chemical properties or biological functions, from orphan gene clusters has opened up the characterization of many new chemo- and genotypes in genome mining approaches. Here, we guided our genome mining of two predicted enediyne pathways in Salinispora tropica CNB-440 by a DNA interference bioassay to isolate DNA-targeting enediyne polyketides. An organic extract of S. tropica showed DNA-interference activity that surprisingly was not abolished in genetic mutants of the targeted enediyne pathways, ST_pks1 and spo. Instead we showed that the product of the orphan type II polyketide synthase pathway, ST_pks2, is solely responsible for the DNA-interfering activity of the parent strain. Subsequent comparative metabolic profiling revealed the lomaiviticins, glycosylated diazofluorene polyketides, as the ST_pks2 products. This study marks the first report of the 59 open reading frame lomaiviticin gene cluster (lom) and supports the biochemical logic of their dimeric construction via a pathway related to the kinamycin monomer. PMID:23649992

  3. Marine Actinobacteria from the Gulf of California: diversity, abundance and secondary metabolite biosynthetic potential

    PubMed Central

    Becerril-Espinosa, Amayaly; Freel, Kelle C.; Jensen, Paul R.

    2015-01-01

    The Gulf of California is a coastal marine ecosystem characterized as having abundant biological resources and a high level of endemism. In this work we report the isolation and characterization of Actinobacteria from different sites in the western Gulf of California. We collected 126 sediment samples and isolated on average 3.1–38.3 Actinobacterial strains from each sample. Phylogenetic analysis of 136 strains identified them as members of the genera Actinomadura, Micromonospora, Nocardiopsis, Nonomuraea, Saccharomonospora, Salinispora, Streptomyces and Verrucosispora. These strains were grouped into 26–56 operational taxonomic units (OTUs) based on 16S rRNA gene sequence identities of 98–100 %. At 98 % sequence identity, three OTUs appear to represent new taxa while nine (35 %) have only been reported from marine environments. Sixty-three strains required seawater for growth. These fell into two OTUs at the 98 % identity level and include one that failed to produce aerial hyphae and was only distantly related (≤95.5 % 16S identity) to any previously cultured Streptomyces sp. Phylogenetic analyses of ketosynthase domains associated with polyketide synthase genes revealed sequences that ranged from 55 to 99 % nucleotide identity to experimentally characterized biosynthetic pathways suggesting that some may be associated with the production of new secondary metabolites. These results indicate that marine sediments from the Gulf of California harbor diverse Actinobacterial taxa with the potential to produce new secondary metabolites. PMID:23229438

  4. The ethylene biosynthetic and perception machinery is differentially expressed during endosperm and embryo development in maize.

    PubMed

    Gallie, D R; Young, T E

    2004-04-01

    The maize endosperm undergoes programmed cell death late in its development so that, with the exception of the aleurone layer, the tissue is dead by the time the kernel matures. Although ethylene is known to regulate the onset of endosperm cell death, the temporal and spatial control of the ethylene biosynthetic and perception machinery during maize endosperm development has not been examined. In this study, we report the isolation of the maize gene families for ACC synthase, ACC oxidase, the ethylene receptor, and EIN2 and EIL, which act downstream of the receptor. We show that ACC oxidase is expressed primarily in the endosperm, and only at low levels in the developing embryo late in its development. ACC synthase is expressed throughout endosperm development but, in contrast to ACC oxidase, it is transiently expressed to a significantly higher level in the developing embryo at a time that corresponds with the onset of endosperm cell death. Only two ethylene receptor gene families were identified in maize, in contrast to the five types previously identified in Arabidopsis. Members of both ethylene receptor families were expressed to substantially higher levels in the developing embryo than in the endosperm, as were members of the EIN2 and EIL gene families. These results suggest that the endosperm and embryo both contribute to the synthesis of ethylene, and they provide a basis for understanding why the developing endosperm is especially sensitive to ethylene-induced cell death while the embryo is protected. PMID:14760521

  5. Discovery of cahuitamycins as biofilm inhibitors derived from a convergent biosynthetic pathway

    PubMed Central

    Park, Sung Ryeol; Tripathi, Ashootosh; Wu, Jianfeng; Schultz, Pamela J.; Yim, Isaiah; McQuade, Thomas J.; Yu, Fengan; Arevang, Carl-Johan; Mensah, Abraham Y.; Tamayo-Castillo, Giselle; Xi, Chuanwu; Sherman, David H.

    2016-01-01

    Pathogenic microorganisms often have the ability to attach to a surface, building a complex matrix where they colonize to form a biofilm. This cellular superstructure can display increased resistance to antibiotics and cause serious, persistent health problems in humans. Here we describe a high-throughput in vitro screen to identify inhibitors of Acinetobacter baumannii biofilms using a library of natural product extracts derived from marine microbes. Analysis of extracts derived from Streptomyces gandocaensis results in the discovery of three peptidic metabolites (cahuitamycins A–C), with cahuitamycin C being the most effective inhibitor (IC50=14.5 μM). Biosynthesis of cahuitamycin C proceeds via a convergent biosynthetic pathway, with one of the steps apparently being catalysed by an unlinked gene encoding a 6-methylsalicylate synthase. Efforts to assess starter unit diversification through selective mutasynthesis lead to production of unnatural analogues cahuitamycins D and E of increased potency (IC50=8.4 and 10.5 μM). PMID:26880271

  6. Cecropia peltata Accumulates Starch or Soluble Glycogen by Differentially Regulating Starch Biosynthetic Genes[W][OA

    PubMed Central

    Bischof, Sylvain; Umhang, Martin; Eicke, Simona; Streb, Sebastian; Qi, Weihong; Zeeman, Samuel C.

    2013-01-01

    The branched glucans glycogen and starch are the most widespread storage carbohydrates in living organisms. The production of semicrystalline starch granules in plants is more complex than that of small, soluble glycogen particles in microbes and animals. However, the factors determining whether glycogen or starch is formed are not fully understood. The tropical tree Cecropia peltata is a rare example of an organism able to make either polymer type. Electron micrographs and quantitative measurements show that glycogen accumulates to very high levels in specialized myrmecophytic structures (Müllerian bodies), whereas starch accumulates in leaves. Compared with polymers comprising leaf starch, glycogen is more highly branched and has shorter branches—factors that prevent crystallization and explain its solubility. RNA sequencing and quantitative shotgun proteomics reveal that isoforms of all three classes of glucan biosynthetic enzyme (starch/glycogen synthases, branching enzymes, and debranching enzymes) are differentially expressed in Müllerian bodies and leaves, providing a system-wide view of the quantitative programming of storage carbohydrate metabolism. This work will prompt targeted analysis in model organisms and cross-species comparisons. Finally, as starch is the major carbohydrate used for food and industrial applications worldwide, these data provide a basis for manipulating starch biosynthesis in crops to synthesize tailor-made polyglucans. PMID:23632447

  7. A cell-free framework for rapid biosynthetic pathway prototyping and enzyme discovery.

    PubMed

    Karim, Ashty S; Jewett, Michael C

    2016-07-01

    Speeding up design-build-test (DBT) cycles is a fundamental challenge facing biochemical engineering. To address this challenge, we report a new cell-free protein synthesis driven metabolic engineering (CFPS-ME) framework for rapid biosynthetic pathway prototyping. In our framework, cell-free cocktails for synthesizing target small molecules are assembled in a mix-and-match fashion from crude cell lysates either containing selectively enriched pathway enzymes from heterologous overexpression or directly producing pathway enzymes in lysates by CFPS. As a model, we apply our approach to n-butanol biosynthesis showing that Escherichia coli lysates support a highly active 17-step CoA-dependent n-butanol pathway in vitro. The elevated degree of flexibility in the cell-free environment allows us to manipulate physiochemical conditions, access enzymatic nodes, discover new enzymes, and prototype enzyme sets with linear DNA templates to study pathway performance. We anticipate that CFPS-ME will facilitate efforts to define, manipulate, and understand metabolic pathways for accelerated DBT cycles without the need to reengineer organisms. PMID:26996382

  8. The Inositol-3-Phosphate Synthase Biosynthetic Enzyme Has Distinct Catalytic and Metabolic Roles

    PubMed Central

    Frej, Anna D.; Clark, Jonathan; Le Roy, Caroline I.; Lilla, Sergio; Thomason, Peter A.; Otto, Grant P.; Churchill, Grant; Insall, Robert H.; Claus, Sandrine P.; Hawkins, Phillip; Stephens, Len

    2016-01-01

    Inositol levels, maintained by the biosynthetic enzyme inositol-3-phosphate synthase (Ino1), are altered in a range of disorders, including bipolar disorder and Alzheimer's disease. To date, most inositol studies have focused on the molecular and cellular effects of inositol depletion without considering Ino1 levels. Here we employ a simple eukaryote, Dictyostelium discoideum, to demonstrate distinct effects of loss of Ino1 and inositol depletion. We show that loss of Ino1 results in an inositol auxotrophy that can be rescued only partially by exogenous inositol. Removal of inositol supplementation from the ino1− mutant resulted in a rapid 56% reduction in inositol levels, triggering the induction of autophagy, reduced cytokinesis, and substrate adhesion. Inositol depletion also caused a dramatic generalized decrease in phosphoinositide levels that was rescued by inositol supplementation. However, loss of Ino1 triggered broad metabolic changes consistent with the induction of a catabolic state that was not rescued by inositol supplementation. These data suggest a metabolic role for Ino1 that is independent of inositol biosynthesis. To characterize this role, an Ino1 binding partner containing SEL1L1 domains (Q54IX5) and having homology to mammalian macromolecular complex adaptor proteins was identified. Our findings therefore identify a new role for Ino1, independent of inositol biosynthesis, with broad effects on cell metabolism. PMID:26951199

  9. The Inositol-3-Phosphate Synthase Biosynthetic Enzyme Has Distinct Catalytic and Metabolic Roles.

    PubMed

    Frej, Anna D; Clark, Jonathan; Le Roy, Caroline I; Lilla, Sergio; Thomason, Peter A; Otto, Grant P; Churchill, Grant; Insall, Robert H; Claus, Sandrine P; Hawkins, Phillip; Stephens, Len; Williams, Robin S B

    2016-05-15

    Inositol levels, maintained by the biosynthetic enzyme inositol-3-phosphate synthase (Ino1), are altered in a range of disorders, including bipolar disorder and Alzheimer's disease. To date, most inositol studies have focused on the molecular and cellular effects of inositol depletion without considering Ino1 levels. Here we employ a simple eukaryote, Dictyostelium discoideum, to demonstrate distinct effects of loss of Ino1 and inositol depletion. We show that loss of Ino1 results in an inositol auxotrophy that can be rescued only partially by exogenous inositol. Removal of inositol supplementation from the ino1(-) mutant resulted in a rapid 56% reduction in inositol levels, triggering the induction of autophagy, reduced cytokinesis, and substrate adhesion. Inositol depletion also caused a dramatic generalized decrease in phosphoinositide levels that was rescued by inositol supplementation. However, loss of Ino1 triggered broad metabolic changes consistent with the induction of a catabolic state that was not rescued by inositol supplementation. These data suggest a metabolic role for Ino1 that is independent of inositol biosynthesis. To characterize this role, an Ino1 binding partner containing SEL1L1 domains (Q54IX5) and having homology to mammalian macromolecular complex adaptor proteins was identified. Our findings therefore identify a new role for Ino1, independent of inositol biosynthesis, with broad effects on cell metabolism. PMID:26951199

  10. Identification of a dTDP-rhamnose biosynthetic pathway that oscillates with the molting cycle in Caenorhabditis elegans

    PubMed Central

    Feng, Likui; Shou, Qingyao; Butcher, Rebecca A.

    2016-01-01

    L-Rhamnose is a common component of cell-wall polysaccharides, glycoproteins and some natural products in bacteria and plants, but is rare in fungi and animals. In the present study, we identify and characterize a biosynthetic pathway for dTDP-rhamnose in Caenorhabditis elegans that is highly conserved across nematode species. We show that RML-1 activates glucose 1-phosphate (Glc-1-P) in the presence of either dTTP or UTP to yield dTDP-glucose or UDP-glucose, respectively. RML-2 is a dTDP-glucose 4,6-dehydratase, converting dTDP-glucose into dTDP-4-keto-6-deoxyglucose. Using mass spectrometry and NMR spectroscopy, we demonstrate that coincubation of dTDP-4-keto-6-deoxyglucose with RML-3 (3,5-epimerase) and RML-4 (4-keto-reductase) produces dTDP-rhamnose. RML-4 could only be expressed and purified in an active form through co-expression with a co-regulated protein, RML-5, which forms a complex with RML-4. Analysis of the sugar nucleotide pool in C. elegans established the presence of dTDP-rhamnose in vivo. Targeting the expression of the rhamnose biosynthetic genes by RNAi resulted in significant reductions in dTDP-rhamnose, but had no effect on the biosynthesis of a closely related sugar, ascarylose, found in the ascaroside pheromones. Therefore, the rhamnose and ascarylose biosynthetic pathways are distinct. We also show that transcriptional reporters for the rhamnose biosynthetic genes are expressed highly in the embryo, in the hypodermis during molting cycles and in the hypodermal seam cells specifically before the molt to the stress-resistant dauer larval stage. These expression patterns suggest that rhamnose biosynthesis may play an important role in hypodermal development or the production of the cuticle or surface coat during molting. PMID:27009306

  11. The biosynthetic routes for carbon monoxide and cyanide in the Ni-Fe active site of hydrogenases are different.

    PubMed

    Roseboom, Winfried; Blokesch, Melanie; Böck, August; Albracht, Simon P J

    2005-01-17

    The incorporation of carbon into the carbon monoxide and cyanide ligands of [NiFe]-hydrogenases has been investigated by using (13)C labelling in infrared studies of the Allochromatium vinosum enzyme and by (14)C labelling experiments with overproduced Hyp proteins from Escherichia coli. The results suggest that the biosynthetic routes of the carbon monoxide and cyanide ligands in [NiFe]-hydrogenases are different. PMID:15642360

  12. Identification of a dTDP-rhamnose biosynthetic pathway that oscillates with the molting cycle in Caenorhabditis elegans.

    PubMed

    Feng, Likui; Shou, Qingyao; Butcher, Rebecca A

    2016-06-01

    L-Rhamnose is a common component of cell-wall polysaccharides, glycoproteins and some natural products in bacteria and plants, but is rare in fungi and animals. In the present study, we identify and characterize a biosynthetic pathway for dTDP-rhamnose in Caenorhabditis elegans that is highly conserved across nematode species. We show that RML-1 activates glucose 1-phosphate (Glc-1-P) in the presence of either dTTP or UTP to yield dTDP-glucose or UDP-glucose, respectively. RML-2 is a dTDP-glucose 4,6-dehydratase, converting dTDP-glucose into dTDP-4-keto-6-deoxyglucose. Using mass spectrometry and NMR spectroscopy, we demonstrate that coincubation of dTDP-4-keto-6-deoxyglucose with RML-3 (3,5-epimerase) and RML-4 (4-keto-reductase) produces dTDP-rhamnose. RML-4 could only be expressed and purified in an active form through co-expression with a co-regulated protein, RML-5, which forms a complex with RML-4. Analysis of the sugar nucleotide pool in C. elegans established the presence of dTDP-rhamnose in vivo Targeting the expression of the rhamnose biosynthetic genes by RNAi resulted in significant reductions in dTDP-rhamnose, but had no effect on the biosynthesis of a closely related sugar, ascarylose, found in the ascaroside pheromones. Therefore, the rhamnose and ascarylose biosynthetic pathways are distinct. We also show that transcriptional reporters for the rhamnose biosynthetic genes are expressed highly in the embryo, in the hypodermis during molting cycles and in the hypodermal seam cells specifically before the molt to the stress-resistant dauer larval stage. These expression patterns suggest that rhamnose biosynthesis may play an important role in hypodermal development or the production of the cuticle or surface coat during molting. PMID:27009306

  13. Characterization of CYP76M5–8 Indicates Metabolic Plasticity within a Plant Biosynthetic Gene Cluster*

    PubMed Central

    Wang, Qiang; Hillwig, Matthew L.; Okada, Kazunori; Yamazaki, Kohei; Wu, Yisheng; Swaminathan, Sivakumar; Yamane, Hisakazu; Peters, Reuben J.

    2012-01-01

    Recent reports have revealed genomic clustering of enzymatic genes for particular biosynthetic pathways in plant specialized/secondary metabolism. Rice (Oryza sativa) carries two such clusters for production of antimicrobial diterpenoid phytoalexins, with the cluster on chromosome 2 containing four closely related/homologous members of the cytochrome P450 CYP76M subfamily (CYP76M5–8). Notably, the underlying evolutionary expansion of these CYP appears to have occurred after assembly of the ancestral biosynthetic gene cluster, suggesting separate roles. It has been demonstrated that CYP76M7 catalyzes C11α-hydroxylation of ent-cassadiene, and presumably mediates an early step in biosynthesis of the derived phytocassane class of phytoalexins. Here we report biochemical characterization of CYP76M5, -6, and -8. Our results indicate that CYP76M8 is a multifunctional/promiscuous hydroxylase, with CYP76M5 and -7 seeming to provide only redundant activity, while CYP76M6 seems to provide both redundant and novel activity, relative to CYP76M8. RNAi-mediated double knockdown of CYP76M7 and -8 suppresses elicitor inducible phytocassane production, indicating a role for these monooxygenases in phytocassane biosynthesis. In addition, our data suggests that CYP76M5, -6, and -8 may play redundant roles in production of the oryzalexin class of phytoalexins as well. Intriguingly, the preceding diterpene synthase for oryzalexin biosynthesis, unlike that for the phytocassanes, is not found in the chromosome 2 diterpenoid biosynthetic gene cluster. Accordingly, our results not only uncover a complex evolutionary history, but also further suggest some intriguing differences between plant biosynthetic gene clusters and the seemingly similar microbial operons. The implications for the underlying metabolic evolution of plants are then discussed. PMID:22215681

  14. Characterization of CYP76M5-8 indicates metabolic plasticity within a plant biosynthetic gene cluster.

    PubMed

    Wang, Qiang; Hillwig, Matthew L; Okada, Kazunori; Yamazaki, Kohei; Wu, Yisheng; Swaminathan, Sivakumar; Yamane, Hisakazu; Peters, Reuben J

    2012-02-24

    Recent reports have revealed genomic clustering of enzymatic genes for particular biosynthetic pathways in plant specialized/secondary metabolism. Rice (Oryza sativa) carries two such clusters for production of antimicrobial diterpenoid phytoalexins, with the cluster on chromosome 2 containing four closely related/homologous members of the cytochrome P450 CYP76M subfamily (CYP76M5-8). Notably, the underlying evolutionary expansion of these CYP appears to have occurred after assembly of the ancestral biosynthetic gene cluster, suggesting separate roles. It has been demonstrated that CYP76M7 catalyzes C11α-hydroxylation of ent-cassadiene, and presumably mediates an early step in biosynthesis of the derived phytocassane class of phytoalexins. Here we report biochemical characterization of CYP76M5, -6, and -8. Our results indicate that CYP76M8 is a multifunctional/promiscuous hydroxylase, with CYP76M5 and -7 seeming to provide only redundant activity, while CYP76M6 seems to provide both redundant and novel activity, relative to CYP76M8. RNAi-mediated double knockdown of CYP76M7 and -8 suppresses elicitor inducible phytocassane production, indicating a role for these monooxygenases in phytocassane biosynthesis. In addition, our data suggests that CYP76M5, -6, and -8 may play redundant roles in production of the oryzalexin class of phytoalexins as well. Intriguingly, the preceding diterpene synthase for oryzalexin biosynthesis, unlike that for the phytocassanes, is not found in the chromosome 2 diterpenoid biosynthetic gene cluster. Accordingly, our results not only uncover a complex evolutionary history, but also further suggest some intriguing differences between plant biosynthetic gene clusters and the seemingly similar microbial operons. The implications for the underlying metabolic evolution of plants are then discussed. PMID:22215681

  15. Identification of (2S,3S)-β-Methyltryptophan as the Real Biosynthetic Intermediate of Antitumor Agent Streptonigrin

    PubMed Central

    Kong, Dekun; Zou, Yi; Zhang, Zhang; Xu, Fei; Brock, Nelson L.; Zhang, Liping; Deng, Zixin; Lin, Shuangjun

    2016-01-01

    Streptonigrin is a potent antitumor antibiotic, active against a wide range of mammalian tumor cells. It was reported that its biosynthesis relies on (2S,3R)-β-methyltryptophan as an intermediate. In this study, the biosynthesis of (2S,3R)-β-methyltryptophan and its isomer (2S,3S)-β-methyltryptophan by enzymes from the streptonigrin biosynthetic pathway is demonstrated. StnR is a pyridoxal 5′-phosphate (PLP)-dependent aminotransferase that catalyzes a transamination between L-tryptophan and β-methyl indolepyruvate. StnQ1 is an S-adenosylmethionine (SAM)-dependent C-methyltransferase and catalyzes β-methylation of indolepyruvate to generate (R)-β-methyl indolepyruvate. Although StnR exhibited a significant preference for (S)-β-methyl indolepyruvate over the (R)-epimer, StnQ1 and StnR together catalyze (2S,3R)-β-methyltryptophan formation from L-tryptophan. StnK3 is a cupin superfamily protein responsible for conversion of (R)-β-methyl indolepyruvate to its (S)-epimer and enables (2S,3S)-β-methyltryptophan biosynthesis from L-tryptophan when combined with StnQ1 and StnR. Most importantly, (2S,3S)-β-methyltryptophan was established as the biosynthetic intermediate of the streptonigrin pathway by feeding experiments with a knockout mutant, contradicting the previous proposal that stated (2S,3R)-β-methyltryptophan as the intermediate. These data set the stage for the complete elucidation of the streptonigrin biosynthetic pathway, which would unlock the potential of creating new streptonigrin analogues by genetic manipulation of the biosynthetic machinery. PMID:26847951

  16. Molecular characterization of tocopherol biosynthetic genes in sweetpotato that respond to stress and activate the tocopherol production in tobacco.

    PubMed

    Ji, Chang Yoon; Kim, Yun-Hee; Kim, Ho Soo; Ke, Qingbo; Kim, Gun-Woo; Park, Sung-Chul; Lee, Haeng-Soon; Jeong, Jae Cheol; Kwak, Sang-Soo

    2016-09-01

    Tocopherol (vitamin E) is a chloroplast lipid that is presumed to be involved in the plant response to oxidative stress. In this study, we isolated and characterized five tocopherol biosynthetic genes from sweetpotato (Ipomoea batatas [L.] Lam) plants, including genes encoding 4-hydroxyphenylpyruvate dioxygenase (IbHPPD), homogentisate phytyltransferase (IbHPT), 2-methyl-6-phytylbenzoquinol methyltransferase (IbMPBQ MT), tocopherol cyclase (IbTC) and γ-tocopherol methyltransferase (IbTMT). Fluorescence microscope analysis indicated that four proteins localized into the chloroplast, whereas IbHPPD observed in the nuclear. Quantitative RT-PCR analysis revealed that the expression patterns of the five tocopherol biosynthetic genes varied in different plant tissues and under different stress conditions. All five genes were highly expressed in leaf tissues, whereas IbHPPD and IbHPT were highly expressed in the thick roots. The expression patterns of these five genes significantly differed in response to PEG, NaCl and H2O2-mediated oxidative stress. IbHPPD was strongly induced following PEG and H2O2 treatment and IbHPT was strongly induced following PEG treatment, whereas IbMPBQ MT and IbTC were highly expressed following NaCl treatment. Upon infection of the bacterial pathogen Pectobacterium chrysanthemi, the expression of IbHPPD increased sharply in sweetpotato leaves, whereas the expression of the other genes was reduced or unchanged. Additionally, transient expression of the five tocopherol biosynthetic genes in tobacco (Nicotiana bentamiana) leaves resulted in increased transcript levels of the transgenes expressions and tocopherol production. Therefore, our results suggested that the five tocopherol biosynthetic genes of sweetpotato play roles in the stress defense response as transcriptional regulators of the tocopherol production. PMID:27156136

  17. Impairment of chondrocyte biosynthetic activity by exposure to 3-tesla high-field magnetic resonance imaging is temporary.

    PubMed

    Sunk, Ilse-Gerlinde; Trattnig, Siegfried; Graninger, Winfried B; Amoyo, Love; Tuerk, Birgit; Steiner, Carl-Walter; Smolen, Josef S; Bobacz, Klaus

    2006-01-01

    The influence of magnetic resonance imaging (MRI) devices at high field strengths on living tissues is unknown. We investigated the effects of a 3-tesla electromagnetic field (EMF) on the biosynthetic activity of bovine articular cartilage. Bovine articular cartilage was obtained from juvenile and adult animals. Whole joints or cartilage explants were subjected to a pulsed 3-tesla EMF; controls were left unexposed. Synthesis of sulfated glycosaminoglycans (sGAGs) was measured by using [35S]sulfate incorporation; mRNA encoding the cartilage markers aggrecan and type II collagen, as well as IL-1beta, were analyzed by RT-PCR. Furthermore, effects of the 3-tesla EMF were determined over the course of time directly after exposure (day 0) and at days 3 and 6. In addition, the influence of a 1.5-tesla EMF on cartilage sGAG synthesis was evaluated. Chondrocyte cell death was assessed by staining with Annexin V and TdT-mediated dUTP nick end labelling (TUNEL). Exposure to the EMF resulted in a significant decrease in cartilage macromolecule synthesis. Gene expression of both aggrecan and IL-1beta, but not of collagen type II, was reduced in comparison with controls. Staining with Annexin V and TUNEL revealed no evidence of cell death. Interestingly, chondrocytes regained their biosynthetic activity within 3 days after exposure, as shown by proteoglycan synthesis rate and mRNA expression levels. Cartilage samples exposed to a 1.5-tesla EMF remained unaffected. Although MRI devices with a field strength of more than 1.5 T provide a better signal-to-noise ratio and thereby higher spatial resolution, their high field strength impairs the biosynthetic activity of articular chondrocytes in vitro. Although this decrease in biosynthetic activity seems to be transient, articular cartilage exposed to high-energy EMF may become vulnerable to damage. PMID:16831232

  18. Genomics of pyrrolnitrin biosynthetic loci: evidence for conservation and whole-operon mobility within gram-negative bacteria.

    PubMed

    Costa, Rodrigo; van Aarle, Ingrid M; Mendes, Rodrigo; van Elsas, Jan Dirk

    2009-01-01

    Pyrrolnitrin (PRN) is a tryptophan-derived secondary metabolite produced by a narrow range of gram-negative bacteria. The PRN biosynthesis by rhizobacteria presumably has a key role in their life strategies and in the biocontrol of plant diseases. The biosynthetic operon that encodes the pathway that converts tryptophan to PRN is composed of four genes, prnA through D, whose diversity, genomic context and spread over bacterial genomes are poorly understood. Therefore, we launched an endeavour aimed at retrieving, by in vitro and in silico means, diverse bacteria carrying the prnABCD biosynthetic loci in their genomes. Analysis of polymorphisms of the prnD gene sequences revealed a high level of conservation between Burkholderia, Pseudomonas and Serratia spp. derived sequences. Whole-operon- and prnD-based phylogeny resulted in tree topologies that are incongruent with the taxonomic status of the evaluated strains as predicted by 16S rRNA gene phylogeny. The genomic composition of c. 20 kb DNA fragments containing the PRN operon varied in different strains. Highly conserved and distinct transposase-encoding genes surrounding the PRN biosynthetic operons of Burkholderia pseudomallei strains were found. A prnABCD-deprived genomic region in B. pseudomallei strain K96243 contained the same gene composition as, and shared high homology with, the flanking regions of the PRN operon in B. pseudomallei strains 668, 1106a and 1710b. Our results strongly suggest that the PRN biosynthetic operon is mobile. The extent, frequency and promiscuity of this mobility remain to be understood. PMID:18793314

  19. Variation in nucleotide sequence of TRI1 in 13 trichothecene-producing species of Fusarium: evidence for a complex evolutionary history of a mycotoxin biosynthetic locus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Trichothecenes are mycotoxins produced by several genera of fungi, including some agriculturally important Fusarium species. In the two species, Fusarium graminearum and F. sporotrichioides, that have been examined most thoroughly, trichothecene biosynthetic enzymes are encoded at three loci: (1) ...

  20. eSNaPD: a versatile, web-based bioinformatics platform for surveying and mining natural product biosynthetic diversity from metagenomes.

    PubMed

    Reddy, Boojala Vijay B; Milshteyn, Aleksandr; Charlop-Powers, Zachary; Brady, Sean F

    2014-08-14

    Environmental Surveyor of Natural Product Diversity (eSNaPD) is a web-based bioinformatics and data aggregation platform that aids in the discovery of gene clusters encoding both novel natural products and new congeners of medicinally relevant natural products using (meta)genomic sequence data. Using PCR-generated sequence tags, the eSNaPD data-analysis pipeline profiles biosynthetic diversity hidden within (meta)genomes by comparing sequence tags to a reference data set of characterized gene clusters. Sample mapping, molecule discovery, library mapping, and new clade visualization modules facilitate the interrogation of large (meta)genomic sequence data sets for diverse downstream analyses, including, but not limited to, the identification of environments rich in untapped biosynthetic diversity, targeted molecule discovery efforts, and chemical ecology studies. eSNaPD is designed to generate a global atlas of biosynthetic diversity that can facilitate a systematic, sequence-based interrogation of nature's biosynthetic potential. PMID:25065533

  1. Functional characterization of ent-copalyl diphosphate synthase, kaurene synthase and kaurene oxidase in the Salvia miltiorrhiza gibberellin biosynthetic pathway.

    PubMed

    Su, Ping; Tong, Yuru; Cheng, Qiqing; Hu, Yating; Zhang, Meng; Yang, Jian; Teng, Zhongqiu; Gao, Wei; Huang, Luqi

    2016-01-01

    Salvia miltiorrhiza Bunge is highly valued in traditional Chinese medicine for its roots and rhizomes. Its bioactive diterpenoid tanshinones have been reported to have many pharmaceutical activities, including antibacterial, anti-inflammatory, and anticancer properties. Previous studies found four different diterpenoid biosynthetic pathways from the universal diterpenoid precursor (E,E,E)-geranylgeranyl diphosphate (GGPP) in S. miltiorrhiza. Here, we describe the functional characterization of ent-copalyl diphosphate synthase (SmCPSent), kaurene synthase (SmKS) and kaurene oxidase (SmKO) in the gibberellin (GA) biosynthetic pathway. SmCPSent catalyzes the cyclization of GGPP to ent-copalyl diphosphate (ent-CPP), which is converted to ent-kaurene by SmKS. Then, SmKO catalyzes the three-step oxidation of ent-kaurene to ent-kaurenoic acid. Our results show that the fused enzyme SmKS-SmCPSent increases ent-kaurene production by several fold compared with separate expression of SmCPSent and SmKS in yeast strains. In this study, we clarify the GA biosynthetic pathway from GGPP to ent-kaurenoic acid and provide a foundation for further characterization of the subsequent enzymes involved in this pathway. These insights may allow for better growth and the improved accumulation of bioactive tanshinones in S. miltiorrhiza through the regulation of the expression of these genes during developmental processes. PMID:26971881

  2. antiSMASH 3.0-a comprehensive resource for the genome mining of biosynthetic gene clusters.

    PubMed

    Weber, Tilmann; Blin, Kai; Duddela, Srikanth; Krug, Daniel; Kim, Hyun Uk; Bruccoleri, Robert; Lee, Sang Yup; Fischbach, Michael A; Müller, Rolf; Wohlleben, Wolfgang; Breitling, Rainer; Takano, Eriko; Medema, Marnix H

    2015-07-01

    Microbial secondary metabolism constitutes a rich source of antibiotics, chemotherapeutics, insecticides and other high-value chemicals. Genome mining of gene clusters that encode the biosynthetic pathways for these metabolites has become a key methodology for novel compound discovery. In 2011, we introduced antiSMASH, a web server and stand-alone tool for the automatic genomic identification and analysis of biosynthetic gene clusters, available at http://antismash.secondarymetabolites.org. Here, we present version 3.0 of antiSMASH, which has undergone major improvements. A full integration of the recently published ClusterFinder algorithm now allows using this probabilistic algorithm to detect putative gene clusters of unknown types. Also, a new dereplication variant of the ClusterBlast module now identifies similarities of identified clusters to any of 1172 clusters with known end products. At the enzyme level, active sites of key biosynthetic enzymes are now pinpointed through a curated pattern-matching procedure and Enzyme Commission numbers are assigned to functionally classify all enzyme-coding genes. Additionally, chemical structure prediction has been improved by incorporating polyketide reduction states. Finally, in order for users to be able to organize and analyze multiple antiSMASH outputs in a private setting, a new XML output module allows offline editing of antiSMASH annotations within the Geneious software. PMID:25948579

  3. Recent advances in biosynthetic modeling of nitric oxide reductases and insights gained from nuclear resonance vibrational and other spectroscopic studies

    DOE PAGESBeta

    Chakraborty, Saumen; Reed, Julian; Sage, Timothy; Branagan, Nicole C.; Petrik, Igor D.; Miner, Kyle D.; Hu, Michael Y.; Zhao, Jiyong; Alp, E. Ercan; Lu, Yi

    2015-08-14

    This Forum Article focuses on recent advances in structural and spectroscopic studies of biosynthetic models of nitric oxide reductases (NORs). NORs are complex metalloenzymes found in the denitrification pathway of Earth's nitrogen cycle where they catalyze the proton-dependent twoelectron reduction of nitric oxide (NO) to nitrous oxide (N2O). While much progress has been made in biochemical and biophysical studies of native NORs and their variants, a. clear mechanistic understanding of this important metalloenzyme related to its function is still elusive. We report herein UV vis and nuclear resonance vibrational spectroscopy (NRVS) studies of mononitrosylated intermediates of the NOR reaction ofmore » a biosynthetic model. The ability to selectively substitute metals at either heme or nonheme metal sites allows the introduction of independent 57Fe probe atoms at either site, as well as allowing the preparation of analogues of stable reaction intermediates by replacing either metal with a redox inactive metal. Together with previous structural and spectroscopic results, we summarize insights gained from studying these biosynthetic models toward understanding structural features responsible for the NOR activity and its mechanism. As a result, the outlook on NOR modeling is also discussed, with an emphasis on the design of models capable of catalytic turnovers designed based on close mimics of the secondary coordination sphere of native NORs.« less

  4. MYB58 and MYB63 are transcriptional activators of the lignin biosynthetic pathway during secondary cell wall formation in Arabidopsis.

    PubMed

    Zhou, Jianli; Lee, Chanhui; Zhong, Ruiqin; Ye, Zheng-Hua

    2009-01-01

    It has previously been shown that SECONDARY WALL-ASSOCIATED NAC DOMAIN PROTEIN1 (SND1) is a key transcription factor regulating secondary cell wall formation, including the biosynthesis of cellulose, xylan, and lignin. In this study, we show that two closely related SND1-regulated MYB transcription factors, MYB58 and MYB63, are transcriptional regulators specifically activating lignin biosynthetic genes during secondary wall formation in Arabidopsis thaliana. MYB58 and MYB63 are phylogenetically distinct from previously characterized MYBs shown to be associated with secondary wall formation or phenylpropanoid metabolism. Expression studies showed that MYB58 and MYB63 are specifically expressed in fibers and vessels undergoing secondary wall thickening. Dominant repression of their functions led to a reduction in secondary wall thickening and lignin content. Overexpression of MYB58 and MYB63 resulted in specific activation of lignin biosynthetic genes and concomitant ectopic deposition of lignin in cells that are normally unlignified. MYB58 was able to activate directly the expression of lignin biosynthetic genes and a secondary wall-associated laccase (LAC4) gene. Furthermore, the expression of MYB58 and MYB63 was shown to be regulated by the SND1 close homologs NST1, NST2, VND6, and VND7 and their downstream target MYB46. Together, our results indicate that MYB58 and MYB63 are specific transcriptional activators of lignin biosynthesis in the SND1-mediated transcriptional network regulating secondary wall formation. PMID:19122102

  5. Recent advances in biosynthetic modeling of nitric oxide reductases and insights gained from nuclear resonance vibrational and other spectroscopic studies

    SciTech Connect

    Chakraborty, Saumen; Reed, Julian; Sage, Timothy; Branagan, Nicole C.; Petrik, Igor D.; Miner, Kyle D.; Hu, Michael Y.; Zhao, Jiyong; Alp, E. Ercan; Lu, Yi

    2015-10-05

    This Forum Article focuses on recent advances in structural and spectroscopic studies of biosynthetic models of nitric oxide reductases (NORs). NORs are complex metalloenzymes found in the denitrification pathway of Earth's nitrogen cycle where they catalyze the proton-dependent twoelectron reduction of nitric oxide (NO) to nitrous oxide (N2O). While much progress has been made in biochemical and biophysical studies of native NORs and their variants, a. clear mechanistic understanding of this important metalloenzyme related to its function is still elusive. We report herein UV vis and nuclear resonance vibrational spectroscopy (NRVS) studies of mononitrosylated intermediates of the NOR reaction of a biosynthetic model. The ability to selectively substitute metals at either heme or nonheme metal sites allows the introduction of independent 57Fe probe atoms at either site, as well as allowing the preparation of analogues of stable reaction intermediates by replacing either metal with a redox inactive metal. Together with previous structural and spectroscopic results, we summarize insights gained from studying these biosynthetic models toward understanding structural features responsible for the NOR activity and its mechanism. As a result, the outlook on NOR modeling is also discussed, with an emphasis on the design of models capable of catalytic turnovers designed based on close mimics of the secondary coordination sphere of native NORs.

  6. antiSMASH 3.0—a comprehensive resource for the genome mining of biosynthetic gene clusters

    PubMed Central

    Weber, Tilmann; Blin, Kai; Duddela, Srikanth; Krug, Daniel; Kim, Hyun Uk; Bruccoleri, Robert; Lee, Sang Yup; Fischbach, Michael A.; Müller, Rolf; Wohlleben, Wolfgang; Breitling, Rainer; Takano, Eriko; Medema, Marnix H.

    2015-01-01

    Microbial secondary metabolism constitutes a rich source of antibiotics, chemotherapeutics, insecticides and other high-value chemicals. Genome mining of gene clusters that encode the biosynthetic pathways for these metabolites has become a key methodology for novel compound discovery. In 2011, we introduced antiSMASH, a web server and stand-alone tool for the automatic genomic identification and analysis of biosynthetic gene clusters, available at http://antismash.secondarymetabolites.org. Here, we present version 3.0 of antiSMASH, which has undergone major improvements. A full integration of the recently published ClusterFinder algorithm now allows using this probabilistic algorithm to detect putative gene clusters of unknown types. Also, a new dereplication variant of the ClusterBlast module now identifies similarities of identified clusters to any of 1172 clusters with known end products. At the enzyme level, active sites of key biosynthetic enzymes are now pinpointed through a curated pattern-matching procedure and Enzyme Commission numbers are assigned to functionally classify all enzyme-coding genes. Additionally, chemical structure prediction has been improved by incorporating polyketide reduction states. Finally, in order for users to be able to organize and analyze multiple antiSMASH outputs in a private setting, a new XML output module allows offline editing of antiSMASH annotations within the Geneious software. PMID:25948579

  7. New Insight into the Ochratoxin A Biosynthetic Pathway through Deletion of a Nonribosomal Peptide Synthetase Gene in Aspergillus carbonarius

    SciTech Connect

    Gallo, A.; Bruno, K. S.; Solfrizzo, M.; Perrone, G.; Mule, G.; Visconti, A.; Baker, S. E.

    2012-09-14

    Ochratoxin A (OTA), a mycotoxin produced by Aspergillus and Penicillium species, is composed of a dihydroisocoumarin ring linked to phenylalanine and its biosynthetic pathway has not yet been completely elucidated. Most of the knowledge regarding the genetic and enzymatic aspects of OTA biosynthesis has been obtained in Penicillium species. In Aspergillus species only pks genes involved in the initial steps of the pathway have been partially characterized. In our study, the inactivation of a gene encoding a nonribosomal peptide synthetase in OTA producing A. carbonarius ITEM 5010 has removed the ability of the fungus to produce OTA. This is the first report on the involvement of an nrps gene product in OTA biosynthetic pathway in Aspergillus species. The absence of OTA and ochratoxin α-the isocoumaric derivative of OTA, and the concomitant increase of ochratoxin β- the dechloro analog of ochratoxin α- were observed in the liquid culture of transformed strain. The data provide the first evidence that the enzymatic step adding phenylalanine to polyketide dihydroisocoumarin precedes the chlorination step to form OTA in A. carbonarius, and that ochratoxin α is a product of hydrolysis of OTA, giving an interesting new insight in the biosynthetic pathway of the toxin.

  8. Recent advances in biosynthetic modeling of nitric oxide reductases and insights gained from nuclear resonance vibrational and other spectroscopic studies.

    PubMed

    Chakraborty, Saumen; Reed, Julian; Sage, J Timothy; Branagan, Nicole C; Petrik, Igor D; Miner, Kyle D; Hu, Michael Y; Zhao, Jiyong; Alp, E Ercan; Lu, Yi

    2015-10-01

    This Forum Article focuses on recent advances in structural and spectroscopic studies of biosynthetic models of nitric oxide reductases (NORs). NORs are complex metalloenzymes found in the denitrification pathway of Earth's nitrogen cycle where they catalyze the proton-dependent two-electron reduction of nitric oxide (NO) to nitrous oxide (N2O). While much progress has been made in biochemical and biophysical studies of native NORs and their variants, a clear mechanistic understanding of this important metalloenzyme related to its function is still elusive. We report herein UV-vis and nuclear resonance vibrational spectroscopy (NRVS) studies of mononitrosylated intermediates of the NOR reaction of a biosynthetic model. The ability to selectively substitute metals at either heme or nonheme metal sites allows the introduction of independent (57)Fe probe atoms at either site, as well as allowing the preparation of analogues of stable reaction intermediates by replacing either metal with a redox inactive metal. Together with previous structural and spectroscopic results, we summarize insights gained from studying these biosynthetic models toward understanding structural features responsible for the NOR activity and its mechanism. The outlook on NOR modeling is also discussed, with an emphasis on the design of models capable of catalytic turnovers designed based on close mimics of the secondary coordination sphere of native NORs. PMID:26274098

  9. Functional characterization of ent-copalyl diphosphate synthase, kaurene synthase and kaurene oxidase in the Salvia miltiorrhiza gibberellin biosynthetic pathway

    PubMed Central

    Su, Ping; Tong, Yuru; Cheng, Qiqing; Hu, Yating; Zhang, Meng; Yang, Jian; Teng, Zhongqiu; Gao, Wei; Huang, Luqi

    2016-01-01

    Salvia miltiorrhiza Bunge is highly valued in traditional Chinese medicine for its roots and rhizomes. Its bioactive diterpenoid tanshinones have been reported to have many pharmaceutical activities, including antibacterial, anti-inflammatory, and anticancer properties. Previous studies found four different diterpenoid biosynthetic pathways from the universal diterpenoid precursor (E,E,E)-geranylgeranyl diphosphate (GGPP) in S. miltiorrhiza. Here, we describe the functional characterization of ent-copalyl diphosphate synthase (SmCPSent), kaurene synthase (SmKS) and kaurene oxidase (SmKO) in the gibberellin (GA) biosynthetic pathway. SmCPSent catalyzes the cyclization of GGPP to ent-copalyl diphosphate (ent-CPP), which is converted to ent-kaurene by SmKS. Then, SmKO catalyzes the three-step oxidation of ent-kaurene to ent-kaurenoic acid. Our results show that the fused enzyme SmKS-SmCPSent increases ent-kaurene production by several fold compared with separate expression of SmCPSent and SmKS in yeast strains. In this study, we clarify the GA biosynthetic pathway from GGPP to ent-kaurenoic acid and provide a foundation for further characterization of the subsequent enzymes involved in this pathway. These insights may allow for better growth and the improved accumulation of bioactive tanshinones in S. miltiorrhiza through the regulation of the expression of these genes during developmental processes. PMID:26971881

  10. Genome mining of astaxanthin biosynthetic genes from Sphingomonas sp. ATCC 55669 for heterologous overproduction in Escherichia coli.

    PubMed

    Ma, Tian; Zhou, Yuanjie; Li, Xiaowei; Zhu, Fayin; Cheng, Yongbo; Liu, Yi; Deng, Zixin; Liu, Tiangang

    2016-02-01

    As a highly valued keto-carotenoid, astaxanthin is widely used in nutritional supplements and pharmaceuticals. Therefore, the demand for biosynthetic astaxanthin and improved efficiency of astaxanthin biosynthesis has driven the investigation of metabolic engineering of native astaxanthin producers and heterologous hosts. However, microbial resources for astaxanthin are limited. In this study, we found that the α-Proteobacterium Sphingomonas sp. ATCC 55669 could produce astaxanthin naturally. We used whole-genome sequencing to identify the astaxanthin biosynthetic pathway using a combined PacBio-Illumina approach. The putative astaxanthin biosynthetic pathway in Sphingomonas sp. ATCC 55669 was predicted. For further confirmation, a high-efficiency targeted engineering carotenoid synthesis platform was constructed in E. coli for identifying the functional roles of candidate genes. All genes involved in astaxanthin biosynthesis showed discrete distributions on the chromosome. Moreover, the overexpression of exogenous E. coli idi in Sphingomonas sp. ATCC 55669 increased astaxanthin production by 5.4-fold. This study described a new astaxanthin producer and provided more biosynthesis components for bioengineering of astaxanthin in the future. PMID:26580858

  11. Endoscopic Trans-iliac Approach to L5-S1 Disc and Foramen – A Report on Clinical Experience

    PubMed Central

    Osman, Said G; Sherlekar, Sandeep; Malik, Atif; Winters, Charles; Grewal, PK; Narayanan, Malini; Gemechu, Nigussie

    2014-01-01

    Background The lumbosacral junction is a difficult area for spine surgery because of the complex anatomy. In the era of minimally invasive spine surgery, the presence of the iliac wing has, at the level of lumbosacral junction, created a major obstacle in the paths of two of the major approaches, namely, the direct lateral and percutaneous posterolateral endoscopic approaches. A trans-iliac cadaver study published by the senior author and co-workers in 1997, suggested the possibility of an alternative approach to the lumbosacral junction. Purpose To determine the feasibility of percutaneous, endoscopic trans-iliac approach to the L5-S1 disc and foramen Study Design Prospective case series study. Materials and Methods 15 consecutive patients undergoing the transiliac approach to L5-S1 disc and foramen were included in the study. Pre- and postoperative visual analogue scale (VAS); Oswestry Disability Index (ODI); and intra-operative blood loss and operative time, were obtained for the study. Preoperative MRI or CT scan was used to determine the need for trans-iliac access. The procedure was performed with the patient in prone position and under monitored sedation for decompression. Endotracheal anesthesia was used for fusion cases. The transiliac access was established with a cannulated drill or core drill through the iliac wing. Once the trans-iliac window had been created, the rest of the procedure proceeded as for percutaneous endoscopic transforaminal decompression and fusion. Results 15 patients (9 male and 6 female) participated in the study. The VAS for back and leg pain significantly improved in all patients. The ODI dropped by more than 50%. There was minimal blood loss, and transient post-operative dysesthesia in 2 cases which resolved after 3 weeks. Conclusion Endoscopic trans-iliac approach to the L5-S1 disc and foramen is feasible and safe. Decompression can be performed safely via trans-iliac access with minimal blood loss, and in a short operative time

  12. Hadron physics potential of future high-luminosity B-factories at the ϒ(5S) and above

    NASA Astrophysics Data System (ADS)

    Drutskoy, A. G.; Guo, F.-K.; Llanes-Estrada, F. J.; Nefediev, A. V.; Torres-Rincon, J. M.

    2013-01-01

    We point out the physics opportunities of future high-luminosity B-factories at the ϒ(5 S) resonance and above. Currently the two B-factories, the SuperB factory in Tor Vergata, Italy and the Belle II factory in KEK, Japan, are under development and are expected to start operation in 2017 and 2016, respectively. In this paper we discuss numerous interesting investigations, which can be performed in the e + e - center-of-mass energy region from the ϒ(5 S) and up to 11.5GeV, where an efficient data taking operation should be possible with the planned B-factories. These studies include abundant Bs production and decay properties; independent confirmation and, if found, exhaustive exploration of Belle's claimed charged bottomonia; clarification of puzzles of interquarkonium dipion transitions; extraction of the light-quark mass ratio from hadronic ϒ(5 S) decays; analysis of quarkonium and exotic internal structure from open flavour decays, leading to severe SU(3) symmetry violations; clarification of whether a hybrid state has similar mass to the ϒ(5 S) bottomonium, making it a double state; searches for molecular/tetraquark states that should be more stable with heavy quarks; completion of the table of positive-parity BJ mesons and study of their basic properties; production of Λ _b bar Λ _b heavy baryon pairs, that, following weak decay, open vistas on the charmed baryon spectrum and new channels to study CP violation; confirmation or refutation of the deviation from pQCD of the pion transition form factor, by extending the Q2 reach of current analysis; and possibly reaching the threshold for the production of triply charmed baryons. If, in addition, the future colliders can be later upgraded to 12.5GeV, then the possibility of copious production of B_c bar B_c pairs opens, entailing new studies of CP violation and improved, independent tests of the CKM picture (through determination of V bc , and of effective theories for heavy quarks.

  13. Functional Characterization of the Vitamin K2 Biosynthetic Enzyme UBIAD1

    PubMed Central

    Hirota, Yoshihisa; Nakagawa, Kimie; Sawada, Natsumi; Okuda, Naoko; Suhara, Yoshitomo; Uchino, Yuri; Kimoto, Takashi; Funahashi, Nobuaki; Kamao, Maya; Tsugawa, Naoko; Okano, Toshio

    2015-01-01

    UbiA prenyltransferase domain-containing protein 1 (UBIAD1) plays a significant role in vitamin K2 (MK-4) synthesis. We investigated the enzymological properties of UBIAD1 using microsomal fractions from Sf9 cells expressing UBIAD1 by analysing MK-4 biosynthetic activity. With regard to UBIAD1 enzyme reaction conditions, highest MK-4 synthetic activity was demonstrated under basic conditions at a pH between 8.5 and 9.0, with a DTT ≥0.1 mM. In addition, we found that geranyl pyrophosphate and farnesyl pyrophosphate were also recognized as a side-chain source and served as a substrate for prenylation. Furthermore, lipophilic statins were found to directly inhibit the enzymatic activity of UBIAD1. We analysed the aminoacid sequences homologies across the menA and UbiA families to identify conserved structural features of UBIAD1 proteins and focused on four highly conserved domains. We prepared protein mutants deficient in the four conserved domains to evaluate enzyme activity. Because no enzyme activity was detected in the mutants deficient in the UBIAD1 conserved domains, these four domains were considered to play an essential role in enzymatic activity. We also measured enzyme activities using point mutants of the highly conserved aminoacids in these domains to elucidate their respective functions. We found that the conserved domain I is a substrate recognition site that undergoes a structural change after substrate binding. The conserved domain II is a redox domain site containing a CxxC motif. The conserved domain III is a hinge region important as a catalytic site for the UBIAD1 enzyme. The conserved domain IV is a binding site for Mg2+/isoprenyl side-chain. In this study, we provide a molecular mapping of the enzymological properties of UBIAD1. PMID:25874989

  14. The raman spectrum of biosynthetic human growth hormone. Its deconvolution, bandfitting, and interpretation

    NASA Astrophysics Data System (ADS)

    Tensmeyer, Lowell G.

    1988-05-01

    The Raman spectrum of amorphous biosynthetic human growth hormone, somatotropin, has been measured at high signal-to-noise ratios, using a CW argon ion laser and single channel detection. The rms signal-to-noise ratio varies from 1800:1 in the Amide I region near 1650 cm -1 region, to 500:1 in the disulfide stretch region near 500 cm -1. Component Raman bands have been extracted from the entire spectral envelope from 1800-400 cm -1, by an interactive process involving both partial deconvolution and band-fitting. Interconsistency of all bands has been achieved by multiple overlapping of adjacent regions that had been isolated for the band-fitting programs. The resulting areas of the Raman component bands have been interpreted to show the ratios of peptide conformations in the hormone: 64% α-helix, 24% β-sheet, 8% β-turns and 4% γ-turns. Analysis of the tyrosine region, usually described as a Fermi resonance doublet near ˜830-850 cm -1, shows four bands, at 825, 833, 853, and 859 cm -1 in this macromolecule. Integrated intensities of these bands (2:2:2:2) are interpreted to show that only half of the eight tyrosine residues function as hydrogen-bond bridges via the acceptance of protons. Both disulfide bridges fall within the frequency ranges for normal, unstressed SS bonds: The 511 and 529 cm -1 bands are indicative of the gauche-gauche-gauche and trans-gauche-gauche conformations, respectively.

  15. Mutational Studies of Putative Biosynthetic Genes for the Cyanobacterial Sunscreen Scytonemin in Nostoc punctiforme ATCC 29133

    PubMed Central

    Ferreira, Daniela; Garcia-Pichel, Ferran

    2016-01-01

    The heterocyclic indole-alkaloid scytonemin is a sunscreen found exclusively among cyanobacteria. An 18-gene cluster is responsible for scytonemin production in Nostoc punctiforme ATCC 29133. The upstream genes scyABCDEF in the cluster are proposed to be responsible for scytonemin biosynthesis from aromatic amino acid substrates. In vitro studies of ScyA, ScyB, and ScyC proved that these enzymes indeed catalyze initial pathway reactions. Here we characterize the role of ScyD, ScyE, and ScyF, which were logically predicted to be responsible for late biosynthetic steps, in the biological context of N. punctiforme. In-frame deletion mutants of each were constructed (ΔscyD, ΔscyE, and ΔscyF) and their phenotypes studied. Expectedly, ΔscyE presents a scytoneminless phenotype, but no accumulation of the predicted intermediaries. Surprisingly, ΔscyD retains scytonemin production, implying that it is not required for biosynthesis. Indeed, scyD presents an interesting evolutionary paradox: it likely originated in a duplication event from scyE, and unlike other genes in the operon, it has not been subjected to purifying selection. This would suggest that it is a pseudogene, and yet scyD is highly conserved in the scytonemin operon of cyanobacteria. ΔscyF also retains scytonemin production, albeit exhibiting a reduction of the production yield compared with the wild-type. This indicates that ScyF is not essential but may play an adjuvant role for scytonemin synthesis. Altogether, our findings suggest that these downstream genes are not responsible, as expected, for the late steps of scytonemin synthesis and we must look for those functions elsewhere. These findings are particularly important for biotechnological production of this sunscreen through heterologous expression of its genes in more tractable organisms. PMID:27242750

  16. Nutritional regulation of long-chain PUFA biosynthetic genes in rainbow trout (Oncorhynchus mykiss).

    PubMed

    Gregory, Melissa K; Collins, Robert O; Tocher, Douglas R; James, Michael J; Turchini, Giovanni M

    2016-05-28

    Most studies on dietary vegetable oil in rainbow trout (Oncorhynchus mykiss) have been conducted on a background of dietary EPA (20 : 5n-3) and DHA (22 : 6n-3) contained in the fishmeal used as a protein source in aquaculture feed. If dietary EPA and DHA repress their endogenous synthesis from α-linolenic acid (ALA, 18 : 3n-3), then the potential of ALA-containing vegetable oils to maintain tissue EPA and DHA has been underestimated. We examined the effect of individual dietary n-3 PUFA on the expression of the biosynthetic genes required for metabolism of ALA to DHA in rainbow trout. A total of 720 juvenile rainbow trout were allocated to twenty-four experimental tanks and assigned one of eight diets. The effect of dietary ALA, EPA or DHA, in isolation or in combination, on hepatic expression of fatty acyl desaturase (FADS)2a(Δ6), FADS2b(Δ5), elongation of very long-chain fatty acid (ELOVL)5 and ELOVL2 was examined after 3 weeks of dietary intervention. The effect of these diets on liver and muscle phospholipid PUFA composition was also examined. The expression levels of FADS2a(Δ6), ELOVL5 and ELOVL2 were highest when diets were high in ALA, with no added EPA or DHA. Under these conditions ALA was readily converted to tissue DHA. Dietary DHA had the largest and most consistent effect in down-regulating the gene expression of all four genes. The ELOVL5 expression was the least responsive of the four genes to dietary n-3 PUFA changes. These findings should be considered when optimising aquaculture feeds containing vegetable oils and/or fish oil or fishmeal to achieve maximum DHA synthesis. PMID:26987422

  17. The Sound of Silence: Activating Silent Biosynthetic Gene Clusters in Marine Microorganisms.

    PubMed

    Reen, F Jerry; Romano, Stefano; Dobson, Alan D W; O'Gara, Fergal

    2015-08-01

    Unlocking the rich harvest of marine microbial ecosystems has the potential to both safeguard the existence of our species for the future, while also presenting significant lifestyle benefits for commercial gain. However, while significant advances have been made in the field of marine biodiscovery, leading to the introduction of new classes of therapeutics for clinical medicine, cosmetics and industrial products, much of what this natural ecosystem has to offer is locked in, and essentially hidden from our screening methods. Releasing this silent potential represents a significant technological challenge, the key to which is a comprehensive understanding of what controls these systems. Heterologous expression systems have been successful in awakening a number of these cryptic marine biosynthetic gene clusters (BGCs). However, this approach is limited by the typically large size of the encoding sequences. More recently, focus has shifted to the regulatory proteins associated with each BGC, many of which are signal responsive raising the possibility of exogenous activation. Abundant among these are the LysR-type family of transcriptional regulators, which are known to control production of microbial aromatic systems. Although the environmental signals that activate these regulatory systems remain unknown, it offers the exciting possibility of evoking mimic molecules and synthetic expression systems to drive production of potentially novel natural products in microorganisms. Success in this field has the potential to provide a quantum leap forward in medical and industrial bio-product development. To achieve these new endpoints, it is clear that the integrated efforts of bioinformaticians and natural product chemists will be required as we strive to uncover new and potentially unique structures from silent or cryptic marine gene clusters. PMID:26264003

  18. Differential expression of carotenoid biosynthetic pathway genes in two contrasting tomato genotypes for lycopene content.

    PubMed

    Pandurangaiah, Shilpa; Ravishankar, Kundapura V; Shivashankar, Kodthalu S; Sadashiva, Avverahally T; Pillakenchappa, Kavitha; Narayanan, Sunil Kumar

    2016-06-01

    Tomato (Solanum lycopersicum L.) is one of the model plant to study carotenoid biosynthesis. In the present study, the fruit carotenoid content were quantified at different developmental stages for two contrasting genotypes, viz. IIHR-249-1 and IIHR-2866 by UPLC. Lycopene content was high in IIHR-249-1 (19.45 mg/100 g fresh weight) compared to IIHR-2866 (1.88 mg/100 g fresh weight) at the ripe stage. qPCR was performed for genes that are involved in the carotenoid biosynthetic pathway to study the difference in lycopene content in fruits of both the genotypes. The expression of Phytoene synthase (PSY) increased by 36-fold and Phytoene desaturase (PDS) increased by 14-fold from immature green stage to ripe stage in IIHR-249-1. The expression of Chloroplast lycopene beta-cyclase (LCY-B) and Chromoplast lycopene beta cyclase (CYC-B) decreased gradually from the initial stage to the ripe stage in IIHR-249-1. IIHR 249-1 showed 3- and 1.8-fold decrease in gene expression for Chloroplast lycopene beta-cyclase (LCY-B) and Chromoplast lycopene beta-cyclase (CYC-B) .The F2 hybrids derived from IIHR-249-1 and IIHR-2866 were analysed at the ripe stage for lycopene content. The gene expression of Chloroplast lycopene beta-cyclase (LCY-B) and Chromoplast lycopene beta-cyclase (CYC-B) in high and low lycopene lines from F2 progenies also showed the decrease in transcript levels of both the genes in high lycopene F2 lines. We wish to suggest that the differential expression of lycopene beta-cyclases can be used in marker-assisted breeding. PMID:27240986

  19. Utility of the Biosynthetic Folate Pathway for Targets in Antimicrobial Discovery

    PubMed Central

    Bourne, Christina R.

    2014-01-01

    The need for new antimicrobials is great in face of a growing pool of resistant pathogenic organisms. This review will address the potential for antimicrobial therapy based on polypharmacological activities within the currently utilized bacterial biosynthetic folate pathway. The folate metabolic pathway leads to synthesis of required precursors for cellular function and contains a critical node, dihydrofolate reductase (DHFR), which is shared between prokaryotes and eukaryotes. The DHFR enzyme is currently targeted by methotrexate in anti-cancer therapies, by trimethoprim for antibacterial uses, and by pyrimethamine for anti-protozoal applications. An additional anti-folate target is dihyropteroate synthase (DHPS), which is unique to prokaryotes as they cannot acquire folate through dietary means. It has been demonstrated as a primary target for the longest standing antibiotic class, the sulfonamides, which act synergistically with DHFR inhibitors. Investigations have revealed most DHPS enzymes possess the ability to utilize sulfa drugs metabolically, producing alternate products that presumably inhibit downstream enzymes requiring the produced dihydropteroate. Recent work has established an off-target effect of sulfonamide antibiotics on a eukaryotic enzyme, sepiapterin reductase, causing alterations in neurotransmitter synthesis. Given that inhibitors of both DHFR and DHPS are designed to mimic their cognate substrate, which contain shared substructures, it is reasonable to expect such “off-target” effects. These inhibitors are also likely to interact with the enzymatic neighbors in the folate pathway that bind products of the DHFR or DHPS enzymes and/or substrates of similar substructure. Computational studies designed to assess polypharmacology reiterate these conclusions. This leads to hypotheses exploring the vast utility of multiple members of the folate pathway for modulating cellular metabolism, and includes an appealing capacity for prokaryotic

  20. Hybrid Biosynthetic Autograft Extender for Use in Posterior Lumbar Interbody Fusion: Safety and Clinical Effectiveness.

    PubMed

    Chedid, Mokbel K; Tundo, Kelly M; Block, Jon E; Muir, Jeffrey M

    2015-01-01

    Autologous iliac crest bone graft is the preferred option for spinal fusion, but the morbidity associated with bone harvest and the need for graft augmentation in more demanding cases necessitates combining local bone with bone substitutes. The purpose of this study was to document the clinical effectiveness and safety of a novel hybrid biosynthetic scaffold material consisting of poly(D,L-lactide-co-glycolide) (PLGA, 75:25) combined by lyophilization with unmodified high molecular weight hyaluronic acid (10-12% wt:wt) as an extender for a broad range of spinal fusion procedures. We retrospectively evaluated all patients undergoing single- and multi-level posterior lumbar interbody fusion at an academic medical center over a 3-year period. A total of 108 patients underwent 109 procedures (245 individual vertebral levels). Patient-related outcomes included pain measured on a Visual Analog Scale. Radiographic outcomes were assessed at 6 weeks, 3-6 months, and 1 year postoperatively. Radiographic fusion or progression of fusion was documented in 221 of 236 index levels (93.6%) at a mean (±SD) time to fusion of 10.2+4.1 months. Single and multi-level fusions were not associated with significantly different success rates. Mean pain scores (+SD) for all patients improved from 6.8+2.5 at baseline to 3.6+2.9 at approximately 12 months. Improvements in VAS were greatest in patients undergoing one- or two-level fusion, with patients undergoing multi-level fusion demonstrating lesser but still statistically significant improvements. Overall, stable fusion was observed in 64.8% of vertebral levels; partial fusion was demonstrated in 28.8% of vertebral levels. Only 15 of 236 levels (6.4%) were non-fused at final follow-up. PMID:26161161