Science.gov

Sample records for 5s rdna gene

  1. Molecular organization of the 5S rDNA gene type II in elasmobranchs

    PubMed Central

    Castro, Sergio I.; Hleap, Jose S.; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    ABSTRACT The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS. PMID:26488198

  2. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    PubMed

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.

  3. Evolutionary dynamics of 5S rDNA location in acridid grasshoppers and its relationship with H3 histone gene and 45S rDNA location.

    PubMed

    Cabral-de-Mello, Diogo C; Cabrero, Josefa; López-León, María Dolores; Camacho, Juan Pedro M

    2011-07-01

    We analyze the chromosomal location of 5S rDNA clusters in 29 species of grasshoppers belonging to the family Acrididae. There was extensive variation among species for the number and location of 5S rDNA sites. Out of 148 sites detected, 75% were proximally located, 21.6% were interstitial, and only 3.4% were distal. The number of 5S rDNA sites per species varied from a single chromosome pair (in six species) to all chromosome pairs (in five species), with a range of intermediate situations. Thirteen chromosomes from eight species carried two 5S rDNA clusters. At intraspecific level, differences among populations were detected in Eyprepocnemis plorans, and some heteromorphisms have also been observed in some species. Double FISH for 5S rDNA and H3 histone gene DNA, performed on 17 of these 29 species, revealed that both markers are sometimes placed in a same chromosome but at different location, whereas they appeared to co-localize in five species (Calliptamus barbarus, Heteracris adpersa, Aiolopus strepens, Oedipoda charpentieri and O. coerulescens). Double fiber-FISH in A. strepens and O. coerulescens showed that the two DNAs are closely interspersed with variable relative amounts of both classes of DNA. Finally, no correlation was observed between the number of 5S and 45S rDNA clusters in 23 species where this information was available. These results are discussed in the light of possible mechanisms of spread that led to the extensive variation in the number of clusters observed for both rDNA types in acridid grasshoppers.

  4. Molecular dissection of the rDNA array and of the 5S rDNA gene in Meloidogyne artiellia: phylogenetic and diagnostic implications.

    PubMed

    Veronico, Pasqua; De Luca, Francesca; De Giorgi, Carla

    2004-06-01

    The sequence of a 13.423 nucleotide genomic fragment has been determined for the plant parasitic nematode Meloidogyne artiellia. It contains an entire rDNA cluster, the bordering intergenic regions and portions of the flanking coding regions. The sequence analysis of the rDNA repeats suggests homogeneity in M. artiellia, thus providing a further indication of the usefulness of these genes for the diagnostic identification of this species. The comparison of the secondary structures of the internal transcribed spacer 2 region in several Meloidogyne species indicates that RNA folding predictions can be used as a tool of potential diagnostic relevance. The other ribosomal gene, 5S rDNA, has been demonstrated to be functional and located near the trans-spliced leader sequences, in the same arrangement found in the distantly related nematode Caenorhabditis elegans but never in other Meloidogyne thus providing species-specific markers for the identification of several Thylenchida parasitic nematodes. PMID:15135452

  5. Chromosomal localization of rDNA genes and genomic organization of 5S rDNA in Oreochromis mossambicus, O. urolepis hornorum and their hybrid.

    PubMed

    Zhu, Hua Ping; Lu, Mai Xin; Gao, Feng Ying; Huang, Zhang Han; Yang, Li Ping; Gui, Jian Fang

    2010-08-01

    In this study, classical and molecular cytogenetic analyses were performed in tilapia fishes, Oreochromis mossambicus (XX/XY sex determination system), O. urolepis hornorum (WZ/ZZ sex determination system) and their hybrid by crossing O. mossambicus female x O. u. hornorum male. An identical karyotype ((2n = 44, NF (total number of chromosomal arms) = 50) was obtained from three examined tilapia samples. Genomic organization analysis of 5S rDNA revealed two different types of 5S rDNA sequences, 5S type I and 5S type II. Moreover, fluorescence in situ hybridization (FISH) with 5S rDNA probes showed six positive fluorescence signals on six chromosomes of all the analysed metaphases from the three tilapia samples. Subsequently, 45S rDNA probes were also prepared, and six positive fluorescence signals were observed on three chromosome pairs in all analysed metaphases of the three tilapia samples. The correlation between 45 rDNA localization and nucleolar organizer regions (NORs) was confirmed by silver nitrate staining in tilapia fishes. Further, different chromosomal localizations of 5S rDNA and 45S rDNA were verified by two different colour FISH probes. Briefly, the current data provide an insights for hybridization projects and breeding improvement of tilapias.

  6. Evolutionary dynamics of the 5S rDNA gene family in the mussel Mytilus: mixed effects of birth-and-death and concerted evolution.

    PubMed

    Freire, Ruth; Arias, Alberto; Insua, Ana M; Méndez, Josefina; Eirín-López, José M

    2010-05-01

    In higher eukaryotes, the gene family encoding the 5S ribosomal RNA (5S rRNA) has been used (together with histones) to showcase the archetypal example of a gene family subject to concerted evolution. However, recent studies have revealed conspicuous features challenging the predictions of this model, including heterogeneity of repeat units, the presence of functional 5S gene variants as well as the existence of 5S rDNA divergent pseudogenes lacking traces of homogenization. In the present work, we have broadened the scope in the evolutionary study of ribosomal gene families by studying the 5S rRNA family in mussels, a model organism which stands out among other animals due to the heterogeneity it displays regarding sequence and organization. To this end, 48 previously unknown 5S rDNA units (coding and spacer regions) were sequenced in five mussel species, leading to the characterization of two new types of units (referred to here as small-beta 5S rDNA and gamma-5S rDNA) coexisting in the genome with alpha and beta rDNA units. The intense genetic dynamics of this family is further supported by the first description of an association between gamma-5S rDNA units and tRNA genes. Molecular evolutionary and phylogenetic analyses revealed an extensive lack of homology among spacer sequences belonging to different rDNA types, suggesting the presence of independent evolutionary pathways leading to their differentiation. Overall, our results suggest that the long-term evolution of the 5S rRNA gene family in mussels is most likely mediated by a mixed mechanism involving the generation of genetic diversity through birth-and-death, followed by a process of local homogenization resulting from concerted evolution in order to maintain the genetic identities of the different 5S units, probably after their transposition to independent chromosomal locations.

  7. Identification of goose (Anser anser) and mule duck (Anasplatyrhynchos x Cairina moschata) foie gras by multiplex polymerase chain reaction amplification of the 5S RDNA gene.

    PubMed

    Rodríguez, M A; García, T; González, I; Asensio, L; Fernández, A; Lobo, E; Hernández, P E; Martín, R

    2001-06-01

    Polymerase chain reaction (PCR) amplification of the nuclear 5S rDNA gene has been used for the identification of goose and mule duck foie gras. Two species-specific reverse primers were designed and used in a multiplex reaction, together with a forward universal primer, to amplify specific fragments of the 5S rDNA in each species. The different sizes of the species-specific amplicons, separated by agarose gel electrophoresis, allowed clear identification of goose and mule duck foie gras samples. This genetic marker can be useful for detecting fraudulent substitution of the duck liver for the more expensive goose liver.

  8. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

    PubMed Central

    Garcia, S; Kovařík, A

    2013-01-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S–5.8S–26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S–18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S–5.8S–26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants. PMID:23512008

  9. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

    PubMed

    Garcia, S; Kovařík, A

    2013-07-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

  10. Physical mapping of 18S and 5S rDNA loci and histone H3 gene in grasshopper species of the subfamily Gomphocerinae (Acrididae).

    PubMed

    Silva-Neto, L C; Bernardino, A C S; Loreto, V; Moura, R C

    2015-01-01

    In this study, fluorescence in situ hybridization (FISH) analysis was used to determine and compare the numbers and chromosomal locations of two multigene families (rDNA and histone H3) in four Neotropical species of gomphocerine grasshoppers. FISH using the 18S rDNA probe identified a single site on the S9 chromosome of Amblytropidia sp and Cauratettix borelli, a single site on chromosome M6 of Compsacris pulcher, and two sites (chromosomes L1 and L2) in Orphulella punctata. By contrast, FISH with a 5S rDNA probe identified dispersion of this sequence in the genomes of the four species, with evidence of intraspecific variations. Amblytropidia sp had six to eight FISH signals on autosomal chromosomes, while C. pulcher exhibited a signal only on the M5 bivalent. The histone H3 gene was less variable and was restricted to a single pair in all species. The conservation of the numbers and locations of 18S rDNA and H3 genes in conjunction with data from the literature was useful for evaluating karyotype evolution in this subfamily. The variation in the number and sizes of 5S rDNA sites indicates a process of recent dispersion that might have been mediated by transposition. PMID:26634462

  11. Physical mapping of 18S and 5S rDNA loci and histone H3 gene in grasshopper species of the subfamily Gomphocerinae (Acrididae).

    PubMed

    Silva-Neto, L C; Bernardino, A C S; Loreto, V; Moura, R C

    2015-11-25

    In this study, fluorescence in situ hybridization (FISH) analysis was used to determine and compare the numbers and chromosomal locations of two multigene families (rDNA and histone H3) in four Neotropical species of gomphocerine grasshoppers. FISH using the 18S rDNA probe identified a single site on the S9 chromosome of Amblytropidia sp and Cauratettix borelli, a single site on chromosome M6 of Compsacris pulcher, and two sites (chromosomes L1 and L2) in Orphulella punctata. By contrast, FISH with a 5S rDNA probe identified dispersion of this sequence in the genomes of the four species, with evidence of intraspecific variations. Amblytropidia sp had six to eight FISH signals on autosomal chromosomes, while C. pulcher exhibited a signal only on the M5 bivalent. The histone H3 gene was less variable and was restricted to a single pair in all species. The conservation of the numbers and locations of 18S rDNA and H3 genes in conjunction with data from the literature was useful for evaluating karyotype evolution in this subfamily. The variation in the number and sizes of 5S rDNA sites indicates a process of recent dispersion that might have been mediated by transposition.

  12. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family

    PubMed Central

    2010-01-01

    Background In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in ~200 species representing the family diversity and other closely related groups. Results Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Conclusions Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units

  13. The 5S rDNA gene family in mollusks: characterization of transcriptional regulatory regions, prediction of secondary structures, and long-term evolution, with special attention to Mytilidae mussels.

    PubMed

    Vizoso, Miguel; Vierna, Joaquín; González-Tizón, Ana M; Martínez-Lage, Andrés

    2011-01-01

    Several reports on the characterization of 5S ribosomal DNA (5S rDNA) in various animal groups have been published to date, but there is a lack of studies analyzing this gene family in a much broader context. Here, we have studied 5S rDNA variation in several molluskan species, including bivalves, gastropods, and cephalopods. The degree of conservation of transcriptional regulatory regions was analyzed in these lineages, revealing a conserved TATA-like box in the upstream region. The evolution of the 120 bp coding region (5S) was also studied, suggesting the occurrence of paralogue groups in razor clams, clams, and cockles. In addition, 5S rDNA sequences from 11 species and 7 genus of Mytilidae Rafinesque, 1815 mussels were sampled and studied in detail. Four different 5S rDNA types, based on the nontranscribed spacer region were identified. The phylogenetic analyses performed within each type showed a between-species gene clustering pattern, suggesting ancestral polymorphism. Moreover, some putative pseudogenized 5S copies were also identified. Our report, together with previous studies that found high degree of intragenomic divergence in bivalve species, suggests that birth-and-death evolution may be the main force driving the evolution of 5S rDNA in these animals, even at the genus level.

  14. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

    2016-04-15

    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product.

  15. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

    2016-04-15

    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. PMID:26789074

  16. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    PubMed Central

    2012-01-01

    Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement) or, less commonly, linked to 35 S rDNA units (L-type). The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6) but not all species. Two species contained major L-type and minor S-type units (termed Ls-type). The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’) is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs. PMID:22716941

  17. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    PubMed

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit. PMID:27106499

  18. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    PubMed

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

  19. Satellite DNA derived from 5S rDNA in Physalaemus cuvieri (Anura, Leiuperidae).

    PubMed

    Vittorazzi, S E; Lourenço, L B; Del-Grande, M L; Recco-Pimentel, S M

    2011-01-01

    In the present study, we describe for the first time a family of 190-bp satellite DNA related to 5S rDNA in anurans and the existence of 2 forms of 5S rDNA, type I (201 bp) and type II (690 bp). The sequences were obtained from genomic DNA of Physalaemus cuvieri from Palmeiras, State of Bahia, Brazil. Analysis of the nucleotide sequence revealed that the satellite DNA obtained by digestion with EcoRI, called PcP190EcoRI, is 70% similar to the coding region of type I 5S rDNA and 66% similar to the coding region of type II 5S rDNA. Membrane hybridization and PCR amplification of the sequence showed that PcP190EcoRI is tandemly repeated. The satellite DNA as well as type I and type II 5S rDNA were localized in P. cuvieri chromosomes by fluorescent in situ hybridization. The PcP190EcoRI sequence was found in the centromeres of chromosomes 1-5 and in the pericentromeric region of chromosome 3. Type I 5S rDNA was detected in chromosome 3, coincident with the site of PcP190EcoRI. Type II 5S rDNA was located interstitially in the long arm of chromosome 5. None of these sequences co-localized with nucleolar organizer regions. Our data suggests that this satellite DNA originates from the 5S ribosomal multigene family, probably by gene duplication, nucleotide divergence and sequence dispersion in the genome.

  20. Physical mapping of 5S rDNA in two species of Knifefishes: Gymnotus pantanal and Gymnotus paraguensis (Gymnotiformes).

    PubMed

    da Silva, M; Matoso, D A; Vicari, M R; de Almeida, M C; Margarido, V P; Artoni, R F

    2011-01-01

    Physical mapping of 5S rDNA in 2 species of knifefishes, Gymnotuspantanal and G. paraguensis (Gymnotiformes), was performed using fluorescence in situ hybridization with a 5S rDNA probe. The 5S rDNA PCR product from the genomes of both species was also sequenced and aligned to determine non-transcribed spacer sequences (NTS). Both species under study had different patterns of 5S rDNA gene cluster distribution. While in the karyotype of G. pantanal two 5S rDNA-bearing pairs were observed, the karyotype of G. paraguensis possessed as many as 19 such pairs. Such multiplication of 5S rDNA gene clusters might be caused by the involvement of transposable elements because the NTS of G. paraguensis was 400 bp long with high identity (90%) with a mobile transposable element called Tc1-like transposon, described from the cyprinid fish Labeo rohita.

  1. 5S rDNA genome regions of Lens species.

    PubMed

    Fernández, M; Ruiz, M L; Linares, C; Fominaya, A; Pérez de la Vega, M

    2005-10-01

    The length variability of the nontranscribed spacer (NTS) of the 5S rDNA repeats was analyzed in species of the genus Lens by means of PCR amplification. The NTS ranged from approximately 227 to approximately 952 bp. The polymorphism detected was higher than previous NTS polymorphisms described in this genus. Three NTS length variants from Lens culinaris subsp. culinaris and 2 from Lens culinaris subsp. orientalis were sequenced. The culinaris NTS fragment lengths were 239, 371, and 838 bp, whereas the orientalis ones were 472 bp and 506 bp, respectively. As a result of sequence similarities, 2 families of sequences were distinguished, 1 including the sequences of 838 and 506 bp, and others with the sequences of 239, 371, and 472 bp. The 1st family was characterized by the presence of a repeated sequence designated A, whereas the 2nd family showed a single A sequence and other repeated sequences designated B, C, and D. The presence of an (AT)n microsatellite was also observed in the 2nd family of sequences. The fragments, which included the 239-bp and 838-bp NTS sequences, as well as the intergenic spacer (IGS) of the 18S-5.8S-26S ribosomal DNA also from L. culinaris subsp. culinaris, were used to localize the nucleolar organizer region (NOR) and the 5S rDNA loci in the chromosomes of several species of the genus Lens by means of fluorescence in situ hybridization (FISH). The selective hybridization of the 2 NTS probes allowed us to distinguish between different 5S rDNA chromosomal loci.

  2. Evolution in the block: common elements of 5S rDNA organization and evolutionary patterns in distant fish genera.

    PubMed

    Campo, Daniel; García-Vázquez, Eva

    2012-01-01

    The 5S rDNA is organized in the genome as tandemly repeated copies of a structural unit composed of a coding sequence plus a nontranscribed spacer (NTS). The coding region is highly conserved in the evolution, whereas the NTS vary in both length and sequence. It has been proposed that 5S rRNA genes are members of a gene family that have arisen through concerted evolution. In this study, we describe the molecular organization and evolution of the 5S rDNA in the genera Lepidorhombus and Scophthalmus (Scophthalmidae) and compared it with already known 5S rDNA of the very different genera Merluccius (Merluccidae) and Salmo (Salmoninae), to identify common structural elements or patterns for understanding 5S rDNA evolution in fish. High intra- and interspecific diversity within the 5S rDNA family in all the genera can be explained by a combination of duplications, deletions, and transposition events. Sequence blocks with high similarity in all the 5S rDNA members across species were identified for the four studied genera, with evidences of intense gene conversion within noncoding regions. We propose a model to explain the evolution of the 5S rDNA, in which the evolutionary units are blocks of nucleotides rather than the entire sequences or single nucleotides. This model implies a "two-speed" evolution: slow within blocks (homogenized by recombination) and fast within the gene family (diversified by duplications and deletions).

  3. Nucleolar association and transcriptional inhibition through 5S rDNA in mammals.

    PubMed

    Fedoriw, Andrew M; Starmer, Joshua; Yee, Della; Magnuson, Terry

    2012-01-01

    Changes in the spatial positioning of genes within the mammalian nucleus have been associated with transcriptional differences and thus have been hypothesized as a mode of regulation. In particular, the localization of genes to the nuclear and nucleolar peripheries is associated with transcriptional repression. However, the mechanistic basis, including the pertinent cis- elements, for such associations remains largely unknown. Here, we provide evidence that demonstrates a 119 bp 5S rDNA can influence nucleolar association in mammals. We found that integration of transgenes with 5S rDNA significantly increases the association of the host region with the nucleolus, and their degree of association correlates strongly with repression of a linked reporter gene. We further show that this mechanism may be functional in endogenous contexts: pseudogenes derived from 5S rDNA show biased conservation of their internal transcription factor binding sites and, in some cases, are frequently associated with the nucleolus. These results demonstrate that 5S rDNA sequence can significantly contribute to the positioning of a locus and suggest a novel, endogenous mechanism for nuclear organization in mammals.

  4. Abridged 5S rDNA units in sea beet (Beta vulgaris subsp. maritima).

    PubMed

    Turner, Daniel J; Brown, Terence A

    2005-04-01

    Amplification by polymerase chain reaction of the 5S rDNA repeat units of Beta vulgaris subsp. maritima resulted in a 350-bp product corresponding to the full-length 5S unit, but also revealed 4 abridged unit classes, each with a deletion that removed most of the spacer and 12-76 bp of the coding sequence. Each abridged type lacks at least 1 of the conserved elements involved in transcription of the 5S gene, and so appear to be nonfunctional. Network analysis revealed that the abridged units are evolving in the same manner as the full-length versions.

  5. Contrasting patterns of the 5S and 45S rDNA evolutions in the Byblis liniflora complex (Byblidaceae).

    PubMed

    Fukushima, Kenji; Imamura, Kaori; Nagano, Katsuya; Hoshi, Yoshikazu

    2011-03-01

    To clarify the evolutionary dynamics of ribosomal RNA genes (rDNAs) in the Byblis liniflora complex (Byblidaceae), we investigated the 5S and 45S rDNA genes through (1) chromosomal physical mapping by fluorescence in situ hybridization (FISH) and (2) phylogenetic analyses using the nontranscribed spacer of 5S rDNA (5S-NTS) and the internal transcribed spacer of 45S rDNA (ITS). In addition, we performed phylogenetic analyses based on rbcL and trnK intron. The complex was divided into 2 clades: B. aquatica-B. filifolia and B. guehoi-B. liniflora-B. rorida. Although members of the complex had conservative symmetric karyotypes, they were clearly differentiated on chromosomal rDNA distribution patterns. The sequence data indicated that ITS was almost homogeneous in all taxa in which two or four 45S rDNA arrays were frequently found at distal regions of chromosomes in the somatic karyotype. ITS homogenization could have been prompted by relatively distal 45S rDNA positions. In contrast, 2-12 5S rDNA arrays were mapped onto proximal/interstitial regions of chromosomes, and some paralogous 5S-NTS were found in the genomes harboring 4 or more arrays. 5S-NTS sequence type-specific FISH analysis showed sequence heterogeneity within and between some 5S rDNA arrays. Interlocus homogenization may have been hampered by their proximal location on chromosomes. Chromosomal location may have affected the contrasting evolutionary dynamics of rDNAs in the B. liniflora complex.

  6. Chromosomal localization of 18S and 5S rDNA using FISH in the genus Tor (Pisces, Cyprinidae).

    PubMed

    Singh, Mamta; Kumar, Ravindra; Nagpure, N S; Kushwaha, B; Gond, Indramani; Lakra, W S

    2009-12-01

    Dual color fluorescence in situ hybridization (FISH) was performed to study the simultaneous chromosomal localization of 18S and 5S ribosomal genes in the genus Tor for the first time. The 18S and 5S rDNAs in four Tor species were amplified, sequenced and mapped on the metaphase chromosomes. The number and distribution of 18S and 5S rDNA clusters were examined on metaphase chromosome spreads using FISH. The specimens of T. chelynoides, T. putitora and T. progeneius showed six bright fluorescent signals of 18S rDNA and T. tor exhibited ten such signals. The 5S rDNA signals were present only on one pair of chromosomes in all the four Tor species. Ag-NORs were observed on two pairs of chromosomes in T. chelynoides, T. putitora, T. progeneius and four pairs in T. tor. Comparison of the observed 18S rDNA FISH signals and Ag-NORs strongly suggested a possible inactivation of NORs localized at the telomeres of a subtelocentric and telocentric chromosome pairs in all four species. The 5S rDNA contained an identical 120 bp long coding region and 81 bp long highly divergent non-transcribed spacers in all species examined. 18S and 5S rDNA sequencing and chromosomal localization can be a useful genetic marker in species identification as well as phylogenetic and evolutionary studies.

  7. Cytogenetic analysis in Polypterus ornatipinnis (Actinopterygii, Cladistia, Polypteridae) and 5S rDNA.

    PubMed

    Morescalchi, Maria Alessandra; Stingo, Vincenzo; Capriglione, Teresa

    2011-03-01

    Polypteridae is a family of archaic freshwater African fish that constitute an interesting subject for the study of the karyological evolution in vertebrates, on account of their primitive morphological characters and peculiar relationships with lower Osteichthyans. In this paper, a cytogenetic analysis on twenty specimens of both sexes of Polypterus ornatipinnis the ornate "bichir", coming from the Congo River basin, was performed by using both classical and molecular techniques. The karyotypic formula (2n=36; FN=72) was composed of 26 M+10 SM. The Alu I banding, performed to characterize heterochromatin in this species, was mainly centromeric. Both the chromosome location of the ribosomal 5S and 18S rRNA genes were examined by using Ag-NOR, classical C-banding, CMA(3) staining and FISH. CMA(3) marked all centromerical regions and showed the presence of two GC rich regions on the p arm of the chromosome pair n°1 and on the q arm of the pair n°14. Staining with Ag-NOR marked the only telomeric region of the chromosome n°1 p arm. After PCR, the 5S rDNA in this species was cloned, sequenced and analyzed. In the 665bp 5S rDNA sequence of P.ornatipinnis, a conserved 120bp gene region for the 5S rDNA was identified, followed by a non-transcribed variable spacer (NTS) which included simple repeats, microsatellites and a fragment of a non-LTR retrotransposon R-TEX. FISH with 5S rDNA marked the subtelomeric region of the q arm of the chromosome pair n°14, previously marked by CMA(3). FISH with 18S rDNA marked the telomeric region of the p arm of the pair n°1, previously marked both by Ag-NOR and CMA(3). The (GATA)(7) repeats marked the telomeric regions of all chromosome pairs, with the exclusion of the n°1, n°3 and n°14; hybridization with telomeric probes (TTAGGG)(n) showed signals at the end of all chromosomes. Karyotype evolution in Polypterus genus was finally discussed, including the new data obtained.

  8. Cytogenetic analysis in Polypterus ornatipinnis (Actinopterygii, Cladistia, Polypteridae) and 5S rDNA.

    PubMed

    Morescalchi, Maria Alessandra; Stingo, Vincenzo; Capriglione, Teresa

    2011-03-01

    Polypteridae is a family of archaic freshwater African fish that constitute an interesting subject for the study of the karyological evolution in vertebrates, on account of their primitive morphological characters and peculiar relationships with lower Osteichthyans. In this paper, a cytogenetic analysis on twenty specimens of both sexes of Polypterus ornatipinnis the ornate "bichir", coming from the Congo River basin, was performed by using both classical and molecular techniques. The karyotypic formula (2n=36; FN=72) was composed of 26 M+10 SM. The Alu I banding, performed to characterize heterochromatin in this species, was mainly centromeric. Both the chromosome location of the ribosomal 5S and 18S rRNA genes were examined by using Ag-NOR, classical C-banding, CMA(3) staining and FISH. CMA(3) marked all centromerical regions and showed the presence of two GC rich regions on the p arm of the chromosome pair n°1 and on the q arm of the pair n°14. Staining with Ag-NOR marked the only telomeric region of the chromosome n°1 p arm. After PCR, the 5S rDNA in this species was cloned, sequenced and analyzed. In the 665bp 5S rDNA sequence of P.ornatipinnis, a conserved 120bp gene region for the 5S rDNA was identified, followed by a non-transcribed variable spacer (NTS) which included simple repeats, microsatellites and a fragment of a non-LTR retrotransposon R-TEX. FISH with 5S rDNA marked the subtelomeric region of the q arm of the chromosome pair n°14, previously marked by CMA(3). FISH with 18S rDNA marked the telomeric region of the p arm of the pair n°1, previously marked both by Ag-NOR and CMA(3). The (GATA)(7) repeats marked the telomeric regions of all chromosome pairs, with the exclusion of the n°1, n°3 and n°14; hybridization with telomeric probes (TTAGGG)(n) showed signals at the end of all chromosomes. Karyotype evolution in Polypterus genus was finally discussed, including the new data obtained. PMID:21429462

  9. Phylogenetic relationships among diploid Aegilops species inferred from 5S rDNA units.

    PubMed

    Baum, B R; Edwards, T; Johnson, D A

    2009-10-01

    Relationships among the currently recognized 11 diploid species within the genus Aegilops have been investigated. Sequence similarity analysis, based upon 363 sequenced 5S rDNA clones from 44 accessions plus 15 sequences retrieved from GenBank, depicted two unit classes labeled the long AE1 and short AE1. Several different analytical methods were applied to infer relationships within haplomes, between haplomes and among the species, including maximum parsimony and maximum likelihood analyses of consensus sequences, "total evidence" phylogeny analysis and "matrix representation with parsimony" analysis. None were able to depict suites of markers or unit classes that could discern among the seven haplomes as is observed among established haplomes in other genera within the tribe Triticeae; however, most species could be separated when displayed on gene trees. These results suggest that the haplomes currently recognized are so refined that they may be relegated as sub-haplomes or haplome variants. Amblyopyrum shares the same 5S rDNA unit classes with the diploid Aegilops species suggesting that it belongs within the latter. Comparisons of the Aegilops sequences with those of Triticum showed that the long AE1 unit class of Ae. tauschii shared the clade with the equivalent long D1 unit class, i.e., the putative D haplome donor, but the short AE1 unit class did not. The long AE1 unit class but not the short, of Ae. speltoides and Ae. searsii both share the clade with the previously identified long {S1 and long G1 unit classes meaning that both Aegilops species can be equally considered putative B haplome donors to tetraploid Triticum species. The semiconserved nature of the nontranscribed spacer in Aegilops and in Triticeae in general is discussed in view that it may have originated by processes of incomplete gene conversion or biased gene conversion or birth-and-death evolution.

  10. Variability of the 5S and 45S rDNA Sites in Passiflora L. Species with Distinct Base Chromosome Numbers

    PubMed Central

    DE MELO, NATONIEL FRANKLIN; GUERRA, MARCELO

    2003-01-01

    Cytologically, the species of Passiflora with known chromosome number can be divided into four groups: (1) 2n = 12, 24, 36; (2) 2n = 24; (3) 2n = 18, 72; and (4) 2n = 20. The base chromosome number proposed for the genus is x = 6, with x = 9, x = 10 and x = 12 being considered secondary base numbers. In the present study, variability of 5S and 45S rDNA sites was investigated in 20 species of these four groups to check the reliability of this hypothesis. In the group with x = 6, five diploid species (2n = 12) exhibit two 5S rDNA sites and two (P. capsularis, P. morifolia and P. rubra) or four (P. misera 2x and P. tricuspis) 45S rDNA sites. The hexaploid cytotype of P. misera had 12 45S rDNA sites and six 5S rDNA. A tetraploid species, P. suberosa, had ten 45S rDNA sites and four 5S rDNA sites, both in the same chromosomes as the 45S rDNA sites. In the group with x = 9, P. actinia, P. amethystina, P. edmundoi, P. elegans, P. galbana, P. glandulosa and P. mucronata displayed six 45S rDNA sites, whereas P. alata, P. cincinnata, P. edulis f. flavicarpa, P. edulis var. roxo and P. laurifolia had four sites. In this group, all species were diploid (2n = 18) and had only two 5S rDNA sites. Passiflora foetida, the only species with 2n = 20, had six 45S rDNA sites and four 5S rDNA sites. The species with x = 12 (2n = 24), P. haematostigma and P. pentagona, showed four 45S rDNA sites and two 5S rDNA. In general, the number and location of 5S and 45S rDNA sites were consistent with the hypothesis of x = 6 as the probable ancestral genome for the genus, while the groups of species with x = 9, x = 10 and x = 12 were considered to be of tetraploid origin with descending dysploidy and gene silencing of some redundant gene sites, mainly those of 5S rDNA. PMID:12876193

  11. Variability of the 5S and 45S rDNA sites in Passiflora L. species with distinct base chromosome numbers.

    PubMed

    de Melo, Natoniel Franklin; Guerra, Marcelo

    2003-08-01

    Cytologically, the species of Passiflora with known chromosome number can be divided into four groups: (1) 2n = 12, 24, 36; (2) 2n = 24; (3) 2n = 18, 72; and (4) 2n = 20. The base chromosome number proposed for the genus is x = 6, with x = 9, x = 10 and x = 12 being considered secondary base numbers. In the present study, variability of 5S and 45S rDNA sites was investigated in 20 species of these four groups to check the reliability of this hypothesis. In the group with x = 6, five diploid species (2n = 12) exhibit two 5S rDNA sites and two (P. capsularis, P. morifolia and P. rubra) or four (P. misera 2x and P. tricuspis) 45S rDNA sites. The hexaploid cytotype of P. misera had 12 45S rDNA sites and six 5S rDNA. A tetraploid species, P. suberosa, had ten 45S rDNA sites and four 5S rDNA sites, both in the same chromosomes as the 45S rDNA sites. In the group with x = 9, P. actinia, P. amethystina, P. edmundoi, P. elegans, P. galbana, P. glandulosa and P. mucronata displayed six 45S rDNA sites, whereas P. alata, P. cincinnata, P. edulis f. flavicarpa, P. edulis var. roxo and P. laurifolia had four sites. In this group, all species were diploid (2n = 18) and had only two 5S rDNA sites. Passiflora foetida, the only species with 2n = 20, had six 45S rDNA sites and four 5S rDNA sites. The species with x = 12 (2n = 24), P. haematostigma and P. pentagona, showed four 45S rDNA sites and two 5S rDNA. In general, the number and location of 5S and 45S rDNA sites were consistent with the hypothesis of x = 6 as the probable ancestral genome for the genus, while the groups of species with x = 9, x = 10 and x = 12 were considered to be of tetraploid origin with descending dysploidy and gene silencing of some redundant gene sites, mainly those of 5S rDNA. PMID:12876193

  12. Chromosomal location of 18S and 5S rDNA sites in Triportheus fish species (Characiformes, Characidae)

    PubMed Central

    2009-01-01

    The location of 18S and 5S rDNA sites was determined in eight species and populations of the fish genus Triportheus by using fluorescent in situ hybridization (FISH). The males and females of all species had 2n = 52 chromosomes and a ZZ/ZW sex chromosome system. A single 18S rDNA site that was roughly equivalent to an Ag-NOR was detected on the short arms of a submetacentric pair in nearly all species, and up to two additional sites were also observed in some species. In addition, another 18S rDNA cluster was identified in a distal region on the long arms of the W chromosome; this finding corroborated previous evidence that this cluster would be a shared feature amongst Triportheus species. In T. angulatus, a heterozygotic paracentric inversion involving the short arms of one homolog of a metacentric pair was associated with NORs. The 5S rDNA sites were located on the short arms of a single submetacentric chromosomal pair, close to the centromeres, except in T. auritus, which had up to ten 5S rDNA sites. The 18S and 5S rDNA sites were co-localized and adjacent on the short arms of a chromosomal pair in two populations of T. nematurus. Although all Triportheus species have a similar karyotypic macrostructure, the results of this work show that in some species ribosomal genes may serve as species-specific markers when used in conjunction with other putatively synapomorphic features. PMID:21637644

  13. Chromosome mapping of 18S rDNA and 5S rDNA by dual-color fluorescence in situ hybridization in the half-smooth tongue sole (Cynoglossus semilaevis).

    PubMed

    Jiang, L; Jiang, J; Liu, J; Yuan, J; Chen, Y; Zhang, Q; Wang, X

    2014-12-18

    Half-smooth tongue sole (Cynoglossus semilaevis) is an important aquaculture flatfish in China. Cytogenetic analysis has revealed that its sex determination system is female heterogametic (ZZ/ZW). The W chromosome is morphologically larger and has been considered evolutionarily younger than any other chromosome in the set. However, the genetic origin and evolution process of this neo-chromosome remains unclear. In this study, 2 tandem arrays of rRNA genes were chosen to address this question. Both the major rDNA (18S rDNA) and the minor rDNA (5S rDNA) were located on the C. semilaevis chromosomes by fluorescence in situ hybridization (FISH). Six 18S rDNA signals were observed on the centromeric regions of 3 pairs of autosomes in both males and females. In females, there was an additional 18S rDNA signal mapping to the telomeric region of the W chromosome long arm. With respect to the 5S rDNA, 12 signals were mapped to the centromeric regions of six pairs of autosomes. Two-color FISH further confirmed that the two pairs of the 5S rDNA signals were correspondingly located at the same positions of the same autosomes as those of the 18S rDNA signals. These results allowed us to speculate about the evolution process of the W chromosome. Chromosome fusions and repetitive sequence accumulations might have occurred in C. semilaevis. The synteny and non-synteny of C. semilaevis 18S rDNA and 5S rDNA might imply the original and evolutionary characteristics of this species. These findings will facilitate studies on karyotype evolution of the order Pleuronectiformes.

  14. Analysis of 5S rDNA organization and variation in polyploid hybrids from crosses of different fish subfamilies.

    PubMed

    Qin, Qinbo; He, Weiguo; Liu, Shaojun; Wang, Jing; Xiao, Jun; Liu, Yun

    2010-07-15

    In this article, sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) were conducted in red crucian carp (RCC), blunt snout bream (BSB), and their polyploid offspring. Three monomeric 5S rDNA classes (designated class I: 203 bp; class II: 340 bp; and class III: 477 bp) of RCC were characterized by distinct NTS types (designated NTS-I, II, and III for the 83, 220, and 357 bp monomers, respectively). In BSB, only one monomeric 5S rDNA was observed (designated class IV: 188 bp), which was characterized by one NTS type (designated NTS-IV: 68 bp). In the polyploid offspring, the tetraploid (4nRB) hybrids partially inherited 5S rDNA classes from their female parent (RCC); however, they also possessed a unique 5S rDNA sequence (designated class I-L: 203 bp) with a novel NTS sequence (designated NTS-I-L: 83 bp). The characteristic paternal 5S rDNA sequences (class IV) were not observed. The 5S rDNA of triploid (3nRB) hybrids was completely inherited from the parental species, and generally preserved the parental 5S rDNA structural organization. These results first revealed the influence of polyploidy on the organization and evolution of the multigene family of 5S rDNA of fish, and are also useful in clarifying aspects of vertebrate genome evolution.

  15. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae)

    PubMed Central

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M

    2011-01-01

    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at −25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant. PMID:21364693

  16. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).

    PubMed

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M

    2011-08-01

    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant.

  17. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).

    PubMed

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M

    2011-08-01

    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant. PMID:21364693

  18. [An intriguing model for 5S rDNA sequences dispersion in the genome of freshwater stingray Potamotrygon motoro (Chondrichthyes: Potamotrygonidae)].

    PubMed

    Cruz, V P; Oliveira, C; Foresti, F

    2015-01-01

    5S rDNA genes of the stingray Potamotrygon motoro were PCR replicated, purified, cloned and sequenced. Two distinct classes of segments of different sizes were obtained. The smallest, with 342 bp units, was classified as class I, and the largest, with 1900 bp units, was designated as class II. Alignment with the consensus sequences for both classes showed changes in a few bases in the 5S rDNA genes. TATA-like sequences were detected in the nontranscribed spacer (NTS) regions of class I and a microsatellite (GCT) 10 sequence was detected in the NTS region of class II. The results obtained can help to understand the molecular organization of ribosomal genes and the mechanism of gene dispersion.

  19. [An intriguing model for 5S rDNA sequences dispersion in the genome of freshwater stingray Potamotrygon motoro (Chondrichthyes: Potamotrygonidae)].

    PubMed

    Cruz, V P; Oliveira, C; Foresti, F

    2015-01-01

    5S rDNA genes of the stingray Potamotrygon motoro were PCR replicated, purified, cloned and sequenced. Two distinct classes of segments of different sizes were obtained. The smallest, with 342 bp units, was classified as class I, and the largest, with 1900 bp units, was designated as class II. Alignment with the consensus sequences for both classes showed changes in a few bases in the 5S rDNA genes. TATA-like sequences were detected in the nontranscribed spacer (NTS) regions of class I and a microsatellite (GCT) 10 sequence was detected in the NTS region of class II. The results obtained can help to understand the molecular organization of ribosomal genes and the mechanism of gene dispersion. PMID:26107907

  20. Physical mapping of the 5S and 18S rDNA in ten species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae): evolutionary tendencies in the genus.

    PubMed

    Bueno, Vanessa; Venere, Paulo César; Thums Konerat, Jocicléia; Zawadzki, Cláudio Henrique; Vicari, Marcelo Ricardo; Margarido, Vladimir Pavan

    2014-01-01

    Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH) with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus.

  1. Physical Mapping of the 5S and 18S rDNA in Ten Species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae): Evolutionary Tendencies in the Genus

    PubMed Central

    César Venere, Paulo; Thums Konerat, Jocicléia; Henrique Zawadzki, Cláudio; Ricardo Vicari, Marcelo; Margarido, Vladimir Pavan

    2014-01-01

    Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH) with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus. PMID:25405240

  2. Non-Random Distribution of 5S rDNA Sites and Its Association with 45S rDNA in Plant Chromosomes.

    PubMed

    Roa, Fernando; Guerra, Marcelo

    2015-01-01

    5S and 45S rDNA sites are the best mapped chromosome regions in eukaryotic chromosomes. In this work, a database was built gathering information about the position and number of 5S rDNA sites in 784 plant species, aiming to identify patterns of distribution along the chromosomes and its correlation with the position of 45S rDNA sites. Data revealed that in most karyotypes (54.5%, including polyploids) two 5S rDNA sites (a single pair) are present, with 58.7% of all sites occurring in the short arm, mainly in the proximal region. In karyotypes of angiosperms with only 1 pair of sites (single sites) they are mostly found in the proximal region (52.0%), whereas in karyotypes with multiple sites the location varies according to the average chromosome size. Karyotypes with multiple sites and small chromosomes (<3 µm) often display proximal sites, while medium-sized (between 3 and 6 µm) and large chromosomes (>6 µm) more commonly show terminal or interstitial sites. In species with holokinetic chromosomes, the modal value of sites per karyotype was also 2, but they were found mainly in a terminal position. Adjacent 5S and 45S rDNA sites were often found in the short arm, reflecting the preferential distribution of both sites in this arm. The high frequency of genera with at least 1 species with adjacent 5S and 45S sites reveals that this association appeared several times during angiosperm evolution, but it has been maintained only rarely as the dominant array in plant genera.

  3. The 5S genes of Drosophila melanogaster.

    PubMed

    Artavanis-Tsakonas, S; Schedl, P; Tschudi, C; Pirrotta, V; Steward, R; Gehring, W J

    1977-12-01

    We have cloned embryonic Drosophila DNA using the poly (dA-DT) connector method (Lobban and Kaiser, 1973) and the ampicillin-resistant plasmid pSF2124 (So, Gill and Falkow, 1975) as a cloning vehicle. Two clones, containing hybrid plasmids with sequences complementary to a 5S RNA probe isolated from Drosophila tissue culture cells, were identified by the Grunstein and Hogness (1975) colony hybridization procedure. One hybrid plasmid has a Drosophila insert which is comprised solely of tandem repeats of the 5S gene plus spacer sequences. The other plasmid contains an insert which has about 20 tandem 5S repeat units plus an additional 4 kilobases of adjacent sequences. The size of the 5S repeat unit was determined by gel electrophoresis and was found to be approximately 375 base pairs. We present a restriction map of both plasmids, and a detailed map of of the5S repeat unit. The 5S repat unit shows slight length and sequence heterogeneity. We present evidence suggesting that the 5S genes in Drosophila melanogaster may be arranged in a single continuous cluster. PMID:413625

  4. Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection

    PubMed Central

    2011-01-01

    Background The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. Results The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. Conclusions These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection. PMID:22004418

  5. A tandem array of 5S ribosomal RNA genes in Pythium irregulare.

    PubMed

    Belkhiri, A; Intengan, H; Klassen, G R

    1997-02-28

    The 5S ribosomal RNA genes of the oomycete Pythium irregulare exist in tandem arrays unlinked to the rDNA repeat unit. A clone with a 9.2-kb insert containing an array of 5S genes was identified in a lambda genomic library and was characterized by restriction mapping and partial sequencing. The array consisted of 9 apparently identical 5S genes and their spacers in tandem, followed by a diverged 5S-like sequence that is likely to be a pseudogene. This gene arrangement, although almost universal in plants and animals, is rare in fungi and protists.

  6. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.

    PubMed

    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto

    2006-05-01

    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes. PMID:16612546

  7. Molecular characterization and physical mapping of two classes of 5S rDNA in the genomes of Gymnotus sylvius and G. inaequilabiatus (Gymnotiformes, Gymnotidae).

    PubMed

    Scacchetti, P C; Alves, J C P; Utsunomia, R; Claro, F L; de Almeida Toledo, L F; Oliveira, C; Foresti, F

    2012-01-01

    The nucleotide sequences of the 5S rRNA multigene family and their distribution across the karyotypes in 2 species of Gymnotiformes, genus Gymnotus (G. sylvius and G. inaequilabiatus) were investigated by means of fluorescence in situ hybridization (FISH). The results showed the existence of 2 distinct classes of 5S rDNA sequences in both species: class I and class II. A high conservative pattern of the codifying region of the 5S rRNA gene was identified, contrasting with significant alterations detected in the nontranscribed spacer (NTS). The presence of TATA-like sequences along the NTS of both species was an expected occurrence, since such sequences have been associated with the regulation of the gene expression. FISH using 5S rDNA class I and class II probes revealed that both gene classes were collocated in the same chromosome pair in the genome of G. sylvius, while in that of G. inaequilabiatus, class II appeared more disperse than class I.

  8. Chromosomal localization of 5S rDNA in Chinese shrimp ( Fenneropenaeus chinensis): a chromosome-specific marker for chromosome identification

    NASA Astrophysics Data System (ADS)

    Huan, Pin; Zhang, Xiaojun; Li, Fuhua; Zhao, Cui; Zhang, Chengsong; Xiang, Jianhai

    2010-03-01

    Chinese shrimp ( Fenneropenaeus chinensis) is an economically important aquaculture species in China. However, cytogenetic and genomic data is limited in the organism partly because the chromosomes are difficult to isolate and analyze. In this study, fluorescence in-situ hybridization (FISH) was used to identify the chromosomes of F. chinensis. The 5S ribosomal RNA gene (rDNA) of F. chinensis was isolated, cloned and then used as a hybridization probe. The results show that the 5S rDNA was located on one pair of homologous chromosomes in F. chinensis. In addition, triploid shrimp were used to evaluate the feasibility of chromosome identification using FISH and to validate the method. It was confirmed that 5S rDNA can be used as a chromosome-specific probe for chromosome identification in F. chinensis. The successful application of FISH in F. chinensis shows that chromosome-specific probes can be developed and this finding will facilitate further research on the chromosomes of penaeid shrimps.

  9. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    PubMed

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus. PMID:26959315

  10. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    PubMed

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus.

  11. Contrasting patterns of evolution of 45S and 5S rDNA families uncover new aspects in the genome constitution of the agronomically important grass Thinopyrum intermedium (Triticeae).

    PubMed

    Mahelka, Václav; Kopecky, David; Baum, Bernard R

    2013-09-01

    We employed sequencing of clones and in situ hybridization (genomic and fluorescent in situ hybridization [GISH and rDNA-FISH]) to characterize both the sequence variation and genomic organization of 45S (herein ITS1-5.8S-ITS2 region) and 5S (5S gene + nontranscribed spacer) ribosomal DNA (rDNA) families in the allohexaploid grass Thinopyrum intermedium. Both rDNA families are organized within several rDNA loci within all three subgenomes of the allohexaploid species. Both families have undergone different patterns of evolution. The 45S rDNA family has evolved in a concerted manner: internal transcribed spacer (ITS) sequences residing within the arrays of two subgenomes out of three got homogenized toward one major ribotype, whereas the third subgenome contained a minor proportion of distinct unhomogenized copies. Homogenization mechanisms such as unequal crossover and/or gene conversion were coupled with the loss of certain 45S rDNA loci. Unlike in the 45S family, the data suggest that neither interlocus homogenization among homeologous chromosomes nor locus loss occurred in 5S rDNA. Consistently with other Triticeae, the 5S rDNA family in intermediate wheatgrass comprised two distinct array types-the long- and short-spacer unit classes. Within the long and short units, we distinguished five and three different types, respectively, likely representing homeologous unit classes donated by putative parental species. Although the major ITS ribotype corresponds in our phylogenetic analysis to the E-genome species, the minor ribotype corresponds to Dasypyrum. 5S sequences suggested the contributions from Pseudoroegneria, Dasypyrum, and Aegilops. The contribution from Aegilops to the intermediate wheatgrass' genome is a new finding with implications in wheat improvement. We discuss rDNA evolution and potential origin of intermediate wheatgrass.

  12. Contrasting patterns of evolution of 45S and 5S rDNA families uncover new aspects in the genome constitution of the agronomically important grass Thinopyrum intermedium (Triticeae).

    PubMed

    Mahelka, Václav; Kopecky, David; Baum, Bernard R

    2013-09-01

    We employed sequencing of clones and in situ hybridization (genomic and fluorescent in situ hybridization [GISH and rDNA-FISH]) to characterize both the sequence variation and genomic organization of 45S (herein ITS1-5.8S-ITS2 region) and 5S (5S gene + nontranscribed spacer) ribosomal DNA (rDNA) families in the allohexaploid grass Thinopyrum intermedium. Both rDNA families are organized within several rDNA loci within all three subgenomes of the allohexaploid species. Both families have undergone different patterns of evolution. The 45S rDNA family has evolved in a concerted manner: internal transcribed spacer (ITS) sequences residing within the arrays of two subgenomes out of three got homogenized toward one major ribotype, whereas the third subgenome contained a minor proportion of distinct unhomogenized copies. Homogenization mechanisms such as unequal crossover and/or gene conversion were coupled with the loss of certain 45S rDNA loci. Unlike in the 45S family, the data suggest that neither interlocus homogenization among homeologous chromosomes nor locus loss occurred in 5S rDNA. Consistently with other Triticeae, the 5S rDNA family in intermediate wheatgrass comprised two distinct array types-the long- and short-spacer unit classes. Within the long and short units, we distinguished five and three different types, respectively, likely representing homeologous unit classes donated by putative parental species. Although the major ITS ribotype corresponds in our phylogenetic analysis to the E-genome species, the minor ribotype corresponds to Dasypyrum. 5S sequences suggested the contributions from Pseudoroegneria, Dasypyrum, and Aegilops. The contribution from Aegilops to the intermediate wheatgrass' genome is a new finding with implications in wheat improvement. We discuss rDNA evolution and potential origin of intermediate wheatgrass. PMID:23741054

  13. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  14. Karyotype divergence and spreading of 5S rDNA sequences between genomes of two species: darter and emerald gobies ( Ctenogobius , Gobiidae).

    PubMed

    Lima-Filho, P A; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Molina, W F

    2014-01-01

    Karyotype analyses of the cryptobenthic marine species Ctenogobius boleosoma and C. smaragdus were performed by means of classical and molecular cytogenetics, including physical mapping of the multigene 18S and 5S rDNA families. C. boleosoma has 2n = 44 chromosomes (2 submetacentrics + 42 acrocentrics; FN = 46) with a single chromosome pair each carrying 18S and 5S ribosomal sites; whereas C. smaragdus has 2n = 48 chromosomes (2 submetacentrics + 46 acrocentrics; FN = 50), also with a single pair bearing 18S rDNA, but an extensive increase in the number of GC-rich 5S rDNA sites in 21 chromosome pairs. The highly divergent karyotypes among Ctenogobius species contrast with observations in several other marine fish groups, demonstrating an accelerated rate of chromosomal evolution mediated by both chromosomal rearrangements and the extensive dispersion of 5S rDNA sequences in the genome. PMID:24643007

  15. Karyotype divergence and spreading of 5S rDNA sequences between genomes of two species: darter and emerald gobies ( Ctenogobius , Gobiidae).

    PubMed

    Lima-Filho, P A; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Molina, W F

    2014-01-01

    Karyotype analyses of the cryptobenthic marine species Ctenogobius boleosoma and C. smaragdus were performed by means of classical and molecular cytogenetics, including physical mapping of the multigene 18S and 5S rDNA families. C. boleosoma has 2n = 44 chromosomes (2 submetacentrics + 42 acrocentrics; FN = 46) with a single chromosome pair each carrying 18S and 5S ribosomal sites; whereas C. smaragdus has 2n = 48 chromosomes (2 submetacentrics + 46 acrocentrics; FN = 50), also with a single pair bearing 18S rDNA, but an extensive increase in the number of GC-rich 5S rDNA sites in 21 chromosome pairs. The highly divergent karyotypes among Ctenogobius species contrast with observations in several other marine fish groups, demonstrating an accelerated rate of chromosomal evolution mediated by both chromosomal rearrangements and the extensive dispersion of 5S rDNA sequences in the genome.

  16. Organization and variation analysis of 5S rDNA in different ploidy-level hybrids of red crucian carp × topmouth culter.

    PubMed

    He, Weiguo; Qin, Qinbo; Liu, Shaojun; Li, Tangluo; Wang, Jing; Xiao, Jun; Xie, Lihua; Zhang, Chun; Liu, Yun

    2012-01-01

    Through distant crossing, diploid, triploid and tetraploid hybrids of red crucian carp (Carassius auratus red var., RCC♀, Cyprininae, 2n = 100) × topmouth culter (Erythroculter ilishaeformis Bleeker, TC♂, Cultrinae, 2n = 48) were successfully produced. Diploid hybrids possessed 74 chromosomes with one set from RCC and one set from TC; triploid hybrids harbored 124 chromosomes with two sets from RCC and one set from TC; tetraploid hybrids had 148 chromosomes with two sets from RCC and two sets from TC. The 5S rDNA of the three different ploidy-level hybrids and their parents were sequenced and analyzed. There were three monomeric 5S rDNA classes (designated class I: 203 bp; class II: 340 bp; and class III: 477 bp) in RCC and two monomeric 5S rDNA classes (designated class IV: 188 bp, and class V: 286 bp) in TC. In the hybrid offspring, diploid hybrids inherited three 5S rDNA classes from their female parent (RCC) and only class IV from their male parent (TC). Triploid hybrids inherited class II and class III from their female parent (RCC) and class IV from their male parent (TC). Tetraploid hybrids gained class II and class III from their female parent (RCC), and generated a new 5S rDNA sequence (designated class I-N). The specific paternal 5S rDNA sequence of class V was not found in the hybrid offspring. Sequence analysis of 5S rDNA revealed the influence of hybridization and polyploidization on the organization and variation of 5S rDNA in fish. This is the first report on the coexistence in vertebrates of viable diploid, triploid and tetraploid hybrids produced by crossing parents with different chromosome numbers, and these new hybrids are novel specimens for studying the genomic variation in the first generation of interspecific hybrids, which has significance for evolution and fish genetics.

  17. Chromosomal Locations of 5S and 45S rDNA in Gossypium Genus and Its Phylogenetic Implications Revealed by FISH.

    PubMed

    Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo

    2013-01-01

    We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G. incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G. raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution.

  18. Ultraviolet damage and nucleosome folding of the 5S ribosomal RNA gene.

    SciTech Connect

    Liu, X; Mann, David B.; Suquet, C; Springer, David L. ); Smerdon, Michael J.

    2000-01-25

    The Xenopus borealis somatic 5S ribosomal RNA gene was used as a model system to determine the mutual effects of nucleosome folding and formation of ultraviolet (UV) photoproducts (primarily cis-syn cyclobutane pyrimidine dimers, or CPDs) in chromatin. We analyzed the preferred rotational and translational settings of 5S rDNA on the histone octamer surface after induction of up to 0.8 CPD/nucleosome core (2.5 kJ/m(2) UV dose). DNase I and hydroxyl radical footprints indicate that UV damage at these levels does not affect the average rotational setting of the 5S rDNA molecules. Moreover, a combination of nuclease trimming and restriction enzyme digestion indicates the preferred translational positions of the histone octamer are not affected by this level of UV damage. We also did not observe differences in the UV damage patterns of irradiated 5S rDNA before or after nucleosome formation, indicating there is little difference in the inhibition of nucleosome folding by specific CPD sites in the 5S rRNA gene. Conversely, nucleosome folding significantly restricts CPD formation at all sites in the three helical turns of the nontranscribed strand located in the dyad axis region of the nucleosome, where DNA is bound exclusively by the histone H3-H4 tetramer. Finally, modulation of the CPD distribution in a 14 nt long pyrimidine tract correlates with its rotational setting on the histone surface, when the strong sequence bias for CPD formation in this tract is minimized by normalization. These results help establish the mutual roles of histone binding and UV photoproducts on their formation in chromatin.

  19. Chromosomal Mapping of Repetitive DNA Sequences in Five Species of Astyanax (Characiformes, Characidae) Reveals Independent Location of U1 and U2 snRNA Sites and Association of U1 snRNA and 5S rDNA.

    PubMed

    Silva, Duilio M Z A; Utsunomia, Ricardo; Pansonato-Alves, José C; Oliveira, Cláudio; Foresti, Fausto

    2015-01-01

    Astyanax is a genus of Characidae fishes currently composed of 155 valid species. Previous cytogenetic studies revealed high chromosomal diversification among them, and several studies have been performed using traditional cytogenetic techniques to investigate karyotypes and chromosomal locations of 18S and 5S rDNA genes. However, only a few studies are currently available about other repetitive sequences. Here, the chromosomal location of small nuclear RNA genes, identified as U1 and U2 snRNA clusters, was established and compared to the distribution of 5S rDNA and histone clusters in 5 Astyanax species (A. paranae, A. fasciatus, A. bockmanni, A. altiparanae, and A. jordani) using FISH. The cytogenetic mapping of U1 and U2 snRNA demonstrated a conserved pattern in the number of sites per genome independent of the location in Astyanax species. The location of the U1 snRNA gene was frequently associated with 5S rDNA sequences, indicating a possible interaction between the distinct repetitive DNA families. Finally, comparisons involving the location of U1 and U2 snRNA clusters in the chromosomes of Astyanax species revealed a very diverse pattern, suggesting that many rearrangements have occurred during the diversification process of this group. PMID:26329975

  20. Chromosomal Mapping of Repetitive DNA Sequences in Five Species of Astyanax (Characiformes, Characidae) Reveals Independent Location of U1 and U2 snRNA Sites and Association of U1 snRNA and 5S rDNA.

    PubMed

    Silva, Duilio M Z A; Utsunomia, Ricardo; Pansonato-Alves, José C; Oliveira, Cláudio; Foresti, Fausto

    2015-01-01

    Astyanax is a genus of Characidae fishes currently composed of 155 valid species. Previous cytogenetic studies revealed high chromosomal diversification among them, and several studies have been performed using traditional cytogenetic techniques to investigate karyotypes and chromosomal locations of 18S and 5S rDNA genes. However, only a few studies are currently available about other repetitive sequences. Here, the chromosomal location of small nuclear RNA genes, identified as U1 and U2 snRNA clusters, was established and compared to the distribution of 5S rDNA and histone clusters in 5 Astyanax species (A. paranae, A. fasciatus, A. bockmanni, A. altiparanae, and A. jordani) using FISH. The cytogenetic mapping of U1 and U2 snRNA demonstrated a conserved pattern in the number of sites per genome independent of the location in Astyanax species. The location of the U1 snRNA gene was frequently associated with 5S rDNA sequences, indicating a possible interaction between the distinct repetitive DNA families. Finally, comparisons involving the location of U1 and U2 snRNA clusters in the chromosomes of Astyanax species revealed a very diverse pattern, suggesting that many rearrangements have occurred during the diversification process of this group.

  1. Molecular confirmation of the genomic constitution of Douglasdeweya (Triticeae: Poaceae): demonstration of the utility of the 5S rDNA sequence as a tool for haplome identification.

    PubMed

    Baum, Bernard R; Johnson, Douglas A

    2008-06-01

    A new genus Douglasdeweya containing the two species, Douglasdeweya deweyi and D. wangii was published in 2005 by Yen et al. based upon the results of cytogenetical and morphological findings. The genome constitution of Douglasdeweya-PPStSt-allowed its segregation from the genus Pseudoroegneria which contains the StSt or StStStSt genomes. Our previous work had demonstrated the utility of using 5S rDNA units, especially the non-transcribed spacer sequence variation, for the resolution of genomes (haplomes) previously established by cytology. Here, we show that sequence analysis of the 5S DNA units from these species strongly supports the proposed species relationships of Yen et al. (Can J Bot 83:413-419, 2005), i.e., the PP genome from Agropyron and the StSt genome from Pseudoroegneria. Analysis of the 5S rDNA units constitutes a powerful tool for genomic research especially in the Triticeae. PMID:18421479

  2. Compilation of 5S rRNA and 5S rRNA gene sequences

    PubMed Central

    Specht, Thomas; Wolters, Jörn; Erdmann, Volker A.

    1990-01-01

    The BERLIN RNA DATABANK as of Dezember 31, 1989, contains a total of 667 sequences of 5S rRNAs or their genes, which is an increase of 114 new sequence entries over the last compilation (1). It covers sequences from 44 archaebacteria, 267 eubacteria, 20 plastids, 6 mitochondria, 319 eukaryotes and 11 eukaryotic pseudogenes. The hardcopy shows only the list (Table 1) of those organisms whose sequences have been determined. The BERLIN RNA DATABANK uses the format of the EMBL Nucleotide Sequence Data Library complemented by a Sequence Alignment (SA) field including secondary structure information. PMID:1692116

  3. Nucleotide excision repair of the 5 S ribosomal RNA gene assembled into a nucleosome.

    PubMed

    Liu, X; Smerdon, M J

    2000-08-01

    A-175-base pair fragment containing the Xenopus borealis somatic 5 S ribosomal RNA gene was used as a model system to determine the effect of nucleosome assembly on nucleotide excision repair (NER) of the major UV photoproduct (cyclobutane pyrimidine dimer (CPD)) in DNA. Xenopus oocyte nuclear extracts were used to carry out repair in vitro on reconstituted, positioned 5 S rDNA nucleosomes. Nucleosome structure strongly inhibits NER at many CPD sites in the 5 S rDNA fragment while having little effect at a few sites. The time course of CPD removal at 35 different sites indicates that >85% of the CPDs in the naked DNA fragment have t(12) values <2 h, whereas <26% of the t(12) values in nucleosomes are <2 h, and 15% are >8 h. Moreover, removal of histone tails from these mononucleosomes has little effect on the repair rates. Finally, nucleosome inhibition of repair shows no correlation with the rotational setting of a 14-nucleotide-long pyrimidine tract located 30 base pairs from the nucleosome dyad. These results suggest that inhibition of NER by mononucleosomes is not significantly influenced by the rotational orientation of CPDs on the histone surface, and histone tails play little (or no) role in this inhibition. PMID:10821833

  4. Characterization and physical mapping of 18S and 5S ribosomal genes in Indian major carps (Pisces, Cyprinidae).

    PubMed

    Ravindra Kumar; Kushwaha, Basdeo; Nagpure, Naresh S

    2013-06-01

    Characterization of the major (18S) and minor (5S) ribosomal RNA genes were carried out in three commercially important Indian major carp (IMC) species, viz. Catla catla, Labeo rohita and Cirrhinus mrigala along with their physical localizations using dual colour fluorescence in situ hybridization. The diploid chromosome number in the above carps was confirmed to be 50 with inter-species karyo-morphological variations. The 18S rDNA signals were observed on 3 pair of chromosomes in C. catla and L. rohita, and two pairs in C. mrigala. The 5S rDNA signal was found on single pair of chromosome in all the species with variation in their position on chromosomes. The sequencing of 18S rDNA generated 1804, 1805 and 1805 bp long fragments, respectively, in C. catla, L. rohita and C. mrigala with more than 98% sequence identity among them. Similarly, sequencing of 5S rDNA generated 191 bp long fragments in the three species with 100% identity in coding region and 23.2% overall variability in non-transcribed spacer region. Thus, these molecular markers could be used as species-specific markers for taxonomic identification and might help in understanding the genetic diversity, genome organization and karyotype evolution of these species.

  5. Functional domains of the Xenopus laevis 5S gene promoter.

    PubMed Central

    Pieler, T; Oei, S L; Hamm, J; Engelke, U; Erdmann, V A

    1985-01-01

    To study the fine structure of the Xenopus laevis somatic 5S gene internal control region, we have created 15 different transversions using mutagenic oligonucleotide primers. The effects of these mutations on 5S DNA transcription in vitro as well as on stable complex formation with transcription factor TF III A and TF III C in crude nuclear extracts were analyzed. Mutations in the common class III 5' promoter element (nucleotides 50-61 in the 5S gene) interfere with transcription activity and stable complex formation whenever they contradict the tDNA box A consensus sequence. The second promoter element is defined by a major sequence block (nucleotides 80-89, box C) and two additional internal residues (70 and 71) at a distance of roughly one helical turn from both the major 3' and 5' control sequences; these two 3' elements contain the primary TF III A binding domain. The remaining nucleotides (62-69 and 71-79) when mutated do not interfere with transcription activity or factor binding and thus they constitute two spacer elements within a symmetrically structured 5S gene promoter. An increase in the relative spacing of box A and box C by insertion of 3 bp between nucleotides 66 and 67 leads to a drastic reduction in transcription activity and the ability to form a stable complex with TF III A and/or TF III C. Thus, accurate spacing is essential for the proper orientation of TF III A on 5S DNA and/or TF III C binding. Images Fig. 1. Fig. 3. Fig. 4. PMID:3004969

  6. Heterochromatin and rDNA 5S and 45S sites as reliable cytogenetic markers for castor bean (Ricinus communis, Euphorbiaceae).

    PubMed

    Vasconcelos, Santelmo; Souza, Analice Araújo de; Gusmão, Cássia Lima Silva; Milani, Máira; Benko-Iseppon, Ana M; Brasileiro-Vidal, Ana Christina

    2010-10-01

    The increasing need for renewable energy resources has led to higher demands for biofuel, a scenario where the castor bean (Ricinus communis L.) seed oil represents a promising source of raw material. Despite that, information regarding the genome organization of R. communis is still scarce, impairing the application of modern biotechnological and breeding procedures. The present work brings the first evaluation of the mitotic chromosomes of this species, including 10 potentially interesting accessions for cultivation in semi-arid environments aiming at the biofuel production. The approach included standard staining, fluorochrome staining (CMA/DAPI), fluorescent in situ hybridization (FISH) with rDNA 5S and 45S, as well as silver impregnation. All accessions were diploid with 2n=2x=20, displaying mainly metacentric chromosomes, with CMA-positive bands (GC-rich) in all pairs of the complement. After silver impregnation, one to 14 nucleoli were observed, while the FISH with rDNA 45S revealed two large sites and a variety of minor dots, and the DNAr 5S hybridized in a single pair. The observed features were discussed and compared with literature data regarding pachytene bivalents.

  7. Distribution of 5-methylcytosine residues in 5S rRNA genes in Arabidopsis thaliana and Secale cereale.

    PubMed

    Fulnecek, J; Matyásek, R; Kovarík, A

    2002-12-01

    Bisulfite genomic sequencing was used to localise 5-methylcytosine residues (mC) in 5S rRNA genes of Arabidopsis thaliana and Secale cereale. The maps of mC distribution were compared with the previously published map of the corresponding region in Nicotiana tabacum. In all three species, the level of methylation of 5S rRNA genes was generally higher than the average for the entire genome. The ratio of 5S rDNA methylation to average overall methylation was 44%/30-33% for N. tabacum, 27%/4-6% for A. thaliana and 24%/20-22% for S. cereale. With the exception of one clone from S. cereale, no methylation-free 5S rDNA was detected. The level of methylation at different sequence motifs in 5S rDNA was calculated for N. tabacum/A. thaliana/ S. cereale, and this analysis yielded the following values (expressed as a percentage of total C): mCG 90%/78%/85%, mCWG 89%/41%/53%, mCmCG 72%/32%/16%, mCCG 4%/2%/0%, mCHH 15%/6%/1%, where W=A or T, and H=A or C or T. Non-symmetrical methylation was almost negligible in the large genome of S. cereale but relatively frequent in N. tabacum and A. thaliana, suggesting that the strict correlation between genome size and cytosine methylation might be violated for this type of methylation. Among non-symmetrical motifs the mCWA triplets were significantly over-represented in Arabidopsis, while in tobacco this preference was not as pronounced. The differences in methylation levels in different sequence contexts might be of phylogenetic significance, but further species in related and different taxa need to be studied before firm conclusions can be drawn. PMID:12471448

  8. TFIIIA binds to different domains of 5S RNA and the Xenopus borealis 5S RNA gene.

    PubMed Central

    Sands, M S; Bogenhagen, D F

    1987-01-01

    We have established the conditions for the reassociation of 5S RNA and TFIIIA to form 7S particles. We tested the ability of altered 5S RNAs to bind TFIIIA, taking advantage of the slower mobility of 7S particles compared with free 5S RNA in native polyacrylamide gels. Linker substitution mutants were constructed encompassing the entire gene, including the intragenic control region. In vitro transcripts of the linker substitution mutants were tested for their ability to bind TFIIIA to form 7S ribonucleoprotein particles. Altered 5S RNAs with base changes in or around helices IV and V, which would interfere with the normal base pairing of that region, showed decreased ability to bind TFIIIA. The transcripts of some mutant genes that were efficiently transcribed (greater than 50% of wild-type efficiency) failed to bind TFIIIA in this gel assay. In contrast, the RNA synthesized from a poorly transcribed mutant, LS 86/97, in which residues 87 to 96 of the RNA were replaced in the single-stranded loop at the base of helix V, bound TFIIIA well. The data indicate that TFIIIA binds to different domains in the 5S RNA gene and 5S RNA. Images PMID:3431548

  9. Conserved Organisation of 45S rDNA Sites and rDNA Gene Copy Number among Major Clades of Early Land Plants.

    PubMed

    Rosato, Marcela; Kovařík, Aleš; Garilleti, Ricardo; Rosselló, Josep A

    2016-01-01

    Genes encoding ribosomal RNA (rDNA) are universal key constituents of eukaryotic genomes, and the nuclear genome harbours hundreds to several thousand copies of each species. Knowledge about the number of rDNA loci and gene copy number provides information for comparative studies of organismal and molecular evolution at various phylogenetic levels. With the exception of seed plants, the range of 45S rDNA locus (encoding 18S, 5.8S and 26S rRNA) and gene copy number variation within key evolutionary plant groups is largely unknown. This is especially true for the three earliest land plant lineages Marchantiophyta (liverworts), Bryophyta (mosses), and Anthocerotophyta (hornworts). In this work, we report the extent of rDNA variation in early land plants, assessing the number of 45S rDNA loci and gene copy number in 106 species and 25 species, respectively, of mosses, liverworts and hornworts. Unexpectedly, the results show a narrow range of ribosomal locus variation (one or two 45S rDNA loci) and gene copies not present in vascular plant lineages, where a wide spectrum is recorded. Mutation analysis of whole genomic reads showed higher (3-fold) intragenomic heterogeneity of Marchantia polymorpha (Marchantiophyta) rDNA compared to Physcomitrella patens (Bryophyta) and two angiosperms (Arabidopsis thaliana and Nicotiana tomentosifomis) suggesting the presence of rDNA pseudogenes in its genome. No association between phylogenetic position, taxonomic adscription and the number of rDNA loci and gene copy number was found. Our results suggest a likely evolutionary rDNA stasis during land colonisation and diversification across 480 myr of bryophyte evolution. We hypothesise that strong selection forces may be acting against ribosomal gene locus amplification. Despite showing a predominant haploid phase and infrequent meiosis, overall rDNA homogeneity is not severely compromised in bryophytes.

  10. Conserved Organisation of 45S rDNA Sites and rDNA Gene Copy Number among Major Clades of Early Land Plants

    PubMed Central

    Rosato, Marcela; Kovařík, Aleš; Garilleti, Ricardo; Rosselló, Josep A.

    2016-01-01

    Genes encoding ribosomal RNA (rDNA) are universal key constituents of eukaryotic genomes, and the nuclear genome harbours hundreds to several thousand copies of each species. Knowledge about the number of rDNA loci and gene copy number provides information for comparative studies of organismal and molecular evolution at various phylogenetic levels. With the exception of seed plants, the range of 45S rDNA locus (encoding 18S, 5.8S and 26S rRNA) and gene copy number variation within key evolutionary plant groups is largely unknown. This is especially true for the three earliest land plant lineages Marchantiophyta (liverworts), Bryophyta (mosses), and Anthocerotophyta (hornworts). In this work, we report the extent of rDNA variation in early land plants, assessing the number of 45S rDNA loci and gene copy number in 106 species and 25 species, respectively, of mosses, liverworts and hornworts. Unexpectedly, the results show a narrow range of ribosomal locus variation (one or two 45S rDNA loci) and gene copies not present in vascular plant lineages, where a wide spectrum is recorded. Mutation analysis of whole genomic reads showed higher (3-fold) intragenomic heterogeneity of Marchantia polymorpha (Marchantiophyta) rDNA compared to Physcomitrella patens (Bryophyta) and two angiosperms (Arabidopsis thaliana and Nicotiana tomentosifomis) suggesting the presence of rDNA pseudogenes in its genome. No association between phylogenetic position, taxonomic adscription and the number of rDNA loci and gene copy number was found. Our results suggest a likely evolutionary rDNA stasis during land colonisation and diversification across 480 myr of bryophyte evolution. We hypothesise that strong selection forces may be acting against ribosomal gene locus amplification. Despite showing a predominant haploid phase and infrequent meiosis, overall rDNA homogeneity is not severely compromised in bryophytes. PMID:27622766

  11. Conserved Organisation of 45S rDNA Sites and rDNA Gene Copy Number among Major Clades of Early Land Plants.

    PubMed

    Rosato, Marcela; Kovařík, Aleš; Garilleti, Ricardo; Rosselló, Josep A

    2016-01-01

    Genes encoding ribosomal RNA (rDNA) are universal key constituents of eukaryotic genomes, and the nuclear genome harbours hundreds to several thousand copies of each species. Knowledge about the number of rDNA loci and gene copy number provides information for comparative studies of organismal and molecular evolution at various phylogenetic levels. With the exception of seed plants, the range of 45S rDNA locus (encoding 18S, 5.8S and 26S rRNA) and gene copy number variation within key evolutionary plant groups is largely unknown. This is especially true for the three earliest land plant lineages Marchantiophyta (liverworts), Bryophyta (mosses), and Anthocerotophyta (hornworts). In this work, we report the extent of rDNA variation in early land plants, assessing the number of 45S rDNA loci and gene copy number in 106 species and 25 species, respectively, of mosses, liverworts and hornworts. Unexpectedly, the results show a narrow range of ribosomal locus variation (one or two 45S rDNA loci) and gene copies not present in vascular plant lineages, where a wide spectrum is recorded. Mutation analysis of whole genomic reads showed higher (3-fold) intragenomic heterogeneity of Marchantia polymorpha (Marchantiophyta) rDNA compared to Physcomitrella patens (Bryophyta) and two angiosperms (Arabidopsis thaliana and Nicotiana tomentosifomis) suggesting the presence of rDNA pseudogenes in its genome. No association between phylogenetic position, taxonomic adscription and the number of rDNA loci and gene copy number was found. Our results suggest a likely evolutionary rDNA stasis during land colonisation and diversification across 480 myr of bryophyte evolution. We hypothesise that strong selection forces may be acting against ribosomal gene locus amplification. Despite showing a predominant haploid phase and infrequent meiosis, overall rDNA homogeneity is not severely compromised in bryophytes. PMID:27622766

  12. Chromosomal mapping of repetitive DNAs in Gobionellus oceanicus and G. stomatus (Gobiidae; Perciformes): A shared XX/XY system and an unusual distribution of 5S rDNA sites on the Y chromosome.

    PubMed

    Lima-Filho, Paulo A; Amorim, Karlla D J; Cioffi, Marcelo B; Bertollo, Luiz A C; Molina, Wagner F

    2014-01-01

    With nearly 2,000 species, Gobiidae is the most specious family of the vertebrates. This high level of speciation is accompanied by conspicuous karyotypic modifications, where the role of repetitive sequences remains largely unknown. This study analyzed the karyotype of 2 species of the genus Gobionellus and mapped 18S and 5S ribosomal RNA genes and (CA)15 microsatellite sequences onto their chromosomes. G. oceanicus (2n = 56; ♂ 12 metacentrics (m) + 4 submetacentrics (sm) + 1 subtelocentric (st) + 39 acrocentrics (a); ♀ 12m + 4sm + 2st + 38a) and G. stomatus (2n = 56; ♂ 20m + 14sm + 1st + 21a; ♀ 20m + 14sm + 2st + 20a) possess the highest diploid chromosome number among the Gobiidae and have different karyotypes. Both species share an XX/XY sex chromosome system with a large subtelocentric X and a small acrocentric Y chromosome which is rich in (CA)15 sequences and bears 5S rRNA sites. Although coding and noncoding repetitive DNA sequences may be involved in the genesis or differentiation of the sex chromosomes, the exclusive presence of 5S rDNA sites on the Y, but not on the X chromosome of both species, represents a novelty in fishes. In summary, the karyotypic differences, as well as new data on the sex chromosome systems in these 2 Gobiidae species, confirm the high chromosomal dynamism observed in this family.

  13. Cloning and sequencing of the rDNA gene family of the water buffalo (Bubalus bubalis).

    PubMed

    Pang, C Y; Deng, T X; Tang, D S; Yang, C Y; Jiang, H; Yang, B Z; Liang, X W

    2012-01-01

    The rDNA genes coding for ribosomal RNA in animals are complicated repeat sequences with high GC content. We amplified water buffalo rDNA gene sequences with the long and accurate (LA) PCR method, using LA Taq DNA polymerase and GC buffer, based on bioinformatic analysis of related organisms. The rDNA genes were found to consist of 9016 nucleotides, including three rRNA genes and two internal transcribed spacers (ITS), which we named 18S rRNA, ITS1, 5.8S rRNA, ITS2 and 28S rRNA. We tested and optimized conditions for cloning these complicated rDNA sequences, including specific rules of primer design, improvements in the reaction system, and selection of the DNA polymerase.

  14. Chromosomal mapping of H3 histone and 5S rRNA genes in eight species of Astyanax (Pisces, Characiformes) with different diploid numbers: syntenic conservation of repetitive genes.

    PubMed

    Piscor, Diovani; Parise-Maltempi, Patricia Pasquali

    2016-03-01

    The genus Astyanax is widely distributed from the southern United States to northern Patagonia, Argentina. While cytogenetic studies have been performed for this genus, little is known about the histone gene families. The aim of this study was to examine the chromosomal relationships among the different species of Astyanax. The chromosomal locations of the 5S rRNA and H3 histone genes were determined in A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, A. mexicanus (all 2n = 50), A. fasciatus (2n = 46), and A. schubarti (2n = 36). All eight species exhibited H3 histone clusters on two chromosome pairs. In six species (A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, and A. fasciatus), syntenic clusters of H3 histone and 5S rDNA were observed on metacentric (m) or submetacentric (sm) chromosomes. In seven species, clusters of 5S rDNA sequences were located on one or two chromosome pairs. In A. mexicanus, 5S rDNA clusters were located on four chromosome pairs. This study demonstrates that H3 histone clusters are conserved on two chromosome pairs in the genus Astyanax, and specific chromosomal features may contribute to the genomic organization of the H3 histone and 5S rRNA genes.

  15. Chromosomal mapping of H3 histone and 5S rRNA genes in eight species of Astyanax (Pisces, Characiformes) with different diploid numbers: syntenic conservation of repetitive genes.

    PubMed

    Piscor, Diovani; Parise-Maltempi, Patricia Pasquali

    2016-03-01

    The genus Astyanax is widely distributed from the southern United States to northern Patagonia, Argentina. While cytogenetic studies have been performed for this genus, little is known about the histone gene families. The aim of this study was to examine the chromosomal relationships among the different species of Astyanax. The chromosomal locations of the 5S rRNA and H3 histone genes were determined in A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, A. mexicanus (all 2n = 50), A. fasciatus (2n = 46), and A. schubarti (2n = 36). All eight species exhibited H3 histone clusters on two chromosome pairs. In six species (A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, and A. fasciatus), syntenic clusters of H3 histone and 5S rDNA were observed on metacentric (m) or submetacentric (sm) chromosomes. In seven species, clusters of 5S rDNA sequences were located on one or two chromosome pairs. In A. mexicanus, 5S rDNA clusters were located on four chromosome pairs. This study demonstrates that H3 histone clusters are conserved on two chromosome pairs in the genus Astyanax, and specific chromosomal features may contribute to the genomic organization of the H3 histone and 5S rRNA genes. PMID:26835745

  16. Molecular characterization and chromosomal mapping of the 5S rRNA gene in Solea senegalensis: a new linkage to the U1, U2, and U5 small nuclear RNA genes.

    PubMed

    Manchado, Manuel; Zuasti, Eugenia; Cross, Ismael; Merlo, Alejandro; Infante, Carlos; Rebordinos, Laureana

    2006-01-01

    Some units of the 5S rDNA of Solea senegalensis were amplified by PCR and sequenced. Three main PCR products (227, 441, and 2166 bp) were identified. The 227- and 441-bp fragments were characterized by highly divergent nontranscribed spacer sequences (referred to as NTS-I and NTS-II) that were 109 and 324 bp long, respectively, yet their coding sequences were nearly identical. The 2166-bp 5S rDNA unit was composed of two 5S rRNA genes separated by NTS-I and followed by a 1721-bp spacer containing the U2, U5, and U1 small nuclear RNA genes (snRNAs). They were inverted and arranged in the transcriptional direction opposite that of the 5S rRNA gene. This simultaneous linkage of 3 different snRNAs had never been observed before. The PCR products were used as probes in fluorescence in situ hybridization experiments to locate the corresponding loci on the chromosomes of S. senegalensis. A major 5S rDNA chromosomal site was located along most of the short arm of a submetacentric pair, while a minor site was detected near the centromeric region of an acrocentric pair.

  17. Cytogenetic Diversity and the Evolutionary Dynamics of rDNA Genes and Telomeric Sequences in the Ancistrus Genus (Loricariidae: Ancistrini).

    PubMed

    Favarato, Ramon Marin; Silva, Maelin da; Oliveira, Renildo Ribeiro de; Artoni, Roberto Ferreira; Feldberg, Eliana; Matoso, Daniele Aparecida

    2016-04-01

    The Ancistrus genus differs from other Ancistrini due to its wide karyotypic diversity, varied diploid numbers, differences in sex chromosomes, and large number of species, as well as its tendency to form small populations with low vagility. This study investigated the role of 5S and 18S rDNA and telomeric repetitive sequences in the evolution of the karyotypic macrostructure of seven species of the genus Ancistrus from the Central Amazon. The results indicate a strong correlation between the location of ribosomal sites and fragile sites in the genome, particularly of 5S rDNA sequences, which are associated, in some species, with telomeric sequences at the sites of chromosomal healing. Moreover, the occurrence of two lineages was observed with regard to the synteny of ribosomal genes. The species of the genus Ancistrus showed high chromosomal lability associated with breakpoints, which was characterized by the presence of repetitive DNA sequences and this process is suggested to be an evolutionary model for the rapid fixation of structural rearrangements. PMID:26829587

  18. Cytogenetic Diversity and the Evolutionary Dynamics of rDNA Genes and Telomeric Sequences in the Ancistrus Genus (Loricariidae: Ancistrini).

    PubMed

    Favarato, Ramon Marin; Silva, Maelin da; Oliveira, Renildo Ribeiro de; Artoni, Roberto Ferreira; Feldberg, Eliana; Matoso, Daniele Aparecida

    2016-04-01

    The Ancistrus genus differs from other Ancistrini due to its wide karyotypic diversity, varied diploid numbers, differences in sex chromosomes, and large number of species, as well as its tendency to form small populations with low vagility. This study investigated the role of 5S and 18S rDNA and telomeric repetitive sequences in the evolution of the karyotypic macrostructure of seven species of the genus Ancistrus from the Central Amazon. The results indicate a strong correlation between the location of ribosomal sites and fragile sites in the genome, particularly of 5S rDNA sequences, which are associated, in some species, with telomeric sequences at the sites of chromosomal healing. Moreover, the occurrence of two lineages was observed with regard to the synteny of ribosomal genes. The species of the genus Ancistrus showed high chromosomal lability associated with breakpoints, which was characterized by the presence of repetitive DNA sequences and this process is suggested to be an evolutionary model for the rapid fixation of structural rearrangements.

  19. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    PubMed

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  20. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.

    PubMed

    Drouin, Guy; Tsang, Corey

    2012-06-01

    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  1. Interaction of Xenopus TFIIIC with the TFIIIA.5 S RNA gene complex.

    PubMed

    Keller, H J; Romaniuk, P J; Gottesfeld, J M

    1992-09-01

    The general transcription factor TFIIIC is necessary for transcription initiation by RNA polymerase III. TFIIIC binds predominantly to the B-Block promoter element, which is present in tRNA genes, several viral RNA genes and repetitive DNA elements, and to the TFIIIA.DNA complex on 5 S RNA genes. Here we report a characterization of Xenopus laevis TFIIIC and its interaction with the TFIIIA.5 S RNA gene complex. A polypeptide with apparent molecular mass of 85 kDa was specifically cross-linked to a B-Block oligonucleotide by UV light. This polypeptide was present in the partially purified TFIIIC fraction and in a complex with a B-Block double-stranded oligonucleotide isolated by nondenaturing gel electrophoresis. TFIIIC.TFIIIA.DNA gel mobility shift complexes were obtained using B-Block DNA affinity-purified TFIIIC and buffer conditions employing low Mg2+ (1 mM) and high dithiothreitol (7 mM) concentrations. Three TFIIIC.TFIIIA.5 S RNA gene complexes were observed by gel mobility shift analysis. One of these complexes was resistant to dissociation by the addition of competing DNA, but the formation of all three complexes was prevented by the inclusion of excess specific competitor DNA in the initial binding reactions. The apparent affinity of TFIIIC for the TFIIIA.5 S DNA complex was 5-fold higher for the somatic-type 5 S RNA gene than for the oocyte-type 5 S RNA gene. Mutations near the 5' boundary of the TFIIIA binding site alter the DNase I footprint of the TFIIIA.DNA complex and reduce the affinity of TFIIIA-mutant 5 S gene complexes for TFIIIC. Differences in TFIIIC affinity for the two classes of 5 S RNA genes may play a role in the developmental regulation of these gene families. PMID:1517247

  2. Early evolutionary colocalization of the nuclear ribosomal 5S and 45S gene families in seed plants: evidence from the living fossil gymnosperm Ginkgo biloba.

    PubMed

    Galián, J A; Rosato, M; Rosselló, J A

    2012-06-01

    In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S-5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S-5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S-5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S-5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary.

  3. Cytogenetic characterization by in situ hybridization techniques and molecular analysis of 5S rRNA genes of the European hazelnut (Corylus avellana).

    PubMed

    Falistocco, E; Marconi, G

    2013-03-01

    The European hazelnut (Corylus avellana L.) is widespread in Europe, where it has been cultivated for centuries. Despite progress in genetics, most of the cytogenetic aspects of this species have been overlooked. The aim of this study was to fill in this gap and obtain basic information on the chromosome structure of this species. Karyomorphological analysis confirmed the chromosome number 2n = 22 and showed that, despite their apparent uniformity, the chromosomes could be separated into three groups of different size: large (L), medium (M), and small (S). As a first step towards the physical mapping of the hazelnut chromosomes, we applied FISH to localize the position of rRNA genes (rDNA). The sites of 45S and 5S rDNA enabled us to identify two chromosome pairs belonging, respectively, to the L and S groups. The self-GISH procedure revealed that repetitive DNA is concentrated in the pericentromeric regions of the chromosomes, as with other species with rather small genomes. The analysis of 5S rDNA repeats offered additional information on the hazelnut genome by obtaining the whole sequence of the transcribed region so far unpublished. The overall results constitute a substantial advance in hazelnut cytogenetics. Further investigation of other species of Corylus could be an effective approach to understanding the phylogenesis of the genus and resolving taxonomic problems.

  4. Two sequence classes of kinetoplastid 5S ribosomal RNA gene revealed among bodonid spliced leader RNA gene arrays.

    PubMed

    Santana, D M; Lukes, J; Sturm, N R; Campbell, D A

    2001-11-13

    The spliced leader RNA genes of Bodo saltans, Cryptobia helicis and Dimastigella trypaniformis were analyzed as molecular markers for additional taxa within the suborder Bodonina. The non-transcribed spacer regions were distinctive for each organism, and 5S rRNA genes were present in Bodo and Dimastigella but not in C. helicis. Two sequence classes of 5S rRNA were evident from analysis of the bodonid genes. The two classes of 5S rRNA genes were found in other Kinetoplastids independent of co-localization with the spliced leader RNA gene.

  5. Chromosomal organization of the 18S and 5S rRNAs and histone H3 genes in Scarabaeinae coleopterans: insights into the evolutionary dynamics of multigene families and heterochromatin

    PubMed Central

    2011-01-01

    Background Scarabaeinae beetles show a high level of macro-chromosomal variability, although the karyotypic organization of heterochromatin and multigene families (rDNAs and histone genes) is poorly understood in this group. To better understand the chromosomal organization and evolution in this group, we analyzed the karyotypes, heterochromatin distribution and chromosomal locations of the rRNAs and histone H3 genes in beetles belonging to eight tribes from the Scarabaeinae subfamily (Coleoptera, Scarabaeidae). Results The number of 18S rRNA gene (a member of the 45S rDNA unit) sites varied from one to 16 and were located on the autosomes, sex chromosomes or both, although two clusters were most common. Comparison of the 45S rDNA cluster number and the diploid numbers revealed a low correlation value. However, a comparison between the number of 45S rDNA sites per genome and the quantity of heterochromatin revealed (i) species presenting heterochromatin restricted to the centromeric/pericentromeric region that contained few rDNA sites and (ii) species with a high quantity of heterochromatin and a higher number of rDNA sites. In contrast to the high variability for heterochromatin and 45S rDNA cluster, the presence of two clusters (one bivalent cluster) co-located on autosomal chromosomes with the 5S rRNA and histone H3 genes was highly conserved. Conclusions Our results indicate that the variability of the 45S rDNA chromosomal clusters is not associated with macro-chromosomal rearrangements but are instead related to the spread of heterochromatin. The data obtained also indicate that both heterochromatin and the 45S rDNA loci could be constrained by similar evolutionary forces regulating spreading in the distinct Scarabaeinae subfamily lineages. For the 5S rRNA and the histone H3 genes, a similar chromosomal organization could be attributed to their association/co-localization in the Scarabaeinae karyotypes. These data provide evidence that different evolutionary

  6. Identification of the gene encoding the 5S ribosomal RNA maturase in Bacillus subtilis: mature 5S rRNA is dispensable for ribosome function.

    PubMed Central

    Condon, C; Brechemier-Baey, D; Beltchev, B; Grunberg-Manago, M; Putzer, H

    2001-01-01

    Over 25 years ago, Pace and coworkers described an activity called RNase M5 in Bacillus subtilis cell extracts responsible for 5S ribosomal RNA maturation (Sogin & Pace, Nature, 1974, 252:598-600). Here we show that RNase M5 is encoded by a gene of previously unknown function that is highly conserved among the low G + C gram-positive bacteria. We propose that the gene be named rnmV. The rnmV gene is nonessential. B. subtilis strains lacking RNase M5 do not make mature 5S rRNA, indicating that this process is not necessary for ribosome function. 5S rRNA precursors can, however, be found in both free and translating ribosomes. In contrast to RNase E, which cleaves the Escherichia coli 5S precursor in a single-stranded region, which is then trimmed to yield mature 5S RNA, RNase M5 cleaves the B. subtilis equivalent in a double-stranded region to yield mature 5S rRNA in one step. For the most part, eubacteria contain one or the other system for 5S rRNA production, with an imperfect division along gram-negative and gram-positive lines. A potential correlation between the presence of RNase E or RNase M5 and the single- or double-stranded nature of the predicted cleavage sites is explored. PMID:11233981

  7. Cytogenetic comparison between two allopatric populations of Astyanax altiparanae Garutti et Britski, 2000 (Teleostei, Characidae), with emphasis on the localization of 18S and 5S rDNA

    PubMed Central

    Pacheco, Rosiley Berton; da Rosa, Renata; Giuliano-Caetano, Lucia; Júlio Jr., Horácio Ferreira; Dias, Ana Lúcia

    2011-01-01

    Abstract Two populations of Astyanax altiparanae (Garutti & Britski, 2000) of the Água dos Patos stream/SP and lake Igapó/PR were analyzed. All individuals showed 2n = 50, however, different karyotypic formulae were observed. The population of the Água dos Patos stream showed 8m +24sm+6st+12a (NF=88) and the population of lake Igapó, 8m+28sm+4st+10a (NF=90). Nucleolus organizing regions (AgNORs) were observed in the terminal position on the short and long arm of different chromosomes of both populations, showing a variation from 3 to 4 chromosomes. Fluorescent in situ hybridization (FISH) using 18S rDNA probes revealed only one pair of chromosomes with fluorescent signals in the terminal site on the short arm in the Igapó lake population, while the population of Água dos Patos stream showed 4 fluorescence terminal signals, characterizing a system of simple and multiple NORs, respectively. 5S rDNA fluorescent signals were detected in the interstitial position of a pair of chromosomes in the two studied populations. Some AgNOR sites revealed to be GC-rich when stained with Chromomycin A3 (CMA3), however, AT positive regions were not observed. The data obtained show that, despite the conservation of the diploid number and location of 5S DNAr, differences in both the distribution of 18S rDNA and karyotypic formula among the populations were found, thus corroborating the existing data on chromosome variability in Astyanax altiparanae that can be significant for cytotaxonomy in this group. PMID:24260632

  8. Cytogenetic comparison between two allopatric populations of Astyanax altiparanae Garutti et Britski, 2000 (Teleostei, Characidae), with emphasis on the localization of 18S and 5S rDNA.

    PubMed

    Pacheco, Rosiley Berton; da Rosa, Renata; Giuliano-Caetano, Lucia; Júlio, Horácio Ferreira; Dias, Ana Lúcia

    2011-01-01

    Two populations of Astyanax altiparanae (Garutti & Britski, 2000) of the Água dos Patos stream/SP and lake Igapó/PR were analyzed. All individuals showed 2n = 50, however, different karyotypic formulae were observed. The population of the Água dos Patos stream showed 8m +24sm+6st+12a (NF=88) and the population of lake Igapó, 8m+28sm+4st+10a (NF=90). Nucleolus organizing regions (AgNORs) were observed in the terminal position on the short and long arm of different chromosomes of both populations, showing a variation from 3 to 4 chromosomes. Fluorescent in situ hybridization (FISH) using 18S rDNA probes revealed only one pair of chromosomes with fluorescent signals in the terminal site on the short arm in the Igapó lake population, while the population of Água dos Patos stream showed 4 fluorescence terminal signals, characterizing a system of simple and multiple NORs, respectively. 5S rDNA fluorescent signals were detected in the interstitial position of a pair of chromosomes in the two studied populations. Some AgNOR sites revealed to be GC-rich when stained with Chromomycin A3 (CMA3), however, AT positive regions were not observed. The data obtained show that, despite the conservation of the diploid number and location of 5S DNAr, differences in both the distribution of 18S rDNA and karyotypic formula among the populations were found, thus corroborating the existing data on chromosome variability in Astyanax altiparanae that can be significant for cytotaxonomy in this group.

  9. Diversity of 5S rRNA genes within individual prokaryotic genomes.

    PubMed

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V; Parsons, Tamasha; Yang, Liying; Gerz, Erika A; Lee, Peng; Xiang, Charlie; Nossa, Carlos W; Pei, Zhiheng

    2012-10-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1161 genomes from 779 unique species, 96 species exhibited > 3% diversity. Twenty-seven species with > 10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) of the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there are tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level.

  10. Analysis of a 5S rRNA gene cloned from Euplotes eurstomus

    SciTech Connect

    Roberson, A.E.; Wolffe, A.; Olins, D.E.

    1987-05-01

    The macronucleus of the hypotrichous ciliated protozoan Euplotes eurystomus lends itself to the study of eukaryotic gene and chromatin structure because native macronuclear DNA exists as linear, gene-sized fragments between 400 and 20,000 bp in length. The macronuclear chromatin, while arranged in a typical nucleosomal structure, is freely soluble in low ionic strength buffers without treatment by nucleases. Thus, specific genes may be enriched as native, intact chromatin molecules. The 5S rRNA gene from Euplotes has been cloned to facilitate investigation of 5S gene-chromatin following characterization of the gene at the DNA level. It has been demonstrated that the gene, while in circular or linear form, can be transcribed in vitro by a Xenopus oocyte nuclear extract. The transcript generated in vitro is 120 nucleotides in length and is synthesized by RNA polymerase III. Anti-Xenopus TFIIIA antibodies recognize a Euplotes macronuclear chromatin-associated protein which is approx. 80 KD in size. It has been established that the sequence of the telomere flanking the 5S gene in Euplotes eurystomus is the same telomeric sequence published for Euplotes aediculatus.

  11. Nonviral Gene Targeting at rDNA Locus of Human Mesenchymal Stem Cells

    PubMed Central

    Hu, Youjin; Liu, Xionghao; Long, Panpan; Xiao, Di; Cun, Jintao; Li, Zhuo; Xue, Jinfeng; Wu, Yong; Luo, Sha; Wu, Lingqian; Liang, Desheng

    2013-01-01

    Background. Genetic modification, such as the addition of exogenous genes to the MSC genome, is crucial to their use as cellular vehicles. Due to the risks associated with viral vectors such as insertional mutagenesis, the safer nonviral vectors have drawn a great deal of attention. Methods. VEGF, bFGF, vitamin C, and insulin-transferrin-selenium-X were supplemented in the MSC culture medium. The cells' proliferation and survival capacity was measured by MTT, determination of the cumulative number of cells, and a colony-forming efficiency assay. The plasmid pHr2-NL was constructed and nucleofected into MSCs. The recombinants were selected using G418 and characterized using PCR and Southern blotting. Results. BFGF is critical to MSC growth and it acted synergistically with vitamin C, VEGF, and ITS-X, causing the cells to expand significantly. The neomycin gene was targeted to the rDNA locus of human MSCs using a nonviral human ribosomal targeting vector. The recombinant MSCs retained multipotential differentiation capacity, typical levels of hMSC surface marker expression, and a normal karyotype, and none were tumorigenic in nude mice. Conclusions. Exogenous genes can be targeted to the rDNA locus of human MSCs while maintaining the characteristics of MSCs. This is the first nonviral gene targeting of hMSCs. PMID:23762822

  12. Transcription factor IIIA induced bending of the Xenopus somatic 5S gene promoter.

    PubMed

    Schroth, G P; Cook, G R; Bradbury, E M; Gottesfeld, J M

    1989-08-10

    Transcription factor IIIA (TFIIIA), the canonical zinc-finger protein, is a protein of relative molecular mass 39,000 (39K) that is required for transcription of 5S-ribosomal subunit genes in Xenopus. It binds in a sequence-specific manner to the internal control region of the 5S gene (see Fig. 1) and facilitates transcription of the gene by RNA polymerase III. It also binds to the 5S gene product to form a 7S ribonucleoprotein particle. In oocytes the 7S particle acts as a storage form of the RNA to be utilized later in development. TFIIIA binds to DNA through its 30 K N-terminal domain, which contains nine zinc-fingers. TFIIIA was the first protein described to have this type of DNA binding motif, but numerous other proteins have now been shown to have zinc-finger domains. A structure for a single zinc-finger from the yeast protein ADR1, was recently proposed based on two-dimensional NMR data (ref. 8), and a similar structure was proposed based on comparison with crystal structures of other metalloproteins. Although models for the interaction of TFIIIA with the 5S-ribosomal gene DNA have been proposed, based on nuclease digestion and methylation interference data, little precise structural information is available for TFIIIA and the physical basis for the interaction of zinc-fingers with DNA is not understood. Using both circular permutation and circularization assays we provide convincing biochemical evidence that TFIIIA bends the DNA at the internal promoter of the 5S gene.

  13. Diversity within the genus Elymus (Poaceae: Triticeae) as investigated by the analysis of the nr5S rDNA variation in species with St and H haplomes.

    PubMed

    Baum, B R; Edwards, T; Johnson, D A

    2015-02-01

    The genus Elymus ("Ryegrass") is a repository for a range of species with a variety of haplome contents; hence the pejorative name "dustbin" genus. We have analyzed 1,059 sequences from 128 accessions representing 24 species to investigate the relationships among the StH haplomes-containing species described by Yen and Yang (Genus Elymus Beijing 5:58-362, 2013). Sequences were assigned to "unit classes" of orthologous sequences and subjected to a suite of analyses including BLAST (Basic Local Alignment Search Tool) searches, phylogenetic analysis and population genetic analysis to estimate species diversity. Our results support the genome analyses in Yen and Yang (Genus Elymus Beijing 5:58-362, 2013), i.e., genomic constitution StStHH including variants restricted to Elymus. Population genetic analysis of the 5S nrDNA sequence data revealed that the within-species variance component is roughly ±89 %; thus, we were unable to identify molecular markers capable to separate the 24 species analyzed. Separate phylogenetic analyses of the two unit classes and of all the data exhibit a trend only of the species to cluster on the phylograms. Finally, the analysis provides evidence for the multiple origins of American and Eurasian species. PMID:25248636

  14. Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

    PubMed

    Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

    2013-11-01

    Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

  15. More than 10% of yeast genes are related to genome stability and influence cellular senescence via rDNA maintenance

    PubMed Central

    Saka, Kimiko; Takahashi, Akihiro; Sasaki, Mariko; Kobayashi, Takehiko

    2016-01-01

    Genome instability triggers cellular senescence and is a common cause of cancer. The ribosomal RNA genes (rDNA), due to their repetitive structure, form a fragile site with frequent rearrangements. To identify eukaryotic factors that connect reduced genome stability to senescence we screened 4,876 strains of a Saccharomyces cerevisiae deletion library for aberrant rDNA and found 708 genes that contribute to its upkeep. 28 mutants caused abnormalities in non-rDNA chromosomes and among them 12 mutants have abnormalities both in rDNA and in non-rDNA chromosomes. Many mutated genes have not previously been implicated with genome maintenance nor their homologues with tumorigenesis in mammals. The link between rDNA state and senescence was broken after deletion of factors related with DNA polymerase ϵ. These mutations also suppressed the short lifespan phenotype of a sir2 mutant, suggesting a model in which molecular events at the heart of the replication fork induce abnormal rDNA recombination and are responsible for the emergence of an aging signal. PMID:26912831

  16. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    PubMed

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA. PMID:26853884

  17. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    PubMed

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA.

  18. Cytogenetic mapping of 5S and 18S rRNAs and H3 histone genes in 4 ancient Proscopiidae grasshopper species: contribution to understanding the evolutionary dynamics of multigene families.

    PubMed

    Cabral-de-Mello, D C; Martins, C; Souza, M J; Moura, R C

    2011-01-01

    This paper reports on the chromosomal location of 18S rRNA, 5S rRNA and H3 histone multigene families in 4 species of a relatively ancient and diversified group of grasshoppers belonging to the family Proscopiidae. The 5S rRNA and H3 histone genes were highly conserved in the number of sites and chromosomal position in the 4th chromosome pair in all species analyzed, whereas the 18S rRNA genes showed slightly more variation because they were present on one or 2 chromosome pairs, depending on the species. The 5S and 18S rRNA gene families occurred in different chromosomes; in contrast, H3 histone and 5S rRNA genes co-localized in the same chromosomal position, with an apparently interspersed organization. Considering that the Proscopiidae family is a relatively ancient group compared with the Acrididae family, the association of the H3 histone and 5S rRNA multigene families can represent a basal condition for grasshoppers, although more research is needed on other representatives of this insect group to confirm this statement. The presence of such an association of 5S rDNA and H3 histone in mussels and arthropods (beetles, grasshoppers and crustaceans) suggests that this linked configuration could represent an ancestral pattern for invertebrates. These results provide new insights into the understanding of the genome organization and the evolution of multigene families in grasshoppers and in insects as a whole.

  19. Targeting of the Human Coagulation Factor IX Gene at rDNA Locus of Human Embryonic Stem Cells

    PubMed Central

    Yang, Junlin; Xue, Jinfeng; Hu, Youjin; Feng, Mai; Niu, Wenbin; Yang, Qiurui; Lei, Ming; Xia, Jiahui; Wu, Lingqian; Liang, Desheng

    2012-01-01

    Background Genetic modification is a prerequisite to realizing the full potential of human embryonic stem cells (hESCs) in human genetic research and regenerative medicine. Unfortunately, the random integration methods that have been the primary techniques used keep creating problems, and the primary alternative method, gene targeting, has been effective in manipulating mouse embryonic stem cells (mESCs) but poorly in hESCs. Methodology/Principal Findings Human ribosomal DNA (rDNA) repeats are clustered on the short arm of acrocentric chromosomes. They consist of approximately 400 copies of the 45S pre-RNA (rRNA) gene per haploid. In the present study, we targeted a physiological gene, human coagulation factor IX, into the rDNA locus of hESCs via homologous recombination. The relative gene targeting efficiency (>50%) and homologous recombination frequency (>10−5) were more than 10-fold higher than those of loci targeted in previous reports. Meanwhile, the targeted clones retained both a normal karyotype and the main characteristics of ES cells. The transgene was found to be stably and ectopically expressed in targeted hESCs. Conclusion/Significance This is the first targeting of a human physiological gene at a defined locus on the hESC genome. Our findings indicate that the rDNA locus may serve as an ideal harbor for transgenes in hESCs. PMID:22615895

  20. Structural polymorphism in the major groove of a 5S RNA gene complements the zinc finger domains of transcription factor IIIA.

    PubMed Central

    Huber, P W; Morii, T; Mei, H Y; Barton, J K

    1991-01-01

    Metal complexes that bind to DNA on the basis of shape-selection have been used to map the conformational features of the DNA binding site for transcription factor IIIA. Conformationally distinct segments are detected on the 5S rRNA gene that correspond closely to the binding sites identified for the individual zinc finger domains of the protein. The local conformations are characterized by a major groove opened because of a change in base pair inclination and/or displacement at a central 5'-pyrimidine-purine-3' step, flanked by a widened minor groove, as would arise at the junctions between alternating B- and A-like DNA segments. Docking experiments with a consensus structure of a zinc finger reveal that the mixed A-B binding site accommodates the peptide domain better than either canonical B- or A-DNA helices. The close structural matching of the conformational variations in the 5S rDNA both to the proposed sites of zinc finger binding and to the shape of an individual zinc finger domain points to DNA structural polymorphism as providing an important determinant in recognition. In particular, shape selection in the 5' half of the internal control region may orient the multiple finger domains. Images PMID:1961749

  1. Variation in rDNA locus number and position among legume species and detection of 2 linked rDNA loci in the model Medicago truncatula by FISH.

    PubMed

    Abirached-Darmency, Mona; Prado-Vivant, Emilce; Chelysheva, Liudmila; Pouthier, Thomas

    2005-06-01

    Within Fabaceae, legume species have a variable genome size, chromosome number, and ploidy level. The genome distribution of ribosomal genes, easily detectable by fluorescent in situ hybridization (FISH), is a good tool for anchoring physical and genetic comparative maps. The organisation of 45S rDNA and 5S loci was analysed by FISH in the 4 closely related species: Pisum sativum, Medicago truncatula, Medicago sativa (2 diploid taxa), and Lathyrus sativus. The 2 types of rDNA arrays displayed interspecific variation in locus number and location, but little intraspecific variation was detected. In the model legume, M. truncatula, the presence of 2 adjacent 45S rDNA loci was demonstrated, and the location of the rDNA loci was independent of the general evolution of the genome DNA. The different parameters relative to clustering of the rDNA loci in specific chromosome regions and the possible basis of rDNA instability are discussed. PMID:16121252

  2. Species identification of Crassostrea and Ostrea oysters by polymerase chain reaction amplification of the 5S rRNA gene.

    PubMed

    Cross, Ismael; Rebordinos, Laureana; Diaz, Edgardo

    2006-01-01

    A specific multiplex polymerase chain reaction (PCR) was developed for the identification of Crassostrea angulata, C. gigas, Ostrea edulis, and O. stentina oyster species. Universal primers were used for the amplification of complete repetition units of 5S rDNA in each of the 4 species. The alignment of the obtained sequences was the basis for the specific design of species-specific primers (ED1, ED2, ST1, ST2, CR1, and CR2) located in the nontranscribed spacer regions. The different sizes of the species-specific amplicons, separated by agarose gel electrophoresis, allowed identification of Crassostrea and Ostrea species. A multiplex PCR with a set of the 6 designed primers showed that they did not interfere with each other and bound specifically to the DNA target. This genetic marker can be very useful for traceability of the species, application in the management of oyster cultures, and conservation of the genetic resources of the species. PMID:16512239

  3. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    PubMed

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families.

  4. An unusual Y chromosome of Drosophila simulans carrying amplified rDNA spacer without rRNA genes.

    PubMed

    Lohe, A R; Roberts, P A

    1990-06-01

    The X and Y chromosomes of Drosophila melanogaster each contain a cluster of several hundred ribosomal RNA genes (rDNA). A nontranscribed spacer region separates adjacent rRNA genes and contains tandem copies of 240 bp repeats that include the initiation site for RNA polymerase I transcription. We show here that Drosophila simulans, a sibling species of D. melanogaster, contains few, if any, rRNA genes on its Y chromosome but carries instead a large block (3,000 kb or 12,500 copies) of 240 bp nontranscribed spacer repeats. The repeats are located at the tip of the long arm of the simulans Y chromosome, in contrast to their location among rRNA genes on the short arm of the Y chromosome of D. melanogaster. The bobbed mutation in homozygous females of D. melanogaster shortens and thins the bristles, owing to a partial deletion of rRNA genes on the X chromosome. The bristles of bobbed/Y males are normal owing to the presence of a full complement of rRNA genes on the Y chromosome. Peculiarly, in bobbed/Y males of D. simulans the short bristle phenotype does not return to normal but is enhanced by the presence of the Y chromosome. We propose that the 12,500 nontranscribed spacer repeats on the Y chromosome are responsible for this biological effect by competition for a protein factor(s) essential for normal levels of rDNA transcription at the X-linked locus.

  5. Physical mapping of 18S and 5S genes in pelagic species of the genera Caranx and Carangoides (Carangidae).

    PubMed

    Jacobina, U P; Bertollo, L A C; Bello Cioffi, M; Molina, W F

    2014-11-14

    In Carangidae, Caranx is taxonomically controversial because of slight morphological differences among species, as well as because of its relationship with the genus Carangoides. Cytogenetic data has contributed to taxonomic and phylogenetic classification for some groups of fish. In this study, we examined the chromosomes of Caranx latus, Caranx lugubris, and Carangoides bartholomaei using classical methods, including conventional staining, C-banding, silver staining for nuclear organizer regions, base-specific fluorochrome, and 18S and 5S ribosomal sequence mapping using in situ hybridization. These 3 species showed chromosome numbers of 2n = 48, simple nuclear organizer regions (pair 1), and mainly centromeric heterochomatin. However, C. latus (NF = 50) and C. bartholomaei (NF = 50) showed a structurally conserved karyotype compared with C. lugubris (NF = 54), with a larger number of 2-armed chromosomes. The richness of GC-positive heterochromatic segments and sites in 5S rDNA in specific locations compared to the other 2 species reinforce the higher evolutionary dynamism in C. lugubris. Cytogenetic aspects shared between C. latus and C. bartholomaei confirm the remarkable phylogenetic proximity between these genera.

  6. snoU6 and 5S RNAs are not reliable miRNA reference genes in neuronal differentiation.

    PubMed

    Lim, Q E; Zhou, L; Ho, Y K; Wan, G; Too, H P

    2011-12-29

    Accurate profiling of microRNAs (miRNAs) is an essential step for understanding the functional significance of these small RNAs in both physiological and pathological processes. Quantitative real-time PCR (qPCR) has gained acceptance as a robust and reliable transcriptomic method to profile subtle changes in miRNA levels and requires reference genes for accurate normalization of gene expression. 5S and snoU6 RNAs are commonly used as reference genes in microRNA quantification. It is currently unknown if these small RNAs are stably expressed during neuronal differentiation. Panels of miRNAs have been suggested as alternative reference genes to 5S and snoU6 in various physiological contexts. To test the hypothesis that miRNAs may serve as stable references during neuronal differentiation, the expressions of eight miRNAs, 5S and snoU6 RNAs in five differentiating neuronal cell types were analyzed using qPCR. The stabilities of the expressions were evaluated using two complementary statistical approaches (geNorm and Normfinder). Expressions of 5S and snoU6 RNAs were stable under some but not all conditions of neuronal differentiation and thus are not suitable reference genes. In contrast, a combination of three miRNAs (miR-103, miR-106b and miR-26b) allowed accurate expression normalization across different models of neuronal differentiation.

  7. Molecular phylogeny of the butterfly tribe Satyrini (Nymphalidae: Satyrinae) with emphasis on the utility of ribosomal mitochondrial genes 16s rDNA and nuclear 28s rDNA.

    PubMed

    Yang, Mingsheng; Zhang, Yalin

    2015-07-09

    The tribe Satyrini is one of the most diverse groups of butterflies, but no robust phylogenetic hypothesis for this group has been achieved. Two rarely used 16s and 28s ribosomal and another seven protein-coding genes were used to reconstruct the phylogeny of the Satyrini, with further aim to evaluate the informativeness of the ribosomal genes. Our maximum parsimony (MP), maximum likelihood (ML) and Bayesian inference (BI) analyses consistently recovered three well-supported clades for the eleven sampled subtribes of Satyrini: clade I includes Eritina and Coenonymphina, being sister to the clade II + clade III; clade II contains Parargina, Mycalesina and Lethina, and the other six subtribes constitute clade III. The placements of the taxonomically unstable Davidina Oberthür and geographically restricted Paroeneis Moore in Satyrina are confirmed for the first time based on molecular evidence. The close relationships of Callerebia Butler, Loxerebia Watkins and Argestina Riley are well-supported. We suggest that Rhaphicera Butler belongs to Lethina. The partitioned Bremer support (PBS) values of MP analysis show that the 16s rDNA contributes well to the nodes representing all the taxa from subtribe to species levels, and the 28s rDNA is informative at the subtribe level. Furthermore, our ML analyses show that the ribosomal genes 16s rDNA and 28s rDNA are informative, because most node support values are lower in the ML tree after the removal of them than that in ML tree constructed based on the full nine-gene dataset. This indicates that some other ribosomal genes should be tentatively used through combining with traditionally used protein-coding genes in further analysis on phylogeny of Satyrini, providing that proper representatives are sampled.

  8. Chromosomal localization and molecular characterization of three different 5S ribosomal DNA clusters in the sea urchin Paracentrotus lividus.

    PubMed

    Caradonna, Fabio; Bellavia, Daniele; Clemente, Ann Maria; Sisino, Giorgia; Barbieri, Rainer

    2007-09-01

    In this paper the chromosomal localization and molecular cloning and characterization of three 5S rDNA clusters of 700 bp (base pairs), 900 bp, and 950 bp in the sea urchin Paracentrotus lividus are reported. Southern blot hybridization demonstrated the existence of three 5S rDNA repeats of differing length in the P. lividus genome. Fluorescence in situ hybridization analysis, performed in parallel on both haploid and diploid metaphases and interphase nuclei using different 5S rDNA units as probes, localized these 5S rDNA clusters in 3 different pairs of P. lividus chromosomes. This is the first complete gene mapping not only in a sea urchin but also in the phylum of echinoderms as a whole. PMID:17893727

  9. Chromosomal localization of 5S rRNA gene loci and the implications for relationships within the Allium complex.

    PubMed

    Lee, S H; Do, G S; Seo, B B

    1999-01-01

    Chromosomal localizations and distribution patterns of the 5S rRNA genes by means of fluorescence in-situ hybridization in diploid Allium species could help to classify species into chromosome types and aid in determining relationships among genomes. All eleven diploid species were classified into five types, A to E. Species of type A showed a pair of 5S rRNA signals on the short arm of chromosome 5 and two pairs of signals on both arms of chromosome 7. Species of types B and C showed one pair and two pairs of signals on the short arm of chromosome 7, respectively. Type D species showed two pairs of signals on the satellite region of the short arm and a pair of signals on the long arm of chromosome 7. Type E species showed three distinct 5S rRNA gene loci signals on the short arm of chromosome 7. Information on chromosomal localization of 5S rRNA gene loci and distribution patterns within chromosomes in diploid Allium species could help to infer the pathway of origin of the three kinds of alloploid species. Data indicate that A. wakegi is an allopolyploid with genomes of types B and C, and A. deltoide-fistulosum is an allotetraploid derived from a natural hybridization between different species within chromosome type A. Results indicate that A. senescens is an allopolyploid with type B chromosomes and an unidentified chromosomal type. PMID:10328620

  10. Transcription of the Drosophila melanogaster 5S RNA gene requires an upstream promoter and four intragenic sequence elements

    SciTech Connect

    Sharp, S.J.; Garcia, A.D.

    1988-03-01

    Linker-scanning (LS) mutations were constructed spanning the length of the Drosophila melanogaster 5S RNA gene. In vitro transcription analysis of the LS 5S DNAs revealed five transcription control regions. One control region essential for the transcription initiation was identified in the 5'-flanking sequence. The major sequence determinants of this upstream promoter region were located between coordinates -39 and -26 (-30 region), but important sequences extended to the transcription start site at position 1. Since mutations in the upstream promoter did not alter the ability of 5S DNA to sequester transcription factors into a stable transcription complex, it appears that this control region involved the interaction of RNA polymerase III. Active 5S DNA transcription additionally required the four intragenic control regions (ICRs) located between coordinates 3 and 18 (ICR I), 37 and 44 (ICR II), 48 and 61 (ICR III), and 78 and 98 (ICR IV). LS mutations in each ICR decreased the ability of 5S DNA to sequester transcription factors. ICR III, ICR IV, and the spacer sequence between were similar in sequence and position to the determinant elements of the multipartite ICR of Xenopus 5S DNA. The importance of ICR III and ICR IV in transcription initiation and in sequestering transcription factors suggests the presence of an activity in D. melanogaster similar to transcription factor TFIIIA of Xenopus laevis and HeLa cells. Transcription initiation of Drosophila 5S DNA was not eliminated by LS mutations in the spacer region even though these mutations reduced the ability of the TFIIIA-like activity to bind.

  11. Molecular characterization of dichloromethane-degrading Hyphomicrobium strains using 16S rDNA and DCM dehalogenase gene sequences.

    PubMed

    Nikolausz, Marcell; Kappelmeyer, Uwe; Nijenhuis, Ivonne; Ziller, Katja; Kästner, Matthias

    2005-09-01

    A phylogenetic analysis of 6 strains of dichloromethane (DCM) utilizing bacteria was performed. Based on the almost complete 16S rDNA sequence determination, all strains clustered together and showed high sequence similarity to Hyphomicrobium denitrificans, except for the strain MC8b, which is only moderately related to them and probably represents a distinct species. The 16S rDNA-based phylogenetic tree was compared to the one obtained from the DNA sequence data of the dcmA gene coding DCM dehalogenase, the key enzyme of DCM utilization. The topology of the two trees is in good agreement and may suggest an ancient origin of DCM dehalogenase, but also raises questions about the original role of the enzyme. PMID:16156115

  12. Repair of rDNA in Saccharomyces cerevisiae: RAD4-independent strand-specific nucleotide excision repair of RNA polymerase I transcribed genes.

    PubMed Central

    Verhage, R A; Van de Putte, P; Brouwer, J

    1996-01-01

    Removal of UV-induced pyrimidine dimers from the individual strands of the rDNA locus in Saccharomyces cerevisiae was studied. Yeast rDNA, that is transcribed by RNA polymerase I(RNA pol I), is repaired efficiently, slightly strand-specific and independently of RAD26, which has been implicated in transcription-coupled repair of the RNA pol II transcribed RPB2 gene. No repair of rDNA is observed in rad1,2,3 and 14 mutants, demonstrating that dimer removal from this highly repetitive DNA is accomplished by nucleotide excision repair (NER). In rad7 and rad16 mutants, which are specifically deficient in repair of non-transcribed DNA, there is a clear preferential repair of the transcribed strand of rDNA, indicating that strand-specific and therefore probably transcription-coupled repair of RNA pol I transcribed genes does exist in yeast. Unexpectedly, the transcribed but not the non-transcribed strand of rDNA can be repaired in rad4 mutants, which seem otherwise completely NER-deficient. PMID:8604332

  13. The nuclear 5S RNAs from chicken, rat and man. U5 RNAs are encoded by multiple genes.

    PubMed

    Krol, A; Gallinaro, H; Lazar, E; Jacob, M; Branlant, C

    1981-02-25

    Preparations of chicken, rat and human nuclear 5S RNA contain two sets of molecules. The set with the lowest electrophoretic mobility (5Sa) contains RNAs identical or closely related to ribosomal 5S RNA from the corresponding animal species. In HeLa cells and rat brain, we only detected an RNA identical to the ribosomal 5S RNA. In hen brain and liver, we found other species differing by a limited number of substitutions. The results suggest that mutated 5S genes may be expressed differently according to the cell type. The set with the highest mobility corresponds to U5 RNA. In both rat brain and HeLa cells, U5 RNA was found to be composed of 4 and 5 different molecules respectively (U5A, U5B1-4) differing by a small number of substitutions or insertions. In hen brain, no U5B was detected but U5A' differing from U5A by the absence of the 3'-terminal adenosine. All the U5 RNAs contain the same set of modified nucleotides. They also have the same secondary structure which consists of two hairpins joined together by a 17 nucleotide long single-stranded region. The 3' half of the molecule has a compact conformation. Together, the results suggest that U5 RNAs are transcribed from a multigene family and that mutated genes may be expressed as far as secondary structure is conserved. The conformation of U5 RNA is likely to be related to its function and it is of interest to mention that several similarities of structure are found between U5 and U1A RNA.

  14. Introduction of a novel 18S rDNA gene arrangement along with distinct ITS region in the saline water microalga Dunaliella

    PubMed Central

    2010-01-01

    Comparison of 18S rDNA gene sequences is a very promising method for identification and classification of living organisms. Molecular identification and discrimination of different Dunaliella species were carried out based on the size of 18S rDNA gene and, number and position of introns in the gene. Three types of 18S rDNA structure have already been reported: the gene with a size of ~1770 bp lacking any intron, with a size of ~2170 bp consisting one intron near 5' terminus, and with a size of ~2570 bp harbouring two introns near 5' and 3' termini. Hereby, we report a new 18S rDNA gene arrangement in terms of intron localization and nucleotide sequence in a Dunaliella isolated from Iranian salt lakes (ABRIINW-M1/2). PCR amplification with genus-specific primers resulted in production of a ~2170 bp DNA band, which is similar to that of D. salina 18S rDNA gene containing only one intron near 5' terminus. Whilst, sequence composition of the gene revealed the lack of any intron near 5' terminus in our isolate. Furthermore, another alteration was observed due to the presence of a 440 bp DNA fragment near 3' terminus. Accordingly, 18S rDNA gene of the isolate is clearly different from those of D. salina and any other Dunaliella species reported so far. Moreover, analysis of ITS region sequence showed the diversity of this region compared to the previously reported species. 18S rDNA and ITS sequences of our isolate were submitted with accesion numbers of EU678868 and EU927373 in NCBI database, respectively. The optimum growth rate of this isolate occured at the salinity level of 1 M NaCl. The maximum carotenoid content under stress condition of intense light (400 μmol photon m-2 s-1), high salinity (4 M NaCl) and deficiency of nitrate and phosphate nutritions reached to 240 ng/cell after 15 days. PMID:20377865

  15. Quantitative analysis of dinoflagellates and diatoms community via Miseq sequencing of actin gene and v9 region of 18S rDNA

    PubMed Central

    Guo, Liliang; Sui, Zhenghong; Liu, Yuan

    2016-01-01

    Miseq sequencing and data analysis for the actin gene and v9 region of 18S rDNA of 7 simulated samples consisting of different mixture of dinoflagellates and diatoms were carried out. Not all the species were detectable in all the 18S v9 samples, and sequence percent in all the v9 samples were not consistent with the corresponding cell percent which may suggest that 18S rDNA copy number in different cells of these species differed greatly which result in the large deviation of the amplification. And 18S rDNA amplification of the microalgae was prone to be contaminated by fungus. The amplification of actin gene all was from the dinoflagellates because of its targeted degenerate primers. All the actin sequences of dinoflagellates were detected in the act samples except act4, and sequence percentage of the dinoflagellates in the act samples was not completely consistent with the dinoflagellates percentage of cell samples, but with certain amplification deviations. Indexes of alpha diversity of actin gene sequencing may be better reflection of community structure, and beta diversity analysis could cluster the dinoflagellates samples with identical or similar composition together and was distinguishable with blooming simulating samples at the generic level. Hence, actin gene was more proper than rDNA as the molecular marker for the community analysis of the dinoflagellates. PMID:27721499

  16. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

    PubMed Central

    Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

    2006-01-01

    As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

  17. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    PubMed Central

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  18. Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

    PubMed

    Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

    2011-11-01

    Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

  19. Intraspecific Genetic Variation and Phylogenetic Analysis of Dirofilaria immitis Samples from Western China Using Complete ND1 and 16S rDNA Gene Sequences

    PubMed Central

    Liu, Tianyu; Liang, Yinan; Zhong, Xiuqin; Wang, Ning; Hu, Dandan; Zhou, Xuan; Gu, Xiaobin; Peng, Xuerong; Yang, Guangyou

    2014-01-01

    Dirofilaria immitis (heartworm) is the causative agent of an important zoonotic disease that is spread by mosquitoes. In this study, molecular and phylogenetic characterization of D. immitis were performed based on complete ND1 and 16S rDNA gene sequences, which provided the foundation for more advanced molecular diagnosis, prevention, and control of heartworm diseases. The mutation rate and evolutionary divergence in adult heartworm samples from seven dogs in western China were analyzed to obtain information on genetic diversity and variability. Phylogenetic relationships were inferred using both maximum parsimony (MP) and Bayes methods based on the complete gene sequences. The results suggest that D. immitis formed an independent monophyletic group in which the 16S rDNA gene has mutated more rapidly than has ND1. PMID:24639299

  20. Morphology and 18S rDNA gene sequence of Blepharisma sinuosum Sawaya, 1940 (Ciliophora: Heterotrichea) from Brazil.

    PubMed

    Fernandes, Noemi Mendes; Dias, Roberto Júnio Pedroso; Senra, Marcus Vinicius Xavier; Soares, Carlos Augusto Gomes; da Silva Neto, Inácio Domingos

    2013-11-01

    The morphology and morphometric data of seven populations of Blepharisma sinuosum from southeastern Brazil were investigated. The description is based on live observations, protargol impregnation, and scanning electron microscopy. Blepharisma sinuosum measures 75-255μm in length and 25-93μm in width and has a spindle-shaped body, pink color, a single contractile vacuole located at the posterior end, 50 adoral membranelles, a conspicuous paroral, 17-35 somatic kineties, a moniliform macronucleus with 2-7 connected nodules, and 3-20 micronuclei. Morphological comparisons with similar species were performed and suggest that B. americanum is the junior synonym of B. sinuosum. The 18S rDNA gene sequence of B. sinuosum was obtained and compared with that of other Blepharisma species. The length and GC content of the obtained sequence is 1652bp and 47.03%, respectively, and has a very high structural similarity (99.9%) with the B. undulans sequence. The validity of the classification of Blepharisma species in morphonuclear subgenera is also discussed.

  1. Phylogenetic relationships of Brazilian isolates of Pythium insidiosum based on ITS rDNA and cytochrome oxidase II gene sequences.

    PubMed

    Azevedo, M I; Botton, S A; Pereira, D I B; Robe, L J; Jesus, F P K; Mahl, C D; Costa, M M; Alves, S H; Santurio, J M

    2012-09-14

    Pythium insidiosum is an aquatic oomycete that is the causative agent of pythiosis. Advances in molecular methods have enabled increased accuracy in the diagnosis of pythiosis, and in studies of the phylogenetic relationships of this oomycete. To evaluate the phylogenetic relationships among isolates of P. insidiosum from different regions of Brazil, and also regarding to other American and Thai isolates, in this study a total of thirty isolates of P. insidiosum from different regions of Brazil was used and had their ITS1, 5.8S rRNA and ITS2 rDNA (ITS) region and the partial sequence of cytochrome oxidase II (COX II) gene sequenced and analyzed. The outgroup consisted of six isolates of other Pythium species and one of Lagenidium giganteum. Phylogenetic analyses of ITS and COX II genes were conducted, both individually and in combination, using four different methods: Maximum parsimony (MP); Neighbor-joining (NJ); Maximum likelihood (ML); and Bayesian analysis (BA). Our data supported P. insidiosum as monophyletic in relation to the other Pythium species, and COX II showed that P. insidiosum appears to be subdivided into three major polytomous groups, whose arrangement provides the Thai isolates as paraphyletic in relation to the Brazilian ones. The molecular analyses performed in this study suggest an evolutionary proximity among all American isolates, including the Brazilian and the Central and North America isolates, which were grouped together in a single entirely polytomous clade. The COX II network results presented signals of a recent expansion for the American isolates, probably originated from an Asian invasion source. Here, COX II showed higher levels bias, although it was the source of higher levels of phylogenetic information when compared to ITS. Nevertheless, the two markers chosen for this study proved to be entirely congruent, at least with respect to phylogenetic relationships between different isolates of P. insidiosum. PMID:22483240

  2. A 5 S rRNA gene is present in the mitochondrial genome of the protist Reclinomonas americana but is absent from red algal mitochondrial DNA.

    PubMed

    Lang, B F; Goff, L J; Gray, M W

    1996-09-01

    Except in the case of land plants, mitochondrial ribosomes apparently lack a 5 S rRNA species, even though this small RNA is a component of all prokaryotic, chloroplast and eukaryotic cytosol ribosomes. In plants, the mitochondrial 5 S rRNA is encoded by mtDNA and differs in sequence from the 5 S rRNA specified by plant nuclear and chloroplast genomes. A distinctive 5 S rRNA component has not been found in the mitochondrial ribosomes of non-plant eukaryotes and, with the notable exception of the chlorophycean alga, Prototheca wickerhamii, a 5 S rRNA gene has not been identified in those non-plant mtDNAs characterized to date. Here, we report the presence of a 5 S rRNA gene in the mtDNA of the heterotrophic flagellate Reclinomonas americana. This unicellular eukaryote is a member of the jakobid flagellates, an early-diverging group of protists that share ultrastructural characteristics with the retortamonads, primitive protists that lack mitochondria. We report sequence data from the mtDNAs of the red algae Porphyra purpurea and Gracilariopsis lemaneiformis, which we use to evaluate a recent claim that a 5 S rRNA gene exists in the mtDNA of a third rhodophyte alga, Chondrus crispus. Our results lead us to the opposite conclusion: that a 5 S rRNA gene is not encoded by red algal mtDNA. In view of the accumulating evidence favoring a monophyletic origin of the mitochondrial genome, it is likely that a 5 S rRNA gene was present in an ancestral proto-mitochondrial genome, and that contemporary mtDNA-encoded 5 S rRNA genes have all descended from this ancestral gene. Considering the highly restricted phylogenetic distribution of identified mtDNA-encoded 5 S rRNA genes, it follows that the mitochondrial 5 S rRNA gene must have been lost multiple times during evolutionary diversification of the eukaryotic lineage.

  3. Analysis of the 5S RNA pool in Arabidopsis thaliana: RNAs are heterogeneous and only two of the genomic 5S loci produce mature 5S RNA.

    PubMed

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5'- and 3'-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array.

  4. Reevaluation of the evolutionary position of opalinids based on 18S rDNA, and alpha- and beta-tubulin gene phylogenies.

    PubMed

    Nishi, Akane; Ishida, Ken-ichiro; Endoh, Hiroshi

    2005-06-01

    Opalinids are enigmatic endosymbiotic protists principally found in the large intestine of anuran amphibians. They are multinucleates and uniformly covered with numerous flagella (or cilia). Their appearance is somewhat similar to that of ciliates, leading to opalinid's initial classification as ciliates, or later as protociliates. However, on the basis of their monomorphic nuclei, absence of a ciliate-like life cycle characterized by conjugation, and an interkinetal fission mode, opalinids were subsequently transferred in the zooflagellates. As several common ultrastructural characteristics shared with proteromonads were elucidated, in particular of the flagellar base, such as their double-stranded flagellar helix, an alliance with proteromonads was widely accepted. Thus, opalinids are currently favored to be placed in the class Opalinea, within the heterokont kingdom Chromista. However, the question of their classification has not been fully resolved, because of a lack of molecular information. Here, we report their phylogenetic position inferred from 18S rDNA, and alpha- and beta-tubulin gene sequences. The 18S rDNA tree gives the opalinids an ancestral position in heterokonts, together with proteromonads, as suggested by the morphological studies. In great contrast, alpha- and beta-tubulin gene analyses suggest an affiliation of opalinids to alveolates, not to heterokonts. However, the AU test implies that opalinids are not closely related with any of other three phyla in the alveolates, suggesting an occupation of an ancestral position within the alveolates. Based on the present molecular information, in particular rDNA phylogeny, and the ultrastructural character of the double helix common to heterokonts, we conclude that opalinids would have a common origin with heterokonts, although analyses based on two tubulin genes do not as yet completely deny a possible placement outside heterokonts. The ambiguity of the evolutionary position shown by the discrepancy

  5. Microbial rRNA: rDNA gene ratios may be unexpectedly low due to extracellular DNA preservation in soils

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We tested a method of estimating the activity of detectable individual bacterial and archaeal OTUs within a community by calculating ratios of absolute 16S rRNA to rDNA copy numbers. We investigated phylogenetically coherent patterns of activity among soil prokaryotes in non-growing soil communitie...

  6. Mutation of a Nopp140 gene dao-5 alters rDNA transcription and increases germ cell apoptosis in C. elegans.

    PubMed

    Lee, C-C; Tsai, Y-T; Kao, C-W; Lee, L-W; Lai, H-J; Ma, T-H; Chang, Y-S; Yeh, N-H; Lo, S J

    2014-01-01

    Human diseases of impaired ribosome biogenesis resulting from disruption of rRNA biosynthesis or loss of ribosomal components are collectively described as 'ribosomopathies'. Treacher Collins syndrome (TCS), a representative human ribosomopathy with craniofacial abnormalities, is attributed to mutations in the tcof1 gene that has a homologous gene called nopp140. Previous studies demonstrated that the dao-5 (dauer and aged animal overexpression gene 5) of Caenorhabditis elegans is a member of nopp140 gene family and plays a role in nucleogenesis in the early embryo. Here, we established a C. elegans model for studying Nopp140-associated ribosomopathy. A null dao-5 mutant ok542 with a semi-infertile phenotype showed a delay in gonadogenesis, as well as a higher incidence of germline apoptosis. These phenotypes in dao-5(ok542) are likely resulted from inefficient rDNA transcription that was observed by run-on analyses and chromatin immunoprecipitation (ChIP) assays measuring the RNA Pol I occupancy on the rDNA promoter. ChIP assays further showed that the modifications of acetylated histone 4 (H4Ac) and dimethylation at the lysine 9 of histone 3 (H3K9me2) around the rDNA promoter were altered in dao-5 mutants compared with the N2 wild type. In addition, activated CEP-1 (a C. elegans p53 homolog) activity was also linked to the loss of DAO-5 in terms of the transcriptional upregulation of two CEP-1 downstream effectors, EGL-1 and CED-13. We propose that the dao-5 mutant of C. elegans can be a valuable model for studying human Nopp140-associated ribosomopathy at the cellular and molecular levels. PMID:24722283

  7. [Structural organization of 5S ribosomal DNA of Rosa rugosa].

    PubMed

    Tynkevych, Iu O; Volkov, R A

    2014-01-01

    In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

  8. [Chromosomal localization of 5S and 45S ribosomal DNA in species of Linum L. section Linum (syn=Protolinum and Adenolinum)].

    PubMed

    Muravenko, O V; Amosova, A V; Samatadze, T E; Semenova, O Iu; Nosova, I V; Popov, K V; Shostak, N G; Zoshchuk, S A; Zelenin, A V

    2004-02-01

    Fluorescence in situ hybridization (FISH) was for the first time used to study the chromosomal location of the 45S (18-2.5S-26S) and 5S ribosomal genes in the genomes of five flax species of the section Linum (syn. Protolinum and Adenolinum). In L. usitatissimum L. (2n = 30), L. angustifolium Huds. (2n = 30), and L. bienne Mill. (2n = 30), a major hybridization site of 45S rDNA was observed in the pericentric region of a large metacentric chromosome. A polymorphic minor locus of 45S rDNA was found on one of the small chromosomes. Sites of 5S rDNA colocalized with those of 45S rDNA, but direct correlation between signal intensities from the 45S and 5S rDNA sites was observed only in some cases. Other 5S rDNA sites mapped to two chromosomes in these flax species. In L. grandiflorum Desf. (2n = 16) and L. austriacum L. (2n = 18), large regions of 45S and 5S rDNA were similarly located on a pair of homologous satellite-bearing chromosomes. An additional large polymorphic site of 45S and 5S rDNA was found in the proximal region of one arm of a small chromosome in the L. usitatissimum. L. angustifolium, and L. bienne karyotypes. The other arm of this chromosome contained a large 5S rDNA cluster. A similar location of the ribosomal genes in the pericentric region of the pair of satellite-bearing metacentrics confirmed the close relationships of the species examined. The difference in chromosomal location of the ribosomal genes between flax species with 2n = 30 and those with 2n = 16 or 18 testified to their assignment to different sections. The use of ribosomal genes as chromosome markers was assumed to be of importance for comparative genomic studies in cultivated flax, a valuable crop species of Russia, and in its wild relatives. PMID:15065434

  9. Employment of 16 S rDNA gene sequencing techniques to identify culturable environmental eubacteria in a tertiary referral hospital.

    PubMed

    Xu, J; Smyth, C L; Buchanan, J A; Dolan, A; Rooney, P J; Millar, B C; Goldsmith, C E; Elborn, J S; Moore, J E

    2004-05-01

    Universal or 'broad-range' eubacterial polymerase chain reaction (PCR) was performed on 53 isolates from environmental water-associated sites in a haematology unit (N = 22) and the outer surfaces of cleaning lotion containers sited throughout a tertiary referral hospital (N = 31) 16 S rDNA PCR was performed using two sets of universal primers, including the novel reverse primer, XB4, to generate a composite amplicon of 1068 bp, which was sequenced to obtain each isolate's identity. Sequence analysis was able to identify 51 isolates. Most (75% from the haematology unit and 81% from cleaner containers) were Gram-positive. Nine different genera were identified from the haematology unit and 13 from the cleaning lotion containers. This study provides the first reports of Terrabacter spp. and Brachybacterium paraconglomeratum isolated from a hospital environment. As unusual and difficult-to-identify environmental organisms are unlikely to be clinically significant, and molecular identification is costly and labour-intensive, we recommend that molecular methods are only used as an adjunct to first-line phenotypic identification schemes where a definitive identification is required. Where molecular identification methods are justified, partial 16 S rDNA PCR and sequencing employing the novel universal primer XB4, is a valuable and reliable technique.

  10. Culturable bacteria present in the fluid of the hooded-pitcher plant Sarracenia minor based on 16S rDNA gene sequence data.

    PubMed

    Siragusa, Alex J; Swenson, Janice E; Casamatta, Dale A

    2007-08-01

    The culturable microbial community within the pitcher fluid of 93 Sarracenia minor carnivorous plants was examined over a 2-year study. Many aspects of the plant/bacterial/insect interaction within the pitcher fluid are minimally understood because the bacterial taxa present in these pitchers have not been identified. Thirteen isolates were characterized by 16S rDNA sequencing and subsequent phylogenetic analysis. The Proteobacteria were the most abundant taxa and included representatives from Serratia, Achromobacter, and Pantoea. The Actinobacteria Micrococcus was also abundant while Bacillus, Lactococcus, Chryseobacterium, and Rhodococcus were infrequently encountered. Several isolates conformed to species identifiers (>98% rDNA gene sequence similarity) including Serratia marcescens (isolates found in 27.5% of pitchers), Achromobacter xylosoxidans (37.6%), Micrococcus luteus (40.9%), Bacillus cereus (isolates found in 10.2%), Bacillus thuringiensis (5.4%), Lactococcus lactis (17.2%), and Rhodococcus equi (2.2%). Species-area curves suggest that sampling efforts were sufficient to recover a representative culturable bacterial community. The bacteria present represent a diverse community probably as a result of introduction by insect vectors, but the ecological significance remains under explored. PMID:17380356

  11. Culturable bacteria present in the fluid of the hooded-pitcher plant Sarracenia minor based on 16S rDNA gene sequence data.

    PubMed

    Siragusa, Alex J; Swenson, Janice E; Casamatta, Dale A

    2007-08-01

    The culturable microbial community within the pitcher fluid of 93 Sarracenia minor carnivorous plants was examined over a 2-year study. Many aspects of the plant/bacterial/insect interaction within the pitcher fluid are minimally understood because the bacterial taxa present in these pitchers have not been identified. Thirteen isolates were characterized by 16S rDNA sequencing and subsequent phylogenetic analysis. The Proteobacteria were the most abundant taxa and included representatives from Serratia, Achromobacter, and Pantoea. The Actinobacteria Micrococcus was also abundant while Bacillus, Lactococcus, Chryseobacterium, and Rhodococcus were infrequently encountered. Several isolates conformed to species identifiers (>98% rDNA gene sequence similarity) including Serratia marcescens (isolates found in 27.5% of pitchers), Achromobacter xylosoxidans (37.6%), Micrococcus luteus (40.9%), Bacillus cereus (isolates found in 10.2%), Bacillus thuringiensis (5.4%), Lactococcus lactis (17.2%), and Rhodococcus equi (2.2%). Species-area curves suggest that sampling efforts were sufficient to recover a representative culturable bacterial community. The bacteria present represent a diverse community probably as a result of introduction by insect vectors, but the ecological significance remains under explored.

  12. Haplotype Detection from Next-Generation Sequencing in High-Ploidy-Level Species: 45S rDNA Gene Copies in the Hexaploid Spartina maritima

    PubMed Central

    Boutte, Julien; Aliaga, Benoît; Lima, Oscar; Ferreira de Carvalho, Julie; Ainouche, Abdelkader; Macas, Jiri; Rousseau-Gueutin, Mathieu; Coriton, Olivier; Ainouche, Malika; Salmon, Armel

    2015-01-01

    Gene and whole-genome duplications are widespread in plant nuclear genomes, resulting in sequence heterogeneity. Identification of duplicated genes may be particularly challenging in highly redundant genomes, especially when there are no diploid parents as a reference. Here, we developed a pipeline to detect the different copies in the ribosomal RNA gene family in the hexaploid grass Spartina maritima from next-generation sequencing (Roche-454) reads. The heterogeneity of the different domains of the highly repeated 45S unit was explored by identifying single nucleotide polymorphisms (SNPs) and assembling reads based on shared polymorphisms. SNPs were validated using comparisons with Illumina sequence data sets and by cloning and Sanger (re)sequencing. Using this approach, 29 validated polymorphisms and 11 validated haplotypes were reported (out of 34 and 20, respectively, that were initially predicted by our program). The rDNA domains of S. maritima have similar lengths as those found in other Poaceae, apart from the 5′-ETS, which is approximately two-times longer in S. maritima. Sequence homogeneity was encountered in coding regions and both internal transcribed spacers (ITS), whereas high intragenomic variability was detected in the intergenic spacer (IGS) and the external transcribed spacer (ETS). Molecular cytogenetic analysis by fluorescent in situ hybridization (FISH) revealed the presence of one pair of 45S rDNA signals on the chromosomes of S. maritima instead of three expected pairs for a hexaploid genome, indicating loss of duplicated homeologous loci through the diploidization process. The procedure developed here may be used at any ploidy level and using different sequencing technologies. PMID:26530424

  13. Evolutionary Dynamics of rDNA Clusters in Chromosomes of Five Clam Species Belonging to the Family Veneridae (Mollusca, Bivalvia)

    PubMed Central

    Pérez-García, Concepción; Hurtado, Ninoska S.; Morán, Paloma; Pasantes, Juan J.

    2014-01-01

    The chromosomal changes accompanying bivalve evolution are an area about which few reports have been published. To improve our understanding on chromosome evolution in Veneridae, ribosomal RNA gene clusters were mapped by fluorescent in situ hybridization (FISH) to chromosomes of five species of venerid clams (Venerupis corrugata, Ruditapes philippinarum, Ruditapes decussatus, Dosinia exoleta, and Venus verrucosa). The results were anchored to the most comprehensive molecular phylogenetic tree currently available for Veneridae. While a single major rDNA cluster was found in each of the five species, the number of 5S rDNA clusters showed high interspecies variation. Major rDNA was either subterminal to the short arms or intercalary to the long arms of metacentric or submetacentric chromosomes, whereas minor rDNA signals showed higher variability. Major and minor rDNAs map to different chromosome pairs in all species, but in R. decussatus one of the minor rDNA gene clusters and the major rDNA cluster were located in the same position on a single chromosome pair. This interspersion of both sequences was confirmed by fiber FISH. Telomeric signals appeared at both ends of every chromosome in all species. FISH mapping data are discussed in relation to the molecular phylogenetic trees currently available for Veneridae. PMID:24967400

  14. Slow molecular evolution in 18S rDNA, rbcL and nad5 genes of mosses compared with higher plants.

    PubMed

    Stenøien, H K

    2008-03-01

    The evolutionary potential of bryophytes (mosses, liverworts and hornworts) has been debated for decades. Fossil record and biogeographical distribution patterns suggest very slow morphological evolution and the retainment of several ancient traits since the split with vascular plants some 450 million years ago. Many have argued that bryophytes may evolve as rapidly as higher plants on the molecular level, but this hypothesis has not been tested so far. Here, it is shown that mosses have experienced significantly lower rates of molecular evolution than higher plants within 18S rDNA (nuclear), rbcL (chloroplast) and nad5 (mitochondrial) genes. Mosses are on an average evolving 2-3 times slower than ferns, gymnosperms and angiosperms; and also green algae seem to be evolving faster than nonvascular plants. These results support the observation of a general correlation between morphological and molecular evolutionary rates in plants and also show that mosses are 'evolutionary sphinxes' regarding both morphological and molecular evolutionary potential.

  15. Detecting a complex of cryptic species within Neoechinorhynchus golvani (Acanthocephala: Neoechinorhynchidae) inferred from ITSs and LSU rDNA gene sequences.

    PubMed

    Martínez-Aquino, Andrés; Reyna-Fabián, Miriam E; Rosas-Valdez, Rogelio; Razo-Mendivil, Ulises; de León, Gerardo Pérez-Ponce; García-Varela, Martín

    2009-10-01

    Neoechinorhynchus golvani is an intestinal parasite of freshwater and brackish water fishes distributed in Mexico. The genetic variability of 40 samples representing 12 populations from north, south, and central Mexico, and 1 from Costa Rica, was estimated by sequencing 2 nuclear genes (ITS1, 5.8S, ITS2, and LSU rDNA, including the domain D2 + D3). The length of both genes ranged from 700 to 779 base pairs (bp) and from 813 to 821 bp, for ITSs and LSU, respectively. The genetic divergence among populations ranged from 19.5 to 35.3% with ITSs and from 9.28 to 19.58% with LSU. Maximum likelihood and maximum parsimony analyses were performed for each data set and also for 2 combined data sets (ITSs + LSU rDNA with and without outgroups), showing strong similarities among trees, with high bootstrap support in all cases. Genetic divergence, in combination with phylogenetic analyses, suggested that the acanthocephalan N. golvani represents a complex of cryptic species, which is composed of at least 3 lineages. The first lineage, corresponding with N. golvani, shows a wide distribution, including localities from northeastern Mexico, southwards through central and southeastern Mexico, and further down to Costa Rica. This lineage is associated with cichlid fishes in strictly freshwater environments. Lineages 2 and 3 are distributed in brackish water systems along the Gulf of Mexico and Pacific slopes, respectively; both are associated with eleotrid fishes, and apparently represent 2 cryptic species. The diversification of the eleotrid and cichlid lineages seems to be the result of independent host-switching events from the ancestral population.

  16. [Comparative analysis of rDNA distribution in metaphase chromosomes of Cucurbitaceae species].

    PubMed

    Xu, Yan-Hao; Yang, Fei; Cheng, You-Lin; Ma, Lu; Wang, Jian-Bo; Li, Li-Jia

    2007-05-01

    Fluorescence in situ hybridization (FISH) and double FISH experiments were carried out to ascertain the chromosomal distribution patterns of the 45S and 5S ribosomal DNAs in the three species of Cucurbitaceae. Five pairs of 45S rDNA loci and two pairs of 5S rDNA signals were detected on chromosomes of Cucurbita moschata Duch. Luffa cylindrical Roem. contained five pairs of 45S rDNA loci and one pair of 5S rDNA loci. In Benincasa hispida Cogn., two pairs of 45S rDNA sites and one pair of 5S rDNA site were detected. In this species, 5S rDNA and one pair of the 45S loci were collocated closely in chromosome 7S. 45S rDNA chromosomal distribution patterns were highly conserved among the three species, althoufh their number varied markedly. The 5S rDNA sites on chromosomes among the three species were highly polymorphic. We further discussed differentially evolutionary processes of 45S and 5S rDNA in plant genomes.

  17. Molecular systematics of the Amphisphaeriaceae based on cladistic analyses of partial LSU rDNA gene sequences.

    PubMed

    Jeewon, Rajesh; Liew, Edward C Y; Hyde, Kevin D

    2003-12-01

    The Amphisphaeriaceae is an important family of ascomycetes within the Xylariales. There has been, however, disagreement regarding the taxonomic placement of many genera within this family and whether it should be confined to ascomycetes producing Pestalotiopsis-like anamorphs. In this study, phylogenetic relationships among members of the Amphisphaeriaceae are investigated using partial sequences of the 28S rDNA. Molecular data provided further evidence to support the association of several coelomycetous genera with the ascomycetous Amphisphaeriaceae. Phylogenetic analyses also show that all ascomycetous genera possessing Pestalotiopsis-like anamorphs are monophyletic and confirm the anamorphic-teleomorphic connections of some. There is, however, insufficient evidence to support the restriction of Amphisphaeriaceae to genera, which produce Pestalotiopsis-like anamorphs, because the phylogenetic placement of Amphisphaeria umbrina is not fully resolved and its affinities with other members received low bootstrap support. The results also indicate that Iodosphaeria and Arecophila should be excluded from the Amphisphaeriaceae. The placement of Lanceispora in the Amphisphaeriaceae is doubtful. A broad concept of the family Amphisphaeriaceae is advocated until further data are available.

  18. Species-genomic relationships among the tribasic diploid and polyploid Carthamus taxa based on physical mapping of active and inactive 18S-5.8S-26S and 5S ribosomal RNA gene families, and the two tandemly repeated DNA sequences.

    PubMed

    Agrawal, Renuka; Tsujimoto, Hisashi; Tandon, Rajesh; Rao, Satyawada Rama; Raina, Soom Nath

    2013-05-25

    In the genus Carthamus (2n=20, 22, 24, 44, 64; x=10, 11, 12), most of the homologues within and between the chromosome complements are difficult to be identified. In the present work, we used fluorescent in situ hybridisation (FISH) to determine the chromosome distribution of the two rRNA gene families, and the two isolated repeated DNA sequences in the 14 Carthamus taxa. The distinctive variability in the distribution, number and signal intensity of hybridisation sites for 18S-26S and 5S rDNA loci could generally distinguish the 14 Carthamus taxa. Active 18S-26S rDNA sites were generally associated with NOR loci on the nucleolar chromosomes. The two A genome taxa, C. glaucus ssp. anatolicus and C. boissieri with 2n=20, and the two botanical varieties of B genome C. tinctorius (2n=24) had diagnostic FISH patterns. The present results support the origin of C. tinctorius from C. palaestinus. FISH patterns of C. arborescens vis-à-vis the other taxa indicate a clear division of Carthamus taxa into two distinct lineages. Comparative distribution and intensity pattern of 18S-26S rDNA sites could distinguish each of the tetraploid and hexaploid taxa. The present results indicate that C. boissieri (2n=20) is one of the genome donors for C. lanatus and C. lanatus ssp. lanatus (2n=44), and C. lanatus is one of the progenitors for the hexaploid (2n=64) taxa. The association of pCtKpnI-2 repeated sequence with rRNA gene cluster (orphon) in 2-10 nucleolar and non-nucleolar chromosomes and the consistent occurrence of pCtKpnI-1 repeated sequence at the subtelomeric region in all the taxa analysed indicate some functional role of these sequences.

  19. [Organization of 5S ribosomal DNA of Melitaea trivia].

    PubMed

    Cherevatov, O V; Volkov, R A

    2011-01-01

    Two length variants of 5S rDNA repeated units were detected in the genome of East European butterfly Melitaea trivia. Both repeat variants contain the 5S rRNA coding region of the same length of 120 bp, but possess the intergenic spacer region (IGS) of different size, 78 and 125 bp, respectively. The level of sequence similarity between the two 5S rDNA variants amounts to 43.9-45.5% in the IGS, whereas the coding region appears to be more conservative. In the IGS, microsatellite sequence motives were found; amplification of these motives could be involved in the evolution of the 5S rDNA.

  20. A phylogeny of cycads (Cycadales) inferred from chloroplast matK gene, trnK intron, and nuclear rDNA ITS region.

    PubMed

    Chaw, Shu-Miaw; Walters, Terrence W; Chang, Chien-Chang; Hu, Shu-Hsuan; Chen, Shin-Hsiao

    2005-10-01

    Phylogenetic relationships among the three families and 12 living genera of cycads were reconstructed by distance and parsimony criteria using three markers: the chloroplast matK gene, the chloroplast trnK intron and the nuclear ITS/5.8S rDNA sequence. All datasets indicate that Cycadaceae (including only the genus Cycas) is remotely related to other cycads, in which Dioon was resolved as the basal-most clade, followed by Bowenia and a clade containing the remaining nine genera. Encephalartos and Lepidozamia are closer to each other than to Macrozamia. The African genus Stangeria is embedded within the New World subfamily Zamiodeae. Therefore, Bowenia is an unlikely sister to Stangeria, contrary to the view that they form the Stangeriaceae. The generic status of Dyerocycas and Chigua is unsupportable as they are paraphyletic with Cycas and the Zamia, respectively. Nonsense mutations in the matK gene and indels in the other two datasets lend evidence to reinforce the above conclusions. According to the phylogenies, the past geography of the genera of cycads and the evolution of character states are hypothesized and discussed. Within the suborder Zamiieae, Stangeria, and the tribe Zamieae evolved significantly faster than other genera. The matK gene and ITS/5.8S region contain more useful information than the trnK intron in addressing phylogeny. Redelimitations of Zamiaceae, Stangeriaceae, subfamily Encephalartoideae and subtribe Macrozamiineae are necessary.

  1. Basic cytogenetics and physical mapping of 5S and 18S ribosomal genes in Hoplias malabaricus (Osteichthyes, Characiformes, Erythrinidae) from isolated natural lagoons: a conserved karyomorph along the Iguaçu river basin.

    PubMed

    Gemi, Gisele; Lui, Roberto Laridondo; Treco, Fernando Rodrigo; Paiz, Leonardo Marcel; Moresco, Rafaela Maria; Margarido, Vladimir Pavan

    2014-01-01

    Erythrinidae include Neotropical teleost fish that are widely distributed in South America. Hoplias Gill, 1903 include two large groups: H. malabaricus Bloch, 1794 and H. lacerdae Miranda Ribeiro, 1908. Hoplias malabaricus is characterized by remarkable karyotype diversity, with some karyomorphs widely distributed geographically while others are more restricted to certain river basins. Cytogenetic analyzes were performed in a population of Hoplias malabaricus from the Wildlife Refuge of Campos de Palmas, the Iguaçu River basin. The specimens showed diploid number of 42 chromosomes (24m+18sm) without differentiated sex chromosomes system. The impregnation by silver nitrate showed multiple AgNORs. Seven pairs (4, 7, 10, 13, 16, 20 and 21) carrying 18S rDNA were detected by FISH. Heterochromatin was verified in the centromeric and pericentromeric region of most chromosomes and the terminal region of some pairs. FISH with 5S rDNA probes showed two chromosome pairs carrying these sites in the interstitial region (8 and 14). The data obtained in this study are similar to those found for two other populations of H. malabaricus already studied in the basin of the Iguaçu River, confirming the hypothesis that this species is natural, not having been introduced, as well as having an intrinsic characteristic, such as the largest number of sites of 18S rDNA.

  2. Partial sequence homogenization in the 5S multigene families may generate sequence chimeras and spurious results in phylogenetic reconstructions.

    PubMed

    Galián, José A; Rosato, Marcela; Rosselló, Josep A

    2014-03-01

    Multigene families have provided opportunities for evolutionary biologists to assess molecular evolution processes and phylogenetic reconstructions at deep and shallow systematic levels. However, the use of these markers is not free of technical and analytical challenges. Many evolutionary studies that used the nuclear 5S rDNA gene family rarely used contiguous 5S coding sequences due to the routine use of head-to-tail polymerase chain reaction primers that are anchored to the coding region. Moreover, the 5S coding sequences have been concatenated with independent, adjacent gene units in many studies, creating simulated chimeric genes as the raw data for evolutionary analysis. This practice is based on the tacitly assumed, but rarely tested, hypothesis that strict intra-locus concerted evolution processes are operating in 5S rDNA genes, without any empirical evidence as to whether it holds for the recovered data. The potential pitfalls of analysing the patterns of molecular evolution and reconstructing phylogenies based on these chimeric genes have not been assessed to date. Here, we compared the sequence integrity and phylogenetic behavior of entire versus concatenated 5S coding regions from a real data set obtained from closely related plant species (Medicago, Fabaceae). Our results suggest that within arrays sequence homogenization is partially operating in the 5S coding region, which is traditionally assumed to be highly conserved. Consequently, concatenating 5S genes increases haplotype diversity, generating novel chimeric genotypes that most likely do not exist within the genome. In addition, the patterns of gene evolution are distorted, leading to incorrect haplotype relationships in some evolutionary reconstructions.

  3. Regulation of the rplY gene encoding 5S rRNA binding protein L25 in Escherichia coli and related bacteria.

    PubMed

    Aseev, Leonid V; Bylinkina, Natalia S; Boni, Irina V

    2015-05-01

    Ribosomal protein (r-protein) L25 is one of the three r-proteins (L25, L5, L18) that interact with 5S rRNA in eubacteria. Specific binding of L25 with a certain domain of 5S r-RNA, a so-called loop E, has been studied in detail, but information about regulation of L25 synthesis has remained totally lacking. In contrast to the rplE (L5) and rplR (L18) genes that belong to the polycistronic spc-operon and are regulated at the translation level by r-protein S8, the rplY (L25) gene forms an independent transcription unit. The main goal of this work was to study the regulation of the rplY expression in vivo. We show that the rplY promoter is down-regulated by ppGpp and its cofactor DksA in response to amino acid starvation. At the level of translation, the rplY expression is subjected to the negative feedback control. The 5'-untranslated region of the rplY mRNA comprises specific sequence/structure features, including an atypical SD-like sequence, which are highly conserved in a subset of gamma-proteobacterial families. Despite the lack of a canonical SD element, the rplY'-'lacZ single-copy reporter showed unusually high translation efficiency. Expression of the rplY gene in trans decreased the translation yield, indicating the mechanism of autogenous repression. Site-directed mutagenesis of the rplY 5' UTR revealed an important role of the conserved elements in the translation control. Thus, the rplY expression regulation represents one more example of regulatory pathways that control ribosome biogenesis in Escherichia coli and related bacteria.

  4. Regulation of the rplY gene encoding 5S rRNA binding protein L25 in Escherichia coli and related bacteria

    PubMed Central

    Aseev, Leonid V.; Bylinkina, Natalia S.; Boni, Irina V.

    2015-01-01

    Ribosomal protein (r-protein) L25 is one of the three r-proteins (L25, L5, L18) that interact with 5S rRNA in eubacteria. Specific binding of L25 with a certain domain of 5S r-RNA, a so-called loop E, has been studied in detail, but information about regulation of L25 synthesis has remained totally lacking. In contrast to the rplE (L5) and rplR (L18) genes that belong to the polycistronic spc-operon and are regulated at the translation level by r-protein S8, the rplY (L25) gene forms an independent transcription unit. The main goal of this work was to study the regulation of the rplY expression in vivo. We show that the rplY promoter is down-regulated by ppGpp and its cofactor DksA in response to amino acid starvation. At the level of translation, the rplY expression is subjected to the negative feedback control. The 5′-untranslated region of the rplY mRNA comprises specific sequence/structure features, including an atypical SD-like sequence, which are highly conserved in a subset of gamma-proteobacterial families. Despite the lack of a canonical SD element, the rplY’-‘lacZ single-copy reporter showed unusually high translation efficiency. Expression of the rplY gene in trans decreased the translation yield, indicating the mechanism of autogenous repression. Site-directed mutagenesis of the rplY 5′ UTR revealed an important role of the conserved elements in the translation control. Thus, the rplY expression regulation represents one more example of regulatory pathways that control ribosome biogenesis in Escherichia coli and related bacteria. PMID:25749694

  5. Mutations in TFIIIA that increase stability of the TFIIIA-5 S rRNA gene complex: unusual effects on the kinetics of complex assembly and dissociation.

    PubMed

    Brady, Kristina L; Ponnampalam, Stephen N; Bumbulis, Michael J; Setzer, David R

    2005-07-22

    We have identified four mutations in Xenopus TFIIIA that increase the stability of TFIIIA-5 S rRNA gene complexes. In each case, the mutation has a relatively modest effect on equilibrium binding affinity. In three cases, these equilibrium binding effects can be ascribed primarily to decreases in the rate constant for protein-DNA complex dissociation. In the fourth case, however, a substitution of phenylalanine for the wild-type leucine at position 148 in TFIIIA results in much larger compensating changes in the kinetics of complex assembly and dissociation. The data support a model in which a relatively unstable population of complexes with multi-component dissociation kinetics forms rapidly; complexes then undergo a slow conformational change that results in very stable, kinetically homogeneous TFIIIA-DNA complexes. The L148F mutant protein acts as a particularly potent transcriptional activator when it is fused to the VP16 activation domain and expressed in yeast cells. Substitution of L148 to tyrosine or tryptophan produces an equally strong transcriptional activator. Substitution to histidine results in genetic and biochemical effects that are more modest than, but similar to, those observed with the L148F mutation. We propose that an amino acid with a planar side chain at position 148 can intercalate between adjacent base pairs in the intermediate element of the 5 S rRNA gene. Intercalation occurs slowly but results in a very stable DNA-protein complex. These results suggest that transcriptional activation by a cis-acting sequence element is largely dependent on the kinetic, rather than the thermodynamic, stability of the complex formed with an activator protein. Thus, transcriptional activation is dependent in large part on the lifetime of the activator-DNA complex rather than on binding site occupancy at steady state. Introduction of intercalating amino acids into zinc finger proteins may be a useful tool for producing artificial transcription factors with

  6. Evolution of rDNA in Nicotiana Allopolyploids: A Potential Link between rDNA Homogenization and Epigenetics

    PubMed Central

    Kovarik, Ales; Dadejova, Martina; Lim, Yoong K.; Chase, Mark W.; Clarkson, James J.; Knapp, Sandra; Leitch, Andrew R.

    2008-01-01

    Background The evolution and biology of rDNA have interested biologists for many years, in part, because of two intriguing processes: (1) nucleolar dominance and (2) sequence homogenization. We review patterns of evolution in rDNA in the angiosperm genus Nicotiana to determine consequences of allopolyploidy on these processes. Scope Allopolyploid species of Nicotiana are ideal for studying rDNA evolution because phylogenetic reconstruction of DNA sequences has revealed patterns of species divergence and their parents. From these studies we also know that polyploids formed over widely different timeframes (thousands to millions of years), enabling comparative and temporal studies of rDNA structure, activity and chromosomal distribution. In addition studies on synthetic polyploids enable the consequences of de novo polyploidy on rDNA activity to be determined. Conclusions We propose that rDNA epigenetic expression patterns established even in F1 hybrids have a material influence on the likely patterns of divergence of rDNA. It is the active rDNA units that are vulnerable to homogenization, which probably acts to reduce mutational load across the active array. Those rDNA units that are epigenetically silenced may be less vulnerable to sequence homogenization. Selection cannot act on these silenced genes, and they are likely to accumulate mutations and eventually be eliminated from the genome. It is likely that whole silenced arrays will be deleted in polyploids of 1 million years of age and older. PMID:18310159

  7. Then and now: use of 16S rDNA gene sequencing for bacterial identification and discovery of novel bacteria in clinical microbiology laboratories.

    PubMed

    Woo, P C Y; Lau, S K P; Teng, J L L; Tse, H; Yuen, K-Y

    2008-10-01

    In the last decade, as a result of the widespread use of PCR and DNA sequencing, 16S rDNA sequencing has played a pivotal role in the accurate identification of bacterial isolates and the discovery of novel bacteria in clinical microbiology laboratories. For bacterial identification, 16S rDNA sequencing is particularly important in the case of bacteria with unusual phenotypic profiles, rare bacteria, slow-growing bacteria, uncultivable bacteria and culture-negative infections. Not only has it provided insights into aetiologies of infectious disease, but it also helps clinicians in choosing antibiotics and in determining the duration of treatment and infection control procedures. With the use of 16S rDNA sequencing, 215 novel bacterial species, 29 of which belong to novel genera, have been discovered from human specimens in the past 7 years of the 21st century (2001-2007). One hundred of the 215 novel species, 15 belonging to novel genera, have been found in four or more subjects. The largest number of novel species discovered were of the genera Mycobacterium (n = 12) and Nocardia (n = 6). The oral cavity/dental-related specimens (n = 19) and the gastrointestinal tract (n = 26) were the most important sites for discovery and/or reservoirs of novel species. Among the 100 novel species, Streptococcus sinensis, Laribacter hongkongensis, Clostridium hathewayi and Borrelia spielmanii have been most thoroughly characterized, with the reservoirs and routes of transmission documented, and S. sinensis, L. hongkongensis and C. hathewayi have been found globally. One of the greatest hurdles in putting 16S rDNA sequencing into routine use in clinical microbiology laboratories is automation of the technology. The only step that can be automated at the moment is input of the 16S rDNA sequence of the bacterial isolate for identification into one of the software packages that will generate the result of the identity of the isolate on the basis of its sequence database. However

  8. Organization of ribosomal genes in Paramecium tetraurelia

    PubMed Central

    1980-01-01

    The macronuclear ribosomal DNA (rDNA) of the ciliated protozoan Paramecium tetraurelia (stock 51) was analyzed by digestion with restriction endonucleases. The fragments which contained ribosomal RNA (rRNA) coding sequences and spacer sequences were identified. The spacer sequences exhibited some heterogeneity in size. The genes coding for 5.8S RNA, but not for 5S RNA, are linked to the 17S and 25S rRNA genes. Complementary RNA, synthesized from rDNA of stock 51, was hybridized with restriction digests of whole cell DNA from six other allopatric stocks of this species. The restriction patterns of the rDNA from these seven stocks were, in general, very similar, and the sizes of the coding sequences were identical in all seven stocks. Only the restriction pattern of rDNA from stock 127 differed significantly from that of stock 51. The rDNA from stock 127 was isolated and characterized, and with the exception of the restriction pattern of its spacer, it resembled the rDNA from stock 51. It is concluded that the rDNA repeat in Paramecium, including the spacer, has, in general, been conserved during the course of evolution. It is suggested that in some species, even in the absence of genetic exchange among geographically separated populations, selection pressure may act to conserve spacers of tandemly repeated rDNA. The conservation may be related to the number of rDNA copies in the germinal nucleus. PMID:6244317

  9. Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats.

    PubMed

    Warmerdam, Daniël O; van den Berg, Jeroen; Medema, René H

    2016-03-22

    rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded breaks in rDNA. Using selective endonucleases, we show that human cells are highly sensitive to breaks in 45S but not the 5S rDNA repeats. We find that homologous recombination inhibits repair of breaks in 45S rDNA, and this results in repeat loss. We identify the structural maintenance of chromosomes protein 5 (SMC5) as contributing to recombination-mediated repair of rDNA breaks. Together, our data demonstrate that SMC5-mediated recombination can lead to error-prone repair of 45S rDNA repeats, resulting in their loss and thereby reducing cellular viability.

  10. Accumulation of (5'S)-8,5'-cyclo-2'-deoxyadenosine in organs of Cockayne syndrome complementation group B gene knockout mice.

    PubMed

    Kirkali, Güldal; de Souza-Pinto, Nadja C; Jaruga, Pawel; Bohr, Vilhelm A; Dizdaroglu, Miral

    2009-02-01

    Cockayne syndrome (CS) is a human genetic disorder characterized by sensitivity to UV radiation, neurodegeneration, premature aging among other phenotypes. CS complementation group B (CS-B) gene (csb) encodes the CSB protein (CSB) that is involved in base excision repair of a number of oxidatively induced lesions in genomic DNA in vivo. We hypothesized that CSB may also play a role in cellular repair of the DNA helix-distorting tandem lesion (5'S)-8,5'-cyclo-2'-deoxyadenosine (S-cdA). Among many DNA lesions, S-cdA is unique in that it represents a concomitant damage to both the sugar and base moieties of the same nucleoside. Because of the presence of the C8-C5' covalent bond, S-cdA is repaired by nucleotide excision repair unlike most of other oxidatively induced lesions in DNA, which are subject to base excision repair. To test our hypothesis, we isolated genomic DNA from brain, kidney and liver of wild type and csb knockout (csb(-/-)) mice. Animals were not exposed to any exogenous oxidative stress before the experiment. DNA samples were analysed by liquid chromatography/mass spectrometry with isotope-dilution. Statistically greater background levels of S-cdA were observed in all three organs of csb(-/-) mice than in those of wild type mice. These results suggest the in vivo accumulation of S-cdA in genomic DNA due to lack of its repair in csb(-/-) mice. Thus, this study provides, for the first time, the evidence that CSB plays a role in the repair of the DNA helix-distorting tandem lesion S-cdA. Accumulation of unrepaired S-cdA in vivo may contribute to the pathology associated with CS. PMID:18992371

  11. Functional variants of 5S rRNA in the ribosomes of common sea urchin Paracentrotus lividus.

    PubMed

    Dimarco, Eufrosina; Cascone, Eleonora; Bellavia, Daniele; Caradonna, Fabio

    2012-10-15

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus; this study, performed at DNA level only, lends itself as starting point to verify that these clusters could contain transcribed genes, then, to demonstrate the presence of heterogeneity at functional RNA level, also. In the present work we report in P. lividus ribosomes the existence of several transcribed variants of the 5S rRNA and we associate all transcribed variants to the cluster to which belong. Our finding is the first demonstration of the presence of high heterogeneity in functional 5S rRNA molecules in animal ribosomes, a feature that had been considered a peculiarity of some plants. PMID:22967708

  12. Chromosomal characteristics and distribution of rDNA sequences in the brook trout Salvelinus fontinalis (Mitchill, 1814).

    PubMed

    Śliwińska-Jewsiewicka, A; Kuciński, M; Kirtiklis, L; Dobosz, S; Ocalewicz, K; Jankun, Malgorzata

    2015-08-01

    Brook trout Salvelinus fontinalis (Mitchill, 1814) chromosomes have been analyzed using conventional and molecular cytogenetic techniques enabling characteristics and chromosomal location of heterochromatin, nucleolus organizer regions (NORs), ribosomal RNA-encoding genes and telomeric DNA sequences. The C-banding and chromosome digestion with the restriction endonucleases demonstrated distribution and heterogeneity of the heterochromatin in the brook trout genome. DNA sequences of the ribosomal RNA genes, namely the nucleolus-forming 28S (major) and non-nucleolus-forming 5S (minor) rDNAs, were physically mapped using fluorescence in situ hybridization (FISH) and primed in situ labelling. The minor rDNA locus was located on the subtelo-acrocentric chromosome pair No. 9, whereas the major rDNA loci were dispersed on 14 chromosome pairs, showing a considerable inter-individual variation in the number and location. The major and minor rDNA loci were located at different chromosomes. Multichromosomal location (3-6 sites) of the NORs was demonstrated by silver nitrate (AgNO3) impregnation. All Ag-positive i.e. active NORs corresponded to the GC-rich blocks of heterochromatin. FISH with telomeric probe showed the presence of the interstitial telomeric site (ITS) adjacent to the NOR/28S rDNA site on the chromosome 11. This ITS was presumably remnant of the chromosome rearrangement(s) leading to the genomic redistribution of the rDNA sequences. Comparative analysis of the cytogenetic data among several related salmonid species confirmed huge variation in the number and the chromosomal location of rRNA gene clusters in the Salvelinus genome.

  13. Homologous genes for mouse 4.5S hybRNA are found in all eukaryotes and their low molecular weight RNA transcripts intermolecularly hybridize with eukaryotic 18S ribosomal RNAs.

    PubMed

    Trinh-Rohlik, Q; Maxwell, E S

    1988-07-11

    Previous work has reported the isolation and sequencing of a mouse low molecular weight RNA species designated 4.5S hybridizing RNA or hybRNA because of its ability to intermolecularly hybridize with mouse mRNA and 18S rRNA sequences. Using synthetic DNA oligonucleotide probes we have examined the conservation of this gene sequence and its expression as a lmwRNA transcript across evolution. Southern blot analysis has shown that homologous genes of single or low copy number are found in all eukaryotes examined as well as in E. coli. Northern blot analysis has demonstrated 4.5S hybRNA transcription in all mouse tissues as well as expression in yeast and Xenopus laevis as lmwRNAs of approximately 130 and 100 nucleotides, respectively, as compared with mouse/rat/hamster species of approximately 87 nucleotides. Yeast and X. laevis 4.5S hybRNA homologs, isolated by hybrid-selection, were shown by Northern blot analysis to intermolecularly hybridize with homologous as well as heterologous 18S rRNA sequences. The conservation of 4.5S hybRNA homologous genes and their expression as lmwRNA transcripts with common intermolecular RNA:RNA hybridization capabilities in fungi, amphibians, and mammals argues for a common, conserved and required biological function for this lmwRNA in all eukaryotes and potential utilization of its intermolecular RNA:RNA hybridization capabilities to carry out this function.

  14. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.

    PubMed

    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette

    2012-07-01

    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA.

  15. Morphology and small subunit rDNA gene sequence of Pseudoamphisiella quadrinucleata n. sp. (Ciliophora, Urostylida) from the South China Sea.

    PubMed

    Shen, Zhuo; Lin, Xiaofeng; Long, Hongan; Miao, Miao; Liu, Hongbin; Al-Rasheid, Khaled A S; Song, Weibo

    2008-01-01

    The urosylid genus Pseudoamphisiella was established by Song (1996) with hitherto only two known congeners. In the present work, the morphology and infraciliature of a new member, Pseudoamphisiella quadrinucleata n. sp., a form with conspicuous alveolar layer and four macronuclear nodules isolated from the coastal waters both near Hong Kong and near Guangzhou, South China were investigated using living observation and protargol silver impregnation methods. Pseudoamphisiella quadrinucleata differs from other two known forms mainly by the number of macronuclear nodules: constantly four vs. two in Pseudoamphisiella alveolata and 24-57 in Pseudoamphisiella lacazei. To support this, the sequence of the small subunit rDNA of P. quadrinucleata n. sp. showed 14 and 74 nucleotides in comparison with that of the two known congeners, respectively, which hence firmly supports the validity of the new species.

  16. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    PubMed

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location. PMID:27334092

  17. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    PubMed

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location.

  18. Role of DNA-Dependent RNA Polymerase III in the Transcription of the tRNA and 5S RNA Genes

    PubMed Central

    Weinmann, Roberto; Roeder, Robert G.

    1974-01-01

    Mouse myeloma cells have previously been shown (L. B. Schwartz, V. E. F. Sklar, J. A. Jaehning, R. Weinmann & R. G. Roeder, submitted for publication) to contain two chromatographically distinct forms of RNA polymerase III (designated IIIA and IIIB). The enzymes are unaffected by low α-amanitin concentrations which completely inhibit RNA polymerase II, but they exhibit characteristic inhibition curves (identical for IIIA and IIIB) at higher toxin concentrations. RNA polymerase I was unaffected at all α-amanitin concentrations tested. Myeloma RNA polymerases II, IIIA, and IIIB appear to be inhibited by the same mechanism, since the toxin rapidly blocks chain elongation by each enzyme. The characteristic α-amanitin sensitivity of RNA polymerase III has been employed in studies of the function(s) of the class III RNA polymerases. Isolated myeloma nuclei and nucleoli contińue to synthesize RNA via the endogenous RNA polymerases when incubated in vitro. With nuclei, newly synthesized 4S precursor (pre-4S) and 5S RNA species were detected by electrophoretic analysis either of the total nuclear RNA or of the RNA released into the supernatant during incubation. The synthesis of both pre-4S and 5S RNA species was inhibited by α-amanitin, but only at high concentrations; and the α-amanitin inhibition curves for these RNAs were identical to those obtained for solubilized RNA polymerases IIIA and IIIB. In control experiments it was shown that the endogenous RNA polymerase II activity of isolated nuclei was inhibited by α-amanitin concentrations similar to those required to inhibit purified enzyme II. However, 40-50% of the endogenous activity of nuclei and 100% of the endogenous activity of purified nucleoli was completely resistant to the high α-amanitin concentrations necessary to inhibit the RNA polymerase III activities. These experiments rule out nonspecific inhibitory effects in the endogenous systems. These results unequivocally demonstrate the role of RNA

  19. rDNA Copy Number Variants Are Frequent Passenger Mutations in Saccharomyces cerevisiae Deletion Collections and de Novo Transformants

    PubMed Central

    Kwan, Elizabeth X.; Wang, Xiaobin S.; Amemiya, Haley M.; Brewer, Bonita J.; Raghuraman, M. K.

    2016-01-01

    The Saccharomyces cerevisiae ribosomal DNA (rDNA) locus is known to exhibit greater instability relative to the rest of the genome. However, wild-type cells preferentially maintain a stable number of rDNA copies, suggesting underlying genetic control of the size of this locus. We performed a screen of a subset of the Yeast Knock-Out (YKO) single gene deletion collection to identify genetic regulators of this locus and to determine if rDNA copy number correlates with yeast replicative lifespan. While we found no correlation between replicative lifespan and rDNA size, we identified 64 candidate strains with significant rDNA copy number differences. However, in the process of validating candidate rDNA variants, we observed that independent isolates of our de novo gene deletion strains had unsolicited but significant changes in rDNA copy number. Moreover, we were not able to recapitulate rDNA phenotypes from the YKO yeast deletion collection. Instead, we found that the standard lithium acetate transformation protocol is a significant source of rDNA copy number variation, with lithium acetate exposure being the treatment causing variable rDNA copy number events after transformation. As the effects of variable rDNA copy number are being increasingly reported, our finding that rDNA is affected by lithium acetate exposure suggested that rDNA copy number variants may be influential passenger mutations in standard strain construction in S. cerevisiae. PMID:27449518

  20. Chromosomal localization of the 18S-28S and 5S rRNA genes and (TTAGGG)n sequences of butterfly lizards (Leiolepis belliana belliana and Leiolepis boehmei, Agamidae, Squamata).

    PubMed

    Srikulnath, Kornsorn; Uno, Yoshinobu; Matsubara, Kazumi; Thongpan, Amara; Suputtitada, Saowanee; Apisitwanich, Somsak; Nishida, Chizuko; Matsuda, Yoichi

    2011-10-01

    Chromosomal mapping of the butterfly lizards Leiolepis belliana belliana and L. boehmei was done using the 18S-28S and 5S rRNA genes and telomeric (TTAGGG)n sequences. The karyotype of L. b. belliana was 2n = 36, whereas that of L. boehmei was 2n = 34. The 18S-28S rRNA genes were located at the secondary constriction of the long arm of chromosome 1, while the 5S rRNA genes were found in the pericentromeric region of chromosome 6 in both species. Hybridization signals for the (TTAGGG)n sequence were observed at the telomeric ends of all chromosomes, as well as interstitially at the same position as the 18S-28S rRNA genes in L. boehmei. This finding suggests that in L. boehmei telomere-to-telomere fusion probably occurred between chromosome 1 and a microchromosome where the 18S-28S rRNA genes were located or, alternatively, at the secondary constriction of chromosome 1. The absence of telomeric sequence signals in chromosome 1 of L. b. belliana suggested that its chromosomes may have only a few copies of the (TTAGGG)n sequence or that there may have been a gradual loss of the repeat sequences during chromosomal evolution.

  1. Identification of airborne bacterial and fungal species in the clinical microbiology laboratory of a university teaching hospital employing ribosomal DNA (rDNA) PCR and gene sequencing techniques.

    PubMed

    Nagano, Yuriko; Walker, Jim; Loughrey, Anne; Millar, Cherie; Goldsmith, Colin; Rooney, Paul; Elborn, Stuart; Moore, John

    2009-06-01

    Universal or "broad-range" PCR-based ribosomal DNA (rDNA) was performed on a collection of 58 isolates (n = 30 bacteria + 28 fungi), originating from environmental air from several locations within a busy clinical microbiology laboratory, supporting a university teaching hospital. A total of 10 bacterial genera were identified including both Gram-positive and Gram-negative genera. Gram-positive organisms accounted for 27/30 (90%) of total bacterial species, consisting of seven genera and included (in descending order of frequency) Staphylococcus, Micrococcus, Corynebacterium, Paenibacillus, Arthrobacter, Janibacter and Rothia. Gram-negative organisms were less frequently isolated 3/30 (10%) and comprised three genera, including Moraxella, Psychrobacter and Haloanella. Eight fungal genera were identified among the 28 fungal organisms isolated, including (in descending order of frequency) Cladosporium, Penicillium, Aspergillus, Thanatephorus, Absidia, Eurotium, Paraphaeosphaeria and Tritirachium, with Cladosporium accounting for 10/28 (35.7%) of the total fungal isolates. In conclusion, this study identified the presence of 10 bacterial and eight fungal genera in the air within the laboratory sampled. Although this reflected diversity of the microorganisms present, none of these organisms have been described previously as having an inhalational route of laboratory-acquired infection. Therefore, we believe that the species of organisms identified and the concentration levels of these airborne contaminants determined, do not pose a significant health and safety threat for immunocompotent laboratory personnel and visitors. PMID:20183192

  2. Comet-FISH with rDNA probes for the analysis of mutagen-induced DNA damage in plant cells.

    PubMed

    Kwasniewska, Jolanta; Grabowska, Marta; Kwasniewski, Miroslaw; Kolano, Bozena

    2012-06-01

    We used comet-fluorescence in situ hybridization (FISH) in the model plant species Crepis capillaris following exposure of seedlings to maleic hydrazide (MH). FISH with 5S and 25S rDNA probes was applied to comets obtained under alkaline conditions to establish whether these DNA regions were preferentially involved in comet tail formation. MH treatment induced significant fragmentation of nuclear DNA and of rDNA loci. A 24-h post-treatment recovery period allowed a partial reversibility of MH-induced damage on nuclear and rDNA regions. Analyses of FISH signals demonstrated that rDNA sequences were always involved in tail formation and that 5S rDNA was more frequently present in the tail than 25S rDNA, regardless of treatment. The involvement of 25S rDNA in nucleolus formation and differences in chromatin structure between the two loci may explain the different susceptibility of the 25S and 5S rDNA regions to migrate into the tail. This work is the first report on the application of FISH to comet preparations from plants to analyze the distribution and repair of DNA damage within specific genomic regions after mutagenic treatment. Moreover, our work suggests that comet-FISH in plants may be a useful tool for environmental monitoring assessment. PMID:22556029

  3. Chaperoning 5S RNA assembly.

    PubMed

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-07-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit.

  4. Chaperoning 5S RNA assembly

    PubMed Central

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-01-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998

  5. Patterns of rDNA and telomeric sequences diversification: contribution to repetitive DNA organization in Phyllostomidae bats.

    PubMed

    Calixto, Merilane da Silva; de Andrade, Izaquiel Santos; Cabral-de-Mello, Diogo Cavalcanti; Santos, Neide; Martins, Cesar; Loreto, Vilma; de Souza, Maria José

    2014-02-01

    Chromosomal organization and the evolution of genome architecture can be investigated by physical mapping of the genes for 45S and 5S ribosomal DNAs (rDNAs) and by the analysis of telomeric sequences. We studied 12 species of bats belonging to four subfamilies of the family Phyllostomidae in order to correlate patterns of distribution of heterochromatin and the multigene families for rDNA. The number of clusters for 45S gene ranged from one to three pairs, with exclusively location in autosomes, except for Carollia perspicillata that had in X chromosome. The 5S gene all the species studied had only one site located on an autosomal pair. In no species the 45S and 5S genes collocated. The fluorescence in situ hybridization (FISH) probe for telomeric sequences revealed fluorescence on all telomeres in all species, except in Carollia perspicillata. Non-telomeric sites in the pericentromeric region of the chromosomes were observed in most species, ranged from one to 12 pairs. Most interstitial telomeric sequences were coincident with heterochromatic regions. The results obtained in the present work indicate that different evolutionary mechanisms are acting in Phyllostomidae genome architecture, as well as the occurrence of Robertsonian fusion during the chromosomal evolution of bats without a loss of telomeric sequences. These data contribute to understanding the organization of multigene families and telomeric sequences on bat genome as well as the chromosomal evolutionary history of Phyllostomidae bats.

  6. PAGE analysis of the heteroduplexes formed between PCR-amplified 16S rRNA genes: estimation of sequence similarity and rDNA complexity.

    PubMed

    Espejo, R T; Feijóo, C G; Romero, J; Vásquez, M

    1998-06-01

    Analysis of the 16S rRNA genes retrieved directly from different environments has proven to be a powerful tool that has greatly expanded our knowledge of microbial diversity and phylogeny. It is shown here that sequence similarity between 80 and 100% among 16S rDNAs can be estimated by the electrophoretic migration of their heteroduplexes. This was measured by hybridization and electrophoresis in polyacrylamide gels of the product obtained after PCR amplification of almost the entire 16S rRNA gene from different bacterial species. These heteroduplexes were also observed after amplification of samples containing DNA from two or more bacterial species and a procedure was applied to identify reliably heteroduplexes among the amplification products. The electrophoretic migration of the heteroduplexes observed after PCR was used to detect the presence of 16S rDNAs with different sequences in DNA extracted from both a mixture of two bacterial species and samples containing a natural bacterial community.

  7. Molecular identification of Hysterothylacium aduncum specimens isolated from commercially important fish species of Eastern Mediterranean Sea using mtDNA cox1 and ITS rDNA gene sequences.

    PubMed

    Keskin, Emre; Koyuncu, Cafer Erkin; Genc, Ercument

    2015-04-01

    The presence of a Raphidascarid parasitic nematode Hysterothylacium aduncum (Rudolphi, 1802) in two sparid fish (Sparus aurata and Diplodus vulgaris) and one soleid fish (Solea solea) was investigated in this study. A total of 868 individuals; 385 S. aurata, 437 D. vulgaris and 46 S. solea were collected from the Mersin Bay between February 2013 and January 2014 and examined. Variations in the prevalence, mean intensity, and mean abundance of the parasite were 14.55%, 2.05, and 0.30 for S. aurata, 4.12%, 2.44, and 0.10 for D. vulgaris, and 15.22%, 3.29, and 0.50 for S. sole respectively. Nucleotide sequences of 1398 base pair long fragment of 18S rRNA-ITS1-5.8S rRNA-ITS2-28S rRNA region and 641 base pair long fragment of mtDNA cytochrome c oxidase I (cox1) gene were used in molecular identification of isolated parasites at species level. All the parasite samples were identified as H. aduncum based on nucleotide sequence comparisons. Both ITS rDNA and mtDNA cox1 sequences revealed a genetic variation among H. aduncum specimens isolated from different fish species, while only mtDNA cox1 sequences were indicating a mean genetic distance of 0.010 among H. aduncum specimens of the same host species. PMID:25543079

  8. [18S-25S rDNA variation in tissue culture of some Gentiana L. species].

    PubMed

    Mel'nyk, V M; Andrieiev, I O; Spiridonova, K V; Strashniuk, N M; Kunakh, V A

    2007-01-01

    18S-25S rDNA of intact plants and tissue cultures of G. acaulis, G. punctata and G. lutea have been investigated by using blot-hybridization. The decrease of rDNA amount was found in the callus cultures as compared with the plants. In contrast to other species, G. lutea showed intragenome heterogeneity of rRNA genes as well as qualitative rDNA changes in tissue culture, in particular appearance of altered repeats. The relationship between the peculiarities of rRNA gene structure and their rearrangements in in vitro culture was suggested.

  9. Novel genetic diversity within Anopheles punctimacula s.l.: phylogenetic discrepancy between the Barcode cytochrome c oxidase I (COI) gene and the rDNA second internal transcribed spacer (ITS2).

    PubMed

    Loaiza, Jose R; Scott, Marilyn E; Bermingham, Eldredge; Sanjur, Oris I; Rovira, Jose R; Dutari, Larissa C; Linton, Yvonne-Marie; Bickersmith, Sara; Conn, Jan E

    2013-10-01

    Anopheles punctimacula s.l. is a regional malaria vector in parts of Central America, but its role in transmission is controversial due to its unresolved taxonomic status. Two cryptic species, An. malefactor and An. calderoni, have been previously confused with this taxon, and evidence for further genetic differentiation has been proposed. In the present study we collected and morphologically identified adult female mosquitoes of An. punctimacula s.l. from 10 localities across Panama and one in Costa Rica. DNA sequences from three molecular regions, the three prime end of the mitochondrial cytochrome c oxidase I gene (3' COI), the Barcode region in the five prime end of the COI (5' COI), and the rDNA second internal transcribed spacer (ITS2) were used to test the hypothesis of new molecular lineages within An. punctimacula s.l. Phylogenetic analyses using the 3' COI depicted six highly supported molecular lineages (A-F), none of which was An. malefactor. In contrast, phylogenetic inference with the 5' COI demonstrated paraphyly. Tree topologies based on the combined COI regions and ITS2 sequence data supported the same six lineages as the 3' COI alone. As a whole this evidence suggests that An. punctimacula s.l. comprises two geographically isolated lineages, but it is not clear whether these are true species. The phylogenetic structure of the An. punctimacula cluster as well as that of other unknown lineages (C type I vs C type II; D vs E) appears to be driven by geographic partition, because members of these assemblages did not overlap spatially. We report An. malefactor for the first time in Costa Rica, but our data do not support the presence of An. calderoni in Panama. PMID:23806568

  10. Next generation sequencing analysis reveals a relationship between rDNA unit diversity and locus number in Nicotiana diploids

    PubMed Central

    2012-01-01

    Background Tandemly arranged nuclear ribosomal DNA (rDNA), encoding 18S, 5.8S and 26S ribosomal RNA (rRNA), exhibit concerted evolution, a pattern thought to result from the homogenisation of rDNA arrays. However rDNA homogeneity at the single nucleotide polymorphism (SNP) level has not been detailed in organisms with more than a few hundred copies of the rDNA unit. Here we study rDNA complexity in species with arrays consisting of thousands of units. Methods We examined homogeneity of genic (18S) and non-coding internally transcribed spacer (ITS1) regions of rDNA using Roche 454 and/or Illumina platforms in four angiosperm species, Nicotiana sylvestris, N. tomentosiformis, N. otophora and N. kawakamii. We compared the data with Southern blot hybridisation revealing the structure of intergenic spacer (IGS) sequences and with the number and distribution of rDNA loci. Results and Conclusions In all four species the intragenomic homogeneity of the 18S gene was high; a single ribotype makes up over 90% of the genes. However greater variation was observed in the ITS1 region, particularly in species with two or more rDNA loci, where >55% of rDNA units were a single ribotype, with the second most abundant variant accounted for >18% of units. IGS heterogeneity was high in all species. The increased number of ribotypes in ITS1 compared with 18S sequences may reflect rounds of incomplete homogenisation with strong selection for functional genic regions and relaxed selection on ITS1 variants. The relationship between the number of ITS1 ribotypes and the number of rDNA loci leads us to propose that rDNA evolution and complexity is influenced by locus number and/or amplification of orphaned rDNA units at new chromosomal locations. PMID:23259460

  11. Single-step co-integration of multiple expressible heterologous genes into the ribosomal DNA of the methylotrophic yeast Hansenula polymorpha.

    PubMed

    Klabunde, J; Diesel, A; Waschk, D; Gellissen, G; Hollenberg, C P; Suckow, M

    2002-05-01

    We have investigated the methylotrophic yeast Hansenula polymorpha as a host for the co-integration and expression of multiple heterologous genes using an rDNA integration approach. The ribosomal DNA (rDNA) of H. polymorpha was found to consist of a single rDNA cluster of about 50-60 repeats of an 8-kb unit located on chromosome II. A 2.4-kb segment of H. polymorpha rDNA encompassing parts of the 25S, the complete 5S and the non-transcribed spacer region between 25S and 18S rDNA was isolated and inserted into conventional integrative H. polymorpha plasmids harboring the Saccharomyces- cerevisiae-derived URA3 gene for selection. These rDNA plasmids integrated homologously into the rDNA repeats of a H. polymorpha (odc1) host as several independent clusters. Anticipating that this mode of multiple-cluster integration could be used for the simultaneous integration of several distinct rDNA plasmids, the host strain was co-transformed with a mixture of up to three different plasmids, all bearing the same URA3 selection marker. Transformations indeed resulted in mitotically stable strains harboring one, two, or all three plasmids integrated into the rDNA. The overall copy number of the plasmids integrated did not exceed the number of rDNA repeats present in the untransformed host strain, irrespective of the number of different plasmids involved. Strains harboring different plasmids co-expressed the introduced genes, resulting in functional proteins. Thus, this approach provides a new and attractive tool for the rapid generation of recombinant strains that simultaneously co-produce several proteins in desired stoichiometric ratios. PMID:12021801

  12. rDNA genetic imbalance and nucleolar chromatin restructuring is induced by distant hybridization between Raphanus sativus and Brassica alboglabra.

    PubMed

    Long, Hong; Chen, Chunli; Wang, Bing; Feng, Yanni

    2015-01-01

    The expression of rDNA in hybrids inherited from only one progenitor refers to nucleolar dominance. The molecular basis for choosing which genes to silence remains unclear. We report genetic imbalance induced by distant hybridization correlates with formation of rDNA genes (NORs) in the hybrids between Raphanus sativus L. and Brassica alboglabra Bailey. Moreover, increased CCGG methylation of rDNA in F1 hybrids is concomitant with Raphanus-derived rDNA gene silencing and rDNA transcriptional inactivity revealed by nucleolar configuration restriction. Newly formed rDNA gene locus occurred through chromosomal in F1 hybrids via chromosomal imbalance. NORs are gained de novo, lost, and/or transposed in the new genome. Inhibition of methyltransferases leads to changes in nucleolar architecture, implicating a key role of methylation in control of nucleolar dominance and vital nucleolar configuration transition. Our findings suggest that gene imbalance and methylation-related chromatin restructuring is important for rDNA gene silencing that may be crucial for synthesis of specific proteins. PMID:25723542

  13. rDNA genetic imbalance and nucleolar chromatin restructuring is induced by distant hybridization between Raphanus sativus and Brassica alboglabra.

    PubMed

    Long, Hong; Chen, Chunli; Wang, Bing; Feng, Yanni

    2015-01-01

    The expression of rDNA in hybrids inherited from only one progenitor refers to nucleolar dominance. The molecular basis for choosing which genes to silence remains unclear. We report genetic imbalance induced by distant hybridization correlates with formation of rDNA genes (NORs) in the hybrids between Raphanus sativus L. and Brassica alboglabra Bailey. Moreover, increased CCGG methylation of rDNA in F1 hybrids is concomitant with Raphanus-derived rDNA gene silencing and rDNA transcriptional inactivity revealed by nucleolar configuration restriction. Newly formed rDNA gene locus occurred through chromosomal in F1 hybrids via chromosomal imbalance. NORs are gained de novo, lost, and/or transposed in the new genome. Inhibition of methyltransferases leads to changes in nucleolar architecture, implicating a key role of methylation in control of nucleolar dominance and vital nucleolar configuration transition. Our findings suggest that gene imbalance and methylation-related chromatin restructuring is important for rDNA gene silencing that may be crucial for synthesis of specific proteins.

  14. Astonishing 35S rDNA diversity in the gymnosperm species Cycas revoluta Thunb.

    PubMed

    Wang, Wencai; Ma, Lu; Becher, Hannes; Garcia, Sònia; Kovarikova, Alena; Leitch, Ilia J; Leitch, Andrew R; Kovarik, Ales

    2016-09-01

    In all eukaryotes, the highly repeated 35S ribosomal DNA (rDNA) sequences encoding 18S-5.8S-26S ribosomal RNA (rRNA) typically show high levels of intragenomic uniformity due to homogenisation processes, leading to concerted evolution of 35S rDNA repeats. Here, we compared 35S rDNA divergence in several seed plants using next generation sequencing and a range of molecular and cytogenetic approaches. Most species showed similar 35S rDNA homogeneity indicating concerted evolution. However, Cycas revoluta exhibits an extraordinary diversity of rDNA repeats (nucleotide sequence divergence of different copies averaging 12 %), influencing both the coding and non-coding rDNA regions nearly equally. In contrast, its rRNA transcriptome was highly homogeneous suggesting that only a minority of genes (<20 %) encode functional rRNA. The most common SNPs were C > T substitutions located in symmetrical CG and CHG contexts which were also highly methylated. Both functional genes and pseudogenes appear to cluster on chromosomes. The extraordinary high levels of 35S rDNA diversity in C. revoluta, and probably other species of cycads, indicate that the frequency of repeat homogenisation has been much lower in this lineage, compared with all other land plant lineages studied. This has led to the accumulation of methylation-driven mutations and pseudogenisation. Potentially, the reduced homology between paralogs prevented their elimination by homologous recombination, resulting in long-term retention of rDNA pseudogenes in the genome.

  15. Astonishing 35S rDNA diversity in the gymnosperm species Cycas revoluta Thunb.

    PubMed

    Wang, Wencai; Ma, Lu; Becher, Hannes; Garcia, Sònia; Kovarikova, Alena; Leitch, Ilia J; Leitch, Andrew R; Kovarik, Ales

    2016-09-01

    In all eukaryotes, the highly repeated 35S ribosomal DNA (rDNA) sequences encoding 18S-5.8S-26S ribosomal RNA (rRNA) typically show high levels of intragenomic uniformity due to homogenisation processes, leading to concerted evolution of 35S rDNA repeats. Here, we compared 35S rDNA divergence in several seed plants using next generation sequencing and a range of molecular and cytogenetic approaches. Most species showed similar 35S rDNA homogeneity indicating concerted evolution. However, Cycas revoluta exhibits an extraordinary diversity of rDNA repeats (nucleotide sequence divergence of different copies averaging 12 %), influencing both the coding and non-coding rDNA regions nearly equally. In contrast, its rRNA transcriptome was highly homogeneous suggesting that only a minority of genes (<20 %) encode functional rRNA. The most common SNPs were C > T substitutions located in symmetrical CG and CHG contexts which were also highly methylated. Both functional genes and pseudogenes appear to cluster on chromosomes. The extraordinary high levels of 35S rDNA diversity in C. revoluta, and probably other species of cycads, indicate that the frequency of repeat homogenisation has been much lower in this lineage, compared with all other land plant lineages studied. This has led to the accumulation of methylation-driven mutations and pseudogenisation. Potentially, the reduced homology between paralogs prevented their elimination by homologous recombination, resulting in long-term retention of rDNA pseudogenes in the genome. PMID:26637996

  16. Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization.

    PubMed

    Dingman, Douglas W

    2012-07-01

    Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions.

  17. Molecular cytogenetic analysis of the Appenine endemic cyprinid fish Squalius lucumonis and three other Italian leuciscines using chromosome banding and FISH with rDNA probes.

    PubMed

    Rossi, Anna Rita; Milana, Valentina; Hett, Anne Kathrin; Tancioni, Lorenzo

    2012-12-01

    Karyotype and other chromosomal characteristics of the Appenine endemic cyprinid fish, Toscana stream chub Squalius lucumonis, were analysed using conventional banding and FISH with 45S and 5S rDNA probes. The diploid chromosome number (2n = 50) and karyotype characteristics including pericentromeric heterochromatic blocks and GC-rich CMA(3)-positive sites corresponding to both positive Ag-NORs and 45S rDNA loci on the short arms of a single medium-sized submetacentric chromosome pair were consistent with those found in most European leuciscine cyprinids. On other hand, 5S rDNA FISH in the Toscana stream chub and three other Italian leuciscines, S. squalus, Rutilus rubilio and Telestes muticellus, revealed a species-specific hybridization pattern, i.e. signals on four (S. lucumonis), three (S. squalus and R. rubilio) and two (T. muticellus) chromosome pairs. Whereas all the species shared the 5S rDNA loci on the largest subtelocentric chromosome pair, a "leuciscine" cytotaxonomic marker, S. lucumonis showed both classes of rDNA loci tandem aligned on the short arms of chromosome pair No. 12. The present findings suggest that the observed high variability of 5S rDNA loci provides a powerful tool for investigation of karyotype differentiation in karyologically conservative leuciscine fishes.

  18. Molecular cytogenetic analysis of the Appenine endemic cyprinid fish Squalius lucumonis and three other Italian leuciscines using chromosome banding and FISH with rDNA probes.

    PubMed

    Rossi, Anna Rita; Milana, Valentina; Hett, Anne Kathrin; Tancioni, Lorenzo

    2012-12-01

    Karyotype and other chromosomal characteristics of the Appenine endemic cyprinid fish, Toscana stream chub Squalius lucumonis, were analysed using conventional banding and FISH with 45S and 5S rDNA probes. The diploid chromosome number (2n = 50) and karyotype characteristics including pericentromeric heterochromatic blocks and GC-rich CMA(3)-positive sites corresponding to both positive Ag-NORs and 45S rDNA loci on the short arms of a single medium-sized submetacentric chromosome pair were consistent with those found in most European leuciscine cyprinids. On other hand, 5S rDNA FISH in the Toscana stream chub and three other Italian leuciscines, S. squalus, Rutilus rubilio and Telestes muticellus, revealed a species-specific hybridization pattern, i.e. signals on four (S. lucumonis), three (S. squalus and R. rubilio) and two (T. muticellus) chromosome pairs. Whereas all the species shared the 5S rDNA loci on the largest subtelocentric chromosome pair, a "leuciscine" cytotaxonomic marker, S. lucumonis showed both classes of rDNA loci tandem aligned on the short arms of chromosome pair No. 12. The present findings suggest that the observed high variability of 5S rDNA loci provides a powerful tool for investigation of karyotype differentiation in karyologically conservative leuciscine fishes. PMID:23238894

  19. Bacterial flora as indicated by PCR-temperature gradient gel electrophoresis (TGGE) of 16S rDNA gene fragments from isolated guts of phlebotomine sand flies (Diptera: Psychodidae).

    PubMed

    Guernaoui, S; Garcia, D; Gazanion, E; Ouhdouch, Y; Boumezzough, A; Pesson, B; Fontenille, D; Sereno, D

    2011-03-01

    In this study, we tested the capacity of Temperature Gradient Gel Electrophoresis (TGGE)-based fingerprinting of 16S rDNA PCR fragments to assess bacterial composition in a single isolated sand fly gut. Bacterial content was studied in different life stages of a laboratory-reared colony of Phlebotomus duboscqi and in a wild-caught Phlebotomus papatasi population. Our study demonstrates that a major reorganization in the gut bacterial community occurs during metamorphosis of sand flies. Chloroflexi spp. was dominant in the guts of pre-imaginal stages, although Microbacterium spp. and another as yet unidentified bacteria were detected in the gut of the adult specimen. Interestingly, Microbacterium spp. was also found in all the adult guts of both species. We demonstrate that the analysis of bacterial diversity in an individualized sand fly gut is possible with fingerprinting of 16S rDNA. The use of such methodology, in conjunction with other culture-based methods, will be of great help in investigating the behavior of the Leishmania-bacterial community in an ecological context.

  20. BEND3 represses rDNA transcription by stabilizing a NoRC component via USP21 deubiquitinase.

    PubMed

    Khan, Abid; Giri, Sumanprava; Wang, Yating; Chakraborty, Arindam; Ghosh, Archit K; Anantharaman, Aparna; Aggarwal, Vasudha; Sathyan, Kizhakke M; Ha, Taekjip; Prasanth, Kannanganattu V; Prasanth, Supriya G

    2015-07-01

    Ribosome biogenesis dictates the translational capacity of cells. Several mechanisms establish and maintain transcriptional output from eukaryotic ribosomal DNA (rDNA) loci. rDNA silencing is one such mechanism that ensures the inactivity and hence the maintenance of a silenced state of a subset of rRNA gene copies. Whereas oncogenic agents stimulate rRNA gene transcription, tumor suppressors decrease rRNA gene transcription. We demonstrate in mammalian cells that BANP, E5R, and Nac1 (BEN) domain 3 (BEND3), a quadruple BEN domain-containing protein, localizes in nucleoli and binds to ribosomal RNA gene promoters to help repress rRNA genes. Loss of BEND3 increases histone H3K4 trimethylation and, correspondingly, decreases rDNA promoter DNA methylation, consistent with a role for BEND3 in rDNA silencing. BEND3 associates with the nucleolar-remodeling complex (NoRC), and SUMOylated BEND3 stabilizes NoRC component TTF-1-interacting protein 5 via association with ubiquitin specific protease 21 (USP21) debiquitinase. Our results provide mechanistic insights into how the novel rDNA transcription repressor BEND3 acts together with NoRC to actively coordinate the establishment of rDNA silencing.

  1. BEND3 represses rDNA transcription by stabilizing a NoRC component via USP21 deubiquitinase

    PubMed Central

    Khan, Abid; Giri, Sumanprava; Wang, Yating; Chakraborty, Arindam; Ghosh, Archit K.; Anantharaman, Aparna; Aggarwal, Vasudha; Sathyan, Kizhakke M.; Ha, Taekjip; Prasanth, Kannanganattu V.; Prasanth, Supriya G.

    2015-01-01

    Ribosome biogenesis dictates the translational capacity of cells. Several mechanisms establish and maintain transcriptional output from eukaryotic ribosomal DNA (rDNA) loci. rDNA silencing is one such mechanism that ensures the inactivity and hence the maintenance of a silenced state of a subset of rRNA gene copies. Whereas oncogenic agents stimulate rRNA gene transcription, tumor suppressors decrease rRNA gene transcription. We demonstrate in mammalian cells that BANP, E5R, and Nac1 (BEN) domain 3 (BEND3), a quadruple BEN domain-containing protein, localizes in nucleoli and binds to ribosomal RNA gene promoters to help repress rRNA genes. Loss of BEND3 increases histone H3K4 trimethylation and, correspondingly, decreases rDNA promoter DNA methylation, consistent with a role for BEND3 in rDNA silencing. BEND3 associates with the nucleolar-remodeling complex (NoRC), and SUMOylated BEND3 stabilizes NoRC component TTF-1–interacting protein 5 via association with ubiquitin specific protease 21 (USP21) debiquitinase. Our results provide mechanistic insights into how the novel rDNA transcription repressor BEND3 acts together with NoRC to actively coordinate the establishment of rDNA silencing. PMID:26100909

  2. BEND3 represses rDNA transcription by stabilizing a NoRC component via USP21 deubiquitinase.

    PubMed

    Khan, Abid; Giri, Sumanprava; Wang, Yating; Chakraborty, Arindam; Ghosh, Archit K; Anantharaman, Aparna; Aggarwal, Vasudha; Sathyan, Kizhakke M; Ha, Taekjip; Prasanth, Kannanganattu V; Prasanth, Supriya G

    2015-07-01

    Ribosome biogenesis dictates the translational capacity of cells. Several mechanisms establish and maintain transcriptional output from eukaryotic ribosomal DNA (rDNA) loci. rDNA silencing is one such mechanism that ensures the inactivity and hence the maintenance of a silenced state of a subset of rRNA gene copies. Whereas oncogenic agents stimulate rRNA gene transcription, tumor suppressors decrease rRNA gene transcription. We demonstrate in mammalian cells that BANP, E5R, and Nac1 (BEN) domain 3 (BEND3), a quadruple BEN domain-containing protein, localizes in nucleoli and binds to ribosomal RNA gene promoters to help repress rRNA genes. Loss of BEND3 increases histone H3K4 trimethylation and, correspondingly, decreases rDNA promoter DNA methylation, consistent with a role for BEND3 in rDNA silencing. BEND3 associates with the nucleolar-remodeling complex (NoRC), and SUMOylated BEND3 stabilizes NoRC component TTF-1-interacting protein 5 via association with ubiquitin specific protease 21 (USP21) debiquitinase. Our results provide mechanistic insights into how the novel rDNA transcription repressor BEND3 acts together with NoRC to actively coordinate the establishment of rDNA silencing. PMID:26100909

  3. 5S rRNA and ribosome.

    PubMed

    Gongadze, G M

    2011-12-01

    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  4. Overexpression of Ribosomal RNA in the Development of Human Cervical Cancer Is Associated with rDNA Promoter Hypomethylation

    PubMed Central

    Zhou, Hong; Wang, Yapei; Lv, Qiongying; Zhang, Juan; Wang, Qing; Gao, Fei; Hou, Haoli; Zhang, Hao; Zhang, Wei; Li, Lijia

    2016-01-01

    The ribosomal RNA (rRNA) gene encodes rRNA for protein synthesis. Aberrant expression of the rRNA gene has been generally observed in tumor cells and levels of its promoter methylation as an epigenetic regulator affect rRNA gene transcription. The possible relationship between expression and promoter methylation of rDNA has not been examined in human clinical cervical cancer. Here we investigate rRNA gene expression by quantitative real time PCR, and promoter methylation levels by HpaII/MspI digestion and sodium bisulfite sequencing in the development of human cervical cancer. We find that indeed rRNA levels are elevated in most of cervical intraepithelial neoplasia (CIN) specimens as compared with non-cancer tissues. The rDNA promoter region in cervical intraepithelial neoplasia (CIN) tissues reveals significant hypomethylation at cytosines in the context of CpG dinucleotides, accompanied with rDNA chromatin decondensation. Furthermore treatment of HeLa cells with the methylation inhibitor drug 5-aza-2’-deoxycytidine (DAC) demonstrates the negative correlation between the expression of 45S rDNA and the methylation level in the rDNA promoter region. These data suggest that a decrease in rDNA promoter methylation levels can result in an increase of rRNA synthesis in the development of human cervical cancer. PMID:27695092

  5. Contrasting Patterns of rDNA Homogenization within the Zygosaccharomyces rouxii Species Complex

    PubMed Central

    Chand Dakal, Tikam; Giudici, Paolo; Solieri, Lisa

    2016-01-01

    Arrays of repetitive ribosomal DNA (rDNA) sequences are generally expected to evolve as a coherent family, where repeats within such a family are more similar to each other than to orthologs in related species. The continuous homogenization of repeats within individual genomes is a recombination process termed concerted evolution. Here, we investigated the extent and the direction of concerted evolution in 43 yeast strains of the Zygosaccharomyces rouxii species complex (Z. rouxii, Z. sapae, Z. mellis), by analyzing two portions of the 35S rDNA cistron, namely the D1/D2 domains at the 5’ end of the 26S rRNA gene and the segment including the internal transcribed spacers (ITS) 1 and 2 (ITS regions). We demonstrate that intra-genomic rDNA sequence variation is unusually frequent in this clade and that rDNA arrays in single genomes consist of an intermixing of Z. rouxii, Z. sapae and Z. mellis-like sequences, putatively evolved by reticulate evolutionary events that involved repeated hybridization between lineages. The levels and distribution of sequence polymorphisms vary across rDNA repeats in different individuals, reflecting four patterns of rDNA evolution: I) rDNA repeats that are homogeneous within a genome but are chimeras derived from two parental lineages via recombination: Z. rouxii in the ITS region and Z. sapae in the D1/D2 region; II) intra-genomic rDNA repeats that retain polymorphisms only in ITS regions; III) rDNA repeats that vary only in their D1/D2 domains; IV) heterogeneous rDNA arrays that have both polymorphic ITS and D1/D2 regions. We argue that an ongoing process of homogenization following allodiplodization or incomplete lineage sorting gave rise to divergent evolutionary trajectories in different strains, depending upon temporal, structural and functional constraints. We discuss the consequences of these findings for Zygosaccharomyces species delineation and, more in general, for yeast barcoding. PMID:27501051

  6. Similar patterns of rDNA evolution in synthetic and recently formed natural populations of Tragopogon (Asteraceae) allotetraploids

    PubMed Central

    2010-01-01

    Background Tragopogon mirus and T. miscellus are allotetraploids (2n = 24) that formed repeatedly during the past 80 years in eastern Washington and adjacent Idaho (USA) following the introduction of the diploids T. dubius, T. porrifolius, and T. pratensis (2n = 12) from Europe. In most natural populations of T. mirus and T. miscellus, there are far fewer 35S rRNA genes (rDNA) of T. dubius than there are of the other diploid parent (T. porrifolius or T. pratensis). We studied the inheritance of parental rDNA loci in allotetraploids resynthesized from diploid accessions. We investigate the dynamics and directionality of these rDNA losses, as well as the contribution of gene copy number variation in the parental diploids to rDNA variation in the derived tetraploids. Results Using Southern blot hybridization and fluorescent in situ hybridization (FISH), we analyzed copy numbers and distribution of these highly reiterated genes in seven lines of synthetic T. mirus (110 individuals) and four lines of synthetic T. miscellus (71 individuals). Variation among diploid parents accounted for most of the observed gene imbalances detected in F1 hybrids but cannot explain frequent deviations from repeat additivity seen in the allotetraploid lines. Polyploid lineages involving the same diploid parents differed in rDNA genotype, indicating that conditions immediately following genome doubling are crucial for rDNA changes. About 19% of the resynthesized allotetraploid individuals had equal rDNA contributions from the diploid parents, 74% were skewed towards either T. porrifolius or T. pratensis-type units, and only 7% had more rDNA copies of T. dubius-origin compared to the other two parents. Similar genotype frequencies were observed among natural populations. Despite directional reduction of units, the additivity of 35S rDNA locus number is maintained in 82% of the synthetic lines and in all natural allotetraploids. Conclusions Uniparental reductions of homeologous rRNA gene

  7. rDNA amplification in previtellogenic and vitellogenic oocytes of symphylans (Arthropoda, Myriapoda).

    PubMed

    Jabłońska, A; Szklarzewicz, T; Jankowska, W; Kukiełka, M; Biliński, S M

    2002-01-01

    Tube-shaped ovaries of symphylans house numerous developing oocytes that are accompanied by somatic follicular cells. Oocyte nuclei (germinal vesicles) are relatively large and ovoid. During early previtellogenesis they contain compact spherical bodies and lampbrush chromosomes immersed in a translucent karyoplasm. Fluorescent labeling with DAPI and propidium iodide has revealed the presence of both DNA and RNA in the spherical bodies. As previtellogenesis advances, small RNA- and AgNOR-positive nucleoli bud off from these bodies. Full-grown nucleoli consist of coarse-granular material and comprise electron-transparent vacuoles. Our results suggest that in symphylan germinal vesicles amplification of rDNA genes takes place, and that the spherical bodies represent accumulations of extrachromosomal rDNA (rDNA bodies) after commencement of transcriptional activity.

  8. Shifts in rDNA levels act as a genome buffer promoting chromosome homeostasis.

    PubMed

    Deregowska, Anna; Adamczyk, Jagoda; Kwiatkowska, Aleksandra; Gurgul, Artur; Skoneczny, Marek; Skoneczna, Adrianna; Szmatola, Tomasz; Jasielczuk, Igor; Magda, Michal; Rawska, Ewa; Pabian, Sylwia; Panek, Anita; Kaplan, Jakub; Lewinska, Anna; Wnuk, Maciej

    2015-01-01

    The nucleolus is considered to be a stress sensor and rDNA-based regulation of cellular senescence and longevity has been proposed. However, the role of rDNA in the maintenance of genome integrity has not been investigated in detail. Using genomically diverse industrial yeasts as a model and array-based comparative genomic hybridization (aCGH), we show that chromosome level may be balanced during passages and as a response to alcohol stress that may be associated with changes in rDNA pools. Generation- and ethanol-mediated changes in genes responsible for protein and DNA/RNA metabolism were revealed using next-generation sequencing. Links between redox homeostasis, DNA stability, and telomere and nucleolus states were also established. These results suggest that yeast genome is dynamic and chromosome homeostasis may be controlled by rDNA. PMID:26566866

  9. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae).

    PubMed

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country's economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 'Azul', Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700

  10. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae)

    PubMed Central

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Abstract Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 ‘Azul’, Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700

  11. Chromosome mapping of ribosomal genes and histone H4 in the genus Radacridium (Romaleidae)

    PubMed Central

    Anjos, Allison; Loreto, Vilma; de Souza, Maria José

    2013-01-01

    In this study, two species of Romaleidae grasshoppers, Radacridium mariajoseae and R.nordestinum, were analyzed after CMA3/DA/DAPI sequential staining and fluorescence in situ hybridization (FISH) to determine the location of the 18S and 5S rDNA and histone H4 genes. Both species presented karyotypes composed of 2n = 23, X0 with exclusively acrocentric chromosomes. CMA3+ blocks were detected after CMA3/DA/DAPI staining in only one medium size autosome bivalent and in the X chromosome in R. mariajoseae. On the other hand, all chromosomes, except the L1 bivalent, of R. nordestinum presented CMA3+ blocks. FISH analysis showed that the 18S genes are restricted to the X chromosome in R. mariajoseae, whereas these genes were located in the L2, S9 and S10 autosomes in R. nordestinum. In R. mariajoseae, the 5S rDNA sites were localized in the in L1 and L2 bivalents and in the X chromosome. In R. nordestinum, the 5S genes were located in the L2, L3, M4 and M5 pairs. In both species the histone H4 genes were present in a medium size bivalent. Together, these data evidence a great variability of chromosome markers and show that the 18S and 5S ribosomal genes are dispersed in the Radacridium genome without a significant correlation. PMID:24130439

  12. Generalized oscillator strengths for 5s, 5s{sup '}, and 5p excitations of krypton

    SciTech Connect

    Li Wenbin; Zhu Linfan; Yuan Zhensheng; Sun Jianmin; Cheng Huadong; Xu Kezun; Zhong Zhiping; Liu Xiaojing

    2003-06-01

    The absolute generalized oscillator strengths (GOSs) for 5s, 5s{sup '}, 5p [5/2]{sub 3,2}, 5p [3/2]{sub 1,2}, and 5p [1/2]{sub 0} transitions of krypton have been determined in a large K{sup 2} region at a high electron-impact energy of 2500 eV. The positions of the minima and maxima of these GOSs have been determined. The present results show that the angular resolution and pressure effect have great influence on the position and the amplitude of the minimum for the GOS of 5s+5s{sup '} transitions. When these effects are considered, the measured minimum position for the GOS of 5s+5s{sup '} transitions is in excellent agreement with the calculation of Chen and Msezane [J. Phys. B 33, 5397 (2000)].

  13. Aberrant DNA Methylation of rDNA and PRIMA1 in Borderline Personality Disorder

    PubMed Central

    Teschler, Stefanie; Gotthardt, Julia; Dammann, Gerhard; Dammann, Reinhard H.

    2016-01-01

    Borderline personality disorder (BPD) is a serious psychic disease with a high risk for suicide. DNA methylation is a hallmark for aberrant epigenetic regulation and could be involved in the etiology of BPD. Previously, it has been reported that increased DNA methylation of neuropsychiatric genes is found in the blood of patients with BPD compared to healthy controls. Here, we analyzed DNA methylation patterns of the ribosomal RNA gene (rDNA promoter region and 5′-external transcribed spacer/5′ETS) and the promoter of the proline rich membrane anchor 1 gene (PRIMA1) in peripheral blood samples of 24 female patients (mean age (33 ± 11) years) diagnosed with DSM-IV BPD and in 11 female controls (mean age (32 ± 7) years). A significant aberrant methylation of rDNA and PRIMA1 was revealed for BPD patients using pyrosequencing. For the promoter of PRIMA1, the average methylation of six CpG sites was 1.6-fold higher in BPD patients compared to controls. In contrast, the methylation levels of the rDNA promoter region and the 5′ETS were significantly lower (0.9-fold) in patients with BPD compared to controls. Thus, for nine CpGs located in the rDNA promoter region and for four CpGs at the 5′ETS decreased methylation was found in peripheral blood of patients compared to controls. Our results suggest that aberrant methylation of rDNA and PRIMA1 is associated with the pathogenesis of BPD. PMID:26742039

  14. Aberrant DNA Methylation of rDNA and PRIMA1 in Borderline Personality Disorder.

    PubMed

    Teschler, Stefanie; Gotthardt, Julia; Dammann, Gerhard; Dammann, Reinhard H

    2016-01-01

    Borderline personality disorder (BPD) is a serious psychic disease with a high risk for suicide. DNA methylation is a hallmark for aberrant epigenetic regulation and could be involved in the etiology of BPD. Previously, it has been reported that increased DNA methylation of neuropsychiatric genes is found in the blood of patients with BPD compared to healthy controls. Here, we analyzed DNA methylation patterns of the ribosomal RNA gene (rDNA promoter region and 5'-external transcribed spacer/5'ETS) and the promoter of the proline rich membrane anchor 1 gene (PRIMA1) in peripheral blood samples of 24 female patients (mean age (33 ± 11) years) diagnosed with DSM-IV BPD and in 11 female controls (mean age (32 ± 7) years). A significant aberrant methylation of rDNA and PRIMA1 was revealed for BPD patients using pyrosequencing. For the promoter of PRIMA1, the average methylation of six CpG sites was 1.6-fold higher in BPD patients compared to controls. In contrast, the methylation levels of the rDNA promoter region and the 5'ETS were significantly lower (0.9-fold) in patients with BPD compared to controls. Thus, for nine CpGs located in the rDNA promoter region and for four CpGs at the 5'ETS decreased methylation was found in peripheral blood of patients compared to controls. Our results suggest that aberrant methylation of rDNA and PRIMA1 is associated with the pathogenesis of BPD. PMID:26742039

  15. Eukaryotic 5S rRNA biogenesis

    PubMed Central

    Ciganda, Martin; Williams, Noreen

    2012-01-01

    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  16. Deletion of the Tetrahymena thermophila rDNA replication fork barrier region disrupts macronuclear rDNA excision and creates a fragile site in the micronuclear genome.

    PubMed

    Yakisich, J S; Kapler, G M

    2006-01-01

    During macronuclear development the Tetrahymena thermophila ribosomal RNA gene is excised from micronuclear chromosome 1 by site-specific cleavage at chromosome breakage sequence (Cbs) elements, rearranged into a 'palindromic' 21 kb minichromosome and extensively amplified. Gene amplification initiates from origins in the 5' non-transcribed spacer, and forks moving toward the center of the palindrome arrest at a developmentally regulated replication fork barrier (RFB). The RFB is inactive during vegetative cell divisions, suggesting a role in the formation or amplification of macronuclear rDNA. Using micronuclear (germline) transformation, we show that the RFB region facilitates Cbs-mediated excision. Deletion of the RFB inhibits chromosome breakage in a sub-population of developing macronuclei and promotes alternative processing by a Cbs-independent mechanism. Remarkably, the RFB region prevents spontaneous breakage of chromosome 1 in the diploid micronucleus. Strains heterozygous for DeltaRFB and wild-type rDNA lose the DeltaRFB allele and distal left arm of chromosome 1 during vegetative propagation. The wild-type chromosome is subsequently fragmented near the rDNA locus, and both homologs are progressively eroded, suggesting that broken micronuclear chromosomes are not 'healed' by telomerase. Deletion of this 363 bp segment effectively creates a fragile site in the micronuclear genome, providing the first evidence for a non-telomere cis-acting determinant that functions to maintain the structural integrity of a mitotic eukaryotic chromosome.

  17. Preferential PCR amplification of parasitic protistan small subunit rDNA from metazoan tissues.

    PubMed

    Bower, Susan M; Carnegie, Ryan B; Goh, Benjamin; Jones, Simon R; Lowe, Geoffrey J; Mak, Michelle W

    2004-01-01

    A "universal non-metazoan" polymerase chain reaction (UNonMet-PCR) that selectively amplifies a segment of nonmetazoan Small Subunit (SSU) rDNA gene was validated. The primers used were: 18S-EUK581-F (5'-GTGCCAGCAGCCGCG-3') and 18S-EUK1134-R (5'-TTTAAGTTTCAGCCTTGCG-3') with specificity provided by the 19-base reverse primer. Its target site is highly conserved across the Archaea, Bacteria, and eukaryotes (including fungi), but not most Metazoa (except Porifera, Ctenophora, and Myxozoa) which have mismatches at bases 14 and 19 resulting in poor or failed amplification. During validation, UNonMet-PCR amplified SSU rDNA gene fragments from all assayed protists (n = 16 from 7 higher taxa, including two species of marine phytoplankton) and Fungi (n = 3) but amplified very poorly or not at all most assayed Metazoa (n = 13 from 8 higher taxa). When a nonmetazoan parasite was present in a metazoan host, the parasite DNA was preferentially amplified. For example, DNA from the parasite Trypanosoma danilewskyi was preferentially amplified in mixtures containing up to 1,000 x more goldfish Carassius auratus (host) DNA. Also, the weak amplification of uninfected host (Chionoecetes tanneri) SSU rDNA did not occur in the presence of a natural infection with a parasite (Hematodinium sp.). Only Hematodinium sp. SSU rDNA was amplified in samples from infected C. tanneri. This UNonMet-PCR is a powerful tool for amplifying SSU rDNA from non-metazoan pathogens or symbionts that have not been isolated from metazoan hosts.

  18. Cyst-theca relationship of the arctic dinoflagellate cyst Islandinium minutum (Dinophyceae) and phylogenetic position based on SSU rDNA and LSU rDNA.

    PubMed

    Potvin, Éric; Rochon, André; Lovejoy, Connie

    2013-10-01

    Round brown spiny cysts constitute a morphological group common in high latitude dinoflagellate cyst assemblages. The dinoflagellate cyst Islandinium minutum (Harland et Reid) Head, Harland et Matthiessen is the main paleoecological indicator of seasonal sea-ice cover in the Arctic. Despite the importance of this cyst in paleoceanographical studies, its biological affinity has so far been unknown. The biological affinity of the species I. minutum and its phylogenetic position based on the small subunit ribosomal RNA gene (SSU rDNA) and the large subunit ribosomal RNA gene (LSU rDNA) were established from cyst incubation experiments in controlled conditions, optical and scanning electron microscopy, and single-cell PCR. The thecal motile cell obtained was undescribed. Although the motile cell was similar to Archaeperidinium minutum (Kofoid) Jörgensen, the motile cell of I. minutum lacked a transitional plate in the cingular series, which is present in Archaeperidinium spp. Islandinium minutum and Archaeperidinium spp. were paraphyletic in all phylogenetic analyses. Furthermore, Protoperidinium tricingulatum, which also lacks a transitional plate, was closely related to I. minutum and transfered to the genus Islandinium. Based on available data, it is clear that Islandinium is distinct from Archaeperidinium. Therefore, we considered Islandinium Head, Harland et Matthiessen as a non-fossil genus and emend its description, as well as the species I. minutum. This is the first description of a cyst-theca relationship and the first study that reports molecular data based on SSU rDNA and LSU rDNA on a species assigned to the genus Islandinium.

  19. Extrachromosomal amplification of rDNA in oocytes of Hemerobius spp. (Insecta, Neuroptera).

    PubMed

    Kubrakiewicz, J; Biliński, S M

    1995-05-01

    In previtellogenic oocytes of the neuropteran, Hemerobius spp., two distinct, DNA-positive intranuclear structures have been observed. Chromosomes of meiotic prophase assemble in the center of the oocyte nucleus forming a highly polymorphic karyosphere, which persists in this position until the very late stages of vitellogenesis. The extrachromosomal DNA body, containing amplified ribosomal genes, undergoes fragmentation and dispersion in the nucleoplasm. At the onset of previtellogenic growth, transcription of extra rDNA starts, which is accompanied by the appearance of dense, granular material (multiple nucleoli). Arising nucleoli gradually fill the nucleoplasm. At the electron microscopic (EM) level two electron dense structural forms of the granular material have been described. Together with general histological and ultrastructural analysis the amplification of rDNA genes in Hemerobius spp. oocytes has been demonstrated by means of the spreading technique, which has shown that extra rDNA is organized in rings containing various numbers of active ribosomal genes. The transcription activity of amplified genes is manifested in the form of typical "Christmas tree" structures.

  20. Clinorotation influences rDNA and NopA100 localization in nucleoli

    NASA Astrophysics Data System (ADS)

    Sobol, M. A.; González-Camacho, F.; Rodríguez-Vilariño, V.; Kordyum, E. L.; Medina, F. J.

    The nucleolus is the transcription site of rRNA genes as well as the site of processing and initial packaging of their transcripts. The plant nucleolin homologue NopA100 is involved in the regulation of r-chromatin condensation/expansion and rDNA transcription as well as in rRNA processing. We have investigated with immunogold electron microscopy the location of nucleolar DNA and NopA100 in cress root meristematic cells grown under slow horizontal clinorotation, reproducing an important feature of microgravity, namely the absence of an orienting action of a gravity vector, compared to control conditions. We demonstrate redistribution of both rDNA and NopA100 in nucleolar subcomponents induced by clinorotation. Ribosomal DNA concentrated predominantly in fibrillar centers in the form of condensed r-chromatin inclusions and internal non condensed fibrils, redistributing from the dense fibrillar component and the transition zone between fibrillar centers and the dense fibrillar component, recognized as the loci of rDNA transcription. The content of NopA100 was much higher in the inner space of fibrillar centers and reduced in the dense fibrillar component as compared to the control. Based on these data, an effect of slow horizontal clinorotation in lowering the level of rDNA transcription as well as rRNA processing is suggested.

  1. Evolutionary pattern of rDNA following polyploidy in Leymus (Triticeae: Poaceae).

    PubMed

    Fan, Xing; Liu, Jing; Sha, Li-Na; Sun, Gen-Lou; Hu, Zhi-Qin; Zeng, Jian; Kang, Hou-Yang; Zhang, Hai-Qin; Wang, Yi; Wang, Xiao-Li; Zhang, Li; Ding, Chun-Bang; Yang, Rui-Wu; Zheng, You-Liang; Zhou, Yong-Hong

    2014-08-01

    Ribosomal ITS polymorphism and its ancestral genome origin of polyploid Leymus were examined to infer the evolutionary outcome of rDNA gene following allopolyploid speciation and to elucidate the geographic pattern of ITS variation. The results demonstrated that different polyploids have experienced varying fates, including maintenance or homogenization of divergent arrays, occurrence of chimeric repeats and potential pseudogenes. Our data suggested that (1) the Ns, P/F, and St genomic types in Leymus were originated from Psathyrostachys, Agropyron/Eremopyrum, and Pseudoroegneria, respectively; (2) the occurrence of a higher proportion of Leymus species with predominant uniparental rDNA type might associate with the segmental allopolyploid origin, nucleolar dominance of alloploids, and rapid radiation of Leymus; (3) maintenance of multiple parental ITS types in allopolyploid might result from long generation times associated to vegetative multiplication, number and chromosomal location of ribosomal loci and/or recurrent hybridization; (4) the rDNA genealogical structure of Leymus species might associate with the geographic origins; and (5) ITS sequence clade shared by Leymus species from Central Asia, North America, and Nordic might be an outcome of ancestral ITS homogenization. Our results shed new light on understanding evolutionary outcomes of rDNA following allopolyploid speciation and geographic isolation. PMID:24780748

  2. {upsilon}(5S) Results from CLEO

    SciTech Connect

    Pavlunin, Victor

    2006-07-11

    Using the CLEO detector at the Cornell Electron Storage Ring, we have observed the Bs meson in e+e- annihilation at the {upsilon}(5S) resonance. We have fully reconstructed 14 candidates consistent with Bs decays into final states with a J/{psi} or a D{sub s}{sup (*)-}. The probability that this is a background fluctuation is less than 8 x 10-10. We have established that Bs production proceeds predominantly through the creation of B{sub s}*B-bar{sub s}* pairs with {sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s}*) =0[ .11{sub -0.03}{sup +0.04}(stat) {+-} 0.02(syst)] nb. The following limits are set: {sigma}(e{sup +}e{sup -} {yields} B{sub s}B-bar{sub s})/{sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s}*) < 0.16 and [{sigma}(e{sup +}e{sup -} {yields} B{sub s}B-bar{sub s}*) + {sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s})]/{sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s}*) < 0.16 (90% CL). In a separate analysis, by comparing production rates of D{sub s}{sup +} mesons in {upsilon}(5S) and {upsilon}(4S) decays, an estimate of the ratio of B{sub s}{sup (*)} B-bar{sub s}{sup (*)} to the total bb-bar quark pair production at the {upsilon}(5S) energy of (16 {+-} 3 {+-} 6)% is obtained.

  3. Molecular Cytogenetics in Digenean Parasites: Linked and Unlinked Major and 5S rDNAs, B Chromosomes and Karyotype Diversification.

    PubMed

    García-Souto, Daniel; Pasantes, Juan J

    2015-01-01

    Digenetic trematodes are the largest group of internal metazoan parasites, but their chromosomes are poorly studied. Although chromosome numbers and/or karyotypes are known for about 300 of the 18,000 described species, molecular cytogenetic knowledge is mostly limited to the mapping of telomeric sequences and/or of major rDNA clusters in 9 species. In this work we mapped major and 5S rDNA clusters and telomeric sequences in chromosomes of Bucephalus minimus, B. australis, Prosorhynchoides carvajali (Bucephaloidea), Monascus filiformis (Gymnophalloidea), Parorchis acanthus (Echinostomatoidea), Cryptocotyle lingua (Opisthorchioidea), Cercaria longicaudata, Monorchis parvus (Monorchioidea), Diphterostomum brusinae, and Bacciger bacciger (Microphalloidea). Whilst single major and minor rDNA clusters were mapped to different chromosome pairs in B. minimus and P. acanthus, overlapping signals were detected on a single chromosome pair in the remaining taxa. FISH experiments using major rDNA and telomeric probes clearly demonstrated the presence of highly stretched NORs in most of the digenean taxa analyzed. B chromosomes were detected in the B. bacciger samples hosted by Ruditapes decussatus. Although the cercariae specimens obtained from Donax trunculus, Tellina tenuis, and R. decussatus were in agreement with B. bacciger, their karyotypes showed striking morphological differences in agreement with the proposed assignation of these cercariae to different species of the genus Bacciger. Results are discussed in comparison with previous data on digenean chromosomes. PMID:26680763

  4. Characterization of the rDNA unit and sequence analysis of the small subunit rRNA and 5.8S rRNA genes from Tritrichomonas foetus.

    PubMed

    Chakrabarti, D; Dame, J B; Gutell, R R; Yowell, C A

    1992-05-01

    The ribosomal RNA gene unit of the protozoan parasite Tritrichomonas foetus has been cloned and analyzed. Southern blot analysis of the genomic DNA showed that the ribosomal RNA gene unit is organized as a tandem head to tail repeat with a unit length of 6 kb. By Northern analysis a primary transcript of 5.8 kb was detected. Copy number analysis showed the presence of 12 copies of the ribosomal RNA gene unit. The lengths of the small subunit ribosomal RNA and 5.8S ribosomal RNA are 1571 bp and 159 bp, respectively, as determined by sequence analysis. The T. foetus small subunit ribosomal RNA sequence is one of the shortest eukaryotic small subunit rRNA sequences, similar in length to those from 2 other amitochondrial protists. Although shorter than the majority of the eukaryotic small subunit ribosomal RNAs, this sequence maintains the primary and secondary structure common to all eukaryotic small subunit ribosomal RNA structures, while truncating sequences found within the eukaryotic variable regions. The length of the large subunit ribosomal RNA was measured at 2.5 kb.

  5. Chromosomal mapping of rRNA genes, core histone genes and telomeric sequences in Brachidontes puniceus and Brachidontes rodriguezi (Bivalvia, Mytilidae)

    PubMed Central

    2010-01-01

    Background Chromosome rearrangements are an important part of the speciation process in many taxa. The study of chromosome evolution in bivalves is hampered by the absence of clear chromosomal banding patterns and the similarity in both chromosome size and morphology. For this reason, obtaining good chromosome markers is essential for reliable karyotypic comparisons. To begin this task, the chromosomes of the mussels Brachidontes puniceus and B. rodriguezi were studied by means of fluorochrome staining and fluorescent in situ hybridization (FISH). Results Brachidontes puniceus and B. rodriguezi both have 2n = 32 chromosomes but differing karyotype composition. Vertebrate-type telomeric sequences appear at both ends of every single chromosome. B. puniceus presents a single terminal major rRNA gene cluster on a chromosome pair while B. rodriguezi shows two. Both mussels present two 5S rDNA and two core histone gene clusters intercalary located on the long arms of two chromosome pairs. Double and triple-FISH experiments demonstrated that one of the 5S rDNA and one of the major rDNA clusters appear on the same chromosome pair in B. rodriguezi but not in B. puniceus. On the other hand, the second 5S rDNA cluster is located in one of the chromosome pairs also bearing one of the core histone gene clusters in the two mussel species. Conclusion Knowledge of the chromosomal distribution of these sequences in the two species of Brachidontes is a first step in the understanding of the role of chromosome changes on bivalve evolution. PMID:21143946

  6. How well do ITS rDNA sequences differentiate species of true morels (Morchella)?

    PubMed

    Du, Xi-Hui; Zhao, Qi; Yang, Zhu L; Hansen, Karen; Taskin, Hatira; Büyükalaca, Saadet; Dewsbury, Damon; Moncalvo, Jean-Marc; Douhan, Greg W; Robert, Vincent A R G; Crous, Pedro W; Rehner, Stephen A; Rooney, Alejandro P; Sink, Stacy; O'Donnell, Kerry

    2012-01-01

    Arguably more mycophiles hunt true morels (Morchella) during their brief fruiting season each spring in the northern hemisphere than any other wild edible fungus. Concerns about overharvesting by individual collectors and commercial enterprises make it essential that science-based management practices and conservation policies are developed to ensure the sustainability of commercial harvests and to protect and preserve morel species diversity. Therefore, the primary objectives of the present study were to: (i) investigate the utility of the ITS rDNA locus for identifying Morchella species, using phylogenetic species previously inferred from multilocus DNA sequence data as a reference; and (ii) clarify insufficiently identified sequences and determine whether the named sequences in GenBank were identified correctly. To this end, we generated 553 Morchella ITS rDNA sequences and downloaded 312 additional ones generated by other researchers from GenBank using emerencia and analyzed them phylogenetically. Three major findings emerged: (i) ITS rDNA sequences were useful in identifying 48/62 (77.4%) of the known phylospecies; however, they failed to identify 12 of the 22 species within the species-rich Elata Subclade and two closely related species in the Esculenta Clade; (ii) at least 66% of the named Morchella sequences in GenBank are misidentified; and (iii) ITS rDNA sequences of up to six putatively novel Morchella species were represented in GenBank. Recognizing the need for a dedicated Web-accessible reference database to facilitate the rapid identification of known and novel species, we constructed Morchella MLST (http://www.cbs.knaw.nl/morchella/), which can be queried with ITS rDNA sequences and those of the four other genes used in our prior multilocus molecular systematic studies of this charismatic genus.

  7. Phylogenetic relationships within Cornus (Cornaceae) based on 26S rDNA sequences.

    PubMed

    Fan, C

    2001-06-01

    Phylogenetic relationships within the dogwood genus Cornus have been highly controversial due to the great morphological heterogeneity. Earlier phylogenetic analyses of Cornus using chloroplast DNA (cpDNA) data (including rbcL and matK sequences, as well as restriction sites) and morphological characters suggested incongruent relationships within the genus. The present study generated sequence data from the nuclear gene 26S rDNA for Cornus to test the phylogenetic hypotheses based on cpDNA and morphological data. The 26S rDNA sequence data obtained represent 16 species, 13 from Cornus and three from outgroups, having an aligned length of 3380 bp. Both parsimony and maximum likelihood analyses of these sequences were conducted. Trees resulting from these analyses suggest relationships among subgroups of Cornus consistent with those inferred from cpDNA data. That is, the dwarf dogwood (subg. Arctocrania) and the big-bracted dogwood (subg. Cynoxylon and subg. Syncarpea) clades are sisters, which are, in turn, sister to the cornelian cherries (subg. Cornus and subg. Afrocrania). This red-fruited clade is sister to the blue- or white-fruited dogwoods (subg. Mesomora, subg. Kraniopsis, and subg. Yinquania). Within the blue- or white-fruited clade, C. oblonga (subg. Yinquania) is sister to the remainder, and subg. Mesomora is sister to subg. Kraniopsis. These relationships were also suggested by the combined 26S rDNA and cpDNA data, but with higher bootstrap and Bremer support in the combined analysis. The 26S rDNA sequence data of Cornus consist of 12 expansion segments spanning 1034 bp. These expansion segments evolve approximately four times as fast as the conserved core regions. The study provides an example of phylogenetic utility of 26S rDNA sequences below the genus level. PMID:11410478

  8. Utility of internally transcribed spacer region of rDNA (ITS) and β-tubulin gene sequences to infer genetic diversity and migration patterns of Colletotrichum truncatum infecting Capsicum spp.

    PubMed

    Rampersad, Kandyce; Ramdial, Hema; Rampersad, Sephra N

    2016-01-01

    Anthracnose is among the most economically important diseases affecting pepper (Capsicum spp.) production in the tropics and subtropics. Of the three species of Colletotrichum implicated as causal agents of pepper anthracnose, C. truncatum is considered to be the most destructive in agro-ecosystems worldwide. However, the genetic variation and the migration potential of C. truncatum infecting pepper are not known. Five populations were selected for study and a two-locus (internally transcribed spacer region, ITS1-5.8S-ITS2, and β-tubulin, β-TUB) sequence data set was generated and used in the analyses. Sequences of the ITS region were less informative than β -tubulin gene sequences based on comparisons of DNA polymorphism indices. Trinidad had the highest genetic diversity and also had the largest effective population size in pairwise comparisons with the other populations. The Trinidad population also demonstrated significant genetic differentiation from the other populations. AMOVA and STRUCTURE analyses both suggested significant genetic variation within populations more so than among populations. A consensus Maximum Likelihood tree based on β-TUB gene sequences revealed very little intraspecific diversity for all isolates except for Trinidad. Two clades consisting solely of Trinidad isolates may have diverged earlier than the other isolates. There was also evidence of directional migration among the five populations. These findings may have a direct impact on the development of integrated disease management strategies to control C. truncatum infection in pepper. PMID:26843942

  9. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

    2005-01-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  10. Molecular cytogenetic analysis of the crucian carp, Carassius carassius (Linnaeus, 1758) (Teleostei, Cyprinidae), using chromosome staining and fluorescence in situ hybridisation with rDNA probes

    PubMed Central

    Spoz, Aneta; Boron, Alicja; Porycka, Katarzyna; Karolewska, Monika; Ito, Daisuke; Abe, Syuiti; Kirtiklis, Lech; Juchno, Dorota

    2014-01-01

    Abstract The crucian carp Carassius carassius (Linnaeus, 1758) is a species with restricted and decreasing distribution in Europe. Six males and six females of the species from the Baltic Sea basin in Poland were examined to show sequentially CMA3/AgNO3 staining pattern, DAPI staining, and, for the first time in literature, molecular cytogenetic analysis using double-colour fluorescence in situ hybridisation (FISH) with 28S and 5S rDNA probes. The karyotype consisted of 20 m, 36 sm and 44 sta chromosomes, NF=156. The AgNO3 stained NORs were most frequently located terminally in the short arms of two sm and two sta elements, and CMA3-positive sites were also observed suggesting abundant GC-rich repetitive DNA in the regions. Other CMA3-positive sites in the short arms of six to ten sm and sta chromosomes were detected. The results based on 28S rDNA FISH confirmed the location of rDNA sites. DAPI-negative staining of NORs suggested the scarcity of AT-rich DNA in the regions. FISH with 5S rDNA probe revealed 8–14 loci (ten and 12 in respectively 49 and 29% of metaphases). They were located in two sm and eight to ten sta chromosomes and six of them were larger than others. Simultaneously, mapping of the two rDNA families on the chromosomes of C. carassius revealed that both 28S and 5S rDNA probes were located in different chromosomes. Molecular cytogenetic data of C. carassius presented here for the first time give an important insight into the structure of chromosomes of this polyploid and declining species and may be useful in its systematics. PMID:25349674

  11. When fathers are instant losers: homogenization of rDNA loci in recently formed Cardamine × schulzii trigenomic allopolyploid.

    PubMed

    Zozomová-Lihová, Judita; Mandáková, Terezie; Kovaříková, Alena; Mühlhausen, Andreas; Mummenhoff, Klaus; Lysak, Martin A; Kovařík, Aleš

    2014-09-01

    Recently formed allopolyploids represent an excellent system to study the impacts of hybridization and genomic duplication on genome structure and evolution. Here we explored the 35SrRNA genes (rDNA) in the Cardamine × schulzii allohexaploid that was formed by two subsequent hybridization events within the past c. 150 yr. The rDNA loci were analyzed by cloning, next generation sequencing (NGS), RT-PCR and FISH methods. The primary C. × insueta triploid hybrid derived from C. rivularis (♀) and C. amara (♂) had gene ratios highly skewed towards maternal sequences. Similarly, C. × schulzii, originating from the secondary hybridization event involving C. × insueta (♀) and C. pratensis (♂), showed a reduction in paternal rDNA homeologs despite an excess of chromosomes inherited from C. pratensis. We also identified novel rDNA loci in C. × schulzii, suggesting that lost loci might be slowly reinstalled by translocation (but not recombination) of genes from partner genomes. Prevalent clonal propagation of allopolyploids, C. × insueta and C. × schulzii, indicates that concerted evolution of rDNA may occur in the absence of extensive meiotic cycles. Adoption of NGS in rDNA variant analysis is highly informative for deciphering the evolutionary histories of allopolyploid species with ongoing homogenization processes. PMID:24916080

  12. Chromosomal localization of 18S rDNA and telomere sequence in the aye-aye, Daubentonia madagascariensis.

    PubMed

    Rakotoarisoa, G; Hirai, Y; Go, Y; Kawamoto, Y; Shima, T; Koyama, N; Randrianjafy, A; Mora, R; Hirai, H

    2000-10-01

    Chromosomal localization of 18S rDNA and telomere sequence was attempted on the chromosomes of the aye-aye (2n = 30) using fluorescence in situ hybridization (FISH) and primed in situ labeling (PRINS), respectively. The rDNA was localized at the tip or whole of the short arm of acrocentric chromosomes 13 and 14 in all spreads observed. However, post-FISH silver-nitrate (Ag) staining showed that transcriptional activity of the rRNA genes was variable, particularly in chromosome 14, which was most frequently negative in one homologue carrying the smaller copy number of rDNA. This observation supports, at the molecular cytogenetic level, previous data concerning the relationship between the copy number of rDNA and its trancriptional activity. On the other hand, telomere sequence was localized only at the telomeric region of all chromosomes, the so-called telomere-only pattern, a characteristic similar to that of the greater bushbaby. These data may provide information on the chromosomal evolution of the lemur, because locations of rDNA and telomere sequences frequently offer important clues in reconstruction of karyotype differentiation. PMID:11245223

  13. Fragile Sites of 'Valencia' Sweet Orange (Citrus sinensis) Chromosomes Are Related with Active 45s rDNA.

    PubMed

    Lan, Hong; Chen, Chun-Li; Miao, Yin; Yu, Chang-Xiu; Guo, Wen-Wu; Xu, Qiang; Deng, Xiu-Xin

    2016-01-01

    Citrus sinensis chromosomes present a morphological differentiation of bands after staining by the fluorochromes CMA and DAPI, but there is still little information on its chromosomal characteristics. In this study, the chromosomes in 'Valencia' C. sinensis were analyzed by fluorescence in situ hybridization (FISH) using telomere DNA and the 45S rDNA gene as probes combining CMA/DAPI staining, which showed that there were two fragile sites in sweet orange chromosomes co-localizing at distended 45S rDNA regions, one proximally locating on B-type chromosome and the other subterminally locating on D-type chromosome. While the chromosomal CMA banding and 45S rDNA FISH mapping in the doubled haploid line of 'Valencia' C. sinensis indicated six 45S rDNA regions, four were identified as fragile sites as doubled comparing its parental line, which confirmed the cytological heterozygosity and chromosomal heteromorphisms in sweet orange. Furthermore, Ag-NOR identified two distended 45S rDNA regions to be active nucleolar organizing regions (NORs) in diploid 'Valencia' C. sinensis. The occurrence of quadrivalent in meiosis of pollen mother cells (PMCs) in 'Valencia' sweet orange further confirmed it was a chromosomal reciprocal translocation line. We speculated this chromosome translocation was probably related to fragile sites. Our data provide insights into the chromosomal characteristics of the fragile sites in 'Valencia' sweet orange and are expected to facilitate the further investigation of the possible functions of fragile sites. PMID:26977938

  14. Fragile Sites of 'Valencia' Sweet Orange (Citrus sinensis) Chromosomes Are Related with Active 45s rDNA.

    PubMed

    Lan, Hong; Chen, Chun-Li; Miao, Yin; Yu, Chang-Xiu; Guo, Wen-Wu; Xu, Qiang; Deng, Xiu-Xin

    2016-01-01

    Citrus sinensis chromosomes present a morphological differentiation of bands after staining by the fluorochromes CMA and DAPI, but there is still little information on its chromosomal characteristics. In this study, the chromosomes in 'Valencia' C. sinensis were analyzed by fluorescence in situ hybridization (FISH) using telomere DNA and the 45S rDNA gene as probes combining CMA/DAPI staining, which showed that there were two fragile sites in sweet orange chromosomes co-localizing at distended 45S rDNA regions, one proximally locating on B-type chromosome and the other subterminally locating on D-type chromosome. While the chromosomal CMA banding and 45S rDNA FISH mapping in the doubled haploid line of 'Valencia' C. sinensis indicated six 45S rDNA regions, four were identified as fragile sites as doubled comparing its parental line, which confirmed the cytological heterozygosity and chromosomal heteromorphisms in sweet orange. Furthermore, Ag-NOR identified two distended 45S rDNA regions to be active nucleolar organizing regions (NORs) in diploid 'Valencia' C. sinensis. The occurrence of quadrivalent in meiosis of pollen mother cells (PMCs) in 'Valencia' sweet orange further confirmed it was a chromosomal reciprocal translocation line. We speculated this chromosome translocation was probably related to fragile sites. Our data provide insights into the chromosomal characteristics of the fragile sites in 'Valencia' sweet orange and are expected to facilitate the further investigation of the possible functions of fragile sites.

  15. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  16. Interpopulation hybridization generates meiotically stable rDNA epigenetic variants in allotetraploid Tragopogon mirus.

    PubMed

    Matyášek, Roman; Dobešová, Eva; Húska, Dalibor; Ježková, Ivana; Soltis, Pamela S; Soltis, Douglas E; Kovařík, Aleš

    2016-02-01

    Uniparental silencing of 35S rRNA genes (rDNA), known as nucleolar dominance (ND), is common in interspecific hybrids. Allotetraploid Tragopogon mirus composed of Tragopogon dubius (d) and Tragopogon porrifolius (p) genomes shows highly variable ND. To examine the molecular basis of such variation, we studied the genetic and epigenetic features of rDNA homeologs in several lines derived from recently and independently formed natural populations. Inbred lines derived from T. mirus with a dominant d-rDNA homeolog transmitted this expression pattern over generations, which may explain why it is prevalent among natural populations. In contrast, lines derived from the p-rDNA dominant progenitor were meiotically unstable, frequently switching to co-dominance. Interpopulation crosses between progenitors displaying reciprocal ND resulted in d-rDNA dominance, indicating immediate suppression of p-homeologs in F1 hybrids. Original p-rDNA dominance was not restored in later generations, even in those segregants that inherited the corresponding parental rDNA genotype, thus indicating the generation of additional p-rDNA and d-rDNA epigenetic variants. Despite preserved intergenic spacer (IGS) structure, they showed altered cytosine methylation and chromatin condensation patterns, and a correlation between expression, hypomethylation of RNA Pol I promoters and chromatin decondensation was apparent. Reversion of such epigenetic variants occurred rarely, resulting in co-dominance maintained in individuals with distinct genotypes. Generally, interpopulation crosses may generate epialleles that are not present in natural populations, underlying epigenetic dynamics in young allopolyploids. We hypothesize that highly expressed variants with distinct IGS features may induce heritable epigenetic reprogramming of the partner rDNA arrays, harmonizing the expression of thousands of genes in allopolyploids. PMID:26711705

  17. Plantago lagopus B Chromosome Is Enriched in 5S rDNA-Derived Satellite DNA.

    PubMed

    Kumke, Katrin; Macas, Jiří; Fuchs, Jörg; Altschmied, Lothar; Kour, Jasmeet; Dhar, Manoj K; Houben, Andreas

    2016-01-01

    B chromosomes are supernumerary dispensable parts of the karyotype which appear in some individuals of some populations in some species. Using advanced sequencing technology, we in silico characterized the high-copy DNA composition of Plantago lagopus with and without B chromosomes. The nuclear genome (2.46 pg/2C) was found to be relatively rich in repetitive sequences, with highly and moderately repeated elements making up 68% of the genome. Besides a centromere-specific marker, we identified a B-specific satellite and a repeat enriched in polymorphic A chromosome segments. The B-specific tandem repeat PLsatB originated from sequence amplification including 5S rDNA fragments. PMID:27173804

  18. Phylogenetic Analysis of Geographically Diverse Radopholus similis via rDNA Sequence Reveals a Monomorphic Motif

    PubMed Central

    Kaplan, D. T.; Thomas, W. K.; Frisse, L. M.; Sarah, J. L.; Stanton, J. M.; Speijer, P. R.; Marin, D. H.; Opperman, C. H.

    2000-01-01

    The nucleic acid sequences of rDNA ITS1 and the rDNA D2/D3 expansion segment were compared for 57 burrowing nematode isolates collected from Australia, Cameroon, Central America, Cuba, Dominican Republic, Florida, Guadeloupe, Hawaii, Nigeria, Honduras, Indonesia, Ivory Coast, Puerto Rico, South Africa, and Uganda. Of the 57 isolates, 55 were morphologically similar to Radopholus similis and seven were citrus-parasitic. The nucleic acid sequences for PCR-amplified ITS1 and for the D2/D3 expansion segment of the 28S rDNA gene were each identical for all putative R. similis. Sequence divergence for both the ITS1 and the D2/D3 was concordant with morphological differences that distinguish R. similis from other burrowing nematode species. This result substantiates previous observations that the R. similis genome is highly conserved across geographic regions. Autapomorphies that would delimit phylogenetic lineages of non-citrus-parasitic R. similis from those that parasitize citrus were not observed. The data presented herein support the concept that R. similis is comprised of two pathotypes-one that parasitizes citrus and one that does not. PMID:19270959

  19. Evolutionary relationships among Magnetospirillum strains inferred from phylogenetic analysis of 16S rDNA sequences.

    PubMed Central

    Burgess, J G; Kawaguchi, R; Sakaguchi, T; Thornhill, R H; Matsunaga, T

    1993-01-01

    We have investigated the evolutionary relationships between two facultatively anaerobic Magnetospirillum strains (AMB-1 and MGT-1) and fastidious, obligately microaerophilic species, such as Magnetospirillum magnetotacticum, using a molecular phylogenetic approach. Genomic DNA from strains MGT-1 and AMB-1 was used as a template for amplification of the genes coding for 16S rRNA (16S rDNA) by the polymerase chain reaction. Amplified DNA fragments were sequenced (1,424 bp) and compared with sequences for M. magnetotacticum MS-1 and Magnetospirillum gryphiswaldense MSR-1. Phylogenetic analysis of the aligned 16S rDNA sequences indicated that the two new magnetic spirilla, AMB-1 and MGT-1, lie within the alpha subdivision (alpha-1) of the eubacterial group Proteobacteria and are closely related to Rhodospirillum fulvum and to several endosymbiotic bacteria. Strains AMB-1, MGT-1, and MS-1 formed a cluster, termed group I, in which they were more closely related to each other than to group II, which contained M. gryphiswaldense MSR-1. Group I strains were also physiologically distinct from strain MSR-1. Sequence alignment studies allowed elucidation of genus-specific regions of the 16S rDNA, and oligonucleotide primers complementary to two of these regions were used to develop a specific polymerase chain reaction assay for detection of magnetic spirilla in natural samples. Images PMID:7691800

  20. Phylogeny of the Eustigmatophyceae Based upon 18S rDNA, with Emphasis on Nannochloropsis.

    PubMed

    Andersen, R A; Brett, R W; Potter, D; Sexton, J P

    1998-02-01

    Complete 18S rDNA sequences were determined for 25 strains representing five genera of the Eustigmatophyceae, including re-examination of three strains with previously published sequences. Parsimony analysis of these and 44 published sequences for other heterokont chromophytes (unalignable sites removed) revealed that the Eustigmatophyceae were a monophyletic group. Analysis of eustigmatophyte taxa only (complete gene analyzed) supported the current familial classification scheme. Twenty one strains of Nannochloropsis were also examined using light microscopy. Gross morphology of cells was variable and overlapped among the strains; cell size was consistent within strains but sometimes varied considerably among strains of a species. The 18S rDNA of N. gaditana, N. oculata and N. salina was re-sequenced for strains used in previous publications and one or more nucleotide differences were found. Nucleotide sequences for Nannochloropsis species varied by up to 32 nucleotides. Identical sequences were found for six strains of N. salina, five strains of N. gadifana, four strains of N. granulata, and two strains of N. oculata, respectively. Four strains could not be assigned to described species and may represent two new species. The unique 18S rDNA sequences for each sibling species of Nannochloropsis demonstrates the presence of considerable genetic diversity despite the extremely simple morphology in this genus. PMID:23196114

  1. Karyotype Diversification and Evolution in Diploid and Polyploid South American Hypochaeris (Asteraceae) Inferred from rDNA Localization and Genetic Fingerprint Data

    PubMed Central

    Weiss-Schneeweiss, Hanna; Tremetsberger, Karin; Schneeweiss, Gerald M.; Parker, John S.; Stuessy, Tod F.

    2008-01-01

    Background and Aims Changes in chromosome structure and number play an important role in plant evolution. A system well-suited to studying different modes of chromosome evolution is the genus Hypochaeris (Asteraceae) with its centre of species' diversity in South America. All South American species uniformly have a chromosome base number of x = 4 combined with variation in rDNA number and distribution, and a high frequency of polyploidy. The aim of this paper is to assess directions and mechanisms of karyotype evolution in South American species by interpreting both newly obtained and previous data concerning rDNA localization in a phylogenetic context. Methods Eleven Hypochaeris species from 18 populations were studied using fluorescence in situ hybridization (FISH) with 35S and 5S rDNA probes. A phylogenetic framework was established from neighbour-net analysis of amplified fragment length polymorphism (AFLP) fingerprint data. Key Results A single 5S rDNA locus is invariably found on the short arm of chromosome 2. Using 35S rDNA loci, based on number (one or two) and localization (interstitial on the long arm of chromosome 2, but sometimes lacking, and terminal or interstitial on the short arm of chromosome 3, only very rarely lacking), seven karyotype groups can be distinguished; five of these include polyploids. Karyotype groups with more than one species do not form monophyletic groups. Conclusions Early evolution of Hypochaeris in South America was characterized by considerable karyotype differentiation resulting from independent derivations from an ancestral karyotype. There was marked diversification with respect to the position and evolution of the 35S rDNA locus on chromosome 3, probably involving inversions and/or transpositions, and on chromosome 2 (rarely 3) concerning inactivation and loss. Among these different karyotype assemblages, the apargioides group and its derivatives constitute by far the majority of species. PMID:18285356

  2. Primary structure of the 5 S subunit of transcarboxylase as deduced from the genomic DNA sequence.

    PubMed

    Thornton, C G; Kumar, G K; Shenoy, B C; Haase, F C; Phillips, N F; Park, V M; Magner, W J; Hejlik, D P; Wood, H G; Samols, D

    1993-09-13

    Transcarboxylase from Propionibacterium shermanii is a complex biotin-containing enzyme composed of 30 polypeptides of three different types. It is composed of six dimeric outer subunits associated with a central cylindrical hexameric subunit through 12 biotinyl subunits; three outer subunits on each face of the central hexamer. Each outer dimer is termed a 5 S subunit which associates with two biotinyl subunits. The enzyme catalyzes a two-step reaction in which methylmalonyl-CoA and pyruvate form propionyl-CoA and oxalacetate, the 5 S subunit specifically catalyzing one of these reactions. We report here the cloning, sequencing and expression of the monomer of the 5 S subunit. The gene was identified by matching amino acid sequences derived from isolated authentic 5 S peptides with the deduced sequence of an open reading frame present on a cloned P. shermanii genomic fragment known to contain the gene encoding the 1.3 S biotinyl subunit. The cloned 5 S gene encodes a protein of 519 amino acids, M(r) 57,793. The deduced sequence shows regions of extensive homology with that of pyruvate carboxylase and oxalacetate decarboxylase, two enzymes which catalyze the same or reverse reaction. A fragment was subcloned into pUC19 in an orientation such that the 5 S open reading frame could be expressed from the lac promoter of the vector. Crude extracts prepared from these cells contained an immunoreactive band on Western blots which co-migrated with authentic 5 S and were fully active in catalyzing the 5 S partial reaction. We conclude that we have cloned, sequenced and expressed the monomer of the 5 S subunit and that the expressed product is catalytically active. PMID:8365490

  3. Unusual dispersion of histone repeats on the whole chromosomal complement and their colocalization with ribosomal genes in Rachycentron canadum (Rachycentridae, Perciformes).

    PubMed

    Costa, Gideão W W F; Cioffi, Marcelo B; Bertollo, Luiz A C; Molina, Wagner F

    2014-01-01

    Rachycentron canadum, the only representative of the family Rachycentridae, has been the focus of biotechnological interest due to its significant potential in marine fish farming. The chromosome set of this species has been widely investigated with respect to the location of genes and multigene families. A FISH analysis was performed using 4 multigene families as probes, represented by 5S and 18S ribosomal genes and histones H2B-H2A and H3. Earlier data suggested that differential replication of heterochromatin could be partially associated with functional genes. Indeed, our results showed that the DNA contained in heterochromatic regions of R. canadum contains 5S and 18S ribosomal genes as well as the gene sequences of histones H2B-H2A and H3, which were colocalized. The distribution of H3 sequences in all heterochromatic regions, except in 13q, could indicate an important evolutionary role for this class of repetitive sequences. Besides, the presence of chromosome regions bearing multifunctional repetitive sequences formed by H2B-H2A/H3/18S rDNA and H2B-H2A/H3/5S rDNA clusters was demonstrated for the first time in fishes. The implications of differential histone gene extension and its functionality in the karyotype of R. canadum remain unknown. PMID:25341625

  4. Discovery and characterization of Acanthamoeba castellanii mitochondrial 5S rRNA.

    PubMed

    Bullerwell, Charles E; Schnare, Murray N; Gray, Michael W

    2003-03-01

    Although 5S rRNA is a highly conserved and universal component of eubacterial, archaeal, chloroplast, and eukaryotic cytoplasmic ribosomes, a mitochondrial DNA-encoded 5S rRNA has so far been identified only in land plants and certain protists. This raises the question of whether 5S rRNA is actually required for and used in mitochondrial translation. In the protist Acanthamoeba castellanii, BLAST searches fail to reveal a 5S rRNA gene in the complete mitochondrial genome sequence, nor is a 5S-sized RNA species detectable in ethidium bromide-stained gels of highly purified mitochondrial RNA preparations. Here we show that an alternative visualization technique, UV shadowing, readily detects a novel, mitochondrion-specific small RNA in A. castellanii mitochondrial RNA preparations, and that this RNA species is, in fact, a 5S rRNA encoded by the A. castellanii mitochondrial genome. These results emphasize the need for caution when interpreting negative results that suggest the absence of 5S rRNA and/or a mitochondrial DNA-encoded 5S rRNA sequence in other (particularly protist) mitochondrial systems.

  5. Phylogeny of gregarines (Apicomplexa) as inferred from small-subunit rDNA and beta-tubulin.

    PubMed

    Leander, Brian S; Clopton, Richard E; Keeling, Patrick J

    2003-01-01

    Gregarines are thought to be deep-branching apicomplexans. Accordingly, a robust inference of gregarine phylogeny is crucial to any interpretation of apicomplexan evolution, but molecular sequences from gregarines are restricted to a small number of small-subunit (SSU) rDNA sequences from derived taxa. This work examines the usefulness of SSU rDNA and beta-tubulin sequences for inferring gregarine phylogeny. SSU rRNA genes from Lecudina (Mingazzini) sp., Monocystis agilis Stein, Leidyana migrator Clopton and Gregarina polymorpha Dufour, as well as the beta-tubulin gene from Leidyana migrator, were sequenced. The results of phylogenetic analyses of alveolate taxa using both genes were consistent with an early origin of gregarines and the putative 'sister' relationship between gregarines and Cryptosporidium, but neither phylogeny was strongly supported. In addition, two SSU rDNA sequences from unidentified marine eukaryotes were found to branch among the gregarines: one was a sequence derived from the haemolymph parasite of the giant clam, Tridacna crocea, and the other was a sequence misattributed to the foraminiferan Ammonium beccarii. In all of our analyses, the SSU rDNA sequence from Colpodella sp. clustered weakly with the apicomplexans, which is consistent with ultrastructural data. Altogether, the exact position of gregarines with respect to Cryptosporidium and other apicomplexans remains to be confirmed, but the congruence of SSU rDNA and beta-tubulin trees with one another and with morphological data does suggest that further sampling of molecular data will eventually put gregarine diversity into a phylogenetic context.

  6. The phylogenetic position of the pelobiont Mastigamoeba balamuthi based on sequences of rDNA and translation elongation factors EF-1alpha and EF-2.

    PubMed

    Arisue, Nobuko; Hashimot, Tetsuo; Lee, Jennifer A; Moore, Dorothy V; Gordon, Paul; Sensen, Christoph W; Gaasterland, Terry; Hasegawa, Masami; Müller, Miklós

    2002-01-01

    The taxonomic position and phylogenetic relationships of the Pelobionta, an amitochondriate amoeboflagellate group, are not yet completely settled. To provide more information, we obtained sequences for the large subunit rDNA gene, the gene for translation elongation factor 1alpha, and for a large part of the gene encoding translation elongation factor 2 from a representative of this group, Mastigamoeba balamuthi (formerly Phreatamoeba balamuthi). The gene for the large subunit rDNA was unusually large compared to those of other protists, a phenomenon that had previously been observed for the gene encoding the small subunit rDNA. Phylogenetic reconstruction using a maximum likelihood method was performed with these sequences, as well as the gene encoding the small subunit rDNA. When evaluated individually, the M. balamuthi genes for the small and large subunit rDNAs and elongation factor 1alpha had a most recent common ancestor with either the Mycetozoa (slime molds) or with Entamoeba histolytica. A clade formed by M. balamuthi, E. histolytica, and Mycetozoa was not rejected statistically for any of the sequences. A combined maximum likelihood analysis using 3,935 positions from all molecules suggested that these three taxonomic units form a robust clade. We were unable to resolve the closest group to this clade using the combined analysis. These findings support the notion, which had previously been proposed primarily on cytological evidence, that both M. balamuthi and E. histolytica are closely related to the Mycetozoa and that these three together represent a major eukaryotic lineage.

  7. Complete structure of nuclear rDNA of the obligate plant parasite Plasmodiophora brassicae: intraspecific polymorphisms in the exon and group I intron of the large subunit rDNA.

    PubMed

    Niwa, Rieko; Kawahara, Ai; Murakami, Hiroharu; Tanaka, Shuhei; Ezawa, Tatsuhiro

    2011-07-01

    Plasmodiophora brassicae is a soil-borne obligate intracellular parasite in the phylum Cercozoa of the Rhizaria that causes clubroot disease of crucifer crops. To control the disease, understanding the distribution and infection routes of the pathogen is essential, and thus development of reliable molecular markers to discriminate geographic populations is required. In this study, the nuclear ribosomal RNA gene (rDNA) repeat unit of P. brassicae was determined, with particular emphasis on the structure of large subunit (LSU) rDNA, in which polymorphic regions were expected to be present. The complete rDNA complex was 9513bp long, which included the small subunit, 5.8S and LSU rDNAs as well as the internal transcribed spacer and intergenic spacer regions. Among eight field populations collected from throughout Honshu Island, Japan, a 1.1 kbp region of the LSU rDNA, including the divergent 8 domain, exhibited intraspecific polymorphisms that reflected geographic isolation of the populations. Two new group I introns were found in this region in six out of the eight populations, and the sequences also reflected their geographic isolation. The polymorphic region found in this study may have potential for the development of molecular markers for discrimination of field populations/isolates of this organism.

  8. Complete structure of nuclear rDNA of the obligate plant parasite Plasmodiophora brassicae: intraspecific polymorphisms in the exon and group I intron of the large subunit rDNA.

    PubMed

    Niwa, Rieko; Kawahara, Ai; Murakami, Hiroharu; Tanaka, Shuhei; Ezawa, Tatsuhiro

    2011-07-01

    Plasmodiophora brassicae is a soil-borne obligate intracellular parasite in the phylum Cercozoa of the Rhizaria that causes clubroot disease of crucifer crops. To control the disease, understanding the distribution and infection routes of the pathogen is essential, and thus development of reliable molecular markers to discriminate geographic populations is required. In this study, the nuclear ribosomal RNA gene (rDNA) repeat unit of P. brassicae was determined, with particular emphasis on the structure of large subunit (LSU) rDNA, in which polymorphic regions were expected to be present. The complete rDNA complex was 9513bp long, which included the small subunit, 5.8S and LSU rDNAs as well as the internal transcribed spacer and intergenic spacer regions. Among eight field populations collected from throughout Honshu Island, Japan, a 1.1 kbp region of the LSU rDNA, including the divergent 8 domain, exhibited intraspecific polymorphisms that reflected geographic isolation of the populations. Two new group I introns were found in this region in six out of the eight populations, and the sequences also reflected their geographic isolation. The polymorphic region found in this study may have potential for the development of molecular markers for discrimination of field populations/isolates of this organism. PMID:21497131

  9. In situ chromosomal localization of rDNA sites in "Safed Musli" Chlorophytum ker-gawl and their physical measurement by fiber FISH.

    PubMed

    Lavania, U C; Basu, S; Srivastava, S; Mukai, Y; Lavania, S

    2005-01-01

    Fluorescence In Situ Hybridization (FISH) technique has been applied on somatic chromosomes and extended DNA fibers in the medicinally important species of Chlorophytum to elucidate physical localization and measurement of the rDNA sites using two rRNA multigene families homologous to 45S and 5S rDNA. The two species of Chlorophytum, namely C. borivillianum and C. comosum, both with 2n = 28, reveal diversity for copy number and localization of rDNA sites. C. borivillianum is comprised of five 45S-rDNA sites:one each in the secondary constriction region of chromosomes 7, 8, 9; one in the subtelomeric region of the short arm of chromosome 2 and the telomeric region of the short arm of chromosome 12; and one 5S-rDNA site in the subtelomeric region of the long arm of chromosome 1. In C. comosum, there are three 45S-rDNA sites (one each in the short arm of chromosomes 12, 13, and 14) and two 5S-rDNA sites (in the secondary constriction regions of chromosomes 2 and 13). Fiber FISH analysis conducted on extended DNA fibers revealed variation in the size of continuous tandem strings for the two r-DNA families. Taking the standard value of native B DNA equivalent to 3.27 kb for 1 mum, it was estimated that the physical size of continuous DNA strings is of the order of approximately 90 kb, 180 kb, and 300 kb for 45S-rDNA and of the order of 60 kb, 150 kb for 5S-rDNA in C. comosum, grossly in correspondence to their respective physical sizes at metaphase.

  10. When molecules support morphology: Phylogenetic reconstruction of the family Onuphidae (Eunicida, Annelida) based on 16S rDNA and 18S rDNA.

    PubMed

    Budaeva, Nataliya; Schepetov, Dmitry; Zanol, Joana; Neretina, Tatiana; Willassen, Endre

    2016-01-01

    Onuphid polychaetes are tubicolous marine worms commonly reported worldwide from intertidal areas to hadal depths. They often dominate in benthic communities and have economic importance in aquaculture and recreational fishing. Here we report the phylogeny of the family Onuphidae based on the combined analyses of nuclear (18S rDNA) and mitochondrial (16S rDNA) genes. Results of Bayesian and Maximum Likelihood analyses supported the monophyly of Onuphidae and its traditional subdivision into two monophyletic subfamilies: Onuphinae and Hyalinoeciinae. Ten of 22 recognized genera were monophyletic with strong node support; four more genera included in this study were either monotypic or represented by a single species. None of the genera appeared para- or polyphyletic and this indicates a strong congruence between the traditional morphology-based systematics of the family and the newly obtained molecular-based phylogenetic reconstructions. Intergeneric relationships within Hyalinoeciinae were not resolved. Two strongly supported monophyletic groups of genera were recovered within Onuphinae: ((Onuphis, Aponuphis), Diopatra, Paradiopatra) and (Hirsutonuphis, (Paxtonia, (Kinbergonuphis, Mooreonuphis))). A previously accepted hypothesis on the subdivision of Onuphinae into the Onuphis group of genera and the Diopatra group of genera was largely rejected.

  11. Karyotype characterization and evolution in South American species of Lathyrus (Notolathyrus, Leguminosae) evidenced by heterochromatin and rDNA mapping.

    PubMed

    Chalup, Laura; Samoluk, Sergio Sebastián; Neffa, Viviana Solís; Seijo, Guillermo

    2015-11-01

    Notolathyrus is a section of South American endemic species of the genus Lathyrus. The origin, phylogenetic relationship and delimitation of some species are still controversial. The present study provides an exhaustive analysis of the karyotypes of approximately half (10) of the species recognized for section Notolathyrus and four outgroups (sections Lathyrus and Orobus) by cytogenetic mapping of heterochromatic bands and 45S and 5S rDNA loci. The bulk of the parameters analyzed here generated markers to identify most of the chromosomes in the complements of the analyzed species. Chromosome banding showed interspecific variation in the amount and distribution of heterochromatin, and together with the distribution of rDNA loci, allowed the characterization of all the species studied here. Additionally, some of the chromosome parameters described (st chromosomes and the 45S rDNA loci) constitute the first diagnostic characters for the Notolathyrus section. Evolutionary, chromosome data revealed that the South American species are a homogeneous group supporting the monophyly of the section. Variation in the amount of heterochromatin was not directly related to the variation in DNA content of the Notolathyrus species. However, the correlation observed between the amount of heterochromatin and some geographical and bioclimatic variables suggest that the variation in the heterochromatic fraction should have an adaptive value.

  12. Polymorphism and recombination for rDNA in the putatively asexual microsporidian Nosema ceranae, a pathogen of honeybees.

    PubMed

    Sagastume, Soledad; del Aguila, Carmen; Martín-Hernández, Raquel; Higes, Mariano; Henriques-Gil, Nuno

    2011-01-01

    Nosema ceranae is currently one of the major pathogens of honeybees, related to the worldwide colony losses phenomenon. The genotyping of strains based on ribosomal DNA (rDNA) can be misleading if the repeated units are not identical. The analysis of cloned rDNA fragments containing the intergenic spacer (IGS) and part of the rDNA small-subunit (SSU) gene, from N. ceranae isolates from different European and Central Asia populations, revealed a high diversity of sequences. The variability involved single-nucleotide polymorphisms and insertion/deletions, resulting in 79 different haplotypes. Two sequences from the same isolate could be as different as any pair of sequences from different samples; in contrast, identical haplotypes were also found in very different geographical origins. Consequently, haplotypes cannot be organized in a consistent phylogenetic tree, clearly indicating that rDNA is not a reliable marker for the differentiation of N. ceranae strains. The results indicate that recombination between different sequences may produce new variants, which is quite surprising in microsporidia, usually considered to have an asexual mode of reproduction. The diversity of sequences and their geographical distribution indicate that haplotypes of different lineages may occasionally be present in a same cell and undergo homologue recombination, therefore suggesting a sexual haplo-diploid cycle.

  13. Radiolaria Divided into Polycystina and Spasmaria in Combined 18S and 28S rDNA Phylogeny

    PubMed Central

    Dolven, Jane K.; Ose, Randi F.; Klaveness, Dag; Kristensen, Tom; Bjørklund, Kjell R.; Shalchian-Tabrizi, Kamran

    2011-01-01

    Radiolarians are marine planktonic protists that belong to the eukaryote supergroup Rhizaria together with Foraminifera and Cercozoa. Radiolaria has traditionally been divided into four main groups based on morphological characters; i.e. Polycystina, Acantharia, Nassellaria and Phaeodaria. But recent 18S rDNA phylogenies have shown that Phaeodaria belongs within Cerocozoa, and that the previously heliozoan group Taxopodida should be included in Radiolaria. 18S rDNA phylogenies have not yet resolved the sister relationship between the main Radiolaria groups, but nevertheless suggests that Spumellaria, and thereby also Polycystina, are polyphyletic. Very few sequences other than 18S rDNA have so far been generated from radiolarian cells, mostly due to the fact that Radiolaria has been impossible to cultivate and single cell PCR has been hampered by low success rate. Here we have therefore investigated the mutual evolutionary relationship of the main radiolarian groups by using the novel approach of combining single cell whole genome amplification with targeted PCR amplification of the 18S and 28S rDNA genes. Combined 18S and 28S phylogeny of sequences obtained from single cells shows that Radiolaria is divided into two main lineages: Polycystina (Spumellaria+Nassellaria) and Spasmaria (Acantharia+Taxopodida). Further we show with high support that Foraminifera groups within Radiolaria supporting the Retaria hypothesis. PMID:21853146

  14. Radiolaria divided into Polycystina and Spasmaria in combined 18S and 28S rDNA phylogeny.

    PubMed

    Krabberød, Anders K; Bråte, Jon; Dolven, Jane K; Ose, Randi F; Klaveness, Dag; Kristensen, Tom; Bjørklund, Kjell R; Shalchian-Tabrizi, Kamran

    2011-01-01

    Radiolarians are marine planktonic protists that belong to the eukaryote supergroup Rhizaria together with Foraminifera and Cercozoa. Radiolaria has traditionally been divided into four main groups based on morphological characters; i.e. Polycystina, Acantharia, Nassellaria and Phaeodaria. But recent 18S rDNA phylogenies have shown that Phaeodaria belongs within Cerocozoa, and that the previously heliozoan group Taxopodida should be included in Radiolaria. 18S rDNA phylogenies have not yet resolved the sister relationship between the main Radiolaria groups, but nevertheless suggests that Spumellaria, and thereby also Polycystina, are polyphyletic. Very few sequences other than 18S rDNA have so far been generated from radiolarian cells, mostly due to the fact that Radiolaria has been impossible to cultivate and single cell PCR has been hampered by low success rate. Here we have therefore investigated the mutual evolutionary relationship of the main radiolarian groups by using the novel approach of combining single cell whole genome amplification with targeted PCR amplification of the 18S and 28S rDNA genes. Combined 18S and 28S phylogeny of sequences obtained from single cells shows that Radiolaria is divided into two main lineages: Polycystina (Spumellaria+Nassellaria) and Spasmaria (Acantharia+Taxopodida). Further we show with high support that Foraminifera groups within Radiolaria supporting the Retaria hypothesis.

  15. Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

    PubMed Central

    Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B

    1978-01-01

    A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

  16. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    NASA Technical Reports Server (NTRS)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  17. Karyotypic diversification in Mytilus mussels (Bivalvia: Mytilidae) inferred from chromosomal mapping of rRNA and histone gene clusters

    PubMed Central

    2014-01-01

    Background Mussels of the genus Mytilus present morphologically similar karyotypes that are presumably conserved. The absence of chromosome painting probes in bivalves makes difficult verifying this hypothesis. In this context, we comparatively mapped ribosomal RNA and histone gene families on the chromosomes of Mytilus edulis, M. galloprovincialis, M. trossulus and M. californianus by fluorescent in situ hybridization (FISH). Results Major rRNA, core and linker histone gene clusters mapped to different chromosome pairs in the four taxa. In contrast, minor rRNA gene clusters showed a different behavior. In all Mytilus two of the 5S rDNA clusters mapped to the same chromosome pair and one of them showed overlapping signals with those corresponding to one of the histone H1 gene clusters. The overlapping signals on mitotic chromosomes became a pattern of alternate 5S rRNA and linker histone gene signals on extended chromatin fibers. Additionally, M. trossulus showed minor and major rDNA clusters on the same chromosome pair. Conclusion The results obtained suggest that at least some of the chromosomes bearing these sequences are orthologous and that chromosomal mapping of rRNA and histone gene clusters could be a good tool to help deciphering some of the many unsolved questions in the systematic classification of Mytilidae. PMID:25023072

  18. Abundant 5S rRNA-like transcripts encoded by the mitochondrial genome in amoebozoa.

    PubMed

    Bullerwell, Charles E; Burger, Gertraud; Gott, Jonatha M; Kourennaia, Olga; Schnare, Murray N; Gray, Michael W

    2010-05-01

    5S rRNAs are ubiquitous components of prokaryotic, chloroplast, and eukaryotic cytosolic ribosomes but are apparently absent from mitochondrial ribosomes (mitoribosomes) of many eukaryotic groups including animals and fungi. Nevertheless, a clearly identifiable, mitochondrion-encoded 5S rRNA is present in Acanthamoeba castellanii, a member of Amoebozoa. During a search for additional mitochondrial 5S rRNAs, we detected small abundant RNAs in other members of Amoebozoa, namely, in the lobose amoeba Hartmannella vermiformis and in the myxomycete slime mold Physarum polycephalum. These RNAs are encoded by mitochondrial DNA (mtDNA), cosediment with mitoribosomes in glycerol gradients, and can be folded into a secondary structure similar to that of bona fide 5S rRNAs. Further, in the mtDNA of another slime mold, Didymium nigripes, we identified a region that in sequence, potential secondary structure, and genomic location is similar to the corresponding region encoding the Physarum small RNA. A mtDNA-encoded small RNA previously identified in Dictyostelium discoideum is here shown to share several characteristics with known 5S rRNAs. Again, we detected genes encoding potential homologs of this RNA in the mtDNA of three other species of the genus Dictyostelium as well as in a related genus, Polysphondylium. Taken together, our results indicate a widespread occurrence of small, abundant, mtDNA-encoded RNAs with 5S rRNA-like structures that are associated with the mitoribosome in various amoebozoan taxa. Our working hypothesis is that these novel small abundant RNAs represent radically divergent mitochondrial 5S rRNA homologs. We posit that currently unrecognized 5S-like RNAs may exist in other mitochondrial systems in which a conventional 5S rRNA cannot be identified.

  19. Divergent histories of rDNA group I introns in the lichen family Physciaceae.

    PubMed

    Simon, Dawn; Moline, Jessica; Helms, Gert; Friedl, Thomas; Bhattacharya, Debashish

    2005-04-01

    The wide but sporadic distribution of group I introns in protists, plants, and fungi, as well as in eubacteria, likely resulted from extensive lateral transfer followed by differential loss. The extent of horizontal transfer of group I introns can potentially be determined by examining closely related species or genera. We used a phylogenetic approach with a large data set (including 62 novel large subunit [LSU] rRNA group I introns) to study intron movement within the monophyletic lichen family Physciaceae. Our results show five cases of horizontal transfer into homologous sites between species but do not support transposition into ectopic sites. This is in contrast to previous work with Physciaceae small subunit (SSU) rDNA group I introns where strong support was found for multiple ectopic transpositions. This difference in the apparent number of ectopic intron movements between SSU and LSU rDNA genes may in part be explained by a larger number of positions in the SSU rRNA, which can support the insertion and/or retention of group I introns. In contrast, we suggest that the LSU rRNA may have fewer acceptable positions and therefore intron spread is limited in this gene.

  20. Increased 5S rRNA oxidation in Alzheimer's disease.

    PubMed

    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R

    2012-01-01

    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  1. Phylogenetic analyses of four species of Ulva and Monostroma grevillei using ITS, rbc L and 18S rDNA sequence data

    NASA Astrophysics Data System (ADS)

    Lin, Zhongheng; Shen, Songdong; Chen, Weizhou; Li, Huihui

    2013-01-01

    Chlorophyta species are common in the southern and northern coastal areas of China. In recent years, frequent green tide incidents in Chinese coastal waters have raised concerns and attracted the attention of scientists. In this paper, we sequenced the 18S rDNA genes, the internal transcribed spacer (ITS) regions and the rbc L genes in seven organisms and obtained 536-566 bp long ITS sequences, 1 377-1 407 bp long rbc L sequences and 1 718-1 761 bp long partial 18S rDNA sequences. The GC base pair content was highest in the ITS regions and lowest in the rbc L genes. The sequencing results showed that the three Ulva prolifera (or U. pertusa) gene sequences from Qingdao and Nan'ao Island were identical. The ITS, 18S rDNA and rbc L genes in U. prolifera and U. pertusa from different sea areas in China were unchanged by geographic distance. U. flexuosa had the least evolutionary distance from U. californica in both the ITS regions (0.009) and the 18S rDNA (0.002). These data verified that Ulva and Enteromorpha are not separate genera.

  2. Fragile Sites of ‘Valencia’ Sweet Orange (Citrus sinensis) Chromosomes Are Related with Active 45s rDNA

    PubMed Central

    Lan, Hong; Chen, Chun-Li; Miao, Yin; Yu, Chang-Xiu; Guo, Wen-Wu; Xu, Qiang; Deng, Xiu-Xin

    2016-01-01

    Citrus sinensis chromosomes present a morphological differentiation of bands after staining by the fluorochromes CMA and DAPI, but there is still little information on its chromosomal characteristics. In this study, the chromosomes in ‘Valencia’ C. sinensis were analyzed by fluorescence in situ hybridization (FISH) using telomere DNA and the 45S rDNA gene as probes combining CMA/DAPI staining, which showed that there were two fragile sites in sweet orange chromosomes co-localizing at distended 45S rDNA regions, one proximally locating on B-type chromosome and the other subterminally locating on D-type chromosome. While the chromosomal CMA banding and 45S rDNA FISH mapping in the doubled haploid line of ‘Valencia’ C. sinensis indicated six 45S rDNA regions, four were identified as fragile sites as doubled comparing its parental line, which confirmed the cytological heterozygosity and chromosomal heteromorphisms in sweet orange. Furthermore, Ag-NOR identified two distended 45S rDNA regions to be active nucleolar organizing regions (NORs) in diploid ‘Valencia’ C. sinensis. The occurrence of quadrivalent in meiosis of pollen mother cells (PMCs) in ‘Valencia’ sweet orange further confirmed it was a chromosomal reciprocal translocation line. We speculated this chromosome translocation was probably related to fragile sites. Our data provide insights into the chromosomal characteristics of the fragile sites in ‘Valencia’ sweet orange and are expected to facilitate the further investigation of the possible functions of fragile sites. PMID:26977938

  3. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules

    PubMed Central

    Valach, Matus; Burger, Gertraud; Gray, Michael W.; Lang, B. Franz

    2014-01-01

    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator. PMID:25429974

  4. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules.

    PubMed

    Valach, Matus; Burger, Gertraud; Gray, Michael W; Lang, B Franz

    2014-12-16

    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator.

  5. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  6. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces.

  7. S6 Kinase is essential for MYC-dependent rDNA transcription in Drosophila.

    PubMed

    Mitchell, Naomi C; Tchoubrieva, Elissaveta B; Chahal, Arjun; Woods, Simone; Lee, Amanda; Lin, Jane I; Parsons, Linda; Jastrzebski, Katarzyna; Poortinga, Gretchen; Hannan, Katherine M; Pearson, Richard B; Hannan, Ross D; Quinn, Leonie M

    2015-10-01

    Increased rates of ribosome biogenesis and biomass accumulation are fundamental properties of rapidly growing and dividing malignant cells. The MYC oncoprotein drives growth predominantly via its ability to upregulate the ribosome biogenesis program, in particular stimulating the activity of the RNA Polymerase I (Pol I) machinery to increase ribosomal RNA (rRNA) transcription. Although MYC function is known to be highly dependent on the cellular signalling context, the pathways interacting with MYC to regulate transcription of ribosomal genes (rDNA) in vivo in response to growth factor status, nutrient availability and cellular stress are only beginning to be understood. To determine factors critical to MYC-dependent stimulation of rDNA transcription in vivo, we performed a transient expression screen for known oncogenic signalling pathways in Drosophila. Strikingly, from the broad range of pathways tested, we found that ribosomal protein S6 Kinase (S6K) activity, downstream of the TOR pathway, was the only factor rate-limiting for the rapid induction of rDNA transcription due to transiently increased MYC. Further, we demonstrated that one of the mechanism(s) by which MYC and S6K cooperate is through coordinate activation of the essential Pol I transcription initiation factor TIF-1A (RRN 3). As Pol I targeted therapy is now in phase 1 clinical trials in patients with haematological malignancies, including those driven by MYC, these data suggest that therapies dually targeting Pol I transcription and S6K activity may be effective in treating MYC-driven tumours.

  8. S6 Kinase is essential for MYC-dependent rDNA transcription in Drosophila.

    PubMed

    Mitchell, Naomi C; Tchoubrieva, Elissaveta B; Chahal, Arjun; Woods, Simone; Lee, Amanda; Lin, Jane I; Parsons, Linda; Jastrzebski, Katarzyna; Poortinga, Gretchen; Hannan, Katherine M; Pearson, Richard B; Hannan, Ross D; Quinn, Leonie M

    2015-10-01

    Increased rates of ribosome biogenesis and biomass accumulation are fundamental properties of rapidly growing and dividing malignant cells. The MYC oncoprotein drives growth predominantly via its ability to upregulate the ribosome biogenesis program, in particular stimulating the activity of the RNA Polymerase I (Pol I) machinery to increase ribosomal RNA (rRNA) transcription. Although MYC function is known to be highly dependent on the cellular signalling context, the pathways interacting with MYC to regulate transcription of ribosomal genes (rDNA) in vivo in response to growth factor status, nutrient availability and cellular stress are only beginning to be understood. To determine factors critical to MYC-dependent stimulation of rDNA transcription in vivo, we performed a transient expression screen for known oncogenic signalling pathways in Drosophila. Strikingly, from the broad range of pathways tested, we found that ribosomal protein S6 Kinase (S6K) activity, downstream of the TOR pathway, was the only factor rate-limiting for the rapid induction of rDNA transcription due to transiently increased MYC. Further, we demonstrated that one of the mechanism(s) by which MYC and S6K cooperate is through coordinate activation of the essential Pol I transcription initiation factor TIF-1A (RRN 3). As Pol I targeted therapy is now in phase 1 clinical trials in patients with haematological malignancies, including those driven by MYC, these data suggest that therapies dually targeting Pol I transcription and S6K activity may be effective in treating MYC-driven tumours. PMID:26215099

  9. Measuring rDNA diversity in eukaryotic microbial systems: how intragenomic variation, pseudogenes, and PCR artifacts confound biodiversity estimates.

    PubMed

    Thornhill, Daniel J; Lajeunesse, Todd C; Santos, Scott R

    2007-12-01

    Molecular approaches have revolutionized our ability to study the ecology and evolution of micro-organisms. Among the most widely used genetic markers for these studies are genes and spacers of the rDNA operon. However, the presence of intragenomic rDNA variation, especially among eukaryotes, can potentially confound estimates of microbial diversity. To test this hypothesis, bacterially cloned PCR products of the internal transcribed spacer (ITS) region from clonal isolates of Symbiodinium, a large genus of dinoflagellates that live in symbiosis with many marine protists and invertebrate metazoa, were sequenced and analysed. We found widely differing levels of intragenomic sequence variation and divergence in representatives of Symbiodinium clades A to E, with only a small number of variants attributed to Taq polymerase/bacterial cloning error or PCR chimeras. Analyses of 5.8S-rDNA and ITS2 secondary structure revealed that some variants possessed base substitutions and/or indels that destabilized the folded form of these molecules; given the vital nature of secondary structure to the function of these molecules, these likely represent pseudogenes. When similar controls were applied to bacterially cloned ITS sequences from a recent survey of Symbiodinium diversity in Hawaiian Porites spp., most variants (approximately 87.5%) possessed unstable secondary structures, had unprecedented mutations, and/or were PCR chimeras. Thus, data obtained from sequencing of bacterially cloned rDNA genes can substantially exaggerate the level of eukaryotic microbial diversity inferred from natural samples if appropriate controls are not applied. These considerations must be taken into account when interpreting sequence data generated by bacterial cloning of multicopy genes such as rDNA.

  10. Biological significance of 5S rRNA import into human mitochondria: role of ribosomal protein MRP-L18.

    PubMed

    Smirnov, Alexandre; Entelis, Nina; Martin, Robert P; Tarassov, Ivan

    2011-06-15

    5S rRNA is an essential component of ribosomes of all living organisms, the only known exceptions being mitochondrial ribosomes of fungi, animals, and some protists. An intriguing situation distinguishes mammalian cells: Although the mitochondrial genome contains no 5S rRNA genes, abundant import of the nuclear DNA-encoded 5S rRNA into mitochondria was reported. Neither the detailed mechanism of this pathway nor its rationale was clarified to date. In this study, we describe an elegant molecular conveyor composed of a previously identified human 5S rRNA import factor, rhodanese, and mitochondrial ribosomal protein L18, thanks to which 5S rRNA molecules can be specifically withdrawn from the cytosolic pool and redirected to mitochondria, bypassing the classic nucleolar reimport pathway. Inside mitochondria, the cytosolic 5S rRNA is shown to be associated with mitochondrial ribosomes.

  11. Randomly detected genetically modified (GM) maize (Zea mays L.) near a transport route revealed a fragile 45S rDNA phenotype.

    PubMed

    Waminal, Nomar Espinosa; Ryu, Ki Hyun; Choi, Sun-Hee; Kim, Hyun Hee

    2013-01-01

    Monitoring of genetically modified (GM) crops has been emphasized to prevent their potential effects on the environment and human health. Monitoring of the inadvertent dispersal of transgenic maize in several fields and transport routes in Korea was carried out by qualitative multiplex PCR, and molecular analyses were conducted to identify the events of the collected GM maize. Cytogenetic investigations through fluorescence in situ hybridization (FISH) of the GM maize were performed to check for possible changes in the 45S rDNA cluster because this cluster was reported to be sensitive to replication and transcription stress. Three GM maize kernels were collected from a transport route near Incheon port, Korea, and each was found to contain NK603, stacked MON863 x NK603, and stacked NK603 x MON810 inserts, respectively. Cytogenetic analysis of the GM maize containing the stacked NK603 x MON810 insert revealed two normal compact 5S rDNA signals, but the 45S rDNA showed a fragile phenotype, demonstrating a "beads-on-a-string" fragmentation pattern, which seems to be a consequence of genetic modification. Implications of the 45S rDNA cluster fragility in GM maize are also discussed.

  12. Randomly Detected Genetically Modified (GM) Maize (Zea mays L.) near a Transport Route Revealed a Fragile 45S rDNA Phenotype

    PubMed Central

    Waminal, Nomar Espinosa; Ryu, Ki Hyun; Choi, Sun-Hee; Kim, Hyun Hee

    2013-01-01

    Monitoring of genetically modified (GM) crops has been emphasized to prevent their potential effects on the environment and human health. Monitoring of the inadvertent dispersal of transgenic maize in several fields and transport routes in Korea was carried out by qualitative multiplex PCR, and molecular analyses were conducted to identify the events of the collected GM maize. Cytogenetic investigations through fluorescence in situ hybridization (FISH) of the GM maize were performed to check for possible changes in the 45S rDNA cluster because this cluster was reported to be sensitive to replication and transcription stress. Three GM maize kernels were collected from a transport route near Incheon port, Korea, and each was found to contain NK603, stacked MON863 x NK603, and stacked NK603 x MON810 inserts, respectively. Cytogenetic analysis of the GM maize containing the stacked NK603 x MON810 insert revealed two normal compact 5S rDNA signals, but the 45S rDNA showed a fragile phenotype, demonstrating a “beads-on-a-string” fragmentation pattern, which seems to be a consequence of genetic modification. Implications of the 45S rDNA cluster fragility in GM maize are also discussed. PMID:24040165

  13. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    NASA Technical Reports Server (NTRS)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  14. Authentication of Curcuma species (Zingiberaceae) based on nuclear 18S rDNA and plastid trnK sequences.

    PubMed

    Cao, Hui; Sasaki, Yohei; Fushimi, Hirotoshi; Komatsu, Katsuko

    2010-07-01

    Curcuma drugs have been used discriminatingly for invigorating blood circulation, promoting digestion, and as a cholagogic in China. However, there is confusion about the drug's botanical origins and clinical uses because of morphological similarity of Curcuma plants and drugs. Comparative sequencing of the 18S rRNA gene in nuclear ribosomal DNA (rDNA) and trnK gene in chloroplast DNA (cpDNA) was carried out in order to examine interspecies phylogeny and to identify ultimately Curcuma species. A total of a hundred of accessions of eighteen species were analyzed. This resulted in an aligned matrix of 1810 bp for 18S rDNA and 2 800 bp for trnK. 18S rDNA sequence divergence within the ingroup ranged from 0-0.05%, trnK ranged from 0-0.19%. One base transversion-substituted site (from cytosine to thymine) was observed from the upstream of 18S rDNA at nucleotide position 234 in C. kwangsiensis and Japanese population of C. zedoaria which have separated genetic distance to other Curcuma taxa. Two noncoding regions embedded in trnK intron showed higher variability, including nucleotide substitutions, repeat insertion and deletions. Based on consensus of relationship, eighteen major lineages within Curcuma are recognized at the species level. The results suggest that Curcuma is monophyletic with 100% bootstrap support and sister to the genera Hedychium and Zingiber. The trnK sequences showed considerable variations between Curcuma species and thus were revealed as a promising candidate for barcoding of Curcuma species, which provide valuable characters for inferring relationship within species but are insufficient to resolve relationships among closely related taxa.

  15. Saturation Mutagenesis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Smith, Maria W.; Meskauskas, Arturas; Wang, Pinger; Sergiev, Petr V.; Dinman, Jonathan D.

    2001-01-01

    rRNAs are the central players in the reactions catalyzed by ribosomes, and the individual rRNAs are actively involved in different ribosome functions. Our previous demonstration that yeast 5S rRNA mutants (called mof9) can impact translational reading frame maintenance showed an unexpected function for this ubiquitous biomolecule. At the time, however, the highly repetitive nature of the genes encoding rRNAs precluded more detailed genetic and molecular analyses. A new genetic system allows all 5S rRNAs in the cell to be transcribed from a small, easily manipulated plasmid. The system is also amenable for the study of the other rRNAs, and provides an ideal genetic platform for detailed structural and functional studies. Saturation mutagenesis reveals regions of 5S rRNA that are required for cell viability, translational accuracy, and virus propagation. Unexpectedly, very few lethal alleles were identified, demonstrating the resilience of this molecule. Superimposition of genetic phenotypes on a physical map of 5S rRNA reveals the existence of phenotypic clusters of mutants, suggesting that specific regions of 5S rRNA are important for specific functions. Mapping these mutants onto the Haloarcula marismortui large subunit reveals that these clusters occur at important points of physical interaction between 5S rRNA and the different functional centers of the ribosome. Our analyses lead us to propose that one of the major functions of 5S rRNA may be to enhance translational fidelity by acting as a physical transducer of information between all of the different functional centers of the ribosome. PMID:11713264

  16. High-Resolution Infrared Spectroscopy of Carbon-Sulfur Chains: II. C_5S and SC_5S

    NASA Astrophysics Data System (ADS)

    Thorwirth, Sven; Salomon, Thomas; Dudek, John B.

    2016-06-01

    Unbiased high-resolution infrared survey scans of the ablation products from carbon-sulfur targets in the 2100 to 2150 cm-1 regime reveal two bands previously not observed in the gas phase. On the basis of comparison against laboratory matrix-isolation work and new high-level quantum-chemical calculations these bands are attributed to the linear C_5S and SC_5S clusters. While polar C_5S was studied earlier using Fourier-transform microwave techniques, the present work marks the first gas-phase spectroscopic detection of SC_5S. H. Wang, J. Szczepanski, P. Brucat, and M. Vala 2005, Int. J. Quant. Chem. 102, 795 Y. Kasai, K. Obi, Y. Ohshima, Y. Hirahara, Y. Endo, K. Kawaguchi, and A. Murakami 1993, ApJ 410, L45 V. D. Gordon, M. C. McCarthy, A. J. Apponi, and P. Thaddeus 2001, ApJS 134, 311

  17. Enterococcus faecium PBP5-S/R, the missing link between PBP5-S and PBP5-R.

    PubMed

    Pietta, Ester; Montealegre, Maria Camila; Roh, Jung Hyeob; Cocconcelli, Pier Sandro; Murray, Barbara E

    2014-11-01

    During a study to investigate the evolution of ampicillin resistance in Enterococcus faecium, we observed that a number of E. faecium strains, mainly from the recently described subclade A2, showed PBP5 sequences in between PBP5-S and PBP5-R. These hybrid PBP5-S/R patterns reveal a progression of amino acid changes from the S form to the R form of this protein; however, these changes do not strictly correlate with changes in ampicillin MICs.

  18. Secondray structure and sequence of ITS2-rDNA of the Egyptian malaria vector Anopheles pharoensis (Theobald).

    PubMed

    Wassim, Nahla M

    2014-04-01

    Out of the twelve Anophelines present in Egypt, only five species known to be malaria vectors. Anopheles (An.) pharoensis proved to be the important vector all over Egypt, especially in the Delta. Anopheles sergenti proved to be the primary vector in the Oases of the Western Desert, An. multicolor in Faiyoum, An. stephensi in the Red Sea Coast, and An. superpictus in Sinai. Genomic DNA was isolated from single adult mosquito of An. pharoensis (Sahel Sudanese form), PCR was performed to amplify ITS2 region of rDNA using specific primers for 5.8S and 28S rDNA genes. The amplicons were purified, directly sequenced and aligned to the sequence of the same region of An. gambiae, using clustalw2. The length of ITS2-rDNA of An. pharoensis was 411bp. The GC content of the ITS2 reported 53% is consistent with spacer base composition in Anopheles species. The similarity between the two species was 52% and genetic distance was 0.46.Variable simple sequence repeats (SSRs) are found at low frequency. The secondary structure of rDNA-ITS2was predicted by MFOLD and was -192; 60 to-195.32 kilocalories/mole.

  19. Secondray structure and sequence of ITS2-rDNA of the Egyptian malaria vector Anopheles pharoensis (Theobald).

    PubMed

    Wassim, Nahla M

    2014-04-01

    Out of the twelve Anophelines present in Egypt, only five species known to be malaria vectors. Anopheles (An.) pharoensis proved to be the important vector all over Egypt, especially in the Delta. Anopheles sergenti proved to be the primary vector in the Oases of the Western Desert, An. multicolor in Faiyoum, An. stephensi in the Red Sea Coast, and An. superpictus in Sinai. Genomic DNA was isolated from single adult mosquito of An. pharoensis (Sahel Sudanese form), PCR was performed to amplify ITS2 region of rDNA using specific primers for 5.8S and 28S rDNA genes. The amplicons were purified, directly sequenced and aligned to the sequence of the same region of An. gambiae, using clustalw2. The length of ITS2-rDNA of An. pharoensis was 411bp. The GC content of the ITS2 reported 53% is consistent with spacer base composition in Anopheles species. The similarity between the two species was 52% and genetic distance was 0.46.Variable simple sequence repeats (SSRs) are found at low frequency. The secondary structure of rDNA-ITS2was predicted by MFOLD and was -192; 60 to-195.32 kilocalories/mole. PMID:24961025

  20. 18S rDNA dataset profiling microeukaryotic populations within Chicago area nearshore waters.

    PubMed

    Searle, Daniel; Sible, Emily; Cooper, Alexandria; Putonti, Catherine

    2016-03-01

    Despite their critical role in the aquatic food web and nutrient cycling, microeukaryotes within freshwater environments are under-studied. Herein we present the first high-throughput molecular survey of microeukaryotes within Lake Michigan. Every two weeks from May 13 to August 5, 2014, we collected surface water samples from the nearshore waters of four Chicago area beaches: Gillson Park, Montrose Beach, 57th Street Beach, and Calumet Beach. Four biological replicates were collected for each sampling date and location, resulting in 112 samples. Eighty-nine of these samples were surveyed through targeted sequencing of the V7 and V8 regions of the 18S rDNA gene. Both technical and biological replicates were sequenced and are included in this dataset. Raw sequence data is available via NCBI's SRA database (BioProject PRJNA294919). PMID:26904716

  1. 18S rDNA dataset profiling microeukaryotic populations within Chicago area nearshore waters.

    PubMed

    Searle, Daniel; Sible, Emily; Cooper, Alexandria; Putonti, Catherine

    2016-03-01

    Despite their critical role in the aquatic food web and nutrient cycling, microeukaryotes within freshwater environments are under-studied. Herein we present the first high-throughput molecular survey of microeukaryotes within Lake Michigan. Every two weeks from May 13 to August 5, 2014, we collected surface water samples from the nearshore waters of four Chicago area beaches: Gillson Park, Montrose Beach, 57th Street Beach, and Calumet Beach. Four biological replicates were collected for each sampling date and location, resulting in 112 samples. Eighty-nine of these samples were surveyed through targeted sequencing of the V7 and V8 regions of the 18S rDNA gene. Both technical and biological replicates were sequenced and are included in this dataset. Raw sequence data is available via NCBI's SRA database (BioProject PRJNA294919).

  2. E1BF/Ku interacts physically and functionally with the core promoter binding factor CPBF and promotes the basal transcription of rat and human ribosomal RNA genes.

    PubMed

    Niu, H; Zhang, J; Jacob, S T

    1995-01-01

    We have previously characterized an RNA polymerase (pol) I transcription factor, E1BF, from rat cells. This protein is immunologically related to Ku autoantigen and is required in pol-I directed transcription of rodent ribosomal RNA gene (rDNA). Glycerol density gradient fractionation and in situ UV cross-linking analysis of the purified factor showed directly that it consists of a heterodimer of 85 and 72 kDa polypeptides. E1BF also interacted with the human core promoter and augmented transcription of human rDNA as much as fivefold in HeLa nuclear extract, whereas transcription from adenovirus major late promoter, CMV or SV40 early promoters by pol II and of U6 and 5S RNA genes by pol III were either unaffected or minimally inhibited by the antibodies. Purified rat E1BF partially restored the suppression of human rDNA transcription by anti-Ku antibodies. Immunoprecipitation of rat cell extract with the anti-Ku antibodies followed by SDS-PAGE of the precipitated proteins and Southwestern analysis showed that E1BF interacts with CPBF, a core promoter binding factor. When the majority of CPBF and E1BF was removed from the reaction mixture by preincubation with a core promoter oligo nucleotide fragment, rDNA transcription was severely impaired. Addition of exogenous CPBF or E1BF to such a reaction resulted in significant restoration of the transcription, whereas inclusion of both factors caused further enhancement of rDNA transcription. These data demonstrate that E1BF is a basal pol I transcription factor that interacts with a core promoter binding factor both physically and functionally, and that is not a general pol II or pol III transcription factor.

  3. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  4. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  5. Altered gravity influences rDNA and NopA100 localization in nucleoli

    NASA Astrophysics Data System (ADS)

    Sobol, M. A.; Kordyum, E. L.

    Fundamental discovery of gravisensitivity of cells no specified to gravity perception focused increasing attention on an elucidation of the mechanisms involved in altered gravity effects at the cellular and subcellular levels. The nucleolus is the transcription site of rRNA genes as well as the site of processing and initial packaging of their transcripts with ribosomal and nonribosomal proteins. The mechanisms inducing the changes in the subcomponents of the nucleolus that is morphologically defined yet highly dynamic structure are still unknown in detail. To understand the functional organization of the nucleolus as in the control as under altered gravity conditions it is essential to determine both the precise location of rDNA and the proteins playing the key role in rRNA processing. Lepidium sativum seeds were germinated in 1% agar medium on the slow horizontal clinostat (2 rpm) and in the stationary conditions. We investigated the root meristematic cells dissected from the seedlings grown in darkness for two days. The investigations were carried out with anti-DNA and anti-NopA100 antibodies labeling as well as with TdT procedure, and immunogold electron microscopy. In the stationary growth conditions, the anti-DNA antibody as well TdT procedure were capable of detecting fibrillar centers (FCs) and the dense fibrillar component (DFC) in the nucleolus. In FCs, gold particles were revealed on the condensed chromatin inclusions, internal fibrils of decondensed rDNA and the transition zone FC-DFC. Quantitatively, FCs appeared 1,5 times more densely labeled than DFC. NopA100 was localized in FCs and in DFC. In FCs, the most of protein was revealed in the transition zone FC-DFC. After a quantitative study, FCs and the transition zone FC-DFC appeared to contain NopA100 1,7 times more than DFC. Under the conditions of altered gravity, quantitative data clearly showed a redistribution of nucleolar DNA and NopA100 between FCs and DFC in comparison with the control. In

  6. L5-S1 Laparoscopic Anterior Interbody Fusion

    PubMed Central

    Zeni, Tallal M.; Phillips, Frank M.; Mathur, Sameer; Zografakis, John G.; Moore, Ronald M.; Laguna, Luis E.

    2006-01-01

    Objective: We evaluated our experience with laparoscopic L5-S1 anterior lumbar interbody fusion (ALIF). Methods: This represents a retrospective analysis of consecutive patients who underwent L5-S1 laparoscopic ALIF between February 1998 and August 2003. Results: Twenty-eight patients underwent L5-S1 LAIF (15 males and 13 females). The mean age was 43 years (range, 26 to 67). Mean operative time was 225 minutes (range, 137 to 309 minutes). No conversions to an open procedure were necessary. Twenty-four (85.7%) patients underwent successful bilateral cage placement. Four patients (14.3%) in whom only a single cage could be placed underwent supplementary posterior pedicle screw placement. Mean length of stay (LOS) was 4.1 days (range, 2 to 15). Two patients underwent reoperation subacutely secondary to symptomatic lateral displacement of the cage. One patient developed radiculopathy 6 months postoperatively and required reoperation. One patient developed a small bowel obstruction secondary to adhesions to the cage requiring laparoscopic reoperation. Fusion was achieved in all patients. Visual analogue scale scores for back pain were significantly improved from 8.6±0.8 to 2.8±0.8 (P<0.0001) at 1 year. Conclusion: L5-S1 LAIF is feasible and safe with all the advantages of minimally invasive surgery. Fusion rates and pain improvement were comparable to those with an open repair. PMID:17575763

  7. Analyzing Digital Library Initiatives: 5S Theory Perspective

    ERIC Educational Resources Information Center

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko

    2015-01-01

    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  8. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron.

    PubMed Central

    MacKay, R M; Salgado, D; Bonen, L; Stackebrandt, E; Doolittle, W F

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are (formula: see text), respectively. Specific phylogenetic relationships of P. denitrificans with purple non-sulphur bacteria, and of Prochloron with cyanobacteria are demonstrated, and unique features of potential secondary structure are described. PMID:7099971

  9. Transformation of tetrahymena thermophila with hypermethylated rRNA genes

    SciTech Connect

    Karrer, K.M.; Yao, M.C.

    1988-04-01

    The extrachromosomal rRNA genes (rDNA) of Tetrahymena thermophila contain 0.4% N/sup 6/-methyladenine. C3 strain rDNA was isolated, hypermethylated in vitro, and microinjected into B strain host cells. Clonal cell lines were established, and transformants were selected on the basis of resistance to paromomycin, conferred by the injected rDNA. The effects of methylation by three enzymes which methylate the sequence 5'-NAT-3'', the dam, EcoRI, and ClaI methylases, were tested. Hypermethylation of the injected rDNA had no effect on transformation efficiency relative to mock-methylated controls. The injected C3 strain rDNA efficiently replaced host rDNA as the major constituent of the population of rDNA molecules. Hypermethylation of the injected DNA was not maintained through 20 to 25 cell generations.

  10. Molecular characterization and phylogeny of whipworm nematodes inferred from DNA sequences of cox1 mtDNA and 18S rDNA.

    PubMed

    Callejón, Rocío; Nadler, Steven; De Rojas, Manuel; Zurita, Antonio; Petrášová, Jana; Cutillas, Cristina

    2013-11-01

    A molecular phylogenetic hypothesis is presented for the genus Trichuris based on sequence data from the mitochondrial cytochrome c oxidase 1 (cox1) and ribosomal 18S genes. The taxa consisted of different described species and several host-associated isolates (undescribed taxa) of Trichuris collected from hosts from Spain. Sequence data from mitochondrial cox1 (partial gene) and nuclear 18S near-complete gene were analyzed by maximum likelihood and Bayesian inference methods, as separate and combined datasets, to evaluate phylogenetic relationships among taxa. Phylogenetic results based on 18S ribosomal DNA (rDNA) were robust for relationships among species; cox1 sequences delimited species and revealed phylogeographic variation, but most relationships among Trichuris species were poorly resolved by mitochondrial sequences. The phylogenetic hypotheses for both genes strongly supported monophyly of Trichuris, and distinct genetic lineages corresponding to described species or nematodes associated with certain hosts were recognized based on cox1 sequences. Phylogenetic reconstructions based on concatenated sequences of the two loci, cox1 (mitochondrial DNA (mtDNA)) and 18S rDNA, were congruent with the overall topology inferred from 18S and previously published results based on internal transcribed spacer sequences. Our results demonstrate that the 18S rDNA and cox1 mtDNA genes provide resolution at different levels, but together resolve relationships among geographic populations and species in the genus Trichuris.

  11. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    PubMed

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment. PMID:22724546

  12. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    PubMed

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment.

  13. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

    2013-10-01

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status.

  14. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

    2013-10-01

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status. PMID:23933480

  15. PCR amplification of 16S rDNA from lyophilized cell cultures facilitates studies in molecular systematics

    NASA Technical Reports Server (NTRS)

    Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.

    1990-01-01

    The sequence of the major portion of a Bacillus cycloheptanicus strain SCH(T) 16S rRNA gene is reported. This sequence suggests that B. cycloheptanicus is genetically quite distinct from traditional Bacillus strains (e.g., B. subtilis) and may be properly regarded as belonging to a different genus. The sequence was determined from DNA that was produced by direct amplification of ribosomal DNA from a lyophilized cell pellet with straightforward polymerase chain reaction (PCR) procedures. By obviating the need to revive cell cultures from the lyophile pellet, this approach facilitates rapid 16S rDNA sequencing and thereby advances studies in molecular systematics.

  16. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro.

    PubMed

    Sharwood, Robert E; Hotto, Amber M; Bollenbach, Thomas J; Stern, David B

    2011-02-01

    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3'-to-5' exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNA(Arg), raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S-AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1.

  17. Physical studies of 5S RNA variants at position 66.

    PubMed Central

    Zhang, P; Popieniek, P; Moore, P B

    1989-01-01

    Two variants of the 5S RNA of E. coli have been examined by imino proton NMR spectroscopy, one of them a deletion of A66 (Christiansen, J., Douthwaite, S.R., Christensen, A. and Garrett, R.A. (1985) EMBO J. 4, 1019-1024) and the other a replacement of A66 with a C (Goringer, H.U. and Wagner, R. (1986) Biol. Chem. Hoppe-Seyler 367, 769-780). Both are of interest because the role the bulged A in helix II of 5S RNA is supposed to play in interactions with ribosomal protein L18. The data show that the structural perturbations that result from these mutations are minimal, and assign the resonances of some of the imino protons around position 66. Some mutations at or near position 66 greatly reduce the L18-dependent increase in the circular dichroism of 5S RNA at 267 nm first observed by Bear and coworkers (Bear, D.G., Schleich, T., Noller, H.F. and Garrett, R.A. (1977) Nucl. Acids Res. 4, 2511-2526). PMID:2479908

  18. Male meiosis, heterochromatin characterization and chromosomal location of rDNA in Microtomus lunifer (Berg, 1900) (Hemiptera: Reduviidae: Hammacerinae)

    PubMed Central

    Poggio, María Georgina; Bressa, María José; Papeschi, Alba Graciela

    2011-01-01

    Abstract In the present work, we analysed the male meiosis, the content and distribution of heterochromatin and the number and location of nucleolus organizing regions in Microtomus lunifer (Berg, 1900) by means of standard technique, C- and fluorescent bandings, and fluorescent in situ hybridization with an 18S rDNA probe. This species is the second one cytogenetically analysed within the Hammacerinae. Its male diploid chromosome number is 31 (2n=28+X1X2Y), including a minute pair of m-chromosomes. The diploid autosomal number and the presence of m-chromosomes are similar to those reported in Microtomus conspicillaris (Drury, 1782) (2n=28+XY). However, Microtomus lunifer has a multiple sex chromosome system X1X2Y (male) that could have originated by fragmentation of the ancestral X chromosome. Taking into account that Microtomus conspicillaris and Microtomus lunifer are the only two species within Reduviidae that possess m-chromosomes, the presence of this pair could be a synapomorphy for the species of this genus. C- and fluorescent bandings showed that the amount of heterochromatin in Microtomus lunifer was small, and only a small CMA3 bright band was observed in the largest autosomal pair at one terminal region. FISH with the 18S rDNA probe demonstrated that ribosomal genes were terminally placed on the largest autosomal pair. Our present results led us to propose that the location of rDNA genes could be associated with variants of the sex chromosome systems in relation with a kind of the sex chromosome systems within this family. Furthermore, the terminal location of NOR in the largest autosomal pair allowed us to use it as a chromosome marker and, thus, to infer that the kinetic activity of both ends is not a random process, and there is an inversion of this activity. PMID:24260616

  19. Links between nucleolar activity, rDNA stability, aneuploidy and chronological aging in the yeast Saccharomyces cerevisiae.

    PubMed

    Lewinska, Anna; Miedziak, Beata; Kulak, Klaudia; Molon, Mateusz; Wnuk, Maciej

    2014-06-01

    The nucleolus is speculated to be a regulator of cellular senescence in numerous biological systems (Guarente, Genes Dev 11(19):2449-2455, 1997; Johnson et al., Curr Opin Cell Biol 10(3):332-338, 1998). In the budding yeast Saccharomyces cerevisiae, alterations in nucleolar architecture, the redistribution of nucleolar protein and the accumulation of extrachromosomal ribosomal DNA circles (ERCs) during replicative aging have been reported. However, little is known regarding rDNA stability and changes in nucleolar activity during chronological aging (CA), which is another yeast aging model used. In the present study, the impact of aberrant cell cycle checkpoint control (knock-out of BUB1, BUB2, MAD1 and TEL1 genes in haploid and diploid hemizygous states) on CA-mediated changes in the nucleolus was studied. Nucleolus fragmentation, changes in the nucleolus size and the nucleolus/nucleus ratio, ERC accumulation, expression pattern changes and the relocation of protein involved in transcriptional silencing during CA were revealed. All strains examined were affected by oxidative stress, aneuploidy (numerical rather than structural aberrations) and DNA damage. However, the bub1 cells were the most prone to aneuploidy events, which may contribute to observed decrease in chronological lifespan. We postulate that chronological aging may be affected by redox imbalance-mediated chromosome XII instability leading to both rDNA instability and whole chromosome aneuploidy. CA-mediated nucleolus fragmentation may be a consequence of nucleolus enlargement and/or Nop2p upregulation. Moreover, the rDNA content of chronologically aging cells may be a factor determining the subsequent replicative lifespan. Taken together, we demonstrated that the nucleolus state is also affected during CA in yeast.

  20. Cytogenetic analysis and chromosomal characteristics of the polymorphic 18S rDNA of Haliotis discus hannai from Fujian, China.

    PubMed

    Wang, Haishan; Luo, Xuan; You, Weiwei; Dong, Yunwei; Ke, Caihuan

    2015-01-01

    We report on novel chromosomal characteristics of Haliotis discus hannai from a breeding population at Fujian, China. The karyotypes of H. discus hannai we obtained from an abalone farm include a common type 2n = 36 = 10M + 8SM (82%) and two rare types 2n = 36 = 11M + 7SM (14%) and 2n = 36 = 10M + 7SM + 1ST (4%). The results of silver staining showed that the NORs of H. discus hannai were usually located terminally on the long arms of chromosome pairs 14 and 17, NORs were also sometimes located terminally on the short arms of other chromosomes, either metacentric or submetacentric pairs. The number of Ag-nucleoli ranged from 2 to 8, and the mean number was 3.61 ± 0.93. Among the scored interphase cells, 41% had 3 detectable nucleoli and 37% had 4 nucleoli. The 18S rDNA FISH result is the first report of the location of 18S rDNA genes in H. discus hannai. The 18S rDNA locations were highly polymorphic in this species. Copies of the gene were observed in the terminal of long or/and short arms of submetacentric or/and metacentric chromosomes. Using FISH with probe for vertebrate-like telomeric sequences (CCCTAA)3 displayed positive green FITC signals at telomere regions of all analyzed chromosome types. We found about 7% of chromosomes had breaks in prophase. A special form of nucleolus not previously described from H. discus hannai was observed in some interphase cells. It consists of many small silver-stained nucleoli gathered together to form a larger nucleolus and may correspond to prenucleolar bodies. PMID:25699679

  1. Cytogenetic analysis and chromosomal characteristics of the polymorphic 18S rDNA of Haliotis discus hannai from Fujian, China.

    PubMed

    Wang, Haishan; Luo, Xuan; You, Weiwei; Dong, Yunwei; Ke, Caihuan

    2015-01-01

    We report on novel chromosomal characteristics of Haliotis discus hannai from a breeding population at Fujian, China. The karyotypes of H. discus hannai we obtained from an abalone farm include a common type 2n = 36 = 10M + 8SM (82%) and two rare types 2n = 36 = 11M + 7SM (14%) and 2n = 36 = 10M + 7SM + 1ST (4%). The results of silver staining showed that the NORs of H. discus hannai were usually located terminally on the long arms of chromosome pairs 14 and 17, NORs were also sometimes located terminally on the short arms of other chromosomes, either metacentric or submetacentric pairs. The number of Ag-nucleoli ranged from 2 to 8, and the mean number was 3.61 ± 0.93. Among the scored interphase cells, 41% had 3 detectable nucleoli and 37% had 4 nucleoli. The 18S rDNA FISH result is the first report of the location of 18S rDNA genes in H. discus hannai. The 18S rDNA locations were highly polymorphic in this species. Copies of the gene were observed in the terminal of long or/and short arms of submetacentric or/and metacentric chromosomes. Using FISH with probe for vertebrate-like telomeric sequences (CCCTAA)3 displayed positive green FITC signals at telomere regions of all analyzed chromosome types. We found about 7% of chromosomes had breaks in prophase. A special form of nucleolus not previously described from H. discus hannai was observed in some interphase cells. It consists of many small silver-stained nucleoli gathered together to form a larger nucleolus and may correspond to prenucleolar bodies.

  2. 5S clavam biosynthesis is controlled by an atypical two-component regulatory system in Streptomyces clavuligerus.

    PubMed

    Kwong, Thomas; Zelyas, Nathan J; Cai, Hui; Tahlan, Kapil; Wong, Annie; Jensen, Susan E

    2012-09-01

    Streptomyces clavuligerus produces a collection of five clavam metabolites, including the clinically important β-lactamase inhibitor clavulanic acid, as well as four structurally related metabolites called 5S clavams. The paralogue gene cluster of S. clavuligerus is one of three clusters of genes for the production of these clavam metabolites. A region downstream of the cluster was analyzed, and snk, res1, and res2, encoding elements of an atypical two-component regulatory system, were located. Mutation of any one of the three genes had no effect on clavulanic acid production, but snk and res2 mutants produced no 5S clavams, whereas res1 mutants overproduced 5S clavams. Reverse transcriptase PCR analyses showed that transcription of cvm7p (which encodes a transcriptional activator of 5S clavam biosynthesis) and 5S clavam biosynthetic genes was eliminated in snk and in res2 mutants but that snk and res2 transcription was unaffected in a cvm7p mutant. Both snk and res2 mutants could be complemented by introduction of cvm7p under the control of an independently regulated promoter. In vitro assays showed that Snk can autophosphorylate and transfer its phosphate group to both Res1 and Res2, and Snk-H365, Res1-D52, and Res2-D52 were identified as the phosphorylation sites for the system. Dephosphorylation assays indicated that Res1 stimulates dephosphorylation of Res2∼P. These results suggest a regulatory cascade in which Snk and Res2 form a two-component system controlling cvm7p transcription, with Res1 serving as a checkpoint to modulate phosphorylation levels. Cvm7P then activates transcription of 5S clavam biosynthetic genes.

  3. Comparison of ITS and 18S rDNA for estimating fungal diversity using PCR-DGGE.

    PubMed

    Liu, Jie; Yu, Yaoyao; Cai, Zhang; Bartlam, Mark; Wang, Yingying

    2015-09-01

    Both the internal transcribed spacer (ITS) region and 18S rRNA genes are broadly applied in molecular fingerprinting studies of fungi. However, the differences in those two ribosomal RNA regions are still largely unknown. In the current study, three sets of most suitable subunit ribosomes in ITS and 18S rRNA were compared using denaturing gradient gel electrophoresis (DGGE) under the optimum experimental conditions. Ten samples from both aquatic and soil environments were tested. The results revealed that the ITS region produced range-weighted richness in the range 36-361, which was significantly higher than that produced by 18S rDNA. There was a similar tendency in terms of the Shannon-Weaver diversity index and community dynamics in both water and soil samples. Samples from water and soil were better separated using ITS than 18S rDNA in principal component analysis of DGGE bands. Our study suggests that the ITS region is more precise and has more potential than 18S rRNA genes in fungal community analysis.

  4. Localized frustration and binding-induced conformational change in recognition of 5S RNA by TFIIIA zinc finger.

    PubMed

    Tan, Cheng; Li, Wenfei; Wang, Wei

    2013-12-19

    Protein TFIIIA is composed of nine tandemly arranged Cys2His2 zinc fingers. It can bind either to the 5S RNA gene as a transcription factor or to the 5S RNA transcript as a chaperone. Although structural and biochemical data provided valuable information on the recognition between the TFIIIIA and the 5S DNA/RNA, the involved conformational motions and energetic factors contributing to the binding affinity and specificity remain unclear. In this work, we conducted MD simulations and MM/GBSA calculations to investigate the binding-induced conformational changes in the recognition of the 5S RNA by the central three zinc fingers of TFIIIA and the energetic factors that influence the binding affinity and specificity at an atomistic level. Our results revealed drastic interdomain conformational changes between these three zinc fingers, involving the exposure/burial of several crucial DNA/RNA binding residues, which can be related to the competition between DNA and RNA for the binding of TFIIIA. We also showed that the specific recognition between finger 4/finger 6 and the 5S RNA introduces frustrations to the nonspecific interactions between finger 5 and the 5S RNA, which may be important to achieve optimal binding affinity and specificity.

  5. Analysis of Mammalian rDNA Internal Transcribed Spacers

    PubMed Central

    Coleman, Annette W.

    2013-01-01

    Nuclear rDNA Internal Transcribed Spacers, ITS1 and ITS2, are widely used for eukaryote phylogenetic studies from the ordinal level to the species level, and there is even a database for ITS2 sequences. However, ITS regions have been ignored in mammalian phylogenetic studies, and only a few rodent and ape sequences are represented in GenBank. The reasons for this dearth, and the remedies, are described here. We have recovered these sequences, mostly >1 kb in length, for 36 mammalian species. Sequence alignment and transcript folding comparisons reveal the rRNA transcript secondary structure. Mammalian ITS regions, though quite long, still fold into the recognizable secondary structure of other eukaryotes. The ITS2 in particular bears the four standard helix loops, and loops II and III have the hallmark characters universal to eukaryotes. Both sequence and insertions/deletions of transcript secondary structure helices observed here support the four superorder taxonomy of Placentalia. On the family level, major unique indels, neatly excising entire helices, will be useful when additional species are represented, resulting in significant further understanding of the details of mammalian evolutionary history. Furthermore, the identification of a highly conserved element of ITS1 common to warm-blooded vertebrates may aid in deciphering the complex mechanism of RNA transcript processing. This is the last major group of terrestrial vertebrates for which rRNA ITS secondary structure has been resolved. PMID:24260162

  6. (Cryptic) sex in the microsporidian Nosema granulosis--evidence from parasite rDNA and host mitochondrial DNA.

    PubMed

    Krebes, Lukas; Zeidler, Lisza; Frankowski, Jens; Bastrop, Ralf

    2014-01-01

    Microsporidia are single-celled, intracellular eukaryotes that parasitise a wide range of animals. The Nosema/Vairimorpha group includes some putative asexual species, and asexuality is proposed to have originated multiple times from sexual ancestors. Here, we studied the variation in the ribosomal DNA (rDNA) of 14 isolates of the presumed apomictic and vertically transmitted Nosema granulosis to evaluate its sexual status. The analysed DNA fragment contained a part of the small-subunit ribosomal gene (SSU) and the entire intergenic spacer (IGS). The mitochondrial cox1 gene of the host Gammarus duebeni (Crustacea) was analysed to temporally calibrate the system and to test the expectation of cophylogeny of host and parasite genealogies. Genetic variability of the SSU gene was very low within and between the isolates. In contrast, intraisolate (within a single host) variability of the IGS felt in two categories, because 12 isolates possess a very high IGS genetic diversity and two isolates were almost invariable in the IGS. This difference suggests variable models of rDNA evolution involving birth-and-death and unexpectedly concerted evolution. An alternative explanation could be a likewise unattended mixed infection of host individuals by more than one parasite strain. Despite considerable genetic divergence between associated host mitochondrial haplotypes, some N. granulosis 'IGS populations' seem not to belong to different gene pools; the relevant tests failed to show significant differences between populations. A set of recombinant IGS sequences made our data incompatible with the model of a solely maternally inherited, asexual species. In line with recent reports, our study supports the hypothesis that some assumed apomictic Microsporidia did not entirely abstain from the evolutionary advantages of sex. In addition, the presented data indicate that horizontal transmission may occur occasionally. This transmission mode could be a survival strategy of N

  7. High dynamics of rDNA cluster location in kissing bug holocentric chromosomes (Triatominae, Heteroptera).

    PubMed

    Panzera, Y; Pita, S; Ferreiro, M J; Ferrandis, I; Lages, C; Pérez, R; Silva, A E; Guerra, M; Panzera, F

    2012-01-01

    In this paper, we determine by fluorescent in situ hybridization the variability in the chromosomal location of 45S rDNA clusters in 38 species belonging to 7 genera of the Triatominae subfamily, using a triatomine-specific 18S rDNA probe. Our results show a striking variability at the inter- and intraspecific level, never reported so far in holocentric chromosomes, revealing the extraordinary genomic dynamics that occurred during the evolution in this group of insects. Our results also demonstrate that the chromosomal position of rDNA clusters is an important marker to disclose chromosomal differentiation in species karyotypically homogenous in their chromosome number.

  8. Targeting of the human F8 at the multicopy rDNA locus in Hemophilia A patient-derived iPSCs using TALENickases.

    PubMed

    Pang, Jialun; Wu, Yong; Li, Zhuo; Hu, Zhiqing; Wang, Xiaolin; Hu, Xuyun; Wang, Xiaoyan; Liu, Xionghao; Zhou, Miaojin; Liu, Bo; Wang, Yanchi; Feng, Mai; Liang, Desheng

    2016-03-25

    Hemophilia A (HA) is a monogenic disease due to lack of the clotting factor VIII (FVIII). This deficiency may lead to spontaneous joint hemorrhages or life-threatening bleeding but there is no cure for HA until very recently. In this study, we derived induced pluripotent stem cells (iPSCs) from patients with severe HA and used transcription activator-like effector nickases (TALENickases) to target the factor VIII gene (F8) at the multicopy ribosomal DNA (rDNA) locus in HA-iPSCs, aiming to rescue the shortage of FVIII protein. The results revealed that more than one copy of the exogenous F8 could be integrated into the rDNA locus. Importantly, we detected exogenous F8 mRNA and FVIII protein in targeted HA-iPSCs. After they were differentiated into endothelial cells (ECs), the exogenous FVIII protein was still detectable. Thus, it is showed that the multicopy rDNA locus could be utilized as an effective target site in patient-derived iPSCs for gene therapy. This strategy provides a novel iPSCs-based therapeutic option for HA and other monogenic diseases.

  9. Phylogeny of coral-inhabiting barnacles (Cirripedia; Thoracica; Pyrgomatidae) based on 12S, 16S and 18S rDNA analysis.

    PubMed

    Simon-Blecher, N; Huchon, D; Achituv, Y

    2007-09-01

    The traditional phylogeny of the coral-inhabiting barnacles, the Pyrgomatidae, is based on morphological characteristics, mainly of the hard parts. It has been difficult to establish the phylogenetic relationships among Pyrgomatidae because of the apparent convergence of morphological characteristics, and due to the use of non-cladistic systematics, which emphasize ancestor-descendant relationships rather than sister-clade relationships. We used partial sequences of two mithochondrial genes, 12S rDNA and 16S rDNA, and a nuclear gene, 18S rDNA, to infer the molecular phylogeny of the pyrgomatids. Our phylogenetic results allowed us to reject previous classifications of Pyrgomatidae based on morphological characteristics. Our results also suggested the possibility of paraphyly of the Pyrgomatidae. The hydrocoral barnacle Wanella is not found on the same clade as the other pyrgomatids, but rather, with the free-living balanids. The basal position of Megatrema and Ceratoconcha is supported. The archeaobalanid Armatobalanus is grouped with Cantellius at the base of the Indo-Pacific pyrgomatines. Fusion of the shell plate and modification of the opercular valves are homoplasious features that occurred more than three times on different clades. The monophyly of the "Savignium" group, comprising four nominal genera, is also not supported, and the different taxa are placed on different clades.

  10. The establishment of species-specific primers for the molecular identification of ten stored-product psocids based on ITS2 rDNA

    PubMed Central

    Zhao, Zi-Hua; Cui, Bing-Yi; Li, Zhi-Hong; Jiang, Fan; Yang, Qian-Qian; Kučerová, Zuzana; Stejskal, Václav; Opit, George; Cao, Yang; Li, Fu-Jun

    2016-01-01

    Psocids are important stored product pests found worldwide that can be spread through grain trade. Most stored-product psocids, including eggs, nymphs, and adults, are very small (~1 mm) and difficult to identify morphologically. Here, we collected 10 economically important stored-product Liposcelis spp. psocids (L. bostrychophila, L. entomophila, L. decolor, L. paeta, L. brunnea, L. corrodens, L. mendax, L. rufa, L. pearmani, and L. tricolor) from 35 geographical locations in 5 countries (China, Czech Republic, Denmark, Germany, and the United States). The ITS2 rDNA gene was extracted and sequenced. The interspecific genetic distance of the stored-product psocids was significantly higher than the intraspecific genetic distance according to the barcoding gap analysis. Ten pairs of species-specific primers based on the ITS2 rDNA were developed for psocid identification. The sensitivity estimation indicated that the species-specific primers could correctly amplify the target ITS2 gene and successfully identify psocids at 1.0 ng/mL. Additionally, these species-specific primers could quantify specificity and identify 10 stored-product psocids; this approach could also be used to accurately identify other stored-product psocids. This work provides a practical approach for the precise examination of 10 stored-product psocid species and also contributes to the development of an identification method using ITS2 rDNA. PMID:26880378

  11. Hot spots of DNA double-strand breaks and genomic contacts of human rDNA units are involved in epigenetic regulation.

    PubMed

    Tchurikov, Nickolai A; Fedoseeva, Daria M; Sosin, Dmitri V; Snezhkina, Anastasia V; Melnikova, Nataliya V; Kudryavtseva, Anna V; Kravatsky, Yuri V; Kretova, Olga V

    2015-08-01

    DNA double-strand breaks (DSBs) are involved in many cellular mechanisms, including replication, transcription, and genome rearrangements. The recent observation that hot spots of DSBs in human chromosomes delimit DNA domains that possess coordinately expressed genes suggests a strong relationship between the organization of transcription patterns and hot spots of DSBs. In this study, we performed mapping of hot spots of DSBs in a human 43-kb ribosomal DNA (rDNA) repeated unit. We observed that rDNA units corresponded to the most fragile sites in human chromosomes and that these units possessed at least nine specific regions containing clusters of extremely frequently occurring DSBs, which were located exclusively in non-coding intergenic spacer (IGS) regions. The hot spots of DSBs corresponded to only a specific subset of DNase-hypersensitive sites, and coincided with CTCF, PARP1, and HNRNPA2B1 binding sites, and H3K4me3 marks. Our rDNA-4C data indicate that the regions of IGS containing the hot spots of DSBs often form contacts with specific regions in different chromosomes, including the pericentromeric regions, as well as regions that are characterized by H3K27ac and H3K4me3 marks, CTCF binding sites, ChIA-PET and RIP signals, and high levels of DSBs. The data suggest a strong link between chromosome breakage and several different mechanisms of epigenetic regulation of gene expression.

  12. Hot spots of DNA double-strand breaks and genomic contacts of human rDNA units are involved in epigenetic regulation

    PubMed Central

    Tchurikov, Nickolai A.; Fedoseeva, Daria M.; Sosin, Dmitri V.; Snezhkina, Anastasia V.; Melnikova, Nataliya V.; Kudryavtseva, Anna V.; Kravatsky, Yuri V.; Kretova, Olga V.

    2015-01-01

    DNA double-strand breaks (DSBs) are involved in many cellular mechanisms, including replication, transcription, and genome rearrangements. The recent observation that hot spots of DSBs in human chromosomes delimit DNA domains that possess coordinately expressed genes suggests a strong relationship between the organization of transcription patterns and hot spots of DSBs. In this study, we performed mapping of hot spots of DSBs in a human 43-kb ribosomal DNA (rDNA) repeated unit. We observed that rDNA units corresponded to the most fragile sites in human chromosomes and that these units possessed at least nine specific regions containing clusters of extremely frequently occurring DSBs, which were located exclusively in non-coding intergenic spacer (IGS) regions. The hot spots of DSBs corresponded to only a specific subset of DNase-hypersensitive sites, and coincided with CTCF, PARP1, and HNRNPA2B1 binding sites, and H3K4me3 marks. Our rDNA-4C data indicate that the regions of IGS containing the hot spots of DSBs often form contacts with specific regions in different chromosomes, including the pericentromeric regions, as well as regions that are characterized by H3K27ac and H3K4me3 marks, CTCF binding sites, ChIA-PET and RIP signals, and high levels of DSBs. The data suggest a strong link between chromosome breakage and several different mechanisms of epigenetic regulation of gene expression. PMID:25280477

  13. Quantitative karyotyping of three diploid Brassica species by imaging methods and localization of 45s rDNA loci on the identified chromosomes.

    PubMed

    Fukui, K; Nakayama, S; Ohmido, N; Yoshiaki, H; Yamabe, M

    1998-03-01

    Chromosomes of the three diploid Brassica species, B. rapa (AA), B. nigra (BB) and B. oleracea (CC), were identified based on their morphological characteristics, especially on the condensation pattern appearing at the somatic pro-metaphase stage. The morphological features of the pro-metaphase chromosomes of the three Brassica spp. were quantified by imaging methods using chromosome image analyzing system II (CHIAS 2). As a result, quantitative chromosome maps or idiograms of the three diploid Brassica spp. were developed. The fluorescence in situ hybridization (FISH) method revealed the location of 45s rDNA (the 26s-5.8s-18s ribosomal RNA gene cluster) on the chromosomes involved. The number of 45s rDNA loci in the B. rapa, B. nigra and B. oleracea are five, three and two, respectively. The loci detected were systematically mapped on the idiograms of the three Brassica spp.

  14. Distribution of Mosquitoes in the South East of Argentina and First Report on the Analysis Based on 18S rDNA and COI Sequences

    PubMed Central

    Díaz-Nieto, Leonardo M.; Maciá, Arnaldo; Parisi, Gustavo; Farina, Juan L.; Vidal-Domínguez, María E.; Perotti, M. Alejandra; Berón, Corina M.

    2013-01-01

    Although Mar del Plata is the most important city on the Atlantic coast of Argentina, mosquitoes inhabiting such area are almost uncharacterized. To increase our knowledge in their distribution, we sampled specimens of natural populations. After the morphological identification based on taxonomic keys, sequences of DNA from small ribosomal subunit (18S rDNA) and cytochrome c oxidase I (COI) genes were obtained from native species and the phylogenetic analysis of these sequences were done. Fourteen species from the genera Uranotaenia, Culex, Ochlerotatus and Psorophora were found and identified. Our 18S rDNA and COI-based analysis indicates the relationships among groups at the supra-species level in concordance with mosquito taxonomy. The introduction and spread of vectors and diseases carried by them are not known in Mar del Plata, but some of the species found in this study were reported as pathogen vectors. PMID:24098700

  15. [Investigation of bacterial diversity in the biological desulfurization reactor for treating high salinity wastewater by the 16S rDNA cloning method].

    PubMed

    Liu, Wei-Guo; Liang, Cun-Zhen; Yang, Jin-Sheng; Wang, Gui-Ping; Liu, Miao-Miao

    2013-02-01

    The bacterial diversity in the biological desulfurization reactor operated continuously for 1 year was studied by the 16S rDNA cloning and sequencing method. Forty clones were randomly selected and their partial 16S rDNA genes (ca. 1,400 bp) were sequenced and blasted. The results indicated that there were dominant bacterias in the biological desulfurization reactor, where 33 clones belonged to 3 different published phyla, while 1 clone belonged to unknown phylum. The dominant bacterial community in the system was Proteobacteria, which accounted for 85.3%. The bacterial community succession was as follows: the gamma-Proteobacteria(55.9%), beta-Proteobacteria(17.6%), Actinobacteridae (8.8%), delta-Proteobacteria (5.9%) , alpha-Proteobacteria(5.9%), and Sphingobacteria (2.9%). Halothiobacillus sp. ST15 and Thiobacillus sp. UAM-I were the major desulfurization strains.

  16. Assessing diversity of the female urine microbiota by high throughput sequencing of 16S rDNA amplicons

    PubMed Central

    2011-01-01

    Background Urine within the urinary tract is commonly regarded as "sterile" in cultivation terms. Here, we present a comprehensive in-depth study of bacterial 16S rDNA sequences associated with urine from healthy females by means of culture-independent high-throughput sequencing techniques. Results Sequencing of the V1V2 and V6 regions of the 16S ribosomal RNA gene using the 454 GS FLX system was performed to characterize the possible bacterial composition in 8 culture-negative (<100,000 CFU/ml) healthy female urine specimens. Sequences were compared to 16S rRNA databases and showed significant diversity, with the predominant genera detected being Lactobacillus, Prevotella and Gardnerella. The bacterial profiles in the female urine samples studied were complex; considerable variation between individuals was observed and a common microbial signature was not evident. Notably, a significant amount of sequences belonging to bacteria with a known pathogenic potential was observed. The number of operational taxonomic units (OTUs) for individual samples varied substantially and was in the range of 20 - 500. Conclusions Normal female urine displays a noticeable and variable bacterial 16S rDNA sequence richness, which includes fastidious and anaerobic bacteria previously shown to be associated with female urogenital pathology. PMID:22047020

  17. Wide occurrence of SSU rDNA intragenomic polymorphism in foraminifera and its implications for molecular species identification.

    PubMed

    Weber, Alexandra Anh-Thu; Pawlowski, Jan

    2014-09-01

    Ribosomal DNA is commonly used as a marker for protist phylogeny and taxonomy because of its ubiquity and its expected species specificity thanks to the mechanism of concerted evolution. However, numerous studies reported the occurrence of intragenomic (intra-individual) polymorphism in various protists and particularly in Foraminifera. To infer to what extent the SSU rDNA intragenomic variability occurs in Foraminifera, we studied 16 foraminiferal species belonging to single-chambered monothalamids and multi-chambered Globothalamea, with one to six individuals per species. We performed single-cell DNA extractions and PCRs of a 600bp fragment of SSU rDNA, and sequenced 9 to 23 clones per individual for a total of 818 sequences. We found intragenomic variability in almost all species, even after excluding singleton mutations. Intra-individual sequence divergence ranged from 0 to 5.15% and was higher than 1% in 11 species. Variability was usually located at the end of stem-loop structures and included compensatory single nucleotide polymorphisms and expansion segments polymorphisms. However, the polymorphisms did not change the secondary structure of the rRNA. Our results suggest a non-concerted evolution of rRNA genes in Foraminifera. The origin of this variability and its implications for species identification in environmental DNA studies are discussed.

  18. Detection of rDNA ITS polymorphism in Rhizoctonia solani AG 2-1 isolates.

    PubMed

    Pannecoucque, Joke; Höfte, Monica

    2009-01-01

    The sequence variability of the ribosomal internal transcribed spacer regions ITS1 and ITS2, including the 5.8S gene, was investigated for Rhizoctonia solani isolates of anastomosis group (AG) 2-1. During PCR RFLP analysis of eight isolates, the restriction patterns of four isolates showed an excess of bands after restriction with the enzymes AvaII and/or HincII, which suggested the presence of more than one ITS region. By cloning the ITS region of six isolates sequence heterogeneity was detected in the isolates that showed an excess of bands in the PCR RFLP analysis; up to nine different ITS regions were identified within one isolate. The same level of diversity was found within the same isolate as among isolates. In the phylogenetic tree based on the rDNA ITS sequences of several AG 2-1 isolates, sequences derived from the same isolate did not form distinct clusters, questioning the relevance of further subdivision of heterogeneous AG 2-1 isolates based on the ITS region.

  19. Detection and characterization of fungal infections of Ammophila arenaria (marram grass) roots by denaturing gradient gel electrophoresis of specifically amplified 18s rDNA.

    PubMed Central

    Kowalchuk, G A; Gerards, S; Woldendorp, J W

    1997-01-01

    Marram grass (Ammophila arenaria L.), a sand-stabilizing plant species in coastal dune areas, is affected by a specific pathosystem thought to include both plant-pathogenic fungi and nematodes. To study the fungal component of this pathosystem, we developed a method for the cultivation-independent detection and characterization of fungi infecting plant roots based on denaturing gradient gel electrophoresis (DGGE) of specifically amplified DNA fragments coding for 18S rRNA (rDNA). A nested PCR strategy was employed to amplify a 569-bp region of the 18S rRNA gene, with the addition of a 36-bp GC clamp, from fungal isolates, from roots of test plants infected in the laboratory, and from field samples of marram grass roots from both healthy and degenerating stands from coastal dunes in The Netherlands. PCR products from fungal isolates were subjected to DGGE to examine the variation seen both between different fungal taxa and within a single species. DGGE of the 18S rDNA fragments could resolve species differences from fungi used in this study yet was unable to discriminate between strains of a single species. The 18S rRNA genes from 20 isolates of fungal species previously recovered from A. arenaria roots were cloned and partially sequenced to aid in the interpretation of DGGE data. DGGE patterns recovered from laboratory plants showed that this technique could reliably identify known plant-infecting fungi. Amplification products from field A. arenaria roots also were analyzed by DGGE, and the major bands were excised, reamplified, sequenced, and subjected to phylogenetic analysis. Some recovered 18S rDNA sequences allowed for phylogenetic placement to the genus level, whereas other sequences were not closely related to known fungal 18S rDNA sequences. The molecular data presented here reveal fungal diversity not detected in previous culture-based surveys. PMID:9327549

  20. Phenotypic assortment in Tetrahymena thermophila: assortment kinetics of antibiotic-resistance markers, tsA, death, and the highly amplified rDNA locus.

    PubMed

    Merriam, E V; Bruns, P J

    1988-10-01

    Phenotypic assortment in Tetrahymena thermophila results from random distribution of alleles during amitotic division of the macronucleus. The rate of assortment is dependent on input ratio and the number of assorting units. The assortment of the antibiotic resistance markers Chx, Mpr and gal was determined and is consistent for each with the model of 45 assorting chromosomes. The gene tsA (previously ts-1) shows normal assortment, in contrast to previous reports. A mutation in the highly amplified ribosomal locus (rdnA2) assorts as if present at only 45 copies. Death of clones occurred at a rate consistent with assortment for a single gene.

  1. Chromosomal localization and characterization of rDNA loci in the Brassica A and C genomes.

    PubMed

    Snowdon, R J; Köhler, W; Köhler, A

    1997-08-01

    Using fluorescence in situ hybridization, we located ribosomal DNA loci on prometaphase chromosomes of the diploid species Brassica rapa and Brassica oleracea and their amphidiploid Brassica napus. Based on comparisons of chromosome morphology and hybridization patterns, we characterized the individual B. napus rDNA loci according to their presumed origins in the Brassica A and C genomes. As reported in other studies, the sum of rDNA loci observed on B. rapa (AA genome) and B. oleracea (CC genome) chromosomes was one greater than the total number of loci seen in their amphidiploid B. napus (AACC). Evidence is presented that this reduction in B. napus rDNA locus number results from the loss of the smallest A genome rDNA site in the amphidiploid.

  2. Phylogenetic study on Shiraia bambusicola by rDNA sequence analyses.

    PubMed

    Cheng, Tian-Fan; Jia, Xiao-Ming; Ma, Xiao-Hang; Lin, Hai-Ping; Zhao, Yu-Hua

    2004-01-01

    In this study, 18S rDNA and ITS-5.8S rDNA regions of four Shiraia bambusicola isolates collected from different species of bamboos were amplified by PCR with universal primer pairs NS1/NS8 and ITS5/ITS4, respectively, and sequenced. Phylogenetic analyses were conducted on three selected datasets of rDNA sequences. Maximum parsimony, distance and maximum likelihood criteria were used to infer trees. Morphological characteristics were also observed. The positioning of Shiraia in the order Pleosporales was well supported by bootstrap, which agreed with the placement by Amano (1980) according to their morphology. We did not find significant inter-hostal differences among these four isolates from different species of bamboos. From the results of analyses and comparison of their rDNA sequences, we conclude that Shiraia should be classified into Pleosporales as Amano (1980) proposed and suggest that it might be positioned in the family Phaeosphaeriaceae.

  3. Karyotypic conservatism in samples of Characidium cf. zebra (Teleostei, Characiformes, Crenuchidae): Physical mapping of ribosomal genes and natural triploidy.

    PubMed

    Pansonato-Alves, José Carlos; Oliveira, Claudio; Foresti, Fausto

    2011-04-01

    Basic and molecular cytogenetic analyses were performed in specimens of Characidium cf. zebra from five collection sites located throughout the Tietê, Paranapanema and Paraguay river basins. The diploid number in specimens from all samples was 2n = 50 with a karyotype composed of 32 metacentric and 18 submetacentric chromosomes in both males and females. Constitutive heterochromatin was present at the centromeric regions of all chromosomes and pair 23, had additional interstitial heterochromatic blocks on its long arms. The nucleolar organizer regions (NORs) were located on the long arms of pair 23, while the 5S rDNA sites were detected in different chromosomes among the studied samples. One specimen from the Alambari river was a natural triploid and had two extra chromosomes, resulting in 2n = 77. The remarkable karyotypic similarity among the specimens of C. cf. zebra suggests a close evolutionary relationship. On the other hand, the distinct patterns of 5S rDNA distribution may be the result of gene flow constraints during their evolutionary history.

  4. Contrasting evolution of a satellite DNA and its ancestral IGS rDNA in Phaseolus (Fabaceae).

    PubMed

    Almeida, Cícero; Fonsêca, Artur; dos Santos, Karla Galvão Bezerra; Mosiolek, Magdalena; Pedrosa-Harand, Andrea

    2012-09-01

    CC4 is a satellite DNA from common bean (Phaseolus vulgaris L.) that is similar to its intergenic spacer (IGS) rDNA. CC4 was originally hypothesized to be an old, fast evolving satellite family that has invaded common bean rDNA. To test this hypothesis and contribute to the understanding of IGS-like satellite DNA evolution, we have investigated its distribution in the genus Phaseolus and related species. CC4 was cloned and used as probe for Southern blot and FISH experiments. CC4 was observed as an independent satellite in common bean, forming two to three major and a few minor pericentromeric clusters. In Phaseolus coccineus, CC4 was present in four major clusters, also not co-localized with the 45S rDNA sites. Remarkably, in the less related species of the genus, signals were detected co-localized with the 45S rDNA sites, but co-localization was not observed in the species where CC4 is present as an independent satellite. No signal was detected in species from related genera. Altogether, the data suggest that CC4 has originated from the IGS rDNA in the P. vulgaris-P. coccineus lineage and has evolved slower than the IGS rDNA from this lineage.

  5. Contrasting evolution of a satellite DNA and its ancestral IGS rDNA in Phaseolus (Fabaceae).

    PubMed

    Almeida, Cícero; Fonsêca, Artur; dos Santos, Karla Galvão Bezerra; Mosiolek, Magdalena; Pedrosa-Harand, Andrea

    2012-09-01

    CC4 is a satellite DNA from common bean (Phaseolus vulgaris L.) that is similar to its intergenic spacer (IGS) rDNA. CC4 was originally hypothesized to be an old, fast evolving satellite family that has invaded common bean rDNA. To test this hypothesis and contribute to the understanding of IGS-like satellite DNA evolution, we have investigated its distribution in the genus Phaseolus and related species. CC4 was cloned and used as probe for Southern blot and FISH experiments. CC4 was observed as an independent satellite in common bean, forming two to three major and a few minor pericentromeric clusters. In Phaseolus coccineus, CC4 was present in four major clusters, also not co-localized with the 45S rDNA sites. Remarkably, in the less related species of the genus, signals were detected co-localized with the 45S rDNA sites, but co-localization was not observed in the species where CC4 is present as an independent satellite. No signal was detected in species from related genera. Altogether, the data suggest that CC4 has originated from the IGS rDNA in the P. vulgaris-P. coccineus lineage and has evolved slower than the IGS rDNA from this lineage. PMID:23050694

  6. [Analysis of DNA homology and 16S rDNA sequence of rhizobia, a new phenotypic subgroup, isolated from Xizang Autonomous Region of China].

    PubMed

    Wang, Su-ying; Yang, Xiao-li; Li, Hai-feng; Liu, Jie

    2006-02-01

    Based on the studies of numerical taxonomy, the seven rhizobial strains isolated from the root nodules of leguminous plants Trigonella spp. and Astragalus spp. growing in the Xizang Autonomous Region of China constituted a new phenotypic subgroup, where wide phenotypic and genotypic diversity among legume crops had been reported due to complex terrain and various climate. The new phenotypic subgroup were further identified to clarify its taxonomic position by DNA homology analysis and 16S rDNA gene sequencing. The mol% G + C ratio of the DNA among members of the new subgroup ranged from 59.5 to 63.3 mol% as determined by T (m) assay. The levels of DNA relatedness, determined by using the DNA liquid hybridization method, among the members of the new subgroup were between 74.3% and 92.3%, while level of DNA relatedness between the central strains XZ2-3 of the new subgroup and the type strains of known species of Rhizobium was less than 47.4%. These results indicated that the new phenotypic subgroup is a DNA homological group different from described species of Rhizobium. Therefore, this new phenotypic subgroup was supposed to be a new species in the genus of Rhizobium since the strains in the same species generally exhibit levels of DNA homology ranging from 70 to 100%. A systematic identification method-16S rDNA gene sequence comparison was carried out to determine the phylogenetic relationships of the new subgroup with the described species of Rhizobium. The GenBank accession number for the 16S rDNA sequence of the central strain XZ2-3 of the new subgroup is DQ099745. The full-length 16S rDNA gene sequence were sequenced by chain terminator techniques and analyzed with PHYLIP. The phylogenetic trees were constructed by using the programs DRAWTREE. The phylogenetic analysis indicated that new subgroup occupy a independent sub-branch in phylogenetic tree. The sequence similarities between the center strain XZ2-3 and the closest relatives, strain R. leguminosarum USDA

  7. A methylated Neurospora 5S rRNA pseudogene contains a transposable element inactivated by repeat-induced point mutation.

    PubMed Central

    Margolin, B S; Garrett-Engele, P W; Stevens, J N; Fritz, D Y; Garrett-Engele, C; Metzenberg, R L; Selker, E U

    1998-01-01

    In an analysis of 22 of the roughly 100 dispersed 5S rRNA genes in Neurospora crassa, a methylated 5S rRNA pseudogene, Psi63, was identified. We characterized the Psi63 region to better understand the control and function of DNA methylation. The 120-bp 5S rRNA-like region of Psi63 is interrupted by a 1.9-kb insertion that has characteristics of sequences that have been modified by repeat-induced point mutation (RIP). We found sequences related to this insertion in wild-type strains of N. crassa and other Neurospora species. Most showed evidence of RIP; but one, isolated from the N. crassa host of Psi63, showed no evidence of RIP. A deletion from near the center of this sequence apparently rendered it incapable of participating in RIP with the related full-length copies. The Psi63 insertion and the related sequences have features of transposons and are related to the Fot1 class of fungal transposable elements. Apparently Psi63 was generated by insertion of a previously unrecognized Neurospora transposable element into a 5S rRNA gene, followed by RIP. We name the resulting inactivated Neurospora transposon PuntRIP1 and the related sequence showing no evidence of RIP, but harboring a deletion that presumably rendered it defective for transposition, dPunt. PMID:9691037

  8. Repumping and spectroscopy of laser-cooled Sr atoms using the (5s5p)3P2-(5s4d)3D2 transition

    NASA Astrophysics Data System (ADS)

    Mickelson, P. G.; Martinez de Escobar, Y. N.; Anzel, P.; De Salvo, B. J.; Nagel, S. B.; Traverso, A. J.; Yan, M.; Killian, T. C.

    2009-12-01

    We describe repumping and spectroscopy of laser-cooled strontium (Sr) atoms using the (5s5p)3P2-(5s4d)3D2 transition. Atom number in a magneto-optical trap is enhanced by driving this transition because Sr atoms that have decayed into the (5s5p)3P2 dark state are repumped back into the (5s2)1S0 ground state. Spectroscopy of 84Sr, 86Sr, 87Sr and 88Sr improves the value of the (5s5p)3P2-(5s4d)3D2 transition frequency and determines the isotope shifts for the transition accurately enough to guide laser-cooling experiments with less abundant isotopes.

  9. Soil clone library analyses to evaluate specificity and selectivity of PCR primers targeting fungal 18S rDNA for denaturing-gradient gel electrophoresis (DGGE).

    PubMed

    Takada Hoshino, Yuko; Morimoto, Sho

    2010-01-01

    We evaluated the fungal specificity and detection bias of four fungal 18S rRNA gene (18S rDNA) primer sets for denaturing-gradient gel electrophoresis (DGGE). We constructed and compared clone libraries amplified from upland and paddy field soils with each primer set (1, NS1/GCFung; 2, FF390/FR1-GC; 3, NS1/FR1-GC; and 4, NS1/EF3 for the first PCR and NS1/FR1-GC for the second PCR). Primer set 4 (for nested PCR) showed the highest specificity for fungi but biased specific sequences. Sets 1, 2, and 3 (for single PCR) amplified non-fungal eukaryotic sequences (from 7 to 16% for upland soil and from 20 to 31% for paddy field soil) and produced libraries with similar distributions of fungal 18S rDNA sequences at both the phylum and the class level. Set 2 tended to amplify more diverse fungal sequences, maintaining higher specificity for fungi. In addition, clone analyses revealed differences among primer sets in the frequency of chimeras. In upland field soil, the libraries amplified with primer sets 3 and 4, which targeted long fragments, contained many chimeric 18S rDNA sequences (18% and 48%, respectively), while the libraries obtained with sets 1 and 2, which targeted short fragments, contained fewer chimeras (5% and 10%, respectively).

  10. Cytological characterization of sunflower by in situ hybridization using homologous rDNA sequences and a BAC clone containing highly represented repetitive retrotransposon-like sequences.

    PubMed

    Talia, P; Greizerstein, E; Quijano, C Díaz; Peluffo, L; Fernández, L; Fernández, P; Hopp, H E; Paniego, N; Heinz, R A; Poggio, L

    2010-03-01

    In the present work we report new tools for the characterization of the complete chromosome complement of sunflower (Helianthus annuus L.), using a bacterial artificial chromosome (BAC) clone containing repetitive sequences with similarity to retrotransposons and a homologous rDNA sequence isolated from the sunflower genome as probes for FISH. The rDNA signal was found in 3 pairs of chromosomes, coinciding with the location of satellites. The BAC clone containing highly represented retroelements hybridized with all the chromosome complement in FISH, and used together with the rDNA probe allowed the discrimination of all chromosome pairs of sunflower. Their distinctive distribution pattern suggests that these probes could be useful for karyotype characterization and for chromosome identification. The karyotype could be subdivided into 3 clear-cut groups of 12 metacentric pairs, 1 submetacentric pair, and 4 subtelocentric pairs, thus resolving previously described karyotype controversies. The use of BAC clones containing single sequences of specific markers and (or) genes associated with important agricultural traits represents an important tool for future locus-specific identification and physical mapping.

  11. Surface water-borne multidrug and heavy metal-resistant Staphylococcus isolates characterized by 16S rDNA sequencing.

    PubMed

    Yilmaz, Fadime; Orman, Nazlı; Serim, Gamze; Kochan, Ceren; Ergene, Aysun; Icgen, Bulent

    2013-12-01

    Four Staphylococcus isolates having both multidrug- and multimetal-resistant ability were isolated from surface water. Further identification of the isolates was obtained through biochemical tests and 16S rDNA gene sequencing. One methicillin-resistant and two methicillin-sensitive isolates were determined as Staphylococcus aureus. The other isolate was identified as Staphylococcus warneri. The antibiotic and heavy metal resistance profiles of the Staphylococcus isolates were determined by using 26 antibiotics and 17 heavy metals. S. aureus isolates displayed resistance to most of the β-lactam antibiotics tested. All Staphylococcus isolates were resistant to heavy metals including silver, lithium, and barium. Due to a possible health risk of these pathogenic bacteria, a need exists for an accurate assessment of their acquired resistance to multiple drugs and metals.

  12. In β-actin knockouts, epigenetic reprogramming and rDNA transcription inactivation lead to growth and proliferation defects.

    PubMed

    Almuzzaini, Bader; Sarshad, Aishe A; Rahmanto, Aldwin S; Hansson, Magnus L; Von Euler, Anne; Sangfelt, Olle; Visa, Neus; Farrants, Ann-Kristin Östlund; Percipalle, Piergiorgio

    2016-08-01

    Actin and nuclear myosin 1 (NM1) are regulators of transcription and chromatin organization. Using a genome-wide approach, we report here that β-actin binds intergenic and genic regions across the mammalian genome, associated with both protein-coding and rRNA genes. Within the rDNA, the distribution of β-actin correlated with NM1 and the other subunits of the B-WICH complex, WSTF and SNF2h. In β-actin(-/-) mouse embryonic fibroblasts (MEFs), we found that rRNA synthesis levels decreased concomitantly with drops in RNA polymerase I (Pol I) and NM1 occupancies across the rRNA gene. Reintroduction of wild-type β-actin, in contrast to mutated forms with polymerization defects, efficiently rescued rRNA synthesis underscoring the direct role for a polymerization-competent form of β-actin in Pol I transcription. The rRNA synthesis defects in the β-actin(-/-) MEFs are a consequence of epigenetic reprogramming with up-regulation of the repressive mark H3K4me1 (monomethylation of lys4 on histone H3) and enhanced chromatin compaction at promoter-proximal enhancer (T0 sequence), which disturb binding of the transcription factor TTF1. We propose a novel genome-wide mechanism where the polymerase-associated β-actin synergizes with NM1 to coordinate permissive chromatin with Pol I transcription, cell growth, and proliferation.-Almuzzaini, B., Sarshad, A. A. , Rahmanto, A. S., Hansson, M. L., Von Euler, A., Sangfelt, O., Visa, N., Farrants, A.-K. Ö., Percipalle, P. In β-actin knockouts, epigenetic reprogramming and rDNA transcription inactivation lead to growth and proliferation defects.

  13. D5S351 and D5S1414 located at the spinal muscular atrophy critical region represent novel informative markers in the Iranian population

    PubMed Central

    Sedghi, Maryam; Vallian, Sadeq

    2015-01-01

    Spinal muscular atrophy (SMA) is a degenerative neuromuscular disease associated with progressive symmetric weakness and atrophy of the limb muscles. In view of the involvement of numerous point mutations and deletions associated with the disease, the application of polymorphic markers flanking the SMA critical region could be valuable in molecular diagnosis of the disease. In the present study, D5S351 and D5S1414 polymorphic markers located at the SMA critical region in the Iranian populations were characterized. Genotyping of the markers indicated the presence of six and nine different alleles for D5S351 and D5S1414, respectively. Haplotype frequency estimation in 25 trios families and 75 unrelated individuals indicated the presence of six informative haplotypes with frequency higher than 0.05 in the studied population. Furthermore, the D′ coefficient and the χ2 value for D5S351 and D5S1414 markers revealed the presence of linkage disequilibrium between the two markers in the Iranians. These data suggested that D5S351 and D5S1414 could be suggested as informative markers for linkage analysis and molecular diagnosis of SMA in the Iranian population. PMID:26693404

  14. Unequal exchanges and the coevolution of X and Y rDNA arrays in Drosophila melanogaster.

    PubMed

    Coen, E S; Dover, G A

    1983-07-01

    We have examined the molecular basis of the response of individuals of D. melanogaster to artificial selection for high and low abdominal bristles. By monitoring the fate of particular rDNA spacer length variants associated with individually isolated X and Y chromosomes, we show that flies from the low bristle number selection lines have undergone an unequal exchange between the X and Y rDNA arrays. Such exchanges result in translocations between X and Y chromosomes, visualised as X.Y compound chromosomes at mitosis. Transfer of few copies of a length variant between X and Y indicates a clustering of variants. Flies that have reverted back to wild-type seemingly have undergone a second unequal exchange, giving rise to a compound X.Y chromosome containing Y rDNA of normal amounts. Unequal exchanges between X and Y rDNA arrays could contribute to the observed coevolution of rDNA sequences on these chromosomes. The biological significance of this outcome is discussed.

  15. Heterothallic species of neurospora are distinguishable by restriction analysis of their nuclear rDNA sequences

    SciTech Connect

    Chambers, C.; Dutta, S.K.

    1983-01-01

    Restriction analysis of rDNAs was used to distinguish nuclear rDNA's of three different reference strains of heterothallic species of the genus Neurospora: N. crassa 74A (FGSC number987), N. intermedia P420 (FGSC number2316), and N. sitophila 10B (FGSC number580). Two approaches were adopted: (1) Nuclear DNA's of these three Neurospora species were treated with various restriction enzymes. Against the streaks of nuclear DNAs on the 0.7% agarose gels background bands were visible. These background bands are visible because rDNA sequences of Neurospora species exist in multiple copies within the nuclear DNA's. (2) The second approach was comparison of auto-radiographs of hybrid molecules of Southern blot transfers of restricted nuclear DNAs and /sup 32/P-labelled nick translated rDNA's (referred to as rDNA probe) isolated from N. crassa slime mutant (FGSC number1118), rDNA cloned into pBR322. A summary of restricted fragment sizes as seen in the gels and in autoradiographs of Southern blots of the respective gels is presented.

  16. Analysis of the unexplored features of rrs (16S rDNA) of the Genus Clostridium

    PubMed Central

    2011-01-01

    Background Bacterial taxonomy and phylogeny based on rrs (16S rDNA) sequencing is being vigorously pursued. In fact, it has been stated that novel biological findings are driven by comparison and integration of massive data sets. In spite of a large reservoir of rrs sequencing data of 1,237,963 entries, this analysis invariably needs supplementation with other genes. The need is to divide the genetic variability within a taxa or genus at their rrs phylogenetic boundaries and to discover those fundamental features, which will enable the bacteria to naturally fall within them. Within the large bacterial community, Clostridium represents a large genus of around 110 species of significant biotechnological and medical importance. Certain Clostridium strains produce some of the deadliest toxins, which cause heavy economic losses. We have targeted this genus because of its high genetic diversity, which does not allow accurate typing with the available molecular methods. Results Seven hundred sixty five rrs sequences (> 1200 nucleotides, nts) belonging to 110 Clostridium species were analyzed. On the basis of 404 rrs sequences belonging to 15 Clostridium species, we have developed species specific: (i) phylogenetic framework, (ii) signatures (30 nts) and (iii) in silico restriction enzyme (14 Type II REs) digestion patterns. These tools allowed: (i) species level identification of 95 Clostridium sp. which are presently classified up to genus level, (ii) identification of 84 novel Clostridium spp. and (iii) potential reduction in the number of Clostridium species represented by small populations. Conclusions This integrated approach is quite sensitive and can be easily extended as a molecular tool for diagnostic and taxonomic identification of any microbe of importance to food industries and health services. Since rapid and correct identification allows quicker diagnosis and consequently treatment as well, it is likely to lead to reduction in economic losses and mortality

  17. Phylogeny and genetic diversity of Bridgeoporus nobilissimus inferred using mitochondrial and nuclear rDNA sequences

    USGS Publications Warehouse

    Redberg, G.L.; Hibbett, D.S.; Ammirati, J.F.; Rodriguez, R.J.

    2003-01-01

    The genetic diversity and phylogeny of Bridgeoporus nobilissimus have been analyzed. DNA was extracted from spores collected from individual fruiting bodies representing six geographically distinct populations in Oregon and Washington. Spore samples collected contained low levels of bacteria, yeast and a filamentous fungal species. Using taxon-specific PCR primers, it was possible to discriminate among rDNA from bacteria, yeast, a filamentous associate and B. nobilissimus. Nuclear rDNA internal transcribed spacer (ITS) region sequences of B. nobilissimus were compared among individuals representing six populations and were found to have less than 2% variation. These sequences also were used to design dual and nested PCR primers for B. nobilissimus-specific amplification. Mitochondrial small-subunit rDNA sequences were used in a phylogenetic analysis that placed B. nobilissimus in the hymenochaetoid clade, where it was associated with Oxyporus and Schizopora.

  18. 5S RRNA GENE DELETIONS CAUSE AN UNEXPECTEDLY HIGH FITNESS LOSS IN ESCHERICHIA COLI. (R825354)

    EPA Science Inventory

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  19. Differentiation of Acidithiobacillus ferrooxidans and A. thiooxidans strains based on 16S-23S rDNA spacer polymorphism analysis.

    PubMed

    Bergamo, Rogério F; Novo, Maria Teresa M; Veríssimo, Ricardo V; Paulino, Luciana C; Stoppe, Nancy C; Sato, Maria Inês Z; Manfio, Gilson P; Prado, Paulo Inácio; Garcia, Oswaldo; Ottoboni, Laura M M

    2004-09-01

    Restriction fragment length polymorphism (RFLP) and sequence analyses of the PCR-amplified 16S-23S rDNA intergenic spacer (ITS) were used for differentiating Acidithiobacillus thiooxidans strains from other related acidithiobacilli, including A. ferrooxidans and A. caldus. RFLP fingerprints obtained with AluI, DdeI, HaeIII, HinfI and MspI enabled the differentiation of all Acidithiobacillus reference strains into species groups. The A. thiooxidans strains investigated (metal mine isolates) yielded identical RFLP patterns to the A. thiooxidans type strain (ATCC 19377(T)), except for strain DAMS, which had a distinct pattern for all enzymes tested. Fourteen A. ferrooxidans mine strains were assigned to 3 RFLP groups, the majority of which were grouped with A. ferrooxidans ATCC 23270(T). The spacer region of one representative strain from each of the RFLP groups obtained was subjected to sequence analysis, in addition to eleven additional A. thiooxidans strains isolated from sediment and water samples, and A. caldus DSM 8584(T). The tRNA(IIe) and tRNA(Ala) genes, present in all strains analyzed, showed high sequence similarity. Phylogenetic analysis of the ITS sequences differentiated all three Acidithiobacillus species. Inter- and infraspecific genetic variations detected were mainly due to the size and sequence polymorphism of the ITS3 region. Mantel tests showed no significant correlation between ITS sequence similarity and the geographical origin of strains. The results showed that the 16S-23S rDNA spacer region is a useful target for the development of molecular-based methods aimed at the detection, rapid differentiation and identification of acidithiobacilli.

  20. Morphology and 18S rDNA of Henneguya gurlei (Myxosporea) from Ameiurus nebulosus (Siluriformes) in North Carolina

    USGS Publications Warehouse

    Iwanowicz, L.R.; Iwanowicz, D.D.; Pote, L.M.; Blazer, V.S.; Schill, W.B.

    2008-01-01

    Henneguya gurlei was isolated from Ameiurus nebulosus captured in North Carolina and redescribed using critical morphological features and 18S small-subunit ribosomal RNA (SSU rDNA) gene sequence. Plasmodia are white, spherical, or subspherical, occur in clusters, measure up to 1.8 mm in length, and are located on the dorsal, pectoral, and anal fins. Histologically, plasmodia are located in the dermis and subdermally, and the larger cysts disrupt the melanocyte pigment layer. The spore body is lanceolate, 18.2 ?? 0.3 ??m (range 15.7-20.3) in length, and 5.4 ?? 0.1 ??m (range 3.8-6.1) in width in valvular view. The caudal appendages are 41.1 ?? 1.1 ??m (range 34.0-49.7) in length. Polar capsules are pyriform and of unequal size. The longer polar capsule measures 6.2 ?? 0.1 ??m (range 5.48-7.06), while the shorter is 5.7 ?? 0.1 ??m (range 4.8-6.4) in length. Polar capsule width is 1.2 ?? 0.03 ??m (range 1.0-1.54). The total length of the spore is 60.9 ?? 1.2 ??m (range 48.7-68.5). Morphologically, this species is similar to other species of Henneguya that are known to infect ictalurids. Based on SSU rDNA sequences, this species is most closely related to H. exilis and H. ictaluri, which infect Ictalurus punctatus. ?? American Society of Parasitologists 2008.

  1. The evolution pattern of rDNA ITS in Avena and phylogenetic relationship of the Avena species (Poaceae: Aveneae).

    PubMed

    Peng, Yuan-Ying; Baum, Bernard R; Ren, Chang-Zhong; Jiang, Qian-Tao; Chen, Guo-Yue; Zheng, You-Liang; Wei, Yu-Ming

    2010-10-01

    Ribosomal ITS sequences are commonly used for phylogenetic reconstruction because they are included in rDNA repeats, and these repeats often undergo rapid concerted evolution within and between arrays. Therefore, the rDNA ITS copies appear to be virtually identical and can sometimes be treated as a single gene. In this paper we examined ITS polymorphism within and among 13 diploid (A and C genomes), seven tetraploid (AB, AC and CC genomes) and four hexaploid (ACD genome) to infer the extent and direction of concerted evolution, and to reveal the phylogenetic and genome relationship among species of Avena. A total of 170 clones of the ITS1-5.8S-ITS2 fragment were sequenced to carry out haplotype and phylogenetic analysis. In addition, 111 Avena ITS sequences retrieved from GenBank were combined with 170 clones to construct a phylogeny and a network. We demonstrate the major divergence between the A and C genomes whereas the distinction among the A and B/D genomes was generally not possible. High affinity among the A(d) genome species A. damascena and the ACD genome species A. fatua was found, whereas the rest of the ACD genome hexaploids and the AACC tetraploids were highly affiliated with the A(l) genome diploid A. longiglumis. One of the AACC species A. murphyi showed the closest relationship with most of the hexaploid species. Both C(v) and C(p) genome species have been proposed as paternal donors of the C-genome carrying polyploids. Incomplete concerted evolution is responsible for the observed differences among different clones of a single Avena individual. The elimination of C-genome rRNA sequences and the resulting evolutionary inference of hexaploid species are discussed.

  2. Thinking beside the box: Should we care about the non-coding strand of the 16S rRNA gene?

    PubMed

    Garcia-Mazcorro, Jose F; Barcenas-Walls, Jose R

    2016-08-01

    The 16S rRNA gene (16S rDNA) codes for RNA that plays a fundamental role during translation in the ribosome and is used extensively as a marker gene to establish relationships among bacteria. However, the complementary non-coding 16S rDNA (nc16S rDNA) has been ignored. An idea emerged in the course of analyzing bacterial 16S rDNA sequences in search for nucleotide composition and substitution patterns: Does the nc16S rDNA code? If so, what does it code for? More importantly: Does 16S rDNA evolution reflect its own evolution or the evolution of its counterpart nc16S rDNA? The objective of this minireview is to discuss these thoughts. nc strands often encode small RNAs (sRNAs), ancient components of gene regulation. nc16S rDNA sequences from different bacterial groups were used to search for possible matches in the Bacterial Small Regulatory RNA Database. Intriguingly, the sequence of one published sRNA obtained from Legionella pneumophila (GenBank: AE0173541) showed high non-random similarity with nc16S rDNA corresponding in part to the V5 region especially from Legionella and relatives. While the target(s) of this sRNA is unclear at the moment, its mere existence might open up a new chapter in the use of the 16S rDNA to study relationships among bacteria. PMID:27412167

  3. Thinking beside the box: Should we care about the non-coding strand of the 16S rRNA gene?

    PubMed

    Garcia-Mazcorro, Jose F; Barcenas-Walls, Jose R

    2016-08-01

    The 16S rRNA gene (16S rDNA) codes for RNA that plays a fundamental role during translation in the ribosome and is used extensively as a marker gene to establish relationships among bacteria. However, the complementary non-coding 16S rDNA (nc16S rDNA) has been ignored. An idea emerged in the course of analyzing bacterial 16S rDNA sequences in search for nucleotide composition and substitution patterns: Does the nc16S rDNA code? If so, what does it code for? More importantly: Does 16S rDNA evolution reflect its own evolution or the evolution of its counterpart nc16S rDNA? The objective of this minireview is to discuss these thoughts. nc strands often encode small RNAs (sRNAs), ancient components of gene regulation. nc16S rDNA sequences from different bacterial groups were used to search for possible matches in the Bacterial Small Regulatory RNA Database. Intriguingly, the sequence of one published sRNA obtained from Legionella pneumophila (GenBank: AE0173541) showed high non-random similarity with nc16S rDNA corresponding in part to the V5 region especially from Legionella and relatives. While the target(s) of this sRNA is unclear at the moment, its mere existence might open up a new chapter in the use of the 16S rDNA to study relationships among bacteria.

  4. Complete Sequence Construction of the Highly Repetitive Ribosomal RNA Gene Repeats in Eukaryotes Using Whole Genome Sequence Data.

    PubMed

    Agrawal, Saumya; Ganley, Austen R D

    2016-01-01

    The ribosomal RNA genes (rDNA) encode the major rRNA species of the ribosome, and thus are essential across life. These genes are highly repetitive in most eukaryotes, forming blocks of tandem repeats that form the core of nucleoli. The primary role of the rDNA in encoding rRNA has been long understood, but more recently the rDNA has been implicated in a number of other important biological phenomena, including genome stability, cell cycle, and epigenetic silencing. Noncoding elements, primarily located in the intergenic spacer region, appear to mediate many of these phenomena. Although sequence information is available for the genomes of many organisms, in almost all cases rDNA repeat sequences are lacking, primarily due to problems in assembling these intriguing regions during whole genome assemblies. Here, we present a method to obtain complete rDNA repeat unit sequences from whole genome assemblies. Limitations of next generation sequencing (NGS) data make them unsuitable for assembling complete rDNA unit sequences; therefore, the method we present relies on the use of Sanger whole genome sequence data. Our method makes use of the Arachne assembler, which can assemble highly repetitive regions such as the rDNA in a memory-efficient way. We provide a detailed step-by-step protocol for generating rDNA sequences from whole genome Sanger sequence data using Arachne, for refining complete rDNA unit sequences, and for validating the sequences obtained. In principle, our method will work for any species where the rDNA is organized into tandem repeats. This will help researchers working on species without a complete rDNA sequence, those working on evolutionary aspects of the rDNA, and those interested in conducting phylogenetic footprinting studies with the rDNA. PMID:27576718

  5. A Natural Polymorphism in rDNA Replication Origins Links Origin Activation with Calorie Restriction and Lifespan

    PubMed Central

    Kwan, Elizabeth X.; Foss, Eric J.; Tsuchiyama, Scott; Alvino, Gina M.; Kruglyak, Leonid; Kaeberlein, Matt; Raghuraman, M. K.; Brewer, Bonita J.; Kennedy, Brian K.; Bedalov, Antonio

    2013-01-01

    Aging and longevity are complex traits influenced by genetic and environmental factors. To identify quantitative trait loci (QTLs) that control replicative lifespan, we employed an outbred Saccharomyces cerevisiae model, generated by crossing a vineyard and a laboratory strain. The predominant QTL mapped to the rDNA, with the vineyard rDNA conferring a lifespan increase of 41%. The lifespan extension was independent of Sir2 and Fob1, but depended on a polymorphism in the rDNA origin of replication from the vineyard strain that reduced origin activation relative to the laboratory origin. Strains carrying vineyard rDNA origins have increased capacity for replication initiation at weak plasmid and genomic origins, suggesting that inability to complete genome replication presents a major impediment to replicative lifespan. Calorie restriction, a conserved mediator of lifespan extension that is also independent of Sir2 and Fob1, reduces rDNA origin firing in both laboratory and vineyard rDNA. Our results are consistent with the possibility that calorie restriction, similarly to the vineyard rDNA polymorphism, modulates replicative lifespan through control of rDNA origin activation, which in turn affects genome replication dynamics. PMID:23505383

  6. Relationships between rDNA, Nop1 and Sir complex in biotechnologically relevant distillery yeasts.

    PubMed

    Adamczyk, Jagoda; Deregowska, Anna; Potocki, Leszek; Kuna, Ewelina; Kaplan, Jakub; Pabian, Sylwia; Kwiatkowska, Aleksandra; Lewinska, Anna; Wnuk, Maciej

    2016-09-01

    Distillery yeasts are poorly characterized physiological group among the Saccharomyces sensu stricto complex. As industrial yeasts are under constant environmental stress during fermentation processes and the nucleolus is a stress sensor, in the present study, nucleolus-related parameters were evaluated in 22 commercially available distillery yeast strains. Distillery yeasts were found to be a heterogeneous group with a variable content and length of rDNA and degree of nucleolus fragmentation. The levels of rDNA were negatively correlated with Nop1 (r = -0.59, p = 0.0038). Moreover, the protein levels of Sir transcriptional silencing complex and longevity regulators, namely Sir1, Sir2, Sir3 and Fob1, were studied and negative correlations between Sir2 and Nop1 (r = -0.45, p = 0.0332), and between Sir2 and Fob1 (r = -0.49, p = 0.0211) were revealed. In general, S. paradoxus group of distillery yeasts with higher rDNA pools and Sir2 level than S. bayanus group was found to be more tolerant to fermentation-associated stress stimuli, namely mild cold/heat stresses and KCl treatment. We postulate that rDNA state may be considered as a novel factor that may modulate a biotechnological process. PMID:27329282

  7. Relationships between rDNA, Nop1 and Sir complex in biotechnologically relevant distillery yeasts.

    PubMed

    Adamczyk, Jagoda; Deregowska, Anna; Potocki, Leszek; Kuna, Ewelina; Kaplan, Jakub; Pabian, Sylwia; Kwiatkowska, Aleksandra; Lewinska, Anna; Wnuk, Maciej

    2016-09-01

    Distillery yeasts are poorly characterized physiological group among the Saccharomyces sensu stricto complex. As industrial yeasts are under constant environmental stress during fermentation processes and the nucleolus is a stress sensor, in the present study, nucleolus-related parameters were evaluated in 22 commercially available distillery yeast strains. Distillery yeasts were found to be a heterogeneous group with a variable content and length of rDNA and degree of nucleolus fragmentation. The levels of rDNA were negatively correlated with Nop1 (r = -0.59, p = 0.0038). Moreover, the protein levels of Sir transcriptional silencing complex and longevity regulators, namely Sir1, Sir2, Sir3 and Fob1, were studied and negative correlations between Sir2 and Nop1 (r = -0.45, p = 0.0332), and between Sir2 and Fob1 (r = -0.49, p = 0.0211) were revealed. In general, S. paradoxus group of distillery yeasts with higher rDNA pools and Sir2 level than S. bayanus group was found to be more tolerant to fermentation-associated stress stimuli, namely mild cold/heat stresses and KCl treatment. We postulate that rDNA state may be considered as a novel factor that may modulate a biotechnological process.

  8. Top2 and Sgs1-Top3 Act Redundantly to Ensure rDNA Replication Termination

    PubMed Central

    Fredsøe, Jacob; Nielsen, Ida; Pedersen, Jakob Madsen; Bentsen, Iben Bach; Lisby, Michael; Bjergbaek, Lotte; Andersen, Anni H

    2015-01-01

    Faithful DNA replication with correct termination is essential for genome stability and transmission of genetic information. Here we have investigated the potential roles of Topoisomerase II (Top2) and the RecQ helicase Sgs1 during late stages of replication. We find that cells lacking Top2 and Sgs1 (or Top3) display two different characteristics during late S/G2 phase, checkpoint activation and accumulation of asymmetric X-structures, which are both independent of homologous recombination. Our data demonstrate that checkpoint activation is caused by a DNA structure formed at the strongest rDNA replication fork barrier (RFB) during replication termination, and consistently, checkpoint activation is dependent on the RFB binding protein, Fob1. In contrast, asymmetric X-structures are formed independent of Fob1 at less strong rDNA replication fork barriers. However, both checkpoint activation and formation of asymmetric X-structures are sensitive to conditions, which facilitate fork merging and progression of replication forks through replication fork barriers. Our data are consistent with a redundant role of Top2 and Sgs1 together with Top3 (Sgs1-Top3) in replication fork merging at rDNA barriers. At RFB either Top2 or Sgs1-Top3 is essential to prevent formation of a checkpoint activating DNA structure during termination, but at less strong rDNA barriers absence of the enzymes merely delays replication fork merging, causing an accumulation of asymmetric termination structures, which are solved over time. PMID:26630413

  9. Comparative physical mapping of the 18S-5.8S-26S rDNA in three sorghum species.

    PubMed

    Sang, Y; Liang, G H

    2000-10-01

    The physical locations of the 18S-5.8S-26S rDNA sequences were examined in three sorghum species by fluorescence in situ hybridization (FISH) using biotin-labeled heterologous 18S-5.8S-26S rDNA probe (pTa71). Each 18S-5.8S-26S rDNA locus occurred at two sites on the chromosomes in Sorghum bicolor (2n = 20) and S. versicolor (2n = 10), but at four sites on the chromosomes of S. halepense (2n = 40) and the tetraploid S. versicolor (2n = 20). Positions of the rDNA loci varied from the interstitial to terminal position among the four accessions of the three sorghum species. The rDNA data are useful for investigation of chromosome evolution and phylogeny. This study excluded S. versicolor as the possible progenitor of S. bicolor.

  10. Distribution of 45S rDNA sites in chromosomes of plants: Structural and evolutionary implications

    PubMed Central

    2012-01-01

    Background 45S rDNA sites are the most widely documented chromosomal regions in eukaryotes. The analysis of the distribution of these sites along the chromosome in several genera has suggested some bias in their distribution. In order to evaluate if these loci are in fact non-randomly distributed and what is the influence of some chromosomal and karyotypic features on the distribution of these sites, a database was built with the position and number of 45S rDNA sites obtained by FISH together with other karyotypic data from 846 plant species. Results In angiosperms the most frequent numbers of sites per diploid karyotype were two and four, suggesting that in spite of the wide dispersion capacity of these sequences the number of rDNA sites tends to be restricted. The sites showed a preferential distribution on the short arms, mainly in the terminal regions. Curiously, these sites were frequently found on the short arms of acrocentric chromosomes where they usually occupy the whole arm. The trend to occupy the terminal region is especially evident in holokinetic chromosomes, where all of them were terminally located. In polyploids there is a trend towards reduction in the number of sites per monoploid complement. In gymnosperms, however, the distribution of rDNA sites varied strongly among the sampled families. Conclusions The location of 45S rDNA sites do not vary randomly, occurring preferentially on the short arm and in the terminal region of chromosomes in angiosperms. The meaning of this preferential location is not known, but some hypotheses are considered and the observed trends are discussed. PMID:23181612

  11. Phylogeographic structure of cotton pest Adelphocoris suturalis (Hemiptera: Miridae): strong subdivision in China inferred from mtDNA and rDNA ITS markers

    PubMed Central

    Zhang, Lijuan; Li, Hu; Li, Shujuan; Zhang, Aibing; Kou, Fei; Xun, Huaizhu; Wang, Pei; Wang, Ying; Song, Fan; Cui, Jianxin; Cui, Jinjie; Gouge, Dawn H.; Cai, Wanzhi

    2015-01-01

    Phylogeographic patterns of some extant plant and vertebrate species have been well studied; however, they are poorly understood in the majority of insects. The study documents analysis of mitochondrial (COI, CYTB and ND5) and nuclear (5.8S rDNA, ITS2 and 28S rDNA) data from 419 individuals of Adelphocoris suturalis, which is one of the main cotton pests found in the 31 locations in China and Japan involved in the study. Results show that the species is highly differentiated between populations from central China and peripheral China regions. Analysis of molecular variance showed a high level of geographical differentiation at different hierarchical levels. Isolation-by-distance test showed no significant correlation between genetic distance and geographical distance among A. suturalis populations, which suggested gene flow is not restricted by distance. In seven peripheral populations, the high levels of genetic differentiation and the small Nem values implied that geographic barriers were more likely restrict gene flow. Neutrality tests and the Bayesian skyline plot suggested population expansion likely happened during the cooling transition between Last Interglacial and Last Glacial Maximum. All lines of evidence suggest that physical barriers, Pleistocene climatic oscillations and geographical heterogeneity have affected the population structure and distribution of this insect in China. PMID:26388034

  12. Phylogeographic structure of cotton pest Adelphocoris suturalis (Hemiptera: Miridae): strong subdivision in China inferred from mtDNA and rDNA ITS markers.

    PubMed

    Zhang, Lijuan; Li, Hu; Li, Shujuan; Zhang, Aibing; Kou, Fei; Xun, Huaizhu; Wang, Pei; Wang, Ying; Song, Fan; Cui, Jianxin; Cui, Jinjie; Gouge, Dawn H; Cai, Wanzhi

    2015-01-01

    Phylogeographic patterns of some extant plant and vertebrate species have been well studied; however, they are poorly understood in the majority of insects. The study documents analysis of mitochondrial (COI, CYTB and ND5) and nuclear (5.8S rDNA, ITS2 and 28S rDNA) data from 419 individuals of Adelphocoris suturalis, which is one of the main cotton pests found in the 31 locations in China and Japan involved in the study. Results show that the species is highly differentiated between populations from central China and peripheral China regions. Analysis of molecular variance showed a high level of geographical differentiation at different hierarchical levels. Isolation-by-distance test showed no significant correlation between genetic distance and geographical distance among A. suturalis populations, which suggested gene flow is not restricted by distance. In seven peripheral populations, the high levels of genetic differentiation and the small Nem values implied that geographic barriers were more likely restrict gene flow. Neutrality tests and the Bayesian skyline plot suggested population expansion likely happened during the cooling transition between Last Interglacial and Last Glacial Maximum. All lines of evidence suggest that physical barriers, Pleistocene climatic oscillations and geographical heterogeneity have affected the population structure and distribution of this insect in China. PMID:26388034

  13. Nuclear and nucleomorph SSU rDNA phylogeny in the Cryptophyta and the evolution of cryptophyte diversity.

    PubMed

    Hoef-Emden, Kerstin; Marin, Birger; Melkonian, Michael

    2002-08-01

    The plastid-bearing members of the Cryptophyta contain two functional eukaryotic genomes of different phylogenetic origin, residing in the nucleus and in the nucleomorph, respectively. These widespread and diverse protists thus offer a unique opportunity to study the coevolution of two different eukaryotic genomes within one group of organisms. In this study, the SSU rRNA genes of both genomes were PCR-amplified with specific primers and phylogenetic analyses were performed on different data sets using different evolutionary models. The results show that the composition of the principal clades obtained from the phylogenetic analyses of both genes was largely congruent, but striking differences in evolutionary rates were observed. These affected the topologies of the nuclear and nucleomorph phylogenies differently, resulting in long-branch attraction artifacts when simple evolutionary models were applied. Deletion of long-branch taxa stabilized the internal branching order in both phylogenies and resulted in a completely resolved topology in the nucleomorph phylogeny. A comparison of the tree topologies derived from SSU rDNA sequences with characters previously used in cryptophyte systematics revealed that the biliprotein type was congruent, but the type of inner periplast component incongruent, with the molecular trees. The latter is indicative of a hidden cellular dimorphism (cells with two periplast types present in a single clonal strain) of presumably widespread occurrence throughout cryptophyte diversity, which, in consequence, has far-reaching implications for cryptophyte systematics as it is practiced today.

  14. Effects of altered gravity on a distribution of rDNA and nucleolar proteins and the expression of nucleolar proteins in plants

    NASA Astrophysics Data System (ADS)

    Sobol, Margaryta; Kordyum, Elizabeth; Medina, Francisco Javier

    The nucleolus is an inner nuclear organelle originated from the activity of hundreds of rRNA genes, typically spanning several megabases. It morphologically reflects the functional events leading to ribosome biogenesis, from the transcription of rDNA through the processing of nascent pre-rRNA to the assembly of pre-ribosomes. A typical nucleolus consists of three major elements, namely fibrillar centers (FCs), the dense fibrillar component (DFC), and granular component (GC). The rate of ribosome biosynthesis and the subnucleolar structure are reliable monitors of the general level of cell metabolism and, consequently, of the rate of cellular growth, being influenced with many external factors, among which altered gravity could be included. Thus, we can hypothesize that the structural organization of the nucleolar subcomponents and the level, distribution and quantitative/qualitative characteristics of the nucleolar proteins would be changed under conditions of altered gravity. To confirm our hypothesis, we applied parallel procedures, such as cytochemistry, immunofluorescence, confocal laser microscopy, immunogold electron microscopy, monoand bi-dimensional electrophoresis and immunoblotting in root meristematic cells from two-day cress seedlings grown under slow horizontal clinorotation (2 rpm) and in stationary control. The complex model of the ultrastructural organization and functions of the nucleolus was created based on the location of rDNA and the nucleolar proteins fibrillarin, NhL90 and NhL68, these latter being cress nucleolin homologues. The principal stages of ribosome biogenesis, namely ribosomal gene activation, rDNA transcription and pre-rRNA processing were reflected in this model. Compared to the pattern shown in control ground gravity conditions, we found firstly a redistribution of both rDNA and nucleolar proteins in nucleolar subcomponents, induced by clinorotation. Under the conditions of altered gravity, nucleolar DNA concentrated

  15. Sequence and structure of the extrachromosomal palindrome encoding the ribosomal RNA genes in Dictyostelium.

    PubMed

    Sucgang, Richard; Chen, Guokai; Liu, Wen; Lindsay, Ryan; Lu, Jing; Muzny, Donna; Shaulsky, Gad; Loomis, William; Gibbs, Richard; Kuspa, Adam

    2003-05-01

    Ribosomal RNAs (rRNAs) are encoded by multicopy families of identical genes. In Dictyostelium and other protists, the rDNA is carried on extrachromosomal palindromic elements that comprise up to 20% of the nuclear DNA. We present the sequence of the 88 kb Dictyostelium rDNA element, noting that the rRNA genes are likely to be the only transcribed regions. By interrogating a library of ordered YAC clones, we provide evidence for a chromosomal copy of the rDNA on chromosome 4. This locus may provide master copies for the stable transmission of the extrachromosomal elements. The extrachromosomal elements were also found to form chromosome-sized clusters of DNA within nuclei of nocodazole-treated cells arrested in mitosis. These clusters resemble true chromosomes and may allow the efficient segregation of the rDNA during mitosis. These rDNA clusters may also explain the cytological observations of a seventh chromosome in this organism.

  16. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    PubMed

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  17. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    PubMed

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease.

  18. The importance of ribosome production, and the 5S RNP–MDM2 pathway, in health and disease

    PubMed Central

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J.

    2016-01-01

    Ribosomes are abundant, large RNA–protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  19. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

    PubMed

    Hori, H; Osawa, S; Iwabuchi, M

    1980-12-11

    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

  20. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  1. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  2. A search for the Bs meson in Υ(5S) decays

    NASA Astrophysics Data System (ADS)

    Shipsey, Ian

    2004-05-01

    The CLEO III detector has recorded approximately 0.5 fb-1 of e^+ e^- annihilation data at the Υ(5S) resonance. Using this data sample, we have searched for fully reconstructed Bs mesons in the reaction Υ(5S) arrow B_s^(*) barB_s^(*)

  3. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  4. The 5S lean method as a tool of industrial management performances

    NASA Astrophysics Data System (ADS)

    Filip, F. C.; Marascu-Klein, V.

    2015-11-01

    Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

  5. Identifications of 5{{s}_{1/2}}-5{{p}_{3/2}} and 5{{s}^{2}}-5s5p EUV transitions of promethium-like Pt, Ir, Os and Re

    NASA Astrophysics Data System (ADS)

    Bekker, H.; Versolato, O. O.; Windberger, A.; Oreshkina, N. S.; Schupp, R.; Baumann, T. M.; Harman, Z.; Keitel, C. H.; Schmidt, P. O.; Ullrich, J.; Crespo López-Urrutia, J. R.

    2015-07-01

    We investigated Pm-, Nd-, and Pr-like spectra in the extreme ultra-violet region around 20 nm of Pt, Ir, Os, and Re (Z = 78-75) produced in the Heidelberg electron beam ion trap. Identification of the transitions was supported by several theoretical calculations, including collisional radiative modeling of the observed spectra. Special attention is given to the identifications of the alkaline-like 5{{s}1/2}-5{{p}3/2} resonance lines in promethium-like highly charged ions. Previous identifications of these lines have been tentative at best due to disagreements with theory and doubts about the experimental charge state identifications. Our experimental results for the 5{{s}1/2}-5{{p}3/2} wavelengths are accurate at the 0.005%-level. Understanding the level-structure of ions near the 4f-5s level crossing is of particular importance for future searches of a possible fine-structure constant variation, and new optical clocks.

  6. Assessment of helminth biodiversity in wild rats using 18S rDNA based metagenomics.

    PubMed

    Tanaka, Ryusei; Hino, Akina; Tsai, Isheng J; Palomares-Rius, Juan Emilio; Yoshida, Ayako; Ogura, Yoshitoshi; Hayashi, Tetsuya; Maruyama, Haruhiko; Kikuchi, Taisei

    2014-01-01

    Parasite diversity has important implications in several research fields including ecology, evolutionary biology and epidemiology. Wide-ranging analysis has been restricted because of the difficult, highly specialised and time-consuming processes involved in parasite identification. In this study, we assessed parasite diversity in wild rats using 18S rDNA-based metagenomics. 18S rDNA PCR products were sequenced using an Illumina MiSeq sequencer and the analysis of the sequences using the QIIME software successfully classified them into several parasite groups. The comparison of the results with those obtained using standard methods including microscopic observation of helminth parasites in the rat intestines and PCR amplification/sequencing of 18S rDNA from isolated single worms suggests that this new technique is reliable and useful to investigate parasite diversity.

  7. Evaluation of amplified rDNA restriction analysis (ARDRA) for the identification of Mycoplasma species

    PubMed Central

    Stakenborg, Tim; Vicca, Jo; Butaye, Patrick; Maes, Dominiek; De Baere, Thierry; Verhelst, Rita; Peeters, Johan; de Kruif, Aart; Haesebrouck, Freddy; Vaneechoutte, Mario

    2005-01-01

    Background Mycoplasmas are present worldwide in a large number of animal hosts. Due to their small genome and parasitic lifestyle, Mycoplasma spp. require complex isolation media. Nevertheless, already over 100 different species have been identified and characterized and their number increases as more hosts are sampled. We studied the applicability of amplified rDNA restriction analysis (ARDRA) for the identification of all 116 acknowledged Mycoplasma species and subspecies. Methods Based upon available 16S rDNA sequences, we calculated and compared theoretical ARDRA profiles. To check the validity of these theoretically calculated profiles, we performed ARDRA on 60 strains of 27 different species and subspecies of the genus Mycoplasma. Results In silico digestion with the restriction endonuclease AluI (AG^CT) was found to be most discriminative and generated from 3 to 13 fragments depending on the Mycoplasma species. Although 73 Mycoplasma species could be differentiated using AluI, other species gave undistinguishable patterns. For these, an additional restriction digestion, typically with BfaI (C^TAG) or HpyF10VI (GCNNNNN^NNGC), was needed for a final identification. All in vitro obtained restriction profiles were in accordance with the calculated fragments based on only one 16S rDNA sequence, except for two isolates of M. columbinum and two isolates of the M. mycoides cluster, for which correct ARDRA profiles were only obtained if the sequences of both rrn operons were taken into account. Conclusion Theoretically, restriction digestion of the amplified rDNA was found to enable differentiation of all described Mycoplasma species and this could be confirmed by application of ARDRA on a total of 27 species and subspecies. PMID:15955250

  8. Karyological Features of Achyrocline (Asteraceae, Gnaphalieae): stable karyotypes, low DNA content variation and linkage of rRNA genes.

    PubMed

    Mazzella, C; Rodríguez, M; Vaio, M; Gaiero, P; López-Carro, B; Santiñaque, F F; Folle, G A; Guerra, M

    2010-01-01

    Many Achyrocline (Asteraceae, tribe Gnaphalieae) species are widely used in Argentina, Brazil and Uruguay as popular medicinal and aromatic plants. Achyrocline flaccida, A. satureioides, A. alata, and A. crassiuscula are distributed in Uruguay and popularly known as 'marcelas'. In order to characterize them, we performed chromosome counts, compared the karyotypes, mapped the 5S and 45S rDNA sites by fluorescent in situ hybridization, and estimated their DNA content. All species were diploid with 2n = 28 chromosomes, this being the first report for A. flaccida and A. crassiuscula. All species showed symmetrical karyotypes composed exclusively of biarmed chromosomes. DNA content estimated by flow cytometry revealed 2C values ranging from 5.73 to 6.03 pg, the amounts for A. alata and A. crassiuscula being higher than those for the other species. Cytogenetic mapping of 5S and 45S rDNA sequences in three species, A. flaccida, A. satureioides and A. alata, showed that in these species both sites co-localized in the pericentromeric region of chromosome 10. This site corresponds to the only DAPI(-) and CMA(+) band of their genomes. Southern blot hybridization of 5S and 45S rDNA on BamHI digested genomic DNA confirmed the tight linkage of these rDNA families into a single unit. Cytological data indicate that Achyrocline species are karyologically poorly differentiated, whereas the uncommon distribution of 5S and 45S rDNA suggests a close relationship with other genera of the Anthemidae tribe.

  9. Genetic diversity of Histoplasma capsulatum strains isolated from Argentina based on nucleotide sequence variations in the internal transcribed spacer regions of rDNA.

    PubMed

    Landaburu, Fernanda; Cuestas, María Luján; Rubio, Andrea; Elías, Nahuel Alejandro; Daneri, Gabriela Lopez; Veciño, Cecilia; Iovannitti, Cristina A; Mujica, María Teresa

    2014-05-01

    The internal transcribed spacer (ITS) regions of rDNA genes of 49 Histoplasma capsulatum (48 from clinical samples and one from soil) isolates were examined. Nucleotide sequence heterogeneity within this region was useful for phylogenetic classification of H. capsulatum and species identification. Thus, in 45 of 49 isolates we observed higher percentages of identity in the nucleotide sequences of ITS regions when the isolates studied herein were compared with those reported in our country in the South America B clade. Phylogenetic analyses of rDNA sequences corresponding to the 537 bp of the ITS region obtained from H. capsulatum isolates assigned South America type B clade (45 isolates), North America type 1 and Asia clade (2 isolates each one). H. capsulatum strains isolated from soil and from patients living in Argentina (45 of 49) clustered together with the H. capsulatum isolates of the South America B clade. The high level of genetic similarity among our isolates suggests that almost one genetic population is present in the microenvironment. Isolates described as H. capsulatum var. capsulatum or var. farciminosum (2 isolates) did not form a monophyletic group and were found in the Asia clade. Subsequent studies are needed to properly identify these isolates.

  10. Genetic diversity of Histoplasma capsulatum strains isolated from Argentina based on nucleotide sequence variations in the internal transcribed spacer regions of rDNA.

    PubMed

    Landaburu, Fernanda; Cuestas, María Luján; Rubio, Andrea; Elías, Nahuel Alejandro; Daneri, Gabriela Lopez; Veciño, Cecilia; Iovannitti, Cristina A; Mujica, María Teresa

    2014-05-01

    The internal transcribed spacer (ITS) regions of rDNA genes of 49 Histoplasma capsulatum (48 from clinical samples and one from soil) isolates were examined. Nucleotide sequence heterogeneity within this region was useful for phylogenetic classification of H. capsulatum and species identification. Thus, in 45 of 49 isolates we observed higher percentages of identity in the nucleotide sequences of ITS regions when the isolates studied herein were compared with those reported in our country in the South America B clade. Phylogenetic analyses of rDNA sequences corresponding to the 537 bp of the ITS region obtained from H. capsulatum isolates assigned South America type B clade (45 isolates), North America type 1 and Asia clade (2 isolates each one). H. capsulatum strains isolated from soil and from patients living in Argentina (45 of 49) clustered together with the H. capsulatum isolates of the South America B clade. The high level of genetic similarity among our isolates suggests that almost one genetic population is present in the microenvironment. Isolates described as H. capsulatum var. capsulatum or var. farciminosum (2 isolates) did not form a monophyletic group and were found in the Asia clade. Subsequent studies are needed to properly identify these isolates. PMID:24299459

  11. Formal Revision of the Alexandrium tamarense Species Complex (Dinophyceae) Taxonomy: The Introduction of Five Species with Emphasis on Molecular-based (rDNA) Classification

    PubMed Central

    John, Uwe; Litaker, R. Wayne; Montresor, Marina; Murray, Shauna; Brosnahan, Michael L.; Anderson, Donald M.

    2015-01-01

    The Alexandrium tamarense species complex is one of the most studied marine dinoflagellate groups due to its ecological, toxicological and economic importance. Several members of this complex produce saxitoxin and its congeners – potent neurotoxins that cause paralytic shellfish poisoning. Isolates from this complex are assigned to A. tamarense, A. fundyense, or A. catenella based on two main morphological characters: the ability to form chains and the presence/absence of a ventral pore between Plates 1′ and 4′. However, studies have shown that these characters are not consistent and/or distinctive. Further, phylogenies based on multiple regions in the rDNA operon indicate that the sequences from morphologically indistinguishable isolates partition into five clades. These clades were initially named based on their presumed geographic distribution, but recently were renamed as Groups I–V following the discovery of sympatry among some groups. In this study we present data on morphology, ITS/5.8S genetic distances, ITS2 compensatory base changes, mating incompatibilities, toxicity, the sxtA toxin synthesis gene, and rDNA phylogenies. All results were consistent with each group representing a distinct cryptic species. Accordingly, the groups were assigned species names as follows: Group I, A. fundyense; Group II, A. mediterraneum; Group III, A. tamarense; Group IV, A. pacificum; Group V, A. australiense. PMID:25460230

  12. Chemical accessibility of the 4.5S RNA in spinach chloroplast ribosomes.

    PubMed Central

    Kumagai, I; Bartsch, M; Subramanian, A R; Erdmann, V A

    1983-01-01

    We have examined the accessibility to diethylpyrocarbonate of spinach chloroplast 4.5S ribosomal RNA when free and when it is part of the ribosomal structure. The modifications in free 4.5S RNA were found mostly in single-stranded regions of the secondary structure model proposed in our previous paper (Kumagai, I. et al. (1982) J.B.C. 257, 12924-28): adenines at positions 17, 19, 33, 36, 54, 55, 60, 64, 68, 72, 77, 86 and 87 were identified as the reactive residues. On the other hand, in 4.5S RNA in 70S ribosomes or 50S subunits, adenine 33 was exclusively modified, and its reactivity was much higher than in free 4.5S RNA. This highly accessible A33 of spinach 4.5S RNA is located within a characteristic seven nucleotide sequence, which is found in the 4.5S rRNAs from spinach, tobacco and a fern but deleted in 4.5S RNAs from maize and wheat. Images PMID:6828382

  13. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    SciTech Connect

    Hirose, Yutaka Harada, Fumio

    2008-01-04

    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus.

  14. Phylogeny of hard- and soft-tick taxa (Acari: Ixodida) based on mitochondrial 16S rDNA sequences.

    PubMed Central

    Black, W C; Piesman, J

    1994-01-01

    Ticks are parasitiform mites that are obligate hematophagous ectoparasites of amphibians, reptiles, birds, and mammals. A phylogeny for tick families, subfamilies, and genera has been described based on morphological characters, life histories, and host associations. To test the existing phylogeny, we sequenced approximately 460 bp from the 3' end of the mitochondrial 16S rRNA gene (rDNA) in 36 hard- and soft-tick species; a mesostigmatid mite, Dermanyssus gallinae, was used as an outgroup. Phylogenies derived using distance, maximum-parsimony, or maximum-likelihood methods were congruent. The existing phylogeny was largely supported with four exceptions. In hard ticks (Ixodidae), members of Haemaphysalinae were monophyletic with the primitive Amblyomminae and members of Hyalomminae grouped within the Rhipicephalinae. In soft ticks (Argasidae), the derived phylogeny failed to support a monophyletic relationship among members of Ornithodorinae and supported placement of Argasinae as basal to the Ixodidae, suggesting that hard ticks may have originated from an Argas-like ancestor. Because most Argas species are obligate bird octoparasites, this result supports earlier suggestions that hard ticks did not evolve until the late Cretaceous. PMID:7937832

  15. Polymorphism of Paramecium pentaurelia (Ciliophora, Oligohymenophorea) strains revealed by rDNA and mtDNA sequences.

    PubMed

    Przyboś, Ewa; Tarcz, Sebastian; Greczek-Stachura, Magdalena; Surmacz, Marta

    2011-05-01

    Paramecium pentaurelia is one of 15 known sibling species of the Paramecium aurelia complex. It is recognized as a species showing no intra-specific differentiation on the basis of molecular fingerprint analyses, whereas the majority of other species are polymorphic. This study aimed at assessing genetic polymorphism within P. pentaurelia including new strains recently found in Poland (originating from two water bodies, different years, seasons, and clones of one strain) as well as strains collected from distant habitats (USA, Europe, Asia), and strains representing other species of the complex. We compared two DNA fragments: partial sequences (349 bp) of the LSU rDNA and partial sequences (618 bp) of cytochrome B gene. A correlation between the geographical origin of the strains and the genetic characteristics of their genotypes was not observed. Different genotypes were found in Kraków in two types of water bodies (Opatkowice-natural pond; Jordan's Park-artificial pond). Haplotype diversity within a single water body was not recorded. Likewise, seasonal haplotype differences between the strains within the artificial water body, as well as differences between clones originating from one strain, were not detected. The clustering of some strains belonging to different species was observed in the phylogenies.

  16. Identification of cephalopod species from the North and Baltic Seas using morphology, COI and 18S rDNA sequences

    NASA Astrophysics Data System (ADS)

    Gebhardt, Katharina; Knebelsberger, Thomas

    2015-09-01

    We morphologically analyzed 79 cephalopod specimens from the North and Baltic Seas belonging to 13 separate species. Another 29 specimens showed morphological features of either Alloteuthis mediaor Alloteuthis subulata or were found to be in between. Reliable identification features to distinguish between A. media and A. subulata are currently not available. The analysis of the DNA barcoding region of the COI gene revealed intraspecific distances (uncorrected p) ranging from 0 to 2.13 % (average 0.1 %) and interspecific distances between 3.31 and 22 % (average 15.52 %). All species formed monophyletic clusters in a neighbor-joining analysis and were supported by bootstrap values of ≥99 %. All COI haplotypes belonging to the 29 Alloteuthis specimens were grouped in one cluster. Neither COI nor 18S rDNA sequences helped to distinguish between the different Alloteuthis morphotypes. For species identification purposes, we recommend the use of COI, as it showed higher bootstrap support of species clusters and less amplification and sequencing failure compared to 18S. Our data strongly support the assumption that the genus Alloteuthis is only represented by a single species, at least in the North Sea. It remained unclear whether this species is A. subulata or A. media. All COI sequences including important metadata were uploaded to the Barcode of Life Data Systems and can be used as reference library for the molecular identification of more than 50 % of the cephalopod fauna known from the North and Baltic Seas.

  17. Taiwanese Trichogramma of Asian Corn Borer: Morphology, ITS-2 rDNA Characterization, and Natural Wolbachia Infection.

    PubMed

    Wu, Li-Hsin; Hoffmann, Ary A; Thomson, Linda J

    2016-01-01

    Egg parasitoids of the genus Trichogramma are natural enemies of many lepidopteran borers in agricultural areas around the world. It is important to identify the correct species and ideally focus on endemic Trichogramma for pest control in particular crops. In this study, Trichogramma wasps were collected from parasitized eggs of Asian corn borer in Southwestern Taiwan. Three Trichogramma species, Trichogramma ostriniae Pang and Chen, Trichogramma chilonis Ishii, and T. sp. y, were identified based on morphology and the nucleotide sequence of the internal transcribed spacer 2 (ITS-2) region of rDNA. Although T. ostriniae and T. sp. y appear to be morphologically similar, ITS-2 identity between these two taxa is only 89%. Surprisingly, a commercially released Trichogramma colony thought to be T. chilonis possessed 99% identity (ITS-2) with the field T. sp. y individuals. This suggests past contamination leading to subsitution of the laboratory-reared T. chilonis colony by T. sp. y. Natural populations of all three Trichogramma species were found to be infected by a single Wolbachia strain which was identified using a wsp gene sequence. PMID:26896674

  18. The phylogeny of native and exotic scallops cultured in China based on 16S rDNA sequences

    NASA Astrophysics Data System (ADS)

    Liu, Baozhong; Dong, Bo; Xiang, Jianhai; Wang, Zaizhao

    2007-01-01

    Scallops of the Family Pectinidae are a valuable resource in marine industry of the world. Understanding the phylogeny of the family is important for the development of the industry. In this study, partial 16S mitochondrial rDNA genes were obtained from 8 scallop species that are commonly cultured indigenous and transplanted species in China. Phylogenetic relationships of Pectinidae were analyzed based on the 8 sequences and other 5 published ones in GenBank, representing 9 genera of the family. The molecular phylogeny trees were constructed using 3 methods with software PHYLIP. The results showe that total 13 species of scallops clustered in 4 clades. Pecten maximus joins P. jacobaeus then Amusium pleuronectes in cluster, indicating close relationship of genus Amusium with Pecten in evolution. P. yessoensis is close to Chlamys farreri and C. islandica. No enough material was available to single out genus Patinopecten as an independent monophyletic subfamily. The position of Adamussium colbecki indicates that it is far from genus Pecten but near to genus Chlamys in evolution.

  19. Angular distribution of Xe 5s. -->. epsilonp photoelectrons: Disagreement between experiment and theory

    SciTech Connect

    Fahlman, A.; Carlson, T.A.; Krause, M.O.

    1983-04-11

    The angular asymmetry parameter ..beta.. for the Xe 5s..-->..epsilonp photoelectrons has been studied with use of synchrotron radiation (h..nu.. = 28--65 eV). The present results show that the relativistic random-phase approximation theory does not satisfactorily describe the Xe 5s photoionization process close to the Cooper minimum and thus require a renewed theoretical approach. The 5s partial photoionization cross section was obtained over the same photon region and the results agree with experimental values found in the literature.

  20. Molecular evolution of homologous gene sequences in germline-limited and somatic chromosomes of Acricotopus.

    PubMed

    Staiber, Wolfgang

    2004-08-01

    The origin of germline-limited chromosomes (Ks) as descendants of somatic chromosomes (Ss) and their structural evolution was recently elucidated in the chironomid Acricotopus. The Ks consist of large S-homologous sections and of heterochromatic segments containing germline-specific, highly repetitive DNA sequences. Less is known about the molecular evolution and features of the sequences in the S-homologous K sections. More information about this was received by comparing homologous gene sequences of Ks and Ss. Genes for 5.8S, 18S, 28S, and 5S ribosomal RNA were choosen for the comparison and therefore isolated first by PCR from somatic DNA of Acricotopus and sequenced. Specific K DNA was collected by microdissection of monopolar moving K complements from differential gonial mitoses and was then amplified by degenerate oligonucleotide primer (DOP)-PCR. With the sequence data of the somatic rDNAs, the homologous 5.8S and 5S rDNA sequences were isolated by PCR from the DOP-PCR sequence pool of the Ks. In addition, a number of K DOP-PCR sequences were directly cloned and analysed. One K clone contained a section of a putative N-acetyltransferase gene. Compared with its homolog from the Ss, the sequence exhibited few nucleotide substitutions (99.2% sequence identity). The same was true for the 5.8S and 5S sequences from Ss and Ks (97.5%-100% identity). This supports the idea that the S-homologous K sequences may be conserved and do not evolve independently from their somatic homologs. Possible mechanisms effecting such conservation of S-derived sequences in the Ks are discussed.

  1. Molecular Organization of the 25S–18S rDNA IGS of Fagus sylvatica and Quercus suber: A Comparative Analysis

    PubMed Central

    Inácio, Vera; Rocheta, Margarida; Morais-Cecílio, Leonor

    2014-01-01

    The 35S ribosomal DNA (rDNA) units, repeated in tandem at one or more chromosomal loci, are separated by an intergenic spacer (IGS) containing functional elements involved in the regulation of transcription of downstream rRNA genes. In the present work, we have compared the IGS molecular organizations in two divergent species of Fagaceae, Fagus sylvatica and Quercus suber, aiming to comprehend the evolution of the IGS sequences within the family. Self- and cross-hybridization FISH was done on representative species of the Fagaceae. The IGS length variability and the methylation level of 18 and 25S rRNA genes were assessed in representatives of three genera of this family: Fagus, Quercus and Castanea. The intergenic spacers in Beech and Cork Oak showed similar overall organizations comprising putative functional elements needed for rRNA gene activity and containing a non-transcribed spacer (NTS), a promoter region, and a 5′-external transcribed spacer. In the NTS: the sub-repeats structure in Beech is more organized than in Cork Oak, sharing some short motifs which results in the lowest sequence similarity of the entire IGS; the AT-rich region differed in both spacers by a GC-rich block inserted in Cork Oak. The 5′-ETS is the region with the higher similarity, having nonetheless different lengths. FISH with the NTS-5′-ETS revealed fainter signals in cross-hybridization in agreement with the divergence between genera. The diversity of IGS lengths revealed variants from ∼2 kb in Fagus, and Quercus up to 5.3 kb in Castanea, and a lack of correlation between the number of variants and the number of rDNA loci in several species. Methylation of 25S Bam HI site was confirmed in all species and detected for the first time in the 18S of Q. suber and Q. faginea. These results provide important clues for the evolutionary trends of the rDNA 25S-18S IGS in the Fagaceae family. PMID:24893289

  2. Molecular organization of the 25S-18S rDNA IGS of Fagus sylvatica and Quercus suber: a comparative analysis.

    PubMed

    Inácio, Vera; Rocheta, Margarida; Morais-Cecílio, Leonor

    2014-01-01

    The 35S ribosomal DNA (rDNA) units, repeated in tandem at one or more chromosomal loci, are separated by an intergenic spacer (IGS) containing functional elements involved in the regulation of transcription of downstream rRNA genes. In the present work, we have compared the IGS molecular organizations in two divergent species of Fagaceae, Fagus sylvatica and Quercus suber, aiming to comprehend the evolution of the IGS sequences within the family. Self- and cross-hybridization FISH was done on representative species of the Fagaceae. The IGS length variability and the methylation level of 18 and 25S rRNA genes were assessed in representatives of three genera of this family: Fagus, Quercus and Castanea. The intergenic spacers in Beech and Cork Oak showed similar overall organizations comprising putative functional elements needed for rRNA gene activity and containing a non-transcribed spacer (NTS), a promoter region, and a 5'-external transcribed spacer. In the NTS: the sub-repeats structure in Beech is more organized than in Cork Oak, sharing some short motifs which results in the lowest sequence similarity of the entire IGS; the AT-rich region differed in both spacers by a GC-rich block inserted in Cork Oak. The 5'-ETS is the region with the higher similarity, having nonetheless different lengths. FISH with the NTS-5'-ETS revealed fainter signals in cross-hybridization in agreement with the divergence between genera. The diversity of IGS lengths revealed variants from ∼ 2 kb in Fagus, and Quercus up to 5.3 kb in Castanea, and a lack of correlation between the number of variants and the number of rDNA loci in several species. Methylation of 25S Bam HI site was confirmed in all species and detected for the first time in the 18S of Q. suber and Q. faginea. These results provide important clues for the evolutionary trends of the rDNA 25S-18S IGS in the Fagaceae family.

  3. The Evolutionary Dynamics of Ribosomal Genes, Histone H3, and Transposable Rex Elements in the Genome of Atlantic Snappers.

    PubMed

    Costa, Gideão Wagner Werneck Félix da; Cioffi, Marcelo de Bello; Bertollo, Luiz Antonio Carlos; Molina, Wagner Franco

    2016-03-01

    Lutjanidae is a family of primarily marine and carnivorous fishes distributed in the Atlantic, Indian, and Pacific oceans, with enormous economic and ecological importance. In order to better clarify the conservative chromosomal evolution of Lutjanidae, we analyzed the evolutionary dynamics of 5 repetitive DNA classes in 5 Lutjanus and in 1 Ocyurus species from the Western Atlantic. The ribosomal 18S sites were generally located in a single chromosome pair, except for L. jocu and L. alexandrei where they are found in 2 pairs. In turn, the 5S rDNA sites are unique, terminal and nonsyntenic with the 18S rDNA sites. In 3 species analyzed, H3 hisDNA genes were found in 1 chromosomal pair. However, while L. jocu presented 2 H3 sites, O. chrysurus showed a noteworthy dispersion of this gene in almost all chromosomes of the karyotype. Retrotransposons Rex1 and Rex3 do not exhibit any association with the explosive distribution of H3 sequences in O. chrysurus. The low compartmentalization of Rex elements, in addition to the general nondynamic distribution of ribosomal and H3 genes, corroborate the karyotype conservatism in Lutjanidae species, also at the microstructural level. However, some "disturbing evolutionary waves" can break down this conservative scenario, as evidenced by the massive random dispersion of H3 hisDNA in the genome of O. chrysurus. The implication of the genomic expansion of H3 histone genes and their functionality remain unknown, although suggesting that they have higher evolutionary dynamics than previously thought. PMID:26792596

  4. Pressure broadening and line shifting of atomic strontium 5s{sup 2} {sup 1}S{sub 0}{yields}5s5p {sup 3}P{sub 1} and 5s5p {sup 3}P{sub 0,1,2}{yields}5s6s {sup 3}S{sub 1} absorption transitions induced by noble-gas collisions

    SciTech Connect

    Holtgrave, Jeremy C.; Wolf, Paul J.

    2005-07-15

    The broadening and shifting of spectral lines induced by collisions with the five noble gases in both the intercombination 5s{sup 2} {sup 1}S{sub 0}{yields}5s5p {sup 3}P{sub 1} system and the triplet 5s5p {sup 3}P{sub 0,1,2}{yields}5s6s {sup 3}S{sub 1} manifold of Sr are studied using tunable dye laser absorption spectroscopy. Cross sections for impact broadening and line shifting are determined from an examination of the spectral line profiles. These results are utilized in an analysis to compute difference potentials modeled by the Lennard-Jones (6-12) potential and the coefficients C{sub 6} and C{sub 12} derived from this analysis are reported.

  5. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    NASA Technical Reports Server (NTRS)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  6. 104. JOB NO. 1347F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    104. JOB NO. 1347-F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD MOTOR COMPANY; LONGITUDINAL SECTION AND TRUSS DETAILS - Ford Motor Company Long Beach Assembly Plant, Assembly Building, 700 Henry Ford Avenue, Long Beach, Los Angeles County, CA

  7. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

    PubMed

    MacKay, R M; Gray, M W; Doolittle, W F

    1980-11-11

    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.

  8. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    PubMed

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p< 0.001). After the implementation of 5S it was observed and determined that facilitating the job and setting up a safe environment created

  9. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    PubMed

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p< 0.001). After the implementation of 5S it was observed and determined that facilitating the job and setting up a safe environment created

  10. Heterochromatin polymorphism and physical mapping of 5S and 18S ribosomal DNA in four populations of Hypostomus strigaticeps (Regan, 1907) from the Paraná River basin, Brazil: evolutionary and environmental correlation.

    PubMed

    Baumgärtner, Lucas; Paiz, Leonardo Marcel; Zawadzki, Cláudio Henrique; Margarido, Vladimir Pavan; Castro, Ana Luiza de Brito Portela

    2014-10-01

    A cytogenetic analysis was performed on four populations of Hypostomus strigaticeps from the Paraná River basin, Brazil. Two populations were collected from the large channel river at the Itaipu reservoir area and the other two were from the upper stretches of tributaries of the Paraná River. All populations showed 2n=72 chromosomes (12m+12sm+18st+30a), intra- and interpopulation 18S rDNA site polymorphisms (two to three acrocentric chromosome pairs), and multiple 5S rDNA sites in three chromosome pairs (4, 21, and 28). C-banding revealed heterochromatin located in the centromere and pericentromere regions of most chromosome; however, large heterochromatic blocks (CMA3(-)/DAPI(+)) on the long arm of acrocentric chromosomes identified intra- and interpopulation polymorphism. The amount and distribution of heterochromatin seem to be correlated to biogeographical characteristics of H. strigaticeps along the Paraná River. Morphometric results also showed diversity among the populations, suggesting phenotypic plasticity of this species. Evolutionary, taxonomy, and biogeographical approaches with regard to H. strigaticeps and interrelationships in Hypostomus are discussed.

  11. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 8 Aliens and Nationality 1 2013-01-01 2013-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  12. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 8 Aliens and Nationality 1 2012-01-01 2012-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  13. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  14. Molecular analysis of complete ssu to lsu rdna sequence in the harmful dinoflagellate alexandrium tamarense (korean isolate, HY970328M)

    NASA Astrophysics Data System (ADS)

    Ki, Jang-Seu; Han, Myung-Soo

    2005-09-01

    New PCR primers (N=18) were designed for the isolation of complete SSU to LSU rDNA sequences from the dinoflagellate Alexandrium tamarense. Standard PCR, employing each primer set selected for amplifications of less than 1.5 kb, successfully amplified the expected rDNA regions of A. tamarense (Korean isolate, HY970328M). Complete SSU, LSU rDNAs and ITS sequences, including 5.8S rDNA, were recorded at 1,800 bp, 520 bp and 3,393 bp, respectively. The LSU rDNA sequence was the first report in Alexandrium genus. No intron was found in the LSU rRNA coding region. Twelve D-domains within the LSU rDNA were put together into 1,879 bp (44.4% G+C), and cores into 1514 bp (42.8% G+C). The core sequence was significantly different (0.0867 of genetic distance, 91% sequence similarity) in comparison with Prorocentrum micans (GenBank access. no. X16108). The D2 region was the longest in length (300 bp) and highly variable among the 12 D-domains. In a phylogenetic analysis using complete LSU rDNA sequences of a variety of phytoplankton, A tamarense was clearly separated with high resolution against other species. The result suggests that the sequence may resolve the taxonomic ambiguities of Alexandrium genus, particularly of the tamarensis complex.

  15. Sequence variation of the rDNA ITS regions within and between anastomosis groups in Rhizoctonia solani.

    PubMed

    Kuninaga, S; Natsuaki, T; Takeuchi, T; Yokosawa, R

    1997-09-01

    Sequence analysis of the rDNA region containing the internal transcribed spacer (ITS) regions and the 5.8s rDNA coding sequence was used to evaluate the genetic diversity of 45 isolates within and between anastomosis groups (AGs) in Rhizoctonia solani. The 5.8s rDNA sequence was completely conserved across all the AGs examined, whereas the ITS rDNA sequence was found to be highly variable among isolates. The sequence homology in the ITS regions was above 96% for isolates of the same subgroup, 66-100% for isolates of different subgroups within an AG, and 55-96% for isolates of different AGs. In neighbor-joining trees based on distances derived from ITS-5.8s rDNA sequences, subgroups IA, IB and IC within AG-1 and subgroups HG-I and HG-II within AG-4 were placed on statistically significant branches as assessed by bootstrap analysis. These results suggest that sequence analysis of ITS rDNA regions of R. solani may be a valuable tool for identifying AG subgroups of biological significance.

  16. The 5S RNP couples p53 homeostasis to ribosome biogenesis and nucleolar stress.

    PubMed

    Sloan, Katherine E; Bohnsack, Markus T; Watkins, Nicholas J

    2013-10-17

    Several proto-oncogenes and tumor suppressors regulate the production of ribosomes. Ribosome biogenesis is a major consumer of cellular energy, and defects result in p53 activation via repression of mouse double minute 2 (MDM2) homolog by the ribosomal proteins RPL5 and RPL11. Here, we report that RPL5 and RPL11 regulate p53 from the context of a ribosomal subcomplex, the 5S ribonucleoprotein particle (RNP). We provide evidence that the third component of this complex, the 5S rRNA, is critical for p53 regulation. In addition, we show that the 5S RNP is essential for the activation of p53 by p14(ARF), a protein that is activated by oncogene overexpression. Our data show that the abundance of the 5S RNP, and therefore p53 levels, is determined by factors regulating 5S complex formation and ribosome integration, including the tumor suppressor PICT1. The 5S RNP therefore emerges as the critical coordinator of signaling pathways that couple cell proliferation with ribosome production.

  17. One-stage surgery through posterior approach-for L5-S1 spondyloptosis

    PubMed Central

    Suslu, Hikmet Turan; Celikoglu, Erhan; Borekcı, Ali; Hıcdonmez, Tufan; Suslu, Hüsnü

    2011-01-01

    Grade 5 spondylolisthesis or spondyloptosis is a rare condition. Generally, the surgical management of spondyloptosis includes multi-staged procedures instead of one-staged procedures. One-stage treatment for spondyloptosis is very rare. A 15-year-old girl with L5-S1 spondyloptosis was admitted with severe low back pain. There was no history of trauma. The patient underwent L5 laminectomy, L5-S1 discectomy, resection of sacral dome, reduction, L3-L4-L5-S1 pedicular screw fixation, and interbody-posterolateral fusion through the posterior approach. The reduction was maintained with bilateral L5-S1 discectomy, resection of the sacral dome, and transpedicular instrumentation from L3 to S1. In this particular case, one-staged approach was adequate for the treatment of L5-S1 spondyloptosis. One-staged surgery using the posterior approach may be adequate for the treatment of L5-S1 spondyloptosis while avoiding the risks inherent in anterior approaches. PMID:23125496

  18. Direct 5S rRNA Assay for Monitoring Mixed-Culture Bioprocesses

    PubMed Central

    Stoner, D. L.; Browning, C. K.; Bulmer, D. K.; Ward, T. E.; MacDonell, M. T.

    1996-01-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species extracted from collected biomass. Separation is based on the unique migration behavior of each 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the genera Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. PMID:16535333

  19. Phylogeny of the eelpout genus Lycodes (Pisces, Zoarcidae) as inferred from mitochondrial cytochrome b and 12S rDNA.

    PubMed

    Møller, Peter R; Gravlund, Peter

    2003-03-01

    The bottom-dwelling and species-rich eelpout genus Lycodes Reinhardt has a great potential for the study of Arctic marine speciation. Subdivision of the genus has been based on single or few morphological characters (e.g., lateral line configuration) with contradicting results and phylogenetic approaches have not been attended. Here we present the first phylogenetic analysis of the genus employing DNA sequences of the mitochondrial genes cytochrome b and 12S rDNA (714 bp). The analysis with the two genes combined resulted in two equally parsimonious trees. In both cladograms most of the previously suggested subgroups are para- or polyphyletic, except for the so-called short-tailed Lycodes spp., with a short tail, a single mediolateral lateral line configuration and a shallow or filled otolith sulcus. The group of long-tailed Lycodes spp., with ventral or ventro-medio-lateral types of lateral line configuration and a deep otolith sulcus, appears to be paraphyletic, since Pacific and Atlantic species in this group are not each other's closest relatives. Thus, the short-tailed species are placed in a derived clade, indicating a secondary shortening of the tail, and a "slope to shore" type of evolution. This is not in accordance with earlier assumptions of the more elongate, deeper living species being the more derived. The basal position of long-tailed Pacific species supports earlier theories of Pacific origin of the genus/family. Small genetic differences between Arctic/Atlantic species indicate a rather recent radiation in these areas after the opening of the Bering Strait 3.0-3.5 million years ago. PMID:12644398

  20. The origin of the 5S ribosomal RNA molecule could have been caused by a single inverse duplication: strong evidence from its sequences.

    PubMed

    Branciamore, Sergio; Di Giulio, Massimo

    2012-04-01

    The secondary structure of the 5S ribosomal RNA (5S rRNA) molecule shows a high degree of symmetry. In order to explain the origin of this symmetry, it has been conjectured that one half of the 5S rRNA molecule was its precursor and that an indirect duplication of this precursor created the other half and thus the current symmetry of the molecule. Here, we have subjected to an empirical test both the indirect duplication model, analysing a total of 684 5S rRNA sequences for complementarity between the two halves of the 5S rRNA, and the direct duplication model analysing in this case the similarity between the two halves of this molecule. In intra- and inter-molecule and intra- and inter-domain comparisons, we find a high statistical support to the hypothesis of a complementarity relationship between the two halves of the 5S rRNA molecule, denying vice versa the hypothesis of similarity between these halves. Therefore, these observations corroborate the indirect duplication model at the expense of the direct duplication model, as reason of the origin of the 5S rRNA molecule. More generally, we discuss and favour the hypothesis that all RNAs and proteins, which present symmetry, did so through gene duplication and not by gradualistic accumulation of few monomers or segments of molecule into a gradualistic growth process. This would be the consequence of the very high propensity that nucleic acids have to be subjected to duplications.

  1. Disruption of the 5S RNP-Mdm2 interaction significantly improves the erythroid defect in a mouse model for Diamond-Blackfan anemia.

    PubMed

    Jaako, P; Debnath, S; Olsson, K; Zhang, Y; Flygare, J; Lindström, M S; Bryder, D; Karlsson, S

    2015-11-01

    Diamond-Blackfan anemia (DBA) is a congenital erythroid hypoplasia caused by haploinsufficiency of genes encoding ribosomal proteins (RPs). Perturbed ribosome biogenesis in DBA has been shown to induce a p53-mediated ribosomal stress response. However, the mechanisms of p53 activation and its relevance for the erythroid defect remain elusive. Previous studies have indicated that activation of p53 is caused by the inhibition of mouse double minute 2 (Mdm2), the main negative regulator of p53, by the 5S ribonucleoprotein particle (RNP). Meanwhile, it is not clear whether this mechanism solely mediates the p53-dependent component found in DBA. To approach this question, we crossed our mouse model for RPS19-deficient DBA with Mdm2(C305F) knock-in mice that have a disrupted 5S RNP-Mdm2 interaction. Upon induction of the Rps19 deficiency, Mdm2(C305F) reversed the p53 response and improved expansion of hematopoietic progenitors in vitro, and ameliorated the anemia in vivo. Unexpectedly, disruption of the 5S RNP-Mdm2 interaction also led to selective defect in erythropoiesis. Our findings highlight the sensitivity of erythroid progenitor cells to aberrations in p53 homeostasis mediated by the 5S RNP-Mdm2 interaction. Finally, we provide evidence indicating that physiological activation of the 5S RNP-Mdm2-p53 pathway may contribute to functional decline of the hematopoietic system in a cell-autonomous manner over time.

  2. Ultrastructure and 18S rDNA phylogeny of Apoikia lindahlii comb. nov. (Chrysophyceae) and its epibiontic protists, Filos agilis gen. et sp. nov. (Bicosoecida) and Nanos amicus gen. et sp. nov. (Bicosoecida).

    PubMed

    Kim, Eunsoo; Yubuki, Naoji; Leander, Brian S; Graham, Linda E

    2010-04-01

    Three heterotrophic stramenopiles--Apoikia lindahlii comb. nov. (Chrysophyceae), Filos agilis gen. et sp. nov. (Bicosoecida), and Nanos amicus gen. et sp. nov. (Bicosoecida)--were isolated from acidic peat bogs. The biflagellate A. lindahlii forms loose irregular colonies from which swimming cells may detach, and produces extensive mucilaginous material containing bacterial cells. Phylogenetic analyses of small subunit rDNA sequences demonstrated that A. lindahlii branches within the Chrysophyceae. While A. lindahlii is an obligate heterotroph, ultrastructural observations revealed a leukoplast in the perinuclear region. The pico-sized uniflagellates F. agilis and N. amicus were isolated from separate lakes and within the mucilage of A. lindahlii, suggesting their close associations in natural habitats. In SSU rDNA phylogenies, F. agilis and N. amicus were closely related to the bicosoecids Adriamonas, Siluania, Paramonas, and Nerada. While Filos, Nanos, and Siluania are similar in light microscopic features, their SSU rDNA gene sequences differed significantly (>8% differences) and were not monophyletic. Both F. agilis and N. amicus have a cytostome/cytopharynx particle ingestion apparatus. Bacterial cells and material similar to the mucilage of A. lindahlii occurred within the food vacuole of F. agilis and N. amicus. The nature of association between A. lindahlii and its epibiontic bicosoecids is discussed.

  3. Extremely high copy numbers and polymorphisms of the rDNA operon estimated from single cell analysis of oligotrich and peritrich ciliates.

    PubMed

    Gong, Jun; Dong, Jun; Liu, Xihan; Massana, Ramon

    2013-05-01

    The copy number and sequence variation of the ribosomal DNA (rDNA) operon are of functional significance in evolution and ecology of organisms. However, the relationship between copy number and sequence variation of rDNA in protists has been rarely studied. Here we quantified rDNA copy numbers of oligotrich and peritrich ciliate species using single-cell quantitative PCR. We also examined the rDNA sequence variation by using single-cell PCR, cloning, and sequencing of multiple clones. We found that the rDNA copy numbers per cell were extremely high and different among even congeners, with the highest record of about 310,000. There was substantial intraindividual haplotype diversity and nucleotide diversity for the rDNA markers, with sequence differences primarily characterized by single nucleotide polymorphisms. Haplotype and nucleotide diversity was positively correlated to the rDNA copy number. Our findings provide evidence that: (1) ciliates generally have much higher rDNA copy numbers than other protists and fungi, which could lead to overestimation of the relative abundance of ciliates in environmental samples when rDNA sequence-based methodologies are used; and that (2) the rDNA might not always evolve in a strictly concerted manner in ciliates, which may raise problems in rDNA-based inference of species richness and phylogeny.

  4. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  5. A critical role for noncoding 5S rRNA in regulating Mdmx stability.

    PubMed

    Li, Muyang; Gu, Wei

    2011-09-16

    Both p53 and Mdmx are ubiquitinated and degraded by the same E3 ligase Mdm2; interestingly, however, while p53 is rapidly degraded by Mdm2, Mdmx is a stable protein in most cancer cells. Thus, the mechanism by which Mdmx is degraded by Mdm2 needs further elucidation. Here, we identified the noncoding 5S rRNA as a major component of Mdmx-associated complexes from human cells. We show that 5S rRNA acts as a natural inhibitor of Mdmx degradation by Mdm2. RNAi-mediated knockdown of endogenous 5S rRNA, while not affecting p53 levels, significantly induces Mdmx degradation and, subsequently, activates p53-dependent growth arrest. Notably, 5S rRNA binds the RING domain of Mdmx and blocks its ubiquitination by Mdm2, whereas Mdm2-mediated p53 ubiquitination remains intact. These results provide insights into the differential effects on p53 and Mdmx by Mdm2 in vivo and reveal a critical role for noncoding 5S rRNA in modulating the p53-Mdmx axis.

  6. Direct 5S rRNA assay for monitoring mixed-culture bioprocesses

    SciTech Connect

    Stoner, D.L.; Bulmer, D.K.; Ward, T.E.

    1996-06-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis in denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the general Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. 40 refs., 12 figs., 1 tab.

  7. Affinity chromatography of Drosophila melanogaster ribosomal proteins to 5S rRNA.

    PubMed

    Stark, B C; Chooi, W Y

    1985-02-20

    The binding of Drosophila melanogaster ribosomal proteins to D. melanogaster 5S rRNA was studied using affinity chromatography of total ribosomal proteins (TP80) on 5S rRNA linked via adipic acid dihydrazide to Sepharose 4B. Ribosomal proteins which bound 5S rRNA at 0.3 M potassium chloride and were eluted at 1 M potassium chloride were identified as proteins 1, L4, 2/3, L14/L16, and S1, S2, S3, S4, S5, by two-dimensional polyacrylamide gel electrophoresis. Using poly A-Sepharose 4B columns as a model of non-specific binding, we found that a subset of TP80 proteins is also bound. This subset, while containing some of the proteins bound by 5S rRNA columns, was distinctly different from the latter subset, indicating that the binding to 5S rRNA was specific for that RNA species. PMID:3923010

  8. 5 S and 5.8 S ribosomal RNA sequences and protist phylogenetics.

    PubMed

    Walker, W F

    1985-01-01

    More than 100 5 S 5.8 S rRNA sequences from protists, including fungi, are known. Through a combination of quantitative treeing and special consideration of "signature' nucleotide combinations, the most significant phylogenetic implications of these data are emphasized. Also, limitations of the data for phylogenetic inferences are discussed and other significant data are brought to bear on the inferences obtained. 5 S sequences from red algae are seen as the most isolated among eukaryotics. A 5 S sequence lineage consisting of oomycetes, euglenoids, most protozoa, most slime molds and perhaps dinoflagellates and mesozoa is defined. Such a lineage is not evident from 5.8 S rRNA or cytochrome c sequence data. 5 S sequences from Ascomycota and Basidiomycota are consistent with the proposal that each is derived from a mycelial form with a haploid yeast phase and simple septal pores, probably most resembling present Taphrinales. 5 S sequences from Chytridiomycota and Zygomycota are not clearly distinct from each other and suggest that a major lineage radiation occurred in the early history of each. Qualitative biochemical data clearly supports a dichotomy between an Ascomycota-Basidiomycota lineage and a Zygomycota-Chytridiomycota lineage.

  9. Phylogenetic relationships among higher Nemertean (Nemertea) Taxa inferred from 18S rDNA sequences.

    PubMed

    Sundberg, P; Turbeville, J M; Lindh, S

    2001-09-01

    We estimated the phylogenetic relationships of 15 nemertean (phylum Nemertea) species from the four subclasses Hoplo-, Hetero-, Palaeo-, and Bdellonemertea with 18S rDNA sequence data. Three outgroup taxa were used for rooting: Annelida, Platyhelminthes, and Mollusca. Parsimony and maximum-likelihood analyses supported the monophyletic status of the Heteronemertea and a taxon consisting of hoplonemerteans and Bdellonemertea, while indicating that Palaeonemertea is paraphyletic. The monophyletic status of the two nemertean classes Anopla and Enopla is not supported by the data. The unambiguous clades are well supported, as assessed by a randomization test (bootstrapping) and branch support values.

  10. Molecular authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii by ITS and 5S rRNA spacer sequencing.

    PubMed

    Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui

    2007-01-01

    In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii. PMID:17202681

  11. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    NASA Technical Reports Server (NTRS)

    Luehrsen, K. R.; Fox, G. E.

    1981-01-01

    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  12. Characterization of the L4-L5-S1 motion segment using the stepwise reduction method.

    PubMed

    Jaramillo, Héctor Enrique; Puttlitz, Christian M; McGilvray, Kirk; García, José J

    2016-05-01

    The two aims of this study were to generate data for a more accurate calibration of finite element models including the L5-S1 segment, and to find mechanical differences between the L4-L5 and L5-S1 segments. Then, the range of motion (ROM) and facet forces for the L4-S1 segment were measured using the stepwise reduction method. This consists of sequentially testing and reducing each segment in nine stages by cutting the ligaments, facet capsules, and removing the nucleus. Five L4-S1 human segments (median: 65 years, range: 53-84 years, SD=11.0 years) were loaded under a maximum pure moment of 8Nm. The ROM was measured using stereo-photogrammetry via tracking of three markers and the facet contact forces (CF) were measured using a Tekscan system. The ROM for the L4-L5 segment and all stages showed good agreement with published data. The major differences in ROM between the L4-L5 and L5-S1 segments were found for lateral bending and all stages, for which the L4-L5 ROM was about 1.5-3 times higher than that of the L5-S1 segment, consistent with L5-S1 facet CF about 1.3 to 4 times higher than those measured for the L4-L5 segment. For the other movements and few stages, the L4-L5 ROM was significantly lower that of the L5-S1 segment. ROM and CF provide important baseline data for more accurate calibration of FE models and to understand the role that their structures play in lower lumbar spine mechanics.

  13. Characterization of the L4-L5-S1 motion segment using the stepwise reduction method.

    PubMed

    Jaramillo, Héctor Enrique; Puttlitz, Christian M; McGilvray, Kirk; García, José J

    2016-05-01

    The two aims of this study were to generate data for a more accurate calibration of finite element models including the L5-S1 segment, and to find mechanical differences between the L4-L5 and L5-S1 segments. Then, the range of motion (ROM) and facet forces for the L4-S1 segment were measured using the stepwise reduction method. This consists of sequentially testing and reducing each segment in nine stages by cutting the ligaments, facet capsules, and removing the nucleus. Five L4-S1 human segments (median: 65 years, range: 53-84 years, SD=11.0 years) were loaded under a maximum pure moment of 8Nm. The ROM was measured using stereo-photogrammetry via tracking of three markers and the facet contact forces (CF) were measured using a Tekscan system. The ROM for the L4-L5 segment and all stages showed good agreement with published data. The major differences in ROM between the L4-L5 and L5-S1 segments were found for lateral bending and all stages, for which the L4-L5 ROM was about 1.5-3 times higher than that of the L5-S1 segment, consistent with L5-S1 facet CF about 1.3 to 4 times higher than those measured for the L4-L5 segment. For the other movements and few stages, the L4-L5 ROM was significantly lower that of the L5-S1 segment. ROM and CF provide important baseline data for more accurate calibration of FE models and to understand the role that their structures play in lower lumbar spine mechanics. PMID:27017302

  14. Strong nondipole effect created by multielectron correlation in 5s photoionization of xenon

    SciTech Connect

    Ricz, S.; Koever, A.; Varga, D.; Ricsoka, T.; Sankari, R.; Jurvansuu, M.; Nikkinen, J.; Aksela, H.; Aksela, S.

    2003-01-01

    The angular distribution of the Xe 5s photoelectrons was measured in the 90-225 eV photon energy range using linearly polarized synchrotron radiation. The experimentally determined angular distribution parameters were compared with theoretical values obtained from calculations based on the random-phase approximation and the time-dependent density-functional theory. Experiment shows that the dipole ({beta}) and nondipole ({gamma}) parameters vary strongly as a function of the photon energy, in accordance with calculations that account for the interchannel coupling. Nondipole effects observed clearly in experiment confirm the role of multielectron correlation in describing the 5s photoionization of Xe far from the ionization threshold.

  15. The radiative lifetime of the 5S(0)2 metastable level of O(2+)

    NASA Technical Reports Server (NTRS)

    Johnson, B. C.; Smith, P. L.; Knight, R. D.

    1984-01-01

    The radiative lifetime of the 5S(0)2 metastable level of O(2+) was measured as 1.22 + or - 0.08 ms at the 90 percent confidence level by observing the time dependence of the spontaneous emission from metastable ions created and stored in a cylindrical radio-frequency ion trap. The intersystem line emission 2s(2)2p(2) 3P - 2s2p(3) 5S(0) was observed at 1660.8 and 1666.2 A. Discrepancies between measured and calculated values indicate that certain calculated transition probabilities for intersystem lines may be less reliable than previously believed.

  16. The nucleotide sequences of 5S rRNAs from three ciliated protozoa.

    PubMed Central

    Kumazaki, T; Hori, H; Osawa, S; Mita, T; Higashinakagawa, T

    1982-01-01

    The nucleotide sequences of 5S rRNAs from three ciliated protozoa, Paramecium tetraurelia, Tetrahymena thermophila and Blepharisma japonicum have been determined. All of them are 120 nucleotides long and the sequence of probable tRNA binding site of position 41-44 is GAAC which is characteristic of the plant 5S rRNAs. The sequence similarity percents are 87% (Paramecium/Tetrahymena), 86% (Paramecium/Blepharisma) and 79% (Tetrahymena/Blepharisma), suggesting a close relationship of these three ciliates. PMID:7122243

  17. Relationship between organization and function of ribosomal genes in Drosophila melanogaster

    SciTech Connect

    Karpen, G.H.

    1987-01-01

    In most eukaryotic organisms, the genes that encode the 18S and 28S ribosomal RNAs (rDNA genes) are tandemly repeated, and are located in constitutive heterochromatin and/or centromeric or telomeric regions. P-element mediated transformation was used to investigate the relationship between rDNA organization and function in Drosophila melanogaster. Tritiated-uridine incorporation under heat shock conditions and in situ hybridization to rRNA were used to demonstrate that a single rDNA gene inserted into euchromatin can be transcribed at a high rate, in polytene nuclei. P-element-mediated transformation of a single Drosophila rDNA gene was also utilized to investigate the ability of ribosomal DNA to organize a nucleolus. Cytological approaches demonstrated that structures resembling the endogenous nucleoli were preferentially associated with four different sites of rDNA insertion, in polytene nuclei. These mini-nucleoli also contained components specific to the nucleolus, as shown by in situ hybridization to rRNA and indirect immunofluorescence with an antibody that binds to Drosophila nucleoli. The transformed genes were able to partially rescue mutant phenotypes due to a deficiency of rDNA, indicating that the mini-nucleoli were functional.

  18. Molecular Cytogenetic Analysis of the European Hake Merluccius merluccius (Merlucciidae, Gadiformes): U1 and U2 snRNA Gene Clusters Map to the Same Location.

    PubMed

    García-Souto, Daniel; Troncoso, Tomás; Pérez, Montse; Pasantes, Juan José

    2015-01-01

    The European hake (Merluccius merluccius) is a highly valuable and intensely fished species in which a long-term alive stock has been established in captivity for aquaculture purposes. Due to their huge economic importance, genetic studies on hakes were mostly focused on phylogenetic and phylogeographic aspects; however chromosome numbers are still not described for any of the fifteen species in the genus Merluccius. In this work we report a chromosome number of 2n = 42 and a karyotype composed of three meta/submetacentric and 18 subtelo/telocentric chromosome pairs. Telomeric sequences appear exclusively at both ends of every single chromosome. Concerning rRNA genes, this species show a single 45S rDNA cluster at an intercalary location on the long arm of subtelocentric chromosome pair 12; the single 5S rDNA cluster is also intercalary to the long arm of chromosome pair 4. While U2 snRNA gene clusters map to a single subcentromeric position on chromosome pair 13, U1 snRNA gene clusters seem to appear on almost all chromosome pairs, but showing bigger clusters on pairs 5, 13, 16, 17 and 19. The brightest signals on pair 13 are coincident with the single U2 snRNA gene cluster signals. Therefore, the use of these probes allows the unequivocal identification of at least 7 of the chromosome pairs that compose the karyotype of Merluccius merluccius thus opening the way to integrate molecular genetics and cytological data on the study of the genome of this important species. PMID:26716701

  19. Molecular Cytogenetic Analysis of the European Hake Merluccius merluccius (Merlucciidae, Gadiformes): U1 and U2 snRNA Gene Clusters Map to the Same Location

    PubMed Central

    García-Souto, Daniel; Troncoso, Tomás; Pérez, Montse; Pasantes, Juan José

    2015-01-01

    The European hake (Merluccius merluccius) is a highly valuable and intensely fished species in which a long-term alive stock has been established in captivity for aquaculture purposes. Due to their huge economic importance, genetic studies on hakes were mostly focused on phylogenetic and phylogeographic aspects; however chromosome numbers are still not described for any of the fifteen species in the genus Merluccius. In this work we report a chromosome number of 2n = 42 and a karyotype composed of three meta/submetacentric and 18 subtelo/telocentric chromosome pairs. Telomeric sequences appear exclusively at both ends of every single chromosome. Concerning rRNA genes, this species show a single 45S rDNA cluster at an intercalary location on the long arm of subtelocentric chromosome pair 12; the single 5S rDNA cluster is also intercalary to the long arm of chromosome pair 4. While U2 snRNA gene clusters map to a single subcentromeric position on chromosome pair 13, U1 snRNA gene clusters seem to appear on almost all chromosome pairs, but showing bigger clusters on pairs 5, 13, 16, 17 and 19. The brightest signals on pair 13 are coincident with the single U2 snRNA gene cluster signals. Therefore, the use of these probes allows the unequivocal identification of at least 7 of the chromosome pairs that compose the karyotype of Merluccius merluccius thus opening the way to integrate molecular genetics and cytological data on the study of the genome of this important species. PMID:26716701

  20. Effects of 16S rDNA sampling on estimates of the number of endosymbiont lineages in sucking lice

    PubMed Central

    Burleigh, J. Gordon; Light, Jessica E.; Reed, David L.

    2016-01-01

    Phylogenetic trees can reveal the origins of endosymbiotic lineages of bacteria and detect patterns of co-evolution with their hosts. Although taxon sampling can greatly affect phylogenetic and co-evolutionary inference, most hypotheses of endosymbiont relationships are based on few available bacterial sequences. Here we examined how different sampling strategies of Gammaproteobacteria sequences affect estimates of the number of endosymbiont lineages in parasitic sucking lice (Insecta: Phthirapatera: Anoplura). We estimated the number of louse endosymbiont lineages using both newly obtained and previously sequenced 16S rDNA bacterial sequences and more than 42,000 16S rDNA sequences from other Gammaproteobacteria. We also performed parametric and nonparametric bootstrapping experiments to examine the effects of phylogenetic error and uncertainty on these estimates. Sampling of 16S rDNA sequences affects the estimates of endosymbiont diversity in sucking lice until we reach a threshold of genetic diversity, the size of which depends on the sampling strategy. Sampling by maximizing the diversity of 16S rDNA sequences is more efficient than randomly sampling available 16S rDNA sequences. Although simulation results validate estimates of multiple endosymbiont lineages in sucking lice, the bootstrap results suggest that the precise number of endosymbiont origins is still uncertain. PMID:27547523

  1. Effects of 16S rDNA sampling on estimates of the number of endosymbiont lineages in sucking lice.

    PubMed

    Allen, Julie M; Burleigh, J Gordon; Light, Jessica E; Reed, David L

    2016-01-01

    Phylogenetic trees can reveal the origins of endosymbiotic lineages of bacteria and detect patterns of co-evolution with their hosts. Although taxon sampling can greatly affect phylogenetic and co-evolutionary inference, most hypotheses of endosymbiont relationships are based on few available bacterial sequences. Here we examined how different sampling strategies of Gammaproteobacteria sequences affect estimates of the number of endosymbiont lineages in parasitic sucking lice (Insecta: Phthirapatera: Anoplura). We estimated the number of louse endosymbiont lineages using both newly obtained and previously sequenced 16S rDNA bacterial sequences and more than 42,000 16S rDNA sequences from other Gammaproteobacteria. We also performed parametric and nonparametric bootstrapping experiments to examine the effects of phylogenetic error and uncertainty on these estimates. Sampling of 16S rDNA sequences affects the estimates of endosymbiont diversity in sucking lice until we reach a threshold of genetic diversity, the size of which depends on the sampling strategy. Sampling by maximizing the diversity of 16S rDNA sequences is more efficient than randomly sampling available 16S rDNA sequences. Although simulation results validate estimates of multiple endosymbiont lineages in sucking lice, the bootstrap results suggest that the precise number of endosymbiont origins is still uncertain. PMID:27547523

  2. Distribution of 18S rDNA sites and absence of the canonical TTAGG insect telomeric repeat in parasitoid Hymenoptera.

    PubMed

    Gokhman, Vladimir E; Anokhin, Boris A; Kuznetsova, Valentina G

    2014-08-01

    Karyotypes of six species belonging to three main clades of parasitoid Hymenoptera, the superfamilies Ichneumonoidea (Ichneumonidae: Ichneumon amphibolus), Cynipoidea (Cynipidae: Diplolepis rosae) and Chalcidoidea (Eurytomidae: Eurytoma robusta, Eu. serratulae and Eu. compressa, and Torymidae: Torymus bedeguaris) were studied using FISH with 18S rDNA and telomeric (TTAGG)n probes. Haploid karyotypes of D. rosae, Eu. robusta and Eu. serratulae carried the only 18S rDNA hybridization signal, whereas those of I. amphibolus and Eu. compressa carried three and two rDNA clusters respectively. In addition, three rDNA sites were visualized in the aneuploid female of T. bedeguaris. The number of rDNA clusters in parasitoid Hymenoptera generally correlates to the chromosome number. Apart from the overwhelming majority of the studied species of aculeate Hymenoptera, no hybridization signals were obtained from FISH with the telomeric (TTAGG)n probe in the examined parasitoid species. These data suggest absence of the canonical (TTAGG)n insect telomeric motif in the Ichneumonoidea, Cynipoidea and Chalcidoidea, and perhaps in parasitoid Hymenoptera in general.

  3. Protein purification in multicompartment electrolyzers for crystal growth of r-DNA products in microgravity

    NASA Technical Reports Server (NTRS)

    Righetti, Pier Giorgio; Casale, Elena; Carter, Daniel; Snyder, Robert S.; Wenisch, Elisabeth; Faupel, Michel

    1990-01-01

    Recombinant-DNA (deoxyribonucleic acid) (r-DNA) proteins, produced in large quantities for human consumption, are now available in sufficient amounts for crystal growth. Crystallographic analysis is the only method now available for defining the atomic arrangements within complex biological molecules and decoding, e.g., the structure of the active site. Growing protein crystals in microgravity has become an important aspect of biology in space, since crystals that are large enough and of sufficient quality to permit complete structure determinations are usually obtained. However even small amounts of impurities in a protein preparation are anathema for the growth of a regular crystal lattice. A multicompartment electrolyzer with isoelectric, immobiline membranes, able to purify large quantities of r-DNA proteins is described. The electrolyzer consists of a stack of flow cells, delimited by membranes of very precise isoelectric point (pI, consisting of polyacrylamide supported by glass fiber filters containing Immobiline buffers and titrants to uniquely define a pI value) and very high buffering power, able to titrate all proteins tangent or crossing such membranes. By properly selecting the pI values of two membranes delimiting a flow chamber, a single protein can be kept isoelectric in a single flow chamber and thus, be purified to homogeneity (by the most stringent criterion, charge homogeneity).

  4. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON QSAR

    EPA Science Inventory

    Dyer, S.D., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to predict HC5's Based on QSARs (Abstract). To be presented at the SETAC Europe 14th Annual Meeting: Environmental Science Solution: A Pan-European Perspective, 18-...

  5. Nucleotide sequences of 5S rRNAs from four jellyfishes.

    PubMed

    Hori, H; Ohama, T; Kumazaki, T; Osawa, S

    1982-11-25

    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica.

  6. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON MINIMAL DATA

    EPA Science Inventory

    Dyer, S., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to Predict HC5's Based on Minimal Data (Abstract). To be presented at the SETAC Fourth World Congress, 14-18 November 2004, Portland, OR. 1 p. (ERL,GB R1013).

  7. The 5-S RNA . protein complex from an extreme halophile, Halobacterium cutirubrum. Purification and characterization.

    PubMed

    Smith, N; Matheson, A T; Yaguchi, M; Willick, G E; Nazar, R N

    1978-09-01

    A 5-S RNA . protein complex has been isolated from the 50-S ribosomal subunit of an extreme halophile, Halobacterium cutirubrum. The 50-S ribosomal subunit from the extreme halophile requires 3.4 M K+ and 100 mM Mg2+ for stability. However, if the high K+ concentration is maintained but the Mg2+ concentration lowered to 0.3 mM, the 5-S RNA . protein complex is selectively extracted from the subunit. After being purified on an Agarose 0.5-m column the complex had a molecular weight of about 80000 and contained 5-S RNA and two proteins, HL13 and HL19, with molecular weights (by sedimentation equilibrium) of 18700 and 18000, respectively. No ATPase or GTPase activity could be detected in the 5-S RNA . protein complex. The amino acid composition and electrophoretic mobility on polyacrylamide gels indicated both proteins were much more acidic than the equivalent from Escherichia coli or Bacillus stearothermophilus. Partial amino acid sequence data suggest HL13 is homologous to EL18 and HL19 to EL5.

  8. Characterization of Ffh of Mycobacterium tuberculosis and its interaction with 4.5S RNA.

    PubMed

    Palaniyandi, Kannan; Veerasamy, Malini; Narayanan, Sujatha

    2012-10-12

    Signal recognition particle (SRP) mediates targeting of proteins to appropriate cellular compartments, which is an important process in all living organisms. In prokaryotes, SRP consists of Ffh, a protein, and 4.5S RNA that recognizes signal peptide emerging from ribosomes. The SRP (Ffh) of one the most successful intracellular pathogen, Mycobacterium tuberculosis, has been investigated with respect to biochemical properties. In the present study, Ffh of M. tuberculosis was overexpressed and was confirmed to be a GTPase using thin layer chromatography and malachite green assay. The GTP binding ability was confirmed by GTP overlay assay. The 4.5S RNA sequence of M. tuberculosis was synthesized by in vitro transcription assay. The interaction between Ffh and 4.5S RNA was confirmed by overlay assay and RNA gel shift assay. The results show that the biochemical properties of M. tuberculosis Ffh have been conserved, and this is the first report that shows the interaction of components of SRP in M. tuberculosis, namely Ffh protein and 4.5S RNA.

  9. 10. GIRDER APPROACH ON YORKTOWN SIDE, SHOWING PIERS 8S5S (LEFT ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. GIRDER APPROACH ON YORKTOWN SIDE, SHOWING PIERS 8S-5S (LEFT TO RIGHT), AND FLOORBEAM/STRINGER SYSTEM. VIEW LOOKING NORTH. - George P. Coleman Memorial Bridge, Spanning York River at U.S. Route 17, Yorktown, York County, VA

  10. Relativistic effects on interchannel coupling in atomic photoionization: The photoelectron angular distribution of Xe 5s

    SciTech Connect

    Hemmers, O.; Manson, S. T.; Sant'Anna, M. M.; Focke, P.; Wang, H.; Sellin, I. A.; Lindle, D. W.

    2001-08-01

    Measurements of the photoelectron angular-distribution asymmetry parameter {beta} for Xe 5s photoionization have been performed in the 80--200 eV photon-energy region. The results show a substantial deviation from the nonrelativistic value of {beta}=2 and provide a clear signature of significant relativistic effects in interchannel coupling.

  11. 12. PIERS 5S AND 4S, SHOWING TRANSITION AT 4S FROM ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. PIERS 5S AND 4S, SHOWING TRANSITION AT 4S FROM GIRDER SPAN TO 'SUSPENDED' TRUSS SPAN AT U0. VIEW LOOKING WEST. - George P. Coleman Memorial Bridge, Spanning York River at U.S. Route 17, Yorktown, York County, VA

  12. An efficient synthetic approach to 6,5'-(S)- and 6,5'-(R)-cyclouridine.

    PubMed

    Theile, Christopher S; McLaughlin, Larry W

    2012-06-01

    Here we present new routes for the efficient syntheses of 6,5'-(S)- and 6,5'-(R)-cyclouridine. The syntheses utilize readily accessible uridine as a starting material. This route to the R diastereomer is significantly more efficient than previous synthetic efforts, allowing us to obtain large amounts of pure material for future biological testing.

  13. Nucleotide sequences of 5S rRNAs from four jellyfishes.

    PubMed

    Hori, H; Ohama, T; Kumazaki, T; Osawa, S

    1982-11-25

    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica. PMID:6130512

  14. Adaptation of the S-5-S pendulum seismometer for measurement of rotational ground motion

    NASA Astrophysics Data System (ADS)

    Knejzlík, Jaromír; Kaláb, Zdeněk; Rambouský, Zdeněk

    2012-10-01

    The Russian electrodynamic seismometer model S-5-S has been adapted for the measurement of rotational ground motion. The mechanical system of the original S-5-S seismometer consists of electrodynamic sensing and damping transducer coils mounted on an asymmetrical double-arm pendulum. This pendulum is suspended on a footing using two pairs of crossed flat springs, which operate as the axis of rotation. The pendulum is stabilised by an additional spring. The S-5-S can be used either as a vertical or as a horizontal sensor. The adaptation of the S-5-S seismometer described below involves removal of the additional spring and installation of an additional mass on the damping arm. Strain gauge angle sensors are installed on one pair of the crossed flat springs. The main dynamic parameters of the rotational seismometer created in this way, i.e. the natural period and damping, are controlled electronically by feedback currents proportional to the angular displacement and angular velocity, both fed to the damping transducer coil. This new seismometer, named the S-5-SR, enables measurement of the rotational component of ground motion around the horizontal or the vertical axes. The output signal from this S-5-SR seismometer can be proportional either to rotational displacement or rotational velocity.

  15. Biosynthesis of resorcylic acid lactone (5S)-5-hydroxylasiodiplodin in Lasiodiplodia theobromae.

    PubMed

    Kashima, Takasumi; Takahashi, Kosaku; Matsuura, Hideyuki; Nabeta, Kensuke

    2009-11-01

    An administration study of (2)H-labeled precursors showed that the 9-hydroxydecanoyl unit, the acyl intermediate of lasiodiplodin (1), was also the intermediate of (5S)-5-hydroxylasiodiplodin (2) in Lasiodiplodia theobromae. The incorporation of [O-methyl-(2)H(3)]-lasiodiplodin (6) into 2 indicated that hydroxylation at C-5 occurred after cyclization. PMID:19897901

  16. Photodissociation dynamics of superexcited O2: Dissociation channels O(5S) vs. O(3S)

    NASA Astrophysics Data System (ADS)

    Zhou, Yiyong; Meng, Qingnan; Mo, Yuxiang

    2014-07-01

    The photodissociation dynamics of O2, O2 + hυ → O(3P) + O(2p3(4S)3s, 3S/5S), has been studied by combining the XUV laser pump / UV laser probe and velocity map imaging methods in the photon energy range 14.64-15.20 eV. The fragment yield spectra of O(3S) and O(5S) and their velocity map images have been recorded using the state-selective (1+1) REMPI method to detect the fragments. The fragment yield spectra show resolved fine structure that arises from the predissociated Rydberg states I, I' and I″ (3ΠΩ = 0,1,2). The branching ratios between the two decay channels have been measured by one-photon ionization of the fragments O(3S) and O(5S) simultaneously. It is surprising to find that the dissociation cross sections for the production of O(5S) are larger than, or comparable to, those of O(3S) for the I and I' states, while the cross sections for the production of O(5S) are smaller than those of O(3S) for the I″ state. All fragments O(5S) arise from perpendicular transitions, which provides direct experimental evidence about the symmetry assignments of the states I, I' and I″ excited in this energy region. Although most of the fragments O(3S) arise from perpendicular transitions, some of them are from parallel transitions. Based on the calculated ab initio potential energy curves, we propose that the neutral dissociation into O(3P) + O(3S) occurs mainly via the interaction of the Rydberg states I, I', and I″ with the vibrational continuum of the diabatic 83Πu state (1π _u^{ - 1} (a^4 {Π}_u {)3}sσ _g ,^3 Π_u), while the neutral dissociation into O(3P) + O(5S) occurs mainly via the interaction of Rydberg states I, I', and I″ with the diabatic 73Πu (1π _g^{ - 1} (X^2 {Π}_g {)3}p{σ }_u ,^3 Π_u).

  17. Early-life nutrition modulates the epigenetic state of specific rDNA genetic variants in mice.

    PubMed

    Holland, Michelle L; Lowe, Robert; Caton, Paul W; Gemma, Carolina; Carbajosa, Guillermo; Danson, Amy F; Carpenter, Asha A M; Loche, Elena; Ozanne, Susan E; Rakyan, Vardhman K

    2016-07-29

    A suboptimal early-life environment, due to poor nutrition or stress during pregnancy, can influence lifelong phenotypes in the progeny. Epigenetic factors are thought to be key mediators of these effects. We show that protein restriction in mice from conception until weaning induces a linear correlation between growth restriction and DNA methylation at ribosomal DNA (rDNA). This epigenetic response remains into adulthood and is restricted to rDNA copies associated with a specific genetic variant within the promoter. Related effects are also found in models of maternal high-fat or obesogenic diets. Our work identifies environmentally induced epigenetic dynamics that are dependent on underlying genetic variation and establishes rDNA as a genomic target of nutritional insults.

  18. Early-life nutrition modulates the epigenetic state of specific rDNA genetic variants in mice.

    PubMed

    Holland, Michelle L; Lowe, Robert; Caton, Paul W; Gemma, Carolina; Carbajosa, Guillermo; Danson, Amy F; Carpenter, Asha A M; Loche, Elena; Ozanne, Susan E; Rakyan, Vardhman K

    2016-07-29

    A suboptimal early-life environment, due to poor nutrition or stress during pregnancy, can influence lifelong phenotypes in the progeny. Epigenetic factors are thought to be key mediators of these effects. We show that protein restriction in mice from conception until weaning induces a linear correlation between growth restriction and DNA methylation at ribosomal DNA (rDNA). This epigenetic response remains into adulthood and is restricted to rDNA copies associated with a specific genetic variant within the promoter. Related effects are also found in models of maternal high-fat or obesogenic diets. Our work identifies environmentally induced epigenetic dynamics that are dependent on underlying genetic variation and establishes rDNA as a genomic target of nutritional insults. PMID:27386920

  19. 16S rDNA analysis of archaea indicates dominance of Methanobacterium and high abundance of Methanomassiliicoccaceae in rumen of Nili-Ravi buffalo.

    PubMed

    Paul, S S; Deb, S M; Dey, A; Somvanshi, S P S; Singh, D; Rathore, R; Stiverson, J

    2015-10-01

    The molecular diversity of rumen methanogens was investigated using 16S rDNA gene library prepared from the rumen contents of Nili-Ravi buffaloes. Microbial genomic DNA was isolated from four adult male fistulated buffaloes and PCR conditions were set up using specific primers. Amplified product was cloned into a suitable vector, and the inserts of positive clones were sequenced. A total of 142 clones were examined, and the analysis revealed 46 species level (0.01 distance) operational taxonomic units (OTUs). Twenty six OTUs comprising 89 clones (63% of the total clones) were taxonomically assigned to Methanobacterium genus and the majority of them had highest percent identity with Methanobacterium flexile among cultured methanogens. Five OTUs comprising 27 clones (19% of total clones) were taxonomically assigned to Methanomicrobium genus and these clones showed highest sequence identity with Methanomicrobium mobile. Only two OTUs comprising 6 clones (4% of total clones) were assigned to Methanobrevibacter genus. A total of 17 clones belonging to 10 species level OTUs showed highest percent identity (ranging from 85 to 95%) with Methanomassilicoccus luminyensis and were taxonomically classified as Methanomassiliicocaceae. Out of the 142 rDNA clones, 112 clones, which constitute 79% of the total clones representing 42 OTUs, had less than 98.5% sequence identity with any of the cultured strains of methanogens and represent novel species of methanogens. This study has revealed the largest assortment of hydrogenotrophic methanogen phylotypes ever identified from the rumen of Nili-Ravi buffaloes. The study indicates that Methanobacterium is the most dominant methanogen in the rumen of Nili-Ravi buffalo. This is also the first report on the presence of methanogens phylogenetically close to M. luminyensis, an H2 dependent methylotrophic methanogen, in the rumen of buffaloes at such a high level of abundance. PMID:26103451

  20. 16S rDNA analysis of archaea indicates dominance of Methanobacterium and high abundance of Methanomassiliicoccaceae in rumen of Nili-Ravi buffalo.

    PubMed

    Paul, S S; Deb, S M; Dey, A; Somvanshi, S P S; Singh, D; Rathore, R; Stiverson, J

    2015-10-01

    The molecular diversity of rumen methanogens was investigated using 16S rDNA gene library prepared from the rumen contents of Nili-Ravi buffaloes. Microbial genomic DNA was isolated from four adult male fistulated buffaloes and PCR conditions were set up using specific primers. Amplified product was cloned into a suitable vector, and the inserts of positive clones were sequenced. A total of 142 clones were examined, and the analysis revealed 46 species level (0.01 distance) operational taxonomic units (OTUs). Twenty six OTUs comprising 89 clones (63% of the total clones) were taxonomically assigned to Methanobacterium genus and the majority of them had highest percent identity with Methanobacterium flexile among cultured methanogens. Five OTUs comprising 27 clones (19% of total clones) were taxonomically assigned to Methanomicrobium genus and these clones showed highest sequence identity with Methanomicrobium mobile. Only two OTUs comprising 6 clones (4% of total clones) were assigned to Methanobrevibacter genus. A total of 17 clones belonging to 10 species level OTUs showed highest percent identity (ranging from 85 to 95%) with Methanomassilicoccus luminyensis and were taxonomically classified as Methanomassiliicocaceae. Out of the 142 rDNA clones, 112 clones, which constitute 79% of the total clones representing 42 OTUs, had less than 98.5% sequence identity with any of the cultured strains of methanogens and represent novel species of methanogens. This study has revealed the largest assortment of hydrogenotrophic methanogen phylotypes ever identified from the rumen of Nili-Ravi buffaloes. The study indicates that Methanobacterium is the most dominant methanogen in the rumen of Nili-Ravi buffalo. This is also the first report on the presence of methanogens phylogenetically close to M. luminyensis, an H2 dependent methylotrophic methanogen, in the rumen of buffaloes at such a high level of abundance.

  1. Sequence-Based Identification of Mycobacterium Species Using the MicroSeq 500 16S rDNA Bacterial Identification System

    PubMed Central

    Patel, Jean Baldus; Leonard, Debra G. B.; Pan, Xai; Musser, James M.; Berman, Richard E.; Nachamkin, Irving

    2000-01-01

    We evaluated the MicroSeq 500 16S rDNA Bacterial Sequencing Kit (PE Applied Biosystems), a 500-bp sequence-based identification system, for its ability to identify clinical Mycobacterium isolates. The organism identity was determined by comparing the 16S rDNA sequence to the MicroSeq database, which consists primarily of type strain sequences. A total of 113 isolates (18 different species), previously recovered and identified by routine methods from two clinical laboratories, were analyzed by the MicroSeq method. Isolates with discordant results were analyzed by hsp65 gene sequence analysis and in some cases repeat phenotypic identification, AccuProbe rRNA hybridization (Gen-Probe, Inc., San Diego, Calif.), or high-performance liquid chromatography of mycolic acids. For 93 (82%) isolates, the MicroSeq identity was concordant with the previously reported identity. For 18 (16%) isolates, the original identification was discordant with the MicroSeq identification. Of the 18 discrepant isolates, 7 (six unique sequences) were originally misidentified by phenotypic analysis or the AccuProbe assay but were correctly identified by the MicroSeq assay. Of the 18 discrepant isolates, 11 (seven unique sequences) were unusual species that were difficult to identify by phenotypic methods and, in all but one case, by molecular methods. The remaining two isolates (2%) failed definitive phenotypic identification, but the MicroSeq assay was able to definitively identify one of these isolates. The MicroSeq identification system is an accurate and rapid method for the identification of Mycobacterium spp. PMID:10618095

  2. Adaptation of a membrane bioreactor to 1,2-dichloroethane revealed by 16S rDNA pyrosequencing and dhlA qPCR.

    PubMed

    Munro, Jacob E; Liew, Elissa F; Coleman, Nicholas V

    2013-01-01

    A pilot-scale membrane bioreactor (MBR) was tested for bioremediation of 1,2-dichloroethane (DCA) in groundwater. Pyrosequencing of 16S rDNA was used to study changes in the microbiology of the MBR over 137 days, including a 67 day initial adaptation phase of increasing DCA concentration. The bacterial community in the MBR was distinct from those in soil and groundwater at the same site, and was dominated by alpha- and beta- proteobacteria, including Rhodobacter, Methylibium, Rhodopseudomonas, Methyloversatilis, Caldilinea, Thiobacillus, Azoarcus, Hyphomicrobium, and Leptothrix. Biodegradation of DCA in the MBR began after 26 days, and was sustained for the remainder of the experiment. A quantitative PCR (qPCR) assay for the dehalogenase gene dhlA was developed to monitor DCA-degrading bacteria in the MBR, and a positive correlation was seen between dhlA gene abundance and the cumulative amount of DCA that had entered the MBR. Genera previously associated with aerobic DCA biodegradation (Xanthobacter, Ancylobacter, Azoarcus) were present in the MBR, and the abundance of Azoarcus correlated well with dhlA gene abundance. This study shows that MBRs can be an effective method for removal of DCA from groundwater, and that the dhlA qPCR is a rapid and sensitive method for detection of DCA-degrading bacteria. PMID:24175727

  3. The first comprehensive molecular phylogeny of Bryozoa (Ectoprocta) based on combined analyses of nuclear and mitochondrial genes.

    PubMed

    Fuchs, Judith; Obst, Matthias; Sundberg, Per

    2009-07-01

    Bryozoa is one of the most puzzling phyla in the animal kingdom and little is known about their evolutionary history. Its phylogenetic position among the Metazoa remains unsettled, as well as its intra-phylum relationships. Here, we present the first comprehensive molecular phylogeny of Bryozoa based on the mitochondrial gene COI and two nuclear genes 18S rDNA and 28S rDNA including 32 species from 23 families. We show that the monophyletic status is supported for the phylum as well as for previously defined bryozoan classes. The 28S rDNA supports a close relationship of Phylactolaemata and Stenolaemata, while partial COI and 18S rDNA show the freshwater Phylactolaemata as basal bryozoans. The Gymnolaemata have generally been divided into soft-bodied forms (Ctenostomata) and hard-bodied species (Cheilostomata). In our analyses all three genes conflict with this assumption and show hard body forms having evolved within Gymnolaemata several times.

  4. Molecular Taxonomy of Ganoderma cupreum from Southern India Inferred from ITS rDNA Sequences Analysis

    PubMed Central

    2013-01-01

    Ganoderma is a cosmopolitan wood-rot basidiomycete that has been extensively studied for its pathogencity and medicinal properties. Identification of Ganoderma based on macro-microscopic features led to large number of synonyms which resulted in 250 taxonomic names. A Ganoderma species collected from Courtallam, Tamil Nadu was identified as G. cupreum. Phylogenetic analysis inferred from internal transcribed spacer rDNA region resolved the Indian isolate MYC1 as Ganoderma cupreum which clustered with Australian and Asian "cupreum" clade with 85% bootstrap support BS and shared 99% and 98% nucleotide similarity with Malaysian and Australian 'cupreum' respectively. This study represents the first molecular evidence of G. cupreum from Asian origin. PMID:24493948

  5. Three-step laser excitation of the odd-parity 5s5d 3D → 5s nf 3F states of cadmium

    NASA Astrophysics Data System (ADS)

    Nadeem, Ali; Shah, M.; Haq, S. U.; Shahzada, S.; Mumtaz, M.; Waheed, A.; Nawaz, M.; Ahmed, M.; Baig, M. A.

    2014-07-01

    We report new experimental data on the term energies and effective quantum numbers of the highly excited odd parity states of cadmium in the 71 773-72 500 cm-1 energy range. The experiment was performed using three dye lasers simultaneously pumped by the second harmonic (532 nm) of the Nd;YAG laser. The vapor containment and detection system was a thermionic diode ion detector working in a space charge limited mode. The new observations include the 5snf3F3 (12 ⩽ n ⩽ 52), 5snf3F4 (13 ⩽ n ⩽ 33) and 5snf3F2 (12 ⩽ n ⩽ 22) Rydberg series excited from the 5s5d3D multiplet. A two parameter fit to the transitions energies of the 5snf3F3 series yields the binding energy of the 5snd 2D2 level as 13 042.178 ± 0.02 cm-1 and consequently the first ionization of cadmium is determined as 72 540.05 ± 0.13 cm-1, which is in good agreement with the previously reported value.

  6. Restriction fragment length polymorphism of the 5S-rRNA-NTS region: a rapid and precise method for plant identification.

    PubMed

    Bertea, Cinzia Margherita; Gnavi, Giorgio

    2012-01-01

    Molecular genetic methods have several advantages over classical morphological and chemical analyses. The genetic method requires genotype instead than phenotype, therefore PCR-based techniques have been widely used for a rapid identification of plant species, varieties and chemotypes. Recently, the molecular discrimination of some higher plant species has been evaluated using sequences of a 5S-rRNA gene spacer region. The variation in the nontranscribed sequence (NTS) region has been used in a number of plant species for studying intraspecific variation, genome evolution, and phylogenetic reconstruction. Here, we describe a rapid method based on the use of the 5S-rRNA-NTS region as a tool for plant DNA fingerprinting, which combines PCR, sequencing and restriction fragment length polymorphism analyses. PMID:22419491

  7. ASSESSMENT OF FECAL POLLUTION SOURCES IN PLUM CREEK WATERSHED USING BACTEROIDETES 16S RDNA-BASED ASSAYS

    EPA Science Inventory

    Recently, 16S rDNA Bacteroidetes-targeted PCR assays were developed to discriminate between ruminant and human fecal pollution. These assays are rapid and relatively inexpensive but have been used in a limited number of studies. In this study, we evaluated the efficacy o...

  8. ASSESSMENT OF FECAL POLLUTION SOURCES IN PLUM CREEK WATERSHED USING PCR AND PHYLOGENETIC ANALYSES OF BACTEROIDETES 16S RDNA

    EPA Science Inventory

    Traditional methods for assessing fecal pollution in environmental systems, such as monitoring for fecal coliforms are not capable of discriminating between different sources fecal pollution. Recently, 16S rDNA Bacteroidetes-targeted PCR assays were developed to discriminate betw...

  9. Bacterial diversity in the rumen of Indian Surti buffalo (Bubalus bubalis), assessed by 16S rDNA analysis.

    PubMed

    Pandya, P R; Singh, K M; Parnerkar, S; Tripathi, A K; Mehta, H H; Rank, D N; Kothari, R K; Joshi, C G

    2010-01-01

    Bacterial communities in buffalo rumen were characterized using a culture-independent approach for a pooled sample of rumen fluid from 3 adult Surti buffaloes. Buffalo rumen is likely to include species of various bacterial phyla, so 16S rDNA sequences were amplified and cloned from the sample. A total of 191 clones were sequenced and similarities to known 16S rDNA sequences were examined. About 62.82% sequences (120 clones) had >90% similarity to the 16S rDNA database sequences. Furthermore, about 34.03% of the sequences (65 clones) were 85-89% similar to 16S rDNA database sequences. For the remaining 3.14%; the similarity was lower than 85% Phylogenetic analyses were also used to infer the makeup of bacterial communities in the rumen of Surti buffalo. As a result, we distinguished 42 operational taxonomic units (OTUs) based on unique 16S r DNA sequences: 19 OTUs affiliated to an unidentified group (45.23% of total OTUs), 11 OTUs of the phylum Firmicutes, also known as the low G+C group (26.19%), 7 OTUs of the Cytophaga-Flexibacter-Bacteroides phylum (16.66%), 4 OTUs of Spirochaetes (9.52%), and 1 OTU of Actinobacteria (2.38%). These include 10 single-clone OTUs, so Good's coverage (94.76%) of 16S rRNA libraries indicated that sequences identified in the libraries represent the majority of bacterial diversity present in rumen. PMID:20720314

  10. Methanogen diversity in the rumen of Indian Surti buffalo (Bubalus bubalis), assessed by 16S rDNA analysis.

    PubMed

    Singh, K M; Tripathi, A K; Pandya, P R; Parnerkar, S; Rank, D N; Kothari, R K; Joshi, C G

    2012-06-01

    The methanogenic communities in buffalo rumen were characterized using a culture-independent approach of a pooled sample of rumen fluid from three adult Surti buffaloes. Buffalo rumen is likely to include species of various methanogens, so 16S rDNA sequences were amplified and cloned from the sample. A total of 171 clones were sequenced to examine 16S rDNA sequence similarity. About 52.63% sequences (90 clones) had ≥ 90% similarity, whereas, 46.78% of the sequences (81 clones) were 75-89% similar to 16S rDNA database sequences, respectively. Phylogenetic analyses were also used to infer the makeup of methanogenic communities in the rumen of Surti buffalo. As a result, we distinguished 23 operational taxonomic units (OTUs) based on unique 16S rDNA sequences: 12 OTUs (52.17%) affiliated to Methanomicrobiales order, 10 OTUs (43.47%) of the order Methanobacteriales and one OTU (4.34%) of Methanosarcina barkeri like clone, respectively. In addition, the population of Methanomicrobiales and Methabacteriales orders were also observed, accounting 4% and 2.17% of total archea. This study has revealed the largest assortment of hydrogenotrophic methanogens phylotypes ever identified from rumen of Surti buffaloes. PMID:21507441

  11. Climatic controls on drainage basin topography - a synopsis of the western Andean flanks between 15.5 S and 41.5 S lat

    NASA Astrophysics Data System (ADS)

    Rehak, K.; Strecker, M. R.; Echtler, H. P.; Bookhagen, B.

    2007-12-01

    Topography in tectonically active mountain ranges is determined by the interplay between tectonics and climate. Due to the complexity of natural systems it is difficult to evaluate tectonic versus climatic contributions to the long- term landscape evolution. Previous studies suggest that rainfall and its variability strongly influence the morphology of river profiles and mountain ranges. However, it is still controversially discussed how drainage basins reflect tectonic and climatic processes. The Andean Cordillera provides a unique natural setting for studying the relationship between climate, tectonics, and topography. The Andes host various climatic zones with pronounced differences in rainfall regimes. In the central to southern western Andes, climate ranges from hyperarid in the Atacama Desert, 22 to 23°S lat, with a mean annual rainfall of ~ 5 mm/yr to year-round humid conditions south of Valdivia, ~ 40°S lat, with more than 2500 mm/yr. This zonation is controlled by hemisphere-scale atmospheric circulation patterns. With the exception of a northward shift of the Southern Hemisphere Westerlies during glacials the overall precipitation pattern has remained stable on the west coast of South America. The shelf width is reasonably constant along the margin. Uplift rate and lithology vary non-systematically and do not correlate with climatic parameters. Here, we present an analysis of 120 drainage basins along the watershed of the western Andean flank between 15.5 S and 41.5 S lat, using SRTMV3-90m data and a high-resolution rainfall dataset (TRMM 5x5 km). The basins comprise drainage areas of 1 to ~ 30 x 103 km2 and were split into subsets according to position and size. For each basin, we extracted 21 geometry, relief, and climate parameters in order to unravel the determinants of drainage-basin morphology. Our data shows that river-profile concavity and slope, hypsometric integral, basin maximum and mean elevation decrease with increasing rainfall and

  12. Macrolide Resistance in Treponema pallidum Correlates With 23S rDNA Mutations in Recently Isolated Clinical Strains

    PubMed Central

    Molini, Barbara J.; Tantalo, Lauren C.; Sahi, Sharon K.; Rodriguez, Veronica I.; Brandt, Stephanie L.; Fernandez, Mark C.; Godornes, Charmie B.; Marra, Christina M.; Lukehart, Sheila A.

    2016-01-01

    Background High rates of 23S rDNA mutations implicated in macrolide resistance have been identified in Treponema pallidum samples from syphilis patients in many countries. Nonetheless, some clinicians have been reluctant to abandon azithromycin as a treatment for syphilis, citing the lack of a causal association between these mutations and clinical evidence of drug resistance. Although azithromycin resistance has been demonstrated in vivo for the historical Street 14 strain, no recent T. pallidum isolates have been tested. We used the well-established rabbit model of syphilis to determine the in vivo efficacy of azithromycin against 23S rDNA mutant strains collected in 2004 to 2005 from patients with syphilis in Seattle, Wash. Methods Groups of 9 rabbits were each infected with a strain containing 23S rDNA mutation A2058G (strains UW074B, UW189B, UW391B) or A2059G (strains UW228B, UW254B, and UW330B), or with 1 wild type strain (Chicago, Bal 3, and Mexico A). After documentation of infection, 3 animals per strain were treated with azithromycin, 3 were treated with benzathine penicillin G, and 3 served as untreated control groups. Treatment efficacy was documented by darkfield microscopic evidence of T. pallidum, serological response, and rabbit infectivity test. Results Azithromycin uniformly failed to cure rabbits infected with strains harboring either 23S rDNA mutation, although benzathine penicillin G was effective. Infections caused by wild type strains were successfully treated by either azithromycin or benzathine penicillin G. Conclusions A macrolide resistant phenotype was demonstrated for all strains harboring a 23S rDNA mutation, demonstrating that either A2058G or A2059G mutation confers in vivo drug resistance. PMID:27513385

  13. Development of a real-time PCR method for the detection of fossil 16S rDNA fragments of phototrophic sulfur bacteria in the sediments of Lake Cadagno.

    PubMed

    Ravasi, D F; Peduzzi, S; Guidi, V; Peduzzi, R; Wirth, S B; Gilli, A; Tonolla, M

    2012-05-01

    Lake Cadagno is a crenogenic meromictic lake situated in the southern range of the Swiss Alps characterized by a compact chemocline that has been the object of many ecological studies. The population dynamics of phototrophic sulfur bacteria in the chemocline has been monitored since 1994 with molecular methods such as 16S rRNA gene clone library analysis. To reconstruct paleo-microbial community dynamics, we developed a quantitative real-time PCR methodology for specific detection of 16S rRNA gene sequences of purple and green sulfur bacteria populations from sediment samples. We detected fossil 16S rDNA of nine populations of phototrophic sulfur bacteria down to 9-m sediment depth, corresponding to about 9500 years of the lake's biogeological history. These results provide the first evidence for the presence of 16S rDNA of anoxygenic phototrophic bacteria in Holocene sediments of an alpine meromictic lake and indicate that the water column stratification and the bacterial plume were already present in Lake Cadagno thousands of years ago. The finding of Chlorobium clathratiforme remains in all the samples analyzed shows that this population, identified in the water column only in 2001, was already a part of the lake's biota in the past.

  14. The B chromosomes of the African cichlid fish Haplochromis obliquidens harbour 18S rRNA gene copies

    PubMed Central

    2010-01-01

    Background Diverse plant and animal species have B chromosomes, also known as accessory, extra or supernumerary chromosomes. Despite being widely distributed among different taxa, the genomic nature and genetic behavior of B chromosomes are still poorly understood. Results In this study we describe the occurrence of B chromosomes in the African cichlid fish Haplochromis obliquidens. One or two large B chromosome(s) occurring in 39.6% of the analyzed individuals (both male and female) were identified. To better characterize the karyotype and assess the nature of the B chromosomes, fluorescence in situ hybridization (FISH) was performed using probes for telomeric DNA repeats, 18S and 5S rRNA genes, SATA centromeric satellites, and bacterial artificial chromosomes (BACs) enriched in repeated DNA sequences. The B chromosomes are enriched in repeated DNAs, especially non-active 18S rRNA gene-like sequences. Conclusion Our results suggest that the B chromosome could have originated from rDNA bearing subtelo/acrocentric A chromosomes through formation of an isochromosome, or by accumulation of repeated DNAs and rRNA gene-like sequences in a small proto-B chromosome derived from the A complement. PMID:20051104

  15. Two spatially separated phases in semiconducting Rb0.8Fe1.5S2

    DOE PAGES

    Wang, Meng; Tian, Wei; Valdivia, P.; Chi, Songxue; Bourret-Courchesne, E.; Dai, Pengcheng; Birgeneau, R. J.

    2014-09-26

    We report neutron scattering and transport measurements on semiconducting Rb0.8Fe1.5S2, a compound isostructural and isoelectronic to the well-studied A0.8FeySe2(A = K, Rb, Cs, Tl/K) superconducting systems. Both resistivity and DC susceptibility measurements reveal a magnetic phase transition at T = 275 K. Neutron diffraction studies show that the 275 K transition originates from a phase with rhombic iron vacancy order which exhibits an in-plane stripe antiferromagnetic ordering below 275 K. In addition, the stripe antiferromagnetic phase interdigitates mesoscopically with an ubiquitous phase with √5 x√5 iron vacancy order. This phase has a magnetic transition at TN = 425 K andmore » an iron vacancy order-disorder transition at TS = 600 K. These two different structural phases are closely similar to those observed in the isomorphous Se materials. Based on the close similarities of the in-plane antiferromagnetic structures, moments sizes, and ordering temperatures in semiconducting Rb0.8Fe1.5S2 and K0.81Fe1.58Se2, we argue that the in-plane antiferromagnetic order arises from strong coupling between local moments. Superconductivity, previously observed in the A0.8FeySe2₋ zSz system, is absent in A0.8Fe1.5S2, which has a semiconducting ground state. We discuss the implied relationship between stripe and block antiferromagnetism and superconductivity in these materials as well as a strategy for further investigation.« less

  16. Minimally invasive L5-S1 oblique lumbar interbody fusion with anterior plate.

    PubMed

    Pham, Martin H; Jakoi, Andre M; Hsieh, Patrick C

    2016-07-01

    Lumbar interbody fusion is an important technique for the treatment of degenerative disc disease and degenerative scoliosis. The oblique lumbar interbody fusion (OLIF) establishes a minimally invasive retroperitoneal exposure anterior to the psoas and lumbar plexus. In this video case presentation, the authors demonstrate the techniques of the OLIF at L5-S1 performed on a 69-year-old female with degenerative scoliosis as one component of an overall strategy for her deformity correction. The video can be found here: https://youtu.be/VMUYWKLAl0g . PMID:27364428

  17. Rapid identification of bovine mastitis pathogens by high-resolution melt analysis of 16S rDNA sequences.

    PubMed

    Ajitkumar, Praseeda; Barkema, Herman W; De Buck, Jeroen

    2012-03-23

    Accurate identification of mastitis pathogens is often compromised when using conventional culture-based methods. Here, we report a novel, rapid assay tested for speciation of bacterial mastitis pathogens using high-resolution melt analysis (HRMA) of 16S rDNA sequences. Real-time PCR amplification of 16S rRNA gene fragment, spanning the variable region V5 and V6 was performed with a resulting amplicon of 290bp. First, a library was generated of melt curves of 9 common pathogens that are implicated in bovine mastitis. Six of the isolates, Escherichia coli, Streptococcus agalactiae, Klebsiella pneumoniae, Streptococcus uberis, Staphylococcus aureus and Mycoplasma bovis, were type strains while the other 3, Arcanobacterium pyogenes, Corynebacterium bovis and Streptococcus dysgalactiae, were bovine mastitis field isolates. Four of the type strains, E. coli, S. agalactiae, K. pneumoniae and S. aureus, were found to be of human origin, while the other 3 type strains were isolated from bovine infections. Secondly, the melt curves and corresponding amplicon sequences of A. pyogenes, E. coli, S. agalactiae, S. dysgalactiae, K. pneumoniae, S. uberis and S. aureus were compared with 10 bovine mastitis field isolates of each pathogen. Based on the distinct differences in melt curves and sequences between human and bovine isolates of E. coli and K. pneumoniae, it was deemed necessary to select a set of bovine strains for these pathogens to be used as reference strains in the HRMA. Next, the HRMA was validated by three interpreters analyzing the differential clustering pattern of melt curves of 60 bacterial cultures obtained from mastitis milk samples. The three test interpreters were blinded to the culture and sequencing results of the isolates. Overall accuracy of the validation assay was 95% as there was difficulty in identifying the streptococci due to heterogeneity observed in the PCR amplicons of S. uberis. The present study revealed that broad-range real-time PCR with

  18. Electron-correlation-induced interchange of lifetime broadenings of 5s{sup -1} multiplet states in atomic Cs

    SciTech Connect

    Partanen, L.; Holappa, M.; Aksela, H.; Aksela, S.; Schulz, J.

    2009-10-15

    The lifetime broadenings of the most intense 5s photolines of Cs were studied. The aim of this study was to understand the origin of the remarkable differences in the lifetime widths of different 5s{sup -1} multiplet states. The 5s photoelectron spectra of the 6s{yields}6p{sub 1/2,3/2} laser-excited states are presented in the binding energy region of 30-34 eV showing the main 5s photolines of the ground state and laser-excited states as well as the 5s5p{sup 6}6p shakeup satellites. The lifetime widths of the states were determined. The Hartree-Fock calculations were carried out to predict the 5s photoelectron spectrum. The lifetime broadenings of the 5s photolines were found to be due to the transition rates of the subsequent Coster-Kronig transitions to the 5s{sup 2}5p{sup 5} states. It was found that a straightforward single-configuration explanation cannot be given for the lifetime differences. Instead, electron correlation plays an essential role and the lifetime broadenings were found to be predicted well only when configuration interaction between the 5s{sup -1} and 5p{sup -2}5d configurations is taking into account.

  19. What does the 5S rRNA multigene family tell us about the origin of the annual Triticeae (Poaceae)?

    PubMed

    Baum, B R; Edwards, T; Johnson, D A

    2013-05-01

    We have investigated the complex relationships among the annual genera within the tribe Triticeae through phylogenetic analyses of the 5S rRNA multigene family. Cloned sequences were assigned to groups of orthologous sequences, called unit classes, that were subjected to several analyses including BLAST (Basic Local Alignment Search Tool) searches to assess possible ancestral relationships with perennial genera; phylogenetic analyses using parsimony (Pars), maximum likelihood (ML), and Bayesian methods; and minimum reticulation networks from the Pars, ML, and Bayesian trees. In this study, we included genera with both annual and perennial species, such as Dasypyrum, Hordeum, and Secale. BLAST pointed to Pseudoroegneria (carrier of the St genome) and possibly Thinopyrum (carrier of the J genome) as the potential next of kin. However, Thinopyrum and Pseudoroegneria have never fallen together on the individual trees with the former generally associated with Crithopsis, Aegilops, Triticum, and Dasypyrum, while the latter is usually associated with the rest of the genera within Triticeae. The "long" unit classes placed Dasypyrum breviaristatum together with Dasypyrum villosum, whereas the "short" unit classes put them far apart on the trees. None of the gene trees alone was able to summarize the complex relationships among the genera, in line with previous results in the Triticeae. However, the application of tools designed to display phylogenetic networks was able to depict the complex links among the genera based on the short and the long gene trees, including the close link between Thinopyrum and Pseudoroegneria suggested by the phylogenetic analyses. In addition, our analyses provide support for the hypothesis that at least some annual Triticeae taxa are derived from their perennial relatives. PMID:23789993

  20. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    PubMed Central

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-01-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  1. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    NASA Astrophysics Data System (ADS)

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-03-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system.

  2. Bottomonium physics at Υ(4S, 5S, 6S) energies with the Belle detector

    NASA Astrophysics Data System (ADS)

    Tamponi, Umberto

    2016-08-01

    The description of quarkonia as pure quark anti-quark bound states has been recently challenged by the observation of charged states in both the charmonium and bottomonium region and large violations of the heavy quark spin symmetry in hadronic transitions. All these effects can be ascribable to non-negligible contributions from the light quark degrees of freedom in the description of both charmonia and bottomonia. We will report the most recent experimental measurements performed by the Belle collaboration in the Y(4S), Y(5S) and Y(6S) regions, including the measurement of the ratio σ[e+e- → bb̅]/σ[e+e- → μ+ μ- ], the search for neutral states near the B0B̅0 threshold, the first observation of the transition ϒ(4S) → ηhb (lP) and the study of the η transitions at the ϒ(5S) energy. The contribution to the study of the structure of these states coming from the measurement of hadronic transitions will be discussed.

  3. Magnetization reversal phenomena in (Cr0.70Ti0.30)5S6

    NASA Astrophysics Data System (ADS)

    Hashimoto, Satoshi; Matsuda, Yuji; Sato, Tetsuya; Anzai, Shuichiro

    2005-12-01

    Magnetization reversal phenomena (MRP) along magnetic order-order transitions have recently been reported on impurity-doped magnetic systems. Because imperfect long-range magnetic order exists in these systems, it is expected that a systematic investigation of MRP will give physical information on thermomagnetic processes of magnetic systems in the range from the micro- to nanoscales. As a typical order-order transition (a state doubly modulated by helical and canting orders to a collinear ferrimagnetic state) has been known to occur on Cr5S6 at a transition temperature Tt, we investigate the magnetizations of (Cr0.70Ti0.30)5S6 on heating and cooling runs in various magnetic fields. At 20Oe, the field-cooled magnetization just below the Curie temperature has a positive sign; the sign turns negative below the compensation temperature TCM (first step) and finally returns to positive below Tt (second step). The first-step MRP observed in this system is explained by the potential barriers resulting from anisotropy energy when the preferred direction of collinear ferrimagnetic moment reverses. The proposed mechanism for second-step MRP is the pinning effect caused by the impurity atoms (Ti) in the helical long-range-order chains. Comparing other examples of MRPs, we discuss the roles of local impurity centers in the thermomagnetic process in magnetic order-order transitions.

  4. Structural Preservation Percutaneous Endoscopic Lumbar Interlaminar Discectomy for L5-S1 Herniated Nucleus Pulposus

    PubMed Central

    Jang, Jee-Soo; Jang, Il-Tae

    2016-01-01

    Objective. Structures such as ligamentum flavum, annulus, and lamina play an important role in the segmental function. We proposed the surgical technique for achieving the sufficient preservation of segmental structures, in spite of sufficient removal of pathologic disc in the L5-S1 using the ligamentum flavum splitting and sealing technique. Methods. We retrospectively analyzed 80 cases that underwent percutaneous endoscopic lumbar discectomy for L5-S1 herniated nucleus pulposus, using the ligamentum flavum splitting and sealing technique between January 2011 and June 2013. Outcomes were assessed using VAS (leg, back), MacNab's criteria, and the immediate postoperative MRI for all patients. Structural preservation was classified as complete, sufficient, and incomplete. Results. The surgical results are as follows: 65 cases were complete, 15 cases were sufficient, and 0 cases were incomplete. The VAS was decreased at the last follow-up (leg: from 7.91 ± 0.73 to 1.15 ± 0.62; back: from 5.15 ± 0.71 to 1.19 ± 0.75). A favorable outcome (excellent or good outcome by MacNab's criteria) was achieved in 77 patients (96.25%). During the follow-up period, 2 cases (2.5%) of recurrence have occurred. Conclusion. According to the result, we could obtain the favorable clinical and radiological outcomes while simultaneously removing pathologic discs using the ligamentum flavum splitting and annular fissure sealing technique. PMID:27803927

  5. Nuclear rDNA pseudogenes in Chagas disease vectors: evolutionary implications of a new 5.8S+ITS-2 paralogous sequence marker in triatomines of North, Central and northern South America.

    PubMed

    Bargues, M Dolores; Zuriaga, M Angeles; Mas-Coma, Santiago

    2014-01-01

    A pseudogene, paralogous to rDNA 5.8S and ITS-2, is described in Meccus dimidiata dimidiata, M. d. capitata, M. d. maculippenis, M. d. hegneri, M. sp. aff. dimidiata, M. p. phyllosoma, M. p. longipennis, M. p. pallidipennis, M. p. picturata, M. p. mazzottii, Triatoma mexicana, Triatoma nitida and Triatoma sanguisuga, covering North America, Central America and northern South America. Such a nuclear rDNA pseudogene is very rare. In the 5.8S gene, criteria for pseudogene identification included length variability, lower GC content, mutations regarding the functional uniform sequence, and relatively high base substitutions in evolutionary conserved sites. At ITS-2 level, criteria were the shorter sequence and large proportion of insertions and deletions (indels). Pseudogenic 5.8S and ITS-2 secondary structures were different from the functional foldings, different one another, showing less negative values for minimum free energy (mfe) and centroid predictions, and lower fit between mfe, partition function, and centroid structures. A complete characterization indicated a processed pseudogenic unit of the ghost type, escaping from rDNA concerted evolution and with functionality subject to constraints instead of evolving free by neutral drift. Despite a high indel number, low mutation number and an evolutionary rate similar to the functional ITS-2, that pseudogene distinguishes different taxa and furnishes coherent phylogenetic topologies with resolution similar to the functional ITS-2. The discovery of a pseudogene in many phylogenetically related species is unique in animals and allowed for an estimation of its palaeobiogeographical origin based on molecular clock data, inheritance pathways, evolutionary rate and pattern, and geographical spread. Additional to the technical risk to be considered henceforth, this relict pseudogene, designated as "ps(5.8S+ITS-2)", proves to be a valuable marker for specimen classification, phylogenetic analyses, and systematic

  6. The conservation of number and location of 18S sites indicates the relative stability of rDNA in species of Pentatomomorpha (Heteroptera).

    PubMed

    Bardella, Vanessa Bellini; Fernandes, Thiago; Vanzela, André Luís Laforga

    2013-07-01

    Fluorescent in situ hybridization (FISH) with rDNA probes has been used for comparative cytogenetics studies in different groups of organisms. Although heteropterans are a large suborder within Hemiptera, studies using rDNA are limited to the infraorder Cimicomorpha, in which rDNA sites are present in the autosomes or sex chromosomes. We isolated and sequenced a conserved 18S rDNA region of Antiteuchus tripterus (Pentatomidae) and used it as a probe against chromosomes of 25 species belonging to five different families of Pentatomomorpha. The clone pAt05, with a length of 736 bp, exhibited a conserved stretch of 590 bp. FISH analysis with the probe pAt05 always demonstrated hybridization signals in sub-terminal positions, except for Euschistus heros. Apparently, there is a tendency for 18S rDNA sites to locate in autosomes, except for Leptoglossus gonagra and Euryophthalmus rufipennis, which showed signals in the m- and sex chromosomes, respectively. Although FISH has produced evidence that rearrangements are involved in rDNA repositioning, whether in different autosomes or between sex and m-chromosomes, we have no conclusive evidence of what were the pathways of these rearrangements based on the evolutionary history of the species studied here. Nevertheless, the diversity in the number of species analyzed here showed a tendency of 18S rDNA to remain among the autosomes.

  7. Characterization of viable bacteria from Siberian permafrost by 16S rDNA sequencing

    NASA Technical Reports Server (NTRS)

    Shi, T.; Reeves, R. H.; Gilichinsky, D. A.; Friedmann, E. I.

    1997-01-01

    Viable bacteria were found in permafrost core samples from the Kolyma-Indigirka lowland of northeast Siberia. The samples were obtained at different depths; the deepest was about 3 million years old. The average temperature of the permafrost is -10 degrees C. Twenty-nine bacterial isolates were characterized by 16S rDNA sequencing and phylogenetic analysis, cell morphology, Gram staining, endospore formation, and growth at 30 degrees C. The majority of the bacterial isolates were rod shaped and grew well at 30 degrees C; but two of them did not grow at or above 28 degrees C, and had optimum growth temperatures around 20 degrees C. Thirty percent of the isolates could form endospores. Phylogenetic analysis revealed that the isolates fell into four categories: high-GC Gram-positive bacteria, beta-proteobacteria, gamma-proteobacteria, and low-GC Gram-positive bacteria. Most high-GC Gram-positive bacteria and beta-proteobacteria, and all gamma-proteobacteria, came from samples with an estimated age of 1.8-3.0 million years (Olyor suite). Most low-GC Gram-positive bacteria came from samples with an estimated age of 5,000-8,000 years (Alas suite).

  8. Molecular Analysis of Methanogen Richness in Landfill and Marshland Targeting 16S rDNA Sequences.

    PubMed

    Yadav, Shailendra; Kundu, Sharbadeb; Ghosh, Sankar K; Maitra, S S

    2015-01-01

    Methanogens, a key contributor in global carbon cycling, methane emission, and alternative energy production, generate methane gas via anaerobic digestion of organic matter. The methane emission potential depends upon methanogenic diversity and activity. Since they are anaerobes and difficult to isolate and culture, their diversity present in the landfill sites of Delhi and marshlands of Southern Assam, India, was analyzed using molecular techniques like 16S rDNA sequencing, DGGE, and qPCR. The sequencing results indicated the presence of methanogens belonging to the seventh order and also the order Methanomicrobiales in the Ghazipur and Bhalsawa landfill sites of Delhi. Sequences, related to the phyla Crenarchaeota (thermophilic) and Thaumarchaeota (mesophilic), were detected from marshland sites of Southern Assam, India. Jaccard analysis of DGGE gel using Gel2K showed three main clusters depending on the number and similarity of band patterns. The copy number analysis of hydrogenotrophic methanogens using qPCR indicates higher abundance in landfill sites of Delhi as compared to the marshlands of Southern Assam. The knowledge about "methanogenic archaea composition" and "abundance" in the contrasting ecosystems like "landfill" and "marshland" may reorient our understanding of the Archaea inhabitants. This study could shed light on the relationship between methane-dynamics and the global warming process. PMID:26568700

  9. New parachlamydial 16S rDNA phylotypes detected in human clinical samples.

    PubMed

    Corsaro, Daniele; Venditti, Danielle; Valassina, Marcello

    2002-11-01

    Chlamydiales are important intracellular bacterial pathogens, causing a wide variety of diseases in vertebrates, including humans. Besides the well-known species in the family Chlamydiaceae, new chlamydial organisms have recently been discovered, forming three new families: Parachlamydiaceae, Simkaniaceae and Waddliaceae. Parachlamydia acanthamoebae and Simkania negevensis are currently investigated as emerging human respiratory pathogens. Additional chlamydial lineages have been discovered by 16S rDNA-based molecular studies, and their implication in human infections is poorly known. By using a pan-chlamydia 16S rDNA PCR, we have searched for the presence of chlamydiae in 228 clinical samples that all previously had been shown to be PCR-negative for Chlamydophila pneumoniae: 170 respiratory samples, 45 atheromatic plaques and 13 peripheral blood mononuclear cell samples. Nine respiratory samples tested positive. Sequence analysis has allowed us to assign four sequences to Chlamydophila psittaci, three sequences to Chlamydophila felis, and two sequences to two novel phylotypes belonging to the Parachlamydiaceae. These latter sequences showed similarity values of more than 93% with each other and with the P. acanthamoebae sequence, thus belonging to novel, unrecognized species. In conclusion, this report showed that a variety of non-C. pneumoniae chlamydial respiratory infection is present in humans, and that new parachlamydiae distinct from P. acanthamoebae may be detected in human clinical samples. Future studies will be of interest in order to estimate the diversity of these novel chlamydiae in both clinical and environmental samples, as well as their possible clinical implication in human and animal infections.

  10. Molecular Analysis of Methanogen Richness in Landfill and Marshland Targeting 16S rDNA Sequences.

    PubMed

    Yadav, Shailendra; Kundu, Sharbadeb; Ghosh, Sankar K; Maitra, S S

    2015-01-01

    Methanogens, a key contributor in global carbon cycling, methane emission, and alternative energy production, generate methane gas via anaerobic digestion of organic matter. The methane emission potential depends upon methanogenic diversity and activity. Since they are anaerobes and difficult to isolate and culture, their diversity present in the landfill sites of Delhi and marshlands of Southern Assam, India, was analyzed using molecular techniques like 16S rDNA sequencing, DGGE, and qPCR. The sequencing results indicated the presence of methanogens belonging to the seventh order and also the order Methanomicrobiales in the Ghazipur and Bhalsawa landfill sites of Delhi. Sequences, related to the phyla Crenarchaeota (thermophilic) and Thaumarchaeota (mesophilic), were detected from marshland sites of Southern Assam, India. Jaccard analysis of DGGE gel using Gel2K showed three main clusters depending on the number and similarity of band patterns. The copy number analysis of hydrogenotrophic methanogens using qPCR indicates higher abundance in landfill sites of Delhi as compared to the marshlands of Southern Assam. The knowledge about "methanogenic archaea composition" and "abundance" in the contrasting ecosystems like "landfill" and "marshland" may reorient our understanding of the Archaea inhabitants. This study could shed light on the relationship between methane-dynamics and the global warming process.

  11. Molecular Analysis of Methanogen Richness in Landfill and Marshland Targeting 16S rDNA Sequences

    PubMed Central

    Yadav, Shailendra; Kundu, Sharbadeb; Ghosh, Sankar K.; Maitra, S. S.

    2015-01-01

    Methanogens, a key contributor in global carbon cycling, methane emission, and alternative energy production, generate methane gas via anaerobic digestion of organic matter. The methane emission potential depends upon methanogenic diversity and activity. Since they are anaerobes and difficult to isolate and culture, their diversity present in the landfill sites of Delhi and marshlands of Southern Assam, India, was analyzed using molecular techniques like 16S rDNA sequencing, DGGE, and qPCR. The sequencing results indicated the presence of methanogens belonging to the seventh order and also the order Methanomicrobiales in the Ghazipur and Bhalsawa landfill sites of Delhi. Sequences, related to the phyla Crenarchaeota (thermophilic) and Thaumarchaeota (mesophilic), were detected from marshland sites of Southern Assam, India. Jaccard analysis of DGGE gel using Gel2K showed three main clusters depending on the number and similarity of band patterns. The copy number analysis of hydrogenotrophic methanogens using qPCR indicates higher abundance in landfill sites of Delhi as compared to the marshlands of Southern Assam. The knowledge about “methanogenic archaea composition” and “abundance” in the contrasting ecosystems like “landfill” and “marshland” may reorient our understanding of the Archaea inhabitants. This study could shed light on the relationship between methane-dynamics and the global warming process. PMID:26568700

  12. Phylogenetic analysis of Leymus (Poaceae: Triticeae) inferred from nuclear rDNA ITS sequences.

    PubMed

    Sha, Li-Na; Yang, Rui-Wu; Fan, Xing; Wang, Xiao-Li; Zhou, Yong-Hong

    2008-10-01

    To investigate the phylogenetic relationships of polyploid Leymus (Poaceae: Triticeae), sequences of the nuclear rDNA internal transcribed spacer region (ITS) were analyzed for 34 Leymus accessions representing 25 species, together with three Psathyrostachys species (Ns genome), two Pseudoroegneria (St genome) species, Lophopyrum elongatum (E(e) genome), and Thinopyrum bessarabicum (E(b) genome). The phylogenetic analyses (maximum likelihood and Bayesian inference) supported two major clades, one including 21 Leymus species and three Psathyrostachys species, the other with nine Leymus species and four diploid species. The ITS RNA secondary structure of the Leymus species was compared with that of their putative diploid donor. It is suggested that (1) the species from the same areas or neighboring geographic regions are closely related to each other; (2) L. coreanus, L. duthiei, L. duthiei var. longearistatus, and L. komarovii are closely related to other Leymus species, and it is reasonable to transfer these species from the genus Hystrix to Leymus; (3) the ITS sequences of Leymus are evolutionarily distinct; (4) the different Leymus species and different distribution of a species derived their Ns genome from different Psathyrostachys species; and (5) there is a close relationship among Leymus, Pseudoroegneria, Lophopyrum, and Thinopyrum, but it is difficult to presume that the St, E(e), and E(b) genome may be the Xm genome donor of the Leymus species.

  13. Strong nondipole effects in low-energy photoionization of the 5s and 5p subshells of xenon

    SciTech Connect

    Johnson, W. R.; Cheng, K. T.

    2001-02-01

    Large nondipole effects are predicted in the angular distribution of photoelectrons from the 5s and 5p subshells of xenon for photon energies below 200 eV. The nondipole parameter {gamma}{sub 5s} exhibits a dispersion-curve variation near the first minimum of the 5s cross section at 35 eV, reaching a minimum value of -0.8 near 40 eV. Rapid variation of {gamma}{sub 5s} is also found near the second minimum of the 5s cross section at 150 eV, where {gamma}{sub 5s} reaches a maximum value of 1.2. Smaller, but significant, nondipole effects are also found in the parameter {zeta}{sub 5p}={gamma}{sub 5p}+3{delta}{sub 5p}, which has a maximum value of 0.15 near 50 eV, and a second maximum value of 0.18 near 160 eV. The higher energy maxima in {gamma}{sub 5s} and {zeta}{sub 5p} arise from correlation enhanced by shape resonances in the 4p{yields}f quadrupole photoionization channels. These predictions are based on relativistic random-phase approximation calculations in which excitations from 5p, 5s, 4d, 4p, and 4s subshells are coupled.

  14. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    PubMed

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-07

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  15. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site

    NASA Astrophysics Data System (ADS)

    Calviño, Fabiola R.; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-04-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP.

  16. The FERRUM project: Experimental transition probabilities from highly excited even 5s levels in Cr ii

    NASA Astrophysics Data System (ADS)

    Engström, L.; Lundberg, H.; Nilsson, H.; Hartman, H.; Bäckström, E.

    2014-10-01

    We report lifetime measurements of the five levels in the 3d4(a5D)5s e6D term in Cr ii at an energy around 83 000 cm-1, and log(gf) values for 38 transitions from the investigated levels. The lifetimes are obtained using time-resolved, laser-induced fluorescence on ions from a laser-produced plasma. Since the levels have the same parity as the low-lying states directly populated in the plasma, we used a two-photon excitation scheme. This process is greatly facilitated by the presence of the 3d4(a5D)4p z6F levels at roughly half the energy difference. The f-values are obtained by combining the experimental lifetimes with branching fractions derived using relative intensities from a hollow cathode lamp recorded with a Fourier transform spectrometer.

  17. Taxonomy of 5 S ribosomal RNA by the linguistic technique: probing with mitochondrial and mammalian sequences.

    PubMed

    Guimarães, R C; Trifonov, E N; Lagunez-Otero, J

    1997-09-01

    Linguistic similarities and dissimilarities between 5 S rRNA sequences allowed taxonomical separation of species and classes. Comparisons with the molecule from mammals distinguished fungi and plants from protists and animals. Similarities to mammalians progressively increased from protists to invertebrates and to somatic-type molecules of the vertebrates lineage. In this, deviations were detected in avian, oocyte type, and pseudogene sequences. Among bacteria, actinobacteria were most similar to the mammalians, which could be related to the high frequency of associations among members of these groups. Some archaebacterial species most similar to the mammalians belonged to the Thermoproteales and Halobacteria groups. Comparisons with the soybean mitochondrial molecule revealed high internal homogeneity among plant mitochondria. The eubacterial groups most similar to it were Thermus and Rhodobacteria gamma-1 and alpha-2. Other procedures have already indicated similarities of Rhodobacteria alpha to mitochondria but the linguistic similarities were on the average higher with the first two groups.

  18. Direct lateral interbody fusion (DLIF) at the lumbosacral junction L5-S1.

    PubMed

    Shirzadi, Ali; Birch, Kurtis; Drazin, Doniel; Liu, John C; Acosta, Frank

    2012-07-01

    The direct lateral interbody fusion (DLIF), a minimally invasive lateral approach for placement of an interbody fusion device, does not require nerve root retraction or any contact with the great vessels and can lead to short operative times with little blood loss. Due to anatomical restrictions, this procedure has not been used at the lumbosacral (L5-S1) junction. Lumbosacral transitional vertebrae (LSTV), a structural anomaly of the lumbosacral spine associated with low back pain, can result in a level being wrongly identified pre-operatively due to misnumbering of the vertebral levels. To our knowledge, use of the DLIF graft in this patient is the first report of an interbody fusion graft being placed at the disc space between the LSTV and S1 via the transpsoas route. We present a review of the literature regarding the LSTV variation as well as the lateral placement of interbody fusion grafts at the lumbosacral junction.

  19. Electric-dipole 5s - 5p Transitions in Promethiumlike Ions

    SciTech Connect

    Vilkas, M J; Ishikawa, Y; Trabert, E

    2008-02-29

    The 5s-5p electric-dipole resonance transitions in highly ionized promethiumlike ions have been studied applying relativistic multi-reference Moeller-Plesset second-order perturbation theory. The transition wavelengths are determined to within 0.2 {angstrom} in the more highly charged ions, where the level degeneracies are small. For somewhat lighter ions a very large reference space was used in order to account for the many degeneracies. In order to calculate transition probabilities and lifetimes, correlation corrections have been added to the transition operator in the next order. The contributions from the higher orders of the theory, that is, frequency-dependent Breit correction, Lamb shift, and mass shifts, have been estimated. The results are used to re-assess spectroscopic data from beam-foil, electron beam ion trap, and tokamak observations.

  20. Measurement of {Upsilon}(5S) decays to B{sup 0} and B{sup +} mesons

    SciTech Connect

    Drutskoy, A.; Kinoshita, K.; Schwartz, A. J.; Adachi, I.; Haba, J.; Itoh, R.; Iwasaki, Y.; Katayama, N.; Kichimi, H.; Krokovny, P.; Nakao, M.; Nishida, S.; Sakai, Y.; Sumisawa, K.; Trabelsi, K.; Tsuboyama, T.; Uno, S.; Wicht, J.; Aihara, H.; Aulchenko, V.

    2010-06-01

    Decays of the {Upsilon}(5S) resonance to channels with B{sup +} and B{sup 0} mesons are studied using a 23.6 fb{sup -1} data sample collected with the Belle detector at the KEKB asymmetric-energy e{sup +}e{sup -} collider. Fully reconstructed B{sup +{yields}}J/{psi}K{sup +}, B{sup 0{yields}}J/{psi}K*{sup 0}, B{sup +{yields}}D{sup 0{pi}+}, and B{sup 0{yields}}D{sup -{pi}+} decays are used to obtain the charged and neutral B production rates per bb event, f(B{sup +})=(72.1{sub -3.8}{sup +3.9{+-}}5.0)% and f(B{sup 0})=(77.0{sub -5.6}{sup +5.8{+-}}6.1)%. Assuming equal rates to B{sup +} and B{sup 0} mesons in all channels produced at the {Upsilon}(5S) energy, we measure the fractions for transitions to two-body and three-body channels with B meson pairs, f(BB)=(5.5{sub -0.9}{sup +1.0{+-}}0.4)%, f(BB*+B*B)=(13.7{+-}1.3{+-}1.1)%, f(B*B*)=(37.5{sub -1.9}{sup +2.1{+-}}3.0)%, f(BB{pi})=(0.0{+-}1.2{+-}0.3)%, f(BB*{pi}+B*B{pi})=(7.3{sub -2.1}{sup +2.3{+-}}0.8)%, and f(B*B*{pi})=(1.0{sub -1.3}{sup +1.4{+-}}0.4)%. The latter three fractions are obtained assuming isospin conservation.

  1. Measuring B{sub s} width difference at the {Upsilon}(5s) using quantum entanglement

    SciTech Connect

    Atwood, David; Soni, Amarjit

    2010-08-01

    About 90% of B{sub s}B{sub s} pairs produced at the {Upsilon}(5s) resonance are initially B{sub s}{sup *}B{sub s}{sup *} pairs which decay radiatively to B{sub s}B{sub s}. This implies that the B{sub s}B{sub s} pair will then be in an eigenstate of charge conjugation (i.e. C=-1) and therefore in an entangled state. This allows for a determination of {Delta}{Gamma}{sub s}/{Gamma}{sub s} and the CP phase using a number of possible correlations between the decays of the two B{sub s} mesons. In particular, we consider the time integrated correlation, the time ordering asymmetry, and the time ordering-charge asymmetry, which in addition to time ordering distinguishes B{sub s} from B{sub s}, for various combinations of final states. With the statistics of about O(10{sup 7}-10{sup 8}) {Upsilon}(5s) events available at B factories, we find that the time ordering asymmetry between suitably defined hadronic and flavor specific (tagging) decays offers a promising method for determining the width difference. The corresponding time ordering-charge asymmetry can also bound the mixing phase. Similar observables involving exclusive decays are also considered. At the super B factories with O(50) times greater luminosity time ordering and time ordering-charge asymmetries between inclusive and exclusive modes may also provide additional bounds on the phases in those decays.

  2. Observation of B{sub s} Production at the {upsilon}(5S) Resonance

    SciTech Connect

    Bonvicini, G.; Cinabro, D.; Dubrovin, M.; Lincoln, A.; Bornheim, A.; Pappas, S.P.; Weinstein, A.; Asner, D.M.; Edwards, K.W.; Briere, R.A.; Chen, G.P.; Chen, J.; Ferguson, T.; Tatishvili, G.; Vogel, H.; Watkins, M.E.; Rosner, J.L.; Adam, N.E.; Alexander, J.P.; Berkelman, K.

    2006-01-20

    Using the CLEO detector at the Cornell Electron Storage Ring, we have observed the B{sub s} meson in e{sup +}e{sup -} annihilation at the {upsilon}(5S) resonance. We find 14 candidates consistent with B{sub s} decays into final states with a J/{psi} or a D{sub s}{sup (*)-}. The probability that we have observed a background fluctuation is less than 8x10{sup -10}. We have established that at the energy of the {upsilon}(5S) resonance B{sub s} production proceeds predominantly through the creation of B{sub s}*B{sub s}* pairs. We find {sigma}(e{sup +}e{sup -}{yields}B{sub s}*B{sub s}*)=[0.11{sub -0.03}{sup +0.04}(stat){+-}0.02(syst)] nb, and set the following limits: {sigma}(e{sup +}e{sup -}{yields}B{sub s}B{sub s})/{sigma}(e{sup +}e{sup -}{yields}B{sub s}*B{sub s}*)<0.16 and [{sigma}(e{sup +}e{sup -}{yields}B{sub s}B{sub s}*)+{sigma}(e{sup +}e{sup -}{yields}B{sub s}*B{sub s})]/{sigma}(e{sup +}e{sup -}{yields}B{sub s}*= B{sub s}*)<0.16 (90% C.L.). The mass of the B{sub s}* meson is measured to be M{sub B{sub s}}{sub *}=[5.414{+-}0.001(stat){+-}0.003(syst)] GeV/c{sup 2}.

  3. Classification of 5-S Epileptic EEG Recordings Using Distribution Entropy and Sample Entropy.

    PubMed

    Li, Peng; Karmakar, Chandan; Yan, Chang; Palaniswami, Marimuthu; Liu, Changchun

    2016-01-01

    Epilepsy is an electrophysiological disorder of the brain, the hallmark of which is recurrent and unprovoked seizures. Electroencephalogram (EEG) measures electrical activity of the brain that is commonly applied as a non-invasive technique for seizure detection. Although a vast number of publications have been published on intelligent algorithms to classify interictal and ictal EEG, it remains an open question whether they can be detected using short-length EEG recordings. In this study, we proposed three protocols to select 5 s EEG segment for classifying interictal and ictal EEG from normal. We used the publicly-accessible Bonn database, which consists of normal, interical, and ictal EEG signals with a length of 4097 sampling points (23.6 s) per record. In this study, we selected three segments of 868 points (5 s) length from each recordings and evaluated results for each of them separately. The well-studied irregularity measure-sample entropy (SampEn)-and a more recently proposed complexity measure-distribution entropy (DistEn)-were used as classification features. A total of 20 combinations of input parameters m and τ for the calculation of SampEn and DistEn were selected for compatibility. Results showed that SampEn was undefined for half of the used combinations of input parameters and indicated a large intra-class variance. Moreover, DistEn performed robustly for short-length EEG data indicating relative independence from input parameters and small intra-class fluctuations. In addition, it showed acceptable performance for all three classification problems (interictal EEG from normal, ictal EEG from normal, and ictal EEG from interictal) compared to SampEn, which showed better results only for distinguishing normal EEG from interictal and ictal. Both SampEn and DistEn showed good reproducibility and consistency, as evidenced by the independence of results on analysing protocol.

  4. Classification of 5-S Epileptic EEG Recordings Using Distribution Entropy and Sample Entropy

    PubMed Central

    Li, Peng; Karmakar, Chandan; Yan, Chang; Palaniswami, Marimuthu; Liu, Changchun

    2016-01-01

    Epilepsy is an electrophysiological disorder of the brain, the hallmark of which is recurrent and unprovoked seizures. Electroencephalogram (EEG) measures electrical activity of the brain that is commonly applied as a non-invasive technique for seizure detection. Although a vast number of publications have been published on intelligent algorithms to classify interictal and ictal EEG, it remains an open question whether they can be detected using short-length EEG recordings. In this study, we proposed three protocols to select 5 s EEG segment for classifying interictal and ictal EEG from normal. We used the publicly-accessible Bonn database, which consists of normal, interical, and ictal EEG signals with a length of 4097 sampling points (23.6 s) per record. In this study, we selected three segments of 868 points (5 s) length from each recordings and evaluated results for each of them separately. The well-studied irregularity measure—sample entropy (SampEn)—and a more recently proposed complexity measure—distribution entropy (DistEn)—were used as classification features. A total of 20 combinations of input parameters m and τ for the calculation of SampEn and DistEn were selected for compatibility. Results showed that SampEn was undefined for half of the used combinations of input parameters and indicated a large intra-class variance. Moreover, DistEn performed robustly for short-length EEG data indicating relative independence from input parameters and small intra-class fluctuations. In addition, it showed acceptable performance for all three classification problems (interictal EEG from normal, ictal EEG from normal, and ictal EEG from interictal) compared to SampEn, which showed better results only for distinguishing normal EEG from interictal and ictal. Both SampEn and DistEn showed good reproducibility and consistency, as evidenced by the independence of results on analysing protocol. PMID:27148074

  5. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    NASA Technical Reports Server (NTRS)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  6. Variability of 18rDNA loci in four lace bug species (Hemiptera, Tingidae) with the same chromosome number

    PubMed Central

    Golub, Natalia V.; Golub, Viktor B.; Kuznetsova, Valentina G.

    2015-01-01

    Abstract Male karyotypes of Elasmotropis testacea (Herrich-Schaeffer, 1835), Tingis cardui (Linnaeus, 1758), Tingis crispata (Herrich-Schaeffer, 1838), and Agramma femorale Thomson, 1871 (Heteroptera, Cimicomorpha, Tingidae) were analyzed using conventional chromosome staining and FISH with 18S rDNA and (TTAGG)n telomeric probes. The FISH technique was applied for the first time in the Tingidae. In spite of the fact that all species showed the same chromosome number (2n = 12 + XY), they have significant differences in the number and position of rDNA loci. FISH with the classical insect (TTAGG)n probe produced no signals on chromosomes suggesting telomeres in lace bugs to be of some other molecular composition. Tingidae share absence of the (TTAGG)n telomeric sequence with all so far studied taxa of the advanced true bug infraorders Cimicomorpha and Pentatomomorpha. PMID:26753071

  7. Chromosome analysis and rDNA FISH in the stag beetle Dorcus parallelipipedus L. (Coleoptera: Scarabaeoidea: Lucanidae).

    PubMed

    Colomba, M S; Vitturi, R; Zunino, M

    2000-01-01

    In the present work the chromosome complement (2n = 18; 8AA + XY) of th