Science.gov

Sample records for 5s rdna loci

  1. Physical mapping of 18S and 5S rDNA loci and histone H3 gene in grasshopper species of the subfamily Gomphocerinae (Acrididae).

    PubMed

    Silva-Neto, L C; Bernardino, A C S; Loreto, V; Moura, R C

    2015-01-01

    In this study, fluorescence in situ hybridization (FISH) analysis was used to determine and compare the numbers and chromosomal locations of two multigene families (rDNA and histone H3) in four Neotropical species of gomphocerine grasshoppers. FISH using the 18S rDNA probe identified a single site on the S9 chromosome of Amblytropidia sp and Cauratettix borelli, a single site on chromosome M6 of Compsacris pulcher, and two sites (chromosomes L1 and L2) in Orphulella punctata. By contrast, FISH with a 5S rDNA probe identified dispersion of this sequence in the genomes of the four species, with evidence of intraspecific variations. Amblytropidia sp had six to eight FISH signals on autosomal chromosomes, while C. pulcher exhibited a signal only on the M5 bivalent. The histone H3 gene was less variable and was restricted to a single pair in all species. The conservation of the numbers and locations of 18S rDNA and H3 genes in conjunction with data from the literature was useful for evaluating karyotype evolution in this subfamily. The variation in the number and sizes of 5S rDNA sites indicates a process of recent dispersion that might have been mediated by transposition. PMID:26634462

  2. Analysis of the 5S RNA pool in Arabidopsis thaliana: RNAs are heterogeneous and only two of the genomic 5S loci produce mature 5S RNA.

    PubMed

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5'- and 3'-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array. PMID:11779838

  3. [Analysis of 5S rDNA changes in synthetic allopolyploids Triticum x Aegilops].

    PubMed

    Shcherban', A B; Sergeeva, E M; Badaeva, E D; Salina, E A

    2008-01-01

    By the example of three synthetic allopolyploids: Aegilops sharonensis x Ae. umbellulata (2n =28), Triticum urartu x Ae. tauschii (2n =28), T. dicoccoides x Ae. tauschii (2n =42) the 5S rDNA changes at the early stage of allopolyploidization were investigated. Using fluorescent in situ hybridization (FISH), the quantitative changes affecting the separate loci of one of the parental genomes were revealed in plants of S3 generation of each hybrid combination. Souther hybridization with genomic DNA of allopolyploid T. urartu x Ae. tauschii (TMU38 x TQ27) revealed lower intensity of the fragments from Ae. tauschii compared with the T. urartu fragments. It may be confirmation of the reduction of signal on 1D chromosome that was revealed in this hybrid using FISH. Both appearance of a new 5S rDNA fragments and full disappearance of fragments from parental species were not showed by Southern hybridization, as well as PCR-analysis of 5-15 plants of S2-S3 generations. The changes were not found under comparison of primary structure of nine 5S rDNA sequences of allopolyploid TMU38 x TQ27 with analogous sequences from parental species genomes. The observable similarity by FISH results of one of the studied synthetic allopolyploids with natural allopolyploid of similar genome composition indicates the early formation of unique for each allopolyploid 5S rDNA organization. PMID:18856060

  4. Variation in rDNA locus number and position among legume species and detection of 2 linked rDNA loci in the model Medicago truncatula by FISH.

    PubMed

    Abirached-Darmency, Mona; Prado-Vivant, Emilce; Chelysheva, Liudmila; Pouthier, Thomas

    2005-06-01

    Within Fabaceae, legume species have a variable genome size, chromosome number, and ploidy level. The genome distribution of ribosomal genes, easily detectable by fluorescent in situ hybridization (FISH), is a good tool for anchoring physical and genetic comparative maps. The organisation of 45S rDNA and 5S loci was analysed by FISH in the 4 closely related species: Pisum sativum, Medicago truncatula, Medicago sativa (2 diploid taxa), and Lathyrus sativus. The 2 types of rDNA arrays displayed interspecific variation in locus number and location, but little intraspecific variation was detected. In the model legume, M. truncatula, the presence of 2 adjacent 45S rDNA loci was demonstrated, and the location of the rDNA loci was independent of the general evolution of the genome DNA. The different parameters relative to clustering of the rDNA loci in specific chromosome regions and the possible basis of rDNA instability are discussed. PMID:16121252

  5. Analysis of the 5S RNA Pool in Arabidopsis thaliana: RNAs Are Heterogeneous and Only Two of the Genomic 5S Loci Produce Mature 5S RNA

    PubMed Central

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5′- and 3′-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array. [EMBL accession nos: AF330825-AF331032; AF335777-AF335873.] PMID:11779838

  6. Chromosomal Locations of 5S and 45S rDNA in Gossypium Genus and Its Phylogenetic Implications Revealed by FISH

    PubMed Central

    Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo

    2013-01-01

    We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G. incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G. raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution. PMID:23826377

  7. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    PubMed

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit. PMID:27106499

  8. Interplay of RNA Pol IV and ROS1 during post-embryonic 5S rDNA chromatin remodeling.

    PubMed

    Douet, Julien; Blanchard, Bertrand; Cuvillier, Claudine; Tourmente, Sylvette

    2008-12-01

    We have investigated the chromatin structure of 5S rDNA, a heterochromatic pericentromeric tandemly repeated family, at 2, 3, 4 and 5 days post-germination. Our results revealed a large-scale reorganization of 5S rDNA chromatin that occurs during the first days of development. Unexpectedly, there is a decondensation followed by a 're'condensation of 5S rDNA chromatin, to obtain almost mature nuclei 5 d post-germination. The reorganization of 5S rDNA chromatin is accompanied by a rapid and active demethylation of 5S rDNA mediated by the ROS1 (repressor of silencing 1) demethylase, whereas the plant-specific RNA polymerase IV (Pol IV) is essential to the 5S chromatin 're'condensation. In conclusion, Pol IV and ROS1 collaborate to unlock the 5S rDNA chromatin inherited from the seed, and establish adult features. PMID:18845569

  9. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    PubMed

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-04-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS. PMID:26488198

  10. Comparative Studies of 5S rDNA Profiles and Cyt b Sequences in two Onychostoma Species (Cyprinidae)

    PubMed Central

    Han, Chiao-Chuan; Yen, Tsair-Bor; Chen, Nian-Cih; Tseng, Mei-Chen

    2015-01-01

    Onychostoma barbatulum and O. alticorpus, two primarily freshwater cyprinid fish, have similar morphological characters and partially overlapping ecological habitats. In order to explore the genetic differences between these two species, chromosomal characteristics and genetic variations were examined by fluorescence in situ hybridization (FISH) of 5S rDNA and cytochrome (Cyt) b gene analysis. Ten specimens of O. barbatulum and O. alticorpus were collected from the Nanzihsian Stream in southern Taiwan. FISH revealed that the 5S rDNA loci of O. barbatulum and O. alticorpus were found at a pericentromeric and subtelomeric position, respectively, in a pair of submetacentric chromosomes. Cyt b genes were amplified and sequenced from five individuals of each species. Intraspecific genetic distances ranged from 0.001–0.004 in O. barbatulum and from 0.001–0.006 in O. alticorpus. Genetic distances between these two species ranged from 0.132–0.142. The phylogenetic tree showed these two species are not sister species. In conclusion, FISH cytogenetic information and Cyt b gene analyses indicated that these two species have significantly different genetic characteristics; nevertheless, their morphological similarities may be due to environmental adaptation. PMID:26690426

  11. Analysis of 5S rDNA arrays in Arabidopsis thaliana: physical mapping and chromosome-specific polymorphisms.

    PubMed

    Cloix, C; Tutois, S; Mathieu, O; Cuvillier, C; Espagnol, M C; Picard, G; Tourmente, S

    2000-05-01

    A physical map of a pericentromeric region of chromosome 5 containing a 5S rDNA locus and spanning approximately 1000 kb was established using the CIC YAC clones. Three 5S rDNA arrays were resolved in this YAC contig by PFGE analysis and we have mapped different types of sequences between these three blocks. 5S rDNA units from each of these three arrays of chromosome 5, and from chromosomes 3 and 4, were isolated by PCR. A total of 38 new DNA sequences were obtained. Two types of 5S rDNA repeated units exist: the major variant with 0.5-kb repeats and one with short repeats (251 bp) only detected on YAC 11A3 from chromosome 3. Although the 38 sequences displayed noticeable heterogeneity, we were able to group them according to their 5S array origin. The presence of 5S array-specific variants was confirmed with the restriction polymorphism study of all the YACs carrying 5S units. PMID:10810091

  12. Molecular dissection of the rDNA array and of the 5S rDNA gene in Meloidogyne artiellia: phylogenetic and diagnostic implications.

    PubMed

    Veronico, Pasqua; De Luca, Francesca; De Giorgi, Carla

    2004-06-01

    The sequence of a 13.423 nucleotide genomic fragment has been determined for the plant parasitic nematode Meloidogyne artiellia. It contains an entire rDNA cluster, the bordering intergenic regions and portions of the flanking coding regions. The sequence analysis of the rDNA repeats suggests homogeneity in M. artiellia, thus providing a further indication of the usefulness of these genes for the diagnostic identification of this species. The comparison of the secondary structures of the internal transcribed spacer 2 region in several Meloidogyne species indicates that RNA folding predictions can be used as a tool of potential diagnostic relevance. The other ribosomal gene, 5S rDNA, has been demonstrated to be functional and located near the trans-spliced leader sequences, in the same arrangement found in the distantly related nematode Caenorhabditis elegans but never in other Meloidogyne thus providing species-specific markers for the identification of several Thylenchida parasitic nematodes. PMID:15135452

  13. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family

    PubMed Central

    2010-01-01

    Background In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in ~200 species representing the family diversity and other closely related groups. Results Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Conclusions Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units

  14. A Pol V–Mediated Silencing, Independent of RNA–Directed DNA Methylation, Applies to 5S rDNA

    PubMed Central

    Douet, Julien; Tutois, Sylvie; Tourmente, Sylvette

    2009-01-01

    The plant-specific RNA polymerases Pol IV and Pol V are essential to RNA–directed DNA methylation (RdDM), which also requires activities from RDR2 (RNA–Dependent RNA Polymerase 2), DCL3 (Dicer-Like 3), AGO4 (Argonaute), and DRM2 (Domains Rearranged Methyltransferase 2). RdDM is dedicated to the methylation of target sequences which include transposable elements, regulatory regions of several protein-coding genes, and 5S rRNA–encoding DNA (rDNA) arrays. In this paper, we have studied the expression of the 5S-210 transcript, a marker of silencing release at 5S RNA genes, to show a differential impact of RNA polymerases IV and V on 5S rDNA arrays during early development of the plant. Using a combination of molecular and cytological assays, we show that Pol IV, RDR2, DRM2, and Pol V, actors of the RdDM, are required to maintain a transcriptional silencing of 5S RNA genes at chromosomes 4 and 5. Moreover, we have shown a derepression associated to chromatin decondensation specific to the 5S array from chromosome 4 and restricted to the Pol V–loss of function. In conclusion, our results highlight a new role for Pol V on 5S rDNA, which is RdDM–independent and comes specifically at chromosome 4, in addition to the RdDM pathway. PMID:19834541

  15. Chromosomal location of 18S and 5S rDNA sites in Triportheus fish species (Characiformes, Characidae)

    PubMed Central

    2009-01-01

    The location of 18S and 5S rDNA sites was determined in eight species and populations of the fish genus Triportheus by using fluorescent in situ hybridization (FISH). The males and females of all species had 2n = 52 chromosomes and a ZZ/ZW sex chromosome system. A single 18S rDNA site that was roughly equivalent to an Ag-NOR was detected on the short arms of a submetacentric pair in nearly all species, and up to two additional sites were also observed in some species. In addition, another 18S rDNA cluster was identified in a distal region on the long arms of the W chromosome; this finding corroborated previous evidence that this cluster would be a shared feature amongst Triportheus species. In T. angulatus, a heterozygotic paracentric inversion involving the short arms of one homolog of a metacentric pair was associated with NORs. The 5S rDNA sites were located on the short arms of a single submetacentric chromosomal pair, close to the centromeres, except in T. auritus, which had up to ten 5S rDNA sites. The 18S and 5S rDNA sites were co-localized and adjacent on the short arms of a chromosomal pair in two populations of T. nematurus. Although all Triportheus species have a similar karyotypic macrostructure, the results of this work show that in some species ribosomal genes may serve as species-specific markers when used in conjunction with other putatively synapomorphic features. PMID:21637644

  16. Identification of a 5S rDNA spacer type specific Triticum urartu and wheats containing the T. urartu genome.

    PubMed

    Allaby, R G; Brown, T A

    2000-04-01

    A PCR system was designed to amplify 5S spacer rDNA specifically from homeologous chromosome 1 in a variety of species representative of the Aegilops and Triticum genera. Two polymerase chain reaction (PCR) primer combinations were used, one of which appears to be apomorphic in nature and specific to chromosome 1A in Triticum urartu and tetraploid and hexaploid wheats containing the AA genome donated by T. urartu. The value of studying single repeat types to investigate the molecular evolution of 5S-rDNA arrays is considered. PMID:10791812

  17. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    PubMed

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus. PMID:26959315

  18. Chromosome mapping of 18S rDNA and 5S rDNA by dual-color fluorescence in situ hybridization in the half-smooth tongue sole (Cynoglossus semilaevis).

    PubMed

    Jiang, L; Jiang, J; Liu, J; Yuan, J; Chen, Y; Zhang, Q; Wang, X

    2014-01-01

    Half-smooth tongue sole (Cynoglossus semilaevis) is an important aquaculture flatfish in China. Cytogenetic analysis has revealed that its sex determination system is female heterogametic (ZZ/ZW). The W chromosome is morphologically larger and has been considered evolutionarily younger than any other chromosome in the set. However, the genetic origin and evolution process of this neo-chromosome remains unclear. In this study, 2 tandem arrays of rRNA genes were chosen to address this question. Both the major rDNA (18S rDNA) and the minor rDNA (5S rDNA) were located on the C. semilaevis chromosomes by fluorescence in situ hybridization (FISH). Six 18S rDNA signals were observed on the centromeric regions of 3 pairs of autosomes in both males and females. In females, there was an additional 18S rDNA signal mapping to the telomeric region of the W chromosome long arm. With respect to the 5S rDNA, 12 signals were mapped to the centromeric regions of six pairs of autosomes. Two-color FISH further confirmed that the two pairs of the 5S rDNA signals were correspondingly located at the same positions of the same autosomes as those of the 18S rDNA signals. These results allowed us to speculate about the evolution process of the W chromosome. Chromosome fusions and repetitive sequence accumulations might have occurred in C. semilaevis. The synteny and non-synteny of C. semilaevis 18S rDNA and 5S rDNA might imply the original and evolutionary characteristics of this species. These findings will facilitate studies on karyotype evolution of the order Pleuronectiformes. PMID:25526196

  19. Karyotype divergence and spreading of 5S rDNA sequences between genomes of two species: darter and emerald gobies ( Ctenogobius , Gobiidae).

    PubMed

    Lima-Filho, P A; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Molina, W F

    2014-01-01

    Karyotype analyses of the cryptobenthic marine species Ctenogobius boleosoma and C. smaragdus were performed by means of classical and molecular cytogenetics, including physical mapping of the multigene 18S and 5S rDNA families. C. boleosoma has 2n = 44 chromosomes (2 submetacentrics + 42 acrocentrics; FN = 46) with a single chromosome pair each carrying 18S and 5S ribosomal sites; whereas C. smaragdus has 2n = 48 chromosomes (2 submetacentrics + 46 acrocentrics; FN = 50), also with a single pair bearing 18S rDNA, but an extensive increase in the number of GC-rich 5S rDNA sites in 21 chromosome pairs. The highly divergent karyotypes among Ctenogobius species contrast with observations in several other marine fish groups, demonstrating an accelerated rate of chromosomal evolution mediated by both chromosomal rearrangements and the extensive dispersion of 5S rDNA sequences in the genome. PMID:24643007

  20. Phylogenetic analysis of encapsulated and non-encapsulated Trichinella species by studying the 5S rDNA tandemly repeated intergenic region.

    PubMed

    van der Giessen, J W B; Fonville, M; Briels, I; Pozio, E

    2005-09-01

    The identification of sequence regions in the genomes of pathogens which can be useful to distinguish among species and genotypes, is of great importance for epidemiological, molecular, and phylogenetic studies. The 5S ribosomal DNA intergenic spacer region has been identified as a good target to distinguish among eight Trichinella species and genotypes. The recent discovery of two non-encapsulated species in this genus, Trichinella papuae and Trichinella zimbabwensis, which can infect both mammals and reptiles, has suggested analyzing their 5S rDNA. Amplification of the tandem repeats of the 5S rDNA intergenic region of encapsulated species of Trichinella shows a 751bp fragment, whereas the three non-encapsulated species show a fragment of 800bp with T. pseudospiralis showing an additional fragment of 522bp. Although the size of the 800bp PCR fragments of T. papuae and T. zimbabwensis are similar to that of T. pseudospiralis, there are differences in the 5S rDNA intergenic regions among the three non-encapsulated species. Phylogenetic analysis of the 5S rDNA intergenic regions shows a clustering together of the three non-encapsulated Trichinella species that is well separated from the encapsulated ones. In addition, a single PCR-based method allows distinguishing non-encapsulated and encapsulated species. PMID:16076532

  1. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).

    PubMed

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M

    2011-08-01

    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant. PMID:21364693

  2. Molecular confirmation of the genomic constitution of Douglasdeweya (Triticeae: Poaceae): demonstration of the utility of the 5S rDNA sequence as a tool for haplome identification.

    PubMed

    Baum, Bernard R; Johnson, Douglas A

    2008-06-01

    A new genus Douglasdeweya containing the two species, Douglasdeweya deweyi and D. wangii was published in 2005 by Yen et al. based upon the results of cytogenetical and morphological findings. The genome constitution of Douglasdeweya-PPStSt-allowed its segregation from the genus Pseudoroegneria which contains the StSt or StStStSt genomes. Our previous work had demonstrated the utility of using 5S rDNA units, especially the non-transcribed spacer sequence variation, for the resolution of genomes (haplomes) previously established by cytology. Here, we show that sequence analysis of the 5S DNA units from these species strongly supports the proposed species relationships of Yen et al. (Can J Bot 83:413-419, 2005), i.e., the PP genome from Agropyron and the StSt genome from Pseudoroegneria. Analysis of the 5S rDNA units constitutes a powerful tool for genomic research especially in the Triticeae. PMID:18421479

  3. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

    PubMed Central

    Garcia, S; Kovařík, A

    2013-01-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S–5.8S–26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S–18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S–5.8S–26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants. PMID:23512008

  4. Evidence for 5S rDNA Horizontal Transfer in the toadfish Halobatrachus didactylus (Schneider, 1801) based on the analysis of three multigene families

    PubMed Central

    2012-01-01

    Background The Batrachoididae family is a group of marine teleosts that includes several species with more complicated physiological characteristics, such as their excretory, reproductive, cardiovascular and respiratory systems. Previous studies of the 5S rDNA gene family carried out in four species from the Western Atlantic showed two types of this gene in two species but only one in the other two, under processes of concerted evolution and birth-and-death evolution with purifying selection. Here we present results of the 5S rDNA and another two gene families in Halobatrachus didactylus, an Eastern Atlantic species, and draw evolutionary inferences regarding the gene families. In addition we have also mapped the genes on the chromosomes by two-colour fluorescence in situ hybridization (FISH). Results Two types of 5S rDNA were observed, named type α and type β. Molecular analysis of the 5S rDNA indicates that H. didactylus does not share the non-transcribed spacer (NTS) sequences with four other species of the family; therefore, it must have evolved in isolation. Amplification with the type β specific primers amplified a specific band in 9 specimens of H. didactylus and two of Sparus aurata. Both types showed regulatory regions and a secondary structure which mark them as functional genes. However, the U2 snRNA gene and the ITS-1 sequence showed one electrophoretic band and with one type of sequence. The U2 snRNA sequence was the most variable of the three multigene families studied. Results from two-colour FISH showed no co-localization of the gene coding from three multigene families and provided the first map of the chromosomes of the species. Conclusions A highly significant finding was observed in the analysis of the 5S rDNA, since two such distant species as H. didactylus and Sparus aurata share a 5S rDNA type. This 5S rDNA type has been detected in other species belonging to the Batrachoidiformes and Perciformes orders, but not in the Pleuronectiformes

  5. Variability of 18rDNA loci in four lace bug species (Hemiptera, Tingidae) with the same chromosome number

    PubMed Central

    Golub, Natalia V.; Golub, Viktor B.; Kuznetsova, Valentina G.

    2015-01-01

    Abstract Male karyotypes of Elasmotropis testacea (Herrich-Schaeffer, 1835), Tingis cardui (Linnaeus, 1758), Tingis crispata (Herrich-Schaeffer, 1838), and Agramma femorale Thomson, 1871 (Heteroptera, Cimicomorpha, Tingidae) were analyzed using conventional chromosome staining and FISH with 18S rDNA and (TTAGG)n telomeric probes. The FISH technique was applied for the first time in the Tingidae. In spite of the fact that all species showed the same chromosome number (2n = 12 + XY), they have significant differences in the number and position of rDNA loci. FISH with the classical insect (TTAGG)n probe produced no signals on chromosomes suggesting telomeres in lace bugs to be of some other molecular composition. Tingidae share absence of the (TTAGG)n telomeric sequence with all so far studied taxa of the advanced true bug infraorders Cimicomorpha and Pentatomomorpha. PMID:26753071

  6. Chromosomal localization of 5S rDNA in Chinese shrimp ( Fenneropenaeus chinensis): a chromosome-specific marker for chromosome identification

    NASA Astrophysics Data System (ADS)

    Huan, Pin; Zhang, Xiaojun; Li, Fuhua; Zhao, Cui; Zhang, Chengsong; Xiang, Jianhai

    2010-03-01

    Chinese shrimp ( Fenneropenaeus chinensis) is an economically important aquaculture species in China. However, cytogenetic and genomic data is limited in the organism partly because the chromosomes are difficult to isolate and analyze. In this study, fluorescence in-situ hybridization (FISH) was used to identify the chromosomes of F. chinensis. The 5S ribosomal RNA gene (rDNA) of F. chinensis was isolated, cloned and then used as a hybridization probe. The results show that the 5S rDNA was located on one pair of homologous chromosomes in F. chinensis. In addition, triploid shrimp were used to evaluate the feasibility of chromosome identification using FISH and to validate the method. It was confirmed that 5S rDNA can be used as a chromosome-specific probe for chromosome identification in F. chinensis. The successful application of FISH in F. chinensis shows that chromosome-specific probes can be developed and this finding will facilitate further research on the chromosomes of penaeid shrimps.

  7. Physical Mapping of the 5S and 18S rDNA in Ten Species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae): Evolutionary Tendencies in the Genus

    PubMed Central

    César Venere, Paulo; Thums Konerat, Jocicléia; Henrique Zawadzki, Cláudio; Ricardo Vicari, Marcelo; Margarido, Vladimir Pavan

    2014-01-01

    Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH) with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus. PMID:25405240

  8. When fathers are instant losers: homogenization of rDNA loci in recently formed Cardamine × schulzii trigenomic allopolyploid.

    PubMed

    Zozomová-Lihová, Judita; Mandáková, Terezie; Kovaříková, Alena; Mühlhausen, Andreas; Mummenhoff, Klaus; Lysak, Martin A; Kovařík, Aleš

    2014-09-01

    Recently formed allopolyploids represent an excellent system to study the impacts of hybridization and genomic duplication on genome structure and evolution. Here we explored the 35SrRNA genes (rDNA) in the Cardamine × schulzii allohexaploid that was formed by two subsequent hybridization events within the past c. 150 yr. The rDNA loci were analyzed by cloning, next generation sequencing (NGS), RT-PCR and FISH methods. The primary C. × insueta triploid hybrid derived from C. rivularis (♀) and C. amara (♂) had gene ratios highly skewed towards maternal sequences. Similarly, C. × schulzii, originating from the secondary hybridization event involving C. × insueta (♀) and C. pratensis (♂), showed a reduction in paternal rDNA homeologs despite an excess of chromosomes inherited from C. pratensis. We also identified novel rDNA loci in C. × schulzii, suggesting that lost loci might be slowly reinstalled by translocation (but not recombination) of genes from partner genomes. Prevalent clonal propagation of allopolyploids, C. × insueta and C. × schulzii, indicates that concerted evolution of rDNA may occur in the absence of extensive meiotic cycles. Adoption of NGS in rDNA variant analysis is highly informative for deciphering the evolutionary histories of allopolyploid species with ongoing homogenization processes. PMID:24916080

  9. R1 and R2 retrotransposition and deletion in the rDNA loci on the X and Y chromosomes of Drosophila melanogaster.

    PubMed Central

    Pérez-González, César E; Burke, William D; Eickbush, Thomas H

    2003-01-01

    The non-LTR retrotransposons R1 and R2 insert into the 28S rRNA genes of arthropods. Comparisons among Drosophila lineages have shown that these elements are vertically inherited, while studies within species have indicated a rapid turnover of individual copies (elimination of old copies and the insertion of new copies). To better understand the turnover of R1 and R2, 200 retrotranspositions and nearly 100 eliminations have been scored in the Harwich mutation-accumulation lines of Drosophila melanogaster. Because the rDNA arrays in D. melanogaster are present on the X and Y chromosomes and no exchanges were detected in these lines, it was possible to show that R1 retrotranspositions occur predominantly in the male germ line, while R2 retrotranspositions were more evenly divided between the germ lines of both sexes. The rate of elimination of elements from the Y rDNA array was twice that of the X rDNA array with both chromosomal loci containing regions where the rate of elimination was on average eight times higher. Most R1 and R2 eliminations appear to occur by large intrachromosomal events (i.e., loop-out events) that involve multiple rDNA units. These findings are interpreted in light of the known abundance of R1 and R2 elements in the X and Y rDNA loci of D. melanogaster. PMID:14573479

  10. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

    2016-04-15

    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. PMID:26789074

  11. Evolution of the tetraploid Anemone multifida (2n = 32) and hexaploid A. baldensis (2n = 48) (Ranunculaceae) was accompanied by rDNA loci loss and intergenomic translocation: evidence for their common genome origin

    PubMed Central

    Mlinarec, J.; Šatović, Z.; Malenica, N.; Ivančić-Baće, I.; Besendorfer, V.

    2012-01-01

    Background and Aims In the genus Anemone two small groups of taxa occur with the highest ploidy levels 2n = 6x = 48, belonging to the closely related clades: the montane/alpine Baldensis clade and the more temperate Multifida clade. To understand the formation of polyploids within these groups, the evolution of allohexaploid A. baldensis (AABBDD, 2n = 6x = 48) from Europe and allotetraploid Anemone multifida (BBDD, 2n = 4x = 32) from America was analysed. Methods Internal transcribed spacer and non-transcribed spacer sequences were used as molecular markers for phylogenetic analyses. Cytogenetic studies, including genomic in situ hybridization with genomic DNA of potential parental species as probe, fluorescence in situ hybridization with 5S and 18S rDNA as probes and 18S rDNA restriction analyses, were used to identify the parental origin of chromosomes and to study genomic changes following polyploidization. Key Results This study shows that A. multifida (BBDD, 2n= 4x = 32) and A. baldensis (AABBDD, 2n = 6x = 48) are allopolyploids originating from the crosses of diploid members of the Multifida (donor of the A and B subgenomes) and Baldensis groups (donor of the D subgenome). The A and B subgenomes are closely related to the genomes of A. sylvestris, A. virginiana and A. cylindrica, indicating that these species or their progeny might be the ancestral donors of the B subgenome of A. multifida and A and B subgenomes of A. baldensis. Both polyploids have undergone genomic changes such as interchromosomal translocation affecting B and D subgenomes and changes at rDNA sites. Anemone multifida has lost the 35S rDNA loci characteristic of the maternal donor (B subgenome) and maintained only the rDNA loci of the paternal donor (D subgenome). Conclusions It is proposed that A. multifida and A. baldensis probably had a common ancestor and their evolution was facilitated by vegetation changes during the Quaternary, resulting in their present disjunctive distribution. PMID

  12. Localization of 5S and 25S rRNA genes on somatic and meiotic chromosomes in Capsicum species of chili pepper.

    PubMed

    Kwon, Jin-Kyung; Kim, Byung-Dong

    2009-02-28

    The loci of the 5S and 45S rRNA genes were localized on chromosomes in five species of Capsicum, namely, annuum, chacoense, frutescens, baccatum, and chinense by FISH. The 5S rDNA was localized to the distal region of one chromosome in all species observed. The number of 45S rDNA loci varied among species; one in annuum, two in chacoense, frutescens, and chinense, and four in baccatum, with the exceptions that 'CM334' of annuum had three loci and 'tabasco' of frutescens had one locus. 'CM334'-derived BAC clones, 384B09 and 365P05, were screened with 5S rDNA as a probe, and BACs 278M03 and 262A23 were screened with 25S rDNA as a probe. Both ends of these BAC clones were sequenced. FISH with these BAC probes on pachytenes from 'CM334' plant showed one 5S rDNA locus and three 45S rDNA loci, consistent with the patterns on the somatic chromosomes. The 5S rDNA probe was also applied on extended DNA fibers to reveal that its coverage measured as long as 0.439 Mb in the pepper genome. FISH techniques applied on somatic and meiotic chromosomes and fibers have been established for chili to provide valuable information about the copy number variation of 45S rDNA and the actual physical size of the 5S rDNA in chili. PMID:19277503

  13. Chromosomal Mapping of Repetitive DNA Sequences in Five Species of Astyanax (Characiformes, Characidae) Reveals Independent Location of U1 and U2 snRNA Sites and Association of U1 snRNA and 5S rDNA.

    PubMed

    Silva, Duilio M Z A; Utsunomia, Ricardo; Pansonato-Alves, José C; Oliveira, Cláudio; Foresti, Fausto

    2015-01-01

    Astyanax is a genus of Characidae fishes currently composed of 155 valid species. Previous cytogenetic studies revealed high chromosomal diversification among them, and several studies have been performed using traditional cytogenetic techniques to investigate karyotypes and chromosomal locations of 18S and 5S rDNA genes. However, only a few studies are currently available about other repetitive sequences. Here, the chromosomal location of small nuclear RNA genes, identified as U1 and U2 snRNA clusters, was established and compared to the distribution of 5S rDNA and histone clusters in 5 Astyanax species (A. paranae, A. fasciatus, A. bockmanni, A. altiparanae, and A. jordani) using FISH. The cytogenetic mapping of U1 and U2 snRNA demonstrated a conserved pattern in the number of sites per genome independent of the location in Astyanax species. The location of the U1 snRNA gene was frequently associated with 5S rDNA sequences, indicating a possible interaction between the distinct repetitive DNA families. Finally, comparisons involving the location of U1 and U2 snRNA clusters in the chromosomes of Astyanax species revealed a very diverse pattern, suggesting that many rearrangements have occurred during the diversification process of this group. PMID:26329975

  14. Inhibition of DNA Methylation Alters Chromatin Organization, Nuclear Positioning and Activity of 45S rDNA Loci in Cycling Cells of Q. robur

    PubMed Central

    Horvat, Tomislav; Maglica, Željka; Vojta, Aleksandar; Zoldoš, Vlatka

    2014-01-01

    Around 2200 copies of genes encoding ribosomal RNA (rRNA) in pedunculate oak, Quercus robur, are organized into two rDNA loci, the major (NOR-1) and the minor (NOR-2) locus. We present the first cytogenetic evidence indicating that the NOR-1 represents the active nucleolar organizer responsible for rRNA synthesis, while the NOR-2 probably stays transcriptionally silent and does not participate in the formation of the nucleolus in Q. robur, which is a situation resembling the well-known phenomenon of nucleolar dominance. rDNA chromatin topology analyses in cycling root tip cells by light and electron microscopy revealed the minor locus to be highly condensed and located away from the nucleolus, while the major locus was consistently associated with the nucleolus and often exhibited different levels of condensation. In addition, silver precipitation was confined exclusively to the NOR-1 locus. Also, NOR-2 was highly methylated at cytosines and rDNA chromatin was marked with histone modifications characteristic for repressive state. After treatment of the root cells with the methylation inhibitor 5-aza-2′-deoxycytidine, we observed an increase in the total level of rRNA transcripts and a decrease in DNA methylation level at the NOR-2 locus. Also, NOR-2 sites relocalized with respect to the nuclear periphery/nucleolus, however, the relocation did not affect the contribution of this locus to nucleolar formation, nor did it affect rDNA chromatin decondensation, strongly suggesting that NOR-2 has lost the function of rRNA synthesis and nucleolar organization. PMID:25093501

  15. Inhibition of DNA methylation alters chromatin organization, nuclear positioning and activity of 45S rDNA loci in cycling cells of Q. robur.

    PubMed

    Bočkor, Vedrana Vičić; Barišić, Darko; Horvat, Tomislav; Maglica, Željka; Vojta, Aleksandar; Zoldoš, Vlatka

    2014-01-01

    Around 2200 copies of genes encoding ribosomal RNA (rRNA) in pedunculate oak, Quercus robur, are organized into two rDNA loci, the major (NOR-1) and the minor (NOR-2) locus. We present the first cytogenetic evidence indicating that the NOR-1 represents the active nucleolar organizer responsible for rRNA synthesis, while the NOR-2 probably stays transcriptionally silent and does not participate in the formation of the nucleolus in Q. robur, which is a situation resembling the well-known phenomenon of nucleolar dominance. rDNA chromatin topology analyses in cycling root tip cells by light and electron microscopy revealed the minor locus to be highly condensed and located away from the nucleolus, while the major locus was consistently associated with the nucleolus and often exhibited different levels of condensation. In addition, silver precipitation was confined exclusively to the NOR-1 locus. Also, NOR-2 was highly methylated at cytosines and rDNA chromatin was marked with histone modifications characteristic for repressive state. After treatment of the root cells with the methylation inhibitor 5-aza-2'-deoxycytidine, we observed an increase in the total level of rRNA transcripts and a decrease in DNA methylation level at the NOR-2 locus. Also, NOR-2 sites relocalized with respect to the nuclear periphery/nucleolus, however, the relocation did not affect the contribution of this locus to nucleolar formation, nor did it affect rDNA chromatin decondensation, strongly suggesting that NOR-2 has lost the function of rRNA synthesis and nucleolar organization. PMID:25093501

  16. Intraspecific polymorphism of ribosomal DNA loci number and morphology in Brachypodium pinnatum and Brachypodium sylvaticum.

    PubMed

    Breda, Ewa; Wolny, Elzbieta; Hasterok, Robert

    2012-12-01

    The genus Brachypodium has become the target of extensive cytomolecular studies since one of its representatives, B. distachyon, has been accepted as a model plant for temperate cereals and forage grasses. Recent preliminary studies suggested that intraspecific rDNA polymorphism can occur in at least two members of the genus, B. sylvaticum and B. pinnatum, so the aim of this study was to further analyse this phenomenon. FISH with 25S rDNA and 5S rDNA probes was performed on somatic metaphase chromosomes, supplemented by the silver staining technique which distinguishes transcriptionally active from inactive 18S-5.8S-25S rDNA loci. The number, size and chromosomal distribution of 5S rDNA loci were very constant: two loci were invariably observed in all studied diploid accessions of both species, while four 5S rDNA loci were present in the tetraploid B. pinnatum. In contrast to 5S rDNA loci, those of the 35S rDNA were more variable. Two or three loci were observed in the diploid B. pinnatum and four in tetraploid accessions. In chromosome complements of B. sylvaticum accessions from two to six 35S rDNA sites were detected. Regardless of total rDNA locus number, only two were transcriptionally active in diploid accessions of both species, while two or four were active in the tetraploid B. pinnatum. Additionally, the fluorescent CMA/DAPI banding method was used to identify the relation between rDNA sites and CMA+ bands. It was revealed that the number and chromosomal distribution of CMA+ bands are in congruence only with 35S rDNA loci which gave strong FISH signals. PMID:22893263

  17. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    PubMed Central

    2012-01-01

    Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement) or, less commonly, linked to 35 S rDNA units (L-type). The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6) but not all species. Two species contained major L-type and minor S-type units (termed Ls-type). The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’) is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs. PMID:22716941

  18. Plant rDNA database: update and new features

    PubMed Central

    Garcia, Sònia; Gálvez, Francisco; Gras, Airy; Kovařík, Aleš; Garnatje, Teresa

    2014-01-01

    The Plant rDNA database (www.plantrdnadatabase.com) is an open access online resource providing detailed information on numbers, structures and positions of 5S and 18S-5.8S-26S (35S) ribosomal DNA loci. The data have been obtained from >600 publications on plant molecular cytogenetics, mostly based on fluorescent in situ hybridization (FISH). This edition of the database contains information on 1609 species derived from 2839 records, which means an expansion of 55.76 and 94.45%, respectively. It holds the data for angiosperms, gymnosperms, bryophytes and pteridophytes available as of June 2013. Information from publications reporting data for a single rDNA (either 5S or 35S alone) and annotation regarding transcriptional activity of 35S loci now appears in the database. Preliminary analyses suggest greater variability in the number of rDNA loci in gymnosperms than in angiosperms. New applications provide ideograms of the species showing the positions of rDNA loci as well as a visual representation of their genome sizes. We have also introduced other features to boost the usability of the Web interface, such as an application for convenient data export and a new section with rDNA–FISH-related information (mostly detailing protocols and reagents). In addition, we upgraded and/or proofread tabs and links and modified the website for a more dynamic appearance. This manuscript provides a synopsis of these changes and developments. Database URL: http://www.plantrdnadatabase.com PMID:24980131

  19. Cytogenetic comparison between two allopatric populations of Astyanax altiparanae Garutti et Britski, 2000 (Teleostei, Characidae), with emphasis on the localization of 18S and 5S rDNA

    PubMed Central

    Pacheco, Rosiley Berton; da Rosa, Renata; Giuliano-Caetano, Lucia; Júlio Jr., Horácio Ferreira; Dias, Ana Lúcia

    2011-01-01

    Abstract Two populations of Astyanax altiparanae (Garutti & Britski, 2000) of the Água dos Patos stream/SP and lake Igapó/PR were analyzed. All individuals showed 2n = 50, however, different karyotypic formulae were observed. The population of the Água dos Patos stream showed 8m +24sm+6st+12a (NF=88) and the population of lake Igapó, 8m+28sm+4st+10a (NF=90). Nucleolus organizing regions (AgNORs) were observed in the terminal position on the short and long arm of different chromosomes of both populations, showing a variation from 3 to 4 chromosomes. Fluorescent in situ hybridization (FISH) using 18S rDNA probes revealed only one pair of chromosomes with fluorescent signals in the terminal site on the short arm in the Igapó lake population, while the population of Água dos Patos stream showed 4 fluorescence terminal signals, characterizing a system of simple and multiple NORs, respectively. 5S rDNA fluorescent signals were detected in the interstitial position of a pair of chromosomes in the two studied populations. Some AgNOR sites revealed to be GC-rich when stained with Chromomycin A3 (CMA3), however, AT positive regions were not observed. The data obtained show that, despite the conservation of the diploid number and location of 5S DNAr, differences in both the distribution of 18S rDNA and karyotypic formula among the populations were found, thus corroborating the existing data on chromosome variability in Astyanax altiparanae that can be significant for cytotaxonomy in this group. PMID:24260632

  20. Cytogenetic comparison between two allopatric populations of Astyanax altiparanae Garutti et Britski, 2000 (Teleostei, Characidae), with emphasis on the localization of 18S and 5S rDNA.

    PubMed

    Pacheco, Rosiley Berton; da Rosa, Renata; Giuliano-Caetano, Lucia; Júlio, Horácio Ferreira; Dias, Ana Lúcia

    2011-01-01

    Two populations of Astyanax altiparanae (Garutti & Britski, 2000) of the Água dos Patos stream/SP and lake Igapó/PR were analyzed. All individuals showed 2n = 50, however, different karyotypic formulae were observed. The population of the Água dos Patos stream showed 8m +24sm+6st+12a (NF=88) and the population of lake Igapó, 8m+28sm+4st+10a (NF=90). Nucleolus organizing regions (AgNORs) were observed in the terminal position on the short and long arm of different chromosomes of both populations, showing a variation from 3 to 4 chromosomes. Fluorescent in situ hybridization (FISH) using 18S rDNA probes revealed only one pair of chromosomes with fluorescent signals in the terminal site on the short arm in the Igapó lake population, while the population of Água dos Patos stream showed 4 fluorescence terminal signals, characterizing a system of simple and multiple NORs, respectively. 5S rDNA fluorescent signals were detected in the interstitial position of a pair of chromosomes in the two studied populations. Some AgNOR sites revealed to be GC-rich when stained with Chromomycin A3 (CMA3), however, AT positive regions were not observed. The data obtained show that, despite the conservation of the diploid number and location of 5S DNAr, differences in both the distribution of 18S rDNA and karyotypic formula among the populations were found, thus corroborating the existing data on chromosome variability in Astyanax altiparanae that can be significant for cytotaxonomy in this group. PMID:24260632

  1. Robertsonian polymorphism in the marine gastropod, Nucella lapillus: advances in karyology using rDNA loci and NORs.

    PubMed

    Pascoe, P L; Patton, S J; Critcher, R; Dixon, D R

    1996-03-01

    Previous studies of the Robertsonian polymorphism in the Atlantic dog-whelk, Nucella lapillus (2n = 26-36), have been limited by the inability to identify unequivocally individual chromosomes in the karyotype. This species, as with many other marine invertebrates, has proven largely refractory to the standard (mammalian) chromosome-banding techniques. In this study, fluorescence in situ hybridization (FISH) using a rDNA probe was applied to the metaphase chromosomes of the 2n = 26 and 2n = 36 forms of N. lapillus. The results were compared with silver-staining of the nucleolar organizer regions (NORs). The FISH technique was shown to be more sensitive and less intrinsically prone to variation than the silver-staining method. An additional NOR/rDNA locus was observed in the 2n = 36 form which, to date, has not been seen in any 2n = 26 population. The 2n = 36 karyotype is described for a south-west UK population that differs from that reported previously in the literature. After fission, Robertsonian metacentrics are shown to correspond to at least one subtelocentric product. PMID:8601340

  2. The specific isolation of complete 5S rDNA units from chromosome 1A of hexaploid, tetraploid, and diploid wheat species using PCR with head-to-head oriented primers.

    PubMed

    Van Campenhout, S; Stappen, J V; Volckaert, G

    2001-08-01

    The presence of 5S rDNA units on chromosome 1A of Triticum aestivum was shown by the development of a specific PCR test, using head-to-head oriented primers. This primer set allowed the amplification of complete 5S DNA units and was used to isolate SS-Rrna-A1 sequences from polyploid and diploid wheat species. Multiple-alignment and parsimony analyses of the 132 sequences divided the sequences into four types. The isolates from T. aestivum and the tetraploid species (T. dicoccoides, T. dicoccum, T durum, T. araraticum, and T timopheevi) were all of one type, which was shown to be closely related to the type mainly characteristic for T. urartu. The other two types were isolated exclusively from the diploid species T. monococcum, T aegilopoides, T. thaoudar, and T. sinskajae and the hexaploid species T. zhukovski. Triticum monococcum was the only species for which representatives of each of the four sequence types were found to be present. Further, we discuss the possible multicluster arrangement of the 5S-Rrna-A1 array. PMID:11550886

  3. Diversity within the genus Elymus (Poaceae: Triticeae) as investigated by the analysis of the nr5S rDNA variation in species with St and H haplomes.

    PubMed

    Baum, B R; Edwards, T; Johnson, D A

    2015-02-01

    The genus Elymus ("Ryegrass") is a repository for a range of species with a variety of haplome contents; hence the pejorative name "dustbin" genus. We have analyzed 1,059 sequences from 128 accessions representing 24 species to investigate the relationships among the StH haplomes-containing species described by Yen and Yang (Genus Elymus Beijing 5:58-362, 2013). Sequences were assigned to "unit classes" of orthologous sequences and subjected to a suite of analyses including BLAST (Basic Local Alignment Search Tool) searches, phylogenetic analysis and population genetic analysis to estimate species diversity. Our results support the genome analyses in Yen and Yang (Genus Elymus Beijing 5:58-362, 2013), i.e., genomic constitution StStHH including variants restricted to Elymus. Population genetic analysis of the 5S nrDNA sequence data revealed that the within-species variance component is roughly ±89 %; thus, we were unable to identify molecular markers capable to separate the 24 species analyzed. Separate phylogenetic analyses of the two unit classes and of all the data exhibit a trend only of the species to cluster on the phylograms. Finally, the analysis provides evidence for the multiple origins of American and Eurasian species. PMID:25248636

  4. Comet-FISH with rDNA probes for the analysis of mutagen-induced DNA damage in plant cells.

    PubMed

    Kwasniewska, Jolanta; Grabowska, Marta; Kwasniewski, Miroslaw; Kolano, Bozena

    2012-06-01

    We used comet-fluorescence in situ hybridization (FISH) in the model plant species Crepis capillaris following exposure of seedlings to maleic hydrazide (MH). FISH with 5S and 25S rDNA probes was applied to comets obtained under alkaline conditions to establish whether these DNA regions were preferentially involved in comet tail formation. MH treatment induced significant fragmentation of nuclear DNA and of rDNA loci. A 24-h post-treatment recovery period allowed a partial reversibility of MH-induced damage on nuclear and rDNA regions. Analyses of FISH signals demonstrated that rDNA sequences were always involved in tail formation and that 5S rDNA was more frequently present in the tail than 25S rDNA, regardless of treatment. The involvement of 25S rDNA in nucleolus formation and differences in chromatin structure between the two loci may explain the different susceptibility of the 25S and 5S rDNA regions to migrate into the tail. This work is the first report on the application of FISH to comet preparations from plants to analyze the distribution and repair of DNA damage within specific genomic regions after mutagenic treatment. Moreover, our work suggests that comet-FISH in plants may be a useful tool for environmental monitoring assessment. PMID:22556029

  5. Molecular cytogenetic analysis of the Appenine endemic cyprinid fish Squalius lucumonis and three other Italian leuciscines using chromosome banding and FISH with rDNA probes.

    PubMed

    Rossi, Anna Rita; Milana, Valentina; Hett, Anne Kathrin; Tancioni, Lorenzo

    2012-12-01

    Karyotype and other chromosomal characteristics of the Appenine endemic cyprinid fish, Toscana stream chub Squalius lucumonis, were analysed using conventional banding and FISH with 45S and 5S rDNA probes. The diploid chromosome number (2n = 50) and karyotype characteristics including pericentromeric heterochromatic blocks and GC-rich CMA(3)-positive sites corresponding to both positive Ag-NORs and 45S rDNA loci on the short arms of a single medium-sized submetacentric chromosome pair were consistent with those found in most European leuciscine cyprinids. On other hand, 5S rDNA FISH in the Toscana stream chub and three other Italian leuciscines, S. squalus, Rutilus rubilio and Telestes muticellus, revealed a species-specific hybridization pattern, i.e. signals on four (S. lucumonis), three (S. squalus and R. rubilio) and two (T. muticellus) chromosome pairs. Whereas all the species shared the 5S rDNA loci on the largest subtelocentric chromosome pair, a "leuciscine" cytotaxonomic marker, S. lucumonis showed both classes of rDNA loci tandem aligned on the short arms of chromosome pair No. 12. The present findings suggest that the observed high variability of 5S rDNA loci provides a powerful tool for investigation of karyotype differentiation in karyologically conservative leuciscine fishes. PMID:23238894

  6. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.

    PubMed

    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto

    2006-05-01

    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes. PMID:16612546

  7. Species relations among wild Arachis species with the A genome as revealed by FISH mapping of rDNA loci and heterochromatin detection.

    PubMed

    Robledo, G; Lavia, G I; Seijo, G

    2009-05-01

    Section Arachis of the homonymous genus includes 29 wild diploid species and two allotetraploids (A. monticola and the domesticated peanut, A. hypogaea L.). Although, three different genomes (A, B and D) have been proposed for diploid species with x = 10, they are still not well characterized. Moreover, neither the relationships among species within each genome group nor between diploids and tetraploids (AABB) are completely resolved. To tackle these issues, particularly within the A genome, in this study the rRNA genes (5S and 18S-26S) and heterochromatic bands were physically mapped using fluorescent in situ hybridization (FISH) in 13 species of Arachis. These molecular cytogenetic landmarks have allowed individual identification of a set of chromosomes and were used to construct detailed FISH-based karyotypes for each species. The bulk of the chromosome markers mapped revealed that, although the A genome species have a common karyotype structure, the species can be arranged in three groups (La Plata River Basin, Chiquitano, and Pantanal) on the basis of the variability observed in the heterochromatin and 18S-26S rRNA loci. Notably, these groups are consistent with the geographical co-distribution of the species. This coincidence is discussed on the basis of the particular reproductive traits of the species such as autogamy and geocarpy. Combined with geographic distribution of the taxa, the cytogenetic data provide evidence that A. duranensis is the most probable A genome ancestor of tetraploid species. It is expected that the groups of diploid species established, and their relation with the cultigen, may aid to rationally select wild species with agronomic traits desirable for peanut breeding programs. PMID:19234686

  8. Mitotic lifecycle of chromosomal 3xHMG-box proteins and the role of their N-terminal domain in the association with rDNA loci and proteolysis.

    PubMed

    Antosch, Martin; Schubert, Veit; Holzinger, Philipp; Houben, Andreas; Grasser, Klaus D

    2015-12-01

    The high mobility group (HMG)-box is a DNA-binding domain characteristic of various eukaryotic DNA-binding proteins. 3xHMG-box proteins (containing three copies of the HMG-box domain and a unique basic N-terminal domain) are specific for plants and the Arabidopsis genome encodes two versions termed 3xHMG-box1 and 3xHMG-box2, whose expression is cell cycle-dependent, peaking during mitosis. Here, we analysed in detail the spatiotemporal expression, subcellular localisation and chromosome association of the Arabidopsis thaliana 3xHMG-box proteins. Live cell imaging and structured illumination microscopy revealed that the expression of the 3xHMG-box proteins is induced in late G2 phase of the cell cycle and upon nuclear envelope breakdown in prophase they rapidly associate with the chromosomes. 3xHMG-box1 associates preferentially with 45S rDNA loci and the basic N-terminal domain is involved in the targeting of rDNA loci. Shortly after mitosis the 3xHMG-box proteins are degraded and an N-terminal destruction-box mediates the proteolysis. Ectopic expression/localisation of 3xHMG-box1 in interphase nuclei results in reduced plant growth and various developmental defects including early bolting and abnormal flower morphology. The remarkable conservation of 3xHMG-box proteins within the plant kingdom, their characteristic expression during mitosis, and their striking association with chromosomes, suggest that they play a role in the organisation of plant mitotic chromosomes. PMID:26213803

  9. Physical mapping of 5S and 18S-5.8S-26S RNA gene families in polyploid series of Cenchrus ciliaris Linnaeus, 1771 (Poaceae)

    PubMed Central

    Kharrat-Souissi, Amina; Siljak-Yakovlev, Sonja; Pustahija, Fatima; Chaieb, Mohamed

    2012-01-01

    Abstract The Buffelgrass (Cenchrus ciliaris L., Poaceae) is one of the most important pasturage grasses due to its high productivity and good forage qualities. This species possess a high adaptability to bioclimatic constraints of arid zones and may be used for the restoration of degraded arid ecosystems. Tunisian populations present three ploidy levels (4x, 5x and 6x) with a basic chromosome number x=9. This study reported for the first time the distribution of the ribosomal genes (rRNA) for pentaploid and hexaploid cytotypes of Cenchrus ciliaris. Molecular cytogenetic study using double fluorescence in situ hybridization has shown that the two rDNA families, 5S and 18S-5.8S-26S (18S), displayed intraspecific variation in number of loci among different ploidy levels. Each ploidy level was characterized by specific number of both 5S and 18S rDNA loci (two loci in tetraploid, five in pentaploid and six in hexaploid level). For three studied cytotypes (4x, 5x and 6x) all 5S rDNA loci were localized on the subcentromeric region of chromosomes, while 18S loci were situated on the telomeric region of short chromosome arms. Data of the FISH experiments show proportional increase of ribosomal loci number during polyploidization processes. PMID:24260668

  10. Population studies for STR loci (D3S1358, D5S818, D7S820, D18S51 and FGA) in NWFP and Sindhi populations of Pakistan for forensic use.

    PubMed

    Saqib Shahzad, M; Abbas Bokhari, S Yassir; Rao, Abdul Qayyum; Raza, M Hashim; Ullah, Obaid; Zia-Ur-rahman; Shahid, A Ali; Ahmad, Zahoor; Riazuddin, S

    2004-01-01

    CEMB's Forensic DNA typing project is directed towards the introduction of DNA typing technique in Pakistan's criminal justice system so as to exonerate an innocent and wrongly accused person and incriminates the culprit. The present study is a part of the project of CEMB to analyze Sindhi and NWFP (North West Frontier Province) populations for five STR (Short Tandem Repeat) loci out of 13 CODIS (Combined DNA Index System) loci. Allelic frequencies and heterozygosity for STR markers D3S1358, D5S818, D7S820, D18S51 and FGA (FIBRA) were determined. Samples from unrelated individuals were amplified by multiplex PCR using the unlabelled primers for these markers followed by denaturing Polyacrylamide Gel Electrophoresis (PAGE). Statistical analysis was performed to determine the allelic frequencies and was evaluated using the Chi Square Test. PMID:15782779

  11. Evolutionary site-number changes of ribosomal DNA loci during speciation: complex scenarios of ancestral and more recent polyploid events

    PubMed Central

    Rosato, Marcela; Moreno-Saiz, Juan C.; Galián, José A.; Rosselló, Josep A.

    2015-01-01

    Several genome duplications have been identified in the evolution of seed plants, providing unique systems for studying karyological processes promoting diversification and speciation. Knowledge about the number of ribosomal DNA (rDNA) loci, together with their chromosomal distribution and structure, provides clues about organismal and molecular evolution at various phylogenetic levels. In this work, we aim to elucidate the evolutionary dynamics of karyological and rDNA site-number variation in all known taxa of subtribe Vellinae, showing a complex scenario of ancestral and more recent polyploid events. Specifically, we aim to infer the ancestral chromosome numbers and patterns of chromosome number variation, assess patterns of variation of both 45S and 5S rDNA families, trends in site-number change of rDNA loci within homoploid and polyploid series, and reconstruct the evolutionary history of rDNA site number using a phylogenetic hypothesis as a framework. The best-fitting model of chromosome number evolution with a high likelihood score suggests that the Vellinae core showing x = 17 chromosomes arose by duplication events from a recent x = 8 ancestor. Our survey suggests more complex patterns of polyploid evolution than previously noted for Vellinae. High polyploidization events (6x, 8x) arose independently in the basal clade Vella castrilensis–V. lucentina, where extant diploid species are unknown. Reconstruction of ancestral rDNA states in Vellinae supports the inference that the ancestral number of loci in the subtribe was two for each multigene family, suggesting that an overall tendency towards a net loss of 5S rDNA loci occurred during the splitting of Vellinae ancestors from the remaining Brassiceae lineages. A contrasting pattern for rDNA site change in both paleopolyploid and neopolyploid species was linked to diversification of Vellinae lineages. This suggests dynamic and independent changes in rDNA site number during speciation processes and a

  12. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae)

    PubMed Central

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Abstract Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 ‘Azul’, Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700

  13. Molecular cytogenetic analysis of the crucian carp, Carassius carassius (Linnaeus, 1758) (Teleostei, Cyprinidae), using chromosome staining and fluorescence in situ hybridisation with rDNA probes

    PubMed Central

    Spoz, Aneta; Boron, Alicja; Porycka, Katarzyna; Karolewska, Monika; Ito, Daisuke; Abe, Syuiti; Kirtiklis, Lech; Juchno, Dorota

    2014-01-01

    Abstract The crucian carp Carassius carassius (Linnaeus, 1758) is a species with restricted and decreasing distribution in Europe. Six males and six females of the species from the Baltic Sea basin in Poland were examined to show sequentially CMA3/AgNO3 staining pattern, DAPI staining, and, for the first time in literature, molecular cytogenetic analysis using double-colour fluorescence in situ hybridisation (FISH) with 28S and 5S rDNA probes. The karyotype consisted of 20 m, 36 sm and 44 sta chromosomes, NF=156. The AgNO3 stained NORs were most frequently located terminally in the short arms of two sm and two sta elements, and CMA3-positive sites were also observed suggesting abundant GC-rich repetitive DNA in the regions. Other CMA3-positive sites in the short arms of six to ten sm and sta chromosomes were detected. The results based on 28S rDNA FISH confirmed the location of rDNA sites. DAPI-negative staining of NORs suggested the scarcity of AT-rich DNA in the regions. FISH with 5S rDNA probe revealed 8–14 loci (ten and 12 in respectively 49 and 29% of metaphases). They were located in two sm and eight to ten sta chromosomes and six of them were larger than others. Simultaneously, mapping of the two rDNA families on the chromosomes of C. carassius revealed that both 28S and 5S rDNA probes were located in different chromosomes. Molecular cytogenetic data of C. carassius presented here for the first time give an important insight into the structure of chromosomes of this polyploid and declining species and may be useful in its systematics. PMID:25349674

  14. Regulation of Arabidopsis thaliana 5S rRNA Genes.

    PubMed

    Vaillant, Isabelle; Tutois, Sylvie; Cuvillier, Claudine; Schubert, Ingo; Tourmente, Sylvette

    2007-05-01

    The Arabidopsis thaliana genome comprises around 1,000 copies of 5S rRNA genes encoding both major and minor 5S rRNAs. In mature wild-type leaves, the minor 5S rRNA genes are silent. Using different mutants of DNA methyltransferases (met1, cmt3 and met1 cmt3), components of the RNAi pathway (ago4) or post-translational histone modifier (hda6/sil1), we show that the corresponding proteins are needed to maintain proper methylation patterns at heterochromatic 5S rDNA repeats. Using reverse transcription-PCR and cytological analyses, we report that a decrease of 5S rDNA methylation at CG or CNG sites in these mutants leads to the release of 5S rRNA gene silencing which occurred without detectable changes of the 5S rDNA chromatin structure. In spite of severely reduced DNA methylation, the met1 cmt3 double mutant revealed no increase in minor 5S rRNA transcripts. Furthermore, the release of silencing of minor 5S rDNAs can be achieved without increased formation of euchromatic loops by 5S rDNA, and is independent from the global heterochromatin content. Additionally, fluorescence in situ hybridization with centromeric 180 bp repeats confirmed that these highly repetitive sequences, in spite of their elevated transcriptional activity in the DNA methyltransferase mutants (met1, cmt3 and met1 cmt3), remain within chromocenters of the mutant nuclei. PMID:17412735

  15. Conserved Organisation of 45S rDNA Sites and rDNA Gene Copy Number among Major Clades of Early Land Plants.

    PubMed

    Rosato, Marcela; Kovařík, Aleš; Garilleti, Ricardo; Rosselló, Josep A

    2016-01-01

    Genes encoding ribosomal RNA (rDNA) are universal key constituents of eukaryotic genomes, and the nuclear genome harbours hundreds to several thousand copies of each species. Knowledge about the number of rDNA loci and gene copy number provides information for comparative studies of organismal and molecular evolution at various phylogenetic levels. With the exception of seed plants, the range of 45S rDNA locus (encoding 18S, 5.8S and 26S rRNA) and gene copy number variation within key evolutionary plant groups is largely unknown. This is especially true for the three earliest land plant lineages Marchantiophyta (liverworts), Bryophyta (mosses), and Anthocerotophyta (hornworts). In this work, we report the extent of rDNA variation in early land plants, assessing the number of 45S rDNA loci and gene copy number in 106 species and 25 species, respectively, of mosses, liverworts and hornworts. Unexpectedly, the results show a narrow range of ribosomal locus variation (one or two 45S rDNA loci) and gene copies not present in vascular plant lineages, where a wide spectrum is recorded. Mutation analysis of whole genomic reads showed higher (3-fold) intragenomic heterogeneity of Marchantia polymorpha (Marchantiophyta) rDNA compared to Physcomitrella patens (Bryophyta) and two angiosperms (Arabidopsis thaliana and Nicotiana tomentosifomis) suggesting the presence of rDNA pseudogenes in its genome. No association between phylogenetic position, taxonomic adscription and the number of rDNA loci and gene copy number was found. Our results suggest a likely evolutionary rDNA stasis during land colonisation and diversification across 480 myr of bryophyte evolution. We hypothesise that strong selection forces may be acting against ribosomal gene locus amplification. Despite showing a predominant haploid phase and infrequent meiosis, overall rDNA homogeneity is not severely compromised in bryophytes. PMID:27622766

  16. Chromosomal organization of the 18S and 5S rRNAs and histone H3 genes in Scarabaeinae coleopterans: insights into the evolutionary dynamics of multigene families and heterochromatin

    PubMed Central

    2011-01-01

    Background Scarabaeinae beetles show a high level of macro-chromosomal variability, although the karyotypic organization of heterochromatin and multigene families (rDNAs and histone genes) is poorly understood in this group. To better understand the chromosomal organization and evolution in this group, we analyzed the karyotypes, heterochromatin distribution and chromosomal locations of the rRNAs and histone H3 genes in beetles belonging to eight tribes from the Scarabaeinae subfamily (Coleoptera, Scarabaeidae). Results The number of 18S rRNA gene (a member of the 45S rDNA unit) sites varied from one to 16 and were located on the autosomes, sex chromosomes or both, although two clusters were most common. Comparison of the 45S rDNA cluster number and the diploid numbers revealed a low correlation value. However, a comparison between the number of 45S rDNA sites per genome and the quantity of heterochromatin revealed (i) species presenting heterochromatin restricted to the centromeric/pericentromeric region that contained few rDNA sites and (ii) species with a high quantity of heterochromatin and a higher number of rDNA sites. In contrast to the high variability for heterochromatin and 45S rDNA cluster, the presence of two clusters (one bivalent cluster) co-located on autosomal chromosomes with the 5S rRNA and histone H3 genes was highly conserved. Conclusions Our results indicate that the variability of the 45S rDNA chromosomal clusters is not associated with macro-chromosomal rearrangements but are instead related to the spread of heterochromatin. The data obtained also indicate that both heterochromatin and the 45S rDNA loci could be constrained by similar evolutionary forces regulating spreading in the distinct Scarabaeinae subfamily lineages. For the 5S rRNA and the histone H3 genes, a similar chromosomal organization could be attributed to their association/co-localization in the Scarabaeinae karyotypes. These data provide evidence that different evolutionary

  17. [Organization of 5S ribosomal DNA of Melitaea trivia].

    PubMed

    Cherevatov, O V; Volkov, R A

    2011-01-01

    Two length variants of 5S rDNA repeated units were detected in the genome of East European butterfly Melitaea trivia. Both repeat variants contain the 5S rRNA coding region of the same length of 120 bp, but possess the intergenic spacer region (IGS) of different size, 78 and 125 bp, respectively. The level of sequence similarity between the two 5S rDNA variants amounts to 43.9-45.5% in the IGS, whereas the coding region appears to be more conservative. In the IGS, microsatellite sequence motives were found; amplification of these motives could be involved in the evolution of the 5S rDNA. PMID:21574431

  18. Sequence and organization of 5S ribosomal RNA-encoding genes of Arabidopsis thaliana.

    PubMed

    Campell, B R; Song, Y; Posch, T E; Cullis, C A; Town, C D

    1992-03-15

    We have isolated a genomic clone containing Arabidopsis thaliana 5S ribosomal RNA (rRNA)-encoding genes (rDNA) by screening an A. thaliana library with a 5S rDNA probe from flax. The clone isolated contains seven repeat units of 497 bp, plus 11 kb of flanking genomic sequence at one border. Sequencing of individual subcloned repeat units shows that the sequence of the 5S rRNA coding region is very similar to that reported for other flowering plants. Four A. thaliana ecotypes were found to contain approx. 1000 copies of 5S rDNA per haploid genome. Southern-blot analysis of genomic DNA indicates that 5S rDNA occurs in long tandem arrays, and shows the presence of numerous restriction-site polymorphisms among the six ecotypes studied. PMID:1348233

  19. Comparative cytogenomics of poultry: mapping of single gene and repeat loci in the Japanese quail (Coturnix japonica).

    PubMed

    McPherson, Marla C; Robinson, Charmaine M; Gehlen, Lida P; Delany, Mary E

    2014-04-01

    Well-characterized molecular and cytogenetic maps are yet to be established in Japanese quail (Coturnix japonica). The aim of the current study was to cytogenetically map and determine linkage of specific genes and gene complexes in Japanese quail through the use of chicken (Gallus gallus) and turkey (Meleagris gallopavo) genomic DNA probes and conduct a comparative study among the three genomes. Chicken and turkey clones were used as probes on mitotic metaphase and meiotic pachytene stage chromosomes of the three species for the purpose of high-resolution fluorescence in situ hybridization (FISH). The genes and complexes studied included telomerase RNA (TR), telomerase reverse transcriptase (TERT), 5S rDNA, 18S-5.8S-28S rDNA (i.e., nucleolus organizer region (NOR)), and the major histocompatibility complex (MHC). The telomeric profile of Japanese quail was investigated through the use of FISH with a TTAGGG-PNA probe. A range of telomeric array sizes were confirmed as found for the other poultry species. Three NOR loci were identified in Japanese quail, and single loci each for TR, TERT, 5S rDNA and the MHC-B. The MHC-B and one NOR locus were linked on a microchromosome in Japanese quail. We confirmed physical linkage of 5S rDNA and the TR gene on an intermediate-sized chromosome in quail, similar to both chicken and turkey. TERT localized to CJA 2 in quail and the orthologous chromosome region in chicken (GGA 2) and in turkey (MGA 3). The cytogenetic profile of Japanese quail was further developed by this study and synteny was identified among the three poultry species. PMID:24604153

  20. Next generation sequencing analysis reveals a relationship between rDNA unit diversity and locus number in Nicotiana diploids

    PubMed Central

    2012-01-01

    Background Tandemly arranged nuclear ribosomal DNA (rDNA), encoding 18S, 5.8S and 26S ribosomal RNA (rRNA), exhibit concerted evolution, a pattern thought to result from the homogenisation of rDNA arrays. However rDNA homogeneity at the single nucleotide polymorphism (SNP) level has not been detailed in organisms with more than a few hundred copies of the rDNA unit. Here we study rDNA complexity in species with arrays consisting of thousands of units. Methods We examined homogeneity of genic (18S) and non-coding internally transcribed spacer (ITS1) regions of rDNA using Roche 454 and/or Illumina platforms in four angiosperm species, Nicotiana sylvestris, N. tomentosiformis, N. otophora and N. kawakamii. We compared the data with Southern blot hybridisation revealing the structure of intergenic spacer (IGS) sequences and with the number and distribution of rDNA loci. Results and Conclusions In all four species the intragenomic homogeneity of the 18S gene was high; a single ribotype makes up over 90% of the genes. However greater variation was observed in the ITS1 region, particularly in species with two or more rDNA loci, where >55% of rDNA units were a single ribotype, with the second most abundant variant accounted for >18% of units. IGS heterogeneity was high in all species. The increased number of ribotypes in ITS1 compared with 18S sequences may reflect rounds of incomplete homogenisation with strong selection for functional genic regions and relaxed selection on ITS1 variants. The relationship between the number of ITS1 ribotypes and the number of rDNA loci leads us to propose that rDNA evolution and complexity is influenced by locus number and/or amplification of orphaned rDNA units at new chromosomal locations. PMID:23259460

  1. Genomic organization and evolution of the 5S ribosomal DNA in Tilapiini fishes.

    PubMed

    Alves-Costa, F A; Wasko, A P; Oliveira, C; Foresti, F; Martins, C

    2006-05-01

    5S rDNA sequences present an intense dynamism and have proved to be valuable as genetic markers to distinguish closed related species and also in the understanding of the evolutionary dynamic of repetitive sequences in the genomes. In order to identify patterns of 5S rDNA organization and their evolution in the genome of fish species, such genomic segment was investigated in the tilapias Oreochromis niloticus and Tilapia rendalli, and in the hybrid O. urolepis hornorum x O. mossambicus. A dual 5S rDNA system was identified in the three analyzed tilapia samples. Although each 5S rDNA class was conserved among the three samples, a distinct 5S rDNA genome organization pattern could be evidenced for each sample. The presence of a dual 5S rDNA system seems to be a general trait among non-related teleost fish orders, suggesting that evolutionary events of duplication have occurred before the divergence of the main groups of teleost fishes. PMID:16850228

  2. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    PubMed

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA. PMID:26853884

  3. The Pattern of R2 Retrotransposon Activity in Natural Populations of Drosophila simulans Reflects the Dynamic Nature of the rDNA Locus

    PubMed Central

    Zhou, Jun; Eickbush, Thomas H.

    2009-01-01

    The pattern and frequency of insertions that enable transposable elements to remain active in a population are poorly understood. The retrotransposable element R2 exclusively inserts into the 28S rRNA genes where it establishes long-term, stable relationships with its animal hosts. Previous studies with laboratory stocks of Drosophila simulans have suggested that control over R2 retrotransposition resides within the rDNA loci. In this report, we sampled 180 rDNA loci of animals collected from two natural populations of D. simulans. The two populations were found to have similar patterns of R2 activity. About half of the rDNA loci supported no or very low levels of R2 transcripts with no evidence of R2 retrotransposition. The remaining half of the rDNA loci had levels of R2 transcripts that varied in a continuous manner over almost a 100-fold range and did support new retrotransposition events. Structural analysis of the rDNA loci in 18 lines that spanned the range of R2 transcript levels in these populations revealed that R2 number and rDNA locus size varied 2-fold; however, R2 activity was not readily correlated with either of these parameters. Instead R2 activity was best correlated with the distribution of elements within the rDNA locus. Loci with no activity had larger contiguous blocks of rDNA units free of R2-insertions. These data suggest a model in which frequent recombination within the rDNA locus continually redistributes R2-inserted units resulting in changing levels of R2 activity within individual loci and persistent R2 activity within the population. PMID:19229317

  4. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    PubMed

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location. PMID:27334092

  5. Chromosomal localization and molecular characterization of three different 5S ribosomal DNA clusters in the sea urchin Paracentrotus lividus.

    PubMed

    Caradonna, Fabio; Bellavia, Daniele; Clemente, Ann Maria; Sisino, Giorgia; Barbieri, Rainer

    2007-09-01

    In this paper the chromosomal localization and molecular cloning and characterization of three 5S rDNA clusters of 700 bp (base pairs), 900 bp, and 950 bp in the sea urchin Paracentrotus lividus are reported. Southern blot hybridization demonstrated the existence of three 5S rDNA repeats of differing length in the P. lividus genome. Fluorescence in situ hybridization analysis, performed in parallel on both haploid and diploid metaphases and interphase nuclei using different 5S rDNA units as probes, localized these 5S rDNA clusters in 3 different pairs of P. lividus chromosomes. This is the first complete gene mapping not only in a sea urchin but also in the phylum of echinoderms as a whole. PMID:17893727

  6. Distribution of a limited Sir2 protein pool regulates the strength of yeast rDNA silencing and is modulated by Sir4p.

    PubMed Central

    Smith, J S; Brachmann, C B; Pillus, L; Boeke, J D

    1998-01-01

    Transcriptional silencing in Saccharomyces cerevisiae occurs at the silent mating-type loci HML and HMR, at telomeres, and at the ribosomal DNA (rDNA) locus RDN1. Silencing in the rDNA occurs by a novel mechanism that depends on a single Silent Information Regulator (SIR) gene, SIR2. SIR4, essential for other silenced loci, paradoxically inhibits rDNA silencing. In this study, we elucidate a regulatory mechanism for rDNA silencing based on the finding that rDNA silencing strength directly correlates with cellular Sir2 protein levels. The endogenous level of Sir2p was shown to be limiting for rDNA silencing. Furthermore, small changes in Sir2p levels altered rDNA silencing strength. In rDNA silencing phenotypes, sir2 mutations were shown to be epistatic to sir4 mutations, indicating that SIR4 inhibition of rDNA silencing is mediated through SIR2. Furthermore, rDNA silencing is insensitive to SIR3 overexpression, but is severely reduced by overexpression of full-length Sir4p or a fragment of Sir4p that interacts with Sir2p. This negative effect of SIR4 overexpression was overridden by co-overexpression of SIR2, suggesting that SIR4 directly inhibits the rDNA silencing function of SIR2. Finally, genetic manipulations of SIR4 previously shown to promote extended life span also resulted in enhanced rDNA silencing. We propose a simple model in which telomeres act as regulators of rDNA silencing by competing for limiting amounts of Sir2 protein. PMID:9649515

  7. A Natural Polymorphism in rDNA Replication Origins Links Origin Activation with Calorie Restriction and Lifespan

    PubMed Central

    Kwan, Elizabeth X.; Foss, Eric J.; Tsuchiyama, Scott; Alvino, Gina M.; Kruglyak, Leonid; Kaeberlein, Matt; Raghuraman, M. K.; Brewer, Bonita J.; Kennedy, Brian K.; Bedalov, Antonio

    2013-01-01

    Aging and longevity are complex traits influenced by genetic and environmental factors. To identify quantitative trait loci (QTLs) that control replicative lifespan, we employed an outbred Saccharomyces cerevisiae model, generated by crossing a vineyard and a laboratory strain. The predominant QTL mapped to the rDNA, with the vineyard rDNA conferring a lifespan increase of 41%. The lifespan extension was independent of Sir2 and Fob1, but depended on a polymorphism in the rDNA origin of replication from the vineyard strain that reduced origin activation relative to the laboratory origin. Strains carrying vineyard rDNA origins have increased capacity for replication initiation at weak plasmid and genomic origins, suggesting that inability to complete genome replication presents a major impediment to replicative lifespan. Calorie restriction, a conserved mediator of lifespan extension that is also independent of Sir2 and Fob1, reduces rDNA origin firing in both laboratory and vineyard rDNA. Our results are consistent with the possibility that calorie restriction, similarly to the vineyard rDNA polymorphism, modulates replicative lifespan through control of rDNA origin activation, which in turn affects genome replication dynamics. PMID:23505383

  8. Chaperoning 5S RNA assembly

    PubMed Central

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-01-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998

  9. 5 S Rrna Is Involved in Fidelity of Translational Reading Frame

    PubMed Central

    Dinman, J. D.; Wickner, R. B.

    1995-01-01

    Chromosomal mutants (maintenance of frame = mof) in which the efficiency of -1 ribosomal frame-shifting is increased can be isolated using constructs in which lacZ expression is dependent upon a -1 shift of reading frame. We isolate a new mof mutation, mof9, in Saccharomyces cerevisiae and show that it is complemented by both single and multi-copy 5 S rDNA clones. Two independent insertion mutations in the rDNA locus (rDNA::LEU2 and rDNA::URA3) also display the Mof(-) phenotype and are also complemented by single and multi-copy 5 S rDNA clones. Mutant 5 S rRNAs expressed from a plasmid as 20-50% of total 5 S rRNA in a wild-type host also induced the Mof(-) phenotype. The increase in frameshifting is greatest when the lacZ reporter gene is expressed on a high copy, episomal vector. No differences were found in 5 S rRNA copy number or electrophoretic mobilities in mof9 strains. Both mof9 and rDNA::LEU2 increase the efficiency of +1 frameshifting as well but have no effect on readthrough of UAG or UAA termination codons, indicating that not all translational specificity is affected. These data suggest a role for 5 S rRNA in the maintenance of frame in translation. PMID:8536994

  10. Genetic and cytogenetic analyses of the A genome of Triticum monococcum. VIII. Localization of rDNAs and characterization of 5S rRNA genes.

    PubMed

    Kim, N S; Kuspira, J; Armstrong, K; Bhambhani, R

    1993-02-01

    In situ hybridization with [3H]dCTP labelled pScT7 (5S rDNA) and pTa80 (18S + 26S rDNA) indicated that both hybridized to the terminal regions of two pairs of chromosomes in Triticum monococcum. When the hybridization was performed with a mixture of both probes, only two pairs of chromosome arms were labelled, which suggested that the loci of both genes were located in juxtaposition to one another. Both probes labelled one pair of sites more heavily than the other. Southern analysis of 5S with BamHI-digested DNA from 12 accessions of T. monococcum (including T. urartu) produced two superimposed ladders of approximate sizes of 500 and 330 bp, which differ from T. aestivum in which 500- and 420-bp ladders were found. The 500-bp ladder is derived from chromosome 5A (5SDna-A2) and the 330-bp ladder from chromosome 1A (5SDna-A1). The recognition site for SstI was present in the long spacer region but absent in the short spacer as in T. aestivum; however, unlike T. aestivum, there were HaeIII (GGCC) and HindIII (AAGCTT) recognition sites in the short spacer region. The TaqI recognition sites (TCGA) in the long and short spacer regions are probably more highly methylated in T. monococcum than in T. aestivum. The results have implications regarding the evolutionary changes that occurred in the A genome of the hexaploid compared with the diploid. PMID:18469972

  11. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  12. BEND3 represses rDNA transcription by stabilizing a NoRC component via USP21 deubiquitinase

    PubMed Central

    Khan, Abid; Giri, Sumanprava; Wang, Yating; Chakraborty, Arindam; Ghosh, Archit K.; Anantharaman, Aparna; Aggarwal, Vasudha; Sathyan, Kizhakke M.; Ha, Taekjip; Prasanth, Kannanganattu V.; Prasanth, Supriya G.

    2015-01-01

    Ribosome biogenesis dictates the translational capacity of cells. Several mechanisms establish and maintain transcriptional output from eukaryotic ribosomal DNA (rDNA) loci. rDNA silencing is one such mechanism that ensures the inactivity and hence the maintenance of a silenced state of a subset of rRNA gene copies. Whereas oncogenic agents stimulate rRNA gene transcription, tumor suppressors decrease rRNA gene transcription. We demonstrate in mammalian cells that BANP, E5R, and Nac1 (BEN) domain 3 (BEND3), a quadruple BEN domain-containing protein, localizes in nucleoli and binds to ribosomal RNA gene promoters to help repress rRNA genes. Loss of BEND3 increases histone H3K4 trimethylation and, correspondingly, decreases rDNA promoter DNA methylation, consistent with a role for BEND3 in rDNA silencing. BEND3 associates with the nucleolar-remodeling complex (NoRC), and SUMOylated BEND3 stabilizes NoRC component TTF-1–interacting protein 5 via association with ubiquitin specific protease 21 (USP21) debiquitinase. Our results provide mechanistic insights into how the novel rDNA transcription repressor BEND3 acts together with NoRC to actively coordinate the establishment of rDNA silencing. PMID:26100909

  13. BEND3 represses rDNA transcription by stabilizing a NoRC component via USP21 deubiquitinase.

    PubMed

    Khan, Abid; Giri, Sumanprava; Wang, Yating; Chakraborty, Arindam; Ghosh, Archit K; Anantharaman, Aparna; Aggarwal, Vasudha; Sathyan, Kizhakke M; Ha, Taekjip; Prasanth, Kannanganattu V; Prasanth, Supriya G

    2015-07-01

    Ribosome biogenesis dictates the translational capacity of cells. Several mechanisms establish and maintain transcriptional output from eukaryotic ribosomal DNA (rDNA) loci. rDNA silencing is one such mechanism that ensures the inactivity and hence the maintenance of a silenced state of a subset of rRNA gene copies. Whereas oncogenic agents stimulate rRNA gene transcription, tumor suppressors decrease rRNA gene transcription. We demonstrate in mammalian cells that BANP, E5R, and Nac1 (BEN) domain 3 (BEND3), a quadruple BEN domain-containing protein, localizes in nucleoli and binds to ribosomal RNA gene promoters to help repress rRNA genes. Loss of BEND3 increases histone H3K4 trimethylation and, correspondingly, decreases rDNA promoter DNA methylation, consistent with a role for BEND3 in rDNA silencing. BEND3 associates with the nucleolar-remodeling complex (NoRC), and SUMOylated BEND3 stabilizes NoRC component TTF-1-interacting protein 5 via association with ubiquitin specific protease 21 (USP21) debiquitinase. Our results provide mechanistic insights into how the novel rDNA transcription repressor BEND3 acts together with NoRC to actively coordinate the establishment of rDNA silencing. PMID:26100909

  14. Dynamics of R1 and R2 elements in the rDNA locus of Drosophila simulans.

    PubMed Central

    Pérez-González, C E; Eickbush, T H

    2001-01-01

    The mobile elements R1 and R2 insert specifically into the rRNA gene locus (rDNA locus) of arthropods, a locus known to undergo concerted evolution, the recombinational processes that preserve the sequence homogeneity of all repeats. To monitor how rapidly individual R1 and R2 insertions are turned over in the rDNA locus by these processes, we have taken advantage of the many 5' truncation variants that are generated during the target-primed reverse transcription mechanism used by these non-LTR retrotransposons for their integration. A simple PCR assay was designed to reveal the pattern of the 5' variants present in the rDNA loci of individual X chromosomes in a population of Drosophila simulans. Each rDNA locus in this population was found to have a large, unique collection of 5' variants. Each variant was present at low copy number, usually one copy per chromosome, and was seldom distributed to other chromosomes in the population. The failure of these variants to spread to other units in the same rDNA locus suggests a strong recombinational bias against R1 and R2 that results in the individual copies of these elements being rapidly lost from the rDNA locus. This bias suggests a significantly higher frequency of R1 and R2 retrotransposition than we have previously suggested. PMID:11514447

  15. Evolutionary pattern of rDNA following polyploidy in Leymus (Triticeae: Poaceae).

    PubMed

    Fan, Xing; Liu, Jing; Sha, Li-Na; Sun, Gen-Lou; Hu, Zhi-Qin; Zeng, Jian; Kang, Hou-Yang; Zhang, Hai-Qin; Wang, Yi; Wang, Xiao-Li; Zhang, Li; Ding, Chun-Bang; Yang, Rui-Wu; Zheng, You-Liang; Zhou, Yong-Hong

    2014-08-01

    Ribosomal ITS polymorphism and its ancestral genome origin of polyploid Leymus were examined to infer the evolutionary outcome of rDNA gene following allopolyploid speciation and to elucidate the geographic pattern of ITS variation. The results demonstrated that different polyploids have experienced varying fates, including maintenance or homogenization of divergent arrays, occurrence of chimeric repeats and potential pseudogenes. Our data suggested that (1) the Ns, P/F, and St genomic types in Leymus were originated from Psathyrostachys, Agropyron/Eremopyrum, and Pseudoroegneria, respectively; (2) the occurrence of a higher proportion of Leymus species with predominant uniparental rDNA type might associate with the segmental allopolyploid origin, nucleolar dominance of alloploids, and rapid radiation of Leymus; (3) maintenance of multiple parental ITS types in allopolyploid might result from long generation times associated to vegetative multiplication, number and chromosomal location of ribosomal loci and/or recurrent hybridization; (4) the rDNA genealogical structure of Leymus species might associate with the geographic origins; and (5) ITS sequence clade shared by Leymus species from Central Asia, North America, and Nordic might be an outcome of ancestral ITS homogenization. Our results shed new light on understanding evolutionary outcomes of rDNA following allopolyploid speciation and geographic isolation. PMID:24780748

  16. Clinorotation influences rDNA and NopA100 localization in nucleoli

    NASA Astrophysics Data System (ADS)

    Sobol, M. A.; González-Camacho, F.; Rodríguez-Vilariño, V.; Kordyum, E. L.; Medina, F. J.

    The nucleolus is the transcription site of rRNA genes as well as the site of processing and initial packaging of their transcripts. The plant nucleolin homologue NopA100 is involved in the regulation of r-chromatin condensation/expansion and rDNA transcription as well as in rRNA processing. We have investigated with immunogold electron microscopy the location of nucleolar DNA and NopA100 in cress root meristematic cells grown under slow horizontal clinorotation, reproducing an important feature of microgravity, namely the absence of an orienting action of a gravity vector, compared to control conditions. We demonstrate redistribution of both rDNA and NopA100 in nucleolar subcomponents induced by clinorotation. Ribosomal DNA concentrated predominantly in fibrillar centers in the form of condensed r-chromatin inclusions and internal non condensed fibrils, redistributing from the dense fibrillar component and the transition zone between fibrillar centers and the dense fibrillar component, recognized as the loci of rDNA transcription. The content of NopA100 was much higher in the inner space of fibrillar centers and reduced in the dense fibrillar component as compared to the control. Based on these data, an effect of slow horizontal clinorotation in lowering the level of rDNA transcription as well as rRNA processing is suggested.

  17. Multiple rDNA units distributed on all chromosomes of Nosema bombycis.

    PubMed

    Liu, Handeng; Pan, Guoqing; Song, Shihong; Xu, Jinshan; Li, Tian; Deng, Yanbo; Zhou, Zeyang

    2008-10-01

    Among Microsporidia, Nosema bombycis has a novel arrangement of LSUrRNA, SSUrRNA, ITS, IGS and 5SrRNA. To determine the distribution of rDNA among the chromosomes, we performed genome-wide screening and Southern blotting with three probes (SSU, ITS and IGS). Southern blotting revealed that ribosomal RNA genes are distributed on all chromosomes of N. bombycis, which is contrary to the previous result, which concluded that the N. bombycis rRNA genes were limited to a single chromosome. This wide distribution is similar to that of the rDNA unit of Encephalitozoon cuniculi. Screening of the N. bombycis genome detected 53 LSUrRNA elements, 43 SSUrRNA elements and 36 5SrRNA elements. However, it is still difficult to determine their loci on the chromosomes as the genomic map is unfinished. PMID:18640121

  18. Asymmetric Epigenetic Modification and Elimination of rDNA Sequences by Polyploidization in Wheat[W

    PubMed Central

    Guo, Xiang

    2014-01-01

    rRNA genes consist of long tandem repeats clustered on chromosomes, and their products are important functional components of the ribosome. In common wheat (Triticum aestivum), rDNA loci from the A and D genomes were largely lost during the evolutionary process. This biased DNA elimination may be related to asymmetric transcription and epigenetic modifications caused by the polyploid formation. Here, we observed both sets of parental nucleolus organizing regions (NORs) were expressed after hybridization, but asymmetric silencing of one parental NOR was immediately induced by chromosome doubling, and reversing the ploidy status could not reactivate silenced NORs. Furthermore, increased CHG and CHH DNA methylation on promoters was accompanied by asymmetric silencing of NORs. Enrichment of H3K27me3 and H3K9me2 modifications was also observed to be a direct response to increased DNA methylation and transcriptional inactivation of NOR loci. Both A and D genome NOR loci with these modifications started to disappear in the S4 generation and were completely eliminated by the S7 generation in synthetic tetraploid wheat. Our results indicated that asymmetric epigenetic modification and elimination of rDNA sequences between different donor genomes may lead to stable allopolyploid wheat with increased differentiation and diversity. PMID:25415973

  19. Asymmetric epigenetic modification and elimination of rDNA sequences by polyploidization in wheat.

    PubMed

    Guo, Xiang; Han, Fangpu

    2014-11-01

    rRNA genes consist of long tandem repeats clustered on chromosomes, and their products are important functional components of the ribosome. In common wheat (Triticum aestivum), rDNA loci from the A and D genomes were largely lost during the evolutionary process. This biased DNA elimination may be related to asymmetric transcription and epigenetic modifications caused by the polyploid formation. Here, we observed both sets of parental nucleolus organizing regions (NORs) were expressed after hybridization, but asymmetric silencing of one parental NOR was immediately induced by chromosome doubling, and reversing the ploidy status could not reactivate silenced NORs. Furthermore, increased CHG and CHH DNA methylation on promoters was accompanied by asymmetric silencing of NORs. Enrichment of H3K27me3 and H3K9me2 modifications was also observed to be a direct response to increased DNA methylation and transcriptional inactivation of NOR loci. Both A and D genome NOR loci with these modifications started to disappear in the S4 generation and were completely eliminated by the S7 generation in synthetic tetraploid wheat. Our results indicated that asymmetric epigenetic modification and elimination of rDNA sequences between different donor genomes may lead to stable allopolyploid wheat with increased differentiation and diversity. PMID:25415973

  20. Distribution of 45S rDNA sites in chromosomes of plants: Structural and evolutionary implications

    PubMed Central

    2012-01-01

    Background 45S rDNA sites are the most widely documented chromosomal regions in eukaryotes. The analysis of the distribution of these sites along the chromosome in several genera has suggested some bias in their distribution. In order to evaluate if these loci are in fact non-randomly distributed and what is the influence of some chromosomal and karyotypic features on the distribution of these sites, a database was built with the position and number of 45S rDNA sites obtained by FISH together with other karyotypic data from 846 plant species. Results In angiosperms the most frequent numbers of sites per diploid karyotype were two and four, suggesting that in spite of the wide dispersion capacity of these sequences the number of rDNA sites tends to be restricted. The sites showed a preferential distribution on the short arms, mainly in the terminal regions. Curiously, these sites were frequently found on the short arms of acrocentric chromosomes where they usually occupy the whole arm. The trend to occupy the terminal region is especially evident in holokinetic chromosomes, where all of them were terminally located. In polyploids there is a trend towards reduction in the number of sites per monoploid complement. In gymnosperms, however, the distribution of rDNA sites varied strongly among the sampled families. Conclusions The location of 45S rDNA sites do not vary randomly, occurring preferentially on the short arm and in the terminal region of chromosomes in angiosperms. The meaning of this preferential location is not known, but some hypotheses are considered and the observed trends are discussed. PMID:23181612

  1. Evolutionary Dynamics of rDNA Clusters in Chromosomes of Five Clam Species Belonging to the Family Veneridae (Mollusca, Bivalvia)

    PubMed Central

    Pérez-García, Concepción; Hurtado, Ninoska S.; Morán, Paloma; Pasantes, Juan J.

    2014-01-01

    The chromosomal changes accompanying bivalve evolution are an area about which few reports have been published. To improve our understanding on chromosome evolution in Veneridae, ribosomal RNA gene clusters were mapped by fluorescent in situ hybridization (FISH) to chromosomes of five species of venerid clams (Venerupis corrugata, Ruditapes philippinarum, Ruditapes decussatus, Dosinia exoleta, and Venus verrucosa). The results were anchored to the most comprehensive molecular phylogenetic tree currently available for Veneridae. While a single major rDNA cluster was found in each of the five species, the number of 5S rDNA clusters showed high interspecies variation. Major rDNA was either subterminal to the short arms or intercalary to the long arms of metacentric or submetacentric chromosomes, whereas minor rDNA signals showed higher variability. Major and minor rDNAs map to different chromosome pairs in all species, but in R. decussatus one of the minor rDNA gene clusters and the major rDNA cluster were located in the same position on a single chromosome pair. This interspersion of both sequences was confirmed by fiber FISH. Telomeric signals appeared at both ends of every chromosome in all species. FISH mapping data are discussed in relation to the molecular phylogenetic trees currently available for Veneridae. PMID:24967400

  2. Development of genome-specific 5S rDNA markers in Brassica and related species for hybrid testing.

    PubMed

    La Mura, Maurizio; Norris, Carol; Sporle, Sue; Jayaweera, Dasuni; Greenland, Andy; Lee, David

    2010-08-01

    The Brassicaceae are targets for DNA manipulation to modify oil content and composition. However, any strategy for creating novel products using genetic modification or traditional breeding must take into account the potential for hybridization with other Brassica species, many of which are important sources of edible oils. In this study we have tested Brassica carinata, a possible target for oil modification, to establish whether it can cross with other Brassica species and related genera, and we have developed molecular DNA assays to confirm hybridization. PMID:20725152

  3. Two thraustochytrid 5S ribosomal RNAs.

    PubMed Central

    MacKay, R M; Doolittle, W F

    1982-01-01

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  4. Two thraustochytrid 5S ribosomal RNAs.

    PubMed

    MacKay, R M; Doolittle, W F

    1982-12-20

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  5. The karyotype and 5S rRNA genes from Spanish individuals of the bat species Rhinolophus hipposideros (Rhinolophidae; Chiroptera).

    PubMed

    Puerma, Eva; Acosta, Manuel J; Barragán, Maria José L; Martínez, Sergio; Marchal, Juan Alberto; Bullejos, Mónica; Sánchez, Antonio

    2008-11-01

    The karyotype of individuals of the species Rhinolophus hipposideros from Spain present a chromosome number of 2n = 54 (NFa = 62). The described karyotype for these specimens is very similar to another previously described in individual from Bulgaria. However, the presence of one additional pair of autosomal acrocentric chromosomes in the Bulgarian karyotype and the differences in X chromosome morphology indicated that we have described a new karyotype variant in this species. In addition, we have analyzed several clones of 1.4 and 1 kb of a PstI repeated DNA sequence from the genome of R. hipposideros. The repeated sequence included a region with high identity with the 5S rDNA genes and flanking regions, with no homology with GenBank sequences. Search for polymerase III regulatory elements demonstrated the presence of type I promoter elements (A-box, Intermediate Element and C-box) in the 5S rDNA region. In addition, upstream regulatory elements, as a D-box and Sp1 binding sequences, were present in flanking regions. All data indicated that the cloned repeated sequences are the functional rDNA genes from this species. Finally, FISH demonstrated the presence of rDNA in nine chromosome pairs, which is surprising as most mammals have only one carrier chromosome pair. PMID:18066670

  6. Nucleotide excision repair of the 5 S ribosomal RNA gene assembled into a nucleosome.

    PubMed

    Liu, X; Smerdon, M J

    2000-08-01

    A-175-base pair fragment containing the Xenopus borealis somatic 5 S ribosomal RNA gene was used as a model system to determine the effect of nucleosome assembly on nucleotide excision repair (NER) of the major UV photoproduct (cyclobutane pyrimidine dimer (CPD)) in DNA. Xenopus oocyte nuclear extracts were used to carry out repair in vitro on reconstituted, positioned 5 S rDNA nucleosomes. Nucleosome structure strongly inhibits NER at many CPD sites in the 5 S rDNA fragment while having little effect at a few sites. The time course of CPD removal at 35 different sites indicates that >85% of the CPDs in the naked DNA fragment have t(12) values <2 h, whereas <26% of the t(12) values in nucleosomes are <2 h, and 15% are >8 h. Moreover, removal of histone tails from these mononucleosomes has little effect on the repair rates. Finally, nucleosome inhibition of repair shows no correlation with the rotational setting of a 14-nucleotide-long pyrimidine tract located 30 base pairs from the nucleosome dyad. These results suggest that inhibition of NER by mononucleosomes is not significantly influenced by the rotational orientation of CPDs on the histone surface, and histone tails play little (or no) role in this inhibition. PMID:10821833

  7. The 5S genes of Drosophila melanogaster.

    PubMed

    Artavanis-Tsakonas, S; Schedl, P; Tschudi, C; Pirrotta, V; Steward, R; Gehring, W J

    1977-12-01

    We have cloned embryonic Drosophila DNA using the poly (dA-DT) connector method (Lobban and Kaiser, 1973) and the ampicillin-resistant plasmid pSF2124 (So, Gill and Falkow, 1975) as a cloning vehicle. Two clones, containing hybrid plasmids with sequences complementary to a 5S RNA probe isolated from Drosophila tissue culture cells, were identified by the Grunstein and Hogness (1975) colony hybridization procedure. One hybrid plasmid has a Drosophila insert which is comprised solely of tandem repeats of the 5S gene plus spacer sequences. The other plasmid contains an insert which has about 20 tandem 5S repeat units plus an additional 4 kilobases of adjacent sequences. The size of the 5S repeat unit was determined by gel electrophoresis and was found to be approximately 375 base pairs. We present a restriction map of both plasmids, and a detailed map of of the5S repeat unit. The 5S repat unit shows slight length and sequence heterogeneity. We present evidence suggesting that the 5S genes in Drosophila melanogaster may be arranged in a single continuous cluster. PMID:413625

  8. Distribution of 5-methylcytosine residues in 5S rRNA genes in Arabidopsis thaliana and Secale cereale.

    PubMed

    Fulnecek, J; Matyásek, R; Kovarík, A

    2002-12-01

    Bisulfite genomic sequencing was used to localise 5-methylcytosine residues (mC) in 5S rRNA genes of Arabidopsis thaliana and Secale cereale. The maps of mC distribution were compared with the previously published map of the corresponding region in Nicotiana tabacum. In all three species, the level of methylation of 5S rRNA genes was generally higher than the average for the entire genome. The ratio of 5S rDNA methylation to average overall methylation was 44%/30-33% for N. tabacum, 27%/4-6% for A. thaliana and 24%/20-22% for S. cereale. With the exception of one clone from S. cereale, no methylation-free 5S rDNA was detected. The level of methylation at different sequence motifs in 5S rDNA was calculated for N. tabacum/A. thaliana/ S. cereale, and this analysis yielded the following values (expressed as a percentage of total C): mCG 90%/78%/85%, mCWG 89%/41%/53%, mCmCG 72%/32%/16%, mCCG 4%/2%/0%, mCHH 15%/6%/1%, where W=A or T, and H=A or C or T. Non-symmetrical methylation was almost negligible in the large genome of S. cereale but relatively frequent in N. tabacum and A. thaliana, suggesting that the strict correlation between genome size and cytosine methylation might be violated for this type of methylation. Among non-symmetrical motifs the mCWA triplets were significantly over-represented in Arabidopsis, while in tobacco this preference was not as pronounced. The differences in methylation levels in different sequence contexts might be of phylogenetic significance, but further species in related and different taxa need to be studied before firm conclusions can be drawn. PMID:12471448

  9. Molecular Cytogenetics in Digenean Parasites: Linked and Unlinked Major and 5S rDNAs, B Chromosomes and Karyotype Diversification.

    PubMed

    García-Souto, Daniel; Pasantes, Juan J

    2015-01-01

    Digenetic trematodes are the largest group of internal metazoan parasites, but their chromosomes are poorly studied. Although chromosome numbers and/or karyotypes are known for about 300 of the 18,000 described species, molecular cytogenetic knowledge is mostly limited to the mapping of telomeric sequences and/or of major rDNA clusters in 9 species. In this work we mapped major and 5S rDNA clusters and telomeric sequences in chromosomes of Bucephalus minimus, B. australis, Prosorhynchoides carvajali (Bucephaloidea), Monascus filiformis (Gymnophalloidea), Parorchis acanthus (Echinostomatoidea), Cryptocotyle lingua (Opisthorchioidea), Cercaria longicaudata, Monorchis parvus (Monorchioidea), Diphterostomum brusinae, and Bacciger bacciger (Microphalloidea). Whilst single major and minor rDNA clusters were mapped to different chromosome pairs in B. minimus and P. acanthus, overlapping signals were detected on a single chromosome pair in the remaining taxa. FISH experiments using major rDNA and telomeric probes clearly demonstrated the presence of highly stretched NORs in most of the digenean taxa analyzed. B chromosomes were detected in the B. bacciger samples hosted by Ruditapes decussatus. Although the cercariae specimens obtained from Donax trunculus, Tellina tenuis, and R. decussatus were in agreement with B. bacciger, their karyotypes showed striking morphological differences in agreement with the proposed assignation of these cercariae to different species of the genus Bacciger. Results are discussed in comparison with previous data on digenean chromosomes. PMID:26680763

  10. Phylogenetic Status of an Unrecorded Species of Curvularia, C. spicifera, Based on Current Classification System of Curvularia and Bipolaris Group Using Multi Loci

    PubMed Central

    Jeon, Sun Jeong; Nguyen, Thi Thuong Thuong

    2015-01-01

    A seed-borne fungus, Curvularia sp. EML-KWD01, was isolated from an indigenous wheat seed by standard blotter method. This fungus was characterized based on the morphological characteristics and molecular phylogenetic analysis. Phylogenetic status of the fungus was determined using sequences of three loci: rDNA internal transcribed spacer, large ribosomal subunit, and glyceraldehyde 3-phosphate dehydrogenase gene. Multi loci sequencing analysis revealed that this fungus was Curvularia spicifera within Curvularia group 2 of family Pleosporaceae. PMID:26539036

  11. Functional variants of 5S rRNA in the ribosomes of common sea urchin Paracentrotus lividus.

    PubMed

    Dimarco, Eufrosina; Cascone, Eleonora; Bellavia, Daniele; Caradonna, Fabio

    2012-10-15

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus; this study, performed at DNA level only, lends itself as starting point to verify that these clusters could contain transcribed genes, then, to demonstrate the presence of heterogeneity at functional RNA level, also. In the present work we report in P. lividus ribosomes the existence of several transcribed variants of the 5S rRNA and we associate all transcribed variants to the cluster to which belong. Our finding is the first demonstration of the presence of high heterogeneity in functional 5S rRNA molecules in animal ribosomes, a feature that had been considered a peculiarity of some plants. PMID:22967708

  12. Refinement of the spinal muscular atrophy locus to the interval between D5S435 and MAP1B

    SciTech Connect

    Soares, V.M.; Brzustowicz, L.M.; Kleyn, P.W.; Knowles, J.A.; Palmer, D.A.; Asokan, S.; Penchaszadeh, G.K.; Gilliam, T.C. ); Munsat, T.L. )

    1993-02-01

    The childhood-onset SMA locus has been mapped to chromosome 5q13, in a region bounded by the proximal locus, D5S6, and the closely linked distal loci, D5S112 and MAP1B. We now describe a highly polymorphic, tightly linked microsatellite marker (D5S435) that is very likely the closet proximal marker to the SMA locus. Multipoint linkage analysis firmly establishes the following order of markers at 5q13; centromere-D5S76-D5S6-D5S435-MAP1B/D5S112-D5S39-telomere. The data indicate that SMA resides in an approximately 0.7-cM (range 01.-2.1) region between D5S435 and MAP1B. This finding reduces by approximately fourfold the genetic region that most likely harbors the SMA locus and will facilitate the physical mapping and cloning of the disease gene region. 24 refs., 3 figs., 1 tab.

  13. Molecular phylogenetic studies on filarial parasites based on 5S ribosomal spacer sequences.

    PubMed

    Xie, H; Bain, O; Williams, S A

    1994-06-01

    This paper is the first large-scale molecular phylogenetic study on filarial parasites (family Onchocercidae) which includes 16 species of 6 genera: Brugia beaveri Ash et Little, 1962, B. buckleyi Dissanaike et Paramananthan, 1961; B. malayi (Brug, 1927) Buckley, 1960; B. pahangi (Buckley et Edeson, 1956) Buckley, 1960; B. patei (Buckley, Nelson et Heisch, 1958) Buckley, 1960; B. timori Partono et al, 1977; Wuchereria bancrofti (Cobbold, 1877) Seurat, 1921: W. kalimantani Palmieri. Purnomo, Dennis and Marwoto, 1980: Mansonella perstans (Manson, 1891) Eberhard et Orihel, 1984; loa loc, Stiles, 1905; Onchocerca volvulus (Leuckart, 1983) Railliet er Henry, 1910; O. ochengi Bwangamoi, 1969; O. gutturosa Neumann, 1910; Dirofilaria immitis (Leidy, 1856) Railliet e Henry, 1911; Acanthocheilonema viteae (Krepkogorskaya, 1933) Bain, Baker et Chabaud, 1982 and Litomosoides sigmodontis Chandler, 1931. 5S rRNA gene spacer region sequence data were collected by PCR, cloning and dideoxy sequencing. The 5S rRNA gene spacer region sequences were aligned and analyzed by maximum parsimony algorithms, distance methods and maximum likelihood methods to construct phylogenetic trees. Bootstrap analysis was used to test the robustness of the different phylogenetic reconstructions. The data indicated that 5S spacer region sequences are highly conserved within species yet differ significantly between species. Spliced leader sequences were observed in all of the 5S rDNA spacers with no sequence variation, although flanking region sequence and length heterogeneity was observed even within species. All of the various tree-building methods gave very similar results. This study identified four clades which are strongly supported by bootstrap analysis the Brugia clade; the Wuchereria clade; the Brugia-Wuchereria clade and the Onchocerca clade. The analyses indicated that L. sigmodontis and A. viteae may be the most primitive among the 16 species studied. The data did not show any close

  14. Remote Symbolic Computation of Loci

    ERIC Educational Resources Information Center

    Abanades, Miguel A.; Escribano, Jesus; Botana, Francisco

    2010-01-01

    This article presents a web-based tool designed to compute certified equations and graphs of geometric loci specified using standard Dynamic Geometry Systems (DGS). Complementing the graphing abilities of the considered DGS, the equations of the loci produced by the application are remotely computed using symbolic algebraic techniques from the…

  15. Cytogenetic Diversity and the Evolutionary Dynamics of rDNA Genes and Telomeric Sequences in the Ancistrus Genus (Loricariidae: Ancistrini).

    PubMed

    Favarato, Ramon Marin; Silva, Maelin da; Oliveira, Renildo Ribeiro de; Artoni, Roberto Ferreira; Feldberg, Eliana; Matoso, Daniele Aparecida

    2016-04-01

    The Ancistrus genus differs from other Ancistrini due to its wide karyotypic diversity, varied diploid numbers, differences in sex chromosomes, and large number of species, as well as its tendency to form small populations with low vagility. This study investigated the role of 5S and 18S rDNA and telomeric repetitive sequences in the evolution of the karyotypic macrostructure of seven species of the genus Ancistrus from the Central Amazon. The results indicate a strong correlation between the location of ribosomal sites and fragile sites in the genome, particularly of 5S rDNA sequences, which are associated, in some species, with telomeric sequences at the sites of chromosomal healing. Moreover, the occurrence of two lineages was observed with regard to the synteny of ribosomal genes. The species of the genus Ancistrus showed high chromosomal lability associated with breakpoints, which was characterized by the presence of repetitive DNA sequences and this process is suggested to be an evolutionary model for the rapid fixation of structural rearrangements. PMID:26829587

  16. Analysis of Sir2p domains required for rDNA and telomeric silencing in Saccharomyces cerevisiae.

    PubMed Central

    Cockell, M M; Perrod, S; Gasser, S M

    2000-01-01

    Silent information regulator (Sir) 2 is a limiting component of the Sir2/3/4 complex, which represses transcription at subtelomeric and HM loci. Sir2p also acts independently of Sir3p and Sir4p to influence chromatin organization in the rDNA locus. Deleted and mutated forms of Sir2p have been tested for their ability to complement and/or to disrupt silencing. The highly conserved C-terminal domain of Sir2p (aa 199-562) is insufficient to restore repression at either telomeric or rDNA reporters in a sir2Delta background and fails to nucleate silencing when targeted to an appropriate reporter gene. However, its expression in an otherwise wild-type strain disrupts telomeric repression. Similarly, a point mutation (P394L) within this conserved core inactivates the full-length protein but renders it dominant negative for all types of silencing. Deletion of aa 1-198 from Sir2(394L) eliminates its dominant negative effect. Thus we define two distinct functional domains in Sir2p, both essential for telomeric and rDNA repression: the conserved core domain found within aa 199-562 and a second domain that encompasses aa 94-198. Immunolocalization and two-hybrid studies show that aa 94-198 are required for the binding of Sir2p to Sir4p and for the targeting of Sir2p to the nucleolus through another ligand. The globular core domain provides an essential silencing function distinct from that of targeting or Sir complex formation that may reflect its reported mono-ADP-ribosyl transferase activity. PMID:10757754

  17. Randomly Detected Genetically Modified (GM) Maize (Zea mays L.) near a Transport Route Revealed a Fragile 45S rDNA Phenotype

    PubMed Central

    Waminal, Nomar Espinosa; Ryu, Ki Hyun; Choi, Sun-Hee; Kim, Hyun Hee

    2013-01-01

    Monitoring of genetically modified (GM) crops has been emphasized to prevent their potential effects on the environment and human health. Monitoring of the inadvertent dispersal of transgenic maize in several fields and transport routes in Korea was carried out by qualitative multiplex PCR, and molecular analyses were conducted to identify the events of the collected GM maize. Cytogenetic investigations through fluorescence in situ hybridization (FISH) of the GM maize were performed to check for possible changes in the 45S rDNA cluster because this cluster was reported to be sensitive to replication and transcription stress. Three GM maize kernels were collected from a transport route near Incheon port, Korea, and each was found to contain NK603, stacked MON863 x NK603, and stacked NK603 x MON810 inserts, respectively. Cytogenetic analysis of the GM maize containing the stacked NK603 x MON810 insert revealed two normal compact 5S rDNA signals, but the 45S rDNA showed a fragile phenotype, demonstrating a “beads-on-a-string” fragmentation pattern, which seems to be a consequence of genetic modification. Implications of the 45S rDNA cluster fragility in GM maize are also discussed. PMID:24040165

  18. Dysfunction of Chromatin Assembly Factor 1 Induces Shortening of Telomeres and Loss of 45S rDNA in Arabidopsis thaliana[W][OA

    PubMed Central

    Mozgová, Iva; Mokroš, Petr; Fajkus, Jiří

    2010-01-01

    Chromatin Assembly Factor 1 (CAF1) is a three-subunit H3/H4 histone chaperone responsible for replication-dependent nucleosome assembly. It is composed of CAC 1-3 in yeast; p155, p60, and p48 in humans; and FASCIATA1 (FAS1), FAS2, and MULTICOPY SUPPRESSOR OF IRA1 in Arabidopsis thaliana. We report that disruption of CAF1 function by fas mutations in Arabidopsis results in telomere shortening and loss of 45S rDNA, while other repetitive sequences (5S rDNA, centromeric 180-bp repeat, CACTA, and Athila) are unaffected. Substantial telomere shortening occurs immediately after the loss of functional CAF1 and slows down at telomeres shortened to median lengths around 1 to 1.5 kb. The 45S rDNA loss is progressive, leaving 10 to 15% of the original number of repeats in the 5th generation of mutants affecting CAF1, but the level of the 45S rRNA transcripts is not altered in these mutants. Increasing severity of the fas phenotype is accompanied by accumulation of anaphase bridges, reduced viability, and plant sterility. Our results show that appropriate replication-dependent chromatin assembly is specifically required for stable maintenance of telomeres and 45S rDNA. PMID:20699390

  19. Compilation of 5S rRNA and 5S rRNA gene sequences

    PubMed Central

    Specht, Thomas; Wolters, Jörn; Erdmann, Volker A.

    1990-01-01

    The BERLIN RNA DATABANK as of Dezember 31, 1989, contains a total of 667 sequences of 5S rRNAs or their genes, which is an increase of 114 new sequence entries over the last compilation (1). It covers sequences from 44 archaebacteria, 267 eubacteria, 20 plastids, 6 mitochondria, 319 eukaryotes and 11 eukaryotic pseudogenes. The hardcopy shows only the list (Table 1) of those organisms whose sequences have been determined. The BERLIN RNA DATABANK uses the format of the EMBL Nucleotide Sequence Data Library complemented by a Sequence Alignment (SA) field including secondary structure information. PMID:1692116

  20. Genetic and physical mapping of the Treacher Collins syndrome locus with respect to loci in the chromosome 5q3 region

    SciTech Connect

    Jabs, E.W.; Li, Xiang; Coss, C.; Taylor, E. ); Lovett, M. ); Yamaoka, L.H.; Speer, M.C. ); Cadle, R.; Hall, B. ); Brown, K. )

    1993-10-01

    Treacher Collins syndrome is an autosomal dominant, craniofacial developmental disorder, and its locus (TCOF1) has been mapped to chromosome 5q3. To refine the location of the gene within this region, linkage analysis was performed among the TCOF1 locus and 12 loci (IL9, FGFA, GRL, D5S207, D5S210, D5S376, CSF1R, SPARC, D5S119, D5S209, D5S527, FGFR4) in 13 Treacher Collins syndrome families. The highest maximum lod score was obtained between loci TCOF1 and D5S210 (Z = 10.52; [theta] = 0.02 [+-] 0.07). The best order, IL9-GRL-D5S207/D5S210-CSF1R-SPARC-D5S119, and genetic distances among these loci were determined in the 40 CEPH families by multipoint linkage analysis. YAC clones were used to establish the order of loci, centromere-5[prime]GRL3[prime]-D5S207-D5S210-D5S376-CSF1R-SPARC-D5S119-telomere. By combining known physical mapping data with ours, the order of chromosome 5q3 markers is centomere-IL9-FGFA-5[prime]GRL3[prime]-D5s207-D5S210-D5S376-CSF1R-SPARC-D5S119-D5S209-FGFR4-telomere. Based on this order, haplotype analysis suggests that the TCOF1 locus resides distal CSF1R and proximal to SPARC within a region less than 1 Mb in size. 29 refs., 2 figs., 2 tabs.

  1. Chromosomal mapping of H3 histone and 5S rRNA genes in eight species of Astyanax (Pisces, Characiformes) with different diploid numbers: syntenic conservation of repetitive genes.

    PubMed

    Piscor, Diovani; Parise-Maltempi, Patricia Pasquali

    2016-03-01

    The genus Astyanax is widely distributed from the southern United States to northern Patagonia, Argentina. While cytogenetic studies have been performed for this genus, little is known about the histone gene families. The aim of this study was to examine the chromosomal relationships among the different species of Astyanax. The chromosomal locations of the 5S rRNA and H3 histone genes were determined in A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, A. mexicanus (all 2n = 50), A. fasciatus (2n = 46), and A. schubarti (2n = 36). All eight species exhibited H3 histone clusters on two chromosome pairs. In six species (A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, and A. fasciatus), syntenic clusters of H3 histone and 5S rDNA were observed on metacentric (m) or submetacentric (sm) chromosomes. In seven species, clusters of 5S rDNA sequences were located on one or two chromosome pairs. In A. mexicanus, 5S rDNA clusters were located on four chromosome pairs. This study demonstrates that H3 histone clusters are conserved on two chromosome pairs in the genus Astyanax, and specific chromosomal features may contribute to the genomic organization of the H3 histone and 5S rRNA genes. PMID:26835745

  2. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    NASA Technical Reports Server (NTRS)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  3. Mouse Oocytes Transcribe Injected Xenopus 5S RNA Gene

    PubMed Central

    Brinster, Ralph L.; Chen, Howard Y.; Trumbauer, Myrna E.

    2016-01-01

    Transcripts produced after injection of the Xenopus 5S RNA gene into oocyte germinal vesicles of mice migrate electrophoretically with the 5S RNA marker, an indication that the gene is transcribed and processed with considerable accuracy, Approximately two 5S RNA molecules are transcribed per gene per hour. This system may be useful in studying DNA processing and gene regulation by the mammalian ovum and might be modified to allow permanent incorporation of specific genes into mice. PMID:7194505

  4. Nucleolin: dual roles in rDNA chromatin transcription.

    PubMed

    Durut, Nathalie; Sáez-Vásquez, Julio

    2015-02-01

    Nucleolin is a major nucleolar protein conserved in all eukaryotic organisms. It is a multifunctional protein involved in different cellular aspects like chromatin organization and stability, DNA and RNA metabolism, assembly of ribonucleoprotein complexes, cytokinesis, cell proliferation and stress response. The multifunctionality of nucleolin is linked to its tripartite structure, post-translational modifications and its ability of shuttling from and to the nucleolus/nucleoplasm and cytoplasm. Nucleolin has been now studied for many years and its activities and properties have been described in a number of excellent reviews. Here, we overview the role of nucleolin in RNA polymerase I (RNAPI) transcription and describe recent results concerning its functional interaction with rDNA chromatin organization. For a long time, nucleolin has been associated with rRNA gene expression and pre-rRNA processing. However, the functional connection between nucleolin and active versus inactive rRNA genes is still not fully understood. Novel evidence indicates that the nucleolin protein might be required for controlling the transcriptional ON/OFF states of rDNA chromatin in both mammals and plants. PMID:25225127

  5. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  6. 5SRNAdb: an information resource for 5S ribosomal RNAs

    PubMed Central

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A.; Karlowski, Wojciech M.

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA–protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  7. 5S RNA sequence from the Philosamia silkworm: evidence for variable evolutionary rates in insect 5S RNA.

    PubMed Central

    Xian-Rong, G; Nicoghosian, K; Cedergren, R J

    1982-01-01

    The primary structure of 5S RNA isolated from the posterior silkgland of Philosamia cynthia ricini was determined using three in vitro labelling techniques. The derived sequence consists of 119 nucleotides and can be folded into the secondary structure model proposed for eukaryotic 5S RNAs. This 5S RNA differs from the Bombyx mori molecule in 9 positions and from the Drosophila melanogaster sequence in 14 positions. The comparison of evolutionary rates in insect 5S RNA with inferred rates in other eukaryotic phyla leads to the conclusion that 5S RNA evolution is not constant in different eukaryotic branches, a condition which must be taken into account in phylogenetic tree constructions. Images PMID:7145713

  8. Myc-induced anchorage of the rDNA IGS region to nucleolar matrix modulates growth-stimulated changes in higher-order rDNA architecture.

    PubMed

    Shiue, Chiou-Nan; Nematollahi-Mahani, Amir; Wright, Anthony P H

    2014-05-01

    Chromatin domain organization and the compartmentalized distribution of chromosomal regions are essential for packaging of deoxyribonucleic acid (DNA) in the eukaryotic nucleus as well as regulated gene expression. Nucleoli are the most prominent morphological structures of cell nuclei and nucleolar organization is coupled to cell growth. It has been shown that nuclear scaffold/matrix attachment regions often define the base of looped chromosomal domains in vivo and that they are thereby critical for correct chromosome architecture and gene expression. Here, we show regulated organization of mammalian ribosomal ribonucleic acid genes into distinct chromatin loops by tethering to nucleolar matrix via the non-transcribed inter-genic spacer region of the ribosomal DNA (rDNA). The rDNA gene loop structures are induced specifically upon growth stimulation and are dependent on the activity of the c-Myc protein. Matrix-attached rDNA genes are hypomethylated at the promoter and are thus available for transcriptional activation. rDNA genes silenced by methylation are not recruited to the matrix. c-Myc, which has been shown to induce rDNA transcription directly, is physically associated with rDNA gene looping structures and the intergenic spacer sequence in growing cells. Such a role of Myc proteins in gene activation has not been reported previously. PMID:24609384

  9. rDNA Copy Number Variants Are Frequent Passenger Mutations in Saccharomyces cerevisiae Deletion Collections and de Novo Transformants

    PubMed Central

    Kwan, Elizabeth X.; Wang, Xiaobin S.; Amemiya, Haley M.; Brewer, Bonita J.; Raghuraman, M. K.

    2016-01-01

    The Saccharomyces cerevisiae ribosomal DNA (rDNA) locus is known to exhibit greater instability relative to the rest of the genome. However, wild-type cells preferentially maintain a stable number of rDNA copies, suggesting underlying genetic control of the size of this locus. We performed a screen of a subset of the Yeast Knock-Out (YKO) single gene deletion collection to identify genetic regulators of this locus and to determine if rDNA copy number correlates with yeast replicative lifespan. While we found no correlation between replicative lifespan and rDNA size, we identified 64 candidate strains with significant rDNA copy number differences. However, in the process of validating candidate rDNA variants, we observed that independent isolates of our de novo gene deletion strains had unsolicited but significant changes in rDNA copy number. Moreover, we were not able to recapitulate rDNA phenotypes from the YKO yeast deletion collection. Instead, we found that the standard lithium acetate transformation protocol is a significant source of rDNA copy number variation, with lithium acetate exposure being the treatment causing variable rDNA copy number events after transformation. As the effects of variable rDNA copy number are being increasingly reported, our finding that rDNA is affected by lithium acetate exposure suggested that rDNA copy number variants may be influential passenger mutations in standard strain construction in S. cerevisiae. PMID:27449518

  10. Contrasting Patterns of rDNA Homogenization within the Zygosaccharomyces rouxii Species Complex.

    PubMed

    Chand Dakal, Tikam; Giudici, Paolo; Solieri, Lisa

    2016-01-01

    Arrays of repetitive ribosomal DNA (rDNA) sequences are generally expected to evolve as a coherent family, where repeats within such a family are more similar to each other than to orthologs in related species. The continuous homogenization of repeats within individual genomes is a recombination process termed concerted evolution. Here, we investigated the extent and the direction of concerted evolution in 43 yeast strains of the Zygosaccharomyces rouxii species complex (Z. rouxii, Z. sapae, Z. mellis), by analyzing two portions of the 35S rDNA cistron, namely the D1/D2 domains at the 5' end of the 26S rRNA gene and the segment including the internal transcribed spacers (ITS) 1 and 2 (ITS regions). We demonstrate that intra-genomic rDNA sequence variation is unusually frequent in this clade and that rDNA arrays in single genomes consist of an intermixing of Z. rouxii, Z. sapae and Z. mellis-like sequences, putatively evolved by reticulate evolutionary events that involved repeated hybridization between lineages. The levels and distribution of sequence polymorphisms vary across rDNA repeats in different individuals, reflecting four patterns of rDNA evolution: I) rDNA repeats that are homogeneous within a genome but are chimeras derived from two parental lineages via recombination: Z. rouxii in the ITS region and Z. sapae in the D1/D2 region; II) intra-genomic rDNA repeats that retain polymorphisms only in ITS regions; III) rDNA repeats that vary only in their D1/D2 domains; IV) heterogeneous rDNA arrays that have both polymorphic ITS and D1/D2 regions. We argue that an ongoing process of homogenization following allodiplodization or incomplete lineage sorting gave rise to divergent evolutionary trajectories in different strains, depending upon temporal, structural and functional constraints. We discuss the consequences of these findings for Zygosaccharomyces species delineation and, more in general, for yeast barcoding. PMID:27501051

  11. Karyotyping and in situ chromosomal localization of rDNA sites in black cumin Bunium persicum (Boiss) B. Fedtsch,1915 (Apiaceae)

    PubMed Central

    Chahota, R. K.; Mukai, Y.; Chaudhary, H.K.; Kishore, Naval; Sharma, T.R.

    2011-01-01

    Abstract The fluorescent in situ hybridization (FISH) technique has been applied to somatic chromosomes in the medicinally important species, Bunium persicum, to elucidate its karyotypes. The bicolour FISH technique involving 18S-5.8S-26S and 5S ribosomal RNA genes as probes was used to assign physical localization and measurement of rDNA sites on homologous pairs of chromosomes. The two 18S-5.8S-26S rRNA gene sites were at the terminal regions of the short arms of the chromosomes 1 and 2 involving NOR region of chromosome 1. The 5S rDNA sites were found on subtelomeric region of the long arm of the chromosome number 5 and at interstitial regions of the short arm of chromosome 7. Based on direct visual analysis of chromosome length, morphology and position of FISH signals, a pioneer attempt has been made to construct metaphase karyotype in Bunium persicum, an endangered medicinal plant of North Western Himalayas. PMID:24260640

  12. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

    2013-10-01

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status. PMID:23933480

  13. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    PubMed

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment. PMID:22724546

  14. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  15. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  16. Confirmation of Two Undescribed Fungal Species from Dokdo of Korea Based on Current Classification System Using Multi Loci.

    PubMed

    Lee, Hye Won; Nguyen, Thi Thuong Thuong; Mun, Hye Yeon; Lee, Haengsub; Kim, Changmu; Lee, Hyang Burm

    2015-12-01

    Using dilution plating method, 47 fungal isolates were obtained from a soil sample collected from Dokdo in the East Sea of Korea in 2013. In this study, two fungal isolates, EML-MFS30-1 and EML-DDSF4, were confirmed as undescribed species, Metarhizium guizhouense and Mortierella oligospora in Korea based on current classification system using multi loci including rDNA internal transcribed spacer, large subunit, small subunit, and β-tubulin (BTUB) genes. Herein, detailed morphological descriptions on characters of the undescribed fungal species as well as their molecular phylogenetic status are provided with comparisons to related species. PMID:26839498

  17. Confirmation of Two Undescribed Fungal Species from Dokdo of Korea Based on Current Classification System Using Multi Loci

    PubMed Central

    Lee, Hye Won; Nguyen, Thi Thuong Thuong; Mun, Hye Yeon; Lee, Haengsub; Kim, Changmu

    2015-01-01

    Using dilution plating method, 47 fungal isolates were obtained from a soil sample collected from Dokdo in the East Sea of Korea in 2013. In this study, two fungal isolates, EML-MFS30-1 and EML-DDSF4, were confirmed as undescribed species, Metarhizium guizhouense and Mortierella oligospora in Korea based on current classification system using multi loci including rDNA internal transcribed spacer, large subunit, small subunit, and β-tubulin (BTUB) genes. Herein, detailed morphological descriptions on characters of the undescribed fungal species as well as their molecular phylogenetic status are provided with comparisons to related species. PMID:26839498

  18. Dynamic changes in the distribution of a satellite homologous to intergenic 26-18S rDNA spacer in the evolution of Nicotiana.

    PubMed Central

    Lim, K Y; Skalicka, K; Koukalova, B; Volkov, R A; Matyasek, R; Hemleben, V; Leitch, A R; Kovarik, A

    2004-01-01

    An approximately 135-bp sequence called the A1/A2 repeat was isolated from the transcribed region of the 26-18S rDNA intergenic spacer (IGS) of Nicotiana tomentosiformis. Fluorescence in situ hybridization (FISH) and Southern blot analysis revealed its occurrence as an independent satellite (termed an A1/A2 satellite) outside of rDNA loci in species of Nicotiana section Tomentosae. The chromosomal location, patterns of genomic dispersion, and copy numbers of its tandemly arranged units varied between the species. In more distantly related Nicotiana species the A1/A2 repeats were found only at the nucleolar organizer regions (NOR). There was a trend toward the elimination of the A1/A2 satellite in N. tabacum (tobacco), an allotetraploid with parents closely related to the diploids N. sylvestris and N. tomentosiformis. This process may have already commenced in an S(3) generation of synthetic tobacco. Cytosine residues in the IGS were significantly hypomethylated compared with the A1/A2 satellite. There was no clear separation between the IGS and satellite fractions in sequence analysis of individual clones and we found no evidence for CG suppression. Taken together the data indicate a dynamic nature of the A1/A2 repeats in Nicotiana genomes, with evidence for recurrent integration, copy number expansions, and contractions. PMID:15126410

  19. Physical mapping of 18S and 5S genes in pelagic species of the genera Caranx and Carangoides (Carangidae).

    PubMed

    Jacobina, U P; Bertollo, L A C; Bello Cioffi, M; Molina, W F

    2014-01-01

    In Carangidae, Caranx is taxonomically controversial because of slight morphological differences among species, as well as because of its relationship with the genus Carangoides. Cytogenetic data has contributed to taxonomic and phylogenetic classification for some groups of fish. In this study, we examined the chromosomes of Caranx latus, Caranx lugubris, and Carangoides bartholomaei using classical methods, including conventional staining, C-banding, silver staining for nuclear organizer regions, base-specific fluorochrome, and 18S and 5S ribosomal sequence mapping using in situ hybridization. These 3 species showed chromosome numbers of 2n = 48, simple nuclear organizer regions (pair 1), and mainly centromeric heterochomatin. However, C. latus (NF = 50) and C. bartholomaei (NF = 50) showed a structurally conserved karyotype compared with C. lugubris (NF = 54), with a larger number of 2-armed chromosomes. The richness of GC-positive heterochromatic segments and sites in 5S rDNA in specific locations compared to the other 2 species reinforce the higher evolutionary dynamism in C. lugubris. Cytogenetic aspects shared between C. latus and C. bartholomaei confirm the remarkable phylogenetic proximity between these genera. PMID:25501173

  20. D5S2500 is an ambiguously characterized STR: Identification and description of forensic microsatellites in the genomics age.

    PubMed

    Phillips, C; Parson, W; Amigo, J; King, J L; Coble, M D; Steffen, C R; Vallone, P M; Gettings, K B; Butler, J M; Budowle, B

    2016-07-01

    In the process of establishing short tandem repeat (STR) sequence variant nomenclature guidelines in anticipation of expanded forensic multiplexes for massively parallel sequencing (MPS), it was discovered that the STR D5S2500 has multiple positions and genomic characteristics reported. This ambiguity is because the marker named D5S2500 consists of two different microsatellites forming separate components in the capillary electrophoresis multiplexes of Qiagen's HDplex (Hilden, Germany) and AGCU ScienTech's non-CODIS STR 21plex (Wuxi, Jiangsu, China). This study outlines the genomic details used to identify each microsatellite and reveals the D5S2500 marker in HDplex has the correctly assigned STR name, while the D5S2500 marker in the AGCU 21plex, closely positioned a further 1643 nucleotides in the human reference sequence, is an unnamed microsatellite. The fact that the D5S2500 marker has existed as two distinct STR loci undetected for almost ten years, even with reported discordant genotypes for the standard control DNA, underlines the need for careful scrutiny of the genomic properties of forensic STRs, as they become adapted for sequence analysis with MPS systems. We make the recommendation that precise chromosome location data must be reported for any forensic marker under development but not in common use, so that the genomic characteristics of the locus are validated to the same level of accuracy as its allelic variation and forensic performance. To clearly differentiate each microsatellite, we propose the name D5S2800 be used to identify the Chromosome-5 STR in the AGCU 21plex. PMID:26974236

  1. Analyzing Digital Library Initiatives: 5S Theory Perspective

    ERIC Educational Resources Information Center

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko

    2015-01-01

    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  2. mediator of paramutation1 Is Required for Establishment and Maintenance of Paramutation at Multiple Maize Loci

    PubMed Central

    Dorweiler, Jane E.; Carey, Charles C.; Kubo, Kenneth M.; Hollick, Jay B.; Kermicle, Jerry L.; Chandler, Vicki L.

    2000-01-01

    Paramutation is the directed, heritable alteration of the expression of one allele when heterozygous with another allele. Here, the isolation and characterization of a mutation affecting paramutation, mediator of paramutation1-1 (mop1-1), are described. Experiments demonstrate that the wild-type gene Mop1 is required for establishment and maintenance of the paramutant state. The mop1-1 mutation affects paramutation at the multiple loci tested but has no effect on alleles that do not participate in paramutation. The mutation does not alter the amounts of actin and ubiquitin transcripts, which suggests that the mop1 gene does not encode a global repressor. Maize plants homozygous for mop1-1 can have pleiotropic developmental defects, suggesting that mop1-1 may affect more genes than just the known paramutant ones. The mop1-1 mutation does not alter the extent of DNA methylation in rDNA and centromeric repeats. The observation that mop1 affects paramutation at multiple loci, despite major differences between these loci in their gene structure, correlations with DNA methylation, and stability of the paramutant state, suggests that a common mechanism underlies paramutation. A protein-based epigenetic model for paramutation is discussed. PMID:11090212

  3. Assessment of three mitochondrial loci variability for the crown-of-thorns starfish: a first insight into Acanthaster phylogeography.

    PubMed

    Gérard, Karin; Roby, Charlotte; Chevalier, Nicolas; Thomassin, Bernard; Chenuil, Anne; Féral, Jean-Pierre

    2008-02-01

    Acanthaster planci (L.) is one of the major threats to coral reefs, whose genetic diversity has been mainly studied with allozymes. Allozymes revealed the low genetic differentiation between A. planci populations in the Indo-Pacific area. We obtained sequences of A. planci from Kenya, Mayotte and Madagascar at the three loci cytochrome oxydase subunit I (COI), 16S rDNA (16S) and five tRNAs, analysed together with available sequences of Acanthaster from the Pacific Ocean. The level of genetic diversity varied among the three loci, tRNAs being on average three times less divergent than COI and 16S genes. The genus Acanthaster appeared monophyletic, the two species A. brevispinus (Fisher) and A. planci forming distinct clades in agreement with data from morphology and systematics. The A. planci clade split into a West Indian Ocean group and a Pacific group, in agreement with allozyme data on population differentiation. PMID:18241806

  4. Molecular organization of the 25S-18S rDNA IGS of Fagus sylvatica and Quercus suber: a comparative analysis.

    PubMed

    Inácio, Vera; Rocheta, Margarida; Morais-Cecílio, Leonor

    2014-01-01

    The 35S ribosomal DNA (rDNA) units, repeated in tandem at one or more chromosomal loci, are separated by an intergenic spacer (IGS) containing functional elements involved in the regulation of transcription of downstream rRNA genes. In the present work, we have compared the IGS molecular organizations in two divergent species of Fagaceae, Fagus sylvatica and Quercus suber, aiming to comprehend the evolution of the IGS sequences within the family. Self- and cross-hybridization FISH was done on representative species of the Fagaceae. The IGS length variability and the methylation level of 18 and 25S rRNA genes were assessed in representatives of three genera of this family: Fagus, Quercus and Castanea. The intergenic spacers in Beech and Cork Oak showed similar overall organizations comprising putative functional elements needed for rRNA gene activity and containing a non-transcribed spacer (NTS), a promoter region, and a 5'-external transcribed spacer. In the NTS: the sub-repeats structure in Beech is more organized than in Cork Oak, sharing some short motifs which results in the lowest sequence similarity of the entire IGS; the AT-rich region differed in both spacers by a GC-rich block inserted in Cork Oak. The 5'-ETS is the region with the higher similarity, having nonetheless different lengths. FISH with the NTS-5'-ETS revealed fainter signals in cross-hybridization in agreement with the divergence between genera. The diversity of IGS lengths revealed variants from ∼ 2 kb in Fagus, and Quercus up to 5.3 kb in Castanea, and a lack of correlation between the number of variants and the number of rDNA loci in several species. Methylation of 25S Bam HI site was confirmed in all species and detected for the first time in the 18S of Q. suber and Q. faginea. These results provide important clues for the evolutionary trends of the rDNA 25S-18S IGS in the Fagaceae family. PMID:24893289

  5. macroH2A1 histone variant represses rDNA transcription.

    PubMed

    Cong, Rong; Das, Sadhan; Douet, Julien; Wong, Jiemin; Buschbeck, Marcus; Mongelard, Fabien; Bouvet, Philippe

    2014-01-01

    The regulation of ribosomal DNA transcription is an important step for the control of cell growth. Epigenetic marks such as DNA methylation and posttranslational modifications of canonical histones have been involved in this regulation, but much less is known about the role of histone variants. In this work, we show that the histone variant macroH2A1 is present on the promoter of methylated rDNA genes. The inhibition of the expression of macroH2A1 in human HeLa and HepG2 cells and in a mouse ES cell line resulted in an up to 5-fold increase of pre-rRNA levels. This increased accumulation of pre-rRNA is accompanied by an increase of the loading of RNA polymerase I and UBF on the rDNA without any changes in the number of active rDNA genes. The inhibition of RNA polymerase I transcription by actinomycin D or by knocking down nucleolin, induces the recruitment of macroH2A1 on the rDNA and the relocalization of macroH2A1 in the nucleolus. Interestingly, the inhibition of rDNA transcription induced by nucleolin depletion is alleviated by the inactivation of macroH2A1. These results demonstrate that macroH2A1 is a new factor involved in the regulation of rDNA transcription. PMID:24071584

  6. Protein kinase NII and the regulation of rDNA transcription in mammalian cells.

    PubMed Central

    Belenguer, P; Baldin, V; Mathieu, C; Prats, H; Bensaid, M; Bouche, G; Amalric, F

    1989-01-01

    Transcription of ribosomal RNA genes is generally accepted to correlate with cell growth. Using primary cultures of adult bovine aortic endothelial (ABAE) cells, we have shown that transcription of rDNA in confluent cells falls to 5% of the transcription level in growing cells. Protein kinase NII appears to be a limiting factor to promote rDNA transcription in isolated nuclei of confluent cells. Protein kinase NII was detected by immunocytochemistry in the cytoplasm, nuclei and nucleoli of growing cells while it was no longer present in nucleoli of confluent cells. The kinase activity, in isolated nuclei, was estimated by endogenous phosphorylation of a specific substrate, nucleolin. A 10% residual activity was present in confluent cell nuclei compared to growing cell nuclei. Concomitantly, the transcription 'in vitro' of rDNA in the corresponding nuclei was also highly reduced (by 85%). Addition of exogenous protein kinase NII to confluent cell nuclei induced a strong increase in the phosphorylation of specific proteins including nucleolin. In parallel, the transcription of rDNA was increased by a factor of 5, to nearly the level observed in nuclei prepared from growing cells. These data suggest that, in confluent cells, factors necessary for rDNA transcription machinery are present but inactive in the nucleolus and that the phosphorylation of one or several of these factors (nucleolin, topoisomerase I,...) by protein kinase NII is a key event in the regulation of rDNA transcription. Images PMID:2780290

  7. Physical studies of 5S RNA variants at position 66.

    PubMed Central

    Zhang, P; Popieniek, P; Moore, P B

    1989-01-01

    Two variants of the 5S RNA of E. coli have been examined by imino proton NMR spectroscopy, one of them a deletion of A66 (Christiansen, J., Douthwaite, S.R., Christensen, A. and Garrett, R.A. (1985) EMBO J. 4, 1019-1024) and the other a replacement of A66 with a C (Goringer, H.U. and Wagner, R. (1986) Biol. Chem. Hoppe-Seyler 367, 769-780). Both are of interest because the role the bulged A in helix II of 5S RNA is supposed to play in interactions with ribosomal protein L18. The data show that the structural perturbations that result from these mutations are minimal, and assign the resonances of some of the imino protons around position 66. Some mutations at or near position 66 greatly reduce the L18-dependent increase in the circular dichroism of 5S RNA at 267 nm first observed by Bear and coworkers (Bear, D.G., Schleich, T., Noller, H.F. and Garrett, R.A. (1977) Nucl. Acids Res. 4, 2511-2526). PMID:2479908

  8. Mutations of short tandem repeat loci in cases of paternity testing in Chinese.

    PubMed

    Sun, Mao; Zhang, XiaoNan; Wu, Dan; Shen, Qi; Wu, YuanMing; Fu, ShanMin

    2016-09-01

    In order to find out the characteristics of genetic mutations in 15 short tandem repeat (STR) loci, 3734 parentage cases were analyzed using AmpFlSTR Sinofiler kit. The allele source, mutation rate, and mutation rule of the STR loci were determined. Seventy mutations were observed in all cases for paternity testing. Among 15 STR loci, the highest mutation rate was observed in D12S391 (0.21 %), but the D5S818 gene mutation rate was relatively low (0.02 %). One-step mutation cases accounted for 95.7 % of all of the cases monitored. And the mutations in this study mainly showed paternal mutation (64/70). The research results are of great significance for identification and paternity tests and for the improvement of genetic studies on Chinese population in the future. PMID:26223683

  9. Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization.

    PubMed

    Dingman, Douglas W

    2012-07-01

    Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions. PMID:22510214

  10. Contrasting Patterns of rDNA Homogenization within the Zygosaccharomyces rouxii Species Complex

    PubMed Central

    Chand Dakal, Tikam; Giudici, Paolo; Solieri, Lisa

    2016-01-01

    Arrays of repetitive ribosomal DNA (rDNA) sequences are generally expected to evolve as a coherent family, where repeats within such a family are more similar to each other than to orthologs in related species. The continuous homogenization of repeats within individual genomes is a recombination process termed concerted evolution. Here, we investigated the extent and the direction of concerted evolution in 43 yeast strains of the Zygosaccharomyces rouxii species complex (Z. rouxii, Z. sapae, Z. mellis), by analyzing two portions of the 35S rDNA cistron, namely the D1/D2 domains at the 5’ end of the 26S rRNA gene and the segment including the internal transcribed spacers (ITS) 1 and 2 (ITS regions). We demonstrate that intra-genomic rDNA sequence variation is unusually frequent in this clade and that rDNA arrays in single genomes consist of an intermixing of Z. rouxii, Z. sapae and Z. mellis-like sequences, putatively evolved by reticulate evolutionary events that involved repeated hybridization between lineages. The levels and distribution of sequence polymorphisms vary across rDNA repeats in different individuals, reflecting four patterns of rDNA evolution: I) rDNA repeats that are homogeneous within a genome but are chimeras derived from two parental lineages via recombination: Z. rouxii in the ITS region and Z. sapae in the D1/D2 region; II) intra-genomic rDNA repeats that retain polymorphisms only in ITS regions; III) rDNA repeats that vary only in their D1/D2 domains; IV) heterogeneous rDNA arrays that have both polymorphic ITS and D1/D2 regions. We argue that an ongoing process of homogenization following allodiplodization or incomplete lineage sorting gave rise to divergent evolutionary trajectories in different strains, depending upon temporal, structural and functional constraints. We discuss the consequences of these findings for Zygosaccharomyces species delineation and, more in general, for yeast barcoding. PMID:27501051

  11. Ten microsatellite loci from Zamia integrifolia (Zamiaceae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ten microsatellite loci isolated from Zamia integrifolia are described. All 10 are polymorphic, with three to ten alleles across 36 members of a single population from South Florida. Heterozygosity ranged from 0.067 to 1. Two loci depart significantly from Hardy Weinberg Equilibrium, and exhibit het...

  12. Molecular phylogeny and barcoding of Caulerpa (Bryopsidales) based on the tufA, rbcL, 18S rDNA and ITS rDNA genes.

    PubMed

    Kazi, Mudassar Anisoddin; Reddy, C R K; Jha, Bhavanath

    2013-01-01

    The biodiversity assessment of different taxa of the genus Caulerpa is of interest from the context of morphological plasticity, invasive potential of some species and biotechnological and pharmacological applications. The present study investigated the identification and molecular phylogeny of different species of Caulerpa occurring along the Indian coast inferred from tufA, rbcL, 18S rDNA and ITS rDNA nucleotide sequences. Molecular data confirmed the identification of 10 distinct Caulerpa species: C. veravalensis, C. verticillata, C. racemosa, C. microphysa, C. taxifolia, C. sertularioides, C. scalpelliformis, C. serrulata, C. peltata and C. mexicana. All datasets significantly supported the sister relationship between C. veravalensis and C. racemosa var. cylindracea. It was also concluded from the results that the specimen identified previously as C. microphysa and C. lentillifera could not be considered as separate species. The molecular data revealed the presence of multiple lineages for C. racemosa which can be resolved into separate species. All four markers were used to ascertain their utility for DNA barcoding. The tufA gene proved a better marker with monophyletic association as the main criteria for identification at the species level. The results also support the use of 18S rDNA insertion sequences to delineate the Caulerpa species through character-based barcoding. The ITS rDNA (5.8S-ITS2) phylogenetic analysis also served as another supporting tool. Further, more sequences from additional Caulerpa specimens will need to be analysed in order to support the role of these two markers (ITS rDNA and 18S insertion sequence) in identification of Caulerpa species. The present study revealed the phylogeny of Caulerpa as complete as possible using the currently available data, which is the first comprehensive report illustrating the molecular phylogeny and barcoding of the genus Caulerpa from Indian waters. PMID:24340028

  13. Molecular Phylogeny and Barcoding of Caulerpa (Bryopsidales) Based on the tufA, rbcL, 18S rDNA and ITS rDNA Genes

    PubMed Central

    Kazi, Mudassar Anisoddin; Reddy, C. R. K.; Jha, Bhavanath

    2013-01-01

    The biodiversity assessment of different taxa of the genus Caulerpa is of interest from the context of morphological plasticity, invasive potential of some species and biotechnological and pharmacological applications. The present study investigated the identification and molecular phylogeny of different species of Caulerpa occurring along the Indian coast inferred from tufA, rbcL, 18S rDNA and ITS rDNA nucleotide sequences. Molecular data confirmed the identification of 10 distinct Caulerpa species: C. veravalensis, C. verticillata, C. racemosa, C. microphysa, C. taxifolia, C. sertularioides, C. scalpelliformis, C. serrulata, C. peltata and C. mexicana. All datasets significantly supported the sister relationship between C. veravalensis and C. racemosa var. cylindracea. It was also concluded from the results that the specimen identified previously as C. microphysa and C. lentillifera could not be considered as separate species. The molecular data revealed the presence of multiple lineages for C. racemosa which can be resolved into separate species. All four markers were used to ascertain their utility for DNA barcoding. The tufA gene proved a better marker with monophyletic association as the main criteria for identification at the species level. The results also support the use of 18S rDNA insertion sequences to delineate the Caulerpa species through character-based barcoding. The ITS rDNA (5.8S-ITS2) phylogenetic analysis also served as another supporting tool. Further, more sequences from additional Caulerpa specimens will need to be analysed in order to support the role of these two markers (ITS rDNA and 18S insertion sequence) in identification of Caulerpa species. The present study revealed the phylogeny of Caulerpa as complete as possible using the currently available data, which is the first comprehensive report illustrating the molecular phylogeny and barcoding of the genus Caulerpa from Indian waters. PMID:24340028

  14. Copy Number of the Transposon, Pokey, in rDNA Is Positively Correlated with rDNA Copy Number in Daphnia obtusa

    PubMed Central

    LeRiche, Kaitlynn; Eagle, Shannon H. C.; Crease, Teresa J.

    2014-01-01

    Pokey is a class II DNA transposon that inserts into 28S ribosomal RNA (rRNA) genes and other genomic regions of species in the subgenus, Daphnia. Two divergent lineages, PokeyA and PokeyB have been identified. Recombination between misaligned rRNA genes changes their number and the number of Pokey elements. We used quantitative PCR (qPCR) to estimate rRNA gene and Pokey number in isolates from natural populations of Daphnia obtusa, and in clonally-propagated mutation accumulation lines (MAL) initiated from a single D. obtusa female. The change in direction and magnitude of Pokey and rRNA gene number did not show a consistent pattern across ∼87 generations in the MAL; however, Pokey and rRNA gene number changed in concert. PokeyA and 28S gene number were positively correlated in the isolates from both natural populations and the MAL. PokeyB number was much lower than PokeyA in both MAL and natural population isolates, and showed no correlation with 28S gene number. Preliminary analysis did not detect PokeyB outside rDNA in any isolates and detected only 0 to 4 copies of PokeyA outside rDNA indicating that Pokey may be primarily an rDNA element in D. obtusa. The recombination rate in this species is high and the average size of the rDNA locus is about twice as large as that in other Daphnia species such as D. pulicaria and D. pulex, which may have facilitated expansion of PokeyA to much higher numbers in D. obtusa rDNA than these other species. PMID:25490398

  15. Copy number of the transposon, Pokey, in rDNA is positively correlated with rDNA copy number in Daphnia obtuse [corrected].

    PubMed

    LeRiche, Kaitlynn; Eagle, Shannon H C; Crease, Teresa J

    2014-01-01

    Pokey is a class II DNA transposon that inserts into 28S ribosomal RNA (rRNA) genes and other genomic regions of species in the subgenus, Daphnia. Two divergent lineages, PokeyA and PokeyB have been identified. Recombination between misaligned rRNA genes changes their number and the number of Pokey elements. We used quantitative PCR (qPCR) to estimate rRNA gene and Pokey number in isolates from natural populations of Daphnia obtusa, and in clonally-propagated mutation accumulation lines (MAL) initiated from a single D. obtusa female. The change in direction and magnitude of Pokey and rRNA gene number did not show a consistent pattern across ∼ 87 generations in the MAL; however, Pokey and rRNA gene number changed in concert. PokeyA and 28S gene number were positively correlated in the isolates from both natural populations and the MAL. PokeyB number was much lower than PokeyA in both MAL and natural population isolates, and showed no correlation with 28S gene number. Preliminary analysis did not detect PokeyB outside rDNA in any isolates and detected only 0 to 4 copies of PokeyA outside rDNA indicating that Pokey may be primarily an rDNA element in D. obtusa. The recombination rate in this species is high and the average size of the rDNA locus is about twice as large as that in other Daphnia species such as D. pulicaria and D. pulex, which may have facilitated expansion of PokeyA to much higher numbers in D. obtusa rDNA than these other species. PMID:25490398

  16. Assessment of four DNA fragments (COI, 16S rDNA, ITS2, 12S rDNA) for species identification of the Ixodida (Acari: Ixodida)

    PubMed Central

    2014-01-01

    Background The 5’ region of cytochrome oxidase I (COI) is the standard marker for DNA barcoding. However, COI has proved to be of limited use in identifying some species, and for some taxa, the coding sequence is not efficiently amplified by PCR. These deficiencies lead to uncertainty as to whether COI is the most suitable barcoding fragment for species identification of ticks. Methods In this study, we directly compared the relative effectiveness of COI, 16S ribosomal DNA (rDNA), nuclear ribosomal internal transcribed spacer 2 (ITS2) and 12S rDNA for tick species identification. A total of 307 sequences from 84 specimens representing eight tick species were acquired by PCR. Besides the 1,834 published sequences of 189 tick species from GenBank and the Barcode of Life Database, 430 unpublished sequences representing 59 tick species were also successfully screened by Bayesian analyses. Thereafter, the performance of the four DNA markers to identify tick species was evaluated by identification success rates given by these markers using nearest neighbour (NN), BLASTn, liberal tree-based or liberal tree-based (+threshold) methods. Results Genetic divergence analyses showed that the intra-specific divergence of each marker was much lower than the inter-specific divergence. Our results indicated that the rates of correct sequence identification for all four markers (COI, 16S rDNA, ITS2, 12S rDNA) were very high (> 96%) when using the NN methodology. We also found that COI was not significantly better than the other markers in terms of its rate of correct sequence identification. Overall, BLASTn and NN methods produced higher rates of correct species identification than that produced by the liberal tree-based methods (+threshold or otherwise). Conclusions As the standard DNA barcode, COI should be the first choice for tick species identification, while 16S rDNA, ITS2, and 12S rDNA could be used when COI does not produce reliable results. Besides, NN and BLASTn are

  17. Phylogeny and genetic diversity of Bridgeoporus nobilissimus inferred using mitochondrial and nuclear rDNA sequences

    USGS Publications Warehouse

    Redberg, G.L.; Hibbett, D.S.; Ammirati, J.F., Jr.; Rodriguez, R.J.

    2003-01-01

    The genetic diversity and phylogeny of Bridgeoporus nobilissimus have been analyzed. DNA was extracted from spores collected from individual fruiting bodies representing six geographically distinct populations in Oregon and Washington. Spore samples collected contained low levels of bacteria, yeast and a filamentous fungal species. Using taxon-specific PCR primers, it was possible to discriminate among rDNA from bacteria, yeast, a filamentous associate and B. nobilissimus. Nuclear rDNA internal transcribed spacer (ITS) region sequences of B. nobilissimus were compared among individuals representing six populations and were found to have less than 2% variation. These sequences also were used to design dual and nested PCR primers for B. nobilissimus-specific amplification. Mitochondrial small-subunit rDNA sequences were used in a phylogenetic analysis that placed B. nobilissimus in the hymenochaetoid clade, where it was associated with Oxyporus and Schizopora.

  18. Five Hundred Microsatellite Loci for Peromyscus

    PubMed Central

    WEBER, JESSE N.; PETERS, MAUREEN B; TSYUSKO, OLGA V.; LINNEN, CATHERINE R.; HAGEN, CRIS; SCHABLE, NANCY A.; TUBERVILLE, TRACEY D.; MCKEE, ANNA M.; LANCE, STACEY L.; JONES, KENNETH L.; FISHER, HEIDI S.; DEWEY, MICHAEL J.; HOEKSTRA, HOPI E.; GLENN, TRAVIS C.

    2009-01-01

    Mice of the genus Peromyscus, including several endangered subspecies, occur throughout North America and have been important models for conservation research. We describe 526 primer pairs that amplify microsatellite DNA loci for P. maniculatus bairdii, 467 of which also amplify in P. polionotus subgriseus. For 12 of these loci, we report diversity data from a natural population. These markers will be an important resource for future genomic studies of Peromyscus evolution and mammalian conservation. PMID:20563244

  19. Haplotype Detection from Next-Generation Sequencing in High-Ploidy-Level Species: 45S rDNA Gene Copies in the Hexaploid Spartina maritima

    PubMed Central

    Boutte, Julien; Aliaga, Benoît; Lima, Oscar; Ferreira de Carvalho, Julie; Ainouche, Abdelkader; Macas, Jiri; Rousseau-Gueutin, Mathieu; Coriton, Olivier; Ainouche, Malika; Salmon, Armel

    2015-01-01

    Gene and whole-genome duplications are widespread in plant nuclear genomes, resulting in sequence heterogeneity. Identification of duplicated genes may be particularly challenging in highly redundant genomes, especially when there are no diploid parents as a reference. Here, we developed a pipeline to detect the different copies in the ribosomal RNA gene family in the hexaploid grass Spartina maritima from next-generation sequencing (Roche-454) reads. The heterogeneity of the different domains of the highly repeated 45S unit was explored by identifying single nucleotide polymorphisms (SNPs) and assembling reads based on shared polymorphisms. SNPs were validated using comparisons with Illumina sequence data sets and by cloning and Sanger (re)sequencing. Using this approach, 29 validated polymorphisms and 11 validated haplotypes were reported (out of 34 and 20, respectively, that were initially predicted by our program). The rDNA domains of S. maritima have similar lengths as those found in other Poaceae, apart from the 5′-ETS, which is approximately two-times longer in S. maritima. Sequence homogeneity was encountered in coding regions and both internal transcribed spacers (ITS), whereas high intragenomic variability was detected in the intergenic spacer (IGS) and the external transcribed spacer (ETS). Molecular cytogenetic analysis by fluorescent in situ hybridization (FISH) revealed the presence of one pair of 45S rDNA signals on the chromosomes of S. maritima instead of three expected pairs for a hexaploid genome, indicating loss of duplicated homeologous loci through the diploidization process. The procedure developed here may be used at any ploidy level and using different sequencing technologies. PMID:26530424

  20. Loci-STREAM Version 0.9

    NASA Technical Reports Server (NTRS)

    Wright, Jeffrey; Thakur, Siddharth

    2006-01-01

    Loci-STREAM is an evolving computational fluid dynamics (CFD) software tool for simulating possibly chemically reacting, possibly unsteady flows in diverse settings, including rocket engines, turbomachines, oil refineries, etc. Loci-STREAM implements a pressure- based flow-solving algorithm that utilizes unstructured grids. (The benefit of low memory usage by pressure-based algorithms is well recognized by experts in the field.) The algorithm is robust for flows at all speeds from zero to hypersonic. The flexibility of arbitrary polyhedral grids enables accurate, efficient simulation of flows in complex geometries, including those of plume-impingement problems. The present version - Loci-STREAM version 0.9 - includes an interface with the Portable, Extensible Toolkit for Scientific Computation (PETSc) library for access to enhanced linear-equation-solving programs therein that accelerate convergence toward a solution. The name "Loci" reflects the creation of this software within the Loci computational framework, which was developed at Mississippi State University for the primary purpose of simplifying the writing of complex multidisciplinary application programs to run in distributed-memory computing environments including clusters of personal computers. Loci has been designed to relieve application programmers of the details of programming for distributed-memory computers.

  1. Differentiation of anaerobic polycentric fungi by rDNA PCR-RFLP.

    PubMed

    Fliegerová, K; Mrázek, J; Voigt, K

    2006-01-01

    The suitability of restriction fragment length polymorphism (RFLP) analysis of the ribosomal DNA cluster for discriminating two genera of anaerobic polycentric fungi, Orpinomyces and Anaeromyces, was determined. Three PCR-amplified DNA fragments--nuclear small subunit (SSU; 18S rDNA), the nuclear large subunit (LSU; 28S rDNA) and internal transcribed spacer (ITS)--were restricted with endonucleases AluI, DraI, HinfI and MboI. Although the SSU DNA fragment could be restricted successfully by all four enzymes, no differences were observed between restriction patterns of Orpinomyces and Anaeromyces. The most polymorphic restriction pattern between Orpinomyces and Anaeromyces resulted from cleavage of LSU rDNA fragments cut by AluI and HinfI and ITS fragment cut by DraI and HinfI. Genus-specific RFLP patterns were determined for Orpinomyces and Anaeromyces genera; the results showed that the PCR-RFLP analysis of rDNA offers an easy and rapid tool for differentiation of two polycentric genera of anaerobic fungi, which could be hardly separated on the basis of morphology. PMID:17007423

  2. Phylogenetic relationships of land plants using mitochondrial small-subunit rDNA sequences.

    PubMed

    Duff, R J; Nickrent, D L

    1999-03-01

    Phylogenetic relationships among embryophytes (tracheophytes, mosses, liverworts, and hornworts) were examined using 21 newly generated mitochondrial small-subunit (19S) rDNA sequences. The "core" 19S rDNA contained more phylogenetically informative sites and lower homoplasy than either nuclear 18S or plastid 16S rDNA. Results of phylogenetic analyses using parsimony (MP) and likelihood (ML) were generally congruent. Using MP, two trees were obtained that resolved either liverworts or hornworts as the basal land plant clade. The optimal ML tree showed hornworts as basal. That topology was not statistically different from the two MP trees, thus both appear to be equally viable evolutionary hypotheses. High bootstrap support was obtained for the majority of higher level embryophyte clades named in a recent morphologically based classification, e.g., Tracheophyta, Euphyllophytina, Lycophytina, and Spermatophytata. Strong support was also obtained for the following monophyletic groups: hornworts, liverworts, mosses, lycopsids, leptosporangiate and eusporangiate ferns, gymnosperms and angiosperms. This molecular analysis supported a sister relationship between Equisetum and leptosporangiate ferns and a monophyletic gymnosperms sister to angiosperms. The topologies of deeper clades were affected by taxon inclusion (particularly hornworts) as demonstrated by jackknife analyses. This study represents the first use of mitochondrial 19S rDNA for phylogenetic purposes and it appears well-suited for examining intermediate to deep evolutionary relationships among embryophytes. PMID:10077500

  3. Top2 and Sgs1-Top3 Act Redundantly to Ensure rDNA Replication Termination

    PubMed Central

    Fredsøe, Jacob; Nielsen, Ida; Pedersen, Jakob Madsen; Bentsen, Iben Bach; Lisby, Michael; Bjergbaek, Lotte; Andersen, Anni H

    2015-01-01

    Faithful DNA replication with correct termination is essential for genome stability and transmission of genetic information. Here we have investigated the potential roles of Topoisomerase II (Top2) and the RecQ helicase Sgs1 during late stages of replication. We find that cells lacking Top2 and Sgs1 (or Top3) display two different characteristics during late S/G2 phase, checkpoint activation and accumulation of asymmetric X-structures, which are both independent of homologous recombination. Our data demonstrate that checkpoint activation is caused by a DNA structure formed at the strongest rDNA replication fork barrier (RFB) during replication termination, and consistently, checkpoint activation is dependent on the RFB binding protein, Fob1. In contrast, asymmetric X-structures are formed independent of Fob1 at less strong rDNA replication fork barriers. However, both checkpoint activation and formation of asymmetric X-structures are sensitive to conditions, which facilitate fork merging and progression of replication forks through replication fork barriers. Our data are consistent with a redundant role of Top2 and Sgs1 together with Top3 (Sgs1-Top3) in replication fork merging at rDNA barriers. At RFB either Top2 or Sgs1-Top3 is essential to prevent formation of a checkpoint activating DNA structure during termination, but at less strong rDNA barriers absence of the enzymes merely delays replication fork merging, causing an accumulation of asymmetric termination structures, which are solved over time. PMID:26630413

  4. Molecular rDNA phylogeny of Telotylenchidae Siddiqi, 1960 and evaluation of tail termini

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Three stunt nematode species, Tylenchorhynchus leviterminalis, T. claytoni and Bitylenchus dubius were characterized with segments of small subunit 18S and large subunit 28S rDNA sequences and placed in molecular phylogenetic context with other taxa of Telotylechidae in GenBank. In 18S trees, the sp...

  5. Relationships between rDNA, Nop1 and Sir complex in biotechnologically relevant distillery yeasts.

    PubMed

    Adamczyk, Jagoda; Deregowska, Anna; Potocki, Leszek; Kuna, Ewelina; Kaplan, Jakub; Pabian, Sylwia; Kwiatkowska, Aleksandra; Lewinska, Anna; Wnuk, Maciej

    2016-09-01

    Distillery yeasts are poorly characterized physiological group among the Saccharomyces sensu stricto complex. As industrial yeasts are under constant environmental stress during fermentation processes and the nucleolus is a stress sensor, in the present study, nucleolus-related parameters were evaluated in 22 commercially available distillery yeast strains. Distillery yeasts were found to be a heterogeneous group with a variable content and length of rDNA and degree of nucleolus fragmentation. The levels of rDNA were negatively correlated with Nop1 (r = -0.59, p = 0.0038). Moreover, the protein levels of Sir transcriptional silencing complex and longevity regulators, namely Sir1, Sir2, Sir3 and Fob1, were studied and negative correlations between Sir2 and Nop1 (r = -0.45, p = 0.0332), and between Sir2 and Fob1 (r = -0.49, p = 0.0211) were revealed. In general, S. paradoxus group of distillery yeasts with higher rDNA pools and Sir2 level than S. bayanus group was found to be more tolerant to fermentation-associated stress stimuli, namely mild cold/heat stresses and KCl treatment. We postulate that rDNA state may be considered as a novel factor that may modulate a biotechnological process. PMID:27329282

  6. Aberrant DNA Methylation of rDNA and PRIMA1 in Borderline Personality Disorder.

    PubMed

    Teschler, Stefanie; Gotthardt, Julia; Dammann, Gerhard; Dammann, Reinhard H

    2016-01-01

    Borderline personality disorder (BPD) is a serious psychic disease with a high risk for suicide. DNA methylation is a hallmark for aberrant epigenetic regulation and could be involved in the etiology of BPD. Previously, it has been reported that increased DNA methylation of neuropsychiatric genes is found in the blood of patients with BPD compared to healthy controls. Here, we analyzed DNA methylation patterns of the ribosomal RNA gene (rDNA promoter region and 5'-external transcribed spacer/5'ETS) and the promoter of the proline rich membrane anchor 1 gene (PRIMA1) in peripheral blood samples of 24 female patients (mean age (33 ± 11) years) diagnosed with DSM-IV BPD and in 11 female controls (mean age (32 ± 7) years). A significant aberrant methylation of rDNA and PRIMA1 was revealed for BPD patients using pyrosequencing. For the promoter of PRIMA1, the average methylation of six CpG sites was 1.6-fold higher in BPD patients compared to controls. In contrast, the methylation levels of the rDNA promoter region and the 5'ETS were significantly lower (0.9-fold) in patients with BPD compared to controls. Thus, for nine CpGs located in the rDNA promoter region and for four CpGs at the 5'ETS decreased methylation was found in peripheral blood of patients compared to controls. Our results suggest that aberrant methylation of rDNA and PRIMA1 is associated with the pathogenesis of BPD. PMID:26742039

  7. Aberrant DNA Methylation of rDNA and PRIMA1 in Borderline Personality Disorder

    PubMed Central

    Teschler, Stefanie; Gotthardt, Julia; Dammann, Gerhard; Dammann, Reinhard H.

    2016-01-01

    Borderline personality disorder (BPD) is a serious psychic disease with a high risk for suicide. DNA methylation is a hallmark for aberrant epigenetic regulation and could be involved in the etiology of BPD. Previously, it has been reported that increased DNA methylation of neuropsychiatric genes is found in the blood of patients with BPD compared to healthy controls. Here, we analyzed DNA methylation patterns of the ribosomal RNA gene (rDNA promoter region and 5′-external transcribed spacer/5′ETS) and the promoter of the proline rich membrane anchor 1 gene (PRIMA1) in peripheral blood samples of 24 female patients (mean age (33 ± 11) years) diagnosed with DSM-IV BPD and in 11 female controls (mean age (32 ± 7) years). A significant aberrant methylation of rDNA and PRIMA1 was revealed for BPD patients using pyrosequencing. For the promoter of PRIMA1, the average methylation of six CpG sites was 1.6-fold higher in BPD patients compared to controls. In contrast, the methylation levels of the rDNA promoter region and the 5′ETS were significantly lower (0.9-fold) in patients with BPD compared to controls. Thus, for nine CpGs located in the rDNA promoter region and for four CpGs at the 5′ETS decreased methylation was found in peripheral blood of patients compared to controls. Our results suggest that aberrant methylation of rDNA and PRIMA1 is associated with the pathogenesis of BPD. PMID:26742039

  8. Natural and Sexual Selection on Many Loci

    PubMed Central

    Barton, N. H.; Turelli, M.

    1991-01-01

    A method is developed that describes the effects on an arbitrary number of autosomal loci of selection on haploid and diploid stages, of nonrandom mating between haploid individuals, and of recombination. We provide exact recursions for the dynamics of allele frequencies and linkage disequilibria (nonrandom associations of alleles across loci). When selection is weak relative to recombination, our recursions provide simple approximations for the linkage disequilibria among arbitrary combinations of loci. We show how previous models of sex-independent natural selection on diploids, assortative mating between haploids, and sexual selection on haploids can be analyzed in this framework. Using our weak-selection approximations, we derive new results concerning the coevolution of male traits and female preferences under natural and sexual selection. In particular, we provide general expressions for the intensity of linkage-disequilibrium induced selection experienced by loci that contribute to female preferences for specific male traits. Our general results support the previous observation that these indirect selection forces are so weak that they are unlikely to dominate the evolution of preference-producing loci. PMID:2016044

  9. GWAS identifies four novel eosinophilic esophagitis loci

    PubMed Central

    Sleiman, Patrick MA; Wang, Mei-Lun; Cianferoni, Antonella; Aceves, Seema; Gonsalves, Nirmala; Nadeau, Kari; Bredenoord, Albert J.; Furuta, Glenn T.; Spergel, Jonathan M.; Hakonarson, Hakon

    2014-01-01

    Eosinophilic esophagitis (EoE) is an allergic disorder characterized by infiltration of the esophagus with eosinophils. We had previously reported association of the TSLP/WDR36 locus with EoE. Here we report genome-wide significant associations at four additional loci; c11orf30 and STAT6, which have been previously associated with both atopic and autoimmune disease, and two EoE-specific loci, ANKRD27 that regulates the trafficking of melanogenic enzymes to epidermal melanocytes and CAPN14, that encodes a calpain whose expression is highly enriched in the esophagus. The identification of five EoE loci, not only expands our etiological understanding of the disease but may also represent new therapeutic targets to treat the most debilitating aspect of EoE, esophageal inflammation and remodeling. PMID:25407941

  10. rDNA genetic imbalance and nucleolar chromatin restructuring is induced by distant hybridization between Raphanus sativus and Brassica alboglabra.

    PubMed

    Long, Hong; Chen, Chunli; Wang, Bing; Feng, Yanni

    2015-01-01

    The expression of rDNA in hybrids inherited from only one progenitor refers to nucleolar dominance. The molecular basis for choosing which genes to silence remains unclear. We report genetic imbalance induced by distant hybridization correlates with formation of rDNA genes (NORs) in the hybrids between Raphanus sativus L. and Brassica alboglabra Bailey. Moreover, increased CCGG methylation of rDNA in F1 hybrids is concomitant with Raphanus-derived rDNA gene silencing and rDNA transcriptional inactivity revealed by nucleolar configuration restriction. Newly formed rDNA gene locus occurred through chromosomal in F1 hybrids via chromosomal imbalance. NORs are gained de novo, lost, and/or transposed in the new genome. Inhibition of methyltransferases leads to changes in nucleolar architecture, implicating a key role of methylation in control of nucleolar dominance and vital nucleolar configuration transition. Our findings suggest that gene imbalance and methylation-related chromatin restructuring is important for rDNA gene silencing that may be crucial for synthesis of specific proteins. PMID:25723542

  11. RNA Polymerase I and Fob1 contributions to transcriptional silencing at the yeast rDNA locus.

    PubMed

    Buck, Stephen W; Maqani, Nazif; Matecic, Mirela; Hontz, Robert D; Fine, Ryan D; Li, Mingguang; Smith, Jeffrey S

    2016-07-27

    RNA polymerase II (Pol II)-transcribed genes embedded within the yeast rDNA locus are repressed through a Sir2-dependent process called 'rDNA silencing'. Sir2 is recruited to the rDNA promoter through interactions with RNA polymerase I (Pol I), and to a pair of DNA replication fork block sites (Ter1 and Ter2) through interaction with Fob1. We utilized a reporter gene (mURA3) integrated adjacent to the leftmost rDNA gene to investigate localized Pol I and Fob1 functions in silencing. Silencing was attenuated by loss of Pol I subunits or insertion of an ectopic Pol I terminator within the adjacent rDNA gene. Silencing left of the rDNA array is naturally attenuated by the presence of only one intact Fob1 binding site (Ter2). Repair of the 2nd Fob1 binding site (Ter1) dramatically strengthens silencing such that it is no longer impacted by local Pol I transcription defects. Global loss of Pol I activity, however, negatively affects Fob1 association with the rDNA. Loss of Ter2 almost completely eliminates localized silencing, but is restored by artificially targeting Fob1 or Sir2 as Gal4 DNA binding domain fusions. We conclude that Fob1 and Pol I make independent contributions to establishment of silencing, though Pol I also reinforces Fob1-dependent silencing. PMID:27060141

  12. Homology-dependent repair is involved in 45S rDNA loss in plant CAF-1 mutants

    PubMed Central

    Muchová, Veronika; Amiard, Simon; Mozgová, Iva; Dvořáčková, Martina; Gallego, Maria E; White, Charles; Fajkus, Jiří

    2015-01-01

    Arabidopsis thaliana mutants in FAS1 and FAS2 subunits of chromatin assembly factor 1 (CAF1) show progressive loss of 45S rDNA copies and telomeres. We hypothesized that homology-dependent DNA damage repair (HDR) may contribute to the loss of these repeats in fas mutants. To test this, we generated double mutants by crossing fas mutants with knock-out mutants in RAD51B, one of the Rad51 paralogs of A. thaliana. Our results show that the absence of RAD51B decreases the rate of rDNA loss, confirming the implication of RAD51B-dependent recombination in rDNA loss in the CAF1 mutants. Interestingly, this effect is not observed for telomeric repeat loss, which thus differs from that acting in rDNA loss. Involvement of DNA damage repair in rDNA dynamics in fas mutants is further supported by accumulation of double-stranded breaks (measured as γ-H2AX foci) in 45S rDNA. Occurrence of the foci is not specific for S-phase, and is ATM-independent. While the foci in fas mutants occur both in the transcribed (intranucleolar) and non-transcribed (nucleoplasmic) fraction of rDNA, double fas rad51b mutants show a specific increase in the number of the intranucleolar foci. These results suggest that the repair of double-stranded breaks present in the transcribed rDNA region is RAD51B dependent and that this contributes to rDNA repeat loss in fas mutants, presumably via the single-stranded annealing recombination pathway. Our results also highlight the importance of proper chromatin assembly in the maintenance of genome stability. PMID:25359579

  13. When molecules support morphology: Phylogenetic reconstruction of the family Onuphidae (Eunicida, Annelida) based on 16S rDNA and 18S rDNA.

    PubMed

    Budaeva, Nataliya; Schepetov, Dmitry; Zanol, Joana; Neretina, Tatiana; Willassen, Endre

    2016-01-01

    Onuphid polychaetes are tubicolous marine worms commonly reported worldwide from intertidal areas to hadal depths. They often dominate in benthic communities and have economic importance in aquaculture and recreational fishing. Here we report the phylogeny of the family Onuphidae based on the combined analyses of nuclear (18S rDNA) and mitochondrial (16S rDNA) genes. Results of Bayesian and Maximum Likelihood analyses supported the monophyly of Onuphidae and its traditional subdivision into two monophyletic subfamilies: Onuphinae and Hyalinoeciinae. Ten of 22 recognized genera were monophyletic with strong node support; four more genera included in this study were either monotypic or represented by a single species. None of the genera appeared para- or polyphyletic and this indicates a strong congruence between the traditional morphology-based systematics of the family and the newly obtained molecular-based phylogenetic reconstructions. Intergeneric relationships within Hyalinoeciinae were not resolved. Two strongly supported monophyletic groups of genera were recovered within Onuphinae: ((Onuphis, Aponuphis), Diopatra, Paradiopatra) and (Hirsutonuphis, (Paxtonia, (Kinbergonuphis, Mooreonuphis))). A previously accepted hypothesis on the subdivision of Onuphinae into the Onuphis group of genera and the Diopatra group of genera was largely rejected. PMID:26497420

  14. Structural polymorphism in the major groove of a 5S RNA gene complements the zinc finger domains of transcription factor IIIA.

    PubMed Central

    Huber, P W; Morii, T; Mei, H Y; Barton, J K

    1991-01-01

    Metal complexes that bind to DNA on the basis of shape-selection have been used to map the conformational features of the DNA binding site for transcription factor IIIA. Conformationally distinct segments are detected on the 5S rRNA gene that correspond closely to the binding sites identified for the individual zinc finger domains of the protein. The local conformations are characterized by a major groove opened because of a change in base pair inclination and/or displacement at a central 5'-pyrimidine-purine-3' step, flanked by a widened minor groove, as would arise at the junctions between alternating B- and A-like DNA segments. Docking experiments with a consensus structure of a zinc finger reveal that the mixed A-B binding site accommodates the peptide domain better than either canonical B- or A-DNA helices. The close structural matching of the conformational variations in the 5S rDNA both to the proposed sites of zinc finger binding and to the shape of an individual zinc finger domain points to DNA structural polymorphism as providing an important determinant in recognition. In particular, shape selection in the 5' half of the internal control region may orient the multiple finger domains. Images PMID:1961749

  15. The use of 16S and 16S-23S rDNA to easily detect and differentiate common Gram-negative orchard epiphytes.

    PubMed

    Jeng, R S; Svircev, A M; Myers, A L; Beliaeva, L; Hunter, D M; Hubbes, M

    2001-02-01

    The identification of Gram-negative pathogenic and non-pathogenic bacteria commonly isolated from an orchard phylloplane may result in a time consuming and tedious process for the plant pathologist. The paper provides a simple "one-step" protocol that uses the polymerase chain reaction (PCR) to amplify intergenic spacer regions between 16S and 23S genes and a portion of 16S gene in the prokaryotic rRNA genetic loci. Amplified 16S rDNA, and restriction fragment length polymorphisms (RFLP) following EcoRI digestion produced band patterns that readily distinguished between the plant pathogen Erwinia amylovora (causal agent of fire blight in pear and apple) and the orchard epiphyte Pantoea agglomerans (formerly E. herbicola). The amplified DNA patterns of 16S-23S spacer regions may be used to differentiate E. amylovora at the intraspecies level. Isolates of E. amylovora obtained from raspberries exhibited two major fragments while those obtained from apples showed three distinct amplified DNA bands. In addition, the size of the 16S-23S spacer region differs between Pseudomonas syringae and Pseudomonas fluorescens. The RFLP pattern generated by HaeIII digestion may be used to provide a rapid and accurate identification of these two common orchard epiphytes. PMID:11166101

  16. D5S351 and D5S1414 located at the spinal muscular atrophy critical region represent novel informative markers in the Iranian population

    PubMed Central

    Sedghi, Maryam; Vallian, Sadeq

    2015-01-01

    Spinal muscular atrophy (SMA) is a degenerative neuromuscular disease associated with progressive symmetric weakness and atrophy of the limb muscles. In view of the involvement of numerous point mutations and deletions associated with the disease, the application of polymorphic markers flanking the SMA critical region could be valuable in molecular diagnosis of the disease. In the present study, D5S351 and D5S1414 polymorphic markers located at the SMA critical region in the Iranian populations were characterized. Genotyping of the markers indicated the presence of six and nine different alleles for D5S351 and D5S1414, respectively. Haplotype frequency estimation in 25 trios families and 75 unrelated individuals indicated the presence of six informative haplotypes with frequency higher than 0.05 in the studied population. Furthermore, the D′ coefficient and the χ2 value for D5S351 and D5S1414 markers revealed the presence of linkage disequilibrium between the two markers in the Iranians. These data suggested that D5S351 and D5S1414 could be suggested as informative markers for linkage analysis and molecular diagnosis of SMA in the Iranian population. PMID:26693404

  17. Assessment of Helminth Biodiversity in Wild Rats Using 18S rDNA Based Metagenomics

    PubMed Central

    Tsai, Isheng J.; Palomares-Rius, Juan Emilio; Yoshida, Ayako; Ogura, Yoshitoshi; Hayashi, Tetsuya; Maruyama, Haruhiko; Kikuchi, Taisei

    2014-01-01

    Parasite diversity has important implications in several research fields including ecology, evolutionary biology and epidemiology. Wide-ranging analysis has been restricted because of the difficult, highly specialised and time-consuming processes involved in parasite identification. In this study, we assessed parasite diversity in wild rats using 18S rDNA-based metagenomics. 18S rDNA PCR products were sequenced using an Illumina MiSeq sequencer and the analysis of the sequences using the QIIME software successfully classified them into several parasite groups. The comparison of the results with those obtained using standard methods including microscopic observation of helminth parasites in the rat intestines and PCR amplification/sequencing of 18S rDNA from isolated single worms suggests that this new technique is reliable and useful to investigate parasite diversity. PMID:25340824

  18. Interpopulation hybridization generates meiotically stable rDNA epigenetic variants in allotetraploid Tragopogon mirus.

    PubMed

    Matyášek, Roman; Dobešová, Eva; Húska, Dalibor; Ježková, Ivana; Soltis, Pamela S; Soltis, Douglas E; Kovařík, Aleš

    2016-02-01

    Uniparental silencing of 35S rRNA genes (rDNA), known as nucleolar dominance (ND), is common in interspecific hybrids. Allotetraploid Tragopogon mirus composed of Tragopogon dubius (d) and Tragopogon porrifolius (p) genomes shows highly variable ND. To examine the molecular basis of such variation, we studied the genetic and epigenetic features of rDNA homeologs in several lines derived from recently and independently formed natural populations. Inbred lines derived from T. mirus with a dominant d-rDNA homeolog transmitted this expression pattern over generations, which may explain why it is prevalent among natural populations. In contrast, lines derived from the p-rDNA dominant progenitor were meiotically unstable, frequently switching to co-dominance. Interpopulation crosses between progenitors displaying reciprocal ND resulted in d-rDNA dominance, indicating immediate suppression of p-homeologs in F1 hybrids. Original p-rDNA dominance was not restored in later generations, even in those segregants that inherited the corresponding parental rDNA genotype, thus indicating the generation of additional p-rDNA and d-rDNA epigenetic variants. Despite preserved intergenic spacer (IGS) structure, they showed altered cytosine methylation and chromatin condensation patterns, and a correlation between expression, hypomethylation of RNA Pol I promoters and chromatin decondensation was apparent. Reversion of such epigenetic variants occurred rarely, resulting in co-dominance maintained in individuals with distinct genotypes. Generally, interpopulation crosses may generate epialleles that are not present in natural populations, underlying epigenetic dynamics in young allopolyploids. We hypothesize that highly expressed variants with distinct IGS features may induce heritable epigenetic reprogramming of the partner rDNA arrays, harmonizing the expression of thousands of genes in allopolyploids. PMID:26711705

  19. Quantum speciation in Aegilops: Molecular cytogenetic evidence from rDNA cluster variability in natural populations

    PubMed Central

    Raskina, Olga; Belyayev, Alexander; Nevo, Eviatar

    2004-01-01

    Data are presented on quantum speciation in the Sitopsis section of the genus Aegilops (Poaceae, Monocotyledones). Two small, peripheral, isolated, wild populations of annual cross-pollinated Ae. speltoides and annual self-pollinated Ae. sharonensis are located 30 m apart on different soil types. Despite the close proximity of the two species and their close relatedness, no mixed groups are known. Comparative molecular cytogenetic analysis based on the intrapopulation variability of rRNA-encoding DNA (rDNA) chromosomal patterns of individual Ae. speltoides geno-types revealed an ongoing dynamic process of permanent chromosomal rearrangements. Chromosomal mutations can arise de novo and can be eliminated. Analysis of the progeny of the investigated genotypes testifies that inheritance of de novo rDNA sites happens frequently. Heterologous recombination and/or transposable elements-mediated rDNA transfer seem to be the mechanisms for observed chromosomal repatterning. Consequently, several modified genomic forms, intermediate between Ae. speltoides and Ae. sharonensis, permanently arise in the studied wild population of Ae. speltoides, which make it possible to recognize Ae. sharonensis as a derivative species of Ae. speltoides, as well as to propose rapidness and canalization of quantum speciation in Sitopsis species. PMID:15466712

  20. Phylogeny of the Eustigmatophyceae Based upon 18S rDNA, with Emphasis on Nannochloropsis.

    PubMed

    Andersen, R A; Brett, R W; Potter, D; Sexton, J P

    1998-02-01

    Complete 18S rDNA sequences were determined for 25 strains representing five genera of the Eustigmatophyceae, including re-examination of three strains with previously published sequences. Parsimony analysis of these and 44 published sequences for other heterokont chromophytes (unalignable sites removed) revealed that the Eustigmatophyceae were a monophyletic group. Analysis of eustigmatophyte taxa only (complete gene analyzed) supported the current familial classification scheme. Twenty one strains of Nannochloropsis were also examined using light microscopy. Gross morphology of cells was variable and overlapped among the strains; cell size was consistent within strains but sometimes varied considerably among strains of a species. The 18S rDNA of N. gaditana, N. oculata and N. salina was re-sequenced for strains used in previous publications and one or more nucleotide differences were found. Nucleotide sequences for Nannochloropsis species varied by up to 32 nucleotides. Identical sequences were found for six strains of N. salina, five strains of N. gadifana, four strains of N. granulata, and two strains of N. oculata, respectively. Four strains could not be assigned to described species and may represent two new species. The unique 18S rDNA sequences for each sibling species of Nannochloropsis demonstrates the presence of considerable genetic diversity despite the extremely simple morphology in this genus. PMID:23196114

  1. Molecular analysis of complete ssu to lsu rdna sequence in the harmful dinoflagellate alexandrium tamarense (korean isolate, HY970328M)

    NASA Astrophysics Data System (ADS)

    Ki, Jang-Seu; Han, Myung-Soo

    2005-09-01

    New PCR primers (N=18) were designed for the isolation of complete SSU to LSU rDNA sequences from the dinoflagellate Alexandrium tamarense. Standard PCR, employing each primer set selected for amplifications of less than 1.5 kb, successfully amplified the expected rDNA regions of A. tamarense (Korean isolate, HY970328M). Complete SSU, LSU rDNAs and ITS sequences, including 5.8S rDNA, were recorded at 1,800 bp, 520 bp and 3,393 bp, respectively. The LSU rDNA sequence was the first report in Alexandrium genus. No intron was found in the LSU rRNA coding region. Twelve D-domains within the LSU rDNA were put together into 1,879 bp (44.4% G+C), and cores into 1514 bp (42.8% G+C). The core sequence was significantly different (0.0867 of genetic distance, 91% sequence similarity) in comparison with Prorocentrum micans (GenBank access. no. X16108). The D2 region was the longest in length (300 bp) and highly variable among the 12 D-domains. In a phylogenetic analysis using complete LSU rDNA sequences of a variety of phytoplankton, A tamarense was clearly separated with high resolution against other species. The result suggests that the sequence may resolve the taxonomic ambiguities of Alexandrium genus, particularly of the tamarensis complex.

  2. Radiation-induced mutation at minisatellite loci

    SciTech Connect

    Dubrova, Y.E. |; Nesterov, V.N.; Krouchinsky, N.G.

    1997-10-01

    We are studying the radiation-induced increase of mutation rate in minisatellite loci in mice and humans. Minisatellite mutations were scored by multilocus DNA fingerprint analysis in the progeny of {gamma}-irradiated and non-irradiated mice. The frequency of mutation in offspring of irradiated males was 1.7 higher that in the control group. Germline mutation at human minisatellite loci was studied among children born in heavily polluted areas of the Mogilev district of Belarus after the Chernobyl accident and in a control population. The frequency of mutation assayed both by DNA fingerprinting and by eight single locus probes was found to be two times higher in the exposed families than in the control group. Furthermore, mutation rate was correlated with the parental radiation dose for chronic exposure {sup 137}Cs, consistent with radiation-induction of germline mutation. The potential use of minisatellites in monitoring germline mutation in humans will be discussed.

  3. Characterization of microsatellite loci isolated in trumpeter swan (Cygnus buccinator)

    USGS Publications Warehouse

    John, J. St; Ransler, F.A.; Quinn, T.W.; Oyler-McCance, S.J.

    2006-01-01

    Primers for 16 microsatellite loci were developed for the trumpeter swan (Cygnus buccinator), a species recovering from a recent population bottleneck. In a screen of 158 individuals, the 16 loci were found to have levels of variability ranging from two to seven alleles. No loci were found to be linked, although two loci repeatedly revealed significant departures from Hardy-Weinberg equilibrium. Amplification in the closely related tundra swan (Cygnus columbianus) was successful for all except one locus. These microsatellite loci will be applicable for population genetic analyses and ultimately aid in management efforts. ?? 2006 The Authors.

  4. [Genetic polymorphism of 9 STR loci in Chaoxian National Minority of China].

    PubMed

    Gao, Ya; Jin, Tian-bo; Lai, Jiang-hua; Chen, Teng; Zheng, Hai-bo; Zhu, Bo-feng; Hu, Song-nian; Wang, Jian; Li, Sheng-bin

    2002-11-01

    In order to enrich the Chinese genetic database,nine polymorphic loci of STR,such as D3S1358,vWA,FGA,TH01,TPOX,CSF1PO,D5S818,D13S317 and D7S820 were studied. Based on STR gene scan marked by fluorescence,91 unrelated Chinese Chaoxian individuals were observed.81 alleles and 196 genotypes were found. The corresponding gene frequency and genotype frequency were 0.0055-0.4615 and 0.0110-0.9890 respectively. The genogypes frequency of nine STR loci was good with the Hardy-Weinberg equilibrium (P approximately 0.05). The statistical analysis of nine STR loci showed the following: PIC (polymorphic information content) >or=0.6863, H (heterozygosity) >or=0.6919, DP (discrimination power) >or=0.8301, EPP (probability of paternity exclusion) >or=0.8590. The data studied can be used in Chinese population genetic studies and forensic medicine applications. PMID:15979957

  5. Population genetics of nine short tandem repeat loci: allele frequency distribution in a Brazilian population sample.

    PubMed

    Soares-Vieira, José Arnaldo; Billerbeck, Ana Elisa C; Pinto, Emília Modolo; Iwamura, Edna S M; Bilharinho de Mendonça, Berenice; Otto, Paulo A

    2002-06-01

    Gene and genotype frequencies in relation to the D3S1358, vWA, FGA, TH01, TPOX, CSF1PO, D5S818, D13S317, and D7S820 loci were determined in a sample of 290 unrelated individuals (204 Caucasians and 86 mulattoes) living in the city of São Paulo, Brazil. The sex test Amelogenin was also performed in all subjects from our sample, revealing the expected sex in all instances. Allele frequency data obtained from the analysis of these samples were in the usual range of other population groups with similar racial background. In the sample of Caucasian individuals, panmictic proportions were ruled out in relation to TPOX and CSF1PO loci, but only in the latter was the overall frequency of heterozygotes significantly less than expected. In the sample of mulattoes, Hardy-Weinberg proportions were rejected in relation to FGA and CSF1PO loci, but in no instance were the overall numbers of heterozygotes different from the corresponding expected ones under panmixia. Taking into account all this and also the number of tests performed, the degree of genetic heterogeneity of Brazilian populations, and the critical level reached by the significant results (1% < alpha<5%), the departures from panmixia here observed can be considered to be negligible in altering significantly biologic relationship odds calculated under the assumption of random matings. PMID:12040266

  6. Comparison of CDC and sequence-based molecular typing of syphilis treponemes: tpr and arp loci are variable in multiple samples from the same patient

    PubMed Central

    2013-01-01

    Background Molecular typing of syphilis-causing strains provides important epidemiologic data. We tested whether identified molecular subtypes were identical in PCR-positive parallel samples taken from the same patient at a same time. We also tested whether subtype prevalence differs in skin and blood samples. Results Eighteen syphilis positive patients (showing both positive serology and PCR), with two PCR-typeable parallel samples taken at the same time, were tested with both CDC (Centers for Disease Control and Prevention) and sequence-based typing. Samples taken from 9 of 18 patients were completely typed for TP0136, TP0548, 23S rDNA, arp, and tpr loci. The CDC typing revealed 11 distinct genotypes while the sequence-based typing identified 6 genotypes. When results from molecular typing of TP0136, TP0548, and 23S rDNA were analyzed in samples taken from the same patient, no discrepancies in the identified genotypes were found; however, there were discrepancies in 11 of 18 patients (61.1%) samples relative to the arp and tpr loci. In addition to the above described typing, 127 PCR-positive swabs and whole blood samples were tested for individual genotype frequencies. The repetition number for the arp gene was lower in whole blood (WB) samples compared to swab samples. Similarly, the most common tpr RFLP type “d” was found to have lower occurrence rates in WB samples while type “e” had an increased occurrence in these samples. Conclusions Differences in the CDC subtypes identified in parallel samples indicated genetic instability of the arp and tpr loci and suggested limited applicability of the CDC typing system in epidemiological studies. Differences in treponemal genotypes detected in whole blood and swab samples suggested important differences between both compartments and/or differences in adherence of treponeme variants to human cells. PMID:23898829

  7. Fine mapping of eight psoriasis susceptibility loci.

    PubMed

    Das, Sayantan; Stuart, Philip E; Ding, Jun; Tejasvi, Trilokraj; Li, Yanming; Tsoi, Lam C; Chandran, Vinod; Fischer, Judith; Helms, Cynthia; Duffin, Kristina Callis; Voorhees, John J; Bowcock, Anne M; Krueger, Gerald G; Lathrop, G Mark; Nair, Rajan P; Rahman, Proton; Abecasis, Goncalo R; Gladman, Dafna; Elder, James T

    2015-06-01

    Previous studies have identified 41 independent genome-wide significant psoriasis susceptibility loci. After our first psoriasis genome-wide association study, we designed a custom genotyping array to fine-map eight genome-wide significant susceptibility loci known at that time (IL23R, IL13, IL12B, TNIP1, MHC, TNFAIP3, IL23A and RNF114) enabling genotyping of 2269 single-nucleotide polymorphisms (SNPs) in the eight loci for 2699 psoriasis cases and 2107 unaffected controls of European ancestry. We imputed these data using the latest 1000 Genome reference haplotypes, which included both indels and SNPs, to increase the marker density of the eight loci to 49 239 genetic variants. Using stepwise conditional association analysis, we identified nine independent signals distributed across six of the eight loci. In the major histocompatibility complex (MHC) region, we detected three independent signals at rs114255771 (P = 2.94 × 10(-74)), rs6924962 (P = 3.21 × 10(-19)) and rs892666 (P = 1.11 × 10(-10)). Near IL12B we detected two independent signals at rs62377586 (P = 7.42 × 10(-16)) and rs918518 (P = 3.22 × 10(-11)). Only one signal was observed in each of the TNIP1 (rs17728338; P = 4.15 × 10(-13)), IL13 (rs1295685; P = 1.65 × 10(-7)), IL23A (rs61937678; P = 1.82 × 10(-7)) and TNFAIP3 (rs642627; P = 5.90 × 10(-7)) regions. We also imputed variants for eight HLA genes and found that SNP rs114255771 yielded a more significant association than any HLA allele or amino-acid residue. Further analysis revealed that the HLA-C*06-B*57 haplotype tagged by this SNP had a significantly higher odds ratio than other HLA-C*06-bearing haplotypes. The results demonstrate allelic heterogeneity at IL12B and identify a high-risk MHC class I haplotype, consistent with the existence of multiple psoriasis effectors in the MHC. PMID:25182136

  8. Fine mapping of eight psoriasis susceptibility loci

    PubMed Central

    Das, Sayantan; Stuart, Philip E; Ding, Jun; Tejasvi, Trilokraj; Li, Yanming; Tsoi, Lam C; Chandran, Vinod; Fischer, Judith; Helms, Cynthia; Duffin, Kristina Callis; Voorhees, John J; Bowcock, Anne M; Krueger, Gerald G; Lathrop, G Mark; Nair, Rajan P; Rahman, Proton; Abecasis, Goncalo R; Gladman, Dafna; Elder, James T

    2015-01-01

    Previous studies have identified 41 independent genome-wide significant psoriasis susceptibility loci. After our first psoriasis genome-wide association study, we designed a custom genotyping array to fine-map eight genome-wide significant susceptibility loci known at that time (IL23R, IL13, IL12B, TNIP1, MHC, TNFAIP3, IL23A and RNF114) enabling genotyping of 2269 single-nucleotide polymorphisms (SNPs) in the eight loci for 2699 psoriasis cases and 2107 unaffected controls of European ancestry. We imputed these data using the latest 1000 Genome reference haplotypes, which included both indels and SNPs, to increase the marker density of the eight loci to 49 239 genetic variants. Using stepwise conditional association analysis, we identified nine independent signals distributed across six of the eight loci. In the major histocompatibility complex (MHC) region, we detected three independent signals at rs114255771 (P=2.94 × 10−74), rs6924962 (P=3.21 × 10−19) and rs892666 (P=1.11 × 10−10). Near IL12B we detected two independent signals at rs62377586 (P=7.42 × 10−16) and rs918518 (P=3.22 × 10−11). Only one signal was observed in each of the TNIP1 (rs17728338; P=4.15 × 10−13), IL13 (rs1295685; P=1.65 × 10−7), IL23A (rs61937678; P=1.82 × 10−7) and TNFAIP3 (rs642627; P=5.90 × 10−7) regions. We also imputed variants for eight HLA genes and found that SNP rs114255771 yielded a more significant association than any HLA allele or amino-acid residue. Further analysis revealed that the HLA-C*06-B*57 haplotype tagged by this SNP had a significantly higher odds ratio than other HLA-C*06-bearing haplotypes. The results demonstrate allelic heterogeneity at IL12B and identify a high-risk MHC class I haplotype, consistent with the existence of multiple psoriasis effectors in the MHC. PMID:25182136

  9. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

    2005-01-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  10. Strain identification and 5S rRNA gene characterization of the hyperthermophilic archaebacterium Sulfolobus acidocaldarius.

    PubMed Central

    Durovic, P; Kutay, U; Schleper, C; Dennis, P P

    1994-01-01

    A commonly used laboratory Sulfolobus strain has been unambiguously identified as Sulfolobus acidocaldarius DSM639. The 5S rRNA gene from this strain was cloned and sequenced. It differs at 17 of 124 positions from the identical 5S rRNA sequences from Sulfolobus solfataricus and a strain apparently misidentified as S. acidocaldarius. Analysis of the transcripts from the 5S rRNA gene failed to identify any precursor extending a significant distance beyond the 5' or 3' boundary of the 5S rRNA-coding sequence. This result suggests that the primary transcript of the 5S rRNA gene corresponds in length (within 1 or 2 nucleotides) to the mature 5S rRNA sequence found in 50S ribosomal subunits. Images PMID:8288546

  11. Intraspecific polymorphism of rDNA among five Nosema bombycis isolates from different geographic regions in China.

    PubMed

    Liu, Handeng; Pan, Guoqing; Luo, Bo; Li, Tian; Yang, Qiong; Vossbrinck, Charles R; Debrunner-Vossbrinck, Bettina A; Zhou, Zeyang

    2013-05-01

    The microsporidian Nosema bombycis is the causative agent of pébrine, a highly infectious disease of the silkworm Bombyx mori. Three regions of the multicopy rDNA gene were examined in order to investigate the relationships among five Nosema isolates from various regions of China. Ribosomal DNA alleles are present on each of the 18 chromosomes of N. bombycis and show a high degree of variation. In this study the small subunit (SSU) rDNA, internal transcribed spacer (ITS) and intergenic spacer (IGS) regions for up to 10 different rDNA copies from each N. bombycis isolate were cloned and sequenced. As expected we see greater polymorphism in the ITS region (88 variable sites in 179 nucleotides) and IGS (200 variable sites in 279 nucleotides) than in the SSU rDNA (24 variable sites in 1232 nucleotides). Phylogenetic analysis shows greater differences between alleles within an isolate than between the same alleles from different isolates. The data reveal two very different groups, one from the Sichuan province and the other with a broad distribution including four provinces in southeast China and Japan. The Sichuan isolate does not have any rDNA alleles with sequences identical to those in the other isolates, implying that it is a separate, non-intermixing, population or perhaps a separate species from the other isolates. In light of the polymorphic nature of the rDNA alleles in N. bombycis and their presence on every chromosome, the rDNA gene may be useful for understanding the movement and ultimately the source of pébrine infections. PMID:23399511

  12. Phylogenetic relationships among higher Nemertean (Nemertea) Taxa inferred from 18S rDNA sequences.

    PubMed

    Sundberg, P; Turbeville, J M; Lindh, S

    2001-09-01

    We estimated the phylogenetic relationships of 15 nemertean (phylum Nemertea) species from the four subclasses Hoplo-, Hetero-, Palaeo-, and Bdellonemertea with 18S rDNA sequence data. Three outgroup taxa were used for rooting: Annelida, Platyhelminthes, and Mollusca. Parsimony and maximum-likelihood analyses supported the monophyletic status of the Heteronemertea and a taxon consisting of hoplonemerteans and Bdellonemertea, while indicating that Palaeonemertea is paraphyletic. The monophyletic status of the two nemertean classes Anopla and Enopla is not supported by the data. The unambiguous clades are well supported, as assessed by a randomization test (bootstrapping) and branch support values. PMID:11527461

  13. Large linkage analysis in 100 families with autosomal recessive spinal muscular atrophy (SMA) and 11 EPH families using 15 polymorphic loci in the region 5q11. 2-q13. 3

    SciTech Connect

    Wirth, B.; Pick, E.; Leutner, A.; Dadze, A.; Voosen, B.; Piechaczek-Wappenschmidt, B.; Rudnik-Schoeneborn, S.; Schoenling, J.; Zerres, K. ); Knapp, M. )

    1994-03-01

    The autosomal recessive proximal spinal muscular atrophy (SMA) gene was mapped to the region 5q11.2-q.13.3 in 1990. Here, the authors present a large genetic linkage study of 100 SMA families and 11 CEPH families using 14 polymorphic simple sequence repeats (SSRs) and one RFLP in the region 5q11.2-q.13.3. The genetic interval between the closest SMA flanking loci D5S435 and D5S557 comprises 1 cM at z[sub max] = 27.94. Two recombinants were identified between the SMA gene and the closest telomeric marker D5S557. The first places the SMA gene centromeric to this marker; the second suggests a double recombinant at D5S557, which is very unlikely. More likely explanations are discussed in the paper. No recombinant was found between D5S435 and the SMA gene. They localized a recently described polymorphic marker, D5S351, close to the SMA. Due to its high PIC value of 0.70, it represents a very useful marker for prenatal diagnosis. In addition, they developed a new reverse primer for the nearest centromeric locus D5S435, a useful marker for prenatal diagnosis, which has been very difficult to amplify in the past. Three of the markers presented here are newly developed polymorphic SSRs (one tetranucleotide repeat, D5s507/W15CATT, and two dinucleotide repeats, D5S544/C88.2GT and D5S682/C88.3GT). These markers are too far from the SMA gene to be relevant for cloning; nevertheless, as part of the human genome project, they are contributing to the fine genetic mapping of the region 5q11.2-q.13.3. The most likely order of the loci based on two-point and multipoint linkage analyses as well as on specific recombination events and physical mapping studies is D5S76-D5S507-D5S6-D5S125-D5S680-D5S435-SMA-D5S557-D5S35 -15[prime]MAP1B-3[prime]MAP1B-JK53CA1/2-(D5S127-D5S39)-(D5S544-D5S682). In general, the genetic distances obtained from the SMA and CEPH families are comparable. 25 refs., 4 figs., 5 tabs.

  14. Genetic structure of the Azores Islands: a study using 15 autosomal short tandem repeat loci.

    PubMed

    Santos, Cristina; Alvarez, Luis; Aluja, Maria Pilar; Bruges-Armas, Jacome; Lima, Manuela

    2009-12-01

    The Azores archipelago (Portugal), located in the Atlantic Ocean, 1,500 km from the European mainland, is formed by nine islands of volcanic origin. The relative position of these islands allows the definition of three geographical groups: Eastern, Central and Western. Previous studies of the Azores using Short Tandem Repeats (STRs) have highlighted differences in the frequencies of several loci, when compared to Mainland Portugal or Madleira Island. Furthermore, linkage disequilibrium (LD), described for Azorean samples has been tentatively explained as reflecting the presence of genetic sub-structuring in the archipelago. To provide information concerning the genetic profile of the Azores Islands and to evaluate the presence of substructuring we have determined the allelic frequencies of 15 autosomal STR loci, using the AmpFlSTR Identifiler Kit, in representative samples from the Azorean Islands. Either considering the Azores as a whole, or analysing by island all the loci were in conformity with Hardy-Weinberg equilibrium. Average gene diversity ranged from 0.7669 in Corvo to 0.7972 in Terceira Island. Allelic independence between loci, tested for the global sample, detected significant LD (after correction for multiple tests) for pairs D21S11/D7S820 and D3S1358/D5S818. The exact test of population differentiation, combining the information of the 15 markers analysed, revealed significant differences between the three groups of islands, and between islands. Inter-island analysis reinforces the previous data that suggested the existence of sub-structuring in the Azores archipelago. Moreover, the data generated by this study can be used in a future forensic genetic database of the Azores after the appropriate enlacement of sample size by island, preventing, in that way, misinterpretations caused by population substructuring and small sample sizes. PMID:20102040

  15. A revised nomenclature for transcribed human endogenous retroviral loci

    PubMed Central

    2011-01-01

    Background Endogenous retroviruses (ERVs) and ERV-like sequences comprise 8% of the human genome. A hitherto unknown proportion of ERV loci are transcribed and thus contribute to the human transcriptome. A small proportion of these loci encode functional proteins. As the role of ERVs in normal and diseased biological processes is not yet established, transcribed ERV loci are of particular interest. As more transcribed ERV loci are likely to be identified in the near future, the development of a systematic nomenclature is important to ensure that all information on each locus can be easily retrieved. Results Here we present a revised nomenclature of transcribed human endogenous retroviral loci that sorts loci into groups based on Repbase classifications. Each symbol is of the format ERV + group symbol + unique number. Group symbols are based on a mixture of Repbase designations and well-supported symbols used in the literature. The presented guidelines will allow newly identified loci to be easily incorporated into the scheme. Conclusions The naming system will be employed by the HUGO Gene Nomenclature Committee for naming transcribed human ERV loci. We hope that the system will contribute to clarifying a certain aspect of a sometimes confusing nomenclature for human endogenous retroviruses. The presented system may also be employed for naming transcribed loci of human non-ERV repeat loci. PMID:21542922

  16. Effects of 16S rDNA sampling on estimates of the number of endosymbiont lineages in sucking lice.

    PubMed

    Allen, Julie M; Burleigh, J Gordon; Light, Jessica E; Reed, David L

    2016-01-01

    Phylogenetic trees can reveal the origins of endosymbiotic lineages of bacteria and detect patterns of co-evolution with their hosts. Although taxon sampling can greatly affect phylogenetic and co-evolutionary inference, most hypotheses of endosymbiont relationships are based on few available bacterial sequences. Here we examined how different sampling strategies of Gammaproteobacteria sequences affect estimates of the number of endosymbiont lineages in parasitic sucking lice (Insecta: Phthirapatera: Anoplura). We estimated the number of louse endosymbiont lineages using both newly obtained and previously sequenced 16S rDNA bacterial sequences and more than 42,000 16S rDNA sequences from other Gammaproteobacteria. We also performed parametric and nonparametric bootstrapping experiments to examine the effects of phylogenetic error and uncertainty on these estimates. Sampling of 16S rDNA sequences affects the estimates of endosymbiont diversity in sucking lice until we reach a threshold of genetic diversity, the size of which depends on the sampling strategy. Sampling by maximizing the diversity of 16S rDNA sequences is more efficient than randomly sampling available 16S rDNA sequences. Although simulation results validate estimates of multiple endosymbiont lineages in sucking lice, the bootstrap results suggest that the precise number of endosymbiont origins is still uncertain. PMID:27547523

  17. Fragile Sites of 'Valencia' Sweet Orange (Citrus sinensis) Chromosomes Are Related with Active 45s rDNA.

    PubMed

    Lan, Hong; Chen, Chun-Li; Miao, Yin; Yu, Chang-Xiu; Guo, Wen-Wu; Xu, Qiang; Deng, Xiu-Xin

    2016-01-01

    Citrus sinensis chromosomes present a morphological differentiation of bands after staining by the fluorochromes CMA and DAPI, but there is still little information on its chromosomal characteristics. In this study, the chromosomes in 'Valencia' C. sinensis were analyzed by fluorescence in situ hybridization (FISH) using telomere DNA and the 45S rDNA gene as probes combining CMA/DAPI staining, which showed that there were two fragile sites in sweet orange chromosomes co-localizing at distended 45S rDNA regions, one proximally locating on B-type chromosome and the other subterminally locating on D-type chromosome. While the chromosomal CMA banding and 45S rDNA FISH mapping in the doubled haploid line of 'Valencia' C. sinensis indicated six 45S rDNA regions, four were identified as fragile sites as doubled comparing its parental line, which confirmed the cytological heterozygosity and chromosomal heteromorphisms in sweet orange. Furthermore, Ag-NOR identified two distended 45S rDNA regions to be active nucleolar organizing regions (NORs) in diploid 'Valencia' C. sinensis. The occurrence of quadrivalent in meiosis of pollen mother cells (PMCs) in 'Valencia' sweet orange further confirmed it was a chromosomal reciprocal translocation line. We speculated this chromosome translocation was probably related to fragile sites. Our data provide insights into the chromosomal characteristics of the fragile sites in 'Valencia' sweet orange and are expected to facilitate the further investigation of the possible functions of fragile sites. PMID:26977938

  18. Hot spots of DNA double-strand breaks in human rDNA units are produced in vivo.

    PubMed

    Tchurikov, Nickolai A; Yudkin, Dmitry V; Gorbacheva, Maria A; Kulemzina, Anastasia I; Grischenko, Irina V; Fedoseeva, Daria M; Sosin, Dmitri V; Kravatsky, Yuri V; Kretova, Olga V

    2016-01-01

    Endogenous hot spots of DNA double-strand breaks (DSBs) are tightly linked with transcription patterns and cancer genomics(1,2). There are nine hot spots of DSBs located in human rDNA units(3-6). Here we describe that the profiles of these hot spots coincide with the profiles of γ-H2AX or H2AX, strongly suggesting a high level of in vivo breakage inside rDNA genes. The data were confirmed by microscopic observation of the largest γ-H2AX foci inside nucleoli in interphase chromosomes. In metaphase chromosomes, we observed that only some portion of rDNA clusters possess γ-H2AX foci and that all γ-H2AX foci co-localize with UBF-1 binding sites, which strongly suggests that only active rDNA units possess the hot spots of DSBs. Both γ-H2AX and UBF-1 are epigenetically inherited and thus indicate the rDNA units that were active in the previous cell cycle. These results have implications for diverse fields, including epigenetics and cancer genomics. PMID:27160357

  19. Chromosomal localization of 18S rDNA and telomere sequence in the aye-aye, Daubentonia madagascariensis.

    PubMed

    Rakotoarisoa, G; Hirai, Y; Go, Y; Kawamoto, Y; Shima, T; Koyama, N; Randrianjafy, A; Mora, R; Hirai, H

    2000-10-01

    Chromosomal localization of 18S rDNA and telomere sequence was attempted on the chromosomes of the aye-aye (2n = 30) using fluorescence in situ hybridization (FISH) and primed in situ labeling (PRINS), respectively. The rDNA was localized at the tip or whole of the short arm of acrocentric chromosomes 13 and 14 in all spreads observed. However, post-FISH silver-nitrate (Ag) staining showed that transcriptional activity of the rRNA genes was variable, particularly in chromosome 14, which was most frequently negative in one homologue carrying the smaller copy number of rDNA. This observation supports, at the molecular cytogenetic level, previous data concerning the relationship between the copy number of rDNA and its trancriptional activity. On the other hand, telomere sequence was localized only at the telomeric region of all chromosomes, the so-called telomere-only pattern, a characteristic similar to that of the greater bushbaby. These data may provide information on the chromosomal evolution of the lemur, because locations of rDNA and telomere sequences frequently offer important clues in reconstruction of karyotype differentiation. PMID:11245223

  20. Retrotransposable elements R1 and R2 in the rDNA units of Drosophila mercatorum: abnormal abdomen revisited.

    PubMed Central

    Malik, H S; Eickbush, T H

    1999-01-01

    R1 and R2 retrotransposable elements are stable components of the 28S rRNA genes of arthropods. While each retrotransposition event leads to incremental losses of rDNA unit expression, little is known about the selective consequences of these elements on the host genome. Previous reports suggested that in the abnormal abdomen (aa) phenotype of Drosophila mercatorum, high levels of rDNA insertions (R1) in conjunction with the under-replication locus (ur), enable the utilization of different ecological conditions via a population level shift to younger age. We have sequenced the R1 and R2 elements of D. mercatorum and show that the levels of R1- and R2-inserted rDNA units were inaccurately scored in the original studies of aa, leading to several misinterpretations. In particular, contrary to earlier reports, aa flies differentially underreplicate R1- and R2-inserted rDNA units, like other species of Drosophila. However, aa flies do not undergo the lower level of underreplication of their functional rDNA units (general underreplication) that is seen in wild-type strains. The lack of general underreplication is expected to confer a selective advantage and, thus, can be interpreted as an adaptation to overcome high levels of R1 and R2 insertions. These results allow us to reconcile some of the apparently contradictory effects of aa and the bobbed phenotype found in other species of Drosophila. PMID:9927458

  1. More than 10% of yeast genes are related to genome stability and influence cellular senescence via rDNA maintenance.

    PubMed

    Saka, Kimiko; Takahashi, Akihiro; Sasaki, Mariko; Kobayashi, Takehiko

    2016-05-19

    Genome instability triggers cellular senescence and is a common cause of cancer. The ribosomal RNA genes (rDNA), due to their repetitive structure, form a fragile site with frequent rearrangements. To identify eukaryotic factors that connect reduced genome stability to senescence we screened 4,876 strains of a Saccharomyces cerevisiae deletion library for aberrant rDNA and found 708 genes that contribute to its upkeep. 28 mutants caused abnormalities in non-rDNA chromosomes and among them 12 mutants have abnormalities both in rDNA and in non-rDNA chromosomes. Many mutated genes have not previously been implicated with genome maintenance nor their homologues with tumorigenesis in mammals. The link between rDNA state and senescence was broken after deletion of factors related with DNA polymerase ϵ. These mutations also suppressed the short lifespan phenotype of a sir2 mutant, suggesting a model in which molecular events at the heart of the replication fork induce abnormal rDNA recombination and are responsible for the emergence of an aging signal. PMID:26912831

  2. Hot spots of DNA double-strand breaks in human rDNA units are produced in vivo

    PubMed Central

    Tchurikov, Nickolai A.; Yudkin, Dmitry V.; Gorbacheva, Maria A.; Kulemzina, Anastasia I.; Grischenko, Irina V.; Fedoseeva, Daria M.; Sosin, Dmitri V.; Kravatsky, Yuri V.; Kretova, Olga V.

    2016-01-01

    Endogenous hot spots of DNA double-strand breaks (DSBs) are tightly linked with transcription patterns and cancer genomics1,2. There are nine hot spots of DSBs located in human rDNA units3–6. Here we describe that the profiles of these hot spots coincide with the profiles of γ-H2AX or H2AX, strongly suggesting a high level of in vivo breakage inside rDNA genes. The data were confirmed by microscopic observation of the largest γ-H2AX foci inside nucleoli in interphase chromosomes. In metaphase chromosomes, we observed that only some portion of rDNA clusters possess γ-H2AX foci and that all γ-H2AX foci co-localize with UBF-1 binding sites, which strongly suggests that only active rDNA units possess the hot spots of DSBs. Both γ-H2AX and UBF-1 are epigenetically inherited and thus indicate the rDNA units that were active in the previous cell cycle. These results have implications for diverse fields, including epigenetics and cancer genomics. PMID:27160357

  3. Effects of 16S rDNA sampling on estimates of the number of endosymbiont lineages in sucking lice

    PubMed Central

    Burleigh, J. Gordon; Light, Jessica E.; Reed, David L.

    2016-01-01

    Phylogenetic trees can reveal the origins of endosymbiotic lineages of bacteria and detect patterns of co-evolution with their hosts. Although taxon sampling can greatly affect phylogenetic and co-evolutionary inference, most hypotheses of endosymbiont relationships are based on few available bacterial sequences. Here we examined how different sampling strategies of Gammaproteobacteria sequences affect estimates of the number of endosymbiont lineages in parasitic sucking lice (Insecta: Phthirapatera: Anoplura). We estimated the number of louse endosymbiont lineages using both newly obtained and previously sequenced 16S rDNA bacterial sequences and more than 42,000 16S rDNA sequences from other Gammaproteobacteria. We also performed parametric and nonparametric bootstrapping experiments to examine the effects of phylogenetic error and uncertainty on these estimates. Sampling of 16S rDNA sequences affects the estimates of endosymbiont diversity in sucking lice until we reach a threshold of genetic diversity, the size of which depends on the sampling strategy. Sampling by maximizing the diversity of 16S rDNA sequences is more efficient than randomly sampling available 16S rDNA sequences. Although simulation results validate estimates of multiple endosymbiont lineages in sucking lice, the bootstrap results suggest that the precise number of endosymbiont origins is still uncertain. PMID:27547523

  4. Obtaining long 16S rDNA sequences using multiple primers and its application on dioxin-containing samples

    PubMed Central

    2015-01-01

    Background Next-generation sequencing (NGS) technology has transformed metagenomics because the high-throughput data allow an in-depth exploration of a complex microbial community. However, accurate species identification with NGS data is challenging because NGS sequences are relatively short. Assembling 16S rDNA segments into longer sequences has been proposed for improving species identification. Current approaches, however, either suffer from amplification bias due to one single primer or insufficient 16S rDNA reads in whole genome sequencing data. Results Multiple primers were used to amplify different 16S rDNA segments for 454 sequencing, followed by 454 read classification and assembly. This permitted targeted sequencing while reducing primer bias. For test samples containing four known bacteria, accurate and near full-length 16S rDNAs of three known bacteria were obtained. For real soil and sediment samples containing dioxins in various concentrations, 16S rDNA sequences were lengthened by 50% for about half of the non-rare microbes, and 16S rDNAs of several microbes reached more than 1000 bp. In addition, reduced primer bias using multiple primers was illustrated. Conclusions A new experimental and computational pipeline for obtaining long 16S rDNA sequences was proposed. The capability of the pipeline was validated on test samples and illustrated on real samples. For dioxin-containing samples, the pipeline revealed several microbes suitable for future studies of dioxin chemistry. PMID:26681335

  5. Distribution of 18S rDNA sites and absence of the canonical TTAGG insect telomeric repeat in parasitoid Hymenoptera.

    PubMed

    Gokhman, Vladimir E; Anokhin, Boris A; Kuznetsova, Valentina G

    2014-08-01

    Karyotypes of six species belonging to three main clades of parasitoid Hymenoptera, the superfamilies Ichneumonoidea (Ichneumonidae: Ichneumon amphibolus), Cynipoidea (Cynipidae: Diplolepis rosae) and Chalcidoidea (Eurytomidae: Eurytoma robusta, Eu. serratulae and Eu. compressa, and Torymidae: Torymus bedeguaris) were studied using FISH with 18S rDNA and telomeric (TTAGG)n probes. Haploid karyotypes of D. rosae, Eu. robusta and Eu. serratulae carried the only 18S rDNA hybridization signal, whereas those of I. amphibolus and Eu. compressa carried three and two rDNA clusters respectively. In addition, three rDNA sites were visualized in the aneuploid female of T. bedeguaris. The number of rDNA clusters in parasitoid Hymenoptera generally correlates to the chromosome number. Apart from the overwhelming majority of the studied species of aculeate Hymenoptera, no hybridization signals were obtained from FISH with the telomeric (TTAGG)n probe in the examined parasitoid species. These data suggest absence of the canonical (TTAGG)n insect telomeric motif in the Ichneumonoidea, Cynipoidea and Chalcidoidea, and perhaps in parasitoid Hymenoptera in general. PMID:24992984

  6. Using an intervening sequence of Faecalibacterium 16S rDNA to identify poultry feces.

    PubMed

    Shen, Zhenyu; Duan, Chuanren; Zhang, Chao; Carson, Andrew; Xu, Dong; Zheng, Guolu

    2013-10-15

    This study was designed to identify poultry feces-specific marker(s) within sequences of Faecalibacterium 16S rDNA for detecting poultry fecal pollution in water. Bioinformatics tools were used in the comparative analysis of 7,458 sequences of Faecalibacterium 16S rDNA, reportedly associated with various poultry (chicken and turkey) and animal species. One intervening sequence (IVS) within between the hypervariable region 1 and the conserved region 2, designated as IVS-p, was found to be unique to poultry feces. Based on this sequence, a PCR assay (PCR-p) was developed. The PCR-p produced an amplicon of 132 bp only in the test when fecal or wastewater samples from poultry were used, but not when using fecal or wastewater samples from other sources. The non-poultry sources included feces of beef or dairy cattle, dog, horse, human, domestic or wild geese, seagull, sheep, swine, and wild turkey. These data indicate that IVS-p may prove to be a useful genetic marker for the specific identification of poultry fecal pollution in environmental waterways. Furthermore, results of data mining and PCR assay indicate that the IVS-p may have a broad geographic distribution. This report represents initial evidence of the potential utility of ribosomal intervening sequences as genetic markers for tracking host sources of fecal pollution in waterways. PMID:24011842

  7. Investigation of the validity of species status of Ixodes dammini (Acari: Ixodidae) using rDNA.

    PubMed Central

    Wesson, D M; McLain, D K; Oliver, J H; Piesman, J; Collins, F H

    1993-01-01

    The two internal transcribed spacers (ITS1 and ITS2) of rDNA of three members of the Ixodes ricinus "complex" (Acari: Ixodidae) were sequenced. Sequence variation was assessed for the North American species I. scapularis, I. dammini, and I. pacificus at three levels: within individual/population, between individuals of different geographic origin within a species, and between species. Both spacers are highly variable, particularly with regard to small deletions and additions which may arise via replication slippage. Homogenization of rDNA multigene arrays for particular sequence variants appears to occur at a relatively rapid rate, since I. pacificus sequences differ from the others at numerous invariant sites, facilitating the use of these sequences to assess sibling species relationships. Based on maximum parsimony and two distance methods (unweighted pair-group with arithmetic means and neighbor-joining), sequence variation in ITS1 and ITS2 suggests that I. scapularis and I. dammini are not distinct species and that even individuals from geographically isolated locations are very similar. Individuals from geographically separated populations of I. pacificus appear to be relatively less closely related to each other but distinct from those of I. scapularis/dammini. In I. scapularis/dammini, diversity within and between individuals from geographic populations contributed equally to total sequence diversity. PMID:8234280

  8. Protein purification in multicompartment electrolyzers for crystal growth of r-DNA products in microgravity

    NASA Technical Reports Server (NTRS)

    Righetti, Pier Giorgio; Casale, Elena; Carter, Daniel; Snyder, Robert S.; Wenisch, Elisabeth; Faupel, Michel

    1990-01-01

    Recombinant-DNA (deoxyribonucleic acid) (r-DNA) proteins, produced in large quantities for human consumption, are now available in sufficient amounts for crystal growth. Crystallographic analysis is the only method now available for defining the atomic arrangements within complex biological molecules and decoding, e.g., the structure of the active site. Growing protein crystals in microgravity has become an important aspect of biology in space, since crystals that are large enough and of sufficient quality to permit complete structure determinations are usually obtained. However even small amounts of impurities in a protein preparation are anathema for the growth of a regular crystal lattice. A multicompartment electrolyzer with isoelectric, immobiline membranes, able to purify large quantities of r-DNA proteins is described. The electrolyzer consists of a stack of flow cells, delimited by membranes of very precise isoelectric point (pI, consisting of polyacrylamide supported by glass fiber filters containing Immobiline buffers and titrants to uniquely define a pI value) and very high buffering power, able to titrate all proteins tangent or crossing such membranes. By properly selecting the pI values of two membranes delimiting a flow chamber, a single protein can be kept isoelectric in a single flow chamber and thus, be purified to homogeneity (by the most stringent criterion, charge homogeneity).

  9. Phylogenetic relationships between Bacillus species and related genera inferred from 16s rDNA sequences

    PubMed Central

    Wei Wang, Mi Sun

    2009-01-01

    Neighbor-joining, maximum-parsimony, minimum-evolution, maximum-likelihood and Bayesian trees constructed based on 16S rDNA sequences of 181 type strains of Bacillus species and related taxa manifested nine phylogenetic groups. The phylogenetic analysis showed that Bacillus was not a monophyletic group. B. subtilis was in Group 1. Group 4, 6 and 8 respectively consisted of thermophiles, halophilic or halotolerant bacilli and alkaliphilic bacilli. Group 2, 4 and 8 consisting of Bacillus species and related genera demonstrated that the current taxonomic system did not agree well with the 16S rDNA evolutionary trees. The position of Caryophanaceae and Planococcaceae in Group 2 suggested that they might be transferred into Bacillaceae, and the heterogeneity of Group 2 implied that some Bacillus species in it might belong to several new genera. Group 9 was mainly comprised of the genera (excluding Bacillus) of Bacillaceae, so some Bacillus species in Group 9: B. salarius, B. qingdaonensis and B. thermcloacae might not belong to Bacillus. Four Bacillus species, B. schlegelii, B. tusciae, B. edaphicus and B. mucilaginosus were clearly placed outside the nine groups. PMID:24031394

  10. Expression quantitative trait loci: present and future

    PubMed Central

    Nica, Alexandra C.; Dermitzakis, Emmanouil T.

    2013-01-01

    The last few years have seen the development of large efforts for the analysis of genome function, especially in the context of genome variation. One of the most prominent directions has been the extensive set of studies on expression quantitative trait loci (eQTLs), namely, the discovery of genetic variants that explain variation in gene expression levels. Such studies have offered promise not just for the characterization of functional sequence variation but also for the understanding of basic processes of gene regulation and interpretation of genome-wide association studies. In this review, we discuss some of the key directions of eQTL research and its implications. PMID:23650636

  11. Discriminatory profile of rDNA sites and trend for acrocentric chromosome formation in the genus Trachinotus Lacépède, 1801 (Perciformes, Carangidae).

    PubMed

    Jacobina, Uedson Pereira; Vicari, Marcelo Ricardo; Bertollo, Luiz Antonio Carlos; Molina, Wagner Franco

    2012-01-01

    Chromosomal traits have provided valuable information for phylogeny and taxonomy of several fish groups. Three Atlantic Carangidae species of the genus Trachinotus Lacépède, 1801 (Trachinotus goodei Jordan et Evermann, 1896, Trachinotus carolinus (Linnaeus, 1766)and Trachinotus falcatus (Linnaeus, 1758)) were investigated, having 2n=48 chromosomes but different chromosomal arms (FN number), i.e., 52, 56 and 58, respectively, in view of the different number of two-armed chromosomes found in their karyotypes. Thus, Trachinotus goodei, Trachinotus carolinus and Trachinotus falcatus present a progressive distancefrom the probable basal karyotype proposed for Perciformes (2n=48 acrocentrics, FN=48). At first sight, these findings do not agree with the phylogenetic hypothesis based on mitochondrial sequences, where Trachinotus goodei appear as the most derived species, followed by Trachinotus falcatus and Trachinotus carolinus, respectively. However, the chromosomal mapping of ribosomal DNAs was informative for clarifying this apparent conflict. Indeed, the multiple 5S and 18S rDNA sites found in Trachinotus goodei corroborate the most derived condition for this species. In this sense, the occurrence of the unexpected number of two-armed chromosomes and FN value for this species, as well as for Trachinotus carolinus, must be due to additional rounds of acrocentric formation in these species, modifying the macrostructure of their karyotypes. PMID:24260676

  12. Discriminatory profile of rDNA sites and trend for acrocentric chromosome formation in the genus Trachinotus Lacépède, 1801 (Perciformes, Carangidae)

    PubMed Central

    Jacobina, Uedson Pereira; Vicari, Marcelo Ricardo; Bertollo, Luiz Antonio Carlos; Molina, Wagner Franco

    2012-01-01

    Abstract Chromosomal traits have provided valuable information for phylogeny and taxonomy of several fish groups. Three Atlantic Carangidae species of the genus Trachinotus Lacépède, 1801 (Trachinotus goodei Jordan et Evermann, 1896, Trachinotus carolinus (Linnaeus, 1766)and Trachinotus falcatus (Linnaeus, 1758)) were investigated, having 2n=48 chromosomes but different chromosomal arms (FN number), i.e., 52, 56 and 58, respectively, in view of the different number of two-armed chromosomes found in their karyotypes. Thus, Trachinotus goodei, Trachinotus carolinus and Trachinotus falcatus present a progressive distancefrom the probable basal karyotype proposed for Perciformes (2n=48 acrocentrics, FN=48). At first sight, these findings do not agree with the phylogenetic hypothesis based on mitochondrial sequences, where Trachinotus goodei appear as the most derived species, followed by Trachinotus falcatus and Trachinotus carolinus, respectively. However, the chromosomal mapping of ribosomal DNAs was informative for clarifying this apparent conflict. Indeed, the multiple 5S and 18S rDNA sites found in Trachinotus goodei corroborate the most derived condition for this species. In this sense, the occurrence of the unexpected number of two-armed chromosomes and FN value for this species, as well as for Trachinotus carolinus, must be due to additional rounds of acrocentric formation in these species, modifying the macrostructure of their karyotypes. PMID:24260676

  13. Altered gravity influences rDNA and NopA100 localization in nucleoli

    NASA Astrophysics Data System (ADS)

    Sobol, M. A.; Kordyum, E. L.

    Fundamental discovery of gravisensitivity of cells no specified to gravity perception focused increasing attention on an elucidation of the mechanisms involved in altered gravity effects at the cellular and subcellular levels. The nucleolus is the transcription site of rRNA genes as well as the site of processing and initial packaging of their transcripts with ribosomal and nonribosomal proteins. The mechanisms inducing the changes in the subcomponents of the nucleolus that is morphologically defined yet highly dynamic structure are still unknown in detail. To understand the functional organization of the nucleolus as in the control as under altered gravity conditions it is essential to determine both the precise location of rDNA and the proteins playing the key role in rRNA processing. Lepidium sativum seeds were germinated in 1% agar medium on the slow horizontal clinostat (2 rpm) and in the stationary conditions. We investigated the root meristematic cells dissected from the seedlings grown in darkness for two days. The investigations were carried out with anti-DNA and anti-NopA100 antibodies labeling as well as with TdT procedure, and immunogold electron microscopy. In the stationary growth conditions, the anti-DNA antibody as well TdT procedure were capable of detecting fibrillar centers (FCs) and the dense fibrillar component (DFC) in the nucleolus. In FCs, gold particles were revealed on the condensed chromatin inclusions, internal fibrils of decondensed rDNA and the transition zone FC-DFC. Quantitatively, FCs appeared 1,5 times more densely labeled than DFC. NopA100 was localized in FCs and in DFC. In FCs, the most of protein was revealed in the transition zone FC-DFC. After a quantitative study, FCs and the transition zone FC-DFC appeared to contain NopA100 1,7 times more than DFC. Under the conditions of altered gravity, quantitative data clearly showed a redistribution of nucleolar DNA and NopA100 between FCs and DFC in comparison with the control. In

  14. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  15. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  16. A search for the Bs meson in Υ(5S) decays

    NASA Astrophysics Data System (ADS)

    Shipsey, Ian

    2004-05-01

    The CLEO III detector has recorded approximately 0.5 fb-1 of e^+ e^- annihilation data at the Υ(5S) resonance. Using this data sample, we have searched for fully reconstructed Bs mesons in the reaction Υ(5S) arrow B_s^(*) barB_s^(*)

  17. Evidence for the presence of 5S rRNA in mammalian mitochondria.

    PubMed

    Magalhães, P J; Andreu, A L; Schon, E A

    1998-09-01

    Mammalian mitochondrial ribosomes contain two prokaryotic-like rRNAs, 12S and 16S, both encoded by mitochondrial DNA. As opposed to cytosolic ribosomes, however, these ribosomes are not thought to contain 5S rRNA. For this reason, it has been unclear whether 5S rRNA, which can be detected in mitochondrial preparations, is an authentic organellar species imported from the cytosol or is merely a copurifying cytosol-derived contaminant. We now show that 5S rRNA is tightly associated with highly purified mitochondrial fractions of human and rat cells and that 5S rRNA transcripts derived from a synthetic gene transfected transiently into human cells are both expressed in vivo and present in highly purified mitochondria and mitoplasts. We conclude that 5S rRNA is imported into mammalian mitochondria, but its function there still remains to be clarified. PMID:9725900

  18. The 5S lean method as a tool of industrial management performances

    NASA Astrophysics Data System (ADS)

    Filip, F. C.; Marascu-Klein, V.

    2015-11-01

    Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

  19. Mitochondrial Enzyme Rhodanese Is Essential for 5 S Ribosomal RNA Import into Human Mitochondria*

    PubMed Central

    Smirnov, Alexandre; Comte, Caroline; Mager-Heckel, Anne-Marie; Addis, Vanessa; Krasheninnikov, Igor A.; Martin, Robert P.; Entelis, Nina; Tarassov, Ivan

    2010-01-01

    5 S rRNA is an essential component of ribosomes. In eukaryotic cells, it is distinguished by particularly complex intracellular traffic, including nuclear export and re-import. The finding that in mammalian cells 5 S rRNA can eventually escape its usual circuit toward nascent ribosomes to get imported into mitochondria has made the scheme more complex, and it has raised questions about both the mechanism of 5 S rRNA mitochondrial targeting and its function inside the organelle. Previously, we showed that import of 5 S rRNA into mitochondria requires unknown cytosolic proteins. Here, one of them was identified as mitochondrial thiosulfate sulfurtransferase, rhodanese. Rhodanese in its misfolded form was found to possess a strong and specific 5 S rRNA binding activity, exploiting sites found earlier to function as signals of 5 S rRNA mitochondrial localization. The interaction with 5 S rRNA occurs cotranslationally and results in formation of a stable complex in which rhodanese is preserved in a compact enzymatically inactive conformation. Human 5 S rRNA in a branched Mg2+-free form, upon its interaction with misfolded rhodanese, demonstrates characteristic functional traits of Hsp40 cochaperones implicated in mitochondrial precursor protein targeting, suggesting that it may use this mechanism to ensure its own mitochondrial localization. Finally, silencing of the rhodanese gene caused not only a proportional decrease of 5 S rRNA import but also a general inhibition of mitochondrial translation, indicating the functional importance of the imported 5 S rRNA inside the organelle. PMID:20663881

  20. Evaluation of population variation at 17 autosomal STR and 16 Y-STR haplotype loci in Croatians.

    PubMed

    Haliti, Naim; Carapina, Mirela; Masić, Marijana; Strinović, Davor; Klarić, Irena Martinović; Kubat, Milovan

    2009-09-01

    Seventeen autosomal STR loci (D8S1179, D21S11, D7S820, CSF1PO, D3S1358, TH01, D13S317, D16S539, D2S1338, D19S433, VWA, TPOX, D18S51, D5S818, FGA, Penta E and Penta D) and 16 Y-STR haplotype loci (DYS19, DYS385, DYS389I, DYS398II, DYS390, DYS391, DYS392, DYS393, DYS437, DYS438, DYS439, DYS448, DYS456, DYS458, DYS635 and GATA H4.1) were analyzed in the sample of 200 unrelated Croatians. The agreement with HWE was confirmed for all autosomal STR loci. The combined power of discrimination (PD) and the combined power of exclusion (PE) for the 17 autosomal STR loci were 0.999999999999999999682299331476 and 0.99999995, respectively. Penta E proved to be the most informative autosomal STR locus. Among 200 Croatian males, 197 Y-STR haplotypes were identified and haplotype diversity was estimated at 0.9998+/-0.0005. PMID:19647700

  1. Initial results on the molecular phylogeny of the Nudibranchia (Gastropoda, Opisthobranchia) based on 18S rDNA data.

    PubMed

    Wollscheid, E; Wägele, H

    1999-11-01

    This study investigated nudibranch phylogeny on the basis of 18S rDNA sequence data. 18S rDNA sequence data of 19 taxa representing the major living orders and families of the Nudibranchia were analyzed. Representatives of the Cephalaspidea, Anaspidea, Gymnomorpha, Prosobranchia, and Pulmonata were also sequenced and used as outgroups. An additional 28 gastropod sequences taken from GenBank were also included in our analyses. Phylogenetic analyses of these more than 50 gastropod taxa provide strong evidence for support of the monophyly of the Nudibranchia. The monophyly of the Doridoidea, Cladobranchia, and Aeolidoidea within the Nudibranchia are also strongly supported. Phylogenetic utility and information content of the 18S rDNA sequences for Nudibranchia, and Opisthobranchia in general, are examined using the program SplitsTree as well as phylogenetic reconstructions using distance and parsimony approaches. 0Results based on these molecular data are compared with hypotheses about nudibranch phylogeny inferred from morphological data. PMID:10603252

  2. Early-life nutrition modulates the epigenetic state of specific rDNA genetic variants in mice.

    PubMed

    Holland, Michelle L; Lowe, Robert; Caton, Paul W; Gemma, Carolina; Carbajosa, Guillermo; Danson, Amy F; Carpenter, Asha A M; Loche, Elena; Ozanne, Susan E; Rakyan, Vardhman K

    2016-07-29

    A suboptimal early-life environment, due to poor nutrition or stress during pregnancy, can influence lifelong phenotypes in the progeny. Epigenetic factors are thought to be key mediators of these effects. We show that protein restriction in mice from conception until weaning induces a linear correlation between growth restriction and DNA methylation at ribosomal DNA (rDNA). This epigenetic response remains into adulthood and is restricted to rDNA copies associated with a specific genetic variant within the promoter. Related effects are also found in models of maternal high-fat or obesogenic diets. Our work identifies environmentally induced epigenetic dynamics that are dependent on underlying genetic variation and establishes rDNA as a genomic target of nutritional insults. PMID:27386920

  3. Quantitative Trait Loci for Murine Growth

    PubMed Central

    Cheverud, J. M.; Routman, E. J.; Duarte, FAM.; van-Swinderen, B.; Cothran, K.; Perel, C.

    1996-01-01

    Body size is an archetypal quantitative trait with variation due to the segregation of many gene loci, each of relatively minor effect, and the environment. We examine the effects of quantitative trait loci (QTLs) on age-specific body weights and growth in the F(2) intercross of the LG/J and SM/J strains of inbred mice. Weekly weights (1-10 wk) and 75 microsatellite genotypes were obtained for 535 mice. Interval mapping was used to locate and measure the genotypic effects of QTLs on body weight and growth. QTL effects were detected on 16 of the 19 autosomes with several chromosomes carrying more than one QTL. The number of QTLs for age-specific weights varied from seven at 1 week to 17 at 10 wk. The QTLs were each of relatively minor, subequal effect. QTLs affecting early and late growth were generally distinct, mapping to different chromosomal locations indicating separate genetic and physiological systems for early and later murine growth. PMID:8846907

  4. Electron microscopic in situ hybridization and autoradiography: Localization and transcription of rDNA in human lymphocyte nucleoli

    SciTech Connect

    Wachtler, F.; Mosgoeller, W.S.; Schwarzacher, H.G. )

    1990-04-01

    The distribution of ribosomal DNA (rDNA) in the nucleoli of human lymphocytes was revealed by in situ hybridization with a nonautoradiographic procedure at the electron microscopic level. rDNA is located in the dense fibrillar component of the nucleolus but not in the fibrillar centers. In the same cells the incorporation of tritiated uridine takes place in the dense fibrillar component of the nucleolus as seen by autoradiography followed by gold latensification. From these findings it can be concluded that the transcription of ribosomal DNA takes place in the dense fibrillar component of the nucleolus.

  5. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

    PubMed Central

    Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

    2006-01-01

    As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

  6. Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

    PubMed Central

    Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B

    1978-01-01

    A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

  7. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    SciTech Connect

    Hirose, Yutaka Harada, Fumio

    2008-01-04

    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus.

  8. Mouse nucleolin binds to 4.5S RNAh, a small noncoding RNA.

    PubMed

    Hirose, Yutaka; Harada, Fumio

    2008-01-01

    4.5S RNAh is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAh is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAh-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAhin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAh-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAh recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAh was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus. PMID:17971306

  9. Molecular characterization of Gastrodiscoides hominis (Platyhelminthes: Trematoda: Digenea) inferred from ITS rDNA sequence analysis.

    PubMed

    Goswami, L M; Prasad, P K; Tandon, V; Chatterjee, A

    2009-06-01

    Gastrodiscoides hominis (Digenea: Paramphistomata: Gastrodiscidae) is an amphistomid intestinal fluke of pigs causing gastrodiscoidiosis. With the use of molecular tools assisting the conventional diagnostic procedures, we aimed at finding out molecular characterization of G. hominis using PCR amplifications of rDNA ITS (1, 2) sequences. The sequences obtained (GenBank accession numbers EF027096, EF027097, EF027098, EU887294, and EU887295) were compared with available sequences of other digenean parasites, particularly those having a zoonotic potential in the northeastern region of India. The BLAST search revealed a close similarity with members of the family Paramphistomidae, showing maximum similarity with the amphistome, Homalogaster paloniae (subfamily Paramphistominae). Based on various tree construction methods, phylogeny of G. hominis is discussed. PMID:19198879

  10. Molecular Taxonomy of Ganoderma cupreum from Southern India Inferred from ITS rDNA Sequences Analysis

    PubMed Central

    2013-01-01

    Ganoderma is a cosmopolitan wood-rot basidiomycete that has been extensively studied for its pathogencity and medicinal properties. Identification of Ganoderma based on macro-microscopic features led to large number of synonyms which resulted in 250 taxonomic names. A Ganoderma species collected from Courtallam, Tamil Nadu was identified as G. cupreum. Phylogenetic analysis inferred from internal transcribed spacer rDNA region resolved the Indian isolate MYC1 as Ganoderma cupreum which clustered with Australian and Asian "cupreum" clade with 85% bootstrap support BS and shared 99% and 98% nucleotide similarity with Malaysian and Australian 'cupreum' respectively. This study represents the first molecular evidence of G. cupreum from Asian origin. PMID:24493948

  11. 18S rDNA dataset profiling microeukaryotic populations within Chicago area nearshore waters

    PubMed Central

    Searle, Daniel; Sible, Emily; Cooper, Alexandria; Putonti, Catherine

    2016-01-01

    Despite their critical role in the aquatic food web and nutrient cycling, microeukaryotes within freshwater environments are under-studied. Herein we present the first high-throughput molecular survey of microeukaryotes within Lake Michigan. Every two weeks from May 13 to August 5, 2014, we collected surface water samples from the nearshore waters of four Chicago area beaches: Gillson Park, Montrose Beach, 57th Street Beach, and Calumet Beach. Four biological replicates were collected for each sampling date and location, resulting in 112 samples. Eighty-nine of these samples were surveyed through targeted sequencing of the V7 and V8 regions of the 18S rDNA gene. Both technical and biological replicates were sequenced and are included in this dataset. Raw sequence data is available via NCBI’s SRA database (BioProject PRJNA294919). PMID:26904716

  12. 18S rDNA dataset profiling microeukaryotic populations within Chicago area nearshore waters.

    PubMed

    Searle, Daniel; Sible, Emily; Cooper, Alexandria; Putonti, Catherine

    2016-03-01

    Despite their critical role in the aquatic food web and nutrient cycling, microeukaryotes within freshwater environments are under-studied. Herein we present the first high-throughput molecular survey of microeukaryotes within Lake Michigan. Every two weeks from May 13 to August 5, 2014, we collected surface water samples from the nearshore waters of four Chicago area beaches: Gillson Park, Montrose Beach, 57th Street Beach, and Calumet Beach. Four biological replicates were collected for each sampling date and location, resulting in 112 samples. Eighty-nine of these samples were surveyed through targeted sequencing of the V7 and V8 regions of the 18S rDNA gene. Both technical and biological replicates were sequenced and are included in this dataset. Raw sequence data is available via NCBI's SRA database (BioProject PRJNA294919). PMID:26904716

  13. Combining denaturing gradient gel electrophoresis of 16S rDNA V3 region and 16S-23S rDNA spacer region polymorphism analyses for the identification of staphylococci from Italian fermented sausages.

    PubMed

    Blaiotta, Giuseppe; Pennacchia, Carmelina; Ercolini, Danilo; Moschetti, Giancarlo; Villani, Francesco

    2003-09-01

    Separation of amplified V3 region from 16S rDNA by denaturing gradient gel electrophoresis (PCR-DGGE) and 16S-23S rDNA intergenic spacer region polymorphism (ISR-PCR) analyses were tested as tool for differentiation of staphylococcal strains commonly isolated from fermented sausages. Variable V3 regions of 25 staphylococcal reference strains and 96 wild strains of species belonging to the genera Staphylococcus, Micrococcus and Kocuria were analyzed. PCR-DGGE profiles obtained were species-specific for S. sciuri, S. haemolyticus, S. hominis, S. auricularis, S. condimenti, S. kloosi, S. vitulus, S. succinus, S. pasteuri, S. capitis and S. (Macrococcus) caseolyticus. Moreover, 7 groups could be distinguished gathering the remaining species as result of the separation of the V3 rDNA amplicons in DGGE. Furthermore, the combination of the results obtained by PCR-DGGE and ISR-PCR analyses allowed a clear differentiation of all the staphylococcal species analysed, with exception of the pairs S. equorum-S. cohnii and S. carnosus-S. schleiferi. The suitability of both molecular techniques and of the combination their results for the identification of staphylococci was validated analysing partial nucleotide sequence of the 16S rDNA of a representative number of wild strains. PMID:14529185

  14. Complete structure of nuclear rDNA of the obligate plant parasite Plasmodiophora brassicae: intraspecific polymorphisms in the exon and group I intron of the large subunit rDNA.

    PubMed

    Niwa, Rieko; Kawahara, Ai; Murakami, Hiroharu; Tanaka, Shuhei; Ezawa, Tatsuhiro

    2011-07-01

    Plasmodiophora brassicae is a soil-borne obligate intracellular parasite in the phylum Cercozoa of the Rhizaria that causes clubroot disease of crucifer crops. To control the disease, understanding the distribution and infection routes of the pathogen is essential, and thus development of reliable molecular markers to discriminate geographic populations is required. In this study, the nuclear ribosomal RNA gene (rDNA) repeat unit of P. brassicae was determined, with particular emphasis on the structure of large subunit (LSU) rDNA, in which polymorphic regions were expected to be present. The complete rDNA complex was 9513bp long, which included the small subunit, 5.8S and LSU rDNAs as well as the internal transcribed spacer and intergenic spacer regions. Among eight field populations collected from throughout Honshu Island, Japan, a 1.1 kbp region of the LSU rDNA, including the divergent 8 domain, exhibited intraspecific polymorphisms that reflected geographic isolation of the populations. Two new group I introns were found in this region in six out of the eight populations, and the sequences also reflected their geographic isolation. The polymorphic region found in this study may have potential for the development of molecular markers for discrimination of field populations/isolates of this organism. PMID:21497131

  15. Species markers for equine strongyles detected in intergenic rDNA by PCR-RFLP.

    PubMed

    Gasser, R B; Stevenson, L A; Chilton, N B; Nansen, P; Bucknell, D G; Beveridge, I

    1996-10-01

    Five species of equine strongyle belonging to the subfamily Strongylinae (Strongylus edentatus, S. equinus, S. vulgaris, Oesophagodontus robustus and Triodontophorus serratus) and 11 species belonging to the subfamily Cyathostominae (Poteriostomum imparidentatum, P. ratzii, Cylicocyclus insignis, Cc. leptostomus, Cc. nassatus, Cylicostephanus calicatus, Cs. longibursatus, Cs. goldi, Cyathostomum catinatum, Cy. labiatum and Cy. pateratum) were characterized using a polymerase chain reaction-linked restriction fragment length polymorphism technique (PCR-RFLP). Internal transcribed spacer ribosomal DNA was amplified from genomic DNA by polymerase chain reaction (PCR) using conserved primers, digested separately with six restriction endonucleases (AluI, BfaI, CfoI, Hae III, VSpI and XbaI) and the fragments separated by agarose gel electrophoresis. The PCR products of the three Strongylus species were approx. 90-100 bp smaller in size compared with those of the other 13 species. The PCR-RFLP analysis of the rDNA region spanning the first and second internal transcribed spacers plus the 5.85 rDNA gene (ITS+) produced characteristic patterns for each of the 16 species examined, and no variation in RFLP patterns was detected within the species Cy. catinatum, where multiple isolates were analysed. The study demonstrates that the internal transcribed spacer sequences provide genetic markers for the species identification of a range of equine strongyles. These markers will be of use for the identification of egg and larval stages, where morphological characters alone are unreliable. The results also indicate that the spacer sequences will be of use to study the systematics of equine strongyles. PMID:8910892

  16. Molecular rDNA phylogeny of Telotylenchidae Siddiqi, 1960 and evaluation of tail termini

    PubMed Central

    Carta, L. K.; Skantar, A. M.; Handoo, Z. A.

    2010-01-01

    Three stunt nematode species, Tylenchorhynchus leviterminalis, T. dubius and T. claytoni were characterized with segments of small subunit 18S and large subunit 28S rDNA sequence and placed in molecular phylogenetic context with other polyphyletic taxa of Telotylenchidae. Based upon comparably sized phylogenetic breadth of outgroups and ingroups, the 28S rDNA contained three times the number of phylogenetically informative alignment characters relative to the alignment total compared to the larger 18S dataset even though there were fewer than half the number of taxa represented. Tail shapes and hyaline termini were characterized for taxa within these subfamily trees, and variability discussed for some related species. In 18S trees, similar terminal tail thickness was found in a well-supported clade of three Tylenchorhynchus: broad-tailed T. leviterminalis branched outside relatively narrow-tailed T. claytoni and T. nudus. Terminal tail thickness within Merliniinae, Telotylenchinae and related taxa showed a mosaic distribution. Thick-tailed Trophurus, Macrotrophurus and putative Paratrophurus did not group together in the 18S tree. Extremely thickened tail termini arose at least once in Amplimerlinius and Pratylenchoides among ten species of Merliniinae plus three Pratylenchoides, and three times within twelve taxa of Telotylenchinae and Trophurinae. Conflicting generic and family nomenclature based on characters such as pharyngeal overlap are discussed in light of current molecular phylogeny. Contrary to some expectations from current taxonomy, Telotylenchus and Tylenchorhynchus cf. robustus did not cluster with three Tylenchorhynchus spp. Two putative species of Neodolichorhynchus failed to group together, and two populations of Scutylenchus quadrifer demonstrated as much or greater genetic distance between them than among three related species of Merlinius. PMID:22736870

  17. Phylogenetic analysis of Demodex caprae based on mitochondrial 16S rDNA sequence.

    PubMed

    Zhao, Ya-E; Hu, Li; Ma, Jun-Xian

    2013-11-01

    Demodex caprae infests the hair follicles and sebaceous glands of goats worldwide, which not only seriously impairs goat farming, but also causes a big economic loss. However, there are few reports on the DNA level of D. caprae. To reveal the taxonomic position of D. caprae within the genus Demodex, the present study conducted phylogenetic analysis of D. caprae based on mt16S rDNA sequence data. D. caprae adults and eggs were obtained from a skin nodule of the goat suffering demodicidosis. The mt16S rDNA sequences of individual mite were amplified using specific primers, and then cloned, sequenced, and aligned. The sequence divergence, genetic distance, and transition/transversion rate were computed, and the phylogenetic trees in Demodex were reconstructed. Results revealed the 339-bp partial sequences of six D. caprae isolates were obtained, and the sequence identity was 100% among isolates. The pairwise divergences between D. caprae and Demodex canis or Demodex folliculorum or Demodex brevis were 22.2-24.0%, 24.0-24.9%, and 22.9-23.2%, respectively. The corresponding average genetic distances were 2.840, 2.926, and 2.665, and the average transition/transversion rates were 0.70, 0.55, and 0.54, respectively. The divergences, genetic distances, and transition/transversion rates of D. caprae versus the other three species all reached interspecies level. The five phylogenetic trees all presented that D. caprae clustered with D. brevis first, and then with D. canis, D. folliculorum, and Demodex injai in sequence. In conclusion, D. caprae is an independent species, and it is closer to D. brevis than to D. canis, D. folliculorum, or D. injai. PMID:23996126

  18. 104. JOB NO. 1347F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    104. JOB NO. 1347-F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD MOTOR COMPANY; LONGITUDINAL SECTION AND TRUSS DETAILS - Ford Motor Company Long Beach Assembly Plant, Assembly Building, 700 Henry Ford Avenue, Long Beach, Los Angeles County, CA

  19. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  20. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    NASA Technical Reports Server (NTRS)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  1. Nucleotide sequence of 5S ribosomal RNA from Aspergillus nidulans and Neurospora crassa.

    PubMed Central

    Piechulla, B; Hahn, U; McLaughlin, L W; Küntzel, H

    1981-01-01

    The nucleotide sequences of 5S rRNA molecules isolated from the cytosol and the mitochondria of the ascomycetes A. nidulans and N. crassa were determined by partial chemical cleavage of 3'-terminally labelled RNA. The sequence identity of the cytosolic and mitochondrial RNA preparations confirms the absence of mitochondrion-specific 5S rRNA in these fungi. The sequences of the two organisms differ in 35 positions, and each sequence differs from yeast 5S rRNA in 44 positions. Both molecules contain the sequence GCUC in place of GAAC or GAUY found in all other 5S rRNAs, indicating that this region is not universally involved in base-pairing to the invariant GTpsiC sequence of tRNAs. Images PMID:6453331

  2. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    PubMed

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p< 0.001). After the implementation of 5S it was observed and determined that facilitating the job and setting up a safe environment created

  3. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  4. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  5. One-stage surgery through posterior approach-for L5-S1 spondyloptosis

    PubMed Central

    Suslu, Hikmet Turan; Celikoglu, Erhan; Borekcı, Ali; Hıcdonmez, Tufan; Suslu, Hüsnü

    2011-01-01

    Grade 5 spondylolisthesis or spondyloptosis is a rare condition. Generally, the surgical management of spondyloptosis includes multi-staged procedures instead of one-staged procedures. One-stage treatment for spondyloptosis is very rare. A 15-year-old girl with L5-S1 spondyloptosis was admitted with severe low back pain. There was no history of trauma. The patient underwent L5 laminectomy, L5-S1 discectomy, resection of sacral dome, reduction, L3-L4-L5-S1 pedicular screw fixation, and interbody-posterolateral fusion through the posterior approach. The reduction was maintained with bilateral L5-S1 discectomy, resection of the sacral dome, and transpedicular instrumentation from L3 to S1. In this particular case, one-staged approach was adequate for the treatment of L5-S1 spondyloptosis. One-staged surgery using the posterior approach may be adequate for the treatment of L5-S1 spondyloptosis while avoiding the risks inherent in anterior approaches. PMID:23125496

  6. Direct 5S rRNA Assay for Monitoring Mixed-Culture Bioprocesses

    PubMed Central

    Stoner, D. L.; Browning, C. K.; Bulmer, D. K.; Ward, T. E.; MacDonell, M. T.

    1996-01-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species extracted from collected biomass. Separation is based on the unique migration behavior of each 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the genera Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. PMID:16535333

  7. Microbial rRNA: rDNA gene ratios may be unexpectedly low due to extracellular DNA preservation in soils

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We tested a method of estimating the activity of detectable individual bacterial and archaeal OTUs within a community by calculating ratios of absolute 16S rRNA to rDNA copy numbers. We investigated phylogenetically coherent patterns of activity among soil prokaryotes in non-growing soil communitie...

  8. ASSESSMENT OF FECAL POLLUTION SOURCES IN PLUM CREEK WATERSHED USING BACTEROIDETES 16S RDNA-BASED ASSAYS

    EPA Science Inventory

    Recently, 16S rDNA Bacteroidetes-targeted PCR assays were developed to discriminate between ruminant and human fecal pollution. These assays are rapid and relatively inexpensive but have been used in a limited number of studies. In this study, we evaluated the efficacy o...

  9. Bacterial diversity in the rumen of Indian Surti buffalo (Bubalus bubalis), assessed by 16S rDNA analysis.

    PubMed

    Pandya, P R; Singh, K M; Parnerkar, S; Tripathi, A K; Mehta, H H; Rank, D N; Kothari, R K; Joshi, C G

    2010-01-01

    Bacterial communities in buffalo rumen were characterized using a culture-independent approach for a pooled sample of rumen fluid from 3 adult Surti buffaloes. Buffalo rumen is likely to include species of various bacterial phyla, so 16S rDNA sequences were amplified and cloned from the sample. A total of 191 clones were sequenced and similarities to known 16S rDNA sequences were examined. About 62.82% sequences (120 clones) had >90% similarity to the 16S rDNA database sequences. Furthermore, about 34.03% of the sequences (65 clones) were 85-89% similar to 16S rDNA database sequences. For the remaining 3.14%; the similarity was lower than 85% Phylogenetic analyses were also used to infer the makeup of bacterial communities in the rumen of Surti buffalo. As a result, we distinguished 42 operational taxonomic units (OTUs) based on unique 16S r DNA sequences: 19 OTUs affiliated to an unidentified group (45.23% of total OTUs), 11 OTUs of the phylum Firmicutes, also known as the low G+C group (26.19%), 7 OTUs of the Cytophaga-Flexibacter-Bacteroides phylum (16.66%), 4 OTUs of Spirochaetes (9.52%), and 1 OTU of Actinobacteria (2.38%). These include 10 single-clone OTUs, so Good's coverage (94.76%) of 16S rRNA libraries indicated that sequences identified in the libraries represent the majority of bacterial diversity present in rumen. PMID:20720314

  10. Methanogen diversity in the rumen of Indian Surti buffalo (Bubalus bubalis), assessed by 16S rDNA analysis.

    PubMed

    Singh, K M; Tripathi, A K; Pandya, P R; Parnerkar, S; Rank, D N; Kothari, R K; Joshi, C G

    2012-06-01

    The methanogenic communities in buffalo rumen were characterized using a culture-independent approach of a pooled sample of rumen fluid from three adult Surti buffaloes. Buffalo rumen is likely to include species of various methanogens, so 16S rDNA sequences were amplified and cloned from the sample. A total of 171 clones were sequenced to examine 16S rDNA sequence similarity. About 52.63% sequences (90 clones) had ≥ 90% similarity, whereas, 46.78% of the sequences (81 clones) were 75-89% similar to 16S rDNA database sequences, respectively. Phylogenetic analyses were also used to infer the makeup of methanogenic communities in the rumen of Surti buffalo. As a result, we distinguished 23 operational taxonomic units (OTUs) based on unique 16S rDNA sequences: 12 OTUs (52.17%) affiliated to Methanomicrobiales order, 10 OTUs (43.47%) of the order Methanobacteriales and one OTU (4.34%) of Methanosarcina barkeri like clone, respectively. In addition, the population of Methanomicrobiales and Methabacteriales orders were also observed, accounting 4% and 2.17% of total archea. This study has revealed the largest assortment of hydrogenotrophic methanogens phylotypes ever identified from rumen of Surti buffaloes. PMID:21507441

  11. ASSESSMENT OF FECAL POLLUTION SOURCES IN PLUM CREEK WATERSHED USING PCR AND PHYLOGENETIC ANALYSES OF BACTEROIDETES 16S RDNA

    EPA Science Inventory

    Traditional methods for assessing fecal pollution in environmental systems, such as monitoring for fecal coliforms are not capable of discriminating between different sources fecal pollution. Recently, 16S rDNA Bacteroidetes-targeted PCR assays were developed to discriminate betw...

  12. Hungarian population data on seven PCR-based loci.

    PubMed

    Budowle, B; Woller, J; Koons, B W; Furedi, S; Errera, J D; Padar, Z

    1996-07-01

    Hungarian population data for the loci LDLR, GYPA, HBGG, D7S8, Gc, HLA-DQA1, and D1S80 were generated. The genotype frequency distributions for the loci do not deviate from Hardy Weinberg expectations. Furthermore, there was little evidence for departures from expectations of independence between the loci. Using a test for homogeneity all the loci were similar between two Hungarian population samples and only the HLA-DQA1 locus was statistically different between Hungarians and US Caucasians. There generally would be little forensic differences, whether a Hungarian or a US Caucasian database was used, for estimating multiple locus profile frequencies for the seven PCR-based loci. PMID:8754580

  13. Development of eighteen microsatellite loci in walleye (Sander vitreus)

    USGS Publications Warehouse

    Coykendall, Dolly K.; Morrison, Cheryl L.; Stott, Wendy; Springmann, Marcus J.

    2014-01-01

    A suite of tri- and tetra-nucleotide microsatellite loci were developed for walleye (Sander vitreus) from 454 pyrosequencing data. Eighteen of the 50 primer sets tested amplified consistently in 35 walleye from two lakes on Isle Royale, Lake Superior: Chickenbone Lake and Whittlesey Lake. The loci displayed moderate levels of allelic diversity (average 5.5 alleles/locus) and heterozygosity (average 35.8 %). Levels of genetic diversity were sufficient to produce unique multi-locus genotypes and detect phylogeographic structuring as individuals assigned back to their population of origin. Cross-species amplification within S. canadensis (sauger) was successful for 15 loci, and 11 loci were diagnostic to species. The loci characterized here will be useful for detecting fine-scale spatial structuring, resolving the taxonomic status of Sander species and sub-species, and detecting walleye/sauger hybrids.

  14. Macrolide Resistance in Treponema pallidum Correlates With 23S rDNA Mutations in Recently Isolated Clinical Strains

    PubMed Central

    Molini, Barbara J.; Tantalo, Lauren C.; Sahi, Sharon K.; Rodriguez, Veronica I.; Brandt, Stephanie L.; Fernandez, Mark C.; Godornes, Charmie B.; Marra, Christina M.; Lukehart, Sheila A.

    2016-01-01

    Background High rates of 23S rDNA mutations implicated in macrolide resistance have been identified in Treponema pallidum samples from syphilis patients in many countries. Nonetheless, some clinicians have been reluctant to abandon azithromycin as a treatment for syphilis, citing the lack of a causal association between these mutations and clinical evidence of drug resistance. Although azithromycin resistance has been demonstrated in vivo for the historical Street 14 strain, no recent T. pallidum isolates have been tested. We used the well-established rabbit model of syphilis to determine the in vivo efficacy of azithromycin against 23S rDNA mutant strains collected in 2004 to 2005 from patients with syphilis in Seattle, Wash. Methods Groups of 9 rabbits were each infected with a strain containing 23S rDNA mutation A2058G (strains UW074B, UW189B, UW391B) or A2059G (strains UW228B, UW254B, and UW330B), or with 1 wild type strain (Chicago, Bal 3, and Mexico A). After documentation of infection, 3 animals per strain were treated with azithromycin, 3 were treated with benzathine penicillin G, and 3 served as untreated control groups. Treatment efficacy was documented by darkfield microscopic evidence of T. pallidum, serological response, and rabbit infectivity test. Results Azithromycin uniformly failed to cure rabbits infected with strains harboring either 23S rDNA mutation, although benzathine penicillin G was effective. Infections caused by wild type strains were successfully treated by either azithromycin or benzathine penicillin G. Conclusions A macrolide resistant phenotype was demonstrated for all strains harboring a 23S rDNA mutation, demonstrating that either A2058G or A2059G mutation confers in vivo drug resistance. PMID:27513385

  15. [Rapid detection of Pseudomonas aeruginosa by the fluorescence quantitative PCR assay targeting 16S rDNA].

    PubMed

    Xue, Li-Jun; Wang, Yong-Zhi; Ren, Hao; Tong, Yi-Min; Zhao, Ping; Zhu, Shi-Ying; Qi, Zhong-Tian

    2006-09-01

    The 16S rDNA specific primers were designed for rapid detection of Pseudomonas aeruginosa (PA) by the fluorescence quantitative PCR (FQ-PCR) assay, based upon multiple sequence alignment and phylogenetic tree analysis of the 16S rDNAs of over 20 bacteria. After extraction of PA genomic DNA, the target 16S rDNA fragment was amplified by PCR with specific primers, and used to construct recombinant pMDT-Pfr plasmid, the dilution gradients of which were subjected to the standard quantitation curve in FQ-PCR assay. Different concentrations of PA genomic DNA were detected by FQ-PCR in a 20microL of reaction system with SYBR Green I. At the same time, various genomic DNAs of Staphylococcus aureus, Salmonella typhi, Shigella flexneri, Proteus vulgaris, Staphylococcus epidermidis, Escherichia coli, and Mycobacterium tuberculosis were used as negative controls to confirm specificity of the FQ-PCR detection assay. Results demonstrated that the predicted amplified product of designed primers was of high homology only with PA 16S rDNA, and that sensitivity of the FQ-PCR assay was of 3.6pg/microL of bacterial DNA or (2.1 x 10(3) +/- 3.1 x 10(2)) copies/microL of 16S rDNA, accompanied with high specificity, and that the whole detection process including DNA extraction could be completed in about two hours. In contrast to traditional culture method, the FQ-PCR assay targeting 16S rDNA gene can be used to detect PA rapidly, which exhibits perfect application prospect in future. PMID:17037203

  16. Fragile Sites of ‘Valencia’ Sweet Orange (Citrus sinensis) Chromosomes Are Related with Active 45s rDNA

    PubMed Central

    Lan, Hong; Chen, Chun-Li; Miao, Yin; Yu, Chang-Xiu; Guo, Wen-Wu; Xu, Qiang; Deng, Xiu-Xin

    2016-01-01

    Citrus sinensis chromosomes present a morphological differentiation of bands after staining by the fluorochromes CMA and DAPI, but there is still little information on its chromosomal characteristics. In this study, the chromosomes in ‘Valencia’ C. sinensis were analyzed by fluorescence in situ hybridization (FISH) using telomere DNA and the 45S rDNA gene as probes combining CMA/DAPI staining, which showed that there were two fragile sites in sweet orange chromosomes co-localizing at distended 45S rDNA regions, one proximally locating on B-type chromosome and the other subterminally locating on D-type chromosome. While the chromosomal CMA banding and 45S rDNA FISH mapping in the doubled haploid line of ‘Valencia’ C. sinensis indicated six 45S rDNA regions, four were identified as fragile sites as doubled comparing its parental line, which confirmed the cytological heterozygosity and chromosomal heteromorphisms in sweet orange. Furthermore, Ag-NOR identified two distended 45S rDNA regions to be active nucleolar organizing regions (NORs) in diploid ‘Valencia’ C. sinensis. The occurrence of quadrivalent in meiosis of pollen mother cells (PMCs) in ‘Valencia’ sweet orange further confirmed it was a chromosomal reciprocal translocation line. We speculated this chromosome translocation was probably related to fragile sites. Our data provide insights into the chromosomal characteristics of the fragile sites in ‘Valencia’ sweet orange and are expected to facilitate the further investigation of the possible functions of fragile sites. PMID:26977938

  17. Population data on the thirteen CODIS core short tandem repeat loci in African Americans, U.S. Caucasians, Hispanics, Bahamians, Jamaicans, and Trinidadians.

    PubMed

    Budowle, B; Moretti, T R; Baumstark, A L; Defenbaugh, D A; Keys, K M

    1999-11-01

    Allele distributions for 13 tetrameric short tandem repeat (STR) loci, CSF1PO, FGA, TH01, TPOX, VWA, D3S1358, D5S818, D7S820, D8S1179, D13S317, D16S539, D18S51, and D21S11, were determined in African American, United States Caucasian, Hispanic, Bahamian, Jamaican, and Trinidadian sample populations. There was little evidence for departures from Hardy-Weinberg expectations (HWE) in any of the populations. Based on the exact test, the loci that departed significantly from HWE are: D21S11 (p = 0.010, Bahamians); CSF1PO (p = 0.014, Trinidadians); TPOX (p = 0.011, Jamaicans and p = 0.035, U.S. Caucasians); and D16S539 (p = 0.043, Bahamians). After employing the Bonferroni correction for the number of loci analyzed (i.e., 13 loci per database), these observations are not likely to be significant. There is little evidence for association of alleles between the loci in these databases. The allelic frequency data are similar to other comparable data within the same major population group. PMID:10582369

  18. Genetic study of 15 STRs loci of Identifiler system in Angola population.

    PubMed

    Melo, Miguel Manuel; Carvalho, Mónica; Lopes, Virgínia; Anjos, Maria João; Serra, Armando; Vieira, Duarte Nuno; Sequeiros, Jorge; Corte-Real, Francisco

    2010-10-01

    Angola is located in the African continent, in the area of southern Africa and has a population of approximately 14 million inhabitants. The Angola population has origin from Occidental and Southern Bantu people that came from the great lakes region, creating the most ever known African migration of our days. Allele frequencies for the 15 STRs loci in the AmpFlSTR Identifiler kit (D8S1179, D21S11, D7S820, CSF1PO, D3S1358, HUMTH01, D13S317, D16S539, D2S1338, D19S433, HUMVWA, TPOX, D18S51, D5S818, HUMFIBRA/FGA and including the segment of the X-Y homologous gene amelogenin) were studied for Angola population. The genotype frequency of the 15 STR loci showed no significant deviations from Hardy-Weinberg equilibrium expectations and great values for the combined power of discrimination and combined power of a priori exclusion validate the application of these markers in forensic genetics. Comparative analyses between Angola population data and other relevant population database from Africa, Europe and American are presented. PMID:20457105

  19. False homozygosities at various loci revealed by discrepancies between commercial kits: implications for genetic databases.

    PubMed

    Delamoye, Magali; Duverneuil, Charlotte; Riva, Katia; Leterreux, Michel; Taieb, Stéphane; De Mazancourt, Philippe

    2004-06-30

    Routine control of 2055 consecutive genotypes revealed discrepancies between the profiles established with the SGM plus and/or Profiler plus kits on one hand, and the profiles established with the Powerplex16 kit on the other hand. Furthermore, five discrepancies for vWA, three for D8S1179, two for FGA and three for D18S51 loci were found. In 10 cases (loci vWA, FGA, D18S51, D8S1179), the SGM plus and/or Profiler plus profiles showed homozygosity and the Powerplex16 genotype revealed heterozygosities which were confirmed to be true, both by typing with individual primer pairs and DNA sequencing. In four cases (two discrepancies at locus FGA, one at D18S51 and an abnormal paternity pattern for D5S818), the Powerplex16 kit showed apparent homozygosity and the SGM plus and/or Profiler plus kits showed heterozygosity. Mutation analysis could be performed for some of these individuals and evidenced variants, presumably leading to an annealing failure of one primer; the identified mutations are reported. It is suggested that databases should include information about the kits used to determine the profiles while ensuring that the primer sequences are made available. PMID:15177629

  20. Spare PRELI Gene Loci: Failsafe Chromosome Insurance?

    PubMed Central

    Rangel, Roberto; Ortiz-Quintero, Blanca; Blackburn, Michael R.; Martinez-Valdez, Hector

    2012-01-01

    Background LEA (late embryogenesis abundant) proteins encode conserved N-terminal mitochondrial signal domains and C-terminal (A/TAEKAK) motif repeats, long-presumed to confer cell resistance to stress and death cues. This prompted the hypothesis that LEA proteins are central to mitochondria mechanisms that connect bioenergetics with cell responses to stress and death signaling. In support of this hypothesis, recent studies have demonstrated that mammalian LEA protein PRELI can act as a biochemical hub, which upholds mitochondria energy metabolism, while concomitantly promoting B cell resistance to stress and induced death. Hence, it is important to define in vivo the physiological relevance of PRELI expression. Methods and Findings Given the ubiquitous PRELI expression during mouse development, embryo lethality could be anticipated. Thus, conditional gene targeting was engineered by insertion of flanking loxP (flox)/Cre recognition sites on PRELI chromosome 13 (Chr 13) locus to abort its expression in a tissue-specific manner. After obtaining mouse lines with homozygous PRELI floxed alleles (PRELIf/f), the animals were crossed with CD19-driven Cre-recombinase transgenic mice to investigate whether PRELI inactivation could affect B-lymphocyte physiology and survival. Mice with homozygous B cell-specific PRELI deletion (CD19-Cre/Chr13 PRELI−/−) bred normally and did not show any signs of morbidity. Histopathology and flow cytometry analyses revealed that cell lineage identity, morphology, and viability were indistinguishable between wild type CD19-Cre/Chr13 PRELI+/+ and CD19-Cre/Chr13 PRELI−/− deficient mice. Furthermore, B cell PRELI gene expression seemed unaffected by Chr13 PRELI gene targeting. However, identification of additional PRELI loci in mouse Chr1 and Chr5 provided an explanation for the paradox between LEA-dependent cytoprotection and the seemingly futile consequences of Chr 13 PRELI gene inactivation. Importantly, PRELI expression from spare

  1. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  2. Chromosomal localization and sequence variation of 5S rRNA gene in five Capsicum species.

    PubMed

    Park, Y K; Park, K C; Park, C H; Kim, N S

    2000-02-29

    Chromosomal localization and sequence analysis of the 5S rRNA gene were carried out in five Capsicum species. Fluorescence in situ hybridization revealed that chromosomal location of the 5S rRNA gene was conserved in a single locus at a chromosome which was assigned to chromosome 1 by the synteny relationship with tomato. In sequence analysis, the repeating units of the 5S rRNA genes in the Capsicum species were variable in size from 278 bp to 300 bp. In sequence comparison of our results to the results with other Solanaceae plants as published by others, the coding region was highly conserved, but the spacer regions varied in size and sequence. T stretch regions, just after the end of the coding sequences, were more prominant in the Capsicum species than in two other plants. High G x C rich regions, which might have similar functions as that of the GC islands in the genes transcribed by RNA PolII, were observed after the T stretch region. Although we could not observe the TATA like sequences, an AT rich segment at -27 to -18 was detected in the 5S rRNA genes of the Capsicum species. Species relationship among the Capsicum species was also studied by the sequence comparison of the 5S rRNA genes. While C. chinense, C. frutescens, and C. annuum formed one lineage, C. baccatum was revealed to be an intermediate species between the former three species and C. pubescens. PMID:10774742

  3. Affinity chromatography of Drosophila melanogaster ribosomal proteins to 5S rRNA.

    PubMed

    Stark, B C; Chooi, W Y

    1985-02-20

    The binding of Drosophila melanogaster ribosomal proteins to D. melanogaster 5S rRNA was studied using affinity chromatography of total ribosomal proteins (TP80) on 5S rRNA linked via adipic acid dihydrazide to Sepharose 4B. Ribosomal proteins which bound 5S rRNA at 0.3 M potassium chloride and were eluted at 1 M potassium chloride were identified as proteins 1, L4, 2/3, L14/L16, and S1, S2, S3, S4, S5, by two-dimensional polyacrylamide gel electrophoresis. Using poly A-Sepharose 4B columns as a model of non-specific binding, we found that a subset of TP80 proteins is also bound. This subset, while containing some of the proteins bound by 5S rRNA columns, was distinctly different from the latter subset, indicating that the binding to 5S rRNA was specific for that RNA species. PMID:3923010

  4. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    PubMed Central

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  5. Contrasting evolutionary histories among tightly linked HLA loci.

    PubMed Central

    Klitz, W; Thomson, G; Baur, M P

    1986-01-01

    Genes comprising the major histocompatibility complex (MHC) play a central role in governing the immune response of vertebrates. A great deal of information has been revealed on the molecular biology and physiology of these loci, but three features-the high polymorphism, tight linkage among the loci, and the nonrandom association of alleles-make the system of particular interest from the perspective of population genetics. Information on the dynamic evolutionary forces that have acted on a locus can be inferred from the number and distribution of alleles that it carries. Ten loci from the HLA region of the human MHC, each sampled from several different populations, have been examined for departures from the expected value of homozygosity under the condition of selective neutrality. The homozygosities of five class I and II loci that code for membrane glycoproteins, HLA-A, -B, -C, -DR, and -DQ, and of glyoxylase I (GLO) were significantly less than the neutrality expectations. This suggests the presence of some form of balancing selection. In spite of being closely linked, in fact, located between the class I and class II histocompatibility loci, the homozygosities of the four class III or complement loci C2, Bf, C4A, and C4B, which are detected by electrophoresis, were indistinguishable from, or exceeded, that expected under neutrality. Although this conforms to the suggestion that, in general, electrophoretic variants are neutral, because of the tight linkage to loci demonstrating a history of selection, it is possible that the mechanism for generating variation in the class III loci may be different from that of the class I and class II loci. PMID:3766540

  6. Naturally segregating loci exhibit epistasis for fitness

    PubMed Central

    Monnahan, Patrick J.; Kelly, John K.

    2015-01-01

    The extent to which gene interaction or epistasis contributes to fitness variation within populations remains poorly understood, despite its importance to a myriad of evolutionary questions. Here, we report a multi-year field study estimating fitness of Mimulus guttatus genetic lines in which pairs of naturally segregating loci exist in an otherwise uniform background. An allele at QTL x5b—a locus originally mapped for its effect on flower size—positively affects survival if combined with one genotype at quantitative trait locus x10a (aa) but has negative effects when combined with the other genotypes (Aa and AA). The viability differences between genotypes parallel phenotypic differences for the time and node at which a plant flowers. Viability is negatively correlated with fecundity across genotypes, indicating antagonistic pleiotropy for fitness components. This trade-off reduces the genetic variance for total fitness relative to the individual fitness components and thus may serve to maintain variation. Additionally, we find that the effects of each locus and their interaction often vary with the environment. PMID:26246336

  7. Mapping Environment-Specific Quantitative Trait Loci

    PubMed Central

    Chen, Xin; Zhao, Fuping; Xu, Shizhong

    2010-01-01

    Environment-specific quantitative trait loci (QTL) refer to QTL that express differently in different environments, a phenomenon called QTL-by-environment (Q × E) interaction. Q × E interaction is a difficult problem extended from traditional QTL mapping. The mixture model maximum-likelihood method is commonly adopted for interval mapping of QTL, but the method is not optimal in handling QTL interacting with environments. We partitioned QTL effects into main and interaction effects. The main effects are represented by the means of QTL effects in all environments and the interaction effects are represented by the variances of the QTL effects across environments. We used the Markov chain Monte Carlo (MCMC) implemented Bayesian method to estimate both the main and the interaction effects. The residual error covariance matrix was modeled using the factor analytic covariance structure. A simulation study showed that the factor analytic structure is robust and can handle other structures as special cases. The method was also applied to Q × E interaction mapping for the yield trait of barley. Eight markers showed significant main effects and 18 markers showed significant Q × E interaction. The 18 interacting markers were distributed across all seven chromosomes of the entire genome. Only 1 marker had both the main and the Q × E interaction effects. Each of the other markers had either a main effect or a Q × E interaction effect but not both. PMID:20805558

  8. Alu insertion loci and platyrrhine primate phylogeny.

    PubMed

    Ray, David A; Xing, Jinchuan; Hedges, Dale J; Hall, Michael A; Laborde, Meredith E; Anders, Bridget A; White, Brittany R; Stoilova, Nadica; Fowlkes, Justin D; Landry, Kate E; Chemnick, Leona G; Ryder, Oliver A; Batzer, Mark A

    2005-04-01

    Short INterspersed Elements (SINEs) make very useful phylogenetic markers because the integration of a particular element at a location in the genome is irreversible and of known polarity. These attributes make analysis of SINEs as phylogenetic characters an essentially homoplasy-free affair. Alu elements are primate-specific SINEs that make up a large portion of the human genome and are also widespread in other primates. Using a combination wet-bench and computational approach we recovered 190 Alu insertions, 183 of which are specific to the genomes of nine New World primates. We used these loci to investigate branching order and have produced a cladogram that supports a sister relationship between Atelidae (spider, woolly, and howler monkeys) and Cebidae (marmosets, tamarins, and owl monkeys) and then the joining of this two family clade to Pitheciidae (titi and saki monkeys). The data support these relationships with a homoplasy index of 0.00. In this study, we report one of the largest applications of SINE elements to phylogenetic analysis to date, and the results provide a robust molecular phylogeny for platyrrhine primates. PMID:15737586

  9. New basal cell carcinoma susceptibility loci

    PubMed Central

    Stacey, Simon N.; Helgason, Hannes; Gudjonsson, Sigurjon A.; Thorleifsson, Gudmar; Zink, Florian; Sigurdsson, Asgeir; Kehr, Birte; Gudmundsson, Julius; Sulem, Patrick; Sigurgeirsson, Bardur; Benediktsdottir, Kristrun R.; Thorisdottir, Kristin; Ragnarsson, Rafn; Fuentelsaz, Victoria; Corredera, Cristina; Gilaberte, Yolanda; Grasa, Matilde; Planelles, Dolores; Sanmartin, Onofre; Rudnai, Peter; Gurzau, Eugene; Koppova, Kvetoslava; Nexø, Bjørn A.; Tjønneland, Anne; Overvad, Kim; Jonasson, Jon G.; Tryggvadottir, Laufey; Johannsdottir, Hrefna; Kristinsdottir, Anna M.; Stefansson, Hreinn; Masson, Gisli; Magnusson, Olafur T.; Halldorsson, Bjarni V.; Kong, Augustine; Rafnar, Thorunn; Thorsteinsdottir, Unnur; Vogel, Ulla; Kumar, Rajiv; Nagore, Eduardo; Mayordomo, José I.; Gudbjartsson, Daniel F.; Olafsson, Jon H.; Stefansson, Kari

    2015-01-01

    In an ongoing screen for DNA sequence variants that confer risk of cutaneous basal cell carcinoma (BCC), we conduct a genome-wide association study (GWAS) of 24,988,228 SNPs and small indels detected through whole-genome sequencing of 2,636 Icelanders and imputed into 4,572 BCC patients and 266,358 controls. Here we show the discovery of four new BCC susceptibility loci: 2p24 MYCN (rs57244888[C], OR=0.76, P=4.7 × 10−12), 2q33 CASP8-ALS2CR12 (rs13014235[C], OR=1.15, P=1.5 × 10−9), 8q21 ZFHX4 (rs28727938[G], OR=0.70, P=3.5 × 10−12) and 10p14 GATA3 (rs73635312[A], OR=0.74, P=2.4 × 10−16). Fine mapping reveals that two variants correlated with rs73635312[A] occur in conserved binding sites for the GATA3 transcription factor. In addition, expression microarrays and RNA-seq show that rs13014235[C] and a related SNP rs700635[C] are associated with expression of CASP8 splice variants in which sequences from intron 8 are retained. PMID:25855136

  10. Photoionization study of Xe 5s: ionization cross sections and photoelectron angular distributions

    NASA Astrophysics Data System (ADS)

    Aarthi, G.; Jose, J.; Deshmukh, S.; Radojevic, V.; Deshmukh, P. C.; Manson, S. T.

    2014-01-01

    We report studies of photoelectron angular distribution and cross-section for photoionization of xenon 5s electrons using the relativistic multiconfiguration Tamm-Dancoff (MCTD) approximation. We find that MCTD provides a significantly improved agreement with experiment, compared to some of the other relativistic many body approximations such as the relativistic random phase approximation and the relativistic random phase approximation with relaxation, over the entire photon energy region bracketing the near-threshold 5s Cooper minimum, from the 5s threshold up to about 70 eV. The MCTD results in the length form are in much better agreement with the experiment than those in the velocity form, suggesting residual correlations that must be of importance.

  11. 4.5S ribonucleic acid, a novel ribosome component in the chloroplasts of flowering plants.

    PubMed Central

    Bowman, C M; Dyer, T A

    1979-01-01

    A species of low-molecular-weight ribosomal RNA, referred to as '4.5S rRNA', was found in addition to 5S rRNA in the large subunit of chloroplast ribosomes of a wide range of flowering plants. It was shown by sequence analysis that several variants of this RNA may occur in a plant. Furthermore, although in most flowering plants the predominant variant contains about 100 nucleotides, in the broad bean it has less than 80. It seems, therefore, to be much more diverse in size and sequence than the other ribosomal RNA species. Like 5S rRNA , it does not contain modified nucleotides and it is also unusual in having an unphosphorylated 5'-end. It is apparently neither a homologue of cytosol 5.8S rRNA nor a fragment of 23S rRNA. Images Fig. 1. Fig. 3. Fig. 4. PMID:540035

  12. Diversity of 5S rRNA genes within individual prokaryotic genomes

    PubMed Central

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V.; Parsons, Tamasha; Yang, Liying; Gerz, Erika A.; Lee, Peng; Xiang, Charlie; Nossa, Carlos W.; Pei, Zhiheng

    2012-01-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1168 genomes from 779 unique species, 96 species exhibited >3% diversity. Twenty seven species with >10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there were tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level. There is supplementary material. PMID:22765222

  13. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    NASA Technical Reports Server (NTRS)

    Luehrsen, K. R.; Fox, G. E.

    1981-01-01

    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  14. Concerted copy number variation balances ribosomal DNA dosage in human and mouse genomes.

    PubMed

    Gibbons, John G; Branco, Alan T; Godinho, Susana A; Yu, Shoukai; Lemos, Bernardo

    2015-02-24

    Tandemly repeated ribosomal DNA (rDNA) arrays are among the most evolutionary dynamic loci of eukaryotic genomes. The loci code for essential cellular components, yet exhibit extensive copy number (CN) variation within and between species. CN might be partly determined by the requirement of dosage balance between the 5S and 45S rDNA arrays. The arrays are nonhomologous, physically unlinked in mammals, and encode functionally interdependent RNA components of the ribosome. Here we show that the 5S and 45S rDNA arrays exhibit concerted CN variation (cCNV). Despite 5S and 45S rDNA elements residing on different chromosomes and lacking sequence similarity, cCNV between these loci is strong, evolutionarily conserved in humans and mice, and manifested across individual genotypes in natural populations and pedigrees. Finally, we observe that bisphenol A induces rapid and parallel modulation of 5S and 45S rDNA CN. Our observations reveal a novel mode of genome variation, indicate that natural selection contributed to the evolution and conservation of cCNV, and support the hypothesis that 5S CN is partly determined by the requirement of dosage balance with the 45S rDNA array. We suggest that human disease variation might be traced to disrupted rDNA dosage balance in the genome. PMID:25583482

  15. Characterization of microsatellite loci isolated in Mountain Plover (Charadrius montanus)

    USGS Publications Warehouse

    John, J. St; Kysela, R.F.; Oyler-McCance, S.J.

    2007-01-01

    Primers for 15 microsatellite loci were developed for Mountain Plover, a species whose distribution and abundance have been reduced drastically in the past 30 years. In a screen of 126 individuals collected from four breeding locales across the species' range, levels of polymorphism ranged from two to 13 alleles per locus. No two loci were found to be linked, although one locus revealed significant departures from Hardy-Weinberg equilibrium. These microsatellite loci can be used in population genetic studies, ultimately aiding in management efforts for Mountain Plover. Additionally, these markers can potentially be used in studies investigating the mating system of Mountain Plover. ?? 2007 Blackwell Publishing Ltd.

  16. Isolation and characterization of microsatellite loci in Quercus fabri (Fagaceae).

    PubMed

    Xiao, Z Z; Chen, W W; Bao, W; Wang, R; Li, Y Y

    2016-01-01

    Quercus fabri is a pioneer species of secondary succession in evergreen broadleaved forests in China. In this study, we isolated and developed 12 polymorphic and 2 monomorphic microsatellite loci for Q. fabri using the biotin-streptavidin capture method. We characterized 12 polymorphic loci in 52 individuals from two populations. The number of alleles per locus ranged from 3 to 23. The observed and expected heterozygosities per locus were 0.033-0.773 and 0.138-0.924, respectively. These microsatellite loci will facilitate the studies on genetic variation, mating system, and gene flow of Q. fabri. PMID:27420954

  17. Characterization of the L4-L5-S1 motion segment using the stepwise reduction method.

    PubMed

    Jaramillo, Héctor Enrique; Puttlitz, Christian M; McGilvray, Kirk; García, José J

    2016-05-01

    The two aims of this study were to generate data for a more accurate calibration of finite element models including the L5-S1 segment, and to find mechanical differences between the L4-L5 and L5-S1 segments. Then, the range of motion (ROM) and facet forces for the L4-S1 segment were measured using the stepwise reduction method. This consists of sequentially testing and reducing each segment in nine stages by cutting the ligaments, facet capsules, and removing the nucleus. Five L4-S1 human segments (median: 65 years, range: 53-84 years, SD=11.0 years) were loaded under a maximum pure moment of 8Nm. The ROM was measured using stereo-photogrammetry via tracking of three markers and the facet contact forces (CF) were measured using a Tekscan system. The ROM for the L4-L5 segment and all stages showed good agreement with published data. The major differences in ROM between the L4-L5 and L5-S1 segments were found for lateral bending and all stages, for which the L4-L5 ROM was about 1.5-3 times higher than that of the L5-S1 segment, consistent with L5-S1 facet CF about 1.3 to 4 times higher than those measured for the L4-L5 segment. For the other movements and few stages, the L4-L5 ROM was significantly lower that of the L5-S1 segment. ROM and CF provide important baseline data for more accurate calibration of FE models and to understand the role that their structures play in lower lumbar spine mechanics. PMID:27017302

  18. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    NASA Technical Reports Server (NTRS)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  19. Molecular phylogeny of endophytic isolates of Ampelomyces from Iran based on rDNA ITS sequences.

    PubMed

    Jamali, Samad

    2015-01-01

    During 2012, five isolates of pycnidial fungi were recovered from roots of tomato (Solanum lycopersicum) plants in Iran. Based on morphological characteristics the presence of Ampelomyces was documented. To confirm morphological identification and clarify the placement of endophytic isolates of Ampelomyces, DNA was extracted from isolates using a genomic DNA purification Kit. Region of internal transcribed spacers 1, 2 and 5.8S genes of rDNA were amplified using ITS4 and ITS1 universal primer set. Amplicons were purified, sequenced and submitted to the GenBank. The resulting sequence (600 bp) was submitted to a BLAST search to find most similar sequences in GenBank. The ITS sequences of isolates obtained in Iran were compared to those of other related authentic sequences obtained from GenBank. Iranian endophytic isolates had 100 % similarity of among themselves, while all isolates of Ampelomyces sequences analyzed had an average of 95.2 % (range 87-100 %) similarity. When Ampelomyces ITS sequences were analyzed by both distance-based and maximum parsimony methods, the Ampelomyces isolates were segregate into 11 distinct clades. The ITS sequences of endophytic isolates obtained in Iran were identical with endophytic isolates from other country including USA, Australia, Hungary and Spain. Our analyses of phylogenetic data showed that endophytic isolates from Iran and other countries are distinct group. The high ITS sequence-divergence values and the phylogenetic analysis suggested the isolates of Ampelomyces in the clades are not closely related and indeed a problematic species complex. PMID:25245955

  20. Characterization of viable bacteria from Siberian permafrost by 16S rDNA sequencing

    NASA Technical Reports Server (NTRS)

    Shi, T.; Reeves, R. H.; Gilichinsky, D. A.; Friedmann, E. I.

    1997-01-01

    Viable bacteria were found in permafrost core samples from the Kolyma-Indigirka lowland of northeast Siberia. The samples were obtained at different depths; the deepest was about 3 million years old. The average temperature of the permafrost is -10 degrees C. Twenty-nine bacterial isolates were characterized by 16S rDNA sequencing and phylogenetic analysis, cell morphology, Gram staining, endospore formation, and growth at 30 degrees C. The majority of the bacterial isolates were rod shaped and grew well at 30 degrees C; but two of them did not grow at or above 28 degrees C, and had optimum growth temperatures around 20 degrees C. Thirty percent of the isolates could form endospores. Phylogenetic analysis revealed that the isolates fell into four categories: high-GC Gram-positive bacteria, beta-proteobacteria, gamma-proteobacteria, and low-GC Gram-positive bacteria. Most high-GC Gram-positive bacteria and beta-proteobacteria, and all gamma-proteobacteria, came from samples with an estimated age of 1.8-3.0 million years (Olyor suite). Most low-GC Gram-positive bacteria came from samples with an estimated age of 5,000-8,000 years (Alas suite).

  1. Identification of a potential fungal species by 18S rDNA for ligninases production.

    PubMed

    Ferhan, M; Santos, S N; Melo, I S; Yan, N; Sain, M

    2013-12-01

    Fungal species for ligninases production was investigated by 18S ribosomal DNA sequence analysis. Two primer sets were chosen to amplify a major part of the 18S rDNA, which resulted in intense PCR product of approximately 550-820 bp in size per sample. The results suggest that the 18S rDNA-based approach is a useful tool for identification of unknown potential fungal species for ligninases production. The isolated fungal species produces mainly manganese peroxidase (MnP). The enzyme oxidized a variety of the usual MnP substrates, including lignin related polyphenols. Time course studies showed that maximum production of ligninolytic enzymes MnP (64 IU L⁻¹), lignin peroxidase (26.35 IU L⁻¹), and laccase (5.44 IU L⁻¹), respectively, were achieved after 10 days of cultivation under optimum conditions. Furthermore, the biological decolorization of Remazol Brilliant Blue R dye following 10 days of cultivation was 94 %. NCBI BLAST was used to search for closest matched sequences in the GenBank database and based on sequence homology the first BLAST hit was Dothioraceae sp. LM572 with accession number EF060858.1. PMID:23744034

  2. Ectomycorrhizal iconoclasts: the ITS rDNA diversity and nitrophilic tendencies of fetid Russula.

    PubMed

    Avis, Peter G

    2012-01-01

    Fetid Russula are frequently dominant ectomycorrhizal fungi, and some appear to be especially nitrophilic. However, little is known about their phylogenetic relationships or how common nitrophilic traits are in this group. This study addresses this gap and presents a phylogenetic analysis of ITS rDNA sequences and a meta-analysis of studies that examine ectomycorrhizal fungi response to nitrogen increase. The phylogenetic analysis indicates that (i) this lineage contains numerous unidentified taxa; (ii) the taxa have distinct geographic distributions; and (iii) the misuse of names such as R amoenolens, R. foetens or R. pectinatoides is common. Twenty-three well supported phylotypes were identified and include clades specific to western North America, eastern North America, Europe and Asia, while morphologically similar collections from tropical-equatorial regions are distinct. The metaanalysis shows that nitrophilic tendencies appear throughout fetid Russulas suggesting that this character is not an isolated trait within this subgenus but instead is a more general feature of the group overall. Mapping these tendencies across a broader portion of the Russulaceae shows that this trait is more regularly found in the basal Russula lineages and Lactarius spp., suggesting that this ability evolved early in these fungi. PMID:22495448

  3. Molecular Analysis of Methanogen Richness in Landfill and Marshland Targeting 16S rDNA Sequences

    PubMed Central

    Yadav, Shailendra; Kundu, Sharbadeb; Ghosh, Sankar K.; Maitra, S. S.

    2015-01-01

    Methanogens, a key contributor in global carbon cycling, methane emission, and alternative energy production, generate methane gas via anaerobic digestion of organic matter. The methane emission potential depends upon methanogenic diversity and activity. Since they are anaerobes and difficult to isolate and culture, their diversity present in the landfill sites of Delhi and marshlands of Southern Assam, India, was analyzed using molecular techniques like 16S rDNA sequencing, DGGE, and qPCR. The sequencing results indicated the presence of methanogens belonging to the seventh order and also the order Methanomicrobiales in the Ghazipur and Bhalsawa landfill sites of Delhi. Sequences, related to the phyla Crenarchaeota (thermophilic) and Thaumarchaeota (mesophilic), were detected from marshland sites of Southern Assam, India. Jaccard analysis of DGGE gel using Gel2K showed three main clusters depending on the number and similarity of band patterns. The copy number analysis of hydrogenotrophic methanogens using qPCR indicates higher abundance in landfill sites of Delhi as compared to the marshlands of Southern Assam. The knowledge about “methanogenic archaea composition” and “abundance” in the contrasting ecosystems like “landfill” and “marshland” may reorient our understanding of the Archaea inhabitants. This study could shed light on the relationship between methane-dynamics and the global warming process. PMID:26568700

  4. Nuclear rDNA and chloroplast rbcL, rbcS and IGS sequence data, and their implications from the Japanese, Korean, and North American harmful algae, Heterosigma akashiwo (Raphidophyceae)

    SciTech Connect

    Ki, Jang-Seu . E-mail: kijs@hanyang.ac.kr; Han, Myung-Soo

    2007-03-15

    The toxic Heterosigma akashiwo has been found in coastal environments and its algal blooms have been associated with mass mortality in marine organisms and farmed fish. Over the last two decades, H. akashiwo has expanded its geographical range on a worldwide scale, though all populations are suspected to be a single species. To find strong molecular evidence, supporting this hypothesis we determined nuclear 18S , ITS and LSU rDNA, and chloroplast rbcL, rbcS and flanking IGS sequences from six isolates located in North America, Japan and Korea. We compared individual loci from molecular regions (e.g., 26.7 kbp of DNA sequence) and found all the isolates to have an identical genotype. Further, the long sequences allow us to compare all the partial sequences that have been reported from samples obtained in ten countries. All these sequence are nearly identical. This suggests that they have dispersed recently from one location. The sequences revealed here can be used as an additional option for making molecular comparisons of sequences from the same isolate.

  5. TP53INP2/DOR, a mediator of cell autophagy, promotes rDNA transcription via facilitating the assembly of the POLR1/RNA polymerase I preinitiation complex at rDNA promoters.

    PubMed

    Xu, Yinfeng; Wan, Wei; Shou, Xin; Huang, Rui; You, Zhiyuan; Shou, Yanhong; Wang, Lingling; Zhou, Tianhua; Liu, Wei

    2016-07-01

    Cells control their metabolism through modulating the anabolic and catabolic pathways. TP53INP2/DOR (tumor protein p53 inducible nuclear protein 2), participates in cell catabolism by serving as a promoter of autophagy. Here we uncover a novel function of TP53INP2 in protein synthesis, a major biosynthetic and energy-consuming anabolic process. TP53INP2 localizes to the nucleolus through its nucleolar localization signal (NoLS) located at the C-terminal domain. Chromatin immunoprecipitation (ChIP) assays detected an association of TP53INP2 with the ribosomal DNA (rDNA), when exclusion of TP53INP2 from the nucleolus repressed rDNA promoter activity and the production of ribosomal RNA (rRNA) and proteins. The removal of TP53INP2 also impaired the association of the POLR1/RNA polymerase I preinitiation complex (PIC) with rDNA. Further, TP53INP2 interacts directly with POLR1 PIC, and is required for the assembly of the complex. These data indicate that TP53INP2 promotes ribosome biogenesis through facilitating rRNA synthesis at the nucleolus, suggesting a dual role of TP53INP2 in cell metabolism, assisting anabolism on the nucleolus, and stimulating catabolism off the nucleolus. PMID:27172002

  6. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON QSAR

    EPA Science Inventory

    Dyer, S.D., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to predict HC5's Based on QSARs (Abstract). To be presented at the SETAC Europe 14th Annual Meeting: Environmental Science Solution: A Pan-European Perspective, 18-...

  7. Sacrum fracture following L5-S1 stand-alone interbody fusion for isthmic spondylolisthesis.

    PubMed

    Phan, Kevin; Mobbs, Ralph J

    2015-11-01

    We report a 72-year-old man with a rare sacral fracture following stand-alone L5-S1 anterior lumbar interbody fusion for isthmic spondylolisthesis. The man underwent a minimally invasive management strategy using posterior percutaneous pedicle fixation and partial reduction of the deformity. We also discuss the current literature on fusion procedures for isthmic spondylolisthesis. PMID:26100158

  8. 5. S U.S. HIGHWAY 34 AND EAST (ILLINOIS) APPROACH TO ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. S U.S. HIGHWAY 34 AND EAST (ILLINOIS) APPROACH TO BRIDGE WITH EAST BRIDGE HOUSE IN RIGHT FOREGROUND. VIEW TO WEST. - MacArthur Bridge, Spanning Mississippi River on Highway 34 between IA & IL, Burlington, Des Moines County, IA

  9. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON MINIMAL DATA

    EPA Science Inventory

    Dyer, S., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to Predict HC5's Based on Minimal Data (Abstract). To be presented at the SETAC Fourth World Congress, 14-18 November 2004, Portland, OR. 1 p. (ERL,GB R1013).

  10. Nucleotide sequences of 5S rRNAs from four jellyfishes.

    PubMed

    Hori, H; Ohama, T; Kumazaki, T; Osawa, S

    1982-11-25

    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica. PMID:6130512

  11. Adaptation of the S-5-S pendulum seismometer for measurement of rotational ground motion

    NASA Astrophysics Data System (ADS)

    Knejzlík, Jaromír; Kaláb, Zdeněk; Rambouský, Zdeněk

    2012-10-01

    The Russian electrodynamic seismometer model S-5-S has been adapted for the measurement of rotational ground motion. The mechanical system of the original S-5-S seismometer consists of electrodynamic sensing and damping transducer coils mounted on an asymmetrical double-arm pendulum. This pendulum is suspended on a footing using two pairs of crossed flat springs, which operate as the axis of rotation. The pendulum is stabilised by an additional spring. The S-5-S can be used either as a vertical or as a horizontal sensor. The adaptation of the S-5-S seismometer described below involves removal of the additional spring and installation of an additional mass on the damping arm. Strain gauge angle sensors are installed on one pair of the crossed flat springs. The main dynamic parameters of the rotational seismometer created in this way, i.e. the natural period and damping, are controlled electronically by feedback currents proportional to the angular displacement and angular velocity, both fed to the damping transducer coil. This new seismometer, named the S-5-SR, enables measurement of the rotational component of ground motion around the horizontal or the vertical axes. The output signal from this S-5-SR seismometer can be proportional either to rotational displacement or rotational velocity.

  12. The nature and identification of quantitative trait loci

    PubMed Central

    2007-01-01

    This white paper by eighty members of the Complex Trait Consortium presents a community’s view on the approaches and statistical analyses that are needed for the identification of genetic loci that determine quantitative traits. Quantitative trait loci (QTLs) can be identified in several ways, but is there a definitive test of whether a candidate locus actually corresponds to a specific QTL? PMID:14634638

  13. Molecular analysis of a NOR site polymorphism in brown trout (Salmo trutta): organization of rDNA intergenic spacers.

    PubMed

    Castro, J; Sánchez, L; Martínez, P; Lucchini, S D; Nardi, I

    1997-12-01

    Using restriction endonuclease mapping, we have analyzed the organization of rDNA (DNA coding for ribosomal RNA (rRNA)) units in the salmonid fish Salmo trutta, as an initial step toward understand the molecular basis of a nucleolar organizer region (NOR) site polymorphism detected in this species. The size of the rDNA units ranged between 15 and 23 kb, with remarkable variation both within individuals and between populations. Three regions of internal tandem repetitiveness responsible for this length polymorphism were located to the intergenic spacers. NOR site polymorphic individuals showed a higher number of length classes, in some cases forming a complete 1 kb fragment ladder. The amount of rRNA genes was as much as 8-fold higher in polymorphic individuals compared with standard individuals. All individuals from the most polymorphic population showed a 14-kb insertion of unknown nature in a small proportion (below 25%) of the 28S rRNA genes. PMID:18464877

  14. Escherichia coli Chromosomal Loci Segregate from Midcell with Universal Dynamics.

    PubMed

    Cass, Julie A; Kuwada, Nathan J; Traxler, Beth; Wiggins, Paul A

    2016-06-21

    The structure of the Escherichia coli chromosome is inherently dynamic over the duration of the cell cycle. Genetic loci undergo both stochastic motion around their initial positions and directed motion to opposite poles of the rod-shaped cell during segregation. We developed a quantitative method to characterize cell-cycle dynamics of the E. coli chromosome to probe the chromosomal steady-state mobility and segregation process. By tracking fluorescently labeled chromosomal loci in thousands of cells throughout the entire cell cycle, our method allows for the statistical analysis of locus position and motion, the step-size distribution for movement during segregation, and the locus drift velocity. The robust statistics of our detailed analysis of the wild-type E. coli nucleoid allow us to observe loci moving toward midcell before segregation occurs, consistent with a replication factory model. Then, as segregation initiates, we perform a detailed characterization of the average segregation velocity of loci. Contrary to origin-centric models of segregation, which predict distinct dynamics for oriC-proximal versus oriC-distal loci, we find that the dynamics of loci were universal and independent of genetic position. PMID:27332118

  15. Discovery and Refinement of Loci Associated with Lipid Levels

    PubMed Central

    Peloso, Gina M.; Gustafsson, Stefan; Kanoni, Stavroula; Ganna, Andrea; Chen, Jin; Buchkovich, Martin L.; Mora, Samia; Beckmann, Jacques S.; Bragg-Gresham, Jennifer L.; Chang, Hsing-Yi; Demirkan, Ayşe; Den Hertog, Heleen M.; Do, Ron; Donnelly, Louise A.; Ehret, Georg B.; Esko, Tõnu; Feitosa, Mary F.; Ferreira, Teresa; Fischer, Krista; Fontanillas, Pierre; Fraser, Ross M.; Freitag, Daniel F.; Gurdasani, Deepti; Heikkilä, Kauko; Hyppönen, Elina; Isaacs, Aaron; Jackson, Anne U.; Johansson, Åsa; Johnson, Toby; Kaakinen, Marika; Kettunen, Johannes; Kleber, Marcus E.; Li, Xiaohui; Luan, Jian’an; Lyytikäinen, Leo-Pekka; Magnusson, Patrik K.E.; Mangino, Massimo; Mihailov, Evelin; Montasser, May E.; Müller-Nurasyid, Martina; Nolte, Ilja M.; O’Connell, Jeffrey R.; Palmer, Cameron D.; Perola, Markus; Petersen, Ann-Kristin; Sanna, Serena; Saxena, Richa; Service, Susan K.; Shah, Sonia; Shungin, Dmitry; Sidore, Carlo; Song, Ci; Strawbridge, Rona J.; Surakka, Ida; Tanaka, Toshiko; Teslovich, Tanya M.; Thorleifsson, Gudmar; Van den Herik, Evita G.; Voight, Benjamin F.; Volcik, Kelly A.; Waite, Lindsay L.; Wong, Andrew; Wu, Ying; Zhang, Weihua; Absher, Devin; Asiki, Gershim; Barroso, Inês; Been, Latonya F.; Bolton, Jennifer L.; Bonnycastle, Lori L; Brambilla, Paolo; Burnett, Mary S.; Cesana, Giancarlo; Dimitriou, Maria; Doney, Alex S.F.; Döring, Angela; Elliott, Paul; Epstein, Stephen E.; Ingi Eyjolfsson, Gudmundur; Gigante, Bruna; Goodarzi, Mark O.; Grallert, Harald; Gravito, Martha L.; Groves, Christopher J.; Hallmans, Göran; Hartikainen, Anna-Liisa; Hayward, Caroline; Hernandez, Dena; Hicks, Andrew A.; Holm, Hilma; Hung, Yi-Jen; Illig, Thomas; Jones, Michelle R.; Kaleebu, Pontiano; Kastelein, John J.P.; Khaw, Kay-Tee; Kim, Eric; Klopp, Norman; Komulainen, Pirjo; Kumari, Meena; Langenberg, Claudia; Lehtimäki, Terho; Lin, Shih-Yi; Lindström, Jaana; Loos, Ruth J.F.; Mach, François; McArdle, Wendy L; Meisinger, Christa; Mitchell, Braxton D.; Müller, Gabrielle; Nagaraja, Ramaiah; Narisu, Narisu; Nieminen, Tuomo V.M.; Nsubuga, Rebecca N.; Olafsson, Isleifur; Ong, Ken K.; Palotie, Aarno; Papamarkou, Theodore; Pomilla, Cristina; Pouta, Anneli; Rader, Daniel J.; Reilly, Muredach P.; Ridker, Paul M.; Rivadeneira, Fernando; Rudan, Igor; Ruokonen, Aimo; Samani, Nilesh; Scharnagl, Hubert; Seeley, Janet; Silander, Kaisa; Stančáková, Alena; Stirrups, Kathleen; Swift, Amy J.; Tiret, Laurence; Uitterlinden, Andre G.; van Pelt, L. Joost; Vedantam, Sailaja; Wainwright, Nicholas; Wijmenga, Cisca; Wild, Sarah H.; Willemsen, Gonneke; Wilsgaard, Tom; Wilson, James F.; Young, Elizabeth H.; Zhao, Jing Hua; Adair, Linda S.; Arveiler, Dominique; Assimes, Themistocles L.; Bandinelli, Stefania; Bennett, Franklyn; Bochud, Murielle; Boehm, Bernhard O.; Boomsma, Dorret I.; Borecki, Ingrid B.; Bornstein, Stefan R.; Bovet, Pascal; Burnier, Michel; Campbell, Harry; Chakravarti, Aravinda; Chambers, John C.; Chen, Yii-Der Ida; Collins, Francis S.; Cooper, Richard S.; Danesh, John; Dedoussis, George; de Faire, Ulf; Feranil, Alan B.; Ferrières, Jean; Ferrucci, Luigi; Freimer, Nelson B.; Gieger, Christian; Groop, Leif C.; Gudnason, Vilmundur; Gyllensten, Ulf; Hamsten, Anders; Harris, Tamara B.; Hingorani, Aroon; Hirschhorn, Joel N.; Hofman, Albert; Hovingh, G. Kees; Hsiung, Chao Agnes; Humphries, Steve E.; Hunt, Steven C.; Hveem, Kristian; Iribarren, Carlos; Järvelin, Marjo-Riitta; Jula, Antti; Kähönen, Mika; Kaprio, Jaakko; Kesäniemi, Antero; Kivimaki, Mika; Kooner, Jaspal S.; Koudstaal, Peter J.; Krauss, Ronald M.; Kuh, Diana; Kuusisto, Johanna; Kyvik, Kirsten O.; Laakso, Markku; Lakka, Timo A.; Lind, Lars; Lindgren, Cecilia M.; Martin, Nicholas G.; März, Winfried; McCarthy, Mark I.; McKenzie, Colin A.; Meneton, Pierre; Metspalu, Andres; Moilanen, Leena; Morris, Andrew D.; Munroe, Patricia B.; Njølstad, Inger; Pedersen, Nancy L.; Power, Chris; Pramstaller, Peter P.; Price, Jackie F.; Psaty, Bruce M.; Quertermous, Thomas; Rauramaa, Rainer; Saleheen, Danish; Salomaa, Veikko; Sanghera, Dharambir K.; Saramies, Jouko; Schwarz, Peter E.H.; Sheu, Wayne H-H; Shuldiner, Alan R.; Siegbahn, Agneta; Spector, Tim D.; Stefansson, Kari; Strachan, David P.; Tayo, Bamidele O.; Tremoli, Elena; Tuomilehto, Jaakko; Uusitupa, Matti; van Duijn, Cornelia M.; Vollenweider, Peter; Wallentin, Lars; Wareham, Nicholas J.; Whitfield, John B.; Wolffenbuttel, Bruce H.R.; Ordovas, Jose M.; Boerwinkle, Eric; Palmer, Colin N.A.; Thorsteinsdottir, Unnur; Chasman, Daniel I.; Rotter, Jerome I.; Franks, Paul W.; Ripatti, Samuli; Cupples, L. Adrienne; Sandhu, Manjinder S.; Rich, Stephen S.

    2013-01-01

    Low-density lipoprotein (LDL) cholesterol, high-density lipoprotein (HDL) cholesterol, triglycerides, and total cholesterol are heritable, modifiable, risk factors for coronary artery disease. To identify new loci and refine known loci influencing these lipids, we examined 188,578 individuals using genome-wide and custom genotyping arrays. We identify and annotate 157 loci associated with lipid levels at P < 5×10−8, including 62 loci not previously associated with lipid levels in humans. Using dense genotyping in individuals of European, East Asian, South Asian, and African ancestry, we narrow association signals in 12 loci. We find that loci associated with blood lipids are often associated with cardiovascular and metabolic traits including coronary artery disease, type 2 diabetes, blood pressure, waist-hip ratio, and body mass index. Our results illustrate the value of genetic data from individuals of diverse ancestries and provide insights into biological mechanisms regulating blood lipids to guide future genetic, biological, and therapeutic research. PMID:24097068

  16. Discovery and refinement of loci associated with lipid levels.

    PubMed

    Willer, Cristen J; Schmidt, Ellen M; Sengupta, Sebanti; Peloso, Gina M; Gustafsson, Stefan; Kanoni, Stavroula; Ganna, Andrea; Chen, Jin; Buchkovich, Martin L; Mora, Samia; Beckmann, Jacques S; Bragg-Gresham, Jennifer L; Chang, Hsing-Yi; Demirkan, Ayşe; Den Hertog, Heleen M; Do, Ron; Donnelly, Louise A; Ehret, Georg B; Esko, Tõnu; Feitosa, Mary F; Ferreira, Teresa; Fischer, Krista; Fontanillas, Pierre; Fraser, Ross M; Freitag, Daniel F; Gurdasani, Deepti; Heikkilä, Kauko; Hyppönen, Elina; Isaacs, Aaron; Jackson, Anne U; Johansson, Asa; Johnson, Toby; Kaakinen, Marika; Kettunen, Johannes; Kleber, Marcus E; Li, Xiaohui; Luan, Jian'an; Lyytikäinen, Leo-Pekka; Magnusson, Patrik K E; Mangino, Massimo; Mihailov, Evelin; Montasser, May E; Müller-Nurasyid, Martina; Nolte, Ilja M; O'Connell, Jeffrey R; Palmer, Cameron D; Perola, Markus; Petersen, Ann-Kristin; Sanna, Serena; Saxena, Richa; Service, Susan K; Shah, Sonia; Shungin, Dmitry; Sidore, Carlo; Song, Ci; Strawbridge, Rona J; Surakka, Ida; Tanaka, Toshiko; Teslovich, Tanya M; Thorleifsson, Gudmar; Van den Herik, Evita G; Voight, Benjamin F; Volcik, Kelly A; Waite, Lindsay L; Wong, Andrew; Wu, Ying; Zhang, Weihua; Absher, Devin; Asiki, Gershim; Barroso, Inês; Been, Latonya F; Bolton, Jennifer L; Bonnycastle, Lori L; Brambilla, Paolo; Burnett, Mary S; Cesana, Giancarlo; Dimitriou, Maria; Doney, Alex S F; Döring, Angela; Elliott, Paul; Epstein, Stephen E; Eyjolfsson, Gudmundur Ingi; Gigante, Bruna; Goodarzi, Mark O; Grallert, Harald; Gravito, Martha L; Groves, Christopher J; Hallmans, Göran; Hartikainen, Anna-Liisa; Hayward, Caroline; Hernandez, Dena; Hicks, Andrew A; Holm, Hilma; Hung, Yi-Jen; Illig, Thomas; Jones, Michelle R; Kaleebu, Pontiano; Kastelein, John J P; Khaw, Kay-Tee; Kim, Eric; Klopp, Norman; Komulainen, Pirjo; Kumari, Meena; Langenberg, Claudia; Lehtimäki, Terho; Lin, Shih-Yi; Lindström, Jaana; Loos, Ruth J F; Mach, François; McArdle, Wendy L; Meisinger, Christa; Mitchell, Braxton D; Müller, Gabrielle; Nagaraja, Ramaiah; Narisu, Narisu; Nieminen, Tuomo V M; Nsubuga, Rebecca N; Olafsson, Isleifur; Ong, Ken K; Palotie, Aarno; Papamarkou, Theodore; Pomilla, Cristina; Pouta, Anneli; Rader, Daniel J; Reilly, Muredach P; Ridker, Paul M; Rivadeneira, Fernando; Rudan, Igor; Ruokonen, Aimo; Samani, Nilesh; Scharnagl, Hubert; Seeley, Janet; Silander, Kaisa; Stancáková, Alena; Stirrups, Kathleen; Swift, Amy J; Tiret, Laurence; Uitterlinden, Andre G; van Pelt, L Joost; Vedantam, Sailaja; Wainwright, Nicholas; Wijmenga, Cisca; Wild, Sarah H; Willemsen, Gonneke; Wilsgaard, Tom; Wilson, James F; Young, Elizabeth H; Zhao, Jing Hua; Adair, Linda S; Arveiler, Dominique; Assimes, Themistocles L; Bandinelli, Stefania; Bennett, Franklyn; Bochud, Murielle; Boehm, Bernhard O; Boomsma, Dorret I; Borecki, Ingrid B; Bornstein, Stefan R; Bovet, Pascal; Burnier, Michel; Campbell, Harry; Chakravarti, Aravinda; Chambers, John C; Chen, Yii-Der Ida; Collins, Francis S; Cooper, Richard S; Danesh, John; Dedoussis, George; de Faire, Ulf; Feranil, Alan B; Ferrières, Jean; Ferrucci, Luigi; Freimer, Nelson B; Gieger, Christian; Groop, Leif C; Gudnason, Vilmundur; Gyllensten, Ulf; Hamsten, Anders; Harris, Tamara B; Hingorani, Aroon; Hirschhorn, Joel N; Hofman, Albert; Hovingh, G Kees; Hsiung, Chao Agnes; Humphries, Steve E; Hunt, Steven C; Hveem, Kristian; Iribarren, Carlos; Järvelin, Marjo-Riitta; Jula, Antti; Kähönen, Mika; Kaprio, Jaakko; Kesäniemi, Antero; Kivimaki, Mika; Kooner, Jaspal S; Koudstaal, Peter J; Krauss, Ronald M; Kuh, Diana; Kuusisto, Johanna; Kyvik, Kirsten O; Laakso, Markku; Lakka, Timo A; Lind, Lars; Lindgren, Cecilia M; Martin, Nicholas G; März, Winfried; McCarthy, Mark I; McKenzie, Colin A; Meneton, Pierre; Metspalu, Andres; Moilanen, Leena; Morris, Andrew D; Munroe, Patricia B; Njølstad, Inger; Pedersen, Nancy L; Power, Chris; Pramstaller, Peter P; Price, Jackie F; Psaty, Bruce M; Quertermous, Thomas; Rauramaa, Rainer; Saleheen, Danish; Salomaa, Veikko; Sanghera, Dharambir K; Saramies, Jouko; Schwarz, Peter E H; Sheu, Wayne H-H; Shuldiner, Alan R; Siegbahn, Agneta; Spector, Tim D; Stefansson, Kari; Strachan, David P; Tayo, Bamidele O; Tremoli, Elena; Tuomilehto, Jaakko; Uusitupa, Matti; van Duijn, Cornelia M; Vollenweider, Peter; Wallentin, Lars; Wareham, Nicholas J; Whitfield, John B; Wolffenbuttel, Bruce H R; Ordovas, Jose M; Boerwinkle, Eric; Palmer, Colin N A; Thorsteinsdottir, Unnur; Chasman, Daniel I; Rotter, Jerome I; Franks, Paul W; Ripatti, Samuli; Cupples, L Adrienne; Sandhu, Manjinder S; Rich, Stephen S; Boehnke, Michael; Deloukas, Panos; Kathiresan, Sekar; Mohlke, Karen L; Ingelsson, Erik; Abecasis, Gonçalo R

    2013-11-01

    Levels of low-density lipoprotein (LDL) cholesterol, high-density lipoprotein (HDL) cholesterol, triglycerides and total cholesterol are heritable, modifiable risk factors for coronary artery disease. To identify new loci and refine known loci influencing these lipids, we examined 188,577 individuals using genome-wide and custom genotyping arrays. We identify and annotate 157 loci associated with lipid levels at P < 5 × 10(-8), including 62 loci not previously associated with lipid levels in humans. Using dense genotyping in individuals of European, East Asian, South Asian and African ancestry, we narrow association signals in 12 loci. We find that loci associated with blood lipid levels are often associated with cardiovascular and metabolic traits, including coronary artery disease, type 2 diabetes, blood pressure, waist-hip ratio and body mass index. Our results demonstrate the value of using genetic data from individuals of diverse ancestry and provide insights into the biological mechanisms regulating blood lipids to guide future genetic, biological and therapeutic research. PMID:24097068

  17. Physical Modeling of Dynamic Coupling between Chromosomal Loci.

    PubMed

    Lampo, Thomas J; Kennard, Andrew S; Spakowitz, Andrew J

    2016-01-19

    The motion of chromosomal DNA is essential to many biological processes, including segregation, transcriptional regulation, recombination, and packaging. Physical understanding of these processes would be dramatically enhanced through predictive, quantitative modeling of chromosome dynamics of multiple loci. Using a polymer dynamics framework, we develop a prediction for the correlation in the velocities of two loci on a single chromosome or otherwise connected by chromatin. These predictions reveal that the signature of correlated motion between two loci can be identified by varying the lag time between locus position measurements. In general, this theory predicts that as the lag time interval increases, the dual-loci dynamic behavior transitions from being completely uncorrelated to behaving as an effective single locus. This transition corresponds to the timescale of the stress communication between loci through the intervening segment. This relatively simple framework makes quantitative predictions based on a single timescale fit parameter that can be directly compared to the in vivo motion of fluorescently labeled chromosome loci. Furthermore, this theoretical framework enables the detection of dynamically coupled chromosome regions from the signature of their correlated motion. PMID:26789757

  18. P-LOCI: a computer program for choosing the most efficient set of loci for parentage assignment

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Determining which and how many codominant marker loci are required for accurate parentage assignment is not straightforward because levels of marker polymorphism and linkage, allelic distributions among potential parents and other factors produce differences in the discriminatory power of individual...

  19. Secondray structure and sequence of ITS2-rDNA of the Egyptian malaria vector Anopheles pharoensis (Theobald).

    PubMed

    Wassim, Nahla M

    2014-04-01

    Out of the twelve Anophelines present in Egypt, only five species known to be malaria vectors. Anopheles (An.) pharoensis proved to be the important vector all over Egypt, especially in the Delta. Anopheles sergenti proved to be the primary vector in the Oases of the Western Desert, An. multicolor in Faiyoum, An. stephensi in the Red Sea Coast, and An. superpictus in Sinai. Genomic DNA was isolated from single adult mosquito of An. pharoensis (Sahel Sudanese form), PCR was performed to amplify ITS2 region of rDNA using specific primers for 5.8S and 28S rDNA genes. The amplicons were purified, directly sequenced and aligned to the sequence of the same region of An. gambiae, using clustalw2. The length of ITS2-rDNA of An. pharoensis was 411bp. The GC content of the ITS2 reported 53% is consistent with spacer base composition in Anopheles species. The similarity between the two species was 52% and genetic distance was 0.46.Variable simple sequence repeats (SSRs) are found at low frequency. The secondary structure of rDNA-ITS2was predicted by MFOLD and was -192; 60 to-195.32 kilocalories/mole. PMID:24961025

  20. Molecular characterization of Stictodora tridactyla (Trematoda: Heterophyidae) from Kuwait Bay using rDNA ITS and mtCO1.

    PubMed

    Al-Kandari, Wafa Y; Alnaqeeb, Majed A; Isaac, Asha M; Al-Bustan, Suzanne A

    2015-11-01

    Stictodora tridactyla is an intestinal fluke in the family Heterophyidae that parasitizes shorebirds and mammals, including humans. Its metacercarial cyst stage was reported in the Arabian killifish, Aphanius dispar, at Kuwait Bay. In the present study, Cerithidea cingulata was found to serve as the first intermediate host of S. tridactyla. In order to establish the snail-fish link in the life cycle of S. tridactyla, complete sequences of ribosomal DNA internal transcribed spacer region 1 and 2 (rDNA ITS1 and ITS2) and partial sequence of cytochrome oxidase subunit 1 were obtained for metacercarial cysts isolated from the fish A. dispar and rediae isolated from the snail C. cingulata. Sequence alignment demonstrated that these larval stages belong to the same heterophyid species, S. tridactyla. Phylogenetic analysis based on rDNA ITS1, ITS2, and mtCO1 confirmed the position of S. tridactyla within the Heterophyidae and found it to cluster with Haplorchis spp. The present study represents the first molecular study correlating the larval stages of S. tridactyla using rDNA ITS1, ITS2, and mtCO1 and examining the phylogenetic relationships of S. tridactyla with different heterophyid species. PMID:26268569

  1. Comparison of rDNA sequences from colchicine treated and untreated sporocysts of Phyllodistomum folium and Bucephalus polymorphus (Digenea).

    PubMed

    Stunzenas, Virmantas; Cryan, Jason R; Molloy, Daniel P

    2004-09-01

    The most frequently used antimitotic agent in cytogenetic studies is colchicine. We investigated whether the initial treatment of trematodes for karyological analysis with colchicine would have mutagenic or degradational effect on rDNA sequences. Dreissena polymorpha is the intermediate host of Phyllodistomum folium and Bucephalus polymorphus, and the sporocyst stage of these trematode species develop, respectively, in the gills and gonads of this mussel. Sporocysts of P. folium and B. polymorphus were obtained from D. polymorpha collected from waterbodies in Belarus and in Lithuania. 5.8S and 28S rDNA genes, ITS1 and ITS2 of P folium and B. polymorphus were sequenced and compared, and no nucleotide sequence differences between colchicine treated and untreated trematodes were found. Based on these results, we conclude that colchicine treatment for 3-5 h has no mutagenic or degradational effect on rDNA sequences. During the course of this investigation, two genetically different P. folium samples were noted in Belarus. PMID:15468529

  2. 18S rDNA Sequences from Microeukaryotes Reveal Oil Indicators in Mangrove Sediment

    PubMed Central

    Santos, Henrique F.; Cury, Juliano C.; Carmo, Flavia L.; Rosado, Alexandre S.; Peixoto, Raquel S.

    2010-01-01

    Background Microeukaryotes are an effective indicator of the presence of environmental contaminants. However, the characterisation of these organisms by conventional tools is often inefficient, and recent molecular studies have revealed a great diversity of microeukaryotes. The full extent of this diversity is unknown, and therefore, the distribution, ecological role and responses to anthropogenic effects of microeukaryotes are rather obscure. The majority of oil from oceanic oil spills (e.g., the May 2010 accident in the Gulf of Mexico) converges on coastal ecosystems such as mangroves, which are threatened with worldwide disappearance, highlighting the need for efficient tools to indicate the presence of oil in these environments. However, no studies have used molecular methods to assess the effects of oil contamination in mangrove sediment on microeukaryotes as a group. Methodology/Principal Findings We evaluated the population dynamics and the prevailing 18S rDNA phylotypes of microeukaryotes in mangrove sediment microcosms with and without oil contamination, using PCR/DGGE and clone libraries. We found that microeukaryotes are useful for monitoring oil contamination in mangroves. Our clone library analysis revealed a decrease in both diversity and species richness after contamination. The phylogenetic group that showed the greatest sensitivity to oil was the Nematoda. After contamination, a large increase in the abundance of the groups Bacillariophyta (diatoms) and Biosoecida was detected. The oil-contaminated samples were almost entirely dominated by organisms related to Bacillariophyta sp. and Cafeteria minima, which indicates that these groups are possible targets for biomonitoring oil in mangroves. The DGGE fingerprints also indicated shifts in microeukaryote profiles; specific band sequencing indicated the appearance of Bacillariophyta sp. only in contaminated samples and Nematoda only in non-contaminated sediment. Conclusions/Significance We believe that

  3. Analysis of the unexplored features of rrs (16S rDNA) of the Genus Clostridium

    PubMed Central

    2011-01-01

    Background Bacterial taxonomy and phylogeny based on rrs (16S rDNA) sequencing is being vigorously pursued. In fact, it has been stated that novel biological findings are driven by comparison and integration of massive data sets. In spite of a large reservoir of rrs sequencing data of 1,237,963 entries, this analysis invariably needs supplementation with other genes. The need is to divide the genetic variability within a taxa or genus at their rrs phylogenetic boundaries and to discover those fundamental features, which will enable the bacteria to naturally fall within them. Within the large bacterial community, Clostridium represents a large genus of around 110 species of significant biotechnological and medical importance. Certain Clostridium strains produce some of the deadliest toxins, which cause heavy economic losses. We have targeted this genus because of its high genetic diversity, which does not allow accurate typing with the available molecular methods. Results Seven hundred sixty five rrs sequences (> 1200 nucleotides, nts) belonging to 110 Clostridium species were analyzed. On the basis of 404 rrs sequences belonging to 15 Clostridium species, we have developed species specific: (i) phylogenetic framework, (ii) signatures (30 nts) and (iii) in silico restriction enzyme (14 Type II REs) digestion patterns. These tools allowed: (i) species level identification of 95 Clostridium sp. which are presently classified up to genus level, (ii) identification of 84 novel Clostridium spp. and (iii) potential reduction in the number of Clostridium species represented by small populations. Conclusions This integrated approach is quite sensitive and can be easily extended as a molecular tool for diagnostic and taxonomic identification of any microbe of importance to food industries and health services. Since rapid and correct identification allows quicker diagnosis and consequently treatment as well, it is likely to lead to reduction in economic losses and mortality

  4. Investigating bacterial populations in styrene-degrading biofilters by 16S rDNA tag pyrosequencing.

    PubMed

    Portune, Kevin J; Pérez, M Carmen; Álvarez-Hornos, F Javier; Gabaldón, Carmen

    2015-01-01

    Microbial biofilms are essential components in the elimination of pollutants within biofilters, yet still little is known regarding the complex relationships between microbial community structure and biodegradation function within these engineered ecosystems. To further explore this relationship, 16S rDNA tag pyrosequencing was applied to samples taken at four time points from a styrene-degrading biofilter undergoing variable operating conditions. Changes in microbial structure were observed between different stages of biofilter operation, and the level of styrene concentration was revealed to be a critical factor affecting these changes. Bacterial genera Azoarcus and Pseudomonas were among the dominant classified genera in the biofilter. Canonical correspondence analysis (CCA) and correlation analysis revealed that the genera Brevundimonas, Hydrogenophaga, and Achromobacter may play important roles in styrene degradation under increasing styrene concentrations. No significant correlations (P > 0.05) could be detected between biofilter operational/functional parameters and biodiversity measurements, although biological heterogeneity within biofilms and/or technical variability within pyrosequencing may have considerably affected these results. Percentages of selected bacterial taxonomic groups detected by fluorescence in situ hybridization (FISH) were compared to results from pyrosequencing in order to assess the effectiveness and limitations of each method for identifying each microbial taxon. Comparison of results revealed discrepancies between the two methods in the detected percentages of numerous taxonomic groups. Biases and technical limitations of both FISH and pyrosequencing, such as the binding of FISH probes to non-target microbial groups and lack of classification of sequences for defined taxonomic groups from pyrosequencing, may partially explain some differences between the two methods. PMID:24950754

  5. 1s2s2p2 5p3 5S transition in B ii

    NASA Astrophysics Data System (ADS)

    Mannervik, S.; Cederquist, H.; Martinson, I.; Brage, T.; Froese Fischer, C.

    1987-04-01

    An experimental and theoretical study has been made of the 1s2s2p2 5P-1s2p3 5S transition in B ii. The experimental wavelength and lifetime (1323.92+/-0.07 Å and 0.65+/-0.01 ns), determined by beam-foil spectroscopy, are more than five times more accurate than previous experimental results. Our theoretical data, from multiconfiguration Hartree-Fock calculations, 1311.6 Å and 0.601 ns, are in excellent agreement with previous theoretical predictions of Beck and Nicolaides [Phys. Lett. 61A, 227 (1977)]. We have also observed the 1s2p3 5S-1s2p23s 5P transition, at 857.7+/-0.2 Å, in accord with the theoretical value 859.1 Å.

  6. Phylogenetic analysis of the genera Thiobacillus and Thiomicrospira by 5S rRNA sequences.

    PubMed Central

    Lane, D J; Stahl, D A; Olsen, G J; Heller, D J; Pace, N R

    1985-01-01

    5S rRNA nucleotide sequences from Thiobacillus neapolitanus, Thiobacillus ferrooxidans, Thiobacillus thiooxidans, Thiobacillus intermedius, Thiobacillus perometabolis, Thiobacillus thioparus, Thiobacillus versutus, Thiobacillus novellus, Thiobacillus acidophilus, Thiomicrospira pelophila, Thiomicrospira sp. strain L-12, and Acidiphilium cryptum were determined. A phylogenetic tree, based upon comparison of these and other related 5S rRNA sequences, is presented. The results place the thiobacilli, Thiomicrospira spp., and Acidiphilium spp. in the "purple photosynthetic" bacterial grouping which also includes the enteric, vibrio, pseudomonad, and other familiar eubacterial groups in addition to the purple photosynthetic bacteria. The genus Thiobacillus is not an evolutionarily coherent grouping but rather spans the full breadth of the purple photosynthetic bacteria. PMID:3924899

  7. Optical characterization of CuIn5S8 crystals by ellipsometry measurements

    NASA Astrophysics Data System (ADS)

    Isik, Mehmet; Gasanly, Nizami

    2016-04-01

    Optical properties of CuIn5S8 crystals grown by Bridgman method were investigated by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficients were obtained from the analysis of ellipsometry experiments performed in the 1.2-6.2 eV spectral region. Analysis of spectral dependence of the absorption coefficient revealed the existence of direct band gap transitions with energy 1.53 eV. Wemple-DiDomenico and Spitzer-Fan models were used to find the oscillator energy, dispersion energy, zero-frequency refractive index and high-frequency dielectric constant values. Structural properties of the CuIn5S8 crystals were investigated using X-ray diffraction and energy dispersive spectroscopy analysis.

  8. Ellipsometry study of optical parameters of AgIn5S8 crystals

    NASA Astrophysics Data System (ADS)

    Isik, Mehmet; Gasanly, Nizami

    2015-12-01

    AgIn5S8 crystals grown by Bridgman method were characterized for optical properties by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficient were obtained from ellipsometry experiments carried out in the 1.2-6.2 eV range. Direct band gap energy of 1.84 eV was found from the analysis of absorption coefficient vs. photon energy. The oscillator energy, dispersion energy and zero-frequency refractive index, high-frequency dielectric constant values were found from the analysis of the experimental data using Wemple-DiDomenico and Spitzer-Fan models. Crystal structure and atomic composition ratio of the constituent elements in the AgIn5S8 crystal were revealed from structural characterization techniques of X-ray diffraction and energy dispersive spectroscopy.

  9. Multiple Loci Associated with Renal Function in African Americans

    PubMed Central

    Shriner, Daniel; Herbert, Alan; Doumatey, Ayo P.; Zhou, Jie; Huang, Hanxia; Erdos, Michael R.; Chen, Guanjie; Gerry, Norman P.; Christman, Michael F.; Adeyemo, Adebowale; Rotimi, Charles N.

    2012-01-01

    The incidence of chronic kidney disease varies by ethnic group in the USA, with African Americans displaying a two-fold higher rate than European Americans. One of the two defining variables underlying staging of chronic kidney disease is the glomerular filtration rate. Meta-analysis in individuals of European ancestry has identified 23 genetic loci associated with the estimated glomerular filtration rate (eGFR). We conducted a follow-up study of these 23 genetic loci using a population-based sample of 1,018 unrelated admixed African Americans. We included in our follow-up study two variants in APOL1 associated with end-stage kidney disease discovered by admixture mapping in admixed African Americans. To address confounding due to admixture, we estimated local ancestry at each marker and global ancestry. We performed regression analysis stratified by local ancestry and combined the resulting regression estimates across ancestry strata using an inverse variance-weighted fixed effects model. We found that 11 of the 24 loci were significantly associated with eGFR in our sample. The effect size estimates were not significantly different between the subgroups of individuals with two copies of African ancestry vs. two copies of European ancestry for any of the 11 loci. In contrast, allele frequencies were significantly different at 10 of the 11 loci. Collectively, the 11 loci, including four secondary signals revealed by conditional analyses, explained 14.2% of the phenotypic variance in eGFR, in contrast to the 1.4% explained by the 24 loci in individuals of European ancestry. Our findings provide insight into the genetic basis of variation in renal function among admixed African Americans. PMID:23028791

  10. Multiple loci associated with renal function in African Americans.

    PubMed

    Shriner, Daniel; Herbert, Alan; Doumatey, Ayo P; Zhou, Jie; Huang, Hanxia; Erdos, Michael R; Chen, Guanjie; Gerry, Norman P; Christman, Michael F; Adeyemo, Adebowale; Rotimi, Charles N

    2012-01-01

    The incidence of chronic kidney disease varies by ethnic group in the USA, with African Americans displaying a two-fold higher rate than European Americans. One of the two defining variables underlying staging of chronic kidney disease is the glomerular filtration rate. Meta-analysis in individuals of European ancestry has identified 23 genetic loci associated with the estimated glomerular filtration rate (eGFR). We conducted a follow-up study of these 23 genetic loci using a population-based sample of 1,018 unrelated admixed African Americans. We included in our follow-up study two variants in APOL1 associated with end-stage kidney disease discovered by admixture mapping in admixed African Americans. To address confounding due to admixture, we estimated local ancestry at each marker and global ancestry. We performed regression analysis stratified by local ancestry and combined the resulting regression estimates across ancestry strata using an inverse variance-weighted fixed effects model. We found that 11 of the 24 loci were significantly associated with eGFR in our sample. The effect size estimates were not significantly different between the subgroups of individuals with two copies of African ancestry vs. two copies of European ancestry for any of the 11 loci. In contrast, allele frequencies were significantly different at 10 of the 11 loci. Collectively, the 11 loci, including four secondary signals revealed by conditional analyses, explained 14.2% of the phenotypic variance in eGFR, in contrast to the 1.4% explained by the 24 loci in individuals of European ancestry. Our findings provide insight into the genetic basis of variation in renal function among admixed African Americans. PMID:23028791

  11. Three-step laser excitation of the odd-parity 5s5d 3D → 5s nf 3F states of cadmium

    NASA Astrophysics Data System (ADS)

    Nadeem, Ali; Shah, M.; Haq, S. U.; Shahzada, S.; Mumtaz, M.; Waheed, A.; Nawaz, M.; Ahmed, M.; Baig, M. A.

    2014-07-01

    We report new experimental data on the term energies and effective quantum numbers of the highly excited odd parity states of cadmium in the 71 773-72 500 cm-1 energy range. The experiment was performed using three dye lasers simultaneously pumped by the second harmonic (532 nm) of the Nd;YAG laser. The vapor containment and detection system was a thermionic diode ion detector working in a space charge limited mode. The new observations include the 5snf3F3 (12 ⩽ n ⩽ 52), 5snf3F4 (13 ⩽ n ⩽ 33) and 5snf3F2 (12 ⩽ n ⩽ 22) Rydberg series excited from the 5s5d3D multiplet. A two parameter fit to the transitions energies of the 5snf3F3 series yields the binding energy of the 5snd 2D2 level as 13 042.178 ± 0.02 cm-1 and consequently the first ionization of cadmium is determined as 72 540.05 ± 0.13 cm-1, which is in good agreement with the previously reported value.

  12. Global determinants of mortality in under 5s: 10 year worldwide longitudinal study

    PubMed Central

    Nacher, Mathieu; Guihenneuc, Chantal; Tubert-Bitter, Pascale; Chavance, Michel

    2013-01-01

    Objective To assess at country level the association of mortality in under 5s with a large set of determinants. Design Longitudinal study. Setting 193 United Nations member countries, 2000-09. Methods Yearly data between 2000 and 2009 based on 12 world development indicators were used in a multivariable general additive mixed model allowing for non-linear relations and lag effects. Main outcome measure National rate of deaths in under 5s per 1000 live births Results The model retained the variables: gross domestic product per capita; percentage of the population having access to improved water sources, having access to improved sanitation facilities, and living in urban areas; adolescent fertility rate; public health expenditure per capita; prevalence of HIV; perceived level of corruption and of violence; and mean number of years in school for women of reproductive age. Most of these variables exhibited non-linear behaviours and lag effects. Conclusions By providing a unified framework for mortality in under 5s, encompassing both high and low income countries this study showed non-linear behaviours and lag effects of known or suspected determinants of mortality in this age group. Although some of the determinants presented a linear action on log mortality indicating that whatever the context, acting on them would be a pertinent strategy to effectively reduce mortality, others had a threshold based relation potentially mediated by lag effects. These findings could help designing efficient strategies to achieve maximum progress towards millennium development goal 4, which aims to reduce mortality in under 5s by two thirds between 1990 and 2015. PMID:24212105

  13. Analysis of a 5S rRNA gene cloned from Euplotes eurstomus

    SciTech Connect

    Roberson, A.E.; Wolffe, A.; Olins, D.E.

    1987-05-01

    The macronucleus of the hypotrichous ciliated protozoan Euplotes eurystomus lends itself to the study of eukaryotic gene and chromatin structure because native macronuclear DNA exists as linear, gene-sized fragments between 400 and 20,000 bp in length. The macronuclear chromatin, while arranged in a typical nucleosomal structure, is freely soluble in low ionic strength buffers without treatment by nucleases. Thus, specific genes may be enriched as native, intact chromatin molecules. The 5S rRNA gene from Euplotes has been cloned to facilitate investigation of 5S gene-chromatin following characterization of the gene at the DNA level. It has been demonstrated that the gene, while in circular or linear form, can be transcribed in vitro by a Xenopus oocyte nuclear extract. The transcript generated in vitro is 120 nucleotides in length and is synthesized by RNA polymerase III. Anti-Xenopus TFIIIA antibodies recognize a Euplotes macronuclear chromatin-associated protein which is approx. 80 KD in size. It has been established that the sequence of the telomere flanking the 5S gene in Euplotes eurystomus is the same telomeric sequence published for Euplotes aediculatus.

  14. Identifying causal variants at loci with multiple signals of association.

    PubMed

    Hormozdiari, Farhad; Kostem, Emrah; Kang, Eun Yong; Pasaniuc, Bogdan; Eskin, Eleazar

    2014-10-01

    Although genome-wide association studies have successfully identified thousands of risk loci for complex traits, only a handful of the biologically causal variants, responsible for association at these loci, have been successfully identified. Current statistical methods for identifying causal variants at risk loci either use the strength of the association signal in an iterative conditioning framework or estimate probabilities for variants to be causal. A main drawback of existing methods is that they rely on the simplifying assumption of a single causal variant at each risk locus, which is typically invalid at many risk loci. In this work, we propose a new statistical framework that allows for the possibility of an arbitrary number of causal variants when estimating the posterior probability of a variant being causal. A direct benefit of our approach is that we predict a set of variants for each locus that under reasonable assumptions will contain all of the true causal variants with a high confidence level (e.g., 95%) even when the locus contains multiple causal variants. We use simulations to show that our approach provides 20-50% improvement in our ability to identify the causal variants compared to the existing methods at loci harboring multiple causal variants. We validate our approach using empirical data from an expression QTL study of CHI3L2 to identify new causal variants that affect gene expression at this locus. CAVIAR is publicly available online at http://genetics.cs.ucla.edu/caviar/. PMID:25104515

  15. Identifying Causal Variants at Loci with Multiple Signals of Association

    PubMed Central

    Hormozdiari, Farhad; Kostem, Emrah; Kang, Eun Yong; Pasaniuc, Bogdan; Eskin, Eleazar

    2014-01-01

    Although genome-wide association studies have successfully identified thousands of risk loci for complex traits, only a handful of the biologically causal variants, responsible for association at these loci, have been successfully identified. Current statistical methods for identifying causal variants at risk loci either use the strength of the association signal in an iterative conditioning framework or estimate probabilities for variants to be causal. A main drawback of existing methods is that they rely on the simplifying assumption of a single causal variant at each risk locus, which is typically invalid at many risk loci. In this work, we propose a new statistical framework that allows for the possibility of an arbitrary number of causal variants when estimating the posterior probability of a variant being causal. A direct benefit of our approach is that we predict a set of variants for each locus that under reasonable assumptions will contain all of the true causal variants with a high confidence level (e.g., 95%) even when the locus contains multiple causal variants. We use simulations to show that our approach provides 20–50% improvement in our ability to identify the causal variants compared to the existing methods at loci harboring multiple causal variants. We validate our approach using empirical data from an expression QTL study of CHI3L2 to identify new causal variants that affect gene expression at this locus. CAVIAR is publicly available online at http://genetics.cs.ucla.edu/caviar/. PMID:25104515

  16. Ancient conservation of trinucleotide microsatellite loci in polistine wasps.

    PubMed

    Ezenwa, V O; Peters, J M; Zhu, Y; Arévalo, E; Hastings, M D; Seppä, P; Pedersen, J S; Zacchi, F; Queller, D C; Strassmann, J E

    1998-10-01

    Microsatellites have proven to be very useful genetic markers for studies of kinship, parentage, and gene mapping. If microsatellites are conserved among species, then those developed for one species can be used on related species, which would save the time and effort of developing new loci. We evaluated conservation of 27 trinucleotide loci that were derived from 2 species of Polistes wasps in cross-species applications on 27 species chosen from the major lineages of the Vespidae, which diverged as much as 144 million years ago. We further investigated cross-species polymorphism levels for 18 of the loci. There was a clear relationship between cladistic distance and both conservation of the priming sites and heterozygosity. However the loci derived from P. bellicosus were much more widely conserved and polymorphic than were those derived from P. annularis. The disparity in cross-species utility between these sets of loci means that caution should be used in generalizing from conservation rates derived from single species. We found no relationship between locus conservation or heterozygosity and GC content of flanks, repeat motif, repeat length, or heterozygosity in the original species, which suggests that generalizations from other studies reporting such patterns are premature. PMID:9878228

  17. Microsatellite loci analysis for individual identification in Shiba Inu.

    PubMed

    Arata, Sayaka; Asahi, Ai; Takeuchi, Yukari; Mori, Yuji

    2016-03-01

    Eighteen autosomal microsatellite loci were examined using 275 Shiba Inus in Japan. Eighteen dogs representing eight trios were obtained from four breeders to calculate mutation rates, and 257 dogs kept by owners were collected through veterinary clinics throughout Japan to calculate population genetic parameters and estimate discrimination power. After two loci (INU005 and AHTk253) were excluded, average expected heterozygosity (He), polymorphic information content (PIC) and fixation index (F) were 0.665, 0.623 and 0.046, respectively. The combined power of discrimination over the 16 microsatellite markers was more than 0.9999. Therefore, it is suggested that these 16 microsatellite loci recommended by the International Society for Animal Genetics (ISAG) are applicable for individual identification and parentage testing of domestic Shiba Inu in Japan. PMID:26537551

  18. Microsatellite loci analysis for individual identification in Shiba Inu

    PubMed Central

    ARATA, Sayaka; ASAHI, Ai; TAKEUCHI, Yukari; MORI, Yuji

    2015-01-01

    Eighteen autosomal microsatellite loci were examined using 275 Shiba Inus in Japan. Eighteen dogs representing eight trios were obtained from four breeders to calculate mutation rates, and 257 dogs kept by owners were collected through veterinary clinics throughout Japan to calculate population genetic parameters and estimate discrimination power. After two loci (INU005 and AHTk253) were excluded, average expected heterozygosity (He), polymorphic information content (PIC) and fixation index (F) were 0.665, 0.623 and 0.046, respectively. The combined power of discrimination over the 16 microsatellite markers was more than 0.9999. Therefore, it is suggested that these 16 microsatellite loci recommended by the International Society for Animal Genetics (ISAG) are applicable for individual identification and parentage testing of domestic Shiba Inu in Japan. PMID:26537551

  19. Proactive control of proactive interference using the method of loci

    PubMed Central

    Bass, Willa S.; Oswald, Karl M.

    2014-01-01

    Proactive interferencebuilds up with exposure to multiple lists of similar items with a resulting reduction in recall. This study examined the effectiveness of using a proactive strategy of the method of loci to reduce proactive interference in a list recall paradigm of categorically similar words. While all participants reported using some form of strategy to recall list words, this study demonstrated that young adults were able to proactively use the method of loci after 25 min of instruction to reduce proactive interference as compared with other personal spontaneous strategies. The implications of this study are that top-down proactive strategies such as the method of loci can significantly reduce proactive interference, and that the use of image and sequence or location are especially useful in this regard. PMID:25157300

  20. Proactive control of proactive interference using the method of loci.

    PubMed

    Bass, Willa S; Oswald, Karl M

    2014-01-01

    Proactive interferencebuilds up with exposure to multiple lists of similar items with a resulting reduction in recall. This study examined the effectiveness of using a proactive strategy of the method of loci to reduce proactive interference in a list recall paradigm of categorically similar words. While all participants reported using some form of strategy to recall list words, this study demonstrated that young adults were able to proactively use the method of loci after 25 min of instruction to reduce proactive interference as compared with other personal spontaneous strategies. The implications of this study are that top-down proactive strategies such as the method of loci can significantly reduce proactive interference, and that the use of image and sequence or location are especially useful in this regard. PMID:25157300

  1. Genome-Wide Significant Loci: How Important Are They?

    PubMed Central

    Björkegren, Johan L.M.; Kovacic, Jason C.; Dudley, Joel T.; Schadt, Eric E.

    2015-01-01

    Genome-wide association studies (GWAS) have been extensively used to study common complex diseases such as coronary artery disease (CAD), revealing 153 suggestive CAD loci, of which at least 46 have been validated as having genome-wide significance. However, these loci collectively explain <10% of the genetic variance in CAD. Thus, we must address the key question of what factors constitute the remaining 90% of CAD heritability. We review possible limitations of GWAS, and contextually consider some candidate CAD loci identified by this method. Looking ahead, we propose systems genetics as a complementary approach to unlocking the CAD heritability and etiology. Systems genetics builds network models of relevant molecular processes by combining genetic and genomic datasets to ultimately identify key “drivers” of disease. By leveraging systems-based genetic approaches, we can help reveal the full genetic basis of common complex disorders, enabling novel diagnostic and therapeutic opportunities. PMID:25720628

  2. Multiple loci affect genetic predisposition to hepatocarcinogenesis in mice

    SciTech Connect

    Manenti, G.; Gariboldi, M.; Canzian, F.

    1994-09-01

    The C3H/He mouse represents a good experimental model of genetic predispositoin to hepatocellular tumor development. We analyzed an interspecific test-cross population of 106 urethane-treated male (C3H/He x Mus spretus) x C57BL/6J mice, typed with 222 genetic markers to locate precisely the hepatocellular tumor susceptibility (Hcs) loci. Three regions, on chromosomes 2, 5, and 19, showed a significant linkage with hepatocellular tumor development, as indicated by different quantitative indexes estimating liver tumor size. Liver tumor frequency was not genetically controlled. These loci are different from three other Hcs loci that we have previously mapped in an F2 progeny of the C3H/He mouse crossed with the resistant laboratory strain A/J. The present result indicates a multigenic model of inheritance for hepatocellular tumor susceptibility.

  3. Genome-Wide Interaction with Insulin Secretion Loci Reveals Novel Loci for Type 2 Diabetes in African Americans.

    PubMed

    Keaton, Jacob M; Hellwege, Jacklyn N; Ng, Maggie C Y; Palmer, Nicholette D; Pankow, James S; Fornage, Myriam; Wilson, James G; Correa, Adolfo; Rasmussen-Torvik, Laura J; Rotter, Jerome I; Chen, Yii-Der I; Taylor, Kent D; Rich, Stephen S; Wagenknecht, Lynne E; Freedman, Barry I; Bowden, Donald W

    2016-01-01

    Type 2 diabetes (T2D) is the result of metabolic defects in insulin secretion and insulin sensitivity, yet most T2D loci identified to date influence insulin secretion. We hypothesized that T2D loci, particularly those affecting insulin sensitivity, can be identified through interaction with insulin secretion loci. To test this hypothesis, single nucleotide polymorphisms (SNPs) associated with acute insulin response to glucose (AIRg), a dynamic measure of first-phase insulin secretion, were identified in African Americans from the Insulin Resistance Atherosclerosis Family Study (IRASFS; n = 492 subjects). These SNPs were tested for interaction, individually and jointly as a genetic risk score (GRS), using genome-wide association study (GWAS) data from five cohorts (ARIC, CARDIA, JHS, MESA, WFSM; n = 2,725 cases, 4,167 controls) with T2D as the outcome. In single variant analyses, suggestively significant (Pinteraction<5×10-6) interactions were observed at several loci including LYPLAL1 (rs10746381), CHN2 (rs7796525), and EXOC1 (rs4289500). Notable AIRg GRS interactions were observed with SAMD4A (rs11627203) and UTRN (rs17074194). These data support the hypothesis that additional genetic factors contributing to T2D risk can be identified by interactions with insulin secretion loci. PMID:27448167

  4. Genome-Wide Interaction with Insulin Secretion Loci Reveals Novel Loci for Type 2 Diabetes in African Americans

    PubMed Central

    Keaton, Jacob M.; Hellwege, Jacklyn N.; Ng, Maggie C. Y.; Palmer, Nicholette D.; Pankow, James S.; Fornage, Myriam; Wilson, James G.; Correa, Adolfo; Rasmussen-Torvik, Laura J.; Rotter, Jerome I.; Chen, Yii-Der I.; Taylor, Kent D.; Rich, Stephen S.; Wagenknecht, Lynne E.; Freedman, Barry I.; Bowden, Donald W.

    2016-01-01

    Type 2 diabetes (T2D) is the result of metabolic defects in insulin secretion and insulin sensitivity, yet most T2D loci identified to date influence insulin secretion. We hypothesized that T2D loci, particularly those affecting insulin sensitivity, can be identified through interaction with insulin secretion loci. To test this hypothesis, single nucleotide polymorphisms (SNPs) associated with acute insulin response to glucose (AIRg), a dynamic measure of first-phase insulin secretion, were identified in African Americans from the Insulin Resistance Atherosclerosis Family Study (IRASFS; n = 492 subjects). These SNPs were tested for interaction, individually and jointly as a genetic risk score (GRS), using genome-wide association study (GWAS) data from five cohorts (ARIC, CARDIA, JHS, MESA, WFSM; n = 2,725 cases, 4,167 controls) with T2D as the outcome. In single variant analyses, suggestively significant (Pinteraction<5×10−6) interactions were observed at several loci including LYPLAL1 (rs10746381), CHN2 (rs7796525), and EXOC1 (rs4289500). Notable AIRg GRS interactions were observed with SAMD4A (rs11627203) and UTRN (rs17074194). These data support the hypothesis that additional genetic factors contributing to T2D risk can be identified by interactions with insulin secretion loci. PMID:27448167

  5. Sequence variation in the human T-cell receptor loci.

    PubMed

    Mackelprang, Rachel; Carlson, Christopher S; Subrahmanyan, Lakshman; Livingston, Robert J; Eberle, Michael A; Nickerson, Deborah A

    2002-12-01

    Identifying common sequence variations known as single nucleotide polymorphisms (SNPs) in human populations is one of the current objectives of the human genome project. Nearly 3 million SNPs have been identified. Analysis of the relative allele frequency of these markers in human populations and the genetic associations between these markers, known as linkage disequilibrium, is now underway to generate a high-density genetic map. Because of the central role T cells play in immune reactivity, the T-cell receptor (TCR) loci have long been considered important candidates for common disease susceptibility within the immune system (e.g., asthma, atopy and autoimmunity). Over the past two decades, hundreds of SNPs in the TCR loci have been identified. Most studies have focused on defining SNPs in the variable gene segments which are involved in antigenic recognition. On average, the coding sequence of each TCR variable gene segment contains two SNPs, with many more found in the 5', 3' and intronic sequences of these segments. Therefore, a potentially large repertoire of functional variants exists in these loci. Association between SNPs (linkage disequilibrium) extends approximately 30 kb in the TCR loci, although a few larger regions of disequilibrium have been identified. Therefore, the SNPs found in one variable gene segment may or may not be associated with SNPs in other surrounding variable gene segments. This suggests that meaningful association studies in the TCR loci will require the analysis and typing of large marker sets to fully evaluate the role of TCR loci in common disease susceptibility in human populations. PMID:12493004

  6. The ribosomal protein genes and Minute loci of Drosophila melanogaster

    PubMed Central

    Marygold, Steven J; Roote, John; Reuter, Gunter; Lambertsson, Andrew; Ashburner, Michael; Millburn, Gillian H; Harrison, Paul M; Yu, Zhan; Kenmochi, Naoya; Kaufman, Thomas C; Leevers, Sally J; Cook, Kevin R

    2007-01-01

    Background Mutations in genes encoding ribosomal proteins (RPs) have been shown to cause an array of cellular and developmental defects in a variety of organisms. In Drosophila melanogaster, disruption of RP genes can result in the 'Minute' syndrome of dominant, haploinsufficient phenotypes, which include prolonged development, short and thin bristles, and poor fertility and viability. While more than 50 Minute loci have been defined genetically, only 15 have so far been characterized molecularly and shown to correspond to RP genes. Results We combined bioinformatic and genetic approaches to conduct a systematic analysis of the relationship between RP genes and Minute loci. First, we identified 88 genes encoding 79 different cytoplasmic RPs (CRPs) and 75 genes encoding distinct mitochondrial RPs (MRPs). Interestingly, nine CRP genes are present as duplicates and, while all appear to be functional, one member of each gene pair has relatively limited expression. Next, we defined 65 discrete Minute loci by genetic criteria. Of these, 64 correspond to, or very likely correspond to, CRP genes; the single non-CRP-encoding Minute gene encodes a translation initiation factor subunit. Significantly, MRP genes and more than 20 CRP genes do not correspond to Minute loci. Conclusion This work answers a longstanding question about the molecular nature of Minute loci and suggests that Minute phenotypes arise from suboptimal protein synthesis resulting from reduced levels of cytoribosomes. Furthermore, by identifying the majority of haplolethal and haplosterile loci at the molecular level, our data will directly benefit efforts to attain complete deletion coverage of the D. melanogaster genome. PMID:17927810

  7. Two spatially separated phases in semiconducting Rb0.8Fe1.5S2

    DOE PAGESBeta

    Wang, Meng; Tian, Wei; Valdivia, P.; Chi, Songxue; Bourret-Courchesne, E.; Dai, Pengcheng; Birgeneau, R. J.

    2014-09-26

    We report neutron scattering and transport measurements on semiconducting Rb0.8Fe1.5S2, a compound isostructural and isoelectronic to the well-studied A0.8FeySe2(A = K, Rb, Cs, Tl/K) superconducting systems. Both resistivity and DC susceptibility measurements reveal a magnetic phase transition at T = 275 K. Neutron diffraction studies show that the 275 K transition originates from a phase with rhombic iron vacancy order which exhibits an in-plane stripe antiferromagnetic ordering below 275 K. In addition, the stripe antiferromagnetic phase interdigitates mesoscopically with an ubiquitous phase with √5 x√5 iron vacancy order. This phase has a magnetic transition at TN = 425 K andmore » an iron vacancy order-disorder transition at TS = 600 K. These two different structural phases are closely similar to those observed in the isomorphous Se materials. Based on the close similarities of the in-plane antiferromagnetic structures, moments sizes, and ordering temperatures in semiconducting Rb0.8Fe1.5S2 and K0.81Fe1.58Se2, we argue that the in-plane antiferromagnetic order arises from strong coupling between local moments. Superconductivity, previously observed in the A0.8FeySe2₋ zSz system, is absent in A0.8Fe1.5S2, which has a semiconducting ground state. We discuss the implied relationship between stripe and block antiferromagnetism and superconductivity in these materials as well as a strategy for further investigation.« less

  8. SAXS investigation on the temperature dependence of the conformation of Carcinus aestuarii 5S hemocyanin subunit

    NASA Astrophysics Data System (ADS)

    Beltramini, M.; Di Muro, P.; Favilla, R.; La Monaca, A.; Mariani, P.; Sabatucci, A. L.; Salvato, B.; Solari, P. L.

    1999-01-01

    The small-angle X-ray scattering technique has been used to study the spatial distribution of a subunit isolated from Carcinus hemocyanin, in solution at pH 7.5 in the 20°C-40°C temperature range. From the obtained scattering profiles, two species with different gyration radius have been detected by Guinier approximation: one species with Rg1≈25 Å is assigned to the 75 kDa 5S subunit whereas a second species with Rg2≈48 Å, and accounting for ≈3% of the total protein, is attributed to the 450 kDa 16S hexamer. Whereas Rg2 decreases slightly (≈10%) and reversibly on increasing the temperature, Rg2 decreases more markedly (≈30%), but irreversibly. The scattering data have been analysed also on the basis of the impenetrable spheres model and by means of the distance distribution function: the temperature dependence of the geometrical dimensions of the particles is confirmed. In addition, for the 5S subunit also the cross-section gyration radius decreases appreciably (15%) and reversibly with temperature. These results are interpreted on the basis of temperature induced structural rearrangements among the three domains of 5S subunit leading to an increased compactness of the molecule and a more elongated form. In contrast, the effect on the hexamer is assigned to its irreversible dissociation to monomers. This interpretation agrees with the analysis of the distance distribution functions, calculated from the Fourier's transforms of the scattering curves at the different temperatures.

  9. Generalization of adiposity genetic loci to US Hispanic women

    PubMed Central

    Graff, M; Fernández-Rhodes, L; Liu, S; Carlson, C; Wassertheil-Smoller, S; Neuhouser, M; Reiner, A; Kooperberg, C; Rampersaud, E; Manson, J E; Kuller, L H; Howard, B V; Ochs-Balcom, H M; Johnson, K C; Vitolins, M Z; Sucheston, L; Monda, K; North, K E

    2013-01-01

    BACKGROUND: Obesity is a public health concern. Yet the identification of adiposity-related genetic variants among United States (US) Hispanics, which is the largest US minority group, remains largely unknown. OBJECTIVE: To interrogate an a priori list of 47 (32 overall body mass and 15 central adiposity) index single-nucleotide polymorphisms (SNPs) previously studied in individuals of European descent among 3494 US Hispanic women in the Women's Health Initiative SNP Health Association Resource (WHI SHARe). DESIGN: Cross-sectional analysis of measured body mass index (BMI), waist circumference (WC) and waist-to-hip ratio (WHR) were inverse normally transformed after adjusting for age, smoking, center and global ancestry. WC and WHR models were also adjusted for BMI. Genotyping was performed using the Affymetrix 6.0 array. In the absence of an a priori selected SNP, a proxy was selected (r2⩾0.8 in CEU). RESULTS: Six BMI loci (TMEM18, NUDT3/HMGA1, FAIM2, FTO, MC4R and KCTD15) and two WC/WHR loci (VEGFA and ITPR2-SSPN) were nominally significant (P<0.05) at the index or proxy SNP in the corresponding BMI and WC/WHR models. To account for distinct linkage disequilibrium patterns in Hispanics and further assess generalization of genetic effects at each locus, we interrogated the evidence for association at the 47 surrounding loci within 1 Mb region of the index or proxy SNP. Three additional BMI loci (FANCL, TFAP2B and ETV5) and five WC/WHR loci (DNM3-PIGC, GRB14, ADAMTS9, LY86 and MSRA) displayed Bonferroni-corrected significant associations with BMI and WC/WHR. Conditional analyses of each index SNP (or its proxy) and the most significant SNP within the 1 Mb region supported the possible presence of index-independent signals at each of these eight loci as well as at KCTD15. CONCLUSION: This study provides evidence for the generalization of nine BMI and seven central adiposity loci in Hispanic women. This study expands the current knowledge of common adiposity

  10. Magic wavelengths for the 5 s -18 s transition in rubidium

    NASA Astrophysics Data System (ADS)

    Goldschmidt, E. A.; Norris, D. G.; Koller, S. B.; Wyllie, R.; Brown, R. C.; Porto, J. V.; Safronova, U. I.; Safronova, M. S.

    2015-03-01

    Magic wavelengths, for which there is no differential ac Stark shift for the ground and excited state of the atom, allow trapping of excited Rydberg atoms without broadening the optical transition. This is an important tool for implementing quantum gates and other quantum information protocols with Rydberg atoms, and reliable theoretical methods to find such magic wavelengths are thus extremely useful. We use a high-precision all-order method to calculate magic wavelengths for the 5 s -18 s transition of rubidium, and compare the calculation to experiment by measuring the light shift for atoms held in an optical dipole trap at a range of wavelengths near a calculated magic value.

  11. Nucleotide sequences of 5S ribosomal RNA from four oomycete and chytrid water molds.

    PubMed

    Walker, W F; Doolittle, W F

    1982-09-25

    The nucleotide sequences of the 5S rRNAs of the oomycete water molds Saprolegnia ferax and Pythium hydnosporum and of the chytrid water molds Blastocladiella simplex and Phlyctochytrium irregulare were determined by chemical and enzymatic partial degradation of 3' and 5' end-labelled molecules, followed by gel sequence analysis. The two oomycete sequences differed in 24 positions and the two chytrid sequences differed in 27 positions. These pairs differed in a mean of 44 positions. The chytrid sequences clearly most resemble the sequence from the zygomycete Phycomyces, while the oomycete sequences appear to be allied with those from protozoa and slime molds. PMID:6890670

  12. Minimally invasive L5-S1 oblique lumbar interbody fusion with anterior plate.

    PubMed

    Pham, Martin H; Jakoi, Andre M; Hsieh, Patrick C

    2016-07-01

    Lumbar interbody fusion is an important technique for the treatment of degenerative disc disease and degenerative scoliosis. The oblique lumbar interbody fusion (OLIF) establishes a minimally invasive retroperitoneal exposure anterior to the psoas and lumbar plexus. In this video case presentation, the authors demonstrate the techniques of the OLIF at L5-S1 performed on a 69-year-old female with degenerative scoliosis as one component of an overall strategy for her deformity correction. The video can be found here: https://youtu.be/VMUYWKLAl0g . PMID:27364428

  13. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    PubMed

    Eastman, Alexander W; Yuan, Ze-Chun

    2014-01-01

    Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing projects. PMID

  14. Male meiosis, heterochromatin characterization and chromosomal location of rDNA in Microtomus lunifer (Berg, 1900) (Hemiptera: Reduviidae: Hammacerinae)

    PubMed Central

    Poggio, María Georgina; Bressa, María José; Papeschi, Alba Graciela

    2011-01-01

    Abstract In the present work, we analysed the male meiosis, the content and distribution of heterochromatin and the number and location of nucleolus organizing regions in Microtomus lunifer (Berg, 1900) by means of standard technique, C- and fluorescent bandings, and fluorescent in situ hybridization with an 18S rDNA probe. This species is the second one cytogenetically analysed within the Hammacerinae. Its male diploid chromosome number is 31 (2n=28+X1X2Y), including a minute pair of m-chromosomes. The diploid autosomal number and the presence of m-chromosomes are similar to those reported in Microtomus conspicillaris (Drury, 1782) (2n=28+XY). However, Microtomus lunifer has a multiple sex chromosome system X1X2Y (male) that could have originated by fragmentation of the ancestral X chromosome. Taking into account that Microtomus conspicillaris and Microtomus lunifer are the only two species within Reduviidae that possess m-chromosomes, the presence of this pair could be a synapomorphy for the species of this genus. C- and fluorescent bandings showed that the amount of heterochromatin in Microtomus lunifer was small, and only a small CMA3 bright band was observed in the largest autosomal pair at one terminal region. FISH with the 18S rDNA probe demonstrated that ribosomal genes were terminally placed on the largest autosomal pair. Our present results led us to propose that the location of rDNA genes could be associated with variants of the sex chromosome systems in relation with a kind of the sex chromosome systems within this family. Furthermore, the terminal location of NOR in the largest autosomal pair allowed us to use it as a chromosome marker and, thus, to infer that the kinetic activity of both ends is not a random process, and there is an inversion of this activity. PMID:24260616

  15. Molecular microbial diversity of an anaerobic digestor as determined by small-subunit rDNA sequence analysis.

    PubMed Central

    Godon, J J; Zumstein, E; Dabert, P; Habouzit, F; Moletta, R

    1997-01-01

    The bacterial community structure of a fluidized-bed reactor fed by vinasses (wine distillation waste) was analyzed. After PCR amplification, four small-subunit (SSU) rDNA clone libraries of Bacteria, Archaea, Procarya, and Eucarya populations were established. The community structure was determined by operational taxonomic unit (OTU) phylogenetic analyses of 579 partial rDNA sequences (about 500 bp long). A total of 146 OTUs were found, comprising 133, 6, and 7 from the Bacteria, Archaea, and Eucarya domains, respectively. A total of 117 bacterial OTU were affiliated with major phyla: low-G+C gram-positive bacteria, Cytophaga-Flexibacter-Bacteroides, Proteobacteria, high-G+C gram-positive bacteria, and Spirochaetes, where the clone distribution was 34, 26, 17, 6, and 4%, respectively. The other 16 bacterial OTUs represent 13% of the clones. They were either affiliated with narrow phyla such as Planctomyces-Chlamydia, green nonsulfur bacteria, or Synergistes, or deeply branched on the phylogenetic tree. A large number of bacterial OTUs are not closely related to any other hitherto determined sequences. The most frequent bacterial OTUs represents less than 5% of the total bacterial SSU rDNA sequences. However, the 20 more frequent bacterial OTUs describe at least 50% of these sequences. Three of the six Archaea OTUs correspond to 95% of the Archaea population and are very similar to already known methanogenic species: Methanosarcina barkeri, Methanosarcina frisius, and Methanobacterium formicicum. In contrast, the three other Archaea OTUs are unusual and are related to thermophilic microorganisms such as Crenarchaea or Thermoplasma spp. Five percent of the sequences analyzed were chimeras and were removed from the analysis. PMID:9212428

  16. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing

    PubMed Central

    Eastman, Alexander W.; Yuan, Ze-Chun

    2015-01-01

    Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing projects. PMID

  17. Cytogenetic Analysis and Chromosomal Characteristics of the Polymorphic 18S rDNA of Haliotis discus hannai from Fujian, China

    PubMed Central

    Wang, Haishan; Luo, Xuan; You, Weiwei; Dong, Yunwei; Ke, Caihuan

    2015-01-01

    We report on novel chromosomal characteristics of Haliotis discus hannai from a breeding population at Fujian, China. The karyotypes of H. discus hannai we obtained from an abalone farm include a common type 2n = 36 = 10M + 8SM (82%) and two rare types 2n = 36 = 11M + 7SM (14%) and 2n = 36 = 10M + 7SM + 1ST (4%). The results of silver staining showed that the NORs of H. discus hannai were usually located terminally on the long arms of chromosome pairs 14 and 17, NORs were also sometimes located terminally on the short arms of other chromosomes, either metacentric or submetacentric pairs. The number of Ag-nucleoli ranged from 2 to 8, and the mean number was 3.61 ± 0.93. Among the scored interphase cells, 41% had 3 detectable nucleoli and 37% had 4 nucleoli. The 18S rDNA FISH result is the first report of the location of 18S rDNA genes in H. discus hannai. The 18S rDNA locations were highly polymorphic in this species. Copies of the gene were observed in the terminal of long or/and short arms of submetacentric or/and metacentric chromosomes. Using FISH with probe for vertebrate-like telomeric sequences (CCCTAA)3 displayed positive green FITC signals at telomere regions of all analyzed chromosome types. We found about 7% of chromosomes had breaks in prophase. A special form of nucleolus not previously described from H. discus hannai was observed in some interphase cells. It consists of many small silver-stained nucleoli gathered together to form a larger nucleolus and may correspond to prenucleolar bodies. PMID:25699679

  18. Molecular systematics of the genus Troglophilus (Rhaphidophoridae, Orthoptera) in Turkey: mitochondrial 16S rDNA evidences

    PubMed Central

    Taylan, Mehmet Sait; Russo, Claudio Di; Rampini, Mauro; Ketmaier, Valerio

    2013-01-01

    Abstract This study focuses on the evolutionary relationships among Turkish species of the cave cricket genus Troglophilus.Fifteen populations were studied for sequence variation in a fragment (543 base pairs) of the mitochondrial DNA (mtDNA) 16S rDNA gene (16S) to reconstruct their phylogenetic relationships and biogeographic history. Genetic data retrieved three main clades and at least three divergent lineages that could not be attributed to any of the taxa known for the area. Molecular time estimates suggest that the diversification of the group took place between the Messinian and the Plio-Pleistocene. PMID:23653493

  19. PCR amplification of 16S rDNA from lyophilized cell cultures facilitates studies in molecular systematics

    NASA Technical Reports Server (NTRS)

    Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.

    1990-01-01

    The sequence of the major portion of a Bacillus cycloheptanicus strain SCH(T) 16S rRNA gene is reported. This sequence suggests that B. cycloheptanicus is genetically quite distinct from traditional Bacillus strains (e.g., B. subtilis) and may be properly regarded as belonging to a different genus. The sequence was determined from DNA that was produced by direct amplification of ribosomal DNA from a lyophilized cell pellet with straightforward polymerase chain reaction (PCR) procedures. By obviating the need to revive cell cultures from the lyophile pellet, this approach facilitates rapid 16S rDNA sequencing and thereby advances studies in molecular systematics.

  20. 16S and 23S plastid rDNA phylogenies of Prototheca species and their auxanographic phenotypes1

    PubMed Central

    Ewing, Aren; Brubaker, Shane; Somanchi, Aravind; Yu, Esther; Rudenko, George; Reyes, Nina; Espina, Karen; Grossman, Arthur; Franklin, Scott

    2014-01-01

    Because algae have become more accepted as sources of human nutrition, phylogenetic analysis can help resolve the taxonomy of taxa that have not been well studied. This can help establish algal evolutionary relationships. Here, we compare Auxenochlorella protothecoides and 23 strains of Prototheca based on their complete 16S and partial 23S plastid rDNA sequences along with nutrient utilization (auxanographic) profiles. These data demonstrate that some of the species groupings are not in agreement with the molecular phylogenetic analyses and that auxanographic profiles are poor predictors of phylogenetic relationships. PMID:25937672

  1. Microsatellite loci discovery from next-generation sequencing data and loci characterization in the epizoic barnacle Chelonibia testudinaria (Linnaeus, 1758)

    PubMed Central

    Zardus, John D.; Wares, John P.

    2016-01-01

    Microsatellite markers remain an important tool for ecological and evolutionary research, but are unavailable for many non-model organisms. One such organism with rare ecological and evolutionary features is the epizoic barnacle Chelonibia testudinaria (Linnaeus, 1758). Chelonibia testudinaria appears to be a host generalist, and has an unusual sexual system, androdioecy. Genetic studies on host specificity and mating behavior are impeded by the lack of fine-scale, highly variable markers, such as microsatellite markers. In the present study, we discovered thousands of new microsatellite loci from next-generation sequencing data, and characterized 12 loci thoroughly. We conclude that 11 of these loci will be useful markers in future ecological and evolutionary studies on C. testudinaria. PMID:27231653

  2. Combinatorial Mismatch Scan (CMS) for loci associated with dementia in the Amish

    PubMed Central

    McCauley, Jacob L; Hahs, Daniel W; Jiang, Lan; Scott, William K; Welsh-Bohmer, Kathleen A; Jackson, Charles E; Vance, Jeffery M; Pericak-Vance, Margaret A; Haines, Jonathan L

    2006-01-01

    Background Population heterogeneity may be a significant confounding factor hampering detection and verification of late onset Alzheimer's disease (LOAD) susceptibility genes. The Amish communities located in Indiana and Ohio are relatively isolated populations that may have increased power to detect disease susceptibility genes. Methods We recently performed a genome scan of dementia in this population that detected several potential loci. However, analyses of these data are complicated by the highly consanguineous nature of these Amish pedigrees. Therefore we applied the Combinatorial Mismatch Scanning (CMS) method that compares identity by state (IBS) (under the presumption of identity by descent (IBD)) sharing in distantly related individuals from such populations where standard linkage and association analyses are difficult to implement. CMS compares allele sharing between individuals in affected and unaffected groups from founder populations. Comparisons between cases and controls were done using two Fisher's exact tests, one testing for excess in IBS allele frequency and the other testing for excess in IBS genotype frequency for 407 microsatellite markers. Results In all, 13 dementia cases and 14 normal controls were identified who were not related at least through the grandparental generation. The examination of allele frequencies identified 24 markers (6%) nominally (p ≤ 0.05) associated with dementia; the most interesting (empiric p ≤ 0.005) markers were D3S1262, D5S211, and D19S1165. The examination of genotype frequencies identified 21 markers (5%) nominally (p ≤ 0.05) associated with dementia; the most significant markers were both located on chromosome 5 (D5S1480 and D5S211). Notably, one of these markers (D5S211) demonstrated differences (empiric p ≤ 0.005) under both tests. Conclusion Our results provide the initial groundwork for identifying genes involved in late-onset Alzheimer's disease within the Amish community. Genes identified within

  3. Isolation and characterization of eight novel microsatellite loci in the double-crested cormorant (Phalacrocorax auritus)

    USGS Publications Warehouse

    Mercer, Dacey; Haig, Susan; Mullins, Thomas

    2010-01-01

    We describe the isolation and characterization of eight microsatellite loci from the double-crested cormorant (Phalacrocorax auritus). Genetic variability was assessed using 60 individuals from three populations. All loci were variable with the number of alleles ranging from two to 17 per locus, and observed heterozygosity varying from 0.05 to 0.89. No loci showed signs of linkage disequilibrium and all loci conformed to Hardy–Weinberg equilibrium frequencies. Further, all loci amplified and were polymorphic in two related Phalacrocorax species. These loci should prove useful for population genetic studies of the double-crested cormorant and other pelecaniform species.

  4. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    NASA Astrophysics Data System (ADS)

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-03-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system.

  5. Intraspecific and Interspecific Variation in 5s RNA Genes Are Decoupled in Diploid Wheat Relatives

    PubMed Central

    Kellogg, E. A.; Appels, R.

    1995-01-01

    5S RNAs form part of the ribosome in most organisms. In some, e.g., prokaryotes and some fungi, the genes are part of the ribosomal operon, but in most eukaryotes they are in tandem arrays of hundreds to thousands of copies separate from the main ribosomal array. 5S RNA genes can be aligned across kingdoms. We were therefore surprised to find that, for 28 diploid species of the wheat tribe (Triticeae), nucleotide diversity within an array is up to 6.2% in the genes, not significantly different from that of the nontranscribed spacers. Rates of concerted evolution must therefore be insufficient to homogenize the entire array. Between species, there are significantly fewer fixed differences in the gene than would be expected, given the high within-species variation. In contrast, the amount of variation between species in the spacer is the same as or greater than that within individuals. This leads to a paradox. High variation within an individual suggests that there is little selection on any particular gene within an array. But conservation of the gene across species implies that polymorphisms are periodically eliminated at a rate approximately equal to or greater than that of speciation. Levels of intraspecific polymorphism and interspecific divergence are thus decoupled. This implies that selective mechanisms exist to eliminate mutations in the gene without also affecting the spacer. PMID:7635297

  6. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure.

    PubMed

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-01-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30-70 K in pressure range of 100-170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50-70 K in pressure range of 100-150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  7. Magnetization reversal phenomena in (Cr0.70Ti0.30)5S6

    NASA Astrophysics Data System (ADS)

    Hashimoto, Satoshi; Matsuda, Yuji; Sato, Tetsuya; Anzai, Shuichiro

    2005-12-01

    Magnetization reversal phenomena (MRP) along magnetic order-order transitions have recently been reported on impurity-doped magnetic systems. Because imperfect long-range magnetic order exists in these systems, it is expected that a systematic investigation of MRP will give physical information on thermomagnetic processes of magnetic systems in the range from the micro- to nanoscales. As a typical order-order transition (a state doubly modulated by helical and canting orders to a collinear ferrimagnetic state) has been known to occur on Cr5S6 at a transition temperature Tt, we investigate the magnetizations of (Cr0.70Ti0.30)5S6 on heating and cooling runs in various magnetic fields. At 20Oe, the field-cooled magnetization just below the Curie temperature has a positive sign; the sign turns negative below the compensation temperature TCM (first step) and finally returns to positive below Tt (second step). The first-step MRP observed in this system is explained by the potential barriers resulting from anisotropy energy when the preferred direction of collinear ferrimagnetic moment reverses. The proposed mechanism for second-step MRP is the pinning effect caused by the impurity atoms (Ti) in the helical long-range-order chains. Comparing other examples of MRPs, we discuss the roles of local impurity centers in the thermomagnetic process in magnetic order-order transitions.

  8. Construction of the mycoplasma evolutionary tree from 5S rRNA sequence data.

    PubMed Central

    Rogers, M J; Simmons, J; Walker, R T; Weisburg, W G; Woese, C R; Tanner, R S; Robinson, I M; Stahl, D A; Olsen, G; Leach, R H

    1985-01-01

    The 5S rRNA sequences of eubacteria and mycoplasmas have been analyzed and a phylogenetic tree constructed. We determined the sequences of 5S rRNA from Clostridium innocuum, Acholeplasma laidlawii, Acholeplasma modicum, Anaeroplasma bactoclasticum, Anaeroplasma abactoclasticum, Ureaplasma urealyticum, Mycoplasma mycoides mycoides, Mycoplasma pneumoniae, and Mycoplasma gallisepticum. Analysis of these and published sequences shows that mycoplasmas form a coherent phylogenetic group that, with C. innocuum, arose as a branch of the low G+C Gram-positive tree, near the lactobacilli and streptococci. The initial event in mycoplasma phylogeny was formation of the Acholeplasma branch; hence, loss of cell wall probably occurred at the time of genome reduction to approximately to 1000 MDa. A subsequent branch produced the Spiroplasma. This branch appears to have been the origin of sterol-requiring mycoplasmas. During development of the Spiroplasma branch there were several independent genome reductions, each to approximately 500 MDa, resulting in Mycoplasma and Ureaplasma species. Mycoplasmas, particularly species with the smallest genomes, have high mutation rates, suggesting that they are in a state of rapid evolution. PMID:2579388

  9. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    PubMed Central

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-01-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  10. A new genotype of Trypanosoma cruzi associated with bats evidenced by phylogenetic analyses using SSU rDNA, cytochrome b and Histone H2B genes and genotyping based on ITS1 rDNA.

    PubMed

    Marcili, A; Lima, L; Cavazzana, M; Junqueira, A C V; Veludo, H H; Maia Da Silva, F; Campaner, M; Paiva, F; Nunes, V L B; Teixeira, M M G

    2009-05-01

    We characterized 15 Trypanosoma cruzi isolates from bats captured in the Amazon, Central and Southeast Brazilian regions. Phylogenetic relationships among T. cruzi lineages using SSU rDNA, cytochrome b, and Histone H2B genes positioned all Amazonian isolates into T. cruzi I (TCI). However, bat isolates from the other regions, which had been genotyped as T. cruzi II (TC II) by the traditional genotyping method based on mini-exon gene employed in this study, were not nested within any of the previously defined TCII sublineages, constituting a new genotype designated as TCbat. Phylogenetic analyses demonstrated that TCbat indeed belongs to T. cruzi and not to other closely related bat trypanosomes of the subgenus Schizotrypanum, and that although separated by large genetic distances TCbat is closest to lineage TCI. A genotyping method targeting ITS1 rDNA distinguished TCbat from established T. cruzi lineages, and from other Schizotrypanum species. In experimentally infected mice, TCbat lacked virulence and yielded low parasitaemias. Isolates of TCbat presented distinctive morphological features and behaviour in triatomines. To date, TCbat genotype was found only in bats from anthropic environments of Central and Southeast Brazil. Our findings indicate that the complexity of T. cruzi is larger than currently known, and confirmed bats as important reservoirs and potential source of T. cruzi infections to humans. PMID:19368741

  11. Homothetic Transformations and Geometric Loci: Properties of Triangles and Quadrilaterals

    ERIC Educational Resources Information Center

    Mammana, Maria Flavia

    2016-01-01

    In this paper, we use geometric transformations to find some interesting properties related with geometric loci. In particular, given a triangle or a cyclic quadrilateral, the locus generated by the centroid or by the orthocentre (for triangles) or by the anticentre (for cyclic quadrilaterals) when one vertex moves on the circumcircle of the…

  12. Evolutionary genomics of immunoglobulin-encoding Loci in vertebrates.

    PubMed

    Das, Sabyasachi; Hirano, Masayuki; Tako, Rea; McCallister, Chelsea; Nikolaidis, Nikolas

    2012-04-01

    Immunoglobulins (or antibodies) are an essential element of the jawed vertebrate adaptive immune response system. These molecules have evolved over the past 500 million years and generated highly specialized proteins that recognize an extraordinarily large number of diverse substances, collectively known as antigens. During vertebrate evolution the diversification of the immunoglobulin-encoding loci resulted in differences in the genomic organization, gene content, and ratio of functional genes and pseudogenes. The tinkering process in the immunoglobulin-encoding loci often gave rise to lineage-specific characteristics that were formed by selection to increase species adaptation and fitness. Immunoglobulin loci and their encoded antibodies have been shaped repeatedly by contrasting evolutionary forces, either to conserve the prototypic structure and mechanism of action or to generate alternative and diversified structures and modes of function. Moreover, evolution favored the development of multiple mechanisms of primary and secondary antibody diversification, which are used by different species to effectively generate an almost infinite collection of diverse antibody types. This review summarizes our current knowledge on the genomics and evolution of the immunoglobulin-encoding loci and their protein products in jawed vertebrates. PMID:23024601

  13. Mapping Quantitative Trait Loci for Resistance to Rice Blast

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Quantitative trait loci (QTLs) conferring resistance to rice blast, caused by Magnaporthe oryzae, have been under-explored. In the present study, composite interval mapping was used to identify the QTLs that condition resistance to the six out of the twelve common races IB1, IB45, IB49, IB54, IC17,...

  14. Testing independence of fragment lengths within VNTR loci

    SciTech Connect

    Geisser, S. ); Johnson, W. )

    1993-11-01

    Methods that were devised to test independence of the bivariate fragment lengths obtained from VNTR loci are applied to several population databases. It is shown that for many of the probes independence (Hardy-Weinberg equilibrium) cannot be sustained. 3 refs., 3 tabs.

  15. The IQ Quantitative Trait Loci Project: A Critique.

    ERIC Educational Resources Information Center

    King, David

    1998-01-01

    Describes the IQ Quantitative Trait Loci (QTL) project, an attempt to identify genes underlying IQ score variations using maps from the Human Genome Project. The essay argues against funding the IQ QTL project because it will end the debates about the genetic basis of intelligence and may lead directly to eugenic programs of genetic testing. (SLD)

  16. Microsatellite loci for the invasive colonial hydrozoan Cordylophora caspia

    EPA Science Inventory

    Cordylophora caspia, a colonial hydrozoan native to the Ponto-Caspian region, has become a common invader of both fresh and brackish water ecosystems of North America and Europe. Here we describe 11 polymorphic microsatellite loci for this species. Preliminary analyses indicate ...

  17. Seven new loci associated with age-related macular degeneration.

    PubMed

    Fritsche, Lars G; Chen, Wei; Schu, Matthew; Yaspan, Brian L; Yu, Yi; Thorleifsson, Gudmar; Zack, Donald J; Arakawa, Satoshi; Cipriani, Valentina; Ripke, Stephan; Igo, Robert P; Buitendijk, Gabriëlle H S; Sim, Xueling; Weeks, Daniel E; Guymer, Robyn H; Merriam, Joanna E; Francis, Peter J; Hannum, Gregory; Agarwal, Anita; Armbrecht, Ana Maria; Audo, Isabelle; Aung, Tin; Barile, Gaetano R; Benchaboune, Mustapha; Bird, Alan C; Bishop, Paul N; Branham, Kari E; Brooks, Matthew; Brucker, Alexander J; Cade, William H; Cain, Melinda S; Campochiaro, Peter A; Chan, Chi-Chao; Cheng, Ching-Yu; Chew, Emily Y; Chin, Kimberly A; Chowers, Itay; Clayton, David G; Cojocaru, Radu; Conley, Yvette P; Cornes, Belinda K; Daly, Mark J; Dhillon, Baljean; Edwards, Albert O; Evangelou, Evangelos; Fagerness, Jesen; Ferreyra, Henry A; Friedman, James S; Geirsdottir, Asbjorg; George, Ronnie J; Gieger, Christian; Gupta, Neel; Hagstrom, Stephanie A; Harding, Simon P; Haritoglou, Christos; Heckenlively, John R; Holz, Frank G; Hughes, Guy; Ioannidis, John P A; Ishibashi, Tatsuro; Joseph, Peronne; Jun, Gyungah; Kamatani, Yoichiro; Katsanis, Nicholas; N Keilhauer, Claudia; Khan, Jane C; Kim, Ivana K; Kiyohara, Yutaka; Klein, Barbara E K; Klein, Ronald; Kovach, Jaclyn L; Kozak, Igor; Lee, Clara J; Lee, Kristine E; Lichtner, Peter; Lotery, Andrew J; Meitinger, Thomas; Mitchell, Paul; Mohand-Saïd, Saddek; Moore, Anthony T; Morgan, Denise J; Morrison, Margaux A; Myers, Chelsea E; Naj, Adam C; Nakamura, Yusuke; Okada, Yukinori; Orlin, Anton; Ortube, M Carolina; Othman, Mohammad I; Pappas, Chris; Park, Kyu Hyung; Pauer, Gayle J T; Peachey, Neal S; Poch, Olivier; Priya, Rinki Ratna; Reynolds, Robyn; Richardson, Andrea J; Ripp, Raymond; Rudolph, Guenther; Ryu, Euijung; Sahel, José-Alain; Schaumberg, Debra A; Scholl, Hendrik P N; Schwartz, Stephen G; Scott, William K; Shahid, Humma; Sigurdsson, Haraldur; Silvestri, Giuliana; Sivakumaran, Theru A; Smith, R Theodore; Sobrin, Lucia; Souied, Eric H; Stambolian, Dwight E; Stefansson, Hreinn; Sturgill-Short, Gwen M; Takahashi, Atsushi; Tosakulwong, Nirubol; Truitt, Barbara J; Tsironi, Evangelia E; Uitterlinden, André G; van Duijn, Cornelia M; Vijaya, Lingam; Vingerling, Johannes R; Vithana, Eranga N; Webster, Andrew R; Wichmann, H-Erich; Winkler, Thomas W; Wong, Tien Y; Wright, Alan F; Zelenika, Diana; Zhang, Ming; Zhao, Ling; Zhang, Kang; Klein, Michael L; Hageman, Gregory S; Lathrop, G Mark; Stefansson, Kari; Allikmets, Rando; Baird, Paul N; Gorin, Michael B; Wang, Jie Jin; Klaver, Caroline C W; Seddon, Johanna M; Pericak-Vance, Margaret A; Iyengar, Sudha K; Yates, John R W; Swaroop, Anand; Weber, Bernhard H F; Kubo, Michiaki; Deangelis, Margaret M; Léveillard, Thierry; Thorsteinsdottir, Unnur; Haines, Jonathan L; Farrer, Lindsay A; Heid, Iris M; Abecasis, Gonçalo R

    2013-04-01

    Age-related macular degeneration (AMD) is a common cause of blindness in older individuals. To accelerate the understanding of AMD biology and help design new therapies, we executed a collaborative genome-wide association study, including >17,100 advanced AMD cases and >60,000 controls of European and Asian ancestry. We identified 19 loci associated at P < 5 × 10(-8). These loci show enrichment for genes involved in the regulation of complement activity, lipid metabolism, extracellular matrix remodeling and angiogenesis. Our results include seven loci with associations reaching P < 5 × 10(-8) for the first time, near the genes COL8A1-FILIP1L, IER3-DDR1, SLC16A8, TGFBR1, RAD51B, ADAMTS9 and B3GALTL. A genetic risk score combining SNP genotypes from all loci showed similar ability to distinguish cases and controls in all samples examined. Our findings provide new directions for biological, genetic and therapeutic studies of AMD. PMID:23455636

  18. Chromosomal localization of microsatellite loci in Drosophila mediopunctata.

    PubMed

    Cavasini, Renato; Batista, Marcos Roberto Dias; Klaczko, Louis Bernard

    2015-03-01

    Drosophila mediopunctata has been used as a model organism for genetics and evolutionary studies in the last three decades. A linkage map with 48 microsatellite loci recently published for this species showed five syntenic groups, which had their homology determined to Drosophila melanogaster chromosomes. Then, by inference, each of the groups was associated with one of the five major chromosomes of D. mediopunctata. Our objective was to carry out a genetic (chromosomal) analysis to increase the number of available loci with known chromosomal location. We made a simultaneous analysis of visible mutant phenotypes and microsatellite genotypes in a backcross of a standard strain and a mutant strain, which had each major autosome marked. Hence, we could establish the chromosomal location of seventeen loci; including one from each of the five major linkage groups previously published, and twelve new loci. Our results were congruent with the previous location and they open new possibilities to future work integrating microsatellites, chromosomal inversions, and genetic determinants of physiological and morphological variation. PMID:25983625

  19. Relatedness calculations for linked loci incorporating subpopulation effects.

    PubMed

    Bright, Jo-Anne; Curran, James M; Buckleton, John S

    2013-05-01

    Often the loci in forensic multiplexes are selected to avoid linked loci. However linked loci have occurred in some recent commercially available multiplexes. Previously formulae have been given for both joint and conditional match probabilities for some relationships that did not account for subpopulation effects. In this paper we extend these works to include a subpopulation correction of the form first suggested by Balding and Nichols. We extend the work to grandparent/grandchild, first cousin, uncle/nephew and half uncle/nephew relationships and apply these to two different populations and STR multiplexes. Our model assumes that the two people have no relationship other that the one specified. That is, we assume their parents are neither related nor themselves inbred. The multiplications inherent in these formulae also assume that there is no linkage disequilibrium at the subpopulation level for these loci. We found that when taking into account linkage the match statistic decreases for all relationships, with siblings having the greatest effect. However, the effect was less than a factor of two decrease in match statistic. PMID:23537755

  20. Educational Software for Mapping Quantitative Trait Loci (QTL)

    ERIC Educational Resources Information Center

    Helms, T. C.; Doetkott, C.

    2007-01-01

    This educational software was developed to aid teachers and students in their understanding of how the process of identifying the most likely quantitative trait loci (QTL) position is determined between two flanking DNA markers. The objective of the software that we developed was to: (1) show how a QTL is mapped to a position on a chromosome using…

  1. Molecularly tagged genes and quantitative trait loci in cucumber

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Since the release of the cucumber draft genome, significant progress has been made in molecular mapping, tagging or cloning of horticulturally important genes and quantitative trait loci (QTLs) in cucumber, which provides the foundation for practicing marker-assisted selection in cucumber breeding. ...

  2. Novel loci and pathways significantly associated with longevity.

    PubMed

    Zeng, Yi; Nie, Chao; Min, Junxia; Liu, Xiaomin; Li, Mengmeng; Chen, Huashuai; Xu, Hanshi; Wang, Mingbang; Ni, Ting; Li, Yang; Yan, Han; Zhang, Jin-Pei; Song, Chun; Chi, Li-Qing; Wang, Han-Ming; Dong, Jie; Zheng, Gu-Yan; Lin, Li; Qian, Feng; Qi, Yanwei; Liu, Xiao; Cao, Hongzhi; Wang, Yinghao; Zhang, Lijuan; Li, Zhaochun; Zhou, Yufeng; Wang, Yan; Lu, Jiehua; Li, Jianxin; Qi, Ming; Bolund, Lars; Yashin, Anatoliy; Land, Kenneth C; Gregory, Simon; Yang, Ze; Gottschalk, William; Tao, Wei; Wang, Jian; Wang, Jun; Xu, Xun; Bae, Harold; Nygaard, Marianne; Christiansen, Lene; Christensen, Kaare; Franceschi, Claudio; Lutz, Michael W; Gu, Jun; Tan, Qihua; Perls, Thomas; Sebastiani, Paola; Deelen, Joris; Slagboom, Eline; Hauser, Elizabeth; Xu, Huji; Tian, Xiao-Li; Yang, Huanming; Vaupel, James W

    2016-01-01

    Only two genome-wide significant loci associated with longevity have been identified so far, probably because of insufficient sample sizes of centenarians, whose genomes may harbor genetic variants associated with health and longevity. Here we report a genome-wide association study (GWAS) of Han Chinese with a sample size 2.7 times the largest previously published GWAS on centenarians. We identified 11 independent loci associated with longevity replicated in Southern-Northern regions of China, including two novel loci (rs2069837-IL6; rs2440012-ANKRD20A9P) with genome-wide significance and the rest with suggestive significance (P < 3.65 × 10(-5)). Eight independent SNPs overlapped across Han Chinese, European and U.S. populations, and APOE and 5q33.3 were replicated as longevity loci. Integrated analysis indicates four pathways (starch, sucrose and xenobiotic metabolism; immune response and inflammation; MAPK; calcium signaling) highly associated with longevity (P ≤ 0.006) in Han Chinese. The association with longevity of three of these four pathways (MAPK; immunity; calcium signaling) is supported by findings in other human cohorts. Our novel finding on the association of starch, sucrose and xenobiotic metabolism pathway with longevity is consistent with the previous results from Drosophilia. This study suggests protective mechanisms including immunity and nutrient metabolism and their interactions with environmental stress play key roles in human longevity. PMID:26912274

  3. Novel loci and pathways significantly associated with longevity

    PubMed Central

    Zeng, Yi; Nie, Chao; Min, Junxia; Liu, Xiaomin; Li, Mengmeng; Chen, Huashuai; Xu, Hanshi; Wang, Mingbang; Ni, Ting; Li, Yang; Yan, Han; Zhang, Jin-Pei; Song, Chun; Chi, Li-Qing; Wang, Han-Ming; Dong, Jie; Zheng, Gu-Yan; Lin, Li; Qian, Feng; Qi, Yanwei; Liu, Xiao; Cao, Hongzhi; Wang, Yinghao; Zhang, Lijuan; Li, Zhaochun; Zhou, Yufeng; Wang, Yan; Lu, Jiehua; Li, Jianxin; Qi, Ming; Bolund, Lars; Yashin, Anatoliy; Land, Kenneth C.; Gregory, Simon; Yang, Ze; Gottschalk, William; Tao, Wei; Wang, Jian; Wang, Jun; Xu, Xun; Bae, Harold; Nygaard, Marianne; Christiansen, Lene; Christensen, Kaare; Franceschi, Claudio; Lutz, Michael W.; Gu, Jun; Tan, Qihua; Perls, Thomas; Sebastiani, Paola; Deelen, Joris; Slagboom, Eline; Hauser, Elizabeth; Xu, Huji; Tian, Xiao-Li; Yang, Huanming; Vaupel, James W.

    2016-01-01

    Only two genome-wide significant loci associated with longevity have been identified so far, probably because of insufficient sample sizes of centenarians, whose genomes may harbor genetic variants associated with health and longevity. Here we report a genome-wide association study (GWAS) of Han Chinese with a sample size 2.7 times the largest previously published GWAS on centenarians. We identified 11 independent loci associated with longevity replicated in Southern-Northern regions of China, including two novel loci (rs2069837-IL6; rs2440012-ANKRD20A9P) with genome-wide significance and the rest with suggestive significance (P < 3.65 × 10−5). Eight independent SNPs overlapped across Han Chinese, European and U.S. populations, and APOE and 5q33.3 were replicated as longevity loci. Integrated analysis indicates four pathways (starch, sucrose and xenobiotic metabolism; immune response and inflammation; MAPK; calcium signaling) highly associated with longevity (P ≤ 0.006) in Han Chinese. The association with longevity of three of these four pathways (MAPK; immunity; calcium signaling) is supported by findings in other human cohorts. Our novel finding on the association of starch, sucrose and xenobiotic metabolism pathway with longevity is consistent with the previous results from Drosophilia. This study suggests protective mechanisms including immunity and nutrient metabolism and their interactions with environmental stress play key roles in human longevity. PMID:26912274

  4. Repair of rDNA in Saccharomyces cerevisiae: RAD4-independent strand-specific nucleotide excision repair of RNA polymerase I transcribed genes.

    PubMed Central

    Verhage, R A; Van de Putte, P; Brouwer, J

    1996-01-01

    Removal of UV-induced pyrimidine dimers from the individual strands of the rDNA locus in Saccharomyces cerevisiae was studied. Yeast rDNA, that is transcribed by RNA polymerase I(RNA pol I), is repaired efficiently, slightly strand-specific and independently of RAD26, which has been implicated in transcription-coupled repair of the RNA pol II transcribed RPB2 gene. No repair of rDNA is observed in rad1,2,3 and 14 mutants, demonstrating that dimer removal from this highly repetitive DNA is accomplished by nucleotide excision repair (NER). In rad7 and rad16 mutants, which are specifically deficient in repair of non-transcribed DNA, there is a clear preferential repair of the transcribed strand of rDNA, indicating that strand-specific and therefore probably transcription-coupled repair of RNA pol I transcribed genes does exist in yeast. Unexpectedly, the transcribed but not the non-transcribed strand of rDNA can be repaired in rad4 mutants, which seem otherwise completely NER-deficient. PMID:8604332

  5. Molecular phylogenetics at the Felsenstein zone: approaching the Strepsiptera problem using 5.8S and 28S rDNA sequences.

    PubMed

    Hwang, U W; Kim, W; Tautz, D; Friedrich, M

    1998-06-01

    Recent efforts to reconstruct the phylogenetic position of the insect order Strepsiptera have elicited a major controversy in molecular phylogenetics. We sequenced the 5.8S rDNA and major parts of the 28S rDNA 5' region of the strepsipteran species Stylops melittae. Their evolutionary dynamics were analyzed together with previously published insect rDNA sequences to identify tree estimation bias risks and to explore additional sources of phylogenetic information. Several major secondary structure changes were found as being autapomorphic for the Diptera, the Strepsiptera, or the Archaeognatha. Besides elevated substitution rates a significant AT bias was present in dipteran and strepsipteran 28S rDNA which, however, was restricted to stem sites in the Diptera while also affecting single-stranded sites in the Strepsiptera. When dipteran taxa were excluded from tree estimation all methods consistently supported the placement of Strepsiptera to within the Holometabola. When dipteran taxa were included maximum likelihood continued to favor a sister-group relationship of Strepsiptera with Mecoptera while remaining methods strongly supported a sister-group relationship with Diptera. Parametric bootstrap analysis revealed maximum likelihood as a consistent estimator if rate heterogeneity across sites was taken into account. Though the position of Strepsiptera within Holometabola remains elusive, we conclude that the evolution of dipteran and strepsipteran rDNA involved similar yet independent changes of substitution parameters. PMID:9667995

  6. Sharp switches between regular and swinger mitochondrial replication: 16S rDNA systematically exchanging nucleotides A<->T+C<->G in the mitogenome of Kamimuria wangi.

    PubMed

    Seligmann, Hervé

    2016-07-01

    Swinger DNAs are sequences whose homology with known sequences is detected only by assuming systematic exchanges between nucleotides. Nine symmetric (X<->Y, i.e. A<->C) and fourteen asymmetric (X->Y->Z, i.e. A->C->G) exchanges exist. All swinger DNA previously detected in GenBank follow the A<->T+C<->G exchange, while mitochondrial swinger RNAs distribute among different swinger types. Here different alignment criteria detect 87 additional swinger mitochondrial DNAs (86 from insects), including the first swinger gene embedded within a complete genome, corresponding to the mitochondrial 16S rDNA of the stonefly Kamimuria wangi. Other Kamimuria mt genome regions are "regular", stressing unanswered questions on (a) swinger polymerization regulation; (b) swinger 16S rDNA functions; and (c) specificity to rDNA, in particular 16S rDNA. Sharp switches between regular and swinger replication, together with previous observations on swinger transcription, suggest that swinger replication might be due to a switch in polymerization mode of regular polymerases and the possibility of swinger-encoded information, predicted in primordial genes such as rDNA. PMID:25865623

  7. Encephalitozoon cuniculi (Microspora) genome: physical map and evidence for telomere-associated rDNA units on all chromosomes

    PubMed Central

    Brugère, Jean-François; Cornillot, Emmanuel; Méténier, Guy; Bensimon, Aaron; Vivarès, Christian P.

    2000-01-01

    A restriction map of the 2.8-Mb genome of the unicellular eukaryote Encephalitozoon cuniculi (phylum Microspora), a mammal-infecting intracellular parasite, has been constructed using two restriction enzymes with 6 bp recognition sites (BssHII and MluI). The fragments resulting from either single digestions of the whole molecular karyotype or double digestions of 11 individual chromosomes have been separated by two-dimensional pulsed field gel electrophoresis (2D-PFGE) procedures. The average distance between successive restriction sites is ~19 kb. The terminal regions of the chromosomes show a common pattern covering ~15 kb and including one 16S–23S rDNA unit. Results of hybridisation and molecular combing experiments indicate a palindromic-like orientation of the two subtelomeric rDNA copies on each chromosome. We have also located 67 DNA markers (clones from a partial E.cuniculi genomic library) by hybridisation to restriction fragments. Partial or complete sequencing has revealed homologies with known protein-coding genes for 32 of these clones. Evidence for two homologous chromosomes III, with a size difference (3 kb) related to a subtelomeric deletion/insertion event, argues for diploidy of E.cuniculi. The physical map should be useful for both the whole genome sequencing project and studies on genome plasticity of this widespread parasite. PMID:10773069

  8. Use of acetate for enrichment of electrochemically active microorganisms and their 16S rDNA analyses.

    PubMed

    Lee, Jiyoung; Phung, Nguyet Thu; Chang, In Seop; Kim, Byung Hong; Sung, Ha Chin

    2003-06-27

    A fuel cell-type electrochemical device has been used to enrich microbes oxidizing acetate with concomitant electricity generation without using an electron mediator from activated sludge. The device generated a stable current of around 5 mA with complete oxidation of 5 mM acetate at the hydraulic retention time of 2.5 h after 4 weeks of enrichment. Over 70% of electrons available from acetate oxidation was recovered as current. Carbon monoxide or hydrogen did not influence acetate oxidation or current generation from the microbial fuel cell (MFC). Denaturing gradient gel electrophoresis showed that DNA extracted from the acetate-enriched MFC had different 16S rDNA patterns from those of sludge or glucose+glutamate-enriched MFCs. Nearly complete 16S rDNA sequence analyses showed that diverse bacteria were enriched in the MFC fed with acetate. Electron microscopic observations showed biofilm developed on the electrode, but not microbial clumps observed in MFCs fed with complex fuel such as glucose and wastewater from a corn-processing factory. PMID:12829284

  9. Assessing diversity of the female urine microbiota by high throughput sequencing of 16S rDNA amplicons

    PubMed Central

    2011-01-01

    Background Urine within the urinary tract is commonly regarded as "sterile" in cultivation terms. Here, we present a comprehensive in-depth study of bacterial 16S rDNA sequences associated with urine from healthy females by means of culture-independent high-throughput sequencing techniques. Results Sequencing of the V1V2 and V6 regions of the 16S ribosomal RNA gene using the 454 GS FLX system was performed to characterize the possible bacterial composition in 8 culture-negative (<100,000 CFU/ml) healthy female urine specimens. Sequences were compared to 16S rRNA databases and showed significant diversity, with the predominant genera detected being Lactobacillus, Prevotella and Gardnerella. The bacterial profiles in the female urine samples studied were complex; considerable variation between individuals was observed and a common microbial signature was not evident. Notably, a significant amount of sequences belonging to bacteria with a known pathogenic potential was observed. The number of operational taxonomic units (OTUs) for individual samples varied substantially and was in the range of 20 - 500. Conclusions Normal female urine displays a noticeable and variable bacterial 16S rDNA sequence richness, which includes fastidious and anaerobic bacteria previously shown to be associated with female urogenital pathology. PMID:22047020

  10. Identification of Thiobacillus ferrooxidans strains based on restriction fragment length polymorphism analysis of 16S rDNA.

    PubMed

    Kamimura, K; Wakai, S; Sugio, T

    2001-01-01

    The 16S rDNA sequences from ten strains of Thiobacillus ferrooxidans were amplified by PCR. The products were compared by performing restriction fragment length polymorphism (RFLP) analysis with restriction endonucleases Alu I, Hap II, Hha I, and Hae III. The RFLP patterns revealed that T. ferrooxidans could be distinguished from other iron- or sulphur-oxidizing bacteria such as T. thiooxidans NB1-3, T. caldus GO-1, Leptospirillum ferrooxidans and the marine iron-oxidizing bacterium strain KU2-11. The RFLP patterns obtained with Alu I, Hap II, and Hae III were the same for nine strains of T. ferrooxidans except for strain ATCC 13661. The RFLP patterns for strains NASF-1 and ATCC 13661 with Hha I were distinct from those for other T. ferrooxidans strains. The 16S rDNA sequence of T. ferrooxidans NASF-1 possessed an additional restriction site for Hha I. These results show that iron-oxidizing bacteria isolated from natural environments were rapidly identified as T. ferrooxidans by the method combining RFLP analysis with physiological analysis. PMID:11414499

  11. Studying long 16S rDNA sequences with ultrafast-metagenomic sequence classification using exact alignments (Kraken).

    PubMed

    Valenzuela-González, Fabiola; Martínez-Porchas, Marcel; Villalpando-Canchola, Enrique; Vargas-Albores, Francisco

    2016-03-01

    Ultrafast-metagenomic sequence classification using exact alignments (Kraken) is a novel approach to classify 16S rDNA sequences. The classifier is based on mapping short sequences to the lowest ancestor and performing alignments to form subtrees with specific weights in each taxon node. This study aimed to evaluate the classification performance of Kraken with long 16S rDNA random environmental sequences produced by cloning and then Sanger sequenced. A total of 480 clones were isolated and expanded, and 264 of these clones formed contigs (1352 ± 153 bp). The same sequences were analyzed using the Ribosomal Database Project (RDP) classifier. Deeper classification performance was achieved by Kraken than by the RDP: 73% of the contigs were classified up to the species or variety levels, whereas 67% of these contigs were classified no further than the genus level by the RDP. The results also demonstrated that unassembled sequences analyzed by Kraken provide similar or inclusively deeper information. Moreover, sequences that did not form contigs, which are usually discarded by other programs, provided meaningful information when analyzed by Kraken. Finally, it appears that the assembly step for Sanger sequences can be eliminated when using Kraken. Kraken cumulates the information of both sequence senses, providing additional elements for the classification. In conclusion, the results demonstrate that Kraken is an excellent choice for use in the taxonomic assignment of sequences obtained by Sanger sequencing or based on third generation sequencing, of which the main goal is to generate larger sequences. PMID:26812576

  12. Freshwater Perkinsea and marine-freshwater colonizations revealed by pyrosequencing and phylogeny of environmental rDNA.

    PubMed

    Bråte, Jon; Logares, Ramiro; Berney, Cédric; Ree, Dan Kristofer; Klaveness, Dag; Jakobsen, Kjetill S; Shalchian-Tabrizi, Kamran

    2010-09-01

    Protist parasites are ecologically important, as they can have great impact on host population dynamics and functioning of entire ecosystems. Nevertheless, little is known about their prevalence in aquatic habitats. Here, we investigate the diversity and distributional patterns of the protist parasites Perkinsus and Parvilucifera (Perkinsea). Our approach included 454 pyrosequencing of the 18S rDNA gene obtained from a high-altitude lake (Lake Finsevatn, Norway) and phylogenetic analyses of all publicly available sequences related to Perkinsea. The applied PCR primers target a 450 bp region that encompass the variable V4 region of the 18S rDNA gene and have been optimized for the Titanium upgrade of the 454 technology. Nearly 5000 sequences longer than 150 bp were recovered from nearly all eukaryotic supergroups, and of those, 13 unique sequences were affiliated to Perkinsea. Thus, our new strategy for 454 amplicon sequencing was able to recover a large diversity of distantly related eukaryotes and previously unknown species of Perkinsea. In addition, we identified 40 Perkinsea sequences in GenBank generated by other recent diversity surveys. Importantly, phylogenetic analyses of these sequences identified 17 habitat-specific marine and freshwater clades (PERK 1-17). Hence, only a few successful transitions between these habitats have taken place over the entire history of Perkinsea, suggesting that the boundary between marine and fresh waters may constitute a barrier to cross-colonizations for intracellular parasites. PMID:20393574

  13. Genus-specific profile of acetic acid bacteria by 16S rDNA PCR-DGGE.

    PubMed

    De Vero, Luciana; Giudici, Paolo

    2008-06-30

    An effective method for grouping acetic acid bacteria (AAB) genera was defined and evaluated as a tool for preliminary screening of the major AAB species involved in vinegar production. Acetobacter, Gluconobacter, Gluconacetobacter, Asaia, Neoasaia, Saccharibacter, Frateuria and Kozakia AAB strains were screened on the basis of the 16S rDNA sequences using polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) technique. The DGGE profile of all the strains tested, consisted of one single band of approximately 330 bp for each strain and allowed their clustering. The results obtained clearly reflected in silico phylogenetic analysis of the AAB species used in this study, in fact, the species with a higher 16S rDNA sequence homology showed a similar electrophoretic profile. In particular almost all the species belonging to the genus Gluconacetobacter showed a DGGE pattern nearly identical and well distinct from all the other AAB genera. Furthermore by PCR-DGGE it was possible to clearly group the species more frequently recovered from vinegar fermentation which are mainly distributed in the genera Acetobacter, Gluconobacter and Gluconacetobacter. PMID:17919758

  14. Telonemia-specific environmental 18S rDNA PCR reveals unknown diversity and multiple marine-freshwater colonizations

    PubMed Central

    2010-01-01

    Background Recent surveys of eukaryote 18S rDNA diversity in marine habitats have uncovered worldwide distribution of the heterotrophic eukaryote phylum Telonemia. Here we investigate the diversity and geographic distribution of Telonemia sequences by in-depth sequencing of several new 18S rDNA clone libraries from both marine and freshwater sites by using a Telonemia-specific PCR strategy. Results In contrast to earlier studies that have employed eukaryote-wide PCR design, we identified a large and unknown diversity of phylotypes and the first rigorous evidence for several freshwater species, altogether comprising 91 unique sequences. Phylogenies of these and publicly available sequences showed 20 statistically supported sub-clades as well as several solitary phylotypes with no clear phylogenetic affiliation. Most of these sub-clades were composed of phylotypes from different geographic regions. Conclusions By using specific PCR primers we reveal a much larger diversity of Telonemia from environmental samples than previously uncovered by eukaryote-wide primers. The new data substantially diminish the geographic structuring of clades identified in earlier studies. Nevertheless, since these clades comprise several distinct phylotypes we cannot exclude endemicity at species level. We identified two freshwater clades and a few solitary phylotypes, implying that Telonemia have colonized freshwater habitats and adapted to the different environmental and ecological conditions at independent occasions. PMID:20534135

  15. Does the evolutionary conservation of microsatellite loci imply function?

    SciTech Connect

    Shriver, M.D.; Deka, R.; Ferrell, R.E.

    1994-09-01

    Microsatellites are highly polymorphic tandem arrays of short (1-6 bp) sequence motifs which have been found widely distributed in the genomes of all eukaryotes. We have analyzed allele frequency data on 16 microsatellite loci typed in the great apes (human, chimp, orangutan, and gorilla). The majority of these loci (13) were isolated from human genomic libraries; three were cloned from chimpanzee genomic DNA. Most of these loci are not only present in all apes species, but are polymorphic with comparable levels of heterozygosity and have alleles which overlap in size. The extent of divergence of allele frequencies among these four species were studies using the stepwise-weighted genetic distance (Dsw), which was previously shown to conform to linearity with evolutionary time since divergence for loci where mutations exist in a stepwise fashion. The phylogenetic tree of the great apes constructed from this distance matrix was consistent with the expected topology, with a high bootstrap confidence (82%) for the human/chimp clade. However, the allele frequency distributions of these species are 10 times more similar to each other than expected when they were calibrated with a conservative estimate of the time since separation of humans and the apes. These results are in agreement with sequence-based surveys of microsatellites which have demonstrated that they are highly (90%) conserved over short periods of evolutionary time (< 10 million years) and moderately (30%) conserved over long periods of evolutionary time (> 60-80 million years). This evolutionary conservation has prompted some authors to speculate that there are functional constraints on microsatellite loci. In contrast, the presence of directional bias of mutations with constraints and/or selection against aberrant sized alleles can explain these results.

  16. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site

    PubMed Central

    Calviño, Fabiola R.; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-01-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1–RpL5-N–RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1–RpL5–RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP. PMID:25849277

  17. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    PubMed

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-01-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP. PMID:25849277

  18. Electric-dipole 5s - 5p Transitions in Promethiumlike Ions

    SciTech Connect

    Vilkas, M J; Ishikawa, Y; Trabert, E

    2008-02-29

    The 5s-5p electric-dipole resonance transitions in highly ionized promethiumlike ions have been studied applying relativistic multi-reference Moeller-Plesset second-order perturbation theory. The transition wavelengths are determined to within 0.2 {angstrom} in the more highly charged ions, where the level degeneracies are small. For somewhat lighter ions a very large reference space was used in order to account for the many degeneracies. In order to calculate transition probabilities and lifetimes, correlation corrections have been added to the transition operator in the next order. The contributions from the higher orders of the theory, that is, frequency-dependent Breit correction, Lamb shift, and mass shifts, have been estimated. The results are used to re-assess spectroscopic data from beam-foil, electron beam ion trap, and tokamak observations.

  19. Solution-Based Processing of the Phase-Change Material KSb5S8

    SciTech Connect

    Mitzi,D.; Raoux, S.; Schrott, A.; Copel, M.; Kellock, A.; Jordan-Sweet, J.

    2006-01-01

    A hydrazine-based process for solution-depositing phase-change materials (PCMs) is demonstrated, using KSb{sub 5}S{sub 8} (KSS) as an example. The process involves dissolving the elemental metals and chalcogen in hydrazine at room temperature and spin-coating the solution onto a substrate, followed by a short low-temperature (T {<=} 250 C) anneal. The spin-coated KSS films, which range in thickness from 10 to 90 nm, are examined using variable temperature X-ray diffraction, medium energy ion scattering (MEIS), Rutherford backscattering spectroscopy (RBS), and scanning electron microscopy (SEM). The spin-coated KSS films exhibit a reversible amorphous-crystalline transition with a relatively high crystallization temperature ({approx}280 C). Selected other chalcogenide-based PCMs are also expected to be suitable for thin-film deposition using this approach.

  20. Minimally Invasive Approach For Extraforaminal Synovial Cyst L5-S1

    PubMed Central

    Torres Campa-Santamarina, Jose; Towne, Sara; Alimi, Marjan; Härtl, Roger

    2015-01-01

    Symptoms from synovial cysts are produced by neural compression in the spinal canal or the foramen. Few cases of extraforaminal synovial cyst have been published in the literature. This is a case report of a 65-year-old female who presented with a three-month history of sciatic pain and no relief with conservative treatment. MRI showed a left-sided extraforaminal synovial cyst at L5-S1 with compression of the L5 nerve root at the lateral portion of the foramen. Minimally invasive surgery for resection was performed using an extraforaminal tubular microscopic endoscopy-assisted approach. The patient improved clinically and remained symptom-free for the entire follow-up of 30 months. PMID:26623217

  1. Magic wavelengths for the 5 s - 18 s transition in rubidium

    NASA Astrophysics Data System (ADS)

    Goldschmidt, Elizabeth; Norris, David; Koller, Silvio; Wyllie, Robert; Brown, Roger; Porto, Trey; Safronova, Ulyana; Safronova, Marianna

    2015-05-01

    Magic wavelengths, for which there is no differential ac Stark shift for the ground and excited state of the atom, allow trapping of excited Rydberg atoms without broadening the optical transition. This is an important tool for implementing quantum gates and other quantum information protocols with Rydberg atoms, and reliable theoretical methods to find such magic wavelengths are thus extremely useful. We use a high-precision all-order method to calculate magic wavelengths for the 5 s - 18 s transition of rubidium near the 18 s - 6 p resonances. We compare the calculation to experiment by measuring the light shift for atoms held in a crossed optical dipole trap with wavelength tuned around the 18 s - 6p3 / 2 resonance at the experimentally convenient wavelength of 1064 nm.

  2. Phylogenetic tree derived from bacterial, cytosol and organelle 5S rRNA sequences.

    PubMed Central

    Küntzel, H; Heidrich, M; Piechulla, B

    1981-01-01

    A phylogenetic tree was constructed by computer analysis of 47 completely determined 5S rRNA sequences. The wheat mitochondrial sequence is significantly more related to prokaryotic than to eukaryotic sequences, and its affinity to that of the thermophilic Gram-negative bacterium Thermus aquaticus is comparable to the affinity between Anacystis nidulans and chloroplastic sequences. This strongly supports the idea of an endosymbiotic origin of plant mitochondria. A comparison of the plant cytosol and chloroplast sub-trees suggests a similar rate of nucleotide substitution in nuclear genes and chloroplastic genes. Other features of the tree are a common precursor of protozoa and metazoa, which appears to be more related to the fungal than to the plant protosequence, and an early divergence of the archebacterial sequence (Halobacterium cutirubrum) from the prokaryotic branch. PMID:6785727

  3. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    NASA Technical Reports Server (NTRS)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  4. Classification of 5-S Epileptic EEG Recordings Using Distribution Entropy and Sample Entropy

    PubMed Central

    Li, Peng; Karmakar, Chandan; Yan, Chang; Palaniswami, Marimuthu; Liu, Changchun

    2016-01-01

    Epilepsy is an electrophysiological disorder of the brain, the hallmark of which is recurrent and unprovoked seizures. Electroencephalogram (EEG) measures electrical activity of the brain that is commonly applied as a non-invasive technique for seizure detection. Although a vast number of publications have been published on intelligent algorithms to classify interictal and ictal EEG, it remains an open question whether they can be detected using short-length EEG recordings. In this study, we proposed three protocols to select 5 s EEG segment for classifying interictal and ictal EEG from normal. We used the publicly-accessible Bonn database, which consists of normal, interical, and ictal EEG signals with a length of 4097 sampling points (23.6 s) per record. In this study, we selected three segments of 868 points (5 s) length from each recordings and evaluated results for each of them separately. The well-studied irregularity measure—sample entropy (SampEn)—and a more recently proposed complexity measure—distribution entropy (DistEn)—were used as classification features. A total of 20 combinations of input parameters m and τ for the calculation of SampEn and DistEn were selected for compatibility. Results showed that SampEn was undefined for half of the used combinations of input parameters and indicated a large intra-class variance. Moreover, DistEn performed robustly for short-length EEG data indicating relative independence from input parameters and small intra-class fluctuations. In addition, it showed acceptable performance for all three classification problems (interictal EEG from normal, ictal EEG from normal, and ictal EEG from interictal) compared to SampEn, which showed better results only for distinguishing normal EEG from interictal and ictal. Both SampEn and DistEn showed good reproducibility and consistency, as evidenced by the independence of results on analysing protocol. PMID:27148074

  5. Simple detection of the 5S ribosomal RNA of Pneumocystis carinii using in situ hybridisation.

    PubMed Central

    Kobayashi, M; Urata, T; Ikezoe, T; Hakoda, E; Uemura, Y; Sonobe, H; Ohtsuki, Y; Manabe, T; Miyagi, S; Miyoshi, I

    1996-01-01

    AIMS: To investigate the effectiveness of digoxigenin incorporated double stranded DNA probes produced by the polymerase chain reaction (PCR), for the detection of Pneumocystis carinii, using in situ hybridisation (ISH). METHODS: Formalin fixed, paraffin wax embedded sections of 26 human lung samples from 11 patients with P carinii pneumonia (PCP), and 15 with various types of fungal and viral pneumonia, were obtained during necropsy or transbronchial lung biopsy. Three additional PCP induced rat lung samples were also tested. PCR probes were prepared using the digoxigenin labelling mixture, and they were amplified from the DNA of a PCP induced rat lung after administration of dexamethasone, on the basis that 5S ribosomal RNA sequences are identical in human and rat P carinii. ISH was performed using this probe, and visualised using the digoxigenin nucleic acid detection kit. An immunohistochemical study using anti-human Pneumocystis monoclonal antibody was also carried out in parallel. RESULTS: ISH positively stained eight (of eight) lung necropsy specimens from patients with PCP, three (of three) transbronchial lung biopsy specimens from patients with PCP, and none of the three PCP induced rat lung specimens. In contrast, none of the specimens from patients with pneumonia caused by Aspergillus sp (n = 5), Candida sp (n = 4), Cryptococcus sp (n = 2), mucormycosis (n = 2), or cytomegalovirus (n = 2) were positive on ISH or immunohistochemistry. CONCLUSIONS: Using a digoxigenin labelled PCR probe for the entire 5S rRNA sequence in conjunction with conventional staining, ISH is highly reactive and specific for the diagnosis of PCP. Images PMID:9038753

  6. [Genetic linkage of blood group, egg and serum protein and plumage color loci in chickens].

    PubMed

    Gintovt, V E; Novik, I E; Moiseeva, I G; Tolokoniikova, E V

    1976-01-01

    Genetic relationship of six blood group (A, B, C, D, E, x5), three egg (G2, G3, Ov) and one serum (Alb) protein loci and two plumage colour (I-dominant white, E-extended black) loci were investigated. 3250 gametes have been analysed for 21 loci combinations, 11 from them have never been studied on linkage. Blood group loci A, B, C, D, E, x5 segregated independently on egg protein loci G2, G3, and Ov, serum protein locus Alb and plumage colour locus E. No linkage was observed between blood group locus B and dominant white locus I. Close linkage for two egg protein loci G3 and Ov is confirmed. Independent segregation of investigated blood group, egg and serum protein loci suggests their localization on different autosomes in the chicken genome. The recent literature and the authors' data on genetic relationship between blood group, polymorphic protein loci and morphological traits are reviewed. PMID:1010323

  7. Thousands of microsatellite loci from the venomous coralsnake (Micrurus fulvius) and variability of select loci across populations and related species

    PubMed Central

    Castoe, Todd A.; Streicher, Jeffrey W.; Meik, Jesse M.; Ingrasci, Matthew J.; Poole, Alexander W.; de Koning, A.P. Jason; Campbell, Jonathan A.; Parkinson, Christopher L.; Smith, Eric N.; Pollock, David D.

    2012-01-01

    Studies of population genetics increasingly use next-generation DNA sequencing to identify microsatellite loci in non-model organisms. There are, however, relatively few studies that validate the feasibility of transitioning from marker development to experimental application across populations and species. North American coralsnakes of the Micrurus fulvius species complex occur in the United States and Mexico, and little is known about their population structure and phylogenetic relationships. This absence of information and population genetics markers is particularly concerning because they are highly venomous and have important implications on human health. To alleviate this problem in coralsnakes, we investigated the feasibility of using 454 shotgun sequences for microsatellite marker development. First, a genomic shotgun library from a single individual was sequenced (~7.74 megabases; 26,831 reads) to identify potentially amplifiable microsatellite loci (PALs). We then hierarchically sampled 76 individuals from throughout the geographic distribution of the species complex and examined whether PALs were amplifiable and polymorphic. Approximately half of the loci tested were readily amplifiable from all individuals, and 80% of the loci tested for variation were variable and thus informative as population genetic markers. To evaluate the repetitive landscape characteristics across multiple snakes, we also compared microsatellite content between the coralsnake and two other previously sampled snakes, the venomous copperhead (Agkistrodon contortrix) and Burmese python (Python molurus). PMID:22938699

  8. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells

    PubMed Central

    Cao, Weibiao

    2016-01-01

    Mechanisms of the progression from Barrett’s esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK) inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA. PMID:26901778

  9. PCR primers for microsatellite loci in the desert tortoise (Gopherus agassizii, Testudinidae)

    USGS Publications Warehouse

    Edwards, T.; Goldberg, C.S.; Kaplan, M.E.; Schwalbe, C.R.; Swann, D.E.

    2003-01-01

    The desert tortoise, Gopherus agassizii, is a threatened species native to the North American desert southwest and is recognized as having distinct Mojave and Sonoran populations. We identified six polymorphic microsatellite loci in the desert tortoise. All six loci were polymorphic in Sonoran samples. Five of the loci were variable in Mojave samples with varying degrees of amplification success. Two of the loci exhibited low allelic variation (2-3 alleles) while four were highly variable (8-27 alleles).

  10. Isolation and characterization of microsatellite loci from the soybean aphid, Aphis glycines Matsumura (Hemiptera: Aphididae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ten novel microsatellite loci were isolated and characterized from the soybean aphid, APHIS GLYCINES, a serious invasive pest of soybeans in North America. The isolated loci were polymorphic, with two to 19 alleles in 48 wild individuals collected from Korea, Japan, and the United States. All loci ...

  11. Development of microsatellite loci for the endangered species Pityopsis ruthii (Asteraceae)1

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Premise of the study: Microsatellite loci were developed for the endangered species Pityopsis ruthii and will permit genetic and conservation studies of the species. Methods and Results:A microsatellite enriched library was used to develop 12 polymorphic microsatellite loci for P. ruthii. The loci ...

  12. Isolation and characterization of microsatellite Loci for Cornus sanguniea (Cornaceae) 1

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Premise of the study: Microsatellite loci were developed for Cornus sanguinea and will permit genetic and conservation studies of the species. Methods and Results: A microsatellite-enriched library was used to develop 16 polymorphic microsatellite loci for C. sanguinea. The loci amplified 5-11 allel...

  13. New Sporulation Loci in Streptomyces coelicolor A3(2)

    PubMed Central

    Ryding, N. Jamie; Bibb, Maureen J.; Molle, Virginie; Findlay, Kim C.; Chater, Keith F.; Buttner, Mark J.

    1999-01-01

    Sporulation mutants of Streptomyces coelicolor appear white because they are defective in the synthesis of the grey polyketide spore pigment, and such white (whi) mutants had been used to define eight sporulation loci, whiA, whiB, whiD, whiE, whiG, whiH, whiI, and whiJ (K. F. Chater, J. Gen. Microbiol. 72:9–28, 1972; N. J. Ryding, Ph.D. thesis, University of East Anglia, 1995). In an attempt to identify new whi loci, we mutagenized S. coelicolor M145 spores with nitrosoguanidine and identified 770 mutants with colonies ranging from white to medium grey. After excluding unstable strains, we examined the isolates by phase-contrast microscopy and chose 115 whi mutants with clear morphological phenotypes for further study. To exclude mutants representing cloned whi genes, self-transmissible SCP2*-derived plasmids carrying whiA, whiB, whiG, whiH, or whiJ (but not whiD, whiE, or whiI) were introduced into each mutant by conjugation, and strains in which the wild-type phenotype was restored either partially or completely by any of these plasmids were excluded from further analysis. In an attempt to complement some of the remaining 31 whi mutants, an SCP2* library of wild-type S. coelicolor chromosomal DNA was introduced into 19 of the mutants by conjugation. Clones restoring the wild-type phenotype to 12 of the 19 strains were isolated and found to represent five distinct loci, designated whiK, whiL, whiM, whiN, and whiO. Each of the five loci was located on the ordered cosmid library: whiL, whiM, whiN, and whiO occupied positions distinct from previously cloned whi genes; whiK was located on the same cosmid overlap as whiD, but the two loci were shown by complementation to be distinct. The phenotypes resulting from mutations at each of these new loci are described. PMID:10464216

  14. Distribution and 16S rDNA sequences of Argas monachus (Acari: Argasidae), a soft tick parasite of Myiopsitta monachus (Aves: Psittacidae).

    PubMed

    Mastropaolo, Mariano; Turienzo, Paola; Di Iorio, Osvaldo; Nava, Santiago; Venzal, José M; Guglielmone, Alberto A; Mangold, Atilio J

    2011-11-01

    Specimens of Argas monachus Keirans et al. were collected from Myiopsitta monachus nests in 42 localities in Argentina and Paraguay from 2006 to 2010. A list of localities where this tick has been found is presented. 16S rDNA sequences of specimens of A. monachus from different localities were compared to confirm whether they belong to the same specific taxon. Argas monachus is present in the phytogeographic provinces of Chaco, Espinal, and Monte, but not in the Pampa (all from de Chaco Domain) where the host is well distributed. No differences were found among 16S rDNA sequences of geographically distant specimens. PMID:21739257

  15. The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure.

    PubMed Central

    Leontis, N B; Westhof, E

    1998-01-01

    A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings

  16. The nature of Z_b states from a combined analysis of Upsilon (5S)rightarrow h_b(mP) π ^+ π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{(*)}π

    NASA Astrophysics Data System (ADS)

    Huo, Wen-Sheng; Chen, Guo-Ying

    2016-03-01

    With a combined analysis of data on Upsilon (5S)rightarrow h_b(1P,2P)π ^+π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{(*)}π in an effective field theory approach, we determine resonance parameters of Z_b states in two scenarios. In one scenario we assume that Z_b states are pure molecular states, while in the other one we assume that Z_b states contain compact components. We find that the present data favor that there should be some compact components inside Z_b^{(' )} associated with the molecular components. By fitting the invariant mass spectra of Upsilon (5S)rightarrow h_b(1P,2P)π ^+π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{*}π , we determine that the probability of finding the compact components in Z_b states may be as large as about 40 %.

  17. Fine scale association mapping of disease loci using simplex families.

    PubMed

    Morris, A P; Whittaker, J C

    2000-05-01

    We present a new method for the fine scale mapping of disease loci based on samples of simplex families, each containing an affected child. The method is based on a generalisation of a single locus allele transmission model to multiple marker loci. The model is developed under the assumption of a single ancestral mutation and allows for the calculation of posterior probabilities that each allele at a particular marker was present on the founder chromosome. We illustrate the method using simulated family data for cystic fibrosis and Huntingtons disease, for which the locations of mutations in the disease genes are now known. For both diseases, our new method provides good estimates of the location of the mutations. PMID:11246474

  18. Seven newly identified loci for autoimmune thyroid disease.

    PubMed

    Cooper, Jason D; Simmonds, Matthew J; Walker, Neil M; Burren, Oliver; Brand, Oliver J; Guo, Hui; Wallace, Chris; Stevens, Helen; Coleman, Gillian; Franklyn, Jayne A; Todd, John A; Gough, Stephen C L

    2012-12-01

    Autoimmune thyroid disease (AITD), including Graves' disease (GD) and Hashimoto's thyroiditis (HT), is one of the most common of the immune-mediated diseases. To further investigate the genetic determinants of AITD, we conducted an association study using a custom-made single-nucleotide polymorphism (SNP) array, the ImmunoChip. The SNP array contains all known and genotype-able SNPs across 186 distinct susceptibility loci associated with one or more immune-mediated diseases. After stringent quality control, we analysed 103 875 common SNPs (minor allele frequency >0.05) in 2285 GD and 462 HT patients and 9364 controls. We found evidence for seven new AITD risk loci (P < 1.12 × 10(-6); a permutation test derived significance threshold), five at locations previously associated and two at locations awaiting confirmation, with other immune-mediated diseases. PMID:22922229

  19. Properties of multivariable root loci. M.S. Thesis

    NASA Technical Reports Server (NTRS)

    Yagle, A. E.

    1981-01-01

    Various properties of multivariable root loci are analyzed from a frequency domain point of view by using the technique of Newton polygons, and some generalizations of the SISO root locus rules to the multivariable case are pointed out. The behavior of the angles of arrival and departure is related to the Smith-MacMillan form of G(s) and explicit equations for these angles are obtained. After specializing to first order and a restricted class of higher order poles and zeros, some simple equations for these angles that are direct generalizations of the SISO equations are found. The unusual behavior of root loci on the real axis at branch points is studied. The SISO root locus rules for break-in and break-out points are shown to generalize directly to the multivariable case. Some methods for computing both types of points are presented.

  20. Origin and evolution of organisms as deduced from 5S ribosomal RNA sequences.

    PubMed

    Hori, H; Osawa, S

    1987-09-01

    A phylogenetic tree of most of the major groups of organisms has been constructed from the 352 5S ribosomal RNA sequences now available. The tree suggests that there are several major groups of eubacteria that diverged during the early stages of their evolution. Metabacteria (= archaebacteria) and eukaryotes separated after the emergence of eubacteria. Among eukaryotes, red algae emerged first; and, later, thraustochytrids (a Proctista group), ascomycetes (yeast), green plants (green algae and land plants), "yellow algae" (brown algae, diatoms, and chrysophyte algae), basidiomycetes (mushrooms and rusts), slime- and water molds, various protozoans, and animals emerged, approximately in that order. Three major types of photosynthetic eukaryotes--i.e., red algae (= Chlorophyll a group), green plants (Chl. a + b group) and yellow algae (Chl. a + c)--are remotely related to one another. Other photosynthetic unicellular protozoans--such as Cyanophora (Chl. a), Euglenophyta (Chl. a + b), Cryptophyta (Chl. a + c), and Dinophyta (Chl. a + c)--seem to have separated shortly after the emergence of the yellow algae. PMID:2452957

  1. Evolution of green plants as deduced from 5S rRNA sequences

    PubMed Central

    Hori, Hiroshi; Lim, Byung-Lak; Osawa, Syozo

    1985-01-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  2. Evolution of green plants as deduced from 5S rRNA sequences.

    PubMed

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  3. Hard X-ray XAFS beamline, BL5S1, at AichiSR

    NASA Astrophysics Data System (ADS)

    Tabuchi, M.; Asakura, H.; Morimoto, H.; Watanabe, N.; Takeda, Y.

    2016-05-01

    A XAFS beamline, BL5S1, had been operated at Aichi Synchrotron Radiation Center, Japan since March 2013. The beamline was designed for the measurements in the energy range from 5 to 20 keV. The photon flux of 6 x 1010 at around 9 keV and beam spot size of 0.5 x 0.3 mm at sample position are as good as designed. For the standard transmission XAFS measurement, both of the step- and quick- scan modes are available. Energy resolution at around 9keV is good enough to discuss the energy shift of the order of 0.1 eV or higher even when the measurements are conducted in the quick-scan mode. With several kinds of detectors for fluorescence and/or CEY detection mode measurements, and various kinds of sample holders which are supported by the XAFS measurement software, users easily obtain spectra for their samples. Such a standard, well operated and easy to access XAFS beamline must be very important to broaden the base of the XAFS society further.

  4. Design and performance of a 1 MW-5 s high temperature superconductor magnetic energy storage system

    NASA Astrophysics Data System (ADS)

    Morandi, Antonio; Gholizad, Babak; Fabbri, Massimo

    2016-01-01

    The feasibility of a 1 MW-5 s superconducting magnetic energy storage (SMES) system based on state-of-the-art high-temperature superconductor (HTS) materials is investigated in detail. Both YBCO coated conductors and MgB2 are considered. A procedure for the electromagnetic design of the coil is introduced and the final layout is arrived at and compared for the two materials. The choice of the inductance of the coil is carried out as part of the design procedure. Both low-field (3 T) and high-field (8 T) designs are considered for the YBCO. AC losses during a complete charge/discharge cycle at full power are estimated and the cooling power needed for continuous operation is derived. The power conditioning system and control algorithms needed to carry out various operations are discussed in detail. Performances of the SMES system during voltage sag compensation, load leveling and power factor correction are investigated by means of numerical simulation.

  5. Secondary structure and domain architecture of the 23S and 5S rRNAs

    PubMed Central

    Petrov, Anton S.; Bernier, Chad R.; Hershkovits, Eli; Xue, Yuzhen; Waterbury, Chris C.; Hsiao, Chiaolong; Stepanov, Victor G.; Gaucher, Eric A.; Grover, Martha A.; Harvey, Stephen C.; Hud, Nicholas V.; Wartell, Roger M.; Fox, George E.; Williams, Loren Dean

    2013-01-01

    We present a de novo re-determination of the secondary (2°) structure and domain architecture of the 23S and 5S rRNAs, using 3D structures, determined by X-ray diffraction, as input. In the traditional 2° structure, the center of the 23S rRNA is an extended single strand, which in 3D is seen to be compact and double helical. Accurately assigning nucleotides to helices compels a revision of the 23S rRNA 2° structure. Unlike the traditional 2° structure, the revised 2° structure of the 23S rRNA shows architectural similarity with the 16S rRNA. The revised 2° structure also reveals a clear relationship with the 3D structure and is generalizable to rRNAs of other species from all three domains of life. The 2° structure revision required us to reconsider the domain architecture. We partitioned the 23S rRNA into domains through analysis of molecular interactions, calculations of 2D folding propensities and compactness. The best domain model for the 23S rRNA contains seven domains, not six as previously ascribed. Domain 0 forms the core of the 23S rRNA, to which the other six domains are rooted. Editable 2° structures mapped with various data are provided (http://apollo.chemistry.gatech.edu/RibosomeGallery). PMID:23771137

  6. Intrachromosomal mapping of seven biochemical loci in barley, Hordeum vulgare.

    PubMed

    Liu, C J; Heun, M; Gale, M D

    1993-10-01

    Seven biochemical loci, AmpA, Amy1, Amy2, Est-H5, Hor1, Hor2, and Wsp-H1, have been intrachromosomally mapped in the barley genome using a previously published RFLP-based genetic map. In all cases, the map locations confirmed prior chromosome assignments and agreed closely with the map positions of their homoeoloci in hexaploid wheat. PMID:24190199

  7. [Principle of genetic equilibrium for two gene loci].

    PubMed

    Pan, Shen-Yuan; Qu, Ai; Hui, Peng; Li, Ai-Ling

    2004-03-01

    Because linkage equilibrium is introduced by directly quoting the conclusions or imprecise mathematical reasoning in most of textbooks, many students are puzzled with the problem of linkage equilibrium when they learn population genetics. Based on the radical conditions of genetic equilibrium, the principle of linkage equilibrium condition and process, for two gene loci is introduced by precise mathematical reasoning. The article may provide reference to teachers and students in the teaching and learning of population genetics. PMID:15639991

  8. CD33 modulates TREM2: convergence of Alzheimer loci.

    PubMed

    Chan, Gail; White, Charles C; Winn, Phoebe A; Cimpean, Maria; Replogle, Joseph M; Glick, Laura R; Cuerdon, Nicole E; Ryan, Katie J; Johnson, Keith A; Schneider, Julie A; Bennett, David A; Chibnik, Lori B; Sperling, Reisa A; Bradshaw, Elizabeth M; De Jager, Philip L

    2015-11-01

    We used a protein quantitative trait analysis in monocytes from 226 individuals to evaluate cross-talk between Alzheimer loci. The NME8 locus influenced PTK2B and the CD33 risk allele led to greater TREM2 expression. There was also a decreased TREM1/TREM2 ratio with a TREM1 risk allele, decreased TREM2 expression with CD33 suppression and elevated cortical TREM2 mRNA expression with amyloid pathology. PMID:26414614

  9. ISOLATION AND CHARACTERIZATION OF 15 MICROSATELLITE LOCI FOR Ophicephalus argus Cantor.

    PubMed

    Xiao, M; Xia, H; Bao, F

    2015-10-01

    The isolation and development of 15 polymorphic dinucleotide microsatellite loci were described for Ophicephalus argus from the Huaihe River. All loci were polymorphic in the 30 individuals tested. The number of alleles per variable locus ranged from nine to seventeen, with a mean of 12.00. These novel microsatellite loci showed high level of polymorphism. Observed and expected heterozygosities ranged from 0.793 to 0.929 and from 0.841 to 0.952, respectively. Two loci were found deviated from HWE in the sampled population after Bonferroni correction. These microsatellite loci will be useful for revealing population structure, genetic diversity, and phylogeography of Ophicephalus argus. PMID:27169238

  10. Isolation and characterization of 21 polymorphic microsatellite loci in the Japanese dace (Tribolodon hakonensis)

    USGS Publications Warehouse

    Koizumi, Noriyuki; Quinn, Thomas W.; Park, Myeongsoo; Fike, Jennifer A.; Nishida, Kazuya; Takemura, Takeshi; Watabe, Keiji; Mori, Atsushi

    2011-01-01

    Twenty one polymorphic microsatellite loci for the Japanese dace (Tribolodon hakonensis) were isolated and characterized. The number of observed alleles per locus in 32 individuals ranged from 3 to 30. The observed and expected heterozygosities ranged from 0.125 to 0.969 and from 0.175 to 0.973, respectively. All loci conformed to Hardy–Weinberg equilibrium, no linkage disequilibrium was observed between pairs of loci and no loci showed evidence of null alleles. These microsatellite loci will be useful for investigating the intraspecific genetic variation and population structure of this species.

  11. Characterization of 38 microsatellite loci in the European blackbird, Turdus merula (Turdidae, AVES).

    PubMed

    Simeoni, Michelle; Dawson, Deborah A; Gentle, Louise K; Coiffait, Lisette; Wolff, Kirsten; Evans, Karl L; Gaston, Kevin J; Hatchwell, Ben J

    2009-11-01

    We characterized 38 microsatellite loci in the European blackbird, Turdus merula. Thirty-seven loci were identified by testing 242 loci that had been originally isolated in other avian species. One additional locus was isolated from a European blackbird genomic library. All loci were characterized in 20-29 blackbirds from a population in the Czech Republic and displayed between two and 16 alleles, with observed heterozygosity ranging from 0.04 to 1.00. Thirty-seven loci could be assigned a chromosome location in the zebra finch (Taeniopygia guttata) genome based on sequence homology. PMID:21564948

  12. Population genetic data of 15 STR loci in Gansu Han population from China.

    PubMed

    Sun, Mao; Zhang, XiaoNan; Wu, Dan; Shen, Qi; Wu, YuanMing

    2015-07-01

    The genetic polymorphisms of 15 autosomal short tandem repeat (STR) loci included in the AmpFISTR Sinofiler™ kit were evaluated in 547 healthy unrelated Han individuals from Gansu, China. All of the loci reached the Hardy-Weinberg equilibrium after the Bonferroni correction (p > 0.0033). These loci were examined to determine allele frequencies and forensic statistical parameters. The combined discrimination power and probability of excluding paternity of the 15 STR loci were 0.999999 and 0.995097, respectively. Results suggested that the 15 STR loci are highly polymorphic, which is suitable for forensic personal identification and paternity testing. PMID:25504110

  13. Details of the evolutionary history from invertebrates to vertebrates, as deduced from the sequences of 18S rDNA.

    PubMed Central

    Wada, H; Satoh, N

    1994-01-01

    Almost the entire sequences of 18S rDNA were determined for two chaetognaths, five echinoderms, a hemichordate, and two urochordates (a larvacean and a salp). Phylogenetic comparisons of the sequences, together with those of other deuterostomes (an ascidian, a cephalochordate, and vertebrates) and protostomes (an arthropod and a mollusc), suggest the monophyly of the deuterostomes, with the exception of the chaetognaths. Chaetognaths may not be a group of deuterostomes. The deuterostome group closest to vertebrates was the group of cephalochordates. Ascidians, larvaceans, and salps seem to form a discrete group (urochordates), in which the early divergence of larvaceans is evident. These results support the hypothesis that chordates evolved from free-living ancestors. PMID:8127885

  14. 28s rDNA group-I introns: a powerful tool for identifying strains of Beauveria brongniartii.

    PubMed

    Neuvéglise, C; Brygoo, Y; Riba, G

    1997-04-01

    The nuclear ribosomal DNA of the entomopathogenic fungus Beauveria brongniartii is polymorphic in terms of both restriction site and length. Insertions of 350-450 bp long, identified as group-I introns, were detected in the 28s rDNA. A panel of 47 strains of B. brongniartii, two B. bassiana and one Metarhizium anisopliae of various geographical and biological origins were found to contain 14 variant forms of intron differing in size and restriction pattern, at four different positions. Twelve types of ribosomal large subunit were defined on the basis of variant distribution and compared with strain clustering based on internal transcribed spacers analysis. There was a correlation between the characteristic introns and isolates collected from the sugar cane pest Hoplochelus marginalis. Primers for polymerase chain reaction amplification were chosen from these variants, and used to develop a specific method for detecting strains pathogenic towards Hoplochelus. PMID:9131812

  15. Description of the male, redescription of the female and 16S rDNA sequence of Ixodes aulacodi (Ixodidae).

    PubMed

    Chiţimia-Dobler, Lidia; D'Amico, Gianluca; Yao, Patrick Kouassi; Kalmár, Zsuzsa; Gherman, Călin Mircea; Mihalca, Andrei Daniel; Estrada-Peña, Agustin

    2016-04-01

    Ixodes (Afrixodes) aulacodiArthur, 1956 is a poorly known species that has been recorded predominantly in the wet countries of western and central Africa, mainly associated to the greater cane rat Thryonomys swinderianus (Temmink). We herein redescribe the female, describe the male (ascribed to the species from specimens found in copula) and provide the 16S rDNA sequence. We also provide complete illustrations of the adults based on specimens found on greater cane rats in Ivory Coast. Ixodes aulacodi is included in the group of species of the subgenus Afrixodes that have horseshoe shaped anal groove, and which lack auriculae and cornua. The female is easily separated when compared with other species because of a unique combination of characters: All the coxae have internal spurs, coxa II has two external spurs, syncoxae are absent, and trochanters I-III have one spur each. The male has a notched hypostome and lacks syncoxae, auriculae and cornua. PMID:26803353

  16. Three Group-I introns in 18S rDNA of Endosymbiotic Algae of Paramecium bursaria from Japan

    NASA Astrophysics Data System (ADS)

    Hoshina, Ryo; Kamako, Shin-ichiro; Imamura, Nobutaka

    2004-08-01

    In the nuclear encoded small subunit ribosomal DNA (18S rDNA) of symbiotic alga of Paramecium bursaria (F36 collected in Japan) possesses three intron-like insertions (Hoshina et al., unpubl. data, 2003). The present study confirmed these exact lengths and insertion sites by reverse transcription-PCR. Two of them were inserted at Escherichia coli 16S rRNA genic position 943 and 1512 that are frequent intron insertion positions, but another insertion position (nearly 1370) was the first finding. Their secondary structures suggested they belong to Group-I intron; one belongs to subgroup IE, others belong to subgroup IC1. Similarity search indicated these introns are ancestral ones.

  17. Loop mediated isothermal amplification of 5.8S rDNA for specific detection of Tritrichomonas foetus.

    PubMed

    Oyhenart, Jorge; Martínez, Florencia; Ramírez, Rosana; Fort, Marcelo; Breccia, Javier D

    2013-03-31

    Tritrichomonas foetus is the causative agent of bovine trichomonosis, a sexually transmitted disease leading to infertility and abortion. A test based on loop mediated isothermal amplification (LAMP) targeting the 5.8S rDNA subunit was designed for the specific identification of T. foetus. The LAMP assay was validated using 28 T. foetus and 35 non-T. foetus trichomonads strains. It did not exhibit cross-reaction with closely related parasites commonly found in smegma cultures like Tetratrichomonas spp. and Pentatrichomonas hominis. Bovine smegma did not show interferences for the detection of the parasite and, the sensitivity of the method (4×10(3) CFU/mL, approximately 10 cells/reaction) was slightly higher than that found for PCR amplification with TFR3 and TFR4 primers. The LAMP approach has potential applications for diagnosis and control of T. foetus and, practical use for low skill operators in rural areas. PMID:23265811

  18. Short communication: Genetic variants of Sarcocystis cruzi in infected Malaysian cattle based on 18S rDNA.

    PubMed

    Ng, Yit Han; Fong, Mun Yik; Subramaniam, Vellayan; Shahari, Shahhaziq; Lau, Yee Ling

    2015-12-01

    Sarcocystis species are pathogenic parasites that infect a wide range of animals, including cattle. A high prevalence of cattle sarcocystosis has been reported worldwide, but its status is unknown in Malaysia. This study focused on utilizing 18S rDNA to identify Sarcocystis species in Malaysian cattle and to determine their genetic variants. In this study, only Sarcocystis cruzi was detected in Malaysian cattle. The intra-species S. cruzi phylogenetic tree analysis and principal coordinate analysis (PCoA), respectively displayed two minor groups among the parasite isolates. This finding was supported by high Wright FST value (FST=0.647). The definitive hosts (dogs) may play a fundamental role in the development of S. cruzi genetic variants. Additionally, the existence of microheterogeneity within the S. cruzi merozoites and/or distinct genetic variants arisen from independent merozoites in mature sarcocysts, possibly contributed to the existence of intra-species variations within the population. PMID:26679818

  19. Sequence analysis of the rDNA internal transcribed spacer 2 of five species of South American human malaria mosquitoes.

    PubMed

    Fritz, G N

    1998-03-01

    The rDNA internal transcribed spacer 2 (ITS2) was sequenced for 5 species of mosquitoes that may be important vectors of human malaria in certain regions of South America and are difficult to distinguish by morphology: Anopheles evansae, An. nuneztovari, An. rangeli, An. strodei and An. trinkae. ITS2 sequences from samples collected in Ecuador, Bolivia, Venezuela and Brazil were aligned and compared in order to determine the usefulness of this spacer for the elaboration of species specific primers and DNA probes. The ITS2 was found to be different in size (ranging from 333 to 397 bp) and sequence between all pairs of species. Highly variable regions were found primarily at the 3' end of the spacer and were interspersed with relatively conserved sites. Instraspecific sequence variation was limited to a single transversion between specimens of An. rangeli from distant geographic locations suggesting concerted evolution and homogenization of the ITS2. PMID:10520449

  20. Genome-wide association study identifies five new schizophrenia loci

    PubMed Central

    2012-01-01

    We examined the role of common genetic variation in schizophrenia in a genome-wide association study of substantial size: a stage 1 discovery sample of 21,856 individuals of European ancestry and a stage 2 replication sample of 29,839 independent subjects. The combined stage 1 and 2 analysis yielded genome-wide significant associations with schizophrenia for seven loci, five of which are new (1p21.3, 2q32.3, 8p23.2, 8q21.3 and 10q24.32-q24.33) and two of which have been previously implicated (6p21.32-p22.1 and 18q21.2). The strongest new finding (P = 1.6 × 10−11) was with rs1625579 within an intron of a putative primary transcript for MIR137 (microRNA 137), a known regulator of neuronal development. Four other schizophrenia loci achieving genome-wide significance contain predicted targets of MIR137, suggesting MIR137-mediated dysregulation as a previously unknown etiologic mechanism in schizophrenia. In a joint analysis with a bipolar disorder sample (16,374 affected individuals and 14,044 controls), three loci reached genome-wide significance: CACNA1C (rs4765905, P = 7.0 × 10−9), ANK3 (rs10994359, P = 2.5 × 10−8) and the ITIH3-ITIH4 region (rs2239547, P = 7.8 × 10−9). PMID:21926974

  1. Genome-wide association analysis identifies three psoriasis susceptibility loci

    PubMed Central

    Stuart, Philip E.; Nair, Rajan P.; Ellinghaus, Eva; Ding, Jun; Tejasvi, Trilokraj; Gudjonsson, Johann E.; Li, Yun; Weidinger, Stephan; Eberlein, Bernadette; Gieger, Christian; Wichmann, H. Erich; Kunz, Manfred; Ike, Robert; Krueger, Gerald G.; Bowcock, Anne M.; Mroweitz, Ulrich; Lim, Henry W.; Voorhees, John J.; Abecasis, Goncalo R.; Weichenthal, Michael; Franke, Andre; Rahman, Proton; Gladman, Dafna D.; Elder, James T.

    2010-01-01

    To identify novel psoriasis susceptibility loci, we carried out a meta-analysis of two recent genome-wide association studies 1,2, yielding a discovery sample of 1,831 cases and 2,546 controls. 102 of the most promising loci in the discovery analysis were followed up in a three-stage replication study using 4,064 cases and 4,685 controls from Michigan, Toronto, Newfoundland, and Germany. Association at a genome-wide level of significance for the combined discovery and replication samples was found for three genomic regions. One contains NOS2 (rs4795067, p = 4 × 10−11), another contains FBXL19 (rs10782001, p = 9 × 10−10), and a third contains PSMA6 and NFKBIA (rs12586317, p = 2 × 10−8). All three loci were also strongly associated with the subphenotypes of psoriatic arthritis and purely cutaneous psoriasis. Finally, we confirmed a recently identified3 association signal near RNF114. PMID:20953189

  2. Evolution of V genes from the TRV loci of mammals.

    PubMed

    Olivieri, David N; Gambón-Cerdá, Santiago; Gambón-Deza, Francisco

    2015-07-01

    Information concerning the evolution of T lymphocyte receptors (TCR) can be deciphered from that part of the molecule that recognizes antigen presented by major histocompatibility complex (MHC), namely the variable (V) regions. The genes that code for these variable regions are found within the TCR loci. Here, we describe a study of the evolutionary origin of V genes that code for the α and β chains of the TCR loci of mammals. In particular, we demonstrate that most of the 35 TRAV and 25 TRBV conserved genes found in Primates are also found in other Eutheria, while in Marsupials, Monotremes, and Reptiles, these genes diversified in a different manner. We also show that in mammals, all TRAV genes are derived from five ancestral genes, while all TRBV genes originate from four such genes. In Reptiles, the five TRAV and three out of the four TRBV ancestral genes exist, as well as other V genes not found in mammals. We also studied the TRGV and TRDV loci from all mammals, and we show a relationship of the TRDV to the TRAV locus throughout evolutionary time. PMID:26024913

  3. Development of a Lac Operon Concept Inventory (LOCI)

    PubMed Central

    Stefanski, Katherine M.; Gardner, Grant E.; Seipelt-Thiemann, Rebecca L.

    2016-01-01

    Concept inventories (CIs) are valuable tools for educators that assess student achievement and identify misconceptions held by students. Results of student responses can be used to adjust or develop new instructional methods for a given topic. The regulation of gene expression in both prokaryotes and eukaryotes is an important concept in genetics and one that is particularly challenging for undergraduate students. As part of a larger study examining instructional methods related to gene regulation, the authors developed a 12-item CI assessing student knowledge of the lac operon. Using an established protocol, the authors wrote open-ended questions and conducted in-class testing with undergraduate microbiology and genetics students to discover common errors made by students about the lac operon and to determine aspects of item validity. Using these results, we constructed a 12-item multiple-choice lac operon CI called the Lac Operon Concept Inventory (LOCI), The LOCI was reviewed by two experts in the field for content validity. The LOCI underwent item analysis and was assessed for reliability with a sample of undergraduate genetics students (n = 115). The data obtained were found to be valid and reliable (coefficient alpha = 0.994) with adequate discriminatory power and item difficulty. PMID:27252300

  4. Seven New Loci Associated with Age-Related Macular Degeneration

    PubMed Central

    2013-01-01

    Age-related macular degeneration (AMD) is a common cause of blindness in older individuals. To accelerate understanding of AMD biology and help design new therapies, we executed a collaborative genomewide association study, examining >17,100 advanced AMD cases and >60,000 controls of European and Asian ancestry. We identified 19 genomic loci associated with AMD with p<5×10−8 and enriched for genes involved in regulation of complement activity, lipid metabolism, extracellular matrix remodeling and angiogenesis. Our results include 7 loci reaching p<5×10−8 for the first time, near the genes COL8A1/FILIP1L, IER3/DDR1, SLC16A8, TGFBR1, RAD51B, ADAMTS9/MIR548A2, and B3GALTL. A genetic risk score combining SNPs from all loci displayed similar good ability to distinguish cases and controls in all samples examined. Our findings provide new directions for biological, genetic and therapeutic studies of AMD. PMID:23455636

  5. Novel multiple sclerosis susceptibility loci implicated in epigenetic regulation

    PubMed Central

    Andlauer, Till F. M.; Buck, Dorothea; Antony, Gisela; Bayas, Antonios; Bechmann, Lukas; Berthele, Achim; Chan, Andrew; Gasperi, Christiane; Gold, Ralf; Graetz, Christiane; Haas, Jürgen; Hecker, Michael; Infante-Duarte, Carmen; Knop, Matthias; Kümpfel, Tania; Limmroth, Volker; Linker, Ralf A.; Loleit, Verena; Luessi, Felix; Meuth, Sven G.; Mühlau, Mark; Nischwitz, Sandra; Paul, Friedemann; Pütz, Michael; Ruck, Tobias; Salmen, Anke; Stangel, Martin; Stellmann, Jan-Patrick; Stürner, Klarissa H.; Tackenberg, Björn; Then Bergh, Florian; Tumani, Hayrettin; Warnke, Clemens; Weber, Frank; Wiendl, Heinz; Wildemann, Brigitte; Zettl, Uwe K.; Ziemann, Ulf; Zipp, Frauke; Arloth, Janine; Weber, Peter; Radivojkov-Blagojevic, Milena; Scheinhardt, Markus O.; Dankowski, Theresa; Bettecken, Thomas; Lichtner, Peter; Czamara, Darina; Carrillo-Roa, Tania; Binder, Elisabeth B.; Berger, Klaus; Bertram, Lars; Franke, Andre; Gieger, Christian; Herms, Stefan; Homuth, Georg; Ising, Marcus; Jöckel, Karl-Heinz; Kacprowski, Tim; Kloiber, Stefan; Laudes, Matthias; Lieb, Wolfgang; Lill, Christina M.; Lucae, Susanne; Meitinger, Thomas; Moebus, Susanne; Müller-Nurasyid, Martina; Nöthen, Markus M.; Petersmann, Astrid; Rawal, Rajesh; Schminke, Ulf; Strauch, Konstantin; Völzke, Henry; Waldenberger, Melanie; Wellmann, Jürgen; Porcu, Eleonora; Mulas, Antonella; Pitzalis, Maristella; Sidore, Carlo; Zara, Ilenia; Cucca, Francesco; Zoledziewska, Magdalena; Ziegler, Andreas; Hemmer, Bernhard; Müller-Myhsok, Bertram

    2016-01-01

    We conducted a genome-wide association study (GWAS) on multiple sclerosis (MS) susceptibility in German cohorts with 4888 cases and 10,395 controls. In addition to associations within the major histocompatibility complex (MHC) region, 15 non-MHC loci reached genome-wide significance. Four of these loci are novel MS susceptibility loci. They map to the genes L3MBTL3, MAZ, ERG, and SHMT1. The lead variant at SHMT1 was replicated in an independent Sardinian cohort. Products of the genes L3MBTL3, MAZ, and ERG play important roles in immune cell regulation. SHMT1 encodes a serine hydroxymethyltransferase catalyzing the transfer of a carbon unit to the folate cycle. This reaction is required for regulation of methylation homeostasis, which is important for establishment and maintenance of epigenetic signatures. Our GWAS approach in a defined population with limited genetic substructure detected associations not found in larger, more heterogeneous cohorts, thus providing new clues regarding MS pathogenesis. PMID:27386562

  6. Allele frequencies at microsatellite loci: The stepwise mutation model revisited

    SciTech Connect

    Valdes, A.M.; Slatkin, M. ); Freimer, N.B. )

    1993-03-01

    The authors summarize available data on the frequencies of alleles at microsatellite loci in human populations and compare observed distributions of allele frequencies to those generated by a simulation of the stepwise mutation model. They show that observed frequency distributions at 108 loci are consistent with the results of the model under the assumption that mutations cause an increase or decrease in repeat number by one and under the condition that the product Nu, where N is the effective population size and u is the mutation rate, is larger than one. It is also shown that the variance of the distribution of allele sizes is a useful estimator of Nu and performs much better than previously suggested estimators for the stepwise mutation model. In the data, there is no correlation between the mean and variance in allele size at a locus or between the number of alleles and mean allele size, which suggests that the mutation rate at these loci is independent of allele size. 39 refs., 6 figs., 4 tabs.

  7. Pathogen selection drives nonoverlapping associations between HLA loci

    PubMed Central

    Penman, Bridget S.; Ashby, Ben; Buckee, Caroline O.; Gupta, Sunetra

    2013-01-01

    Pathogen-mediated selection is commonly invoked as an explanation for the exceptional polymorphism of the HLA gene cluster, but its role in generating and maintaining linkage disequilibrium between HLA loci is unclear. Here we show that pathogen-mediated selection can promote nonrandom associations between HLA loci. These associations may be distinguished from linkage disequilibrium generated by other population genetic processes by virtue of being nonoverlapping as well as nonrandom. Within our framework, immune selection forces the pathogen population to exist as a set of antigenically discrete strains; this then drives nonoverlapping associations between the HLA loci through which recognition of these antigens is mediated. We demonstrate that this signature of pathogen-driven selection can be observed in existing data, and propose that analyses of HLA population structure can be combined with laboratory studies to help us uncover the functional relationships between HLA alleles. In a wider coevolutionary context, our framework also shows that the inclusion of memory immunity can lead to robust cyclical dynamics across a range of host–pathogen systems. PMID:24225852

  8. Homology of Melanoma-Inducing Loci in the Genus Xiphophorus

    PubMed Central

    Schartl, M.

    1990-01-01

    Several species of the genus Xiphophorus are polymorphic for specific pigment patterns. Some of these give rise to malignant melanoma following the appropriate crossings. For one of these pattern loci from the platyfish Xiphophorus maculatus the melanoma-inducing gene has been cloned and found to encode a novel receptor tyrosine kinase, designated Xmrk. Using molecular probes from this gene in Southern blot analyses on single fish DNA preparations from 600 specimens of different populations of various species of the genus Xiphophorus and their hybrids, either with or without melanoma-predisposing pattern, it was shown that all individuals contain the Xmrk gene as a proto-oncogene. It is located on the sex chromosome. All fish that carry a melanoma-predisposing locus which has been identified by Mendelian genetics contain an additional copy of Xmrk, closely linked to a specific melanophore pattern locus on the sex chromosome. The melanoma-inducing loci of the different species and populations are homologous. The additional copy of Xmrk obviously arose by a gene-duplication event, thereby acquiring the oncogenic potential. The homology of the melanoma-inducing loci points to a similar mechanism of tumor suppression in all feral fish populations of the different species of the genus Xiphophorus. PMID:1981761

  9. Novel multiple sclerosis susceptibility loci implicated in epigenetic regulation.

    PubMed

    Andlauer, Till F M; Buck, Dorothea; Antony, Gisela; Bayas, Antonios; Bechmann, Lukas; Berthele, Achim; Chan, Andrew; Gasperi, Christiane; Gold, Ralf; Graetz, Christiane; Haas, Jürgen; Hecker, Michael; Infante-Duarte, Carmen; Knop, Matthias; Kümpfel, Tania; Limmroth, Volker; Linker, Ralf A; Loleit, Verena; Luessi, Felix; Meuth, Sven G; Mühlau, Mark; Nischwitz, Sandra; Paul, Friedemann; Pütz, Michael; Ruck, Tobias; Salmen, Anke; Stangel, Martin; Stellmann, Jan-Patrick; Stürner, Klarissa H; Tackenberg, Björn; Then Bergh, Florian; Tumani, Hayrettin; Warnke, Clemens; Weber, Frank; Wiendl, Heinz; Wildemann, Brigitte; Zettl, Uwe K; Ziemann, Ulf; Zipp, Frauke; Arloth, Janine; Weber, Peter; Radivojkov-Blagojevic, Milena; Scheinhardt, Markus O; Dankowski, Theresa; Bettecken, Thomas; Lichtner, Peter; Czamara, Darina; Carrillo-Roa, Tania; Binder, Elisabeth B; Berger, Klaus; Bertram, Lars; Franke, Andre; Gieger, Christian; Herms, Stefan; Homuth, Georg; Ising, Marcus; Jöckel, Karl-Heinz; Kacprowski, Tim; Kloiber, Stefan; Laudes, Matthias; Lieb, Wolfgang; Lill, Christina M; Lucae, Susanne; Meitinger, Thomas; Moebus, Susanne; Müller-Nurasyid, Martina; Nöthen, Markus M; Petersmann, Astrid; Rawal, Rajesh; Schminke, Ulf; Strauch, Konstantin; Völzke, Henry; Waldenberger, Melanie; Wellmann, Jürgen; Porcu, Eleonora; Mulas, Antonella; Pitzalis, Maristella; Sidore, Carlo; Zara, Ilenia; Cucca, Francesco; Zoledziewska, Magdalena; Ziegler, Andreas; Hemmer, Bernhard; Müller-Myhsok, Bertram

    2016-06-01

    We conducted a genome-wide association study (GWAS) on multiple sclerosis (MS) susceptibility in German cohorts with 4888 cases and 10,395 controls. In addition to associations within the major histocompatibility complex (MHC) region, 15 non-MHC loci reached genome-wide significance. Four of these loci are novel MS susceptibility loci. They map to the genes L3MBTL3, MAZ, ERG, and SHMT1. The lead variant at SHMT1 was replicated in an independent Sardinian cohort. Products of the genes L3MBTL3, MAZ, and ERG play important roles in immune cell regulation. SHMT1 encodes a serine hydroxymethyltransferase catalyzing the transfer of a carbon unit to the folate cycle. This reaction is required for regulation of methylation homeostasis, which is important for establishment and maintenance of epigenetic signatures. Our GWAS approach in a defined population with limited genetic substructure detected associations not found in larger, more heterogeneous cohorts, thus providing new clues regarding MS pathogenesis. PMID:27386562

  10. Identification of loci affecting flavour volatile emissions in tomato fruits.

    PubMed

    Tieman, Denise M; Zeigler, Michelle; Schmelz, Eric A; Taylor, Mark G; Bliss, Peter; Kirst, Matias; Klee, Harry J

    2006-01-01

    Fresh tomato fruit flavour is the sum of the interaction between sugars, acids, and a set of approximately 30 volatile compounds synthesized from a diverse set of precursors, including amino acids, lipids, and carotenoids. Some of these volatiles impart desirable qualities while others are negatively perceived. As a first step to identify the genes responsible for the synthesis of flavour-related chemicals, an attempt was made to identify loci that influence the chemical composition of ripe fruits. A genetically diverse but well-defined Solanum pennellii IL population was used. Because S. pennellii is a small green-fruited species, this population exhibits great biochemical diversity and is a rich source of genes affecting both fruit development and chemical composition. This population was used to identify multiple loci affecting the composition of chemicals related to flavour. Twenty-five loci were identified that are significantly altered in one or more of 23 different volatiles and four were altered in citric acid content. It was further shown that emissions of carotenoid-derived volatiles were directly correlated with the fruit carotenoid content. Linked molecular markers should be useful for breeding programmes aimed at improving fruit flavour. In the longer term, the genes responsible for controlling the levels of these chemicals will be important tools for understanding the complex interactions that ultimately integrate to provide the unique flavour of a tomato. PMID:16473892

  11. Development of a Lac Operon Concept Inventory (LOCI).

    PubMed

    Stefanski, Katherine M; Gardner, Grant E; Seipelt-Thiemann, Rebecca L

    2016-01-01

    Concept inventories (CIs) are valuable tools for educators that assess student achievement and identify misconceptions held by students. Results of student responses can be used to adjust or develop new instructional methods for a given topic. The regulation of gene expression in both prokaryotes and eukaryotes is an important concept in genetics and one that is particularly challenging for undergraduate students. As part of a larger study examining instructional methods related to gene regulation, the authors developed a 12-item CI assessing student knowledge of the lac operon. Using an established protocol, the authors wrote open-ended questions and conducted in-class testing with undergraduate microbiology and genetics students to discover common errors made by students about the lac operon and to determine aspects of item validity. Using these results, we constructed a 12-item multiple-choice lac operon CI called the Lac Operon Concept Inventory (LOCI), The LOCI was reviewed by two experts in the field for content validity. The LOCI underwent item analysis and was assessed for reliability with a sample of undergraduate genetics students (n = 115). The data obtained were found to be valid and reliable (coefficient alpha = 0.994) with adequate discriminatory power and item difficulty. PMID:27252300

  12. The Red Queen lives: Epistasis between linked resistance loci.

    PubMed

    Metzger, César M J A; Luijckx, Pepijn; Bento, Gilberto; Mariadassou, Mahendra; Ebert, Dieter

    2016-02-01

    A popular theory explaining the maintenance of genetic recombination (sex) is the Red Queen Theory. This theory revolves around the idea that time-lagged negative frequency-dependent selection by parasites favors rare host genotypes generated through recombination. Although the Red Queen has been studied for decades, one of its key assumptions has remained unsupported. The signature host-parasite specificity underlying the Red Queen, where infection depends on a match between host and parasite genotypes, relies on epistasis between linked resistance loci for which no empirical evidence exists. We performed 13 genetic crosses and tested over 7000 Daphnia magna genotypes for resistance to two strains of the bacterial pathogen Pasteuria ramosa. Results reveal the presence of strong epistasis between three closely linked resistance loci. One locus masks the expression of the other two, while these two interact to produce a single resistance phenotype. Changing a single allele on one of these interacting loci can reverse resistance against the tested parasites. Such a genetic mechanism is consistent with host and parasite specificity assumed by the Red Queen Theory. These results thus provide evidence for a fundamental assumption of this theory and provide a genetic basis for understanding the Red Queen dynamics in the Daphnia-Pasteuria system. PMID:26763092

  13. Quantitative trait loci influencing honeybee alarm pheromone levels.

    PubMed

    Hunt, G J; Collins, A M; Rivera, R; Page, R E; Guzmán-Novoa, E

    1999-01-01

    Quantitative trait loci (QTL) mapping procedures were used to identify loci that influence the levels of alarm pheromones found in the stinging apparatus of worker honeybees. An F1 queen was produced from a cross between a queen of European origin and a drone descended from an African subspecies. Haploid drones from the hybrid queen were individually backcrossed to European queens to produce 172 colonies. Samples of stings were taken from backcross workers of these colonies. Alarm pheromone levels were determined by gas chromatography. RAPD markers were scored from the haploid drone fathers of these colonies. The multiple-QTL model (MQM) of MapQTL was used to identify QTLs that influence the levels of four alarm pheromone components. Seven independent, potential QTLs were identified with LOD scores greater than two, and one at LOD 1.88. We identified one QTL for n-decyl acetate, three for n-octanol, four for isopentyl acetate, and one for hexyl acetate. One region of linkage group XI shows a strong influence on body size and the levels of three alarm pheromone components. This locus explained 40% of the variance for the amount of n-decyl acetate (LOD 6.57). In general, the QTLs influencing alarm pheromone levels were independent of previously identified loci that influenced the stinging behavior of these colonies. The only exception was a potential locus influencing levels of n-octanol, which was inversely correlated with stinging behavior. PMID:10544503

  14. Immunochip analysis identifies multiple susceptibility loci for systemic sclerosis.

    PubMed

    Mayes, Maureen D; Bossini-Castillo, Lara; Gorlova, Olga; Martin, José Ezequiel; Zhou, Xiaodong; Chen, Wei V; Assassi, Shervin; Ying, Jun; Tan, Filemon K; Arnett, Frank C; Reveille, John D; Guerra, Sandra; Teruel, María; Carmona, Francisco David; Gregersen, Peter K; Lee, Annette T; López-Isac, Elena; Ochoa, Eguzkine; Carreira, Patricia; Simeón, Carmen Pilar; Castellví, Iván; González-Gay, Miguel Ángel; Zhernakova, Alexandra; Padyukov, Leonid; Alarcón-Riquelme, Marta; Wijmenga, Cisca; Brown, Matthew; Beretta, Lorenzo; Riemekasten, Gabriela; Witte, Torsten; Hunzelmann, Nicolas; Kreuter, Alexander; Distler, Jörg H W; Voskuyl, Alexandre E; Schuerwegh, Annemie J; Hesselstrand, Roger; Nordin, Annika; Airó, Paolo; Lunardi, Claudio; Shiels, Paul; van Laar, Jacob M; Herrick, Ariane; Worthington, Jane; Denton, Christopher; Wigley, Fredrick M; Hummers, Laura K; Varga, John; Hinchcliff, Monique E; Baron, Murray; Hudson, Marie; Pope, Janet E; Furst, Daniel E; Khanna, Dinesh; Phillips, Kristin; Schiopu, Elena; Segal, Barbara M; Molitor, Jerry A; Silver, Richard M; Steen, Virginia D; Simms, Robert W; Lafyatis, Robert A; Fessler, Barri J; Frech, Tracy M; Alkassab, Firas; Docherty, Peter; Kaminska, Elzbieta; Khalidi, Nader; Jones, Henry Niall; Markland, Janet; Robinson, David; Broen, Jasper; Radstake, Timothy R D J; Fonseca, Carmen; Koeleman, Bobby P; Martin, Javier

    2014-01-01

    In this study, 1,833 systemic sclerosis (SSc) cases and 3,466 controls were genotyped with the Immunochip array. Classical alleles, amino acid residues, and SNPs across the human leukocyte antigen (HLA) region were imputed and tested. These analyses resulted in a model composed of six polymorphic amino acid positions and seven SNPs that explained the observed significant associations in the region. In addition, a replication step comprising 4,017 SSc cases and 5,935 controls was carried out for several selected non-HLA variants, reaching a total of 5,850 cases and 9,401 controls of European ancestry. Following this strategy, we identified and validated three SSc risk loci, including DNASE1L3 at 3p14, the SCHIP1-IL12A locus at 3q25, and ATG5 at 6q21, as well as a suggested association of the TREH-DDX6 locus at 11q23. The associations of several previously reported SSc risk loci were validated and further refined, and the observed peak of association in PXK was related to DNASE1L3. Our study has increased the number of known genetic associations with SSc, provided further insight into the pleiotropic effects of shared autoimmune risk factors, and highlighted the power of dense mapping for detecting previously overlooked susceptibility loci. PMID:24387989

  15. Immunochip Analysis Identifies Multiple Susceptibility Loci for Systemic Sclerosis

    PubMed Central

    Mayes, Maureen D.; Bossini-Castillo, Lara; Gorlova, Olga; Martin, José Ezequiel; Zhou, Xiaodong; Chen, Wei V.; Assassi, Shervin; Ying, Jun; Tan, Filemon K.; Arnett, Frank C.; Reveille, John D.; Guerra, Sandra; Teruel, María; Carmona, Francisco David; Gregersen, Peter K.; Lee, Annette T.; López-Isac, Elena; Ochoa, Eguzkine; Carreira, Patricia; Simeón, Carmen Pilar; Castellví, Iván; González-Gay, Miguel Ángel; Ortego-Centeno, Norberto; Ríos, Raquel; Callejas, José Luis; Navarrete, Nuria; García Portales, Rosa; Camps, María Teresa; Fernández-Nebro, Antonio; González-Escribano, María F.; Sánchez-Román, Julio; García-Hernández, Francisco José; Castillo, María Jesús; Aguirre, María Ángeles; Gómez-Gracia, Inmaculada; Fernández-Gutiérrez, Benjamín; Rodríguez-Rodríguez, Luis; Vicente, Esther; Andreu, José Luis; Fernández de Castro, Mónica; García de la Peña, Paloma; López-Longo, Francisco Javier; Martínez, Lina; Fonollosa, Vicente; Espinosa, Gerard; Tolosa, Carlos; Pros, Anna; Rodríguez Carballeira, Mónica; Narváez, Francisco Javier; Rubio Rivas, Manel; Ortiz Santamaría, Vera; Díaz, Bernardino; Trapiella, Luis; Freire, María del Carmen; Sousa, Adrián; Egurbide, María Victoria; Fanlo Mateo, Patricia; Sáez-Comet, Luis; Díaz, Federico; Hernández, Vanesa; Beltrán, Emma; Román-Ivorra, José Andrés; Grau, Elena; Alegre Sancho, Juan José; Blanco García, Francisco J.; Oreiro, Natividad; Fernández Sueiro, Luis; Zhernakova, Alexandra; Padyukov, Leonid; Alarcón-Riquelme, Marta; Wijmenga, Cisca; Brown, Matthew; Beretta, Lorenzo; Riemekasten, Gabriela; Witte, Torsten; Hunzelmann, Nicolas; Kreuter, Alexander; Distler, Jörg H.W.; Voskuyl, Alexandre E.; Schuerwegh, Annemie J.; Hesselstrand, Roger; Nordin, Annika; Airó, Paolo; Lunardi, Claudio; Shiels, Paul; van Laar, Jacob M.; Herrick, Ariane; Worthington, Jane; Denton, Christopher; Wigley, Fredrick M.; Hummers, Laura K.; Varga, John; Hinchcliff, Monique E.; Baron, Murray; Hudson, Marie; Pope, Janet E.; Furst, Daniel E.; Khanna, Dinesh; Phillips, Kristin; Schiopu, Elena; Segal, Barbara M.; Molitor, Jerry A.; Silver, Richard M.; Steen, Virginia D.; Simms, Robert W.; Lafyatis, Robert A.; Fessler, Barri J.; Frech, Tracy M.; AlKassab, Firas; Docherty, Peter; Kaminska, Elzbieta; Khalidi, Nader; Jones, Henry Niall; Markland, Janet; Robinson, David; Broen, Jasper; Radstake, Timothy R.D.J.; Fonseca, Carmen; Koeleman, Bobby P.; Martin, Javier

    2014-01-01

    In this study, 1,833 systemic sclerosis (SSc) cases and 3,466 controls were genotyped with the Immunochip array. Classical alleles, amino acid residues, and SNPs across the human leukocyte antigen (HLA) region were imputed and tested. These analyses resulted in a model composed of six polymorphic amino acid positions and seven SNPs that explained the observed significant associations in the region. In addition, a replication step comprising 4,017 SSc cases and 5,935 controls was carried out for several selected non-HLA variants, reaching a total of 5,850 cases and 9,401 controls of European ancestry. Following this strategy, we identified and validated three SSc risk loci, including DNASE1L3 at 3p14, the SCHIP1-IL12A locus at 3q25, and ATG5 at 6q21, as well as a suggested association of the TREH-DDX6 locus at 11q23. The associations of several previously reported SSc risk loci were validated and further refined, and the observed peak of association in PXK was related to DNASE1L3. Our study has increased the number of known genetic associations with SSc, provided further insight into the pleiotropic effects of shared autoimmune risk factors, and highlighted the power of dense mapping for detecting previously overlooked susceptibility loci. PMID:24387989

  16. Mapping of quantitative trait loci for root hair length in wheat identifies loci that co-locate with loci for yield components.

    PubMed

    Horn, R; Wingen, L U; Snape, J W; Dolan, L

    2016-08-01

    Root hairs are fast growing, ephemeral tubular extensions of the root epidermis. They arise in the unsuberized maturation zone of the root, effectively increasing the root surface area in the region over which nutrient and water uptake occur. Variation in root hair length (RHL) between varieties has been shown to be genetically determined, and could, therefore, have consequences for nutrient capture and yield potential in crops. We describe the development of a medium-to-high throughput screening method for assessing RHL in wheat at the seedling stage. This method was used to screen a number of wheat mapping population parental lines for variation in RHL. Parents of two populations derived from inter-varietal crosses differed for RHL: Spark vs Rialto and Charger vs Badger. We identified quantitative trait loci (QTLs) for RHL in the populations derived from these crosses. In Spark × Rialto, QTLs on chromosomes 1A, 2A and 6A were associated with variation in RHL, whilst in Charger × Badger, a QTL for RHL was identified on 2BL. The QTLs on 2A and 6A co-localized with previously described QTLs for yield components. Longer root hairs may confer an advantage by exploiting limiting mineral and water resources. This first QTL analysis of root hair length in wheat identifies loci that could usefully be further investigated for their role in tolerance to limiting conditions. PMID:27315832

  17. Mapping of quantitative trait loci for root hair length in wheat identifies loci that co-locate with loci for yield components

    PubMed Central

    Horn, R.; Wingen, L. U.; Snape, J. W.; Dolan, L.

    2016-01-01

    Root hairs are fast growing, ephemeral tubular extensions of the root epidermis. They arise in the unsuberized maturation zone of the root, effectively increasing the root surface area in the region over which nutrient and water uptake occur. Variation in root hair length (RHL) between varieties has been shown to be genetically determined, and could, therefore, have consequences for nutrient capture and yield potential in crops. We describe the development of a medium-to-high throughput screening method for assessing RHL in wheat at the seedling stage. This method was used to screen a number of wheat mapping population parental lines for variation in RHL. Parents of two populations derived from inter-varietal crosses differed for RHL: Spark vs Rialto and Charger vs Badger. We identified quantitative trait loci (QTLs) for RHL in the populations derived from these crosses. In Spark × Rialto, QTLs on chromosomes 1A, 2A and 6A were associated with variation in RHL, whilst in Charger × Badger, a QTL for RHL was identified on 2BL. The QTLs on 2A and 6A co-localized with previously described QTLs for yield components. Longer root hairs may confer an advantage by exploiting limiting mineral and water resources. This first QTL analysis of root hair length in wheat identifies loci that could usefully be further investigated for their role in tolerance to limiting conditions. PMID:27315832

  18. RNAP-II molecules participate in the anchoring of the ORC to rDNA replication origins.

    PubMed

    Mayan, Maria D

    2013-01-01

    The replication of genomic DNA is limited to a single round per cell cycle. The first component, which recognises and remains bound to origins from recognition until activation and replication elongation, is the origin recognition complex. How origin recognition complex (ORC) proteins remain associated with chromatin throughout the cell cycle is not yet completely understood. Several genome-wide studies have undoubtedly demonstrated that RNA polymerase II (RNAP-II) binding sites overlap with replication origins and with the binding sites of the replication components. RNAP-II is no longer merely associated with transcription elongation. Several reports have demonstrated that RNAP-II molecules affect chromatin structure, transcription, mRNA processing, recombination and DNA repair, among others. Most of these activities have been reported to directly depend on the interaction of proteins with the C-terminal domain (CTD) of RNAP-II. Two-dimensional gels results and ChIP analysis presented herein suggest that stalled RNAP-II molecules bound to the rDNA chromatin participate in the anchoring of ORC proteins to origins during the G1 and S-phases. The results show that in the absence of RNAP-II, Orc1p, Orc2p and Cdc6p do not bind to origins. Moreover, co-immunoprecipitation experiments suggest that Ser2P-CTD and hypophosphorylated RNAP-II interact with Orc1p. In the context of rDNA, cryptic transcription by RNAP-II did not negatively interfere with DNA replication. However, the results indicate that RNAP-II is not necessary to maintain the binding of ORCs to the origins during metaphase. These findings highlight for the first time the potential importance of stalled RNAP-II in the regulation of DNA replication. PMID:23308214

  19. Morphology and 18S rDNA of Henneguya gurlei (Myxosporea) from Ameiurus nebulosus (Siluriformes) in North Carolina

    USGS Publications Warehouse

    Iwanowicz, L.R.; Iwanowicz, D.D.; Pote, L.M.; Blazer, V.S.; Schill, W.B.

    2008-01-01

    Henneguya gurlei was isolated from Ameiurus nebulosus captured in North Carolina and redescribed using critical morphological features and 18S small-subunit ribosomal RNA (SSU rDNA) gene sequence. Plasmodia are white, spherical, or subspherical, occur in clusters, measure up to 1.8 mm in length, and are located on the dorsal, pectoral, and anal fins. Histologically, plasmodia are located in the dermis and subdermally, and the larger cysts disrupt the melanocyte pigment layer. The spore body is lanceolate, 18.2 ?? 0.3 ??m (range 15.7-20.3) in length, and 5.4 ?? 0.1 ??m (range 3.8-6.1) in width in valvular view. The caudal appendages are 41.1 ?? 1.1 ??m (range 34.0-49.7) in length. Polar capsules are pyriform and of unequal size. The longer polar capsule measures 6.2 ?? 0.1 ??m (range 5.48-7.06), while the shorter is 5.7 ?? 0.1 ??m (range 4.8-6.4) in length. Polar capsule width is 1.2 ?? 0.03 ??m (range 1.0-1.54). The total length of the spore is 60.9 ?? 1.2 ??m (range 48.7-68.5). Morphologically, this species is similar to other species of Henneguya that are known to infect ictalurids. Based on SSU rDNA sequences, this species is most closely related to H. exilis and H. ictaluri, which infect Ictalurus punctatus. ?? American Society of Parasitologists 2008.

  20. In β-actin knockouts, epigenetic reprogramming and rDNA transcription inactivation lead to growth and proliferation defects.

    PubMed

    Almuzzaini, Bader; Sarshad, Aishe A; Rahmanto, Aldwin S; Hansson, Magnus L; Von Euler, Anne; Sangfelt, Olle; Visa, Neus; Farrants, Ann-Kristin Östlund; Percipalle, Piergiorgio

    2016-08-01

    Actin and nuclear myosin 1 (NM1) are regulators of transcription and chromatin organization. Using a genome-wide approach, we report here that β-actin binds intergenic and genic regions across the mammalian genome, associated with both protein-coding and rRNA genes. Within the rDNA, the distribution of β-actin correlated with NM1 and the other subunits of the B-WICH complex, WSTF and SNF2h. In β-actin(-/-) mouse embryonic fibroblasts (MEFs), we found that rRNA synthesis levels decreased concomitantly with drops in RNA polymerase I (Pol I) and NM1 occupancies across the rRNA gene. Reintroduction of wild-type β-actin, in contrast to mutated forms with polymerization defects, efficiently rescued rRNA synthesis underscoring the direct role for a polymerization-competent form of β-actin in Pol I transcription. The rRNA synthesis defects in the β-actin(-/-) MEFs are a consequence of epigenetic reprogramming with up-regulation of the repressive mark H3K4me1 (monomethylation of lys4 on histone H3) and enhanced chromatin compaction at promoter-proximal enhancer (T0 sequence), which disturb binding of the transcription factor TTF1. We propose a novel genome-wide mechanism where the polymerase-associated β-actin synergizes with NM1 to coordinate permissive chromatin with Pol I transcription, cell growth, and proliferation.-Almuzzaini, B., Sarshad, A. A. , Rahmanto, A. S., Hansson, M. L., Von Euler, A., Sangfelt, O., Visa, N., Farrants, A.-K. Ö., Percipalle, P. In β-actin knockouts, epigenetic reprogramming and rDNA transcription inactivation lead to growth and proliferation defects. PMID:27127100

  1. Identification of signature and primers specific to genus Pseudomonas using mismatched patterns of 16S rDNA sequences

    PubMed Central

    Purohit, HJ; Raje, DV; Kapley, A

    2003-01-01

    Background Pseudomonas, a soil bacterium, has been observed as a dominant genus that survives in different habitats with wide hostile conditions. We had a basic assumption that the species level variation in 16S rDNA sequences of a bacterial genus is mainly due to substitutions rather than insertion or deletion of bases. Keeping this in view, the aim was to identify a region of 16S rDNA sequence and within that focus on substitution prone stretches indicating species level variation and to derive patterns from these stretches that are specific to the genus. Results Repeating elements that are highly conserved across different species of Pseudomonas were considered as guiding markers to locate a region within the 16S gene. Four repeating patterns showing more than 80% consistency across fifty different species of Pseudomonas were identified. The sub-sequences between the repeating patterns yielded a continuous region of 495 bases. The sub-sequences after alignment and using Shanon's entropy measure yielded a consensus pattern. A stretch of 24 base positions in this region, showing maximum variations across the sampled sequences was focused for possible genus specific patterns. Nine patterns in this stretch showed nearly 70% specificity to the target genus. These patterns were further used to obtain a signature that is highly specific to Pseudomonas. The signature region was used to design PCR primers, which yielded a PCR product of 150 bp whose specificity was validated through a sample experiment. Conclusions The developed approach was successfully applied to genus Pseudomonas. It could be tried in other bacterial genera to obtain respective signature patterns and thereby PCR primers, for their rapid tracking in the environmental samples. PMID:12769821

  2. 5S rRNA sequences from four marine invertebrates and implications for base pairing models of metazoan sequences.

    PubMed

    Walker, W F; Doolittle, W F

    1983-08-11

    The nucleotide sequences of 5S rRNAs from the starfish Asterias vulgaris, the squid Illex illecebrosus, the sipunculid Phascolopsis gouldii and the jellyfish Aurelia aurita were determined. The sequence from Asterias lends support for one of two previous base pairing models for helix E in metazoan sequences. The Aurelia sequence differs by five nucleotides from that previously reported and does not violate the consensus secondary structure model for eukaryotic 5S rRNA. PMID:6136024

  3. Conformation of 4.5S RNA in the signal recognition particle and on the 30S ribosomal subunit

    PubMed Central

    GU, SHAN-QING; JÖCKEL, JOHANNES; BEINKER, PHILIPP; WARNECKE, JENS; SEMENKOV, YURI P.; RODNINA, MARINA V.; WINTERMEYER, WOLFGANG

    2005-01-01

    The signal recognition particle (SRP) from Escherichia coli consists of 4.5S RNA and protein Ffh. It is essential for targeting ribosomes that are translating integral membrane proteins to the translocation pore in the plasma membrane. Independently of Ffh, 4.5S RNA also interacts with elongation factor G (EF-G) and the 30S ribosomal subunit. Here we use a cross-linking approach to probe the conformation of 4.5S RNA in SRP and in the complex with the 30S ribosomal subunit and to map the binding site. The UV-activatable cross-linker p-azidophenacyl bromide (AzP) was attached to positions 1, 21, and 54 of wild-type or modified 4.5S RNA. In SRP, cross-links to Ffh were formed from AzP in all three positions in 4.5S RNA, indicating a strongly bent conformation in which the 5′ end (position 1) and the tetraloop region (including position 54) of the molecule are close to one another and to Ffh. In ribosomal complexes of 4.5S RNA, AzP in both positions 1 and 54 formed cross-links to the 30S ribosomal subunit, independently of the presence of Ffh. The major cross-linking target on the ribosome was protein S7; minor cross-links were formed to S2, S18, and S21. There were no cross-links from 4.5S RNA to the 50S subunit, where the primary binding site of SRP is located close to the peptide exit. The functional role of 4.5S RNA binding to the 30S subunit is unclear, as the RNA had no effect on translation or tRNA translocation on the ribosome. PMID:16043501

  4. Nucleotide sequences of 5S rRNAs from sponge Halichondria japonica and tunicate Halocynthia roretzi and their phylogenetic positions

    PubMed Central

    Komiya, Hiroyuki; Hasegawa, Masami; Takemura, Shosuke

    1983-01-01

    The nucleotide sequences of 5S rRNAs from sponge Halichondria japonica and tunicate Halocynthia roretzi were determined by chemical and enzymatic gel methods. Their phylogenetic positions among metazoans were derived from the 5S rRNA sequences by a computer analysis based on the maximum parsimony principle. It was suggested that the sponge is closely related to several invertebrates and the tunicate has affinity to vertebrates rather than invertebrates. PMID:6835845

  5. A physical map of 15 loci on human chromosome 5q23-q33 by two-color fluorescence in situ hybridization

    SciTech Connect

    Saltman, D.L.; Dolganov, G.M. ); Warrington, J.A.; Wasmuth, J.J. ); Lovett, M. )

    1993-06-01

    The q23-q33 region of human chromosome 5 encodes a large number of growth factors, growth factor receptors, and hormone/neurotransmitter receptors. This is also the general region into which several disease genes have been mapped, including diastrophic dysplasia, Treacher Collins syndrome, hereditary startle disease, the myeloid disorders that are associated with the 5q-syndrome, autosomal-dominant forms of hereditary deafness, and limb girdle muscular dystrophy. The authors have developed a framework physical map of this region using cosmid clones isolated from the Los Alamos arrayed chromosome 5-specific library. Entry points into this library included 14 probes to genes within this interval and one anonymous polymorphic marker locus. A physical map has been constructed using fluorescence in situ hybridization of these cosmids on metaphase and interphase chromosomes, and this is in good agreement with the radiation hybrid map of the region. The derived order of loci across the region is cen-IL4-IL5-IRF1-IL3-IL9-EGR1-CD14-FGFA-GRL-D5S207-ADRB2-SPARC-RPS14-CSF1R-ADRA1, and the total distance spanned by these loci is approximately 15 Mb. The framework map, genomic clones, and contig expansion within 5q23-q33 should provide valuable resources for the eventual isolation of the clinically relevant loci that reside in this region. 31 refs., 3 figs., 2 tabs.

  6. Phylogenetic origins of the plant mitochondrion based on a comparative analysis of 5S ribosomal RNA sequences

    NASA Technical Reports Server (NTRS)

    Villanueva, E.; Delihas, N.; Luehrsen, K. R.; Fox, G. E.; Gibson, J.

    1985-01-01

    The complete nucleotide sequences of 5S ribosomal RNAs from Rhodocyclus gelatinosa, Rhodobacter sphaeroides, and Pseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains. Rhodobacter sphaeroides is specifically related to Paracoccus denitrificans and Rc. gelatinosa is related to Ps. cepacia. These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found in P. denitrificans are present also in the 5S RNA of Rb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of obtaining these new sequences is that it is possible to clarify the phylogenetic origins of the plant mitochondrion. In particular, a close phylogenetic relationship is found between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely, Rb. sphaeroides, P. denitrificans, and Rhodospirillum rubrum.

  7. STELLAR LOCI. I. METALLICITY DEPENDENCE AND INTRINSIC WIDTHS

    SciTech Connect

    Yuan, Haibo; Liu, Xiaowei; Xiang, Maosheng; Huang, Yang; Chen, Bingqiu E-mail: x.liu@pku.edu.cn

    2015-02-01

    Stellar loci are widely used for selection of interesting outliers, reddening determinations, and calibrations. However, until now, the dependence of stellar loci on metallicity has not been fully explored, and their intrinsic widths are unclear. In this paper, by combining the spectroscopic and recalibrated imaging data of the Sloan Digital Sky Survey (SDSS) Stripe 82, we have built a large, clean sample of dwarf stars with accurate colors and well-determined metallicities to investigate the metallicity dependence and intrinsic widths of the SDSS stellar loci. Typically, 1 dex decrease in metallicity causes 0.20 and 0.02 mag decrease in colors u – g and g – r and 0.02 and 0.02 mag increase in colors r – i and i – z, respectively. The variations are larger for metal-rich stars than for metal-poor ones, and larger for F/G/K stars than for A/M ones. Using the sample, we have performed two-dimensional polynomial fitting to the u – g, g – r, r – i, and i – z colors as a function of color g – i and metallicity [Fe/H]. The residuals, at the level of 0.029, 0.008, 0.008, and 0.011 mag for the u – g, g – r, r – i, and i – z colors, respectively, can be fully accounted for by the photometric errors and metallicity uncertainties, suggesting that the intrinsic widths of the loci are at maximum a few millimagnitudes. The residual distributions are asymmetric, revealing that a significant fraction of stars are binaries. In a companion paper, we will present an unbiased estimate of the binary fraction for field stars. Other potential applications of the metallicity-dependent stellar loci are briefly discussed.

  8. Nine Loci for Ocular Axial Length Identified through Genome-wide Association Studies, Including Shared Loci with Refractive Error

    PubMed Central

    Cheng, Ching-Yu; Schache, Maria; Ikram, M. Kamran; Young, Terri L.; Guggenheim, Jeremy A.; Vitart, Veronique; MacGregor, Stuart; Verhoeven, Virginie J.M.; Barathi, Veluchamy A.; Liao, Jiemin; Hysi, Pirro G.; Bailey-Wilson, Joan E.; St. Pourcain, Beate; Kemp, John P.; McMahon, George; Timpson, Nicholas J.; Evans, David M.; Montgomery, Grant W.; Mishra, Aniket; Wang, Ya Xing; Wang, Jie Jin; Rochtchina, Elena; Polasek, Ozren; Wright, Alan F.; Amin, Najaf; van Leeuwen, Elisabeth M.; Wilson, James F.; Pennell, Craig E.; van Duijn, Cornelia M.; de Jong, Paulus T.V.M.; Vingerling, Johannes R.; Zhou, Xin; Chen, Peng; Li, Ruoying; Tay, Wan-Ting; Zheng, Yingfeng; Chew, Merwyn; Rahi, Jugnoo S.; Hysi, Pirro G.; Yoshimura, Nagahisa; Yamashiro, Kenji; Miyake, Masahiro; Delcourt, Cécile; Maubaret, Cecilia; Williams, Cathy; Guggenheim, Jeremy A.; Northstone, Kate; Ring, Susan M.; Davey-Smith, George; Craig, Jamie E.; Burdon, Kathryn P.; Fogarty, Rhys D.; Iyengar, Sudha K.; Igo, Robert P.; Chew, Emily; Janmahasathian, Sarayut; Iyengar, Sudha K.; Igo, Robert P.; Chew, Emily; Janmahasathian, Sarayut; Stambolian, Dwight; Wilson, Joan E. Bailey; MacGregor, Stuart; Lu, Yi; Jonas, Jost B.; Xu, Liang; Saw, Seang-Mei; Baird, Paul N.; Rochtchina, Elena; Mitchell, Paul; Wang, Jie Jin; Jonas, Jost B.; Nangia, Vinay; Hayward, Caroline; Wright, Alan F.; Vitart, Veronique; Polasek, Ozren; Campbell, Harry; Vitart, Veronique; Rudan, Igor; Vatavuk, Zoran; Vitart, Veronique; Paterson, Andrew D.; Hosseini, S. Mohsen; Iyengar, Sudha K.; Igo, Robert P.; Fondran, Jeremy R.; Young, Terri L.; Feng, Sheng; Verhoeven, Virginie J.M.; Klaver, Caroline C.; van Duijn, Cornelia M.; Metspalu, Andres; Haller, Toomas; Mihailov, Evelin; Pärssinen, Olavi; Wedenoja, Juho; Wilson, Joan E. Bailey; Wojciechowski, Robert; Baird, Paul N.; Schache, Maria; Pfeiffer, Norbert; Höhn, René; Pang, Chi Pui; Chen, Peng; Meitinger, Thomas; Oexle, Konrad; Wegner, Aharon; Yoshimura, Nagahisa; Yamashiro, Kenji; Miyake, Masahiro; Pärssinen, Olavi; Yip, Shea Ping; Ho, Daniel W.H.; Pirastu, Mario; Murgia, Federico; Portas, Laura; Biino, Genevra; Wilson, James F.; Fleck, Brian; Vitart, Veronique; Stambolian, Dwight; Wilson, Joan E. Bailey; Hewitt, Alex W.; Ang, Wei; Verhoeven, Virginie J.M.; Klaver, Caroline C.; van Duijn, Cornelia M.; Saw, Seang-Mei; Wong, Tien-Yin; Teo, Yik-Ying; Fan, Qiao; Cheng, Ching-Yu; Zhou, Xin; Ikram, M. Kamran; Saw, Seang-Mei; Teo, Yik-Ying; Fan, Qiao; Cheng, Ching-Yu; Zhou, Xin; Ikram, M. Kamran; Saw, Seang-Mei; Wong, Tien-Yin; Teo, Yik-Ying; Fan, Qiao; Cheng, Ching-Yu; Zhou, Xin; Ikram, M. Kamran; Saw, Seang-Mei; Wong, Tien-Yin; Teo, Yik-Ying; Fan, Qiao; Cheng, Ching-Yu; Zhou, Xin; Ikram, M. Kamran; Saw, Seang-Mei; Tai, E-Shyong; Teo, Yik-Ying; Fan, Qiao; Cheng, Ching-Yu; Zhou, Xin; Ikram, M. Kamran; Saw, Seang-Mei; Teo, Yik-Ying; Fan, Qiao; Cheng, Ching-Yu; Zhou, Xin; Ikram, M. Kamran; Mackey, David A.; MacGregor, Stuart; Hammond, Christopher J.; Hysi, Pirro G.; Deangelis, Margaret M.; Morrison, Margaux; Zhou, Xiangtian; Chen, Wei; Paterson, Andrew D.; Hosseini, S. Mohsen; Mizuki, Nobuhisa; Meguro, Akira; Lehtimäki, Terho; Mäkelä, Kari-Matti; Raitakari, Olli; Kähönen, Mika; Burdon, Kathryn P.; Craig, Jamie E.; Iyengar, Sudha K.; Igo, Robert P.; Lass, Jonathan H.; Reinhart, William; Belin, Michael W.; Schultze, Robert L.; Morason, Todd; Sugar, Alan; Mian, Shahzad; Soong, Hunson Kaz; Colby, Kathryn; Jurkunas, Ula; Yee, Richard; Vital, Mark; Alfonso, Eduardo; Karp, Carol; Lee, Yunhee; Yoo, Sonia; Hammersmith, Kristin; Cohen, Elisabeth; Laibson, Peter; Rapuano, Christopher; Ayres, Brandon; Croasdale, Christopher; Caudill, James; Patel, Sanjay; Baratz, Keith; Bourne, William; Maguire, Leo; Sugar, Joel; Tu, Elmer; Djalilian, Ali; Mootha, Vinod; McCulley, James; Bowman, Wayne; Cavanaugh, H. Dwight; Verity, Steven; Verdier, David; Renucci, Ann; Oliva, Matt; Rotkis, Walter; Hardten, David R.; Fahmy, Ahmad; Brown, Marlene; Reeves, Sherman; Davis, Elizabeth A.; Lindstrom, Richard; Hauswirth, Scott; Hamilton, Stephen; Lee, W. Barry; Price, Francis; Price, Marianne; Kelly, Kathleen; Peters, Faye; Shaughnessy, Michael; Steinemann, Thomas; Dupps, B.J.; Meisler, David M.; Mifflin, Mark; Olson, Randal; Aldave, Anthony; Holland, Gary; Mondino, Bartly J.; Rosenwasser, George; Gorovoy, Mark; Dunn, Steven P.; Heidemann, David G.; Terry, Mark; Shamie, Neda; Rosenfeld, Steven I.; Suedekum, Brandon; Hwang, David

    2013-01-01

    Refractive errors are common eye disorders of public health importance worldwide. Ocular axial length (AL) is the major determinant of refraction and thus of myopia and hyperopia. We conducted a meta-analysis of genome-wide association studies for AL, combining 12,531 Europeans and 8,216 Asians. We identified eight genome-wide significant loci for AL (RSPO1, C3orf26, LAMA2, GJD2, ZNRF3, CD55, MIP, and ALPPL2) and confirmed one previously reported AL locus (ZC3H11B). Of the nine loci, five (LAMA2, GJD2, CD55, ALPPL2, and ZC3H11B) were associated with refraction in 18 independent cohorts (n = 23,591). Differential gene expression was observed for these loci in minus-lens-induced myopia mouse experiments and human ocular tissues. Two of the AL genes, RSPO1 and ZNRF3, are involved in Wnt signaling, a pathway playing a major role in the regulation of eyeball size. This study provides evidence of shared genes between AL and refraction, but importantly also suggests that these traits may have unique pathways. PMID:24144296

  9. Nine loci for ocular axial length identified through genome-wide association studies, including shared loci with refractive error.

    PubMed

    Cheng, Ching-Yu; Schache, Maria; Ikram, M Kamran; Young, Terri L; Guggenheim, Jeremy A; Vitart, Veronique; MacGregor, Stuart; Verhoeven, Virginie J M; Barathi, Veluchamy A; Liao, Jiemin; Hysi, Pirro G; Bailey-Wilson, Joan E; St Pourcain, Beate; Kemp, John P; McMahon, George; Timpson, Nicholas J; Evans, David M; Montgomery, Grant W; Mishra, Aniket; Wang, Ya Xing; Wang, Jie Jin; Rochtchina, Elena; Polasek, Ozren; Wright, Alan F; Amin, Najaf; van Leeuwen, Elisabeth M; Wilson, James F; Pennell, Craig E; van Duijn, Cornelia M; de Jong, Paulus T V M; Vingerling, Johannes R; Zhou, Xin; Chen, Peng; Li, Ruoying; Tay, Wan-Ting; Zheng, Yingfeng; Chew, Merwyn; Burdon, Kathryn P; Craig, Jamie E; Iyengar, Sudha K; Igo, Robert P; Lass, Jonathan H; Chew, Emily Y; Haller, Toomas; Mihailov, Evelin; Metspalu, Andres; Wedenoja, Juho; Simpson, Claire L; Wojciechowski, Robert; Höhn, René; Mirshahi, Alireza; Zeller, Tanja; Pfeiffer, Norbert; Lackner, Karl J; Bettecken, Thomas; Meitinger, Thomas; Oexle, Konrad; Pirastu, Mario; Portas, Laura; Nag, Abhishek; Williams, Katie M; Yonova-Doing, Ekaterina; Klein, Ronald; Klein, Barbara E; Hosseini, S Mohsen; Paterson, Andrew D; Makela, Kari-Matti; Lehtimaki, Terho; Kahonen, Mika; Raitakari, Olli; Yoshimura, Nagahisa; Matsuda, Fumihiko; Chen, Li Jia; Pang, Chi Pui; Yip, Shea Ping; Yap, Maurice K H; Meguro, Akira; Mizuki, Nobuhisa; Inoko, Hidetoshi; Foster, Paul J; Zhao, Jing Hua; Vithana, Eranga; Tai, E-Shyong; Fan, Qiao; Xu, Liang; Campbell, Harry; Fleck, Brian; Rudan, Igor; Aung, Tin; Hofman, Albert; Uitterlinden, André G; Bencic, Goran; Khor, Chiea-Chuen; Forward, Hannah; Pärssinen, Olavi; Mitchell, Paul; Rivadeneira, Fernando; Hewitt, Alex W; Williams, Cathy; Oostra, Ben A; Teo, Yik-Ying; Hammond, Christopher J; Stambolian, Dwight; Mackey, David A; Klaver, Caroline C W; Wong, Tien-Yin; Saw, Seang-Mei; Baird, Paul N

    2013-08-01

    Refractive errors are common eye disorders of public health importance worldwide. Ocular axial length (AL) is the major determinant of refraction and thus of myopia and hyperopia. We conducted a meta-analysis of genome-wide association studies for AL, combining 12,531 Europeans and 8,216 Asians. We identified eight genome-wide significant loci for AL (RSPO1, C3orf26, LAMA2, GJD2, ZNRF3, CD55, MIP, and ALPPL2) and confirmed one previously reported AL locus (ZC3H11B). Of the nine loci, five (LAMA2, GJD2, CD55, ALPPL2, and ZC3H11B) were associated with refraction in 18 independent cohorts (n = 23,591). Differential gene expression was observed for these loci in minus-lens-induced myopia mouse experiments and human ocular tissues. Two of the AL genes, RSPO1 and ZNRF3, are involved in Wnt signaling, a pathway playing a major role in the regulation of eyeball size. This study provides evidence of shared genes between AL and refraction, but importantly also suggests that these traits may have unique pathways. PMID:24144296

  10. Variation in copy number of the 28S rDNA of Aspergillus fumigatus measured by droplet digital PCR and analog quantitative real-time PCR.

    PubMed

    Alanio, Alexandre; Sturny-Leclère, Aude; Benabou, Marion; Guigue, Nicolas; Bretagne, Stéphane

    2016-08-01

    Droplet digital PCR (ddPCR) after DNA digestion yielded a 28S rDNA copy number of 61 to 86 copies/genome when testing 10 unrelated Aspergillus fumigatus isolates, higher than with quantitative PCR. Unfortunately, ddPCR after DNA digestion did not improve the sensitivity of our PCR assay when testing serum patients with invasive aspergillosis. PMID:27316653

  11. Chromosomal localization of 45S rDNA, sex-specific C values, and heterochromatin distribution in Coccinia grandis (L.) Voigt.

    PubMed

    Bhowmick, Biplab Kumar; Yamamoto, Masashi; Jha, Sumita

    2016-01-01

    Coccinia grandis is a widely distributed dioecious cucurbit in India, with heteromorphic sex chromosomes and X-Y sex determination mode. The present study aids in the cytogenetic characterization of four native populations of this plant employing distribution patterns of 45S rDNA on chromosomes and guanine-cytosine (GC)-rich heterochromatin in the genome coupled with flow cytometric determination of genome sizes. Existence of four nucleolar chromosomes could be confirmed by the presence of four telomeric 45S rDNA signals in both male and female plants. All four 45S rDNA sites are rich in heterochromatin evident from the co-localization of telomeric chromomycin A (CMA)(+ve) signals. The size of 45S rDNA signal was found to differ between the homologues of one nucleolar chromosome pair. The distribution of heterochromatin is found to differ among the male and female populations. The average GC-rich heterochromatin content of male and female populations is 23.27 and 29.86 %, respectively. Moreover, the male plants have a genome size of 0.92 pg/2C while the female plants have a size of 0.73 pg/2C, reflecting a huge genomic divergence between the genders. The great variation in genome size is owing to the presence of Y chromosome in the male populations, playing a multifaceted role in sexual divergence in C. grandis. PMID:25795278

  12. A duplicated NUCLEOLIN gene with antagonistic activity is required for chromatin organization of silent 45S rDNA in Arabidopsis.

    PubMed

    Durut, Nathalie; Abou-Ellail, Mohamed; Pontvianne, Frédéric; Das, Sadhan; Kojima, Hisae; Ukai, Seiko; de Bures, Anne; Comella, Pascale; Nidelet, Sabine; Rialle, Stéphanie; Merret, Remy; Echeverria, Manuel; Bouvet, Philippe; Nakamura, Kenzo; Sáez-Vásquez, Julio

    2014-03-01

    In plants as well as in animals, hundreds to thousands of 45S rRNA gene copies localize in Nucleolus Organizer Regions (NORs), and the activation or repression of specific sets of rDNA depends on epigenetic mechanisms. Previously, we reported that the Arabidopsis thaliana nucleolin protein NUC1, an abundant and evolutionarily conserved nucleolar protein in eukaryotic organisms, is required for maintaining DNA methylation levels and for controlling the expression of specific rDNA variants in Arabidopsis. Interestingly, in contrast with animal or yeast cells, plants contain a second nucleolin gene. Here, we report that Arabidopsis NUC1 and NUC2 nucleolin genes are both required for plant growth and survival and that NUC2 disruption represses flowering. However, these genes seem to be functionally antagonistic. In contrast with NUC1, disruption of NUC2 induces CG hypermethylation of rDNA and NOR association with the nucleolus. Moreover, NUC2 loss of function triggers major changes in rDNA spatial organization, expression, and transgenerational stability. Our analyses indicate that silencing of specific rRNA genes is mostly determined by the active or repressed state of the NORs and that nucleolin proteins play a key role in the developmental control of this process. PMID:24668745

  13. Introduction of a novel 18S rDNA gene arrangement along with distinct ITS region in the saline water microalga Dunaliella

    PubMed Central

    2010-01-01

    Comparison of 18S rDNA gene sequences is a very promising method for identification and classification of living organisms. Molecular identification and discrimination of different Dunaliella species were carried out based on the size of 18S rDNA gene and, number and position of introns in the gene. Three types of 18S rDNA structure have already been reported: the gene with a size of ~1770 bp lacking any intron, with a size of ~2170 bp consisting one intron near 5' terminus, and with a size of ~2570 bp harbouring two introns near 5' and 3' termini. Hereby, we report a new 18S rDNA gene arrangement in terms of intron localization and nucleotide sequence in a Dunaliella isolated from Iranian salt lakes (ABRIINW-M1/2). PCR amplification with genus-specific primers resulted in production of a ~2170 bp DNA band, which is similar to that of D. salina 18S rDNA gene containing only one intron near 5' terminus. Whilst, sequence composition of the gene revealed the lack of any intron near 5' terminus in our isolate. Furthermore, another alteration was observed due to the presence of a 440 bp DNA fragment near 3' terminus. Accordingly, 18S rDNA gene of the isolate is clearly different from those of D. salina and any other Dunaliella species reported so far. Moreover, analysis of ITS region sequence showed the diversity of this region compared to the previously reported species. 18S rDNA and ITS sequences of our isolate were submitted with accesion numbers of EU678868 and EU927373 in NCBI database, respectively. The optimum growth rate of this isolate occured at the salinity level of 1 M NaCl. The maximum carotenoid content under stress condition of intense light (400 μmol photon m-2 s-1), high salinity (4 M NaCl) and deficiency of nitrate and phosphate nutritions reached to 240 ng/cell after 15 days. PMID:20377865

  14. Positive Selection on Loci Associated with Drug and Alcohol Dependence

    PubMed Central

    Sadler, Brooke; Haller, Gabe; Edenberg, Howard; Tischfield, Jay; Brooks, Andy; Kramer, John; Schuckit, Marc; Nurnberger, John; Goate, Alison

    2015-01-01

    Much of the evolution of human behavior remains a mystery, including how certain disadvantageous behaviors are so prevalent. Nicotine addiction is one such phenotype. Several loci have been implicated in nicotine related phenotypes including the nicotinic receptor gene clusters (CHRNs) on chromosomes 8 and 15. Here we use 1000 Genomes sequence data from 3 populations (Africans, Asians and Europeans) to examine whether natural selection has occurred at these loci. We used Tajima’s D and the integrated haplotype score (iHS) to test for evidence of natural selection. Our results provide evidence for strong selection in the nicotinic receptor gene cluster on chromosome 8, previously found to be significantly associated with both nicotine and cocaine dependence, as well as evidence selection acting on the region containing the CHRNA5 nicotinic receptor gene on chromosome 15, that is genome wide significant for risk for nicotine dependence. To examine the possibility that this selection is related to memory and learning, we utilized genetic data from the Collaborative Studies on the Genetics of Alcoholism (COGA) to test variants within these regions with three tests of memory and learning, the Wechsler Adult Intelligence Scale (WAIS) Block Design, WAIS Digit Symbol and WAIS Information tests. Of the 17 SNPs genotyped in COGA in this region, we find one significantly associated with WAIS digit symbol test results. This test captures aspects of reaction time and memory, suggesting that a phenotype relating to memory and learning may have been the driving force behind selection at these loci. This study could begin to explain why these seemingly deleterious SNPs are present at their current frequencies. PMID:26270548

  15. Blood Pressure Loci Identified with a Gene-Centric Array

    PubMed Central

    Johnson, Toby; Gaunt, Tom R.; Newhouse, Stephen J.; Padmanabhan, Sandosh; Tomaszewski, Maciej; Kumari, Meena; Morris, Richard W.; Tzoulaki, Ioanna; O'Brien, Eoin T.; Poulter, Neil R.; Sever, Peter; Shields, Denis C.; Thom, Simon; Wannamethee, Sasiwarang G.; Whincup, Peter H.; Brown, Morris J.; Connell, John M.; Dobson, Richard J.; Howard, Philip J.; Mein, Charles A.; Onipinla, Abiodun; Shaw-Hawkins, Sue; Zhang, Yun; Smith, George Davey; Day, Ian N.M.; Lawlor, Debbie A.; Goodall, Alison H.; Fowkes, F. Gerald; Abecasis, Gonçalo R.; Elliott, Paul; Gateva, Vesela; Braund, Peter S.; Burton, Paul R.; Nelson, Christopher P.; Tobin, Martin D.; van der Harst, Pim; Glorioso, Nicola; Neuvrith, Hani; Salvi, Erika; Staessen, Jan A.; Stucchi, Andrea; Devos, Nabila; Jeunemaitre, Xavier; Plouin, Pierre-François; Tichet, Jean; Juhanson, Peeter; Org, Elin; Putku, Margus; Sõber, Siim; Veldre, Gudrun; Viigimaa, Margus; Levinsson, Anna; Rosengren, Annika; Thelle, Dag S.; Hastie, Claire E.; Hedner, Thomas; Lee, Wai K.; Melander, Olle; Wahlstrand, Björn; Hardy, Rebecca; Wong, Andrew; Cooper, Jackie A.; Palmen, Jutta; Chen, Li; Stewart, Alexandre F.R.; Wells, George A.; Westra, Harm-Jan; Wolfs, Marcel G.M.; Clarke, Robert; Franzosi, Maria Grazia; Goel, Anuj; Hamsten, Anders; Lathrop, Mark; Peden, John F.; Seedorf, Udo; Watkins, Hugh; Ouwehand, Willem H.; Sambrook, Jennifer; Stephens, Jonathan; Casas, Juan-Pablo; Drenos, Fotios; Holmes, Michael V.; Kivimaki, Mika; Shah, Sonia; Shah, Tina; Talmud, Philippa J.; Whittaker, John; Wallace, Chris; Delles, Christian; Laan, Maris; Kuh, Diana; Humphries, Steve E.; Nyberg, Fredrik; Cusi, Daniele; Roberts, Robert; Newton-Cheh, Christopher; Franke, Lude; Stanton, Alice V.; Dominiczak, Anna F.; Farrall, Martin; Hingorani, Aroon D.; Samani, Nilesh J.; Caulfield, Mark J.; Munroe, Patricia B.

    2011-01-01

    Raised blood pressure (BP) is a major risk factor for cardiovascular disease. Previous studies have identified 47 distinct genetic variants robustly associated with BP, but collectively these explain only a few percent of the heritability for BP phenotypes. To find additional BP loci, we used a bespoke gene-centric array to genotype an independent discovery sample of 25,118 individuals that combined hypertensive case-control and general population samples. We followed up four SNPs associated with BP at our p < 8.56 × 10−7 study-specific significance threshold and six suggestively associated SNPs in a further 59,349 individuals. We identified and replicated a SNP at LSP1/TNNT3, a SNP at MTHFR-NPPB independent (r2 = 0.33) of previous reports, and replicated SNPs at AGT and ATP2B1 reported previously. An analysis of combined discovery and follow-up data identified SNPs significantly associated with BP at p < 8.56 × 10−7 at four further loci (NPR3, HFE, NOS3, and SOX6). The high number of discoveries made with modest genotyping effort can be attributed to using a large-scale yet targeted genotyping array and to the development of a weighting scheme that maximized power when meta-analyzing results from samples ascertained with extreme phenotypes, in combination with results from nonascertained or population samples. Chromatin immunoprecipitation and transcript expression data highlight potential gene regulatory mechanisms at the MTHFR and NOS3 loci. These results provide candidates for further study to help dissect mechanisms affecting BP and highlight the utility of studying SNPs and samples that are independent of those studied previously even when the sample size is smaller than that in previous studies. PMID:22100073

  16. Blood pressure loci identified with a gene-centric array.

    PubMed

    Johnson, Toby; Gaunt, Tom R; Newhouse, Stephen J; Padmanabhan, Sandosh; Tomaszewski, Maciej; Kumari, Meena; Morris, Richard W; Tzoulaki, Ioanna; O'Brien, Eoin T; Poulter, Neil R; Sever, Peter; Shields, Denis C; Thom, Simon; Wannamethee, Sasiwarang G; Whincup, Peter H; Brown, Morris J; Connell, John M; Dobson, Richard J; Howard, Philip J; Mein, Charles A; Onipinla, Abiodun; Shaw-Hawkins, Sue; Zhang, Yun; Davey Smith, George; Day, Ian N M; Lawlor, Debbie A; Goodall, Alison H; Fowkes, F Gerald; Abecasis, Gonçalo R; Elliott, Paul; Gateva, Vesela; Braund, Peter S; Burton, Paul R; Nelson, Christopher P; Tobin, Martin D; van der Harst, Pim; Glorioso, Nicola; Neuvrith, Hani; Salvi, Erika; Staessen, Jan A; Stucchi, Andrea; Devos, Nabila; Jeunemaitre, Xavier; Plouin, Pierre-François; Tichet, Jean; Juhanson, Peeter; Org, Elin; Putku, Margus; Sõber, Siim; Veldre, Gudrun; Viigimaa, Margus; Levinsson, Anna; Rosengren, Annika; Thelle, Dag S; Hastie, Claire E; Hedner, Thomas; Lee, Wai K; Melander, Olle; Wahlstrand, Björn; Hardy, Rebecca; Wong, Andrew; Cooper, Jackie A; Palmen, Jutta; Chen, Li; Stewart, Alexandre F R; Wells, George A; Westra, Harm-Jan; Wolfs, Marcel G M; Clarke, Robert; Franzosi, Maria Grazia; Goel, Anuj; Hamsten, Anders; Lathrop, Mark; Peden, John F; Seedorf, Udo; Watkins, Hugh; Ouwehand, Willem H; Sambrook, Jennifer; Stephens, Jonathan; Casas, Juan-Pablo; Drenos, Fotios; Holmes, Michael V; Kivimaki, Mika; Shah, Sonia; Shah, Tina; Talmud, Philippa J; Whittaker, John; Wallace, Chris; Delles, Christian; Laan, Maris; Kuh, Diana; Humphries, Steve E; Nyberg, Fredrik; Cusi, Daniele; Roberts, Robert; Newton-Cheh, Christopher; Franke, Lude; Stanton, Alice V; Dominiczak, Anna F; Farrall, Martin; Hingorani, Aroon D; Samani, Nilesh J; Caulfield, Mark J; Munroe, Patricia B

    2011-12-01

    Raised blood pressure (BP) is a major risk factor for cardiovascular disease. Previous studies have identified 47 distinct genetic variants robustly associated with BP, but collectively these explain only a few percent of the heritability for BP phenotypes. To find additional BP loci, we used a bespoke gene-centric array to genotype an independent discovery sample of 25,118 individuals that combined hypertensive case-control and general population samples. We followed up four SNPs associated with BP at our p < 8.56 × 10(-7) study-specific significance threshold and six suggestively associated SNPs in a further 59,349 individuals. We identified and replicated a SNP at LSP1/TNNT3, a SNP at MTHFR-NPPB independent (r(2) = 0.33) of previous reports, and replicated SNPs at AGT and ATP2B1 reported previously. An analysis of combined discovery and follow-up data identified SNPs significantly associated with BP at p < 8.56 × 10(-7) at four further loci (NPR3, HFE, NOS3, and SOX6). The high number of discoveries made with modest genotyping effort can be attributed to using a large-scale yet targeted genotyping array and to the development of a weighting scheme that maximized power when meta-analyzing results from samples ascertained with extreme phenotypes, in combination with results from nonascertained or population samples. Chromatin immunoprecipitation and transcript expression data highlight potential gene regulatory mechanisms at the MTHFR and NOS3 loci. These results provide candidates for further study to help dissect mechanisms affecting BP and highlight the utility of studying SNPs and samples that are independent of those studied previously even when the sample size is smaller than that in previous studies. PMID:22100073

  17. Positive Selection on Loci Associated with Drug and Alcohol Dependence.

    PubMed

    Sadler, Brooke; Haller, Gabe; Edenberg, Howard; Tischfield, Jay; Brooks, Andy; Kramer, John; Schuckit, Marc; Nurnberger, John; Goate, Alison

    2015-01-01

    Much of the evolution of human behavior remains a mystery, including how certain disadvantageous behaviors are so prevalent. Nicotine addiction is one such phenotype. Several loci have been implicated in nicotine related phenotypes including the nicotinic receptor gene clusters (CHRNs) on chromosomes 8 and 15. Here we use 1000 Genomes sequence data from 3 populations (Africans, Asians and Europeans) to examine whether natural selection has occurred at these loci. We used Tajima's D and the integrated haplotype score (iHS) to test for evidence of natural selection. Our results provide evidence for strong selection in the nicotinic receptor gene cluster on chromosome 8, previously found to be significantly associated with both nicotine and cocaine dependence, as well as evidence selection acting on the region containing the CHRNA5 nicotinic receptor gene on chromosome 15, that is genome wide significant for risk for nicotine dependence. To examine the possibility that this selection is related to memory and learning, we utilized genetic data from the Collaborative Studies on the Genetics of Alcoholism (COGA) to test variants within these regions with three tests of memory and learning, the Wechsler Adult Intelligence Scale (WAIS) Block Design, WAIS Digit Symbol and WAIS Information tests. Of the 17 SNPs genotyped in COGA in this region, we find one significantly associated with WAIS digit symbol test results. This test captures aspects of reaction time and memory, suggesting that a phenotype relating to memory and learning may have been the driving force behind selection at these loci. This study could begin to explain why these seemingly deleterious SNPs are present at their current frequencies. PMID:26270548

  18. Phenotypic associations of genetic susceptibility loci in systemic lupus erythematosus

    PubMed Central

    Sanchez, Elena; Nadig, Ajay; Richardson, Bruce C; Freedman, Barry I; Kaufman, Kenneth M; Kelly, Jennifer A; Niewold, Timothy B; Kamen, Diane L; Gilkeson, Gary S; Ziegler, Julie T; Langefeld, Carl D; Alarcón, Graciela S; Edberg, Jeffrey C; Ramsey-Goldman, Rosalind; Petri, Michelle; Brown, Elizabeth E; Kimberly, Robert P; Reveille, John D; Vilá, Luis M; Merrill, Joan T; Anaya, Juan-Manuel; James, Judith A; Pons-Estel, Bernardo A; Martin, Javier; Park, So-Yeon; Bang, So-Young; Bae, Sang-Cheol; Moser, Kathy L; Vyse, Timothy J; Criswell, Lindsey A; Gaffney, Patrick M; Tsao, Betty P; Jacob, Chaim O; Harley, John B; Alarcón-Riquelme, Marta E; Sawalha, Amr H

    2011-01-01

    Objective Systemic lupus erythematosus is a clinically heterogeneous autoimmune disease. A number of genetic loci that increase lupus susceptibility have been established. This study examines if these genetic loci also contribute to the clinical heterogeneity in lupus. Materials and methods 4001 European-derived, 1547 Hispanic, 1590 African-American and 1191 Asian lupus patients were genotyped for 16 confirmed lupus susceptibility loci. Ancestry informative markers were genotyped to calculate and adjust for admixture. The association between the risk allele in each locus was determined and compared in patients with and without the various clinical manifestations included in the ACR criteria. Results Renal disorder was significantly correlated with the lupus risk allele in ITGAM (p=5.0×10−6, OR 1.25, 95% CI 1.12 to 1.35) and in TNFSF4 (p=0.0013, OR 1.14, 95% CI 1.07 to 1.25). Other significant findings include the association between risk alleles in FCGR2A and malar rash (p=0.0031, OR 1.11, 95% CI 1.17 to 1.33), ITGAM and discoid rash (p=0.0020, OR 1.20, 95% CI 1.06 to 1.33), STAT4 and protection from oral ulcers (p=0.0027, OR 0.89, 95% CI 0.83 to 0.96) and IL21 and haematological disorder (p=0.0027, OR 1.13, 95% CI 1.04 to 1.22). All these associations are significant with a false discovery rate of <0.05 and pass the significance threshold using Bonferroni correction for multiple testing. Conclusion Significant associations were found between lupus clinical manifestations and the FCGR2A, ITGAM, STAT4, TNSF4 and IL21 genes. The findings suggest that genetic profiling might be a useful tool to predict disease manifestations in lupus patients in the future. PMID:21719445

  19. Study of Toll-like receptor gene loci in sarcoidosis

    PubMed Central

    Schürmann, M; Kwiatkowski, R; Albrecht, M; Fischer, A; Hampe, J; Müller-Quernheim, J; Schwinger, E; Schreiber, S

    2008-01-01

    Sarcoidosis is a multi-factorial systemic disease of granulomatous inflammation. Current concepts of the aetiology include interactions of unknown environmental triggers with an inherited susceptibility. Toll-like receptors (TLRs) are main components of innate immunity and therefore TLR genes are candidate susceptibility genes in sarcoidosis. Ten members of the human TLR gene family have been identified and mapped to seven chromosomal segments. The aim of this study was to investigate all known TLR gene loci for genetic linkage with sarcoidosis and to follow positive signals with different methods. We analysed linkage of TLR gene loci to sarcoidosis by use of closely flanking microsatellite markers in 83 families with 180 affected siblings. We found significant linkage between sarcoidosis and markers of the TLR4 gene locus on chromosome 9q (non-parametric linkage score 2·63, P = 0·0043). No linkage was found for the remaining TLR gene loci. We subsequently genotyped 1203 sarcoidosis patients from 997 families, 1084 relatives and 537 control subjects for four single nucleotide polymorphisms of TLR4, including Asp299Gly and Thr399Ile. This genotype data set was studied by case–control comparisons and transmission disequilibrium tests, but showed no significant results. In summary, TLR4 − w ith significant genetic linkage results − appears to be the most promising member of the TLR gene family for further investigation in sarcoidosis. However, our results do not confirm the TLR4 polymorphisms Asp299Gly and Thr399Ile as susceptibility markers. Our results rather point to another as yet unidentified variant within or close to TLR4 that might confer susceptibility to sarcoidosis. PMID:18422738

  20. Mapping autism risk loci using genetic linkage and chromosomal rearrangements

    PubMed Central

    Szatmari, Peter; Paterson, Andrew; Zwaigenbaum, Lonnie; Roberts, Wendy; Brian, Jessica; Liu, Xiao-Qing; Vincent, John; Skaug, Jennifer; Thompson, Ann; Senman, Lili; Feuk, Lars; Qian, Cheng; Bryson, Susan; Jones, Marshall; Marshall, Christian; Scherer, Stephen; Vieland, Veronica; Bartlett, Christopher; Mangin, La Vonne; Goedken, Rhinda; Segre, Alberto; Pericak-Vance, Margaret; Cuccaro, Michael; Gilbert, John; Wright, Harry; Abramson, Ruth; Betancur, Catalina; Bourgeron, Thomas; Gillberg, Christopher; Leboyer, Marion; Buxbaum, Joseph; Davis, Kenneth; Hollander, Eric; Silverman, Jeremy; Hallmayer, Joachim; Lotspeich, Linda; Sutcliffe, James; Haines, Jonathan; Folstein, Susan; Piven, Joseph; Wassink, Thomas; Sheffield, Val; Geschwind, Daniel; Bucan, Maja; Brown, Ted; Cantor, Rita; Constantino, John; Gilliam, Conrad; Herbert, Martha; Lajonchere, Clara; Ledbetter, David; Lese-Martin, Christa; Miller, Janet; Nelson, Stan; Samango-Sprouse, Carol; Spence, Sarah; State, Matthew; Tanzi, Rudolph; Coon, Hilary; Dawson, Geraldine; Devlin, Bernie; Estes, Annette; Flodman, Pamela; Klei, Lambertus; Mcmahon, William; Minshew, Nancy; Munson, Jeff; Korvatska, Elena; Rodier, Patricia; Schellenberg, Gerard; Smith, Moyra; Spence, Anne; Stodgell, Chris; Tepper, Ping Guo; Wijsman, Ellen; Yu, Chang-En; Rogé, Bernadette; Mantoulan, Carine; Wittemeyer, Kerstin; Poustka, Annemarie; Felder, Bärbel; Klauck, Sabine; Schuster, Claudia; Poustka, Fritz; Bölte, Sven; Feineis-Matthews, Sabine; Herbrecht, Evelyn; Schmötzer, Gabi; Tsiantis, John; Papanikolaou, Katerina; Maestrini, Elena; Bacchelli, Elena; Blasi, Francesca; Carone, Simona; Toma, Claudio; Van Engeland, Herman; De Jonge, Maretha; Kemner, Chantal; Koop, Frederieke; Langemeijer, Marjolein; Hijmans, Channa; Staal, Wouter; Baird, Gillian; Bolton, Patrick; Rutter, Michael; Weisblatt, Emma; Green, Jonathan; Aldred, Catherine; Wilkinson, Julie-Anne; Pickles, Andrew; Le Couteur, Ann; Berney, Tom; Mcconachie, Helen; Bailey, Anthony; Francis, Kostas; Honeyman, Gemma; Hutchinson, Aislinn; Parr, Jeremy; Wallace, Simon; Monaco, Anthony; Barnby, Gabrielle; Kobayashi, Kazuhiro; Lamb, Janine; Sousa, Ines; Sykes, Nuala; Cook, Edwin; Guter, Stephen; Leventhal, Bennett; Salt, Jeff; Lord, Catherine; Corsello, Christina; Hus, Vanessa; Weeks, Daniel; Volkmar, Fred; Tauber, Maïté; Fombonne, Eric; Shih, Andy; Meyer, Kacie

    2007-01-01

    Autism spectrum disorders (ASD) are common, heritable neurodevelopmental conditions. The genetic architecture of ASD is complex, requiring large samples to overcome heterogeneity. Here we broaden coverage and sample size relative to other studies of ASD by using Affymetrix 10K single nucleotide polymorphism (SNP) arrays and 1168 families with ≥ 2 affected individuals to perform the largest linkage scan to date, while also analyzing copy number variation (CNV) in these families. Linkage and CNV analyses implicate chromosome 11p12-p13 and neurexins, respectively, amongst other candidate loci. Neurexins team with previously-implicated neuroligins for glutamatergic synaptogenesis, highlighting glutamate-related genes as promising candidates for ASD. PMID:17322880

  1. Thirteen nuclear microsatellite loci for butternut (Juglans cinerea L.).

    PubMed

    Hoban, Sean; Anderson, Robert; McCleary, Tim; Schlarbaum, Scott; Romero-Severson, Jeanne

    2008-05-01

    Butternut (Juglans cinerea L.) is an eastern North American forest tree severely threatened by an exotic fungal pathogen, Sirococcus clavigignenti-juglandacearum. We report here 13 nuclear microsatellites for genetic evaluation of the remaining natural populations. Summary statistics are reported for individuals from a population of butternuts in central Kentucky (N = 63). All markers were polymorphic, with an average of 13.7 alleles per locus observed. Four loci exhibited significantly fewer heterozygotes than expected under Hardy-Weinberg equilibrium (P < 0.05). PMID:21585858

  2. Alpha-globin loci in homozygous beta-thalassemia intermedia.

    PubMed

    Triadou, P; Lapoumeroulie, C; Girot, R; Labie, D

    1983-01-01

    Homozygous beta-thalassemia intermediate (TI) differs from thalassemia major (TM) in being less severe clinically. Associated alpha-thalassemia could account for the TI phenotype by reducing the alpha/non-alpha chain imbalance. We have analyzed the alpha loci of 9 TI and 11 TM patients by restriction endonuclease mapping. All the TM and 7 of the TI patients have the normal complement of four alpha-globin genes (alpha alpha/alpha alpha). One TI patient has three alpha-globin genes (alpha alpha/-alpha), and another TI patient has five alpha genes (alpha alpha/alpha alpha alpha). PMID:6305827

  3. Nine microsatellite loci developed from the octocoral, Paragorgia arborea

    USGS Publications Warehouse

    Coykendall, Dolly K.; Morrison, Cheryl L.

    2015-01-01

    Paragorgia arborea, or bubblegum coral, occurs in continental slope habitats worldwide, which are increasingly threatened by human activities such as energy development and fisheries practices. From 101 putative loci screened, nine microsatellite markers were developed from samples taken from Baltimore canyon in the western North Atlantic Ocean. The number of alleles ranged from two to thirteen per locus and each displayed equilibrium. These nuclear resources will help further research on population connectivity in threatened coral species where mitochondrial markers are known to lack fine-scale genetic diversity.

  4. High-throughput identification of informative nuclear loci for shallow-scale phylogenetics and phylogeography.

    PubMed

    Lemmon, Alan R; Lemmon, Emily Moriarty

    2012-10-01

    One of the major challenges for researchers studying phylogeography and shallow-scale phylogenetics is the identification of highly variable and informative nuclear loci for the question of interest. Previous approaches to locus identification have generally required extensive testing of anonymous nuclear loci developed from genomic libraries of the target taxon, testing of loci of unknown utility from other systems, or identification of loci from the nearest model organism with genomic resources. Here, we present a fast and economical approach to generating thousands of variable, single-copy nuclear loci for any system using next-generation sequencing. We performed Illumina paired-end sequencing of three reduced-representation libraries (RRLs) in chorus frogs (Pseudacris) to identify orthologous, single-copy loci across libraries and to estimate sequence divergence at multiple taxonomic levels. We also conducted PCR testing of these loci across the genus Pseudacris and outgroups to determine whether loci developed for phylogeography can be extended to deeper phylogenetic levels. Prior to sequencing, we conducted in silico digestion of the most closely related reference genome (Xenopus tropicalis) to generate expectations for the number of loci and degree of coverage for a particular experimental design. Using the RRL approach, we: (i) identified more than 100,000 single-copy nuclear loci, 6339 of which were obtained for divergent conspecifics and 904 of which were obtained for heterospecifics; (ii) estimated average nuclear sequence divergence at 0.1% between alleles within an individual, 1.1% between conspecific individuals that represent two different clades, and 1.8% between species; and (iii) determined from PCR testing that 53% of the loci successfully amplify within-species and also many amplify to the genus-level and deeper in the phylogeny (16%). Our study effectively identified nuclear loci present in the genome that have levels of sequence divergence on

  5. Developing criteria and data to determine best options for expanding the core CODIS loci

    PubMed Central

    2012-01-01

    Background Recently, the Combined DNA Index System (CODIS) Core Loci Working Group established by the US Federal Bureau of Investigation (FBI) reviewed and recommended changes to the CODIS core loci. The Working Group identified 20 short tandem repeat (STR) loci (composed of the original CODIS core set loci (minus TPOX), four European recommended loci, PentaE, and DYS391) plus the Amelogenin marker as the new core set. Before selecting and finalizing the core loci, some evaluations are needed to provide guidance for the best options of core selection. Method The performance of current and newly proposed CODIS core loci sets were evaluated with simplified analyses for adventitious hit rates in reasonably large datasets under single-source profile comparisons, mixture comparisons and kinship searches, and for international data sharing. Informativeness (for example, match probability, average kinship index (AKI)) and mutation rates of each locus were some of the criteria to consider for loci selection. However, the primary factor was performance with challenged forensic samples. Results The current battery of loci provided in already validated commercial kits meet the needs for single-source profile comparisons and international data sharing, even with relatively large databases. However, the 13 CODIS core loci are not sufficiently powerful for kinship analyses and searching potential contributors of mixtures in larger databases; 19 or more autosomal STR loci perform better. Y-chromosome STR (Y-STR) loci are very useful to trace paternal lineage, deconvolve female and male mixtures, and resolve inconsistencies with Amelogenin typing. The DYS391 locus is of little theoretical or practical use. Combining five or six Y-chromosome STR loci with existing autosomal STR loci can produce better performance than the same number of autosomal loci for kinship analysis and still yield a sufficiently low match probability for single-source profile comparisons. Conclusion A more

  6. Application of PRECEDE-PROCEED model to tackle problems identified with diarrhoea burden among under-5s in Botswana.

    PubMed

    Popoola, Tosin; Mchunu, Gugu

    2015-05-01

    Diarrhoea has been identified as the second leading cause of mortality among under-5s and also claims more life than HIV, measles and malaria combined together in the same category of population. This article is a combination of literature review and personal experience of lessons learnt from past diarrhoea outbreaks in Botswana that caused significant rate of mortality among under-5s. The paper used literature review to identify contributory factors to diarrhoea burden among under-5s in Botswana and applied a community health nursing framework (PRECEDE-PROCEED) to tackle the problems identified. The study revealed that Botswana mothers are lacking in knowledge related to exclusive breastfeeding, prevention and treatment of diarrhoea disease. The paper recommends that health-care workers in Botswana be sensitized on current diarrhoea management to tailor their health education methods appropriately. PMID:26125574

  7. Xenopus transcription factor IIIA binds primarily at junctions between double helical stems and internal loops in oocyte 5S RNA.

    PubMed Central

    Christiansen, J; Brown, R S; Sproat, B S; Garrett, R A

    1987-01-01

    RNases and chemical probes were used to study the accessibility of each nucleotide of 5S RNA in the native and reconstituted 7S particle from Xenopus laevis oocytes. RNase or chemically treated 5S RNA from intact 7S particles was isolated and analysed using an oligodeoxynucleotide primer and reverse transcriptase. The results were superimposed on a cylindrical projection of an RNA double helix and the protection effects were shown to cluster at two regions on the molecular surface. A three-dimensional model is proposed for the 7S particle in which protein-RNA contacts occur mainly in the major groove of 5S RNA. Images Fig. 1. Fig. 2. PMID:3582366

  8. Transsacral transdiscal L5-S1 screws for the management of high-grade spondylolisthesis in an adolescent.

    PubMed

    Palejwala, Ali; Fridley, Jared; Jea, Andrew

    2016-06-01

    The surgical management of high-grade spondylolisthesis in adolescents remains a controversial issue. Because the basic procedure, posterolateral fusion, is associated with a significant rate of pseudarthrosis and listhesis progression, there is a pressing need for alternative surgical techniques. In the present report, the authors describe the case of an adolescent patient with significant low-back pain who was found to have Grade IV spondylolisthesis at L5-S1 that was treated with transsacral transdiscal screw fixation. Bilateral pedicle screws were placed starting from the top of the S-1 pedicle, across the L5-S1 intervertebral disc space, and into the L-5 body. At 14 months after surgery, the patient had considerable improvement in his pain and radiographic fusion across L5-S1. The authors conclude that transsacral transdiscal pedicle screws may serve as an efficacious and safe option for the correction of high-grade spondylolisthesis in adolescent patients. PMID:26894520

  9. Dissociative excitation of the N(+)(5S) state by electron impact on N2 - Excitation function and quenching

    NASA Technical Reports Server (NTRS)

    Erdman, P. W.; Zipf, E. C.

    1986-01-01

    Metastable N(+)(5S) ions were produced in the laboratory by dissociative excitation of N2 with energetic electrons. The resulting radiative decay of the N(+)(5S) state was observed with sufficient resolution to completely resolve the doublet from the nearby N2 molecular radiation. The excitation function was measured from threshold to 500 eV. The cross section peaks at a high electron energy and also exhibits a high threshold energy both of which are typical of dissociative excitation-ionization processes. This finding complicates the explanation of electron impact on N2 as the mechanism for the source of the 2145 A 'auroral mystery feature' by further increasing the required peak cross section. It is suggested that the apparent N(+)(5S) quenching in auroras may be an artifact due to the softening of the electron energy spectrum in the auroral E region.

  10. Domain rearrangement of SRP protein Ffh upon binding 4.5S RNA and the SRP receptor FtsY

    PubMed Central

    BUSKIEWICZ, IWONA; KUBARENKO, ANDRIY; PESKE, FRANK; RODNINA, MARINA V.; WINTERMEYER, WOLFGANG

    2005-01-01

    The signal recognition particle (SRP) mediates membrane targeting of translating ribosomes displaying a signal-anchor sequence. In Escherichia coli, SRP consists of 4.5S RNA and a protein, Ffh, that recognizes the signal peptide emerging from the ribosome and the SRP receptor at the membrane, FtsY. In the present work, we studied the interactions between the NG and M domains in Ffh and their rearrangements upon complex formation with 4.5S RNA and/or FtsY. In free Ffh, the NG and M domains are facing one another in an orientation that allows cross-linking between positions 231 in the G domain and 377 in the M domain. There are binding interactions between the two domains, as the isolated domains form a strong complex. The interdomain contacts are disrupted upon binding of Ffh to 4.5S RNA, consuming a part of the total binding energy of 4.5S RNA-Ffh association that is roughly equivalent to the free energy of domain binding to each other. In the SRP particle, the NG domain binds to 4.5S RNA in a region adjacent to the binding site of the M domain. Ffh binding to FtsY also requires a reorientation of NG and M domains. These results suggest that in free Ffh, the binding sites for 4.5S RNA and FtsY are occluded by strong domain–domain interactions which must be disrupted for the formation of SRP or the Ffh-FtsY complex. PMID:15923378

  11. Domain rearrangement of SRP protein Ffh upon binding 4.5S RNA and the SRP receptor FtsY.

    PubMed

    Buskiewicz, Iwona; Kubarenko, Andriy; Peske, Frank; Rodnina, Marina V; Wintermeyer, Wolfgang

    2005-06-01

    The signal recognition particle (SRP) mediates membrane targeting of translating ribosomes displaying a signal-anchor sequence. In Escherichia coli, SRP consists of 4.5S RNA and a protein, Ffh, that recognizes the signal peptide emerging from the ribosome and the SRP receptor at the membrane, FtsY. In the present work, we studied the interactions between the NG and M domains in Ffh and their rearrangements upon complex formation with 4.5S RNA and/or FtsY. In free Ffh, the NG and M domains are facing one another in an orientation that allows cross-linking between positions 231 in the G domain and 377 in the M domain. There are binding interactions between the two domains, as the isolated domains form a strong complex. The interdomain contacts are disrupted upon binding of Ffh to 4.5S RNA, consuming a part of the total binding energy of 4.5S RNA-Ffh association that is roughly equivalent to the free energy of domain binding to each other. In the SRP particle, the NG domain binds to 4.5S RNA in a region adjacent to the binding site of the M domain. Ffh binding to FtsY also requires a reorientation of NG and M domains. These results suggest that in free Ffh, the binding sites for 4.5S RNA and FtsY are occluded by strong domain-domain interactions which must be disrupted for the formation of SRP or the Ffh-FtsY complex. PMID:15923378

  12. 5S Clavam Biosynthesis Is Controlled by an Atypical Two-Component Regulatory System in Streptomyces clavuligerus

    PubMed Central

    Kwong, Thomas; Zelyas, Nathan J.; Cai, Hui; Tahlan, Kapil; Wong, Annie

    2012-01-01

    Streptomyces clavuligerus produces a collection of five clavam metabolites, including the clinically important β-lactamase inhibitor clavulanic acid, as well as four structurally related metabolites called 5S clavams. The paralogue gene cluster of S. clavuligerus is one of three clusters of genes for the production of these clavam metabolites. A region downstream of the cluster was analyzed, and snk, res1, and res2, encoding elements of an atypical two-component regulatory system, were located. Mutation of any one of the three genes had no effect on clavulanic acid production, but snk and res2 mutants produced no 5S clavams, whereas res1 mutants overproduced 5S clavams. Reverse transcriptase PCR analyses showed that transcription of cvm7p (which encodes a transcriptional activator of 5S clavam biosynthesis) and 5S clavam biosynthetic genes was eliminated in snk and in res2 mutants but that snk and res2 transcription was unaffected in a cvm7p mutant. Both snk and res2 mutants could be complemented by introduction of cvm7p under the control of an independently regulated promoter. In vitro assays showed that Snk can autophosphorylate and transfer its phosphate group to both Res1 and Res2, and Snk-H365, Res1-D52, and Res2-D52 were identified as the phosphorylation sites for the system. Dephosphorylation assays indicated that Res1 stimulates dephosphorylation of Res2∼P. These results suggest a regulatory cascade in which Snk and Res2 form a two-component system controlling cvm7p transcription, with Res1 serving as a checkpoint to modulate phosphorylation levels. Cvm7P then activates transcription of 5S clavam biosynthetic genes. PMID:22751548

  13. Characterization of 19 microsatellite loci in the clonal monkshood Aconitum kusnezoffii (Ranunculaceae)1

    PubMed Central

    Ge, Xing-Yue; Tian, Hao; Liao, Wan-Jin

    2016-01-01

    Premise of the study: Microsatellite loci were isolated and characterized from Aconitum kusnezoffii (Ranunculaceae) to estimate male and female reproductive success and evaluate the effects of clonal growth on sexual reproduction. Methods and Results: A genomic enrichment approach was used to develop microsatellite markers. In three investigated A. kusnezoffii populations, a total of 19 microsatellite loci were successfully amplified, and 13 of these loci were polymorphic. Most of the primer pairs designed for the identified loci also amplified corresponding microsatellite loci in A. barbatum var. puberulum and A. alboviolaceum. Conclusions: The identified microsatellite loci will be useful for quantifying male and female fitness in A. kusnezoffii and evaluating the effects of clonal growth on sexual reproduction. PMID:27347450

  14. Discovery of six new susceptibility loci and analysis of pleiotropic effects in leprosy.

    PubMed

    Liu, Hong; Irwanto, Astrid; Fu, Xi'an; Yu, Gongqi; Yu, Yongxiang; Sun, Yonghu; Wang, Chuan; Wang, Zhenzhen; Okada, Yukinori; Low, Huiqi; Li, Yi; Liany, Herty; Chen, Mingfei; Bao, Fangfang; Li, Jinghui; You, Jiabao; Zhang, Qilin; Liu, Jian; Chu, Tongsheng; Andiappan, Anand Kumar; Wang, Na; Niu, Guiye; Liu, Dianchang; Yu, Xiulu; Zhang, Lin; Tian, Hongqing; Zhou, Guizhi; Rotzschke, Olaf; Chen, Shumin; Zhang, Xuejun; Liu, Jianjun; Zhang, Furen

    2015-03-01

    Genome-wide association studies (GWAS) have led to the discovery of several susceptibility loci for leprosy with robust evidence, providing biological insight into the role of host genetic factors in mycobacterial infection. However, the identified loci only partially explain disease heritability, and additional genetic risk factors remain to be discovered. We performed a 3-stage GWAS of leprosy in the Chinese population using 8,313 cases and 16,017 controls. Besides confirming all previously published loci, we discovered six new susceptibility loci, and further gene prioritization analysis of these loci implicated BATF3, CCDC88B and CIITA-SOCS1 as new susceptibility genes for leprosy. A systematic evaluation of pleiotropic effects demonstrated a high tendency for leprosy susceptibility loci to show association with autoimmunity and inflammatory diseases. Further analysis suggests that molecular sensing of infection might have a similar pathogenic role across these diseases, whereas immune responses have discordant roles in infectious and inflammatory diseases. PMID:25642632

  15. Discovery and validation of sub-threshold genome-wide association study loci using epigenomic signatures.

    PubMed

    Wang, Xinchen; Tucker, Nathan R; Rizki, Gizem; Mills, Robert; Krijger, Peter Hl; de Wit, Elzo; Subramanian, Vidya; Bartell, Eric; Nguyen, Xinh-Xinh; Ye, Jiangchuan; Leyton-Mange, Jordan; Dolmatova, Elena V; van der Harst, Pim; de Laat, Wouter; Ellinor, Patrick T; Newton-Cheh, Christopher; Milan, David J; Kellis, Manolis; Boyer, Laurie A

    2016-01-01

    Genetic variants identified by genome-wide association studies explain only a modest proportion of heritability, suggesting that meaningful associations lie 'hidden' below current thresholds. Here, we integrate information from association studies with epigenomic maps to demonstrate that enhancers significantly overlap known loci associated with the cardiac QT interval and QRS duration. We apply functional criteria to identify loci associated with QT interval that do not meet genome-wide significance and are missed by existing studies. We demonstrate that these 'sub-threshold' signals represent novel loci, and that epigenomic maps are effective at discriminating true biological signals from noise. We experimentally validate the molecular, gene-regulatory, cellular and organismal phenotypes of these sub-threshold loci, demonstrating that most sub-threshold loci have regulatory consequences and that genetic perturbation of nearby genes causes cardiac phenotypes in mouse. Our work provides a general approach for improving the detection of novel loci associated with complex human traits. PMID:27162171

  16. Comparative structural analysis of eubacterial 5S rRNA by oxidation of adenines in the N-1 position.

    PubMed Central

    Pieler, T; Schreiber, A; Erdmann, V A

    1984-01-01

    Adenines in free 5S rRNA from Escherichia coli, Bacillus stearothermophilus and Thermus thermophilus have been oxidized at their N-1 position using monoperphthalic acid. The determination of the number of adenine 1-N-oxides was on the basis of UV spectroscopic data of the intact molecule. Identification of the most readily accessible nucleotides by sequencing gel analysis reveals that they are located in conserved positions within loops, exposed hairpin loops and single-base bulge loops. Implications for the structure and function of 5S rRNA will be discussed on the basis of this comparative analysis. Images PMID:6201825

  17. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    PubMed

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families. PMID:25315165

  18. Expression of a chimeric human/salmon calcitonin gene integrated into the Saccharomyces cerevisiae genome using rDNA sequences as recombination sites.

    PubMed

    Sun, Hengyi; Zang, Xiaonan; Liu, Yuantao; Cao, Xiaofei; Wu, Fei; Huang, Xiaoyun; Jiang, Minjie; Zhang, Xuecheng

    2015-12-01

    Calcitonin participates in controlling homeostasis of calcium and phosphorus and plays an important role in bone metabolism. The aim of this study was to endow an industrial strain of Saccharomyces cerevisiae with the ability to express chimeric human/salmon calcitonin (hsCT) without the use of antibiotics. To do so, a homologous recombination plasmid pUC18-rDNA2-ura3-P pgk -5hsCT-rDNA1 was constructed, which contains two segments of ribosomal DNA of 1.1 kb (rDNA1) and 1.4 kb (rDNA2), to integrate the heterologous gene into host rDNA. A DNA fragment containing five copies of a chimeric human/salmon calcitonin gene (5hsCT) under the control of the promoter for phosphoglycerate kinase (P pgk ) was constructed to express 5hsCT in S. cerevisiae using ura3 as a selectable auxotrophic marker gene. After digestion by restriction endonuclease HpaI, a linear fragment, rDNA2-ura3-P pgk -5hsCT-rDNA1, was obtained and transformed into the △ura3 mutant of S. cerevisiae by the lithium acetate method. The ura3-P pgk -5hsCT sequence was introduced into the genome at rDNA sites by homologous recombination, and the recombinant strain YS-5hsCT was obtained. Southern blot analysis revealed that the 5hsCT had been integrated successfully into the genome of S. cerevisiae. The results of Western blot and ELISA confirmed that the 5hsCT protein had been expressed in the recombinant strain YS-5hsCT. The expression level reached 2.04 % of total proteins. S. cerevisiae YS-5hsCT decreased serum calcium in mice by oral administration and even 0.01 g lyophilized S. cerevisiae YS-5hsCT/kg decreased serum calcium by 0.498 mM. This work has produced a commercial yeast strain potentially useful for the treatment of osteoporosis. PMID:26254786

  19. Genetics analysis of 38 STR loci in Uygur population from Southern Xinjiang of China.

    PubMed

    Yuan, Li; Liu, Haibo; Liao, Qinxiang; Xu, Xu; Chen, Wen; Hao, Shicheng

    2016-05-01

    The allele frequencies and statistical parameters of 38 autosomal short tandem repeat (STR) loci were analyzed in the Uygur population from Southern Xinjiang of China with 290 unrelated individuals. The results show these 38 STR loci have high or medium power of discrimination and probabilities of exclusion. All loci are in Hardy-Weinberg equilibrium. The genetic distances between the Uygur population and other Chinese populations were also estimated. PMID:26438047

  20. Lineage analysis by microsatellite loci deep sequencing in mice.

    PubMed

    Luo, Tao; He, Xionglei; Xing, Ke

    2016-05-01

    Lineage analysis is the identification of all the progeny of a single progenitor cell, and has become particularly useful for studying developmental processes and cancer biology. Here, we propose a novel and effective method for lineage analysis that combines sequence capture and next-generation sequencing technology. Genome-wide mononucleotide and dinucleotide microsatellite loci in eight samples from two mice were identified and used to construct phylogenetic trees based on somatic indel mutations at these loci, which were unique enough to distinguish and parse samples from different mice into different groups along the lineage tree. For example, biopsies from the liver and stomach, which originate from the endoderm, were located in the same clade, while samples in kidney, which originate from the mesoderm, were located in another clade. Yet, tissue with a common developmental origin may still contain cells of a mixed ancestry. This genome-wide approach thus provides a non-invasive lineage analysis method based on mutations that accumulate in the genomes of opaque multicellular organism somatic cells. Mol. Reprod. Dev. 83: 387-391, 2016. © 2016 Wiley Periodicals, Inc. PMID:26932355

  1. Nucleotide Substitution and Recombination at Orthologous Loci in Staphylococcus aureus†

    PubMed Central

    Hughes, Austin L.; Friedman, Robert

    2005-01-01

    The pattern of nucleotide substitution was examined at 2,129 orthologous loci among five genomes of Staphylococcus aureus, which included two sister pairs of closely related genomes (MW2/MSSA476 and Mu50/N315) and the more distantly related MRSA252. A total of 108 loci were unusual in lacking any synonymous differences among the five genomes; most of these were short genes encoding proteins highly conserved at the amino acid sequence level (including many ribosomal proteins) or unknown predicted genes. In contrast, 45 genes were identified that showed anomalously high divergence at synonymous sites. The latter genes were evidently introduced by homologous recombination from distantly related genomes, and in many cases, the pattern of nucleotide substitution made it possible to reconstruct the most probable recombination event involved. These recombination events introduced genes encoding proteins that differed in amino acid sequence and thus potentially in function. Several of the proteins are known or likely to be involved in pathogenesis (e.g., staphylocoagulase, exotoxin, Ser-Asp fibrinogen-binding bone sialoprotein-binding protein, fibrinogen and keratin-10 binding surface-anchored protein, fibrinogen-binding protein ClfA, and enterotoxin P). Therefore, the results support the hypothesis that exchange of homologous genes among S. aureus genomes can play a role in the evolution of pathogenesis in this species. PMID:15805516

  2. Mutations at 17 STR loci in Chinese population.

    PubMed

    Yan, Jiangwei; Liu, Yacheng; Tang, Hui; Zhang, Qingxia; Huo, Zhenyi; Hu, Songnian; Yu, Jun

    2006-10-16

    Knowledge about mutation rates and the mutational process of short-tandem-repeat (STR) or microsatellite loci used in forensic analysis is crucial for the correct interpretation of resulting genetic profiles. We analysed a total of 19,754 samples from 6532 paternity testing cases at 17 STR loci which are commonly applied to forensics. The parenthood in each of these cases was highly validated (probability>99.99%). We identified 178 mutations. Locus-specific mutation rate estimates varied between 7.0 x 10(-5) and 2.2 x 10(-3), and the overall average mutation rate estimate was 8.4 x 10(-4). The observed mutational features for STRs have important consequences for forensic application such as the definition of criterions for exclusion in paternity testing and the interpretation of DNA profiles in identification analysis. In order to enrich the reference data of STRs mutations which are valuable for forensic application, we suggest the establishment of such database and ask the whole forensic community for data contribution including China. PMID:16857331

  3. Using Environmental Correlations to Identify Loci Underlying Local Adaptation

    PubMed Central

    Coop, Graham; Witonsky, David; Di Rienzo, Anna; Pritchard, Jonathan K.

    2010-01-01

    Loci involved in local adaptation can potentially be identified by an unusual correlation between allele frequencies and important ecological variables or by extreme allele frequency differences between geographic regions. However, such comparisons are complicated by differences in sample sizes and the neutral correlation of allele frequencies across populations due to shared history and gene flow. To overcome these difficulties, we have developed a Bayesian method that estimates the empirical pattern of covariance in allele frequencies between populations from a set of markers and then uses this as a null model for a test at individual SNPs. In our model the sample frequencies of an allele across populations are drawn from a set of underlying population frequencies; a transform of these population frequencies is assumed to follow a multivariate normal distribution. We first estimate the covariance matrix of this multivariate normal across loci using a Monte Carlo Markov chain. At each SNP, we then provide a measure of the support, a Bayes factor, for a model where an environmental variable has a linear effect on the transformed allele frequencies compared to a model given by the covariance matrix alone. This test is shown through power simulations to outperform existing correlation tests. We also demonstrate that our method can be used to identify SNPs with unusually large allele frequency differentiation and offers a powerful alternative to tests based on pairwise or global FST. Software is available at http://www.eve.ucdavis.edu/gmcoop/. PMID:20516501

  4. High polymorphism at microsatellite loci in the Chinese donkey.

    PubMed

    Zhang, R F; Xie, W M; Zhang, T; Lei, C Z

    2016-01-01

    To reveal the genetic diversity and phylogenetic relationships between Chinese donkey breeds, 415 individuals representing ten breeds were investigated using ten microsatellite markers. The observed number of alleles, mean effective number of alleles (NE), mean expected heterozygosity (HE), and polymorphic information content (PIC) of each breed and polymorphic locus were analyzed. The results showed that seven (HTG7, HTG10, AHT4, HTG6, HMS6, HMS3, and HMS7) of ten microsatellite loci were polymorphic. The mean PIC, HE, and NE of seven polymorphic loci for the ten donkey breeds were 0.7679, 0.8072, and 6.0275, respectively. These results suggest that domestic Chinese donkey breeds possess higher levels of genetic diversity and heterozygosity than foreign donkeys. A neighbor-joining tree based on Nei's standard genetic distance showed that there was close genetic distance among Xinjiang, Qingyang, Xiji, and Guanzhong donkey breeds. In addition, Mongolia and Dezhou donkey breeds were placed in the same category. The phylogenetic tree revealed that the genetic relationships between Chinese donkey breeds are consistent with their geographic distribution and breeding history. PMID:27420967

  5. Mapping loci controlling flowering time in Brassica oleracea.

    PubMed

    Camargo, L E; Osborn, T C

    1996-04-01

    The timing of the transition from vegetative to reproductive phase is a major determinant of the morphology and value of Brassica oleracea crops. Quantitative trait loci (QTLs) controlling flowering time in B. oleracea were mapped using restriction fragment length polymorphism (RFLP) loci and flowering data of F3 families derived from a cabbage by broccoli cross. Plants were grown in the field, and a total of 15 surveys were made throughout the experiment at 5-15 day intervals, in which plants were inspected for the presence of flower buds or open flowers. The flowering traits used for data analysis were the proportion of annual plants (PF) within each F3 family at the end of the experiment, and a flowering-time index (FT) that combined both qualitative (annual/biennial) and quantitative (days to flowering) information. Two QTLs on different linkage groups were found associated with both PF and FT and one additional QTL was found associated only with FT. When combined in a multi-locus model, all three QTLs explained 54.1% of the phenotypic variation in FT. Epistasis was found between two genomic regions associated with FT. Comparisons of map positions of QTLs in B. oleracea with those in B. napus and B. rapa provided no evidence for conservation of genomic regions associated with flowering time between these species. PMID:24166330

  6. [Genetic diversity of microsatellite loci in captive Amur tigers].

    PubMed

    Zhang, Yu-Gaung; Li, Di-Qiang; Xiao, Qi-Ming; Rao, Li-Qun; Zhang, Xue-Wen

    2004-09-01

    The tiger is one of the most threatened wildlife species since the abundance and distribution of tiger have decreased dramatically in the last century. The wild Amur tiger (Panthera tigris altaica) only distributed in northeast China, the far east area of Russia and the north Korea and its size of wild population is about 450 in the world and 20 in China. Several hundred captive populations of Amur tigers are the main source to protect gene library of tiger and the source of recovering the wild populations. The Breeding Center for Felidae at Hengdaohezi and Haoerbin Tiger Park in Heilongjiang Province is the biggest captive breeding base in China. How to make clear the genetic pedigree and establish reasonable breeding system is the urgent issues. So we use the microsatellite DNA markers and non-invasive technology to research on the genetic diversity of captive Amur tiger in this study. Ten microsatellite loci (Fca005, Fca075, Fca094, Fca152, Fca161, Fca294, Pti002, Pti003, Pti007 and Pti010), highly variable nuclear markers, were studied their genetic diversity in 113 captive Amur tigers. The PCR amplified products of microsatellite loci were detected by non-denatured polyacrylamide gel electrophoresis. Allele numbers, allelic frequency, gene heterozygosity(H(e)), polymorphism information content(PIC) and effective number of allele(N(e)) were calculated. 41 alleles were found and their size were ranged from 110bp to 250bp in ten microsatellite loci, Fca152 had 6 alleles, Fca075, Fca094 and Fca294 had 5 alleles, Fca005 and Pti002 had 4 alleles and the others had 3 alleles in all tiger samples, respectively. The allelic frequencies were from 0.009 to 0.767; The He ranged from 0.385 to 0.707, and Fca294 and Pti010 locus had the highest and lowest value; the PIC were from 0.353 to 0.658, Fca294 and Pti010 locus had the highest and lowest value; and N(e) were from 1.626 to 3.409, Fca294 and Pti010 locus had the highest and lowest value, which showed the ten

  7. Individual chromosome assignment and chromosomal collinearity in Gossypium thurberi, G. trilobum and D subgenome of G. barbadense revealed by BAC-FISH.

    PubMed

    Gan, Yimei; Chen, Dan; Liu, Fang; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Peng, Renhai; Wang, Kunbo

    2011-01-01

    The experiment on individual chromosome assignments and chromosomal diversity was conducted using a multi-probe fluorescence in situ hybridization (FISH) system in D subgenome of tetraploid Gossypium barbadense (D(b)), G. thurberi (D(1)) and G. trilobum (D(8)), which the later two were the possible subgenome donors of tetraploid cottons. The FISH probes contained a set of bacterial artificial chromosome (BAC) clones specific to 13 individual chromosomes from D subgenome of G. hirsutum (D(h)), a D genome centromere-specific BAC clone 150D24, 45S and 5S ribosomal DNA (rDNA) clones, respectively. All tested chromosome orientations were confirmed by the centromere-specific BAC probe. In D(1) and D(8), four 45S rDNA loci were found assigning at the end of the short arm of chromosomes 03, 07, 09 and 11, while one 5S rDNA locus was successfully marked at pericentromeric region of the short arm of chromosome 09. In D(b), three 45S rDNA loci and two 5S rDNA loci were found out. Among them, two 45S rDNA loci were located at the terminal of the short arm of chromosomes D(b)07 and D(b)09, whilst one 5S rDNA locus was found situating near centromeric region of the short arm of chromosome D(b)09. The positions of the BAC clones specific to the 13 individual chromosomes from D(h) were compared between D(1), D(8) and D(b). The result showed the existence of chromosomal collinearity within D(1) and D(8), and as well between them and D(b). The results will serve as a base for understanding chromosome structure of cotton and polyploidy evolution of cotton genome and will provide bio-information for assembling the sequences of finished and the on-going cotton whole genome sequencing projects. PMID:21952206

  8. Analysis of 31 STR loci in the genetic isolate of Carloforte (Sardinia, Italy)

    PubMed Central

    2009-01-01

    The genotypes of 31 autosomal short tandem repeat loci in the population of Carloforte were analyzed, these representing a linguistic and genetic isolate located on the island of Sardinia (Italy). The markers span the entire length of chromosomes 19, 20, 21 and 22. Allele frequencies and statistical parameters were presented for all loci. Observed heterozygosity ranged from 0.279 to 0.884, and polymorphism information content from 0.552 to 0.886. All but two loci showed Hardy-Weinberg equilibrium after Bonferroni correction. The 31 short tandem repeat loci examined in the present work provide additional data on the genetic structure of the Carloforte population. PMID:21637506

  9. Isolation and characterization of microsatellite loci from the Arctic cisco (Coregonus autumnalis)

    USGS Publications Warehouse

    Ramey, A.; Graziano, S.L.; Nielsen, J.L.

    2008-01-01

    Eight polymorphic microsatellite loci were isolated and characterized for the Arctic cisco, Coregonus autumnalis. Loci were evaluated in 21 samples from the Colville River subsistence fishery. The number of alleles per locus ranged from two to 18. Observed heterozygosity of loci varied from 0.10 to 1.00, and expected heterozygosity ranged from 0.09 to 0.92. All eight microsatellite markers were in Hardy-Weinberg equilibrium. The loci presented here will be useful in describing population structure and exploring populations of origin for Arctic cisco. ?? 2007 Blackwell Publishing Ltd.

  10. Characterization of ten microsatellite loci in midget faded rattlesnake (Crotalus oreganus concolor)

    USGS Publications Warehouse

    Oyler-McCance, Sara J.; Parker, Joshua M.

    2010-01-01

    Primers for 10 microsatellite loci were developed for midget faded rattlesnake (Crotalus oreganus concolor), a small bodied subspecies of the Western Rattlesnake, which is found in the Colorado Plateau of eastern Utah, western Colorado and southwestern Wyoming. In a screen of 23 individuals from the most northern portion of the subspecies range in southwestern Wyoming, the 10 loci were found to have levels of variability ranging from 4 to 11 alleles. No loci were found to be linked, although one locus revealed significant departures from Hardy–Weinberg equilibrium. These microsatellite loci will be applicable for population genetic analyses, which will ultimately aid in management efforts for this rare subspecies of rattlesnake.

  11. Epidemiologic Study of Malassezia Yeasts in Patients with Malassezia Folliculitis by 26S rDNA PCR-RFLP Analysis

    PubMed Central

    Ko, Jong Hyun; Choe, Yong Beom; Ahn, Kyu Joong

    2011-01-01

    Background So far, studies on the inter-relationship between Malassezia and Malassezia folliculitis have been rather scarce. Objective We sought to analyze the differences in body sites, gender and age groups, and to determine whether there is a relationship between certain types of Malassezia species and Malassezia folliculitis. Methods Specimens were taken from the forehead, cheek and chest of 60 patients with Malassezia folliculitis and from the normal skin of 60 age- and gender-matched healthy controls by 26S rDNA PCR-RFLP. Results M. restricta was dominant in the patients with Malassezia folliculitis (20.6%), while M. globosa was the most common species (26.7%) in the controls. The rate of identification was the highest in the teens for the patient group, whereas it was the highest in the thirties for the control group. M. globosa was the most predominant species on the chest with 13 cases (21.7%), and M. restricta was the most commonly identified species, with 17 (28.3%) and 12 (20%) cases on the forehead and cheek, respectively, for the patient group. Conclusion Statistically significant differences were observed between the patient and control groups for the people in their teens and twenties, and in terms of the body site, on the forehead only. PMID:21747616

  12. Epidemiologic Study of Malassezia Yeasts in Acne Patients by Analysis of 26S rDNA PCR-RFLP

    PubMed Central

    Song, Young Chan; Hahn, Hyung Jin; Kim, Ji Young; Ko, Jong Hyun; Choe, Yong Beom; Ahn, Kyu Joong

    2011-01-01

    Background Although acne is a common follicular inflammatory dermatosis, studies of the relationship between Malassezia yeasts and acne have rarely been conducted. Objective We sought to identify Malassezia yeasts from acne patients and establish a relationship between specific types of species of Malassezia and acne. Methods Sixty acne patients were enrolled. Each strain obtained was identified as one of eleven species by 26S rDNA PCR-RFLP. We then compared these data with those of age- and sex-matched healthy subjects. Results Growth of Malassezia was evident in fewer patients with acne (50%) in comparison to controls (70.6%). M. restricta was dominant in patients with acne (23.9%), whereas M. globosa was most common (26.7%) in healthy controls. In the patients group, the rate was the highest (71.7%) in the twenties and, in terms of body site, the rate was the highest (60%) in the chest. In the control group, the rate was the highest (75.0%) in the thirties and in the forehead (85.0%). Conclusion The detection rate of Malassezia yeasts was conspicuously low in the acne patients group. Statistically significant differences were observed between the patient and the control groups in the twenties and thirties, and in terms of body site, in the forehead and chest. PMID:21909202

  13. Taiwanese Trichogramma of Asian Corn Borer: Morphology, ITS-2 rDNA Characterization, and Natural Wolbachia Infection

    PubMed Central

    Wu, Li-Hsin; Hoffmann, Ary A.; Thomson, Linda J.

    2016-01-01

    Egg parasitoids of the genus Trichogramma are natural enemies of many lepidopteran borers in agricultural areas around the world. It is important to identify the correct species and ideally focus on endemic Trichogramma for pest control in particular crops. In this study, Trichogramma wasps were collected from parasitized eggs of Asian corn borer in Southwestern Taiwan. Three Trichogramma species, Trichogramma ostriniae Pang and Chen, Trichogramma chilonis Ishii, and T. sp. y, were identified based on morphology and the nucleotide sequence of the internal transcribed spacer 2 (ITS-2) region of rDNA. Although T. ostriniae and T. sp. y appear to be morphologically similar, ITS-2 identity between these two taxa is only 89%. Surprisingly, a commercially released Trichogramma colony thought to be T. chilonis possessed 99% identity (ITS-2) with the field T. sp. y individuals. This suggests past contamination leading to subsitution of the laboratory-reared T. chilonis colony by T. sp. y. Natural populations of all three Trichogramma species were found to be infected by a single Wolbachia strain which was identified using a wsp gene sequence. PMID:26896674

  14. Taiwanese Trichogramma of Asian Corn Borer: Morphology, ITS-2 rDNA Characterization, and Natural Wolbachia Infection.

    PubMed

    Wu, Li-Hsin; Hoffmann, Ary A; Thomson, Linda J

    2016-01-01

    Egg parasitoids of the genus Trichogramma are natural enemies of many lepidopteran borers in agricultural areas around the world. It is important to identify the correct species and ideally focus on endemic Trichogramma for pest control in particular crops. In this study, Trichogramma wasps were collected from parasitized eggs of Asian corn borer in Southwestern Taiwan. Three Trichogramma species, Trichogramma ostriniae Pang and Chen, Trichogramma chilonis Ishii, and T. sp. y, were identified based on morphology and the nucleotide sequence of the internal transcribed spacer 2 (ITS-2) region of rDNA. Although T. ostriniae and T. sp. y appear to be morphologically similar, ITS-2 identity between these two taxa is only 89%. Surprisingly, a commercially released Trichogramma colony thought to be T. chilonis possessed 99% identity (ITS-2) with the field T. sp. y individuals. This suggests past contamination leading to subsitution of the laboratory-reared T. chilonis colony by T. sp. y. Natural populations of all three Trichogramma species were found to be infected by a single Wolbachia strain which was identified using a wsp gene sequence. PMID:26896674

  15. Development of a novel rDNA based plasmid for enhanced cell surface display on Yarrowia lipolytica

    PubMed Central

    2012-01-01

    In this study, a novel rDNA based plasmid was developed for display of heterologous proteins on the cell surface of Yarrowia lipolytica using the C-terminal end of the glycosylphosphatidylinositol (GPI) anchored Y. lipolytica cell wall protein 1 (YlCWP1). mCherry was used as a model protein to assess the efficiency of the constructed plasmid. Y. lipolytica transformants harbouring the expression cassettes showed a purple colour phenotype on selective YNB-casamino plates as compared to control cells indicating that mCherry was displayed on the cells. Expression of mCherry on cells of Y. lipolytica was confirmed by both fluorescent microscopy and flow cytometry. Furthermore, SDS-PAGE analysis and matrix-assisted laser desorption/ionization (MALDI)-time-of (TOF)-mass spectrometry (MS) peptide mass fingerprinting (PMF) confirmed that the protein cleaved from the yeast cells using enterokinase was mCherry. Efficient cleavage of mCherry reported in this work offers an alternative purification method for displayed heterologous proteins on Y. lipolytica cells using the plasmid constructed in this study. The developed displaying system offers great potential for industrial production and purification of heterologous proteins at low cost. PMID:22608131

  16. Detection of novel organisms associated with salpingitis, by use of 16S rDNA polymerase chain reaction.

    PubMed

    Hebb, Jennifer K; Cohen, Craig R; Astete, Sabina G; Bukusi, Elizabeth A; Totten, Patricia A

    2004-12-15

    Although Chlamydia trachomatis and Neisseria gonorrhoeae are established causes of salpingitis, the majority of cases have no known etiology. We used broad-range 16S rDNA polymerase chain reaction to identify novel, possibly uncultivable, bacteria associated with salpingitis and identified bacterial 16S sequences in Fallopian-tube specimens from 11 (24%) of 45 consecutive women with laparoscopically confirmed acute salpingitis (the case patients) and from 0 of 44 women seeking tubal ligations (the control subjects) at Kenyatta National Hospital, Nairobi, Kenya. Bacterial phylotypes most closely related to Leptotrichia spp. were detected as the sole phylotypes in 1, and mixed with other bacterial phylotypes in 2, specimens. Novel bacterial phylotypes and those associated with bacterial vaginosis, including Atopobium vaginae, were identified in 3 specimens. N. gonorrhoeae and Streptococcus pyogenes were identified in 2 and 1 specimens, respectively. The finding of novel phylotypes associated with salpingitis has important implications for the etiology, pathogenesis, and treatment of this important reproductive-tract disease syndrome. PMID:15551209

  17. Characterization of Lactobacillus from Algerian Goat'S Milk Based on Phenotypic, 16S rDNA Sequencing and their Technological Properties.

    PubMed

    Marroki, Ahmed; Zúñiga, Manuel; Kihal, Mabrouk; Pérez-Martínez, Gaspar

    2011-01-01

    Nineteen strains of Lactobacillus isolated from goat's milk from farms in north-west of Algeria were characterized. Isolates were identified by phenotypic, physiological and genotypic methods and some of their important technological properties were studied. Phenotypic characterization was carried out by studying physiological, morphological characteristics and carbohydrate fermentation patterns using API 50 CHL system. Isolates were also characterized by partial 16S rDNA sequencing. Results obtained with phenotypic methods were correlated with the genotypic characterization and 13 isolates were identified as L. plantarum, two isolates as L. rhamnosus and one isolate as L. fermentum. Three isolates identified as L. plantarum by phenotypic characterization were found to be L. pentosus by the genotypic method. A large diversity in technological properties (acid production in skim milk, exopolysaccharide production, aminopeptidase activity, antibacterial activity and antibiotic susceptibility) was observed. Based on these results, two strains of L. plantarum (LbMS16 and LbMS21) and one strain of L. rhamnosus (LbMF25) have been tentatively selected for use as starter cultures in the manufacture of artisanal fermented dairy products in Algeria. PMID:24031617

  18. Identification of cephalopod species from the North and Baltic Seas using morphology, COI and 18S rDNA sequences

    NASA Astrophysics Data System (ADS)

    Gebhardt, Katharina; Knebelsberger, Thomas

    2015-09-01

    We morphologically analyzed 79 cephalopod specimens from the North and Baltic Seas belonging to 13 separate species. Another 29 specimens showed morphological features of either Alloteuthis mediaor Alloteuthis subulata or were found to be in between. Reliable identification features to distinguish between A. media and A. subulata are currently not available. The analysis of the DNA barcoding region of the COI gene revealed intraspecific distances (uncorrected p) ranging from 0 to 2.13 % (average 0.1 %) and interspecific distances between 3.31 and 22 % (average 15.52 %). All species formed monophyletic clusters in a neighbor-joining analysis and were supported by bootstrap values of ≥99 %. All COI haplotypes belonging to the 29 Alloteuthis specimens were grouped in one cluster. Neither COI nor 18S rDNA sequences helped to distinguish between the different Alloteuthis morphotypes. For species identification purposes, we recommend the use of COI, as it showed higher bootstrap support of species clusters and less amplification and sequencing failure compared to 18S. Our data strongly support the assumption that the genus Alloteuthis is only represented by a single species, at least in the North Sea. It remained unclear whether this species is A. subulata or A. media. All COI sequences including important metadata were uploaded to the Barcode of Life Data Systems and can be used as reference library for the molecular identification of more than 50 % of the cephalopod fauna known from the North and Baltic Seas.

  19. The phylogeny of native and exotic scallops cultured in China based on 16S rDNA sequences

    NASA Astrophysics Data System (ADS)

    Liu, Baozhong; Dong, Bo; Xiang, Jianhai; Wang, Zaizhao

    2007-01-01

    Scallops of the Family Pectinidae are a valuable resource in marine industry of the world. Understanding the phylogeny of the family is important for the development of the industry. In this study, partial 16S mitochondrial rDNA genes were obtained from 8 scallop species that are commonly cultured indigenous and transplanted species in China. Phylogenetic relationships of Pectinidae were analyzed based on the 8 sequences and other 5 published ones in GenBank, representing 9 genera of the family. The molecular phylogeny trees were constructed using 3 methods with software PHYLIP. The results showe that total 13 species of scallops clustered in 4 clades. Pecten maximus joins P. jacobaeus then Amusium pleuronectes in cluster, indicating close relationship of genus Amusium with Pecten in evolution. P. yessoensis is close to Chlamys farreri and C. islandica. No enough material was available to single out genus Patinopecten as an independent monophyletic subfamily. The position of Adamussium colbecki indicates that it is far from genus Pecten but near to genus Chlamys in evolution.

  20. Karyotype variation is indicative of subgenomic and ecotypic differentiation in switchgrass

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A cytogenetic study was conducted on a dihaploid individual (2n'='2X'='18) of switchgrass to establish a chromosome karyotype. Size differences, condensation patterns, and arm-length ratios were used as identifying features and fluorescence in-situ hybridization (FISH) assigned 5S and 45S rDNA loci...

  1. A multivalent three-point linkage analysis model of autotetraploids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A cytogenetic study was conducted on a dihaploid individual (2n'='2X'='18) of switchgrass to establish a chromosome karyotype. Size differences, condensation patterns, and arm-length ratios were used as identifying features and fluorescence in-situ hybridization (FISH) assigned 5S and 45S rDNA loci...

  2. A methylated Neurospora 5S rRNA pseudogene contains a transposable element inactivated by repeat-induced point mutation.

    PubMed Central

    Margolin, B S; Garrett-Engele, P W; Stevens, J N; Fritz, D Y; Garrett-Engele, C; Metzenberg, R L; Selker, E U

    1998-01-01

    In an analysis of 22 of the roughly 100 dispersed 5S rRNA genes in Neurospora crassa, a methylated 5S rRNA pseudogene, Psi63, was identified. We characterized the Psi63 region to better understand the control and function of DNA methylation. The 120-bp 5S rRNA-like region of Psi63 is interrupted by a 1.9-kb insertion that has characteristics of sequences that have been modified by repeat-induced point mutation (RIP). We found sequences related to this insertion in wild-type strains of N. crassa and other Neurospora species. Most showed evidence of RIP; but one, isolated from the N. crassa host of Psi63, showed no evidence of RIP. A deletion from near the center of this sequence apparently rendered it incapable of participating in RIP with the related full-length copies. The Psi63 insertion and the related sequences have features of transposons and are related to the Fot1 class of fungal transposable elements. Apparently Psi63 was generated by insertion of a previously unrecognized Neurospora transposable element into a 5S rRNA gene, followed by RIP. We name the resulting inactivated Neurospora transposon PuntRIP1 and the related sequence showing no evidence of RIP, but harboring a deletion that presumably rendered it defective for transposition, dPunt. PMID:9691037

  3. Temporal and multiple quantitative trait loci analyses of resistance to bacterial wilt in tomato permit the resolution of linked loci.

    PubMed

    Mangin, B; Thoquet, P; Olivier, J; Grimsley, N H

    1999-03-01

    Ralstonia solanacearum is a soil-borne bacterium that causes the serious disease known as bacterial wilt in many plant species. In tomato, several QTL controlling resistance have been found, but in different studies, markers spanning a large region of chromosome 6 showed strong association with the resistance. By using two different approaches to analyze the data from a field test F3 population, we show that at least two separate loci approximately 30 cM apart on this chromosome are most likely involved in the resistance. First, a temporal analysis of the progression of symptoms reveals a distal locus early in the development of the disease. As the disease progresses, the maximum LOD peak observed shifts toward the proximal end of the chromosome, obscuring the distal locus. Second, although classical interval mapping could only detect the presence of one locus, a statistical "two-QTL model" test, specifically adapted for the resolution of linked QTL, strongly supported the hypothesis for the presence of two loci. These results are discussed in the context of current molecular knowledge about disease resistance genes on chromosome 6 and observations made by tomato breeders during the production of bacterial wilt-resistant varieties. PMID:10049932

  4. Temporal and multiple quantitative trait loci analyses of resistance to bacterial wilt in tomato permit the resolution of linked loci.

    PubMed Central

    Mangin, B; Thoquet, P; Olivier, J; Grimsley, N H

    1999-01-01

    Ralstonia solanacearum is a soil-borne bacterium that causes the serious disease known as bacterial wilt in many plant species. In tomato, several QTL controlling resistance have been found, but in different studies, markers spanning a large region of chromosome 6 showed strong association with the resistance. By using two different approaches to analyze the data from a field test F3 population, we show that at least two separate loci approximately 30 cM apart on this chromosome are most likely involved in the resistance. First, a temporal analysis of the progression of symptoms reveals a distal locus early in the development of the disease. As the disease progresses, the maximum LOD peak observed shifts toward the proximal end of the chromosome, obscuring the distal locus. Second, although classical interval mapping could only detect the presence of one locus, a statistical "two-QTL model" test, specifically adapted for the resolution of linked QTL, strongly supported the hypothesis for the presence of two loci. These results are discussed in the context of current molecular knowledge about disease resistance genes on chromosome 6 and observations made by tomato breeders during the production of bacterial wilt-resistant varieties. PMID:10049932

  5. A powerful likelihood method for the analysis of linkage disequilibrium between trait loci and one or more polymorphic marker loci

    SciTech Connect

    Terwilliger, J.D.

    1995-03-01

    Historically, most methods for detecting linkage disequilibrium were designed for use with diallelic marker loci, for which the analysis is straightforward. With the advent of polymorphic markers with many alleles, the normal approach to their analysis has been either to extend the methodology for two-allele systems (leading to an increase in df and to a corresponding loss of power) or to select the allele believed to be associated and then collapse the other alleles, reducing, in a biased way, the locus to a diallelic system. I propose a likelihood-based approach to testing for linkage disequilibrium, an approach that becomes more conservative as the number of alleles increases, and as the number of markers considered jointly increases in a multipoint test for linkage disequilibrium, while maintaining high power. Properties of this method for detecting associations and fine mapping the location of disease traits are investigated. It is found to be, in general, more powerful than conventional methods, and it provides a tractable framework for the fine mapping of new disease loci. Application to the cystic fibrosis data of Kerem et al. is included to illustrate the method. 12 refs., 4 figs., 4 tabs.

  6. Distribution of Mosquitoes in the South East of Argentina and First Report on the Analysis Based on 18S rDNA and COI Sequences

    PubMed Central

    Díaz-Nieto, Leonardo M.; Maciá, Arnaldo; Parisi, Gustavo; Farina, Juan L.; Vidal-Domínguez, María E.; Perotti, M. Alejandra; Berón, Corina M.

    2013-01-01

    Although Mar del Plata is the most important city on the Atlantic coast of Argentina, mosquitoes inhabiting such area are almost uncharacterized. To increase our knowledge in their distribution, we sampled specimens of natural populations. After the morphological identification based on taxonomic keys, sequences of DNA from small ribosomal subunit (18S rDNA) and cytochrome c oxidase I (COI) genes were obtained from native species and the phylogenetic analysis of these sequences were done. Fourteen species from the genera Uranotaenia, Culex, Ochlerotatus and Psorophora were found and identified. Our 18S rDNA and COI-based analysis indicates the relationships among groups at the supra-species level in concordance with mosquito taxonomy. The introduction and spread of vectors and diseases carried by them are not known in Mar del Plata, but some of the species found in this study were reported as pathogen vectors. PMID:24098700

  7. 16S rDNA sequence analysis of bacterial isolates from biodeteriorated mural paintings in the Servilia tomb (Necropolis of carmona, Seville, Spain).

    PubMed

    Heyrman, J; Swings, J

    2001-11-01

    Bacteria were isolated from damaged mural paintings of the Servilia tomb (necropolis of Carmona, Seville, Spain). Selected strains, representative for different clusters of isolates with similar fatty acid profiles, were analysed by 16S rDNA sequence analysis. Bacillus is the dominant genus among the isolates: members of the rRNA species complexes of B. megaterium, B. pumilus and B. firmus were found as well as several other Bacillus species. One group of halotolerant isolates falls in the Bacillus sensu lato group, with closest relatedness to the genera Salibacillus and Virgibacillus. Other genera found are Artbrobacter, Micrococcus, Streptomyces, Sphingomonas, Paenibacillus, and a genus closely related to Paracraurococcus. Many isolates showed low 16S rDNA sequence similarities with the closest related database entries, a strong indication for the presence of several new species among the isolates. PMID:11822679

  8. [Investigation of bacterial diversity in the biological desulfurization reactor for treating high salinity wastewater by the 16S rDNA cloning method].

    PubMed

    Liu, Wei-Guo; Liang, Cun-Zhen; Yang, Jin-Sheng; Wang, Gui-Ping; Liu, Miao-Miao

    2013-02-01

    The bacterial diversity in the biological desulfurization reactor operated continuously for 1 year was studied by the 16S rDNA cloning and sequencing method. Forty clones were randomly selected and their partial 16S rDNA genes (ca. 1,400 bp) were sequenced and blasted. The results indicated that there were dominant bacterias in the biological desulfurization reactor, where 33 clones belonged to 3 different published phyla, while 1 clone belonged to unknown phylum. The dominant bacterial community in the system was Proteobacteria, which accounted for 85.3%. The bacterial community succession was as follows: the gamma-Proteobacteria(55.9%), beta-Proteobacteria(17.6%), Actinobacteridae (8.8%), delta-Proteobacteria (5.9%) , alpha-Proteobacteria(5.9%), and Sphingobacteria (2.9%). Halothiobacillus sp. ST15 and Thiobacillus sp. UAM-I were the major desulfurization strains. PMID:23668153

  9. Characterization of bacterial diversity in pulque, a traditional Mexican alcoholic fermented beverage, as determined by 16S rDNA analysis.

    PubMed

    Escalante, Adelfo; Rodríguez, María Elena; Martínez, Alfredo; López-Munguía, Agustín; Bolívar, Francisco; Gosset, Guillermo

    2004-06-15

    The bacterial diversity in pulque, a traditional Mexican alcoholic fermented beverage, was studied in 16S rDNA clone libraries from three pulque samples. Sequenced clones identified as Lactobacillus acidophilus, Lactobacillus strain ASF360, L. kefir, L. acetotolerans, L. hilgardii, L. plantarum, Leuconostoc pseudomesenteroides, Microbacterium arborescens, Flavobacterium johnsoniae, Acetobacter pomorium, Gluconobacter oxydans, and Hafnia alvei, were detected for the first time in pulque. Identity of 16S rDNA sequenced clones showed that bacterial diversity present among pulque samples is dominated by Lactobacillus species (80.97%). Seventy-eight clones exhibited less than 95% of relatedness to NCBI database sequences, which may indicate the presence of new species in pulque samples. PMID:15183874

  10. Development of a mitochondrial 12S rDNA analysis for distinguishing Sciuridae species with potential to transmit Ehrlichia and Borrelia species to feeding Amblyomma americanum (Acari: Ixodidae).

    PubMed

    Goessling, Lisa S; Allan, Brian F; Mandelbaum, Rachel S; Thach, Robert E

    2012-05-01

    Unique oligonucleotide probes were synthesized to distinguish among closely related vertebrate mitochondrial rDNA sequences present in residual bloodmeals in emergent Amblyomma americanum (L.) (Acari: Ixodidae) nymph life-stage ticks. Use of these probes enabled the identification of the Eastern gray squirrel as an important bloodmeal source in nymphs harboring Ehrlichia and Borrelia species. These results were confirmed by identifying these same bacterial genera in Eastern gray squirrel tissues. PMID:22679888

  11. Mutational analysis of 33 autosomal short tandem repeat (STR) loci in southwest Chinese Han population based on trio parentage testing.

    PubMed

    Jin, Bo; Su, Qin; Luo, Haibo; Li, Yingbi; Wu, Jin; Yan, Jing; Hou, Yiping; Liang, Weibo; Zhang, Lin

    2016-07-01

    Mutation rates and 95% CI of 33 short tandem repeat (STR) loci (D1S2142, D2S1338, D2S441, D3S1358, D3S1754, D5S818, D6S1043, D7S3048, D7S820, D8S1132, D8S1179, D10S1248, D11S2368, D12S391, D13S1492, D13S317, D13S325, D14S306, D15S659, D16S539, D18S1364, D18S51, D19S433, D20S161, D21S11, D22GATA198B05, CSF1PO, FGA, Penta D, Penta E, TH01, TPOX, and vWA) were investigated through more than 424,000 parent-child meiotic transfers obtained from 10636 trios parentage testing cases in southwest Chinese Han population. Overall, 297, including 292 single-step, 4 double-step and 1 triple-step mutation events were observed. The average mutation rate was 0.70×10(-3). Most of the locus-specific mutation rates (varied from 0.20×10(-3) to 1.96×10(-3)) were lower than the other datasets (p<0.05). Mutations of 7 loci are reported for the first time. Mutation rates varied with population from different ethnicities and geographical regions. There was no significant difference between mutation expansion and contraction (∼1.04:1). Paternal origin mutations occurred more frequently than maternal origin ones (∼5.02:1). In addition, mutation rates indicated positive correlation with the expected heterozygosity (He) and geometric mean of longest run of perfect repeats (LRPR), respectively. Short alleles showed a trend toward mutation gain while long alleles trended toward mutation loss. A credible forensic dataset for locus-specific mutation rates of 33 loci has been established based upon strict inclusion criteria of large-sized parents/child-trio cases. PMID:27045978

  12. The establishment of species-specific primers for the molecular identification of ten stored-product psocids based on ITS2 rDNA.

    PubMed

    Zhao, Zi-Hua; Cui, Bing-Yi; Li, Zhi-Hong; Jiang, Fan; Yang, Qian-Qian; Kučerová, Zuzana; Stejskal, Václav; Opit, George; Cao, Yang; Li, Fu-Jun

    2016-01-01

    Psocids are important stored product pests found worldwide that can be spread through grain trade. Most stored-product psocids, including eggs, nymphs, and adults, are very small (~1 mm) and difficult to identify morphologically. Here, we collected 10 economically important stored-product Liposcelis spp. psocids (L. bostrychophila, L. entomophila, L. decolor, L. paeta, L. brunnea, L. corrodens, L. mendax, L. rufa, L. pearmani, and L. tricolor) from 35 geographical locations in 5 countries (China, Czech Republic, Denmark, Germany, and the United States). The ITS2 rDNA gene was extracted and sequenced. The interspecific genetic distance of the stored-product psocids was significantly higher than the intraspecific genetic distance according to the barcoding gap analysis. Ten pairs of species-specific primers based on the ITS2 rDNA were developed for psocid identification. The sensitivity estimation indicated that the species-specific primers could correctly amplify the target ITS2 gene and successfully identify psocids at 1.0 ng/mL. Additionally, these species-specific primers could quantify specificity and identify 10 stored-product psocids; this approach could also be used to accurately identify other stored-product psocids. This work provides a practical approach for the precise examination of 10 stored-product psocid species and also contributes to the development of an identification method using ITS2 rDNA. PMID:26880378

  13. The establishment of species-specif