Science.gov

Sample records for 5s rdna probe

  1. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    PubMed

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit. PMID:27106499

  2. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    PubMed

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus. PMID:26959315

  3. Interplay of RNA Pol IV and ROS1 during post-embryonic 5S rDNA chromatin remodeling.

    PubMed

    Douet, Julien; Blanchard, Bertrand; Cuvillier, Claudine; Tourmente, Sylvette

    2008-12-01

    We have investigated the chromatin structure of 5S rDNA, a heterochromatic pericentromeric tandemly repeated family, at 2, 3, 4 and 5 days post-germination. Our results revealed a large-scale reorganization of 5S rDNA chromatin that occurs during the first days of development. Unexpectedly, there is a decondensation followed by a 're'condensation of 5S rDNA chromatin, to obtain almost mature nuclei 5 d post-germination. The reorganization of 5S rDNA chromatin is accompanied by a rapid and active demethylation of 5S rDNA mediated by the ROS1 (repressor of silencing 1) demethylase, whereas the plant-specific RNA polymerase IV (Pol IV) is essential to the 5S chromatin 're'condensation. In conclusion, Pol IV and ROS1 collaborate to unlock the 5S rDNA chromatin inherited from the seed, and establish adult features. PMID:18845569

  4. Chromosomal Locations of 5S and 45S rDNA in Gossypium Genus and Its Phylogenetic Implications Revealed by FISH

    PubMed Central

    Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo

    2013-01-01

    We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G. incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G. raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution. PMID:23826377

  5. [Analysis of 5S rDNA changes in synthetic allopolyploids Triticum x Aegilops].

    PubMed

    Shcherban', A B; Sergeeva, E M; Badaeva, E D; Salina, E A

    2008-01-01

    By the example of three synthetic allopolyploids: Aegilops sharonensis x Ae. umbellulata (2n =28), Triticum urartu x Ae. tauschii (2n =28), T. dicoccoides x Ae. tauschii (2n =42) the 5S rDNA changes at the early stage of allopolyploidization were investigated. Using fluorescent in situ hybridization (FISH), the quantitative changes affecting the separate loci of one of the parental genomes were revealed in plants of S3 generation of each hybrid combination. Souther hybridization with genomic DNA of allopolyploid T. urartu x Ae. tauschii (TMU38 x TQ27) revealed lower intensity of the fragments from Ae. tauschii compared with the T. urartu fragments. It may be confirmation of the reduction of signal on 1D chromosome that was revealed in this hybrid using FISH. Both appearance of a new 5S rDNA fragments and full disappearance of fragments from parental species were not showed by Southern hybridization, as well as PCR-analysis of 5-15 plants of S2-S3 generations. The changes were not found under comparison of primary structure of nine 5S rDNA sequences of allopolyploid TMU38 x TQ27 with analogous sequences from parental species genomes. The observable similarity by FISH results of one of the studied synthetic allopolyploids with natural allopolyploid of similar genome composition indicates the early formation of unique for each allopolyploid 5S rDNA organization. PMID:18856060

  6. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    PubMed

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-04-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS. PMID:26488198

  7. Physical mapping of 18S and 5S rDNA loci and histone H3 gene in grasshopper species of the subfamily Gomphocerinae (Acrididae).

    PubMed

    Silva-Neto, L C; Bernardino, A C S; Loreto, V; Moura, R C

    2015-01-01

    In this study, fluorescence in situ hybridization (FISH) analysis was used to determine and compare the numbers and chromosomal locations of two multigene families (rDNA and histone H3) in four Neotropical species of gomphocerine grasshoppers. FISH using the 18S rDNA probe identified a single site on the S9 chromosome of Amblytropidia sp and Cauratettix borelli, a single site on chromosome M6 of Compsacris pulcher, and two sites (chromosomes L1 and L2) in Orphulella punctata. By contrast, FISH with a 5S rDNA probe identified dispersion of this sequence in the genomes of the four species, with evidence of intraspecific variations. Amblytropidia sp had six to eight FISH signals on autosomal chromosomes, while C. pulcher exhibited a signal only on the M5 bivalent. The histone H3 gene was less variable and was restricted to a single pair in all species. The conservation of the numbers and locations of 18S rDNA and H3 genes in conjunction with data from the literature was useful for evaluating karyotype evolution in this subfamily. The variation in the number and sizes of 5S rDNA sites indicates a process of recent dispersion that might have been mediated by transposition. PMID:26634462

  8. Physical Mapping of the 5S and 18S rDNA in Ten Species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae): Evolutionary Tendencies in the Genus

    PubMed Central

    César Venere, Paulo; Thums Konerat, Jocicléia; Henrique Zawadzki, Cláudio; Ricardo Vicari, Marcelo; Margarido, Vladimir Pavan

    2014-01-01

    Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH) with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus. PMID:25405240

  9. Chromosomal localization of 5S rDNA in Chinese shrimp ( Fenneropenaeus chinensis): a chromosome-specific marker for chromosome identification

    NASA Astrophysics Data System (ADS)

    Huan, Pin; Zhang, Xiaojun; Li, Fuhua; Zhao, Cui; Zhang, Chengsong; Xiang, Jianhai

    2010-03-01

    Chinese shrimp ( Fenneropenaeus chinensis) is an economically important aquaculture species in China. However, cytogenetic and genomic data is limited in the organism partly because the chromosomes are difficult to isolate and analyze. In this study, fluorescence in-situ hybridization (FISH) was used to identify the chromosomes of F. chinensis. The 5S ribosomal RNA gene (rDNA) of F. chinensis was isolated, cloned and then used as a hybridization probe. The results show that the 5S rDNA was located on one pair of homologous chromosomes in F. chinensis. In addition, triploid shrimp were used to evaluate the feasibility of chromosome identification using FISH and to validate the method. It was confirmed that 5S rDNA can be used as a chromosome-specific probe for chromosome identification in F. chinensis. The successful application of FISH in F. chinensis shows that chromosome-specific probes can be developed and this finding will facilitate further research on the chromosomes of penaeid shrimps.

  10. Analysis of 5S rDNA arrays in Arabidopsis thaliana: physical mapping and chromosome-specific polymorphisms.

    PubMed

    Cloix, C; Tutois, S; Mathieu, O; Cuvillier, C; Espagnol, M C; Picard, G; Tourmente, S

    2000-05-01

    A physical map of a pericentromeric region of chromosome 5 containing a 5S rDNA locus and spanning approximately 1000 kb was established using the CIC YAC clones. Three 5S rDNA arrays were resolved in this YAC contig by PFGE analysis and we have mapped different types of sequences between these three blocks. 5S rDNA units from each of these three arrays of chromosome 5, and from chromosomes 3 and 4, were isolated by PCR. A total of 38 new DNA sequences were obtained. Two types of 5S rDNA repeated units exist: the major variant with 0.5-kb repeats and one with short repeats (251 bp) only detected on YAC 11A3 from chromosome 3. Although the 38 sequences displayed noticeable heterogeneity, we were able to group them according to their 5S array origin. The presence of 5S array-specific variants was confirmed with the restriction polymorphism study of all the YACs carrying 5S units. PMID:10810091

  11. Molecular dissection of the rDNA array and of the 5S rDNA gene in Meloidogyne artiellia: phylogenetic and diagnostic implications.

    PubMed

    Veronico, Pasqua; De Luca, Francesca; De Giorgi, Carla

    2004-06-01

    The sequence of a 13.423 nucleotide genomic fragment has been determined for the plant parasitic nematode Meloidogyne artiellia. It contains an entire rDNA cluster, the bordering intergenic regions and portions of the flanking coding regions. The sequence analysis of the rDNA repeats suggests homogeneity in M. artiellia, thus providing a further indication of the usefulness of these genes for the diagnostic identification of this species. The comparison of the secondary structures of the internal transcribed spacer 2 region in several Meloidogyne species indicates that RNA folding predictions can be used as a tool of potential diagnostic relevance. The other ribosomal gene, 5S rDNA, has been demonstrated to be functional and located near the trans-spliced leader sequences, in the same arrangement found in the distantly related nematode Caenorhabditis elegans but never in other Meloidogyne thus providing species-specific markers for the identification of several Thylenchida parasitic nematodes. PMID:15135452

  12. A Pol V–Mediated Silencing, Independent of RNA–Directed DNA Methylation, Applies to 5S rDNA

    PubMed Central

    Douet, Julien; Tutois, Sylvie; Tourmente, Sylvette

    2009-01-01

    The plant-specific RNA polymerases Pol IV and Pol V are essential to RNA–directed DNA methylation (RdDM), which also requires activities from RDR2 (RNA–Dependent RNA Polymerase 2), DCL3 (Dicer-Like 3), AGO4 (Argonaute), and DRM2 (Domains Rearranged Methyltransferase 2). RdDM is dedicated to the methylation of target sequences which include transposable elements, regulatory regions of several protein-coding genes, and 5S rRNA–encoding DNA (rDNA) arrays. In this paper, we have studied the expression of the 5S-210 transcript, a marker of silencing release at 5S RNA genes, to show a differential impact of RNA polymerases IV and V on 5S rDNA arrays during early development of the plant. Using a combination of molecular and cytological assays, we show that Pol IV, RDR2, DRM2, and Pol V, actors of the RdDM, are required to maintain a transcriptional silencing of 5S RNA genes at chromosomes 4 and 5. Moreover, we have shown a derepression associated to chromatin decondensation specific to the 5S array from chromosome 4 and restricted to the Pol V–loss of function. In conclusion, our results highlight a new role for Pol V on 5S rDNA, which is RdDM–independent and comes specifically at chromosome 4, in addition to the RdDM pathway. PMID:19834541

  13. Comet-FISH with rDNA probes for the analysis of mutagen-induced DNA damage in plant cells.

    PubMed

    Kwasniewska, Jolanta; Grabowska, Marta; Kwasniewski, Miroslaw; Kolano, Bozena

    2012-06-01

    We used comet-fluorescence in situ hybridization (FISH) in the model plant species Crepis capillaris following exposure of seedlings to maleic hydrazide (MH). FISH with 5S and 25S rDNA probes was applied to comets obtained under alkaline conditions to establish whether these DNA regions were preferentially involved in comet tail formation. MH treatment induced significant fragmentation of nuclear DNA and of rDNA loci. A 24-h post-treatment recovery period allowed a partial reversibility of MH-induced damage on nuclear and rDNA regions. Analyses of FISH signals demonstrated that rDNA sequences were always involved in tail formation and that 5S rDNA was more frequently present in the tail than 25S rDNA, regardless of treatment. The involvement of 25S rDNA in nucleolus formation and differences in chromatin structure between the two loci may explain the different susceptibility of the 25S and 5S rDNA regions to migrate into the tail. This work is the first report on the application of FISH to comet preparations from plants to analyze the distribution and repair of DNA damage within specific genomic regions after mutagenic treatment. Moreover, our work suggests that comet-FISH in plants may be a useful tool for environmental monitoring assessment. PMID:22556029

  14. Chromosomal location of 18S and 5S rDNA sites in Triportheus fish species (Characiformes, Characidae)

    PubMed Central

    2009-01-01

    The location of 18S and 5S rDNA sites was determined in eight species and populations of the fish genus Triportheus by using fluorescent in situ hybridization (FISH). The males and females of all species had 2n = 52 chromosomes and a ZZ/ZW sex chromosome system. A single 18S rDNA site that was roughly equivalent to an Ag-NOR was detected on the short arms of a submetacentric pair in nearly all species, and up to two additional sites were also observed in some species. In addition, another 18S rDNA cluster was identified in a distal region on the long arms of the W chromosome; this finding corroborated previous evidence that this cluster would be a shared feature amongst Triportheus species. In T. angulatus, a heterozygotic paracentric inversion involving the short arms of one homolog of a metacentric pair was associated with NORs. The 5S rDNA sites were located on the short arms of a single submetacentric chromosomal pair, close to the centromeres, except in T. auritus, which had up to ten 5S rDNA sites. The 18S and 5S rDNA sites were co-localized and adjacent on the short arms of a chromosomal pair in two populations of T. nematurus. Although all Triportheus species have a similar karyotypic macrostructure, the results of this work show that in some species ribosomal genes may serve as species-specific markers when used in conjunction with other putatively synapomorphic features. PMID:21637644

  15. Identification of a 5S rDNA spacer type specific Triticum urartu and wheats containing the T. urartu genome.

    PubMed

    Allaby, R G; Brown, T A

    2000-04-01

    A PCR system was designed to amplify 5S spacer rDNA specifically from homeologous chromosome 1 in a variety of species representative of the Aegilops and Triticum genera. Two polymerase chain reaction (PCR) primer combinations were used, one of which appears to be apomorphic in nature and specific to chromosome 1A in Triticum urartu and tetraploid and hexaploid wheats containing the AA genome donated by T. urartu. The value of studying single repeat types to investigate the molecular evolution of 5S-rDNA arrays is considered. PMID:10791812

  16. Chromosome mapping of 18S rDNA and 5S rDNA by dual-color fluorescence in situ hybridization in the half-smooth tongue sole (Cynoglossus semilaevis).

    PubMed

    Jiang, L; Jiang, J; Liu, J; Yuan, J; Chen, Y; Zhang, Q; Wang, X

    2014-01-01

    Half-smooth tongue sole (Cynoglossus semilaevis) is an important aquaculture flatfish in China. Cytogenetic analysis has revealed that its sex determination system is female heterogametic (ZZ/ZW). The W chromosome is morphologically larger and has been considered evolutionarily younger than any other chromosome in the set. However, the genetic origin and evolution process of this neo-chromosome remains unclear. In this study, 2 tandem arrays of rRNA genes were chosen to address this question. Both the major rDNA (18S rDNA) and the minor rDNA (5S rDNA) were located on the C. semilaevis chromosomes by fluorescence in situ hybridization (FISH). Six 18S rDNA signals were observed on the centromeric regions of 3 pairs of autosomes in both males and females. In females, there was an additional 18S rDNA signal mapping to the telomeric region of the W chromosome long arm. With respect to the 5S rDNA, 12 signals were mapped to the centromeric regions of six pairs of autosomes. Two-color FISH further confirmed that the two pairs of the 5S rDNA signals were correspondingly located at the same positions of the same autosomes as those of the 18S rDNA signals. These results allowed us to speculate about the evolution process of the W chromosome. Chromosome fusions and repetitive sequence accumulations might have occurred in C. semilaevis. The synteny and non-synteny of C. semilaevis 18S rDNA and 5S rDNA might imply the original and evolutionary characteristics of this species. These findings will facilitate studies on karyotype evolution of the order Pleuronectiformes. PMID:25526196

  17. Karyotype divergence and spreading of 5S rDNA sequences between genomes of two species: darter and emerald gobies ( Ctenogobius , Gobiidae).

    PubMed

    Lima-Filho, P A; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Molina, W F

    2014-01-01

    Karyotype analyses of the cryptobenthic marine species Ctenogobius boleosoma and C. smaragdus were performed by means of classical and molecular cytogenetics, including physical mapping of the multigene 18S and 5S rDNA families. C. boleosoma has 2n = 44 chromosomes (2 submetacentrics + 42 acrocentrics; FN = 46) with a single chromosome pair each carrying 18S and 5S ribosomal sites; whereas C. smaragdus has 2n = 48 chromosomes (2 submetacentrics + 46 acrocentrics; FN = 50), also with a single pair bearing 18S rDNA, but an extensive increase in the number of GC-rich 5S rDNA sites in 21 chromosome pairs. The highly divergent karyotypes among Ctenogobius species contrast with observations in several other marine fish groups, demonstrating an accelerated rate of chromosomal evolution mediated by both chromosomal rearrangements and the extensive dispersion of 5S rDNA sequences in the genome. PMID:24643007

  18. Comparative Studies of 5S rDNA Profiles and Cyt b Sequences in two Onychostoma Species (Cyprinidae)

    PubMed Central

    Han, Chiao-Chuan; Yen, Tsair-Bor; Chen, Nian-Cih; Tseng, Mei-Chen

    2015-01-01

    Onychostoma barbatulum and O. alticorpus, two primarily freshwater cyprinid fish, have similar morphological characters and partially overlapping ecological habitats. In order to explore the genetic differences between these two species, chromosomal characteristics and genetic variations were examined by fluorescence in situ hybridization (FISH) of 5S rDNA and cytochrome (Cyt) b gene analysis. Ten specimens of O. barbatulum and O. alticorpus were collected from the Nanzihsian Stream in southern Taiwan. FISH revealed that the 5S rDNA loci of O. barbatulum and O. alticorpus were found at a pericentromeric and subtelomeric position, respectively, in a pair of submetacentric chromosomes. Cyt b genes were amplified and sequenced from five individuals of each species. Intraspecific genetic distances ranged from 0.001–0.004 in O. barbatulum and from 0.001–0.006 in O. alticorpus. Genetic distances between these two species ranged from 0.132–0.142. The phylogenetic tree showed these two species are not sister species. In conclusion, FISH cytogenetic information and Cyt b gene analyses indicated that these two species have significantly different genetic characteristics; nevertheless, their morphological similarities may be due to environmental adaptation. PMID:26690426

  19. Molecular cytogenetic analysis of the Appenine endemic cyprinid fish Squalius lucumonis and three other Italian leuciscines using chromosome banding and FISH with rDNA probes.

    PubMed

    Rossi, Anna Rita; Milana, Valentina; Hett, Anne Kathrin; Tancioni, Lorenzo

    2012-12-01

    Karyotype and other chromosomal characteristics of the Appenine endemic cyprinid fish, Toscana stream chub Squalius lucumonis, were analysed using conventional banding and FISH with 45S and 5S rDNA probes. The diploid chromosome number (2n = 50) and karyotype characteristics including pericentromeric heterochromatic blocks and GC-rich CMA(3)-positive sites corresponding to both positive Ag-NORs and 45S rDNA loci on the short arms of a single medium-sized submetacentric chromosome pair were consistent with those found in most European leuciscine cyprinids. On other hand, 5S rDNA FISH in the Toscana stream chub and three other Italian leuciscines, S. squalus, Rutilus rubilio and Telestes muticellus, revealed a species-specific hybridization pattern, i.e. signals on four (S. lucumonis), three (S. squalus and R. rubilio) and two (T. muticellus) chromosome pairs. Whereas all the species shared the 5S rDNA loci on the largest subtelocentric chromosome pair, a "leuciscine" cytotaxonomic marker, S. lucumonis showed both classes of rDNA loci tandem aligned on the short arms of chromosome pair No. 12. The present findings suggest that the observed high variability of 5S rDNA loci provides a powerful tool for investigation of karyotype differentiation in karyologically conservative leuciscine fishes. PMID:23238894

  20. Phylogenetic analysis of encapsulated and non-encapsulated Trichinella species by studying the 5S rDNA tandemly repeated intergenic region.

    PubMed

    van der Giessen, J W B; Fonville, M; Briels, I; Pozio, E

    2005-09-01

    The identification of sequence regions in the genomes of pathogens which can be useful to distinguish among species and genotypes, is of great importance for epidemiological, molecular, and phylogenetic studies. The 5S ribosomal DNA intergenic spacer region has been identified as a good target to distinguish among eight Trichinella species and genotypes. The recent discovery of two non-encapsulated species in this genus, Trichinella papuae and Trichinella zimbabwensis, which can infect both mammals and reptiles, has suggested analyzing their 5S rDNA. Amplification of the tandem repeats of the 5S rDNA intergenic region of encapsulated species of Trichinella shows a 751bp fragment, whereas the three non-encapsulated species show a fragment of 800bp with T. pseudospiralis showing an additional fragment of 522bp. Although the size of the 800bp PCR fragments of T. papuae and T. zimbabwensis are similar to that of T. pseudospiralis, there are differences in the 5S rDNA intergenic regions among the three non-encapsulated species. Phylogenetic analysis of the 5S rDNA intergenic regions shows a clustering together of the three non-encapsulated Trichinella species that is well separated from the encapsulated ones. In addition, a single PCR-based method allows distinguishing non-encapsulated and encapsulated species. PMID:16076532

  1. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).

    PubMed

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M

    2011-08-01

    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant. PMID:21364693

  2. Molecular confirmation of the genomic constitution of Douglasdeweya (Triticeae: Poaceae): demonstration of the utility of the 5S rDNA sequence as a tool for haplome identification.

    PubMed

    Baum, Bernard R; Johnson, Douglas A

    2008-06-01

    A new genus Douglasdeweya containing the two species, Douglasdeweya deweyi and D. wangii was published in 2005 by Yen et al. based upon the results of cytogenetical and morphological findings. The genome constitution of Douglasdeweya-PPStSt-allowed its segregation from the genus Pseudoroegneria which contains the StSt or StStStSt genomes. Our previous work had demonstrated the utility of using 5S rDNA units, especially the non-transcribed spacer sequence variation, for the resolution of genomes (haplomes) previously established by cytology. Here, we show that sequence analysis of the 5S DNA units from these species strongly supports the proposed species relationships of Yen et al. (Can J Bot 83:413-419, 2005), i.e., the PP genome from Agropyron and the StSt genome from Pseudoroegneria. Analysis of the 5S rDNA units constitutes a powerful tool for genomic research especially in the Triticeae. PMID:18421479

  3. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

    PubMed Central

    Garcia, S; Kovařík, A

    2013-01-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S–5.8S–26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S–18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S–5.8S–26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants. PMID:23512008

  4. Evidence for 5S rDNA Horizontal Transfer in the toadfish Halobatrachus didactylus (Schneider, 1801) based on the analysis of three multigene families

    PubMed Central

    2012-01-01

    Background The Batrachoididae family is a group of marine teleosts that includes several species with more complicated physiological characteristics, such as their excretory, reproductive, cardiovascular and respiratory systems. Previous studies of the 5S rDNA gene family carried out in four species from the Western Atlantic showed two types of this gene in two species but only one in the other two, under processes of concerted evolution and birth-and-death evolution with purifying selection. Here we present results of the 5S rDNA and another two gene families in Halobatrachus didactylus, an Eastern Atlantic species, and draw evolutionary inferences regarding the gene families. In addition we have also mapped the genes on the chromosomes by two-colour fluorescence in situ hybridization (FISH). Results Two types of 5S rDNA were observed, named type α and type β. Molecular analysis of the 5S rDNA indicates that H. didactylus does not share the non-transcribed spacer (NTS) sequences with four other species of the family; therefore, it must have evolved in isolation. Amplification with the type β specific primers amplified a specific band in 9 specimens of H. didactylus and two of Sparus aurata. Both types showed regulatory regions and a secondary structure which mark them as functional genes. However, the U2 snRNA gene and the ITS-1 sequence showed one electrophoretic band and with one type of sequence. The U2 snRNA sequence was the most variable of the three multigene families studied. Results from two-colour FISH showed no co-localization of the gene coding from three multigene families and provided the first map of the chromosomes of the species. Conclusions A highly significant finding was observed in the analysis of the 5S rDNA, since two such distant species as H. didactylus and Sparus aurata share a 5S rDNA type. This 5S rDNA type has been detected in other species belonging to the Batrachoidiformes and Perciformes orders, but not in the Pleuronectiformes

  5. Molecular cytogenetic analysis of the crucian carp, Carassius carassius (Linnaeus, 1758) (Teleostei, Cyprinidae), using chromosome staining and fluorescence in situ hybridisation with rDNA probes

    PubMed Central

    Spoz, Aneta; Boron, Alicja; Porycka, Katarzyna; Karolewska, Monika; Ito, Daisuke; Abe, Syuiti; Kirtiklis, Lech; Juchno, Dorota

    2014-01-01

    Abstract The crucian carp Carassius carassius (Linnaeus, 1758) is a species with restricted and decreasing distribution in Europe. Six males and six females of the species from the Baltic Sea basin in Poland were examined to show sequentially CMA3/AgNO3 staining pattern, DAPI staining, and, for the first time in literature, molecular cytogenetic analysis using double-colour fluorescence in situ hybridisation (FISH) with 28S and 5S rDNA probes. The karyotype consisted of 20 m, 36 sm and 44 sta chromosomes, NF=156. The AgNO3 stained NORs were most frequently located terminally in the short arms of two sm and two sta elements, and CMA3-positive sites were also observed suggesting abundant GC-rich repetitive DNA in the regions. Other CMA3-positive sites in the short arms of six to ten sm and sta chromosomes were detected. The results based on 28S rDNA FISH confirmed the location of rDNA sites. DAPI-negative staining of NORs suggested the scarcity of AT-rich DNA in the regions. FISH with 5S rDNA probe revealed 8–14 loci (ten and 12 in respectively 49 and 29% of metaphases). They were located in two sm and eight to ten sta chromosomes and six of them were larger than others. Simultaneously, mapping of the two rDNA families on the chromosomes of C. carassius revealed that both 28S and 5S rDNA probes were located in different chromosomes. Molecular cytogenetic data of C. carassius presented here for the first time give an important insight into the structure of chromosomes of this polyploid and declining species and may be useful in its systematics. PMID:25349674

  6. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family

    PubMed Central

    2010-01-01

    Background In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in ~200 species representing the family diversity and other closely related groups. Results Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Conclusions Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units

  7. Cytogenetic comparison between two allopatric populations of Astyanax altiparanae Garutti et Britski, 2000 (Teleostei, Characidae), with emphasis on the localization of 18S and 5S rDNA

    PubMed Central

    Pacheco, Rosiley Berton; da Rosa, Renata; Giuliano-Caetano, Lucia; Júlio Jr., Horácio Ferreira; Dias, Ana Lúcia

    2011-01-01

    Abstract Two populations of Astyanax altiparanae (Garutti & Britski, 2000) of the Água dos Patos stream/SP and lake Igapó/PR were analyzed. All individuals showed 2n = 50, however, different karyotypic formulae were observed. The population of the Água dos Patos stream showed 8m +24sm+6st+12a (NF=88) and the population of lake Igapó, 8m+28sm+4st+10a (NF=90). Nucleolus organizing regions (AgNORs) were observed in the terminal position on the short and long arm of different chromosomes of both populations, showing a variation from 3 to 4 chromosomes. Fluorescent in situ hybridization (FISH) using 18S rDNA probes revealed only one pair of chromosomes with fluorescent signals in the terminal site on the short arm in the Igapó lake population, while the population of Água dos Patos stream showed 4 fluorescence terminal signals, characterizing a system of simple and multiple NORs, respectively. 5S rDNA fluorescent signals were detected in the interstitial position of a pair of chromosomes in the two studied populations. Some AgNOR sites revealed to be GC-rich when stained with Chromomycin A3 (CMA3), however, AT positive regions were not observed. The data obtained show that, despite the conservation of the diploid number and location of 5S DNAr, differences in both the distribution of 18S rDNA and karyotypic formula among the populations were found, thus corroborating the existing data on chromosome variability in Astyanax altiparanae that can be significant for cytotaxonomy in this group. PMID:24260632

  8. Cytogenetic comparison between two allopatric populations of Astyanax altiparanae Garutti et Britski, 2000 (Teleostei, Characidae), with emphasis on the localization of 18S and 5S rDNA.

    PubMed

    Pacheco, Rosiley Berton; da Rosa, Renata; Giuliano-Caetano, Lucia; Júlio, Horácio Ferreira; Dias, Ana Lúcia

    2011-01-01

    Two populations of Astyanax altiparanae (Garutti & Britski, 2000) of the Água dos Patos stream/SP and lake Igapó/PR were analyzed. All individuals showed 2n = 50, however, different karyotypic formulae were observed. The population of the Água dos Patos stream showed 8m +24sm+6st+12a (NF=88) and the population of lake Igapó, 8m+28sm+4st+10a (NF=90). Nucleolus organizing regions (AgNORs) were observed in the terminal position on the short and long arm of different chromosomes of both populations, showing a variation from 3 to 4 chromosomes. Fluorescent in situ hybridization (FISH) using 18S rDNA probes revealed only one pair of chromosomes with fluorescent signals in the terminal site on the short arm in the Igapó lake population, while the population of Água dos Patos stream showed 4 fluorescence terminal signals, characterizing a system of simple and multiple NORs, respectively. 5S rDNA fluorescent signals were detected in the interstitial position of a pair of chromosomes in the two studied populations. Some AgNOR sites revealed to be GC-rich when stained with Chromomycin A3 (CMA3), however, AT positive regions were not observed. The data obtained show that, despite the conservation of the diploid number and location of 5S DNAr, differences in both the distribution of 18S rDNA and karyotypic formula among the populations were found, thus corroborating the existing data on chromosome variability in Astyanax altiparanae that can be significant for cytotaxonomy in this group. PMID:24260632

  9. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

    2016-04-15

    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. PMID:26789074

  10. Chromosomal Mapping of Repetitive DNA Sequences in Five Species of Astyanax (Characiformes, Characidae) Reveals Independent Location of U1 and U2 snRNA Sites and Association of U1 snRNA and 5S rDNA.

    PubMed

    Silva, Duilio M Z A; Utsunomia, Ricardo; Pansonato-Alves, José C; Oliveira, Cláudio; Foresti, Fausto

    2015-01-01

    Astyanax is a genus of Characidae fishes currently composed of 155 valid species. Previous cytogenetic studies revealed high chromosomal diversification among them, and several studies have been performed using traditional cytogenetic techniques to investigate karyotypes and chromosomal locations of 18S and 5S rDNA genes. However, only a few studies are currently available about other repetitive sequences. Here, the chromosomal location of small nuclear RNA genes, identified as U1 and U2 snRNA clusters, was established and compared to the distribution of 5S rDNA and histone clusters in 5 Astyanax species (A. paranae, A. fasciatus, A. bockmanni, A. altiparanae, and A. jordani) using FISH. The cytogenetic mapping of U1 and U2 snRNA demonstrated a conserved pattern in the number of sites per genome independent of the location in Astyanax species. The location of the U1 snRNA gene was frequently associated with 5S rDNA sequences, indicating a possible interaction between the distinct repetitive DNA families. Finally, comparisons involving the location of U1 and U2 snRNA clusters in the chromosomes of Astyanax species revealed a very diverse pattern, suggesting that many rearrangements have occurred during the diversification process of this group. PMID:26329975

  11. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    PubMed Central

    2012-01-01

    Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement) or, less commonly, linked to 35 S rDNA units (L-type). The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6) but not all species. Two species contained major L-type and minor S-type units (termed Ls-type). The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’) is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs. PMID:22716941

  12. The 5S rRNA loop E: chemical probing and phylogenetic data versus crystal structure.

    PubMed Central

    Leontis, N B; Westhof, E

    1998-01-01

    A significant fraction of the bases in a folded, structured RNA molecule participate in noncanonical base pairing interactions, often in the context of internal loops or multi-helix junction loops. The appearance of each new high-resolution RNA structure provides welcome data to guide efforts to understand and predict RNA 3D structure, especially when the RNA in question is a functionally conserved molecule. The recent publication of the crystal structure of the "Loop E" region of bacterial 5S ribosomal RNA is such an event [Correll CC, Freeborn B, Moore PB, Steitz TA, 1997, Cell 91:705-712]. In addition to providing more examples of already established noncanonical base pairs, such as purine-purine sheared pairings, trans-Hoogsteen UA, and GU wobble pairs, the structure provides the first high-resolution views of two new purine-purine pairings and a new GU pairing. The goal of the present analysis is to expand the capabilities of both chemical probing and phylogenetic analysis to predict with greater accuracy the structures of RNA molecules. First, in light of existing chemical probing data, we investigate what lessons could be learned regarding the interpretation of this widely used method of RNA structure probing. Then we analyze the 3D structure with reference to molecular phylogeny data (assuming conservation of function) to discover what alternative base pairings are geometrically compatible with the structure. The comparisons between previous modeling efforts and crystal structures show that the intricate involvements of ions and water molecules in the maintenance of non-Watson-Crick pairs render the process of correctly identifying the interacting sites in such pairs treacherous, except in cases of trans-Hoogsteen A/U or sheared A/G pairs for the adenine N1 site. The phylogenetic analysis identifies A/A, A/C, A/U and C/A, C/C, and C/U pairings isosteric with sheared A/G, as well as A/A and A/C pairings isosteric with both G/U and G/G bifurcated pairings

  13. Localization of 5S and 25S rRNA genes on somatic and meiotic chromosomes in Capsicum species of chili pepper.

    PubMed

    Kwon, Jin-Kyung; Kim, Byung-Dong

    2009-02-28

    The loci of the 5S and 45S rRNA genes were localized on chromosomes in five species of Capsicum, namely, annuum, chacoense, frutescens, baccatum, and chinense by FISH. The 5S rDNA was localized to the distal region of one chromosome in all species observed. The number of 45S rDNA loci varied among species; one in annuum, two in chacoense, frutescens, and chinense, and four in baccatum, with the exceptions that 'CM334' of annuum had three loci and 'tabasco' of frutescens had one locus. 'CM334'-derived BAC clones, 384B09 and 365P05, were screened with 5S rDNA as a probe, and BACs 278M03 and 262A23 were screened with 25S rDNA as a probe. Both ends of these BAC clones were sequenced. FISH with these BAC probes on pachytenes from 'CM334' plant showed one 5S rDNA locus and three 45S rDNA loci, consistent with the patterns on the somatic chromosomes. The 5S rDNA probe was also applied on extended DNA fibers to reveal that its coverage measured as long as 0.439 Mb in the pepper genome. FISH techniques applied on somatic and meiotic chromosomes and fibers have been established for chili to provide valuable information about the copy number variation of 45S rDNA and the actual physical size of the 5S rDNA in chili. PMID:19277503

  14. The specific isolation of complete 5S rDNA units from chromosome 1A of hexaploid, tetraploid, and diploid wheat species using PCR with head-to-head oriented primers.

    PubMed

    Van Campenhout, S; Stappen, J V; Volckaert, G

    2001-08-01

    The presence of 5S rDNA units on chromosome 1A of Triticum aestivum was shown by the development of a specific PCR test, using head-to-head oriented primers. This primer set allowed the amplification of complete 5S DNA units and was used to isolate SS-Rrna-A1 sequences from polyploid and diploid wheat species. Multiple-alignment and parsimony analyses of the 132 sequences divided the sequences into four types. The isolates from T. aestivum and the tetraploid species (T. dicoccoides, T. dicoccum, T durum, T. araraticum, and T timopheevi) were all of one type, which was shown to be closely related to the type mainly characteristic for T. urartu. The other two types were isolated exclusively from the diploid species T. monococcum, T aegilopoides, T. thaoudar, and T. sinskajae and the hexaploid species T. zhukovski. Triticum monococcum was the only species for which representatives of each of the four sequence types were found to be present. Further, we discuss the possible multicluster arrangement of the 5S-Rrna-A1 array. PMID:11550886

  15. Diversity within the genus Elymus (Poaceae: Triticeae) as investigated by the analysis of the nr5S rDNA variation in species with St and H haplomes.

    PubMed

    Baum, B R; Edwards, T; Johnson, D A

    2015-02-01

    The genus Elymus ("Ryegrass") is a repository for a range of species with a variety of haplome contents; hence the pejorative name "dustbin" genus. We have analyzed 1,059 sequences from 128 accessions representing 24 species to investigate the relationships among the StH haplomes-containing species described by Yen and Yang (Genus Elymus Beijing 5:58-362, 2013). Sequences were assigned to "unit classes" of orthologous sequences and subjected to a suite of analyses including BLAST (Basic Local Alignment Search Tool) searches, phylogenetic analysis and population genetic analysis to estimate species diversity. Our results support the genome analyses in Yen and Yang (Genus Elymus Beijing 5:58-362, 2013), i.e., genomic constitution StStHH including variants restricted to Elymus. Population genetic analysis of the 5S nrDNA sequence data revealed that the within-species variance component is roughly ±89 %; thus, we were unable to identify molecular markers capable to separate the 24 species analyzed. Separate phylogenetic analyses of the two unit classes and of all the data exhibit a trend only of the species to cluster on the phylograms. Finally, the analysis provides evidence for the multiple origins of American and Eurasian species. PMID:25248636

  16. Sequence and organization of 5S ribosomal RNA-encoding genes of Arabidopsis thaliana.

    PubMed

    Campell, B R; Song, Y; Posch, T E; Cullis, C A; Town, C D

    1992-03-15

    We have isolated a genomic clone containing Arabidopsis thaliana 5S ribosomal RNA (rRNA)-encoding genes (rDNA) by screening an A. thaliana library with a 5S rDNA probe from flax. The clone isolated contains seven repeat units of 497 bp, plus 11 kb of flanking genomic sequence at one border. Sequencing of individual subcloned repeat units shows that the sequence of the 5S rRNA coding region is very similar to that reported for other flowering plants. Four A. thaliana ecotypes were found to contain approx. 1000 copies of 5S rDNA per haploid genome. Southern-blot analysis of genomic DNA indicates that 5S rDNA occurs in long tandem arrays, and shows the presence of numerous restriction-site polymorphisms among the six ecotypes studied. PMID:1348233

  17. A comparative cytogenetic study of Drosophila parasitoids (Hymenoptera, Figitidae) using DNA-binding fluorochromes and FISH with 45S rDNA probe.

    PubMed

    Gokhman, Vladimir E; Bolsheva, Nadezhda L; Govind, Shubha; Muravenko, Olga V

    2016-06-01

    Karyotypes of Leptopilina boulardi (Barbotin, Carton et Keiner-Pillault, 1979) (n = 9), L. heterotoma (Thomson, 1862) (n = 10), L. victoriae Nordlander, 1980 (n = 10) and Ganaspis xanthopoda (Ashmead, 1896) (n = 9) (Hymenoptera, Figitidae) were studied using DNA-binding ligands with different base specificity [propidium iodide (PI), chromomycin A3 (CMA3) and 4',6-diamidino-2-phenylindole (DAPI)], and fluorescence in situ hybridization (FISH) with a 45S rDNA probe. Fluorochrome staining was similar between the different fluorochromes, except for a single CMA3- and PI-positive and DAPI-negative band per haploid karyotype of each species. FISH with 45S rDNA probe detected a single rDNA site in place of the bright CMA3-positive band, thus identifying the nucleolus organizing region (NOR). Chromosomal locations of NORs were similar for both L. heterotoma and L. victoriae, but strongly differed in L. boulardi as well as in G. xanthopoda. Phylogenetic aspects of NOR localization in all studied species are briefly discussed. PMID:27150102

  18. Chromosomal localization and molecular characterization of three different 5S ribosomal DNA clusters in the sea urchin Paracentrotus lividus.

    PubMed

    Caradonna, Fabio; Bellavia, Daniele; Clemente, Ann Maria; Sisino, Giorgia; Barbieri, Rainer

    2007-09-01

    In this paper the chromosomal localization and molecular cloning and characterization of three 5S rDNA clusters of 700 bp (base pairs), 900 bp, and 950 bp in the sea urchin Paracentrotus lividus are reported. Southern blot hybridization demonstrated the existence of three 5S rDNA repeats of differing length in the P. lividus genome. Fluorescence in situ hybridization analysis, performed in parallel on both haploid and diploid metaphases and interphase nuclei using different 5S rDNA units as probes, localized these 5S rDNA clusters in 3 different pairs of P. lividus chromosomes. This is the first complete gene mapping not only in a sea urchin but also in the phylum of echinoderms as a whole. PMID:17893727

  19. Structure of 4.5S RNA in the signal recognition particle of Escherichia coli as studied by enzymatic and chemical probing.

    PubMed Central

    Lentzen, G; Moine, H; Ehresmann, C; Ehresmann, B; Wintermeyer, W

    1996-01-01

    The structure of 4.5S RNA, the Escherichia coli homologue of the signal recognition particle (SRP) RNA, alone and in the SRP complex with protein P48 (Ffh) was probed both enzymatically and chemically. The molecule is largely resistant against single strand-specific nucleases, indicating a highly base paired structure. Reactivity appears mainly in the apical tetraloop and in one of the conserved internal loops. Although some residues are found reactive toward dimethylsulphate and kethoxal in regions predicted to be unpaired by the phylogenetic secondary structure model of 4.5S RNA, generally the reactivity is low, and some residues in internal loops are not reactive at all. RNase V1 cleaves the RNA at multiple sites that coincide with predicted helices, although the cleavages show a pronounced asymmetry. The binding of protein P48 to 4.5S RNA results in a protection of residues in the apical part of the molecule homologous to eukaryotic SRP RNA (domain IV), whereas the cleavages in the conserved apical tetraloop are not protected. Hydroxyl radical treatment reveals an asymmetric pattern of backbone reactivity; in particular, the region encompassing nucleotides 60-82, i.e., the 3' part of the conserved domain IV, is protected. The data suggest that a bend in the domain IV region, most likely at the central asymmetric internal loop, is an important element of the tertiary structure of 4.5S RNA. Hyperchromicity and lead cleavage data are consistent with the model as they reveal the unfolding of a higher-order structure between 30 and 40 degrees C. Protection by protein P48 occurs in this region of the RNA and, more strongly, in the 5' part of domain IV (nt 26-50, most strongly from 35 to 49). It is likely that P48 binds to the outside of the bent form of 4.5S RNA. PMID:8608448

  20. Analysis of the 5S RNA pool in Arabidopsis thaliana: RNAs are heterogeneous and only two of the genomic 5S loci produce mature 5S RNA.

    PubMed

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5'- and 3'-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array. PMID:11779838

  1. Regulation of Arabidopsis thaliana 5S rRNA Genes.

    PubMed

    Vaillant, Isabelle; Tutois, Sylvie; Cuvillier, Claudine; Schubert, Ingo; Tourmente, Sylvette

    2007-05-01

    The Arabidopsis thaliana genome comprises around 1,000 copies of 5S rRNA genes encoding both major and minor 5S rRNAs. In mature wild-type leaves, the minor 5S rRNA genes are silent. Using different mutants of DNA methyltransferases (met1, cmt3 and met1 cmt3), components of the RNAi pathway (ago4) or post-translational histone modifier (hda6/sil1), we show that the corresponding proteins are needed to maintain proper methylation patterns at heterochromatic 5S rDNA repeats. Using reverse transcription-PCR and cytological analyses, we report that a decrease of 5S rDNA methylation at CG or CNG sites in these mutants leads to the release of 5S rRNA gene silencing which occurred without detectable changes of the 5S rDNA chromatin structure. In spite of severely reduced DNA methylation, the met1 cmt3 double mutant revealed no increase in minor 5S rRNA transcripts. Furthermore, the release of silencing of minor 5S rDNAs can be achieved without increased formation of euchromatic loops by 5S rDNA, and is independent from the global heterochromatin content. Additionally, fluorescence in situ hybridization with centromeric 180 bp repeats confirmed that these highly repetitive sequences, in spite of their elevated transcriptional activity in the DNA methyltransferase mutants (met1, cmt3 and met1 cmt3), remain within chromocenters of the mutant nuclei. PMID:17412735

  2. [Organization of 5S ribosomal DNA of Melitaea trivia].

    PubMed

    Cherevatov, O V; Volkov, R A

    2011-01-01

    Two length variants of 5S rDNA repeated units were detected in the genome of East European butterfly Melitaea trivia. Both repeat variants contain the 5S rRNA coding region of the same length of 120 bp, but possess the intergenic spacer region (IGS) of different size, 78 and 125 bp, respectively. The level of sequence similarity between the two 5S rDNA variants amounts to 43.9-45.5% in the IGS, whereas the coding region appears to be more conservative. In the IGS, microsatellite sequence motives were found; amplification of these motives could be involved in the evolution of the 5S rDNA. PMID:21574431

  3. Analysis of the 5S RNA Pool in Arabidopsis thaliana: RNAs Are Heterogeneous and Only Two of the Genomic 5S Loci Produce Mature 5S RNA

    PubMed Central

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette

    2002-01-01

    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5′- and 3′-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array. [EMBL accession nos: AF330825-AF331032; AF335777-AF335873.] PMID:11779838

  4. Molecular Cytogenetics in Digenean Parasites: Linked and Unlinked Major and 5S rDNAs, B Chromosomes and Karyotype Diversification.

    PubMed

    García-Souto, Daniel; Pasantes, Juan J

    2015-01-01

    Digenetic trematodes are the largest group of internal metazoan parasites, but their chromosomes are poorly studied. Although chromosome numbers and/or karyotypes are known for about 300 of the 18,000 described species, molecular cytogenetic knowledge is mostly limited to the mapping of telomeric sequences and/or of major rDNA clusters in 9 species. In this work we mapped major and 5S rDNA clusters and telomeric sequences in chromosomes of Bucephalus minimus, B. australis, Prosorhynchoides carvajali (Bucephaloidea), Monascus filiformis (Gymnophalloidea), Parorchis acanthus (Echinostomatoidea), Cryptocotyle lingua (Opisthorchioidea), Cercaria longicaudata, Monorchis parvus (Monorchioidea), Diphterostomum brusinae, and Bacciger bacciger (Microphalloidea). Whilst single major and minor rDNA clusters were mapped to different chromosome pairs in B. minimus and P. acanthus, overlapping signals were detected on a single chromosome pair in the remaining taxa. FISH experiments using major rDNA and telomeric probes clearly demonstrated the presence of highly stretched NORs in most of the digenean taxa analyzed. B chromosomes were detected in the B. bacciger samples hosted by Ruditapes decussatus. Although the cercariae specimens obtained from Donax trunculus, Tellina tenuis, and R. decussatus were in agreement with B. bacciger, their karyotypes showed striking morphological differences in agreement with the proposed assignation of these cercariae to different species of the genus Bacciger. Results are discussed in comparison with previous data on digenean chromosomes. PMID:26680763

  5. Variation in rDNA locus number and position among legume species and detection of 2 linked rDNA loci in the model Medicago truncatula by FISH.

    PubMed

    Abirached-Darmency, Mona; Prado-Vivant, Emilce; Chelysheva, Liudmila; Pouthier, Thomas

    2005-06-01

    Within Fabaceae, legume species have a variable genome size, chromosome number, and ploidy level. The genome distribution of ribosomal genes, easily detectable by fluorescent in situ hybridization (FISH), is a good tool for anchoring physical and genetic comparative maps. The organisation of 45S rDNA and 5S loci was analysed by FISH in the 4 closely related species: Pisum sativum, Medicago truncatula, Medicago sativa (2 diploid taxa), and Lathyrus sativus. The 2 types of rDNA arrays displayed interspecific variation in locus number and location, but little intraspecific variation was detected. In the model legume, M. truncatula, the presence of 2 adjacent 45S rDNA loci was demonstrated, and the location of the rDNA loci was independent of the general evolution of the genome DNA. The different parameters relative to clustering of the rDNA loci in specific chromosome regions and the possible basis of rDNA instability are discussed. PMID:16121252

  6. Genomic organization and evolution of the 5S ribosomal DNA in Tilapiini fishes.

    PubMed

    Alves-Costa, F A; Wasko, A P; Oliveira, C; Foresti, F; Martins, C

    2006-05-01

    5S rDNA sequences present an intense dynamism and have proved to be valuable as genetic markers to distinguish closed related species and also in the understanding of the evolutionary dynamic of repetitive sequences in the genomes. In order to identify patterns of 5S rDNA organization and their evolution in the genome of fish species, such genomic segment was investigated in the tilapias Oreochromis niloticus and Tilapia rendalli, and in the hybrid O. urolepis hornorum x O. mossambicus. A dual 5S rDNA system was identified in the three analyzed tilapia samples. Although each 5S rDNA class was conserved among the three samples, a distinct 5S rDNA genome organization pattern could be evidenced for each sample. The presence of a dual 5S rDNA system seems to be a general trait among non-related teleost fish orders, suggesting that evolutionary events of duplication have occurred before the divergence of the main groups of teleost fishes. PMID:16850228

  7. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.

    PubMed

    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto

    2006-05-01

    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes. PMID:16612546

  8. Plant rDNA database: update and new features

    PubMed Central

    Garcia, Sònia; Gálvez, Francisco; Gras, Airy; Kovařík, Aleš; Garnatje, Teresa

    2014-01-01

    The Plant rDNA database (www.plantrdnadatabase.com) is an open access online resource providing detailed information on numbers, structures and positions of 5S and 18S-5.8S-26S (35S) ribosomal DNA loci. The data have been obtained from >600 publications on plant molecular cytogenetics, mostly based on fluorescent in situ hybridization (FISH). This edition of the database contains information on 1609 species derived from 2839 records, which means an expansion of 55.76 and 94.45%, respectively. It holds the data for angiosperms, gymnosperms, bryophytes and pteridophytes available as of June 2013. Information from publications reporting data for a single rDNA (either 5S or 35S alone) and annotation regarding transcriptional activity of 35S loci now appears in the database. Preliminary analyses suggest greater variability in the number of rDNA loci in gymnosperms than in angiosperms. New applications provide ideograms of the species showing the positions of rDNA loci as well as a visual representation of their genome sizes. We have also introduced other features to boost the usability of the Web interface, such as an application for convenient data export and a new section with rDNA–FISH-related information (mostly detailing protocols and reagents). In addition, we upgraded and/or proofread tabs and links and modified the website for a more dynamic appearance. This manuscript provides a synopsis of these changes and developments. Database URL: http://www.plantrdnadatabase.com PMID:24980131

  9. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.

    PubMed

    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng

    2016-07-01

    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location. PMID:27334092

  10. The 5S genes of Drosophila melanogaster.

    PubMed

    Artavanis-Tsakonas, S; Schedl, P; Tschudi, C; Pirrotta, V; Steward, R; Gehring, W J

    1977-12-01

    We have cloned embryonic Drosophila DNA using the poly (dA-DT) connector method (Lobban and Kaiser, 1973) and the ampicillin-resistant plasmid pSF2124 (So, Gill and Falkow, 1975) as a cloning vehicle. Two clones, containing hybrid plasmids with sequences complementary to a 5S RNA probe isolated from Drosophila tissue culture cells, were identified by the Grunstein and Hogness (1975) colony hybridization procedure. One hybrid plasmid has a Drosophila insert which is comprised solely of tandem repeats of the 5S gene plus spacer sequences. The other plasmid contains an insert which has about 20 tandem 5S repeat units plus an additional 4 kilobases of adjacent sequences. The size of the 5S repeat unit was determined by gel electrophoresis and was found to be approximately 375 base pairs. We present a restriction map of both plasmids, and a detailed map of of the5S repeat unit. The 5S repat unit shows slight length and sequence heterogeneity. We present evidence suggesting that the 5S genes in Drosophila melanogaster may be arranged in a single continuous cluster. PMID:413625

  11. Evolution of the MIDTAL microarray: the adaption and testing of oligonucleotide 18S and 28S rDNA probes and evaluation of subsequent microarray generations with Prymnesium spp. cultures and field samples.

    PubMed

    McCoy, Gary R; Touzet, Nicolas; Fleming, Gerard T A; Raine, Robin

    2015-07-01

    The toxic microalgal species Prymnesium parvum and Prymnesium polylepis are responsible for numerous fish kills causing economic stress on the aquaculture industry and, through the consumption of contaminated shellfish, can potentially impact on human health. Monitoring of toxic phytoplankton is traditionally carried out by light microscopy. However, molecular methods of identification and quantification are becoming more common place. This study documents the optimisation of the novel Microarrays for the Detection of Toxic Algae (MIDTAL) microarray from its initial stages to the final commercial version now available from Microbia Environnement (France). Existing oligonucleotide probes used in whole-cell fluorescent in situ hybridisation (FISH) for Prymnesium species from higher group probes to species-level probes were adapted and tested on the first-generation microarray. The combination and interaction of numerous other probes specific for a whole range of phytoplankton taxa also spotted on the chip surface caused high cross reactivity, resulting in false-positive results on the microarray. The probe sequences were extended for the subsequent second-generation microarray, and further adaptations of the hybridisation protocol and incubation temperatures significantly reduced false-positive readings from the first to the second-generation chip, thereby increasing the specificity of the MIDTAL microarray. Additional refinement of the subsequent third-generation microarray protocols with the addition of a poly-T amino linker to the 5' end of each probe further enhanced the microarray performance but also highlighted the importance of optimising RNA labelling efficiency when testing with natural seawater samples from Killary Harbour, Ireland. PMID:25631743

  12. Karyotyping and in situ chromosomal localization of rDNA sites in black cumin Bunium persicum (Boiss) B. Fedtsch,1915 (Apiaceae)

    PubMed Central

    Chahota, R. K.; Mukai, Y.; Chaudhary, H.K.; Kishore, Naval; Sharma, T.R.

    2011-01-01

    Abstract The fluorescent in situ hybridization (FISH) technique has been applied to somatic chromosomes in the medicinally important species, Bunium persicum, to elucidate its karyotypes. The bicolour FISH technique involving 18S-5.8S-26S and 5S ribosomal RNA genes as probes was used to assign physical localization and measurement of rDNA sites on homologous pairs of chromosomes. The two 18S-5.8S-26S rRNA gene sites were at the terminal regions of the short arms of the chromosomes 1 and 2 involving NOR region of chromosome 1. The 5S rDNA sites were found on subtelomeric region of the long arm of the chromosome number 5 and at interstitial regions of the short arm of chromosome 7. Based on direct visual analysis of chromosome length, morphology and position of FISH signals, a pioneer attempt has been made to construct metaphase karyotype in Bunium persicum, an endangered medicinal plant of North Western Himalayas. PMID:24260640

  13. Chaperoning 5S RNA assembly

    PubMed Central

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas

    2015-01-01

    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998

  14. 5 S Rrna Is Involved in Fidelity of Translational Reading Frame

    PubMed Central

    Dinman, J. D.; Wickner, R. B.

    1995-01-01

    Chromosomal mutants (maintenance of frame = mof) in which the efficiency of -1 ribosomal frame-shifting is increased can be isolated using constructs in which lacZ expression is dependent upon a -1 shift of reading frame. We isolate a new mof mutation, mof9, in Saccharomyces cerevisiae and show that it is complemented by both single and multi-copy 5 S rDNA clones. Two independent insertion mutations in the rDNA locus (rDNA::LEU2 and rDNA::URA3) also display the Mof(-) phenotype and are also complemented by single and multi-copy 5 S rDNA clones. Mutant 5 S rRNAs expressed from a plasmid as 20-50% of total 5 S rRNA in a wild-type host also induced the Mof(-) phenotype. The increase in frameshifting is greatest when the lacZ reporter gene is expressed on a high copy, episomal vector. No differences were found in 5 S rRNA copy number or electrophoretic mobilities in mof9 strains. Both mof9 and rDNA::LEU2 increase the efficiency of +1 frameshifting as well but have no effect on readthrough of UAG or UAA termination codons, indicating that not all translational specificity is affected. These data suggest a role for 5 S rRNA in the maintenance of frame in translation. PMID:8536994

  15. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y

    1982-01-01

    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  16. Genetic and cytogenetic analyses of the A genome of Triticum monococcum. VIII. Localization of rDNAs and characterization of 5S rRNA genes.

    PubMed

    Kim, N S; Kuspira, J; Armstrong, K; Bhambhani, R

    1993-02-01

    In situ hybridization with [3H]dCTP labelled pScT7 (5S rDNA) and pTa80 (18S + 26S rDNA) indicated that both hybridized to the terminal regions of two pairs of chromosomes in Triticum monococcum. When the hybridization was performed with a mixture of both probes, only two pairs of chromosome arms were labelled, which suggested that the loci of both genes were located in juxtaposition to one another. Both probes labelled one pair of sites more heavily than the other. Southern analysis of 5S with BamHI-digested DNA from 12 accessions of T. monococcum (including T. urartu) produced two superimposed ladders of approximate sizes of 500 and 330 bp, which differ from T. aestivum in which 500- and 420-bp ladders were found. The 500-bp ladder is derived from chromosome 5A (5SDna-A2) and the 330-bp ladder from chromosome 1A (5SDna-A1). The recognition site for SstI was present in the long spacer region but absent in the short spacer as in T. aestivum; however, unlike T. aestivum, there were HaeIII (GGCC) and HindIII (AAGCTT) recognition sites in the short spacer region. The TaqI recognition sites (TCGA) in the long and short spacer regions are probably more highly methylated in T. monococcum than in T. aestivum. The results have implications regarding the evolutionary changes that occurred in the A genome of the hexaploid compared with the diploid. PMID:18469972

  17. Evolutionary Dynamics of rDNA Clusters in Chromosomes of Five Clam Species Belonging to the Family Veneridae (Mollusca, Bivalvia)

    PubMed Central

    Pérez-García, Concepción; Hurtado, Ninoska S.; Morán, Paloma; Pasantes, Juan J.

    2014-01-01

    The chromosomal changes accompanying bivalve evolution are an area about which few reports have been published. To improve our understanding on chromosome evolution in Veneridae, ribosomal RNA gene clusters were mapped by fluorescent in situ hybridization (FISH) to chromosomes of five species of venerid clams (Venerupis corrugata, Ruditapes philippinarum, Ruditapes decussatus, Dosinia exoleta, and Venus verrucosa). The results were anchored to the most comprehensive molecular phylogenetic tree currently available for Veneridae. While a single major rDNA cluster was found in each of the five species, the number of 5S rDNA clusters showed high interspecies variation. Major rDNA was either subterminal to the short arms or intercalary to the long arms of metacentric or submetacentric chromosomes, whereas minor rDNA signals showed higher variability. Major and minor rDNAs map to different chromosome pairs in all species, but in R. decussatus one of the minor rDNA gene clusters and the major rDNA cluster were located in the same position on a single chromosome pair. This interspersion of both sequences was confirmed by fiber FISH. Telomeric signals appeared at both ends of every chromosome in all species. FISH mapping data are discussed in relation to the molecular phylogenetic trees currently available for Veneridae. PMID:24967400

  18. Evolution of the tetraploid Anemone multifida (2n = 32) and hexaploid A. baldensis (2n = 48) (Ranunculaceae) was accompanied by rDNA loci loss and intergenomic translocation: evidence for their common genome origin

    PubMed Central

    Mlinarec, J.; Šatović, Z.; Malenica, N.; Ivančić-Baće, I.; Besendorfer, V.

    2012-01-01

    Background and Aims In the genus Anemone two small groups of taxa occur with the highest ploidy levels 2n = 6x = 48, belonging to the closely related clades: the montane/alpine Baldensis clade and the more temperate Multifida clade. To understand the formation of polyploids within these groups, the evolution of allohexaploid A. baldensis (AABBDD, 2n = 6x = 48) from Europe and allotetraploid Anemone multifida (BBDD, 2n = 4x = 32) from America was analysed. Methods Internal transcribed spacer and non-transcribed spacer sequences were used as molecular markers for phylogenetic analyses. Cytogenetic studies, including genomic in situ hybridization with genomic DNA of potential parental species as probe, fluorescence in situ hybridization with 5S and 18S rDNA as probes and 18S rDNA restriction analyses, were used to identify the parental origin of chromosomes and to study genomic changes following polyploidization. Key Results This study shows that A. multifida (BBDD, 2n= 4x = 32) and A. baldensis (AABBDD, 2n = 6x = 48) are allopolyploids originating from the crosses of diploid members of the Multifida (donor of the A and B subgenomes) and Baldensis groups (donor of the D subgenome). The A and B subgenomes are closely related to the genomes of A. sylvestris, A. virginiana and A. cylindrica, indicating that these species or their progeny might be the ancestral donors of the B subgenome of A. multifida and A and B subgenomes of A. baldensis. Both polyploids have undergone genomic changes such as interchromosomal translocation affecting B and D subgenomes and changes at rDNA sites. Anemone multifida has lost the 35S rDNA loci characteristic of the maternal donor (B subgenome) and maintained only the rDNA loci of the paternal donor (D subgenome). Conclusions It is proposed that A. multifida and A. baldensis probably had a common ancestor and their evolution was facilitated by vegetation changes during the Quaternary, resulting in their present disjunctive distribution. PMID

  19. Distribution of 18S rDNA sites and absence of the canonical TTAGG insect telomeric repeat in parasitoid Hymenoptera.

    PubMed

    Gokhman, Vladimir E; Anokhin, Boris A; Kuznetsova, Valentina G

    2014-08-01

    Karyotypes of six species belonging to three main clades of parasitoid Hymenoptera, the superfamilies Ichneumonoidea (Ichneumonidae: Ichneumon amphibolus), Cynipoidea (Cynipidae: Diplolepis rosae) and Chalcidoidea (Eurytomidae: Eurytoma robusta, Eu. serratulae and Eu. compressa, and Torymidae: Torymus bedeguaris) were studied using FISH with 18S rDNA and telomeric (TTAGG)n probes. Haploid karyotypes of D. rosae, Eu. robusta and Eu. serratulae carried the only 18S rDNA hybridization signal, whereas those of I. amphibolus and Eu. compressa carried three and two rDNA clusters respectively. In addition, three rDNA sites were visualized in the aneuploid female of T. bedeguaris. The number of rDNA clusters in parasitoid Hymenoptera generally correlates to the chromosome number. Apart from the overwhelming majority of the studied species of aculeate Hymenoptera, no hybridization signals were obtained from FISH with the telomeric (TTAGG)n probe in the examined parasitoid species. These data suggest absence of the canonical (TTAGG)n insect telomeric motif in the Ichneumonoidea, Cynipoidea and Chalcidoidea, and perhaps in parasitoid Hymenoptera in general. PMID:24992984

  20. Development of genome-specific 5S rDNA markers in Brassica and related species for hybrid testing.

    PubMed

    La Mura, Maurizio; Norris, Carol; Sporle, Sue; Jayaweera, Dasuni; Greenland, Andy; Lee, David

    2010-08-01

    The Brassicaceae are targets for DNA manipulation to modify oil content and composition. However, any strategy for creating novel products using genetic modification or traditional breeding must take into account the potential for hybridization with other Brassica species, many of which are important sources of edible oils. In this study we have tested Brassica carinata, a possible target for oil modification, to establish whether it can cross with other Brassica species and related genera, and we have developed molecular DNA assays to confirm hybridization. PMID:20725152

  1. Pump-probe photoelectron velocity-map imaging of autoionizing singly excited 4s{sup 1}4p{sup 6}np{sup 1}(n=7,8) and doubly excited 4s{sup 2}4p{sup 4}5s{sup 1}6p{sup 1} resonances in atomic krypton

    SciTech Connect

    Doughty, Benjamin; Haber, Louis H.; Leone, Stephen R.

    2011-10-15

    Pump-probe photoelectron velocity-map imaging, using 27-eV high-harmonic excitation and 786-nm ionization, is used to resolve overlapping autoionizing resonances in atomic krypton, obtaining two-photon photoelectron angular distributions (PADs) for singly and doubly excited states. Two features in the photoelectron spectrum are assigned to singly excited 4s{sup 1}4p{sup 6}np{sup 1} (n = 7,8) configurations and four features provide information about double excitation configurations. The anisotropy parameters for the singly excited 7p configuration are measured to be {beta}{sub 2} = 1.61 {+-} 0.06 and {beta}{sub 4} = 1.54 {+-} 0.16 while the 8p configuration gives {beta}{sub 2} = 1.23 {+-} 0.19 and {beta}{sub 4} = 0.60 {+-} 0.15. These anisotropies most likely represent the sum of overlapping PADs from states of singlet and triplet spin multiplicities. Of the four bands corresponding to ionization of doubly excited states, two are assigned to 4s{sup 2}4p{sup 4}5s{sup 1}6p{sup 1} configurations that are probed to different J-split ion states. The two remaining doubly excited states are attributed to a previously observed, but unassigned, resonance in the vacuum-ultraviolet photoabsorption spectrum. The PADs from each of the double excitation states are also influenced by overlap from neighboring states that are not completely spectrally resolved. The anisotropies of the observed double excitation states are reported, anticipating future theoretical and experimental work to separate the overlapping PADs into the state resolved PADs. The results can be used to test theories of excited state ionization.

  2. Two thraustochytrid 5S ribosomal RNAs.

    PubMed Central

    MacKay, R M; Doolittle, W F

    1982-01-01

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  3. Two thraustochytrid 5S ribosomal RNAs.

    PubMed

    MacKay, R M; Doolittle, W F

    1982-12-20

    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  4. The karyotype and 5S rRNA genes from Spanish individuals of the bat species Rhinolophus hipposideros (Rhinolophidae; Chiroptera).

    PubMed

    Puerma, Eva; Acosta, Manuel J; Barragán, Maria José L; Martínez, Sergio; Marchal, Juan Alberto; Bullejos, Mónica; Sánchez, Antonio

    2008-11-01

    The karyotype of individuals of the species Rhinolophus hipposideros from Spain present a chromosome number of 2n = 54 (NFa = 62). The described karyotype for these specimens is very similar to another previously described in individual from Bulgaria. However, the presence of one additional pair of autosomal acrocentric chromosomes in the Bulgarian karyotype and the differences in X chromosome morphology indicated that we have described a new karyotype variant in this species. In addition, we have analyzed several clones of 1.4 and 1 kb of a PstI repeated DNA sequence from the genome of R. hipposideros. The repeated sequence included a region with high identity with the 5S rDNA genes and flanking regions, with no homology with GenBank sequences. Search for polymerase III regulatory elements demonstrated the presence of type I promoter elements (A-box, Intermediate Element and C-box) in the 5S rDNA region. In addition, upstream regulatory elements, as a D-box and Sp1 binding sequences, were present in flanking regions. All data indicated that the cloned repeated sequences are the functional rDNA genes from this species. Finally, FISH demonstrated the presence of rDNA in nine chromosome pairs, which is surprising as most mammals have only one carrier chromosome pair. PMID:18066670

  5. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae)

    PubMed Central

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo

    2013-01-01

    Abstract Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 ‘Azul’, Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700

  6. Multiple rDNA units distributed on all chromosomes of Nosema bombycis.

    PubMed

    Liu, Handeng; Pan, Guoqing; Song, Shihong; Xu, Jinshan; Li, Tian; Deng, Yanbo; Zhou, Zeyang

    2008-10-01

    Among Microsporidia, Nosema bombycis has a novel arrangement of LSUrRNA, SSUrRNA, ITS, IGS and 5SrRNA. To determine the distribution of rDNA among the chromosomes, we performed genome-wide screening and Southern blotting with three probes (SSU, ITS and IGS). Southern blotting revealed that ribosomal RNA genes are distributed on all chromosomes of N. bombycis, which is contrary to the previous result, which concluded that the N. bombycis rRNA genes were limited to a single chromosome. This wide distribution is similar to that of the rDNA unit of Encephalitozoon cuniculi. Screening of the N. bombycis genome detected 53 LSUrRNA elements, 43 SSUrRNA elements and 36 5SrRNA elements. However, it is still difficult to determine their loci on the chromosomes as the genomic map is unfinished. PMID:18640121

  7. Nucleotide excision repair of the 5 S ribosomal RNA gene assembled into a nucleosome.

    PubMed

    Liu, X; Smerdon, M J

    2000-08-01

    A-175-base pair fragment containing the Xenopus borealis somatic 5 S ribosomal RNA gene was used as a model system to determine the effect of nucleosome assembly on nucleotide excision repair (NER) of the major UV photoproduct (cyclobutane pyrimidine dimer (CPD)) in DNA. Xenopus oocyte nuclear extracts were used to carry out repair in vitro on reconstituted, positioned 5 S rDNA nucleosomes. Nucleosome structure strongly inhibits NER at many CPD sites in the 5 S rDNA fragment while having little effect at a few sites. The time course of CPD removal at 35 different sites indicates that >85% of the CPDs in the naked DNA fragment have t(12) values <2 h, whereas <26% of the t(12) values in nucleosomes are <2 h, and 15% are >8 h. Moreover, removal of histone tails from these mononucleosomes has little effect on the repair rates. Finally, nucleosome inhibition of repair shows no correlation with the rotational setting of a 14-nucleotide-long pyrimidine tract located 30 base pairs from the nucleosome dyad. These results suggest that inhibition of NER by mononucleosomes is not significantly influenced by the rotational orientation of CPDs on the histone surface, and histone tails play little (or no) role in this inhibition. PMID:10821833

  8. Fragile Sites of 'Valencia' Sweet Orange (Citrus sinensis) Chromosomes Are Related with Active 45s rDNA.

    PubMed

    Lan, Hong; Chen, Chun-Li; Miao, Yin; Yu, Chang-Xiu; Guo, Wen-Wu; Xu, Qiang; Deng, Xiu-Xin

    2016-01-01

    Citrus sinensis chromosomes present a morphological differentiation of bands after staining by the fluorochromes CMA and DAPI, but there is still little information on its chromosomal characteristics. In this study, the chromosomes in 'Valencia' C. sinensis were analyzed by fluorescence in situ hybridization (FISH) using telomere DNA and the 45S rDNA gene as probes combining CMA/DAPI staining, which showed that there were two fragile sites in sweet orange chromosomes co-localizing at distended 45S rDNA regions, one proximally locating on B-type chromosome and the other subterminally locating on D-type chromosome. While the chromosomal CMA banding and 45S rDNA FISH mapping in the doubled haploid line of 'Valencia' C. sinensis indicated six 45S rDNA regions, four were identified as fragile sites as doubled comparing its parental line, which confirmed the cytological heterozygosity and chromosomal heteromorphisms in sweet orange. Furthermore, Ag-NOR identified two distended 45S rDNA regions to be active nucleolar organizing regions (NORs) in diploid 'Valencia' C. sinensis. The occurrence of quadrivalent in meiosis of pollen mother cells (PMCs) in 'Valencia' sweet orange further confirmed it was a chromosomal reciprocal translocation line. We speculated this chromosome translocation was probably related to fragile sites. Our data provide insights into the chromosomal characteristics of the fragile sites in 'Valencia' sweet orange and are expected to facilitate the further investigation of the possible functions of fragile sites. PMID:26977938

  9. Variability of 18rDNA loci in four lace bug species (Hemiptera, Tingidae) with the same chromosome number

    PubMed Central

    Golub, Natalia V.; Golub, Viktor B.; Kuznetsova, Valentina G.

    2015-01-01

    Abstract Male karyotypes of Elasmotropis testacea (Herrich-Schaeffer, 1835), Tingis cardui (Linnaeus, 1758), Tingis crispata (Herrich-Schaeffer, 1838), and Agramma femorale Thomson, 1871 (Heteroptera, Cimicomorpha, Tingidae) were analyzed using conventional chromosome staining and FISH with 18S rDNA and (TTAGG)n telomeric probes. The FISH technique was applied for the first time in the Tingidae. In spite of the fact that all species showed the same chromosome number (2n = 12 + XY), they have significant differences in the number and position of rDNA loci. FISH with the classical insect (TTAGG)n probe produced no signals on chromosomes suggesting telomeres in lace bugs to be of some other molecular composition. Tingidae share absence of the (TTAGG)n telomeric sequence with all so far studied taxa of the advanced true bug infraorders Cimicomorpha and Pentatomomorpha. PMID:26753071

  10. Distribution of 5-methylcytosine residues in 5S rRNA genes in Arabidopsis thaliana and Secale cereale.

    PubMed

    Fulnecek, J; Matyásek, R; Kovarík, A

    2002-12-01

    Bisulfite genomic sequencing was used to localise 5-methylcytosine residues (mC) in 5S rRNA genes of Arabidopsis thaliana and Secale cereale. The maps of mC distribution were compared with the previously published map of the corresponding region in Nicotiana tabacum. In all three species, the level of methylation of 5S rRNA genes was generally higher than the average for the entire genome. The ratio of 5S rDNA methylation to average overall methylation was 44%/30-33% for N. tabacum, 27%/4-6% for A. thaliana and 24%/20-22% for S. cereale. With the exception of one clone from S. cereale, no methylation-free 5S rDNA was detected. The level of methylation at different sequence motifs in 5S rDNA was calculated for N. tabacum/A. thaliana/ S. cereale, and this analysis yielded the following values (expressed as a percentage of total C): mCG 90%/78%/85%, mCWG 89%/41%/53%, mCmCG 72%/32%/16%, mCCG 4%/2%/0%, mCHH 15%/6%/1%, where W=A or T, and H=A or C or T. Non-symmetrical methylation was almost negligible in the large genome of S. cereale but relatively frequent in N. tabacum and A. thaliana, suggesting that the strict correlation between genome size and cytosine methylation might be violated for this type of methylation. Among non-symmetrical motifs the mCWA triplets were significantly over-represented in Arabidopsis, while in tobacco this preference was not as pronounced. The differences in methylation levels in different sequence contexts might be of phylogenetic significance, but further species in related and different taxa need to be studied before firm conclusions can be drawn. PMID:12471448

  11. Development of a mitochondrial 12S rDNA analysis for distinguishing Sciuridae species with potential to transmit Ehrlichia and Borrelia species to feeding Amblyomma americanum (Acari: Ixodidae).

    PubMed

    Goessling, Lisa S; Allan, Brian F; Mandelbaum, Rachel S; Thach, Robert E

    2012-05-01

    Unique oligonucleotide probes were synthesized to distinguish among closely related vertebrate mitochondrial rDNA sequences present in residual bloodmeals in emergent Amblyomma americanum (L.) (Acari: Ixodidae) nymph life-stage ticks. Use of these probes enabled the identification of the Eastern gray squirrel as an important bloodmeal source in nymphs harboring Ehrlichia and Borrelia species. These results were confirmed by identifying these same bacterial genera in Eastern gray squirrel tissues. PMID:22679888

  12. Functional variants of 5S rRNA in the ribosomes of common sea urchin Paracentrotus lividus.

    PubMed

    Dimarco, Eufrosina; Cascone, Eleonora; Bellavia, Daniele; Caradonna, Fabio

    2012-10-15

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus; this study, performed at DNA level only, lends itself as starting point to verify that these clusters could contain transcribed genes, then, to demonstrate the presence of heterogeneity at functional RNA level, also. In the present work we report in P. lividus ribosomes the existence of several transcribed variants of the 5S rRNA and we associate all transcribed variants to the cluster to which belong. Our finding is the first demonstration of the presence of high heterogeneity in functional 5S rRNA molecules in animal ribosomes, a feature that had been considered a peculiarity of some plants. PMID:22967708

  13. Fragile Sites of ‘Valencia’ Sweet Orange (Citrus sinensis) Chromosomes Are Related with Active 45s rDNA

    PubMed Central

    Lan, Hong; Chen, Chun-Li; Miao, Yin; Yu, Chang-Xiu; Guo, Wen-Wu; Xu, Qiang; Deng, Xiu-Xin

    2016-01-01

    Citrus sinensis chromosomes present a morphological differentiation of bands after staining by the fluorochromes CMA and DAPI, but there is still little information on its chromosomal characteristics. In this study, the chromosomes in ‘Valencia’ C. sinensis were analyzed by fluorescence in situ hybridization (FISH) using telomere DNA and the 45S rDNA gene as probes combining CMA/DAPI staining, which showed that there were two fragile sites in sweet orange chromosomes co-localizing at distended 45S rDNA regions, one proximally locating on B-type chromosome and the other subterminally locating on D-type chromosome. While the chromosomal CMA banding and 45S rDNA FISH mapping in the doubled haploid line of ‘Valencia’ C. sinensis indicated six 45S rDNA regions, four were identified as fragile sites as doubled comparing its parental line, which confirmed the cytological heterozygosity and chromosomal heteromorphisms in sweet orange. Furthermore, Ag-NOR identified two distended 45S rDNA regions to be active nucleolar organizing regions (NORs) in diploid ‘Valencia’ C. sinensis. The occurrence of quadrivalent in meiosis of pollen mother cells (PMCs) in ‘Valencia’ sweet orange further confirmed it was a chromosomal reciprocal translocation line. We speculated this chromosome translocation was probably related to fragile sites. Our data provide insights into the chromosomal characteristics of the fragile sites in ‘Valencia’ sweet orange and are expected to facilitate the further investigation of the possible functions of fragile sites. PMID:26977938

  14. Rapid detection of mutations associated with resistance to erythromycin in Campylobacter jejuni/coli by PCR and line probe assay.

    PubMed

    Niwa, H; Chuma, T; Okamoto, K; Itoh, K

    2001-10-01

    Mutation of 23S rDNA is one of the mechanisms of erythromycin resistance. PCR and line probe assay (PCR-LiPA) with ten oligonucleotide probes were developed to detect the mutations associated with macrolide resistance at positions of 2072, 2073 and 2074 in 23S rDNA of Campylobacter jejuni/coli. A2074-->G mutation was detected in 12 of 25 isolates, which were resistant to erythromycin. No other mutations in 23S rDNA were detected. The rest of the strains were susceptible to erythromycin and no mutation in 23S rDNA was detected. Six laboratory induced erythromycin resistant mutants had no mutations in 23S rDNA. PCR-LiPA is a useful and rapid method to detect mutations in 23S rDNA associated with erythromycin resistance in C. jejuni/coli. PMID:11691569

  15. Physical mapping of 5S and 18S-5.8S-26S RNA gene families in polyploid series of Cenchrus ciliaris Linnaeus, 1771 (Poaceae)

    PubMed Central

    Kharrat-Souissi, Amina; Siljak-Yakovlev, Sonja; Pustahija, Fatima; Chaieb, Mohamed

    2012-01-01

    Abstract The Buffelgrass (Cenchrus ciliaris L., Poaceae) is one of the most important pasturage grasses due to its high productivity and good forage qualities. This species possess a high adaptability to bioclimatic constraints of arid zones and may be used for the restoration of degraded arid ecosystems. Tunisian populations present three ploidy levels (4x, 5x and 6x) with a basic chromosome number x=9. This study reported for the first time the distribution of the ribosomal genes (rRNA) for pentaploid and hexaploid cytotypes of Cenchrus ciliaris. Molecular cytogenetic study using double fluorescence in situ hybridization has shown that the two rDNA families, 5S and 18S-5.8S-26S (18S), displayed intraspecific variation in number of loci among different ploidy levels. Each ploidy level was characterized by specific number of both 5S and 18S rDNA loci (two loci in tetraploid, five in pentaploid and six in hexaploid level). For three studied cytotypes (4x, 5x and 6x) all 5S rDNA loci were localized on the subcentromeric region of chromosomes, while 18S loci were situated on the telomeric region of short chromosome arms. Data of the FISH experiments show proportional increase of ribosomal loci number during polyploidization processes. PMID:24260668

  16. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.

    1996-01-01

    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  17. Molecular phylogenetic studies on filarial parasites based on 5S ribosomal spacer sequences.

    PubMed

    Xie, H; Bain, O; Williams, S A

    1994-06-01

    This paper is the first large-scale molecular phylogenetic study on filarial parasites (family Onchocercidae) which includes 16 species of 6 genera: Brugia beaveri Ash et Little, 1962, B. buckleyi Dissanaike et Paramananthan, 1961; B. malayi (Brug, 1927) Buckley, 1960; B. pahangi (Buckley et Edeson, 1956) Buckley, 1960; B. patei (Buckley, Nelson et Heisch, 1958) Buckley, 1960; B. timori Partono et al, 1977; Wuchereria bancrofti (Cobbold, 1877) Seurat, 1921: W. kalimantani Palmieri. Purnomo, Dennis and Marwoto, 1980: Mansonella perstans (Manson, 1891) Eberhard et Orihel, 1984; loa loc, Stiles, 1905; Onchocerca volvulus (Leuckart, 1983) Railliet er Henry, 1910; O. ochengi Bwangamoi, 1969; O. gutturosa Neumann, 1910; Dirofilaria immitis (Leidy, 1856) Railliet e Henry, 1911; Acanthocheilonema viteae (Krepkogorskaya, 1933) Bain, Baker et Chabaud, 1982 and Litomosoides sigmodontis Chandler, 1931. 5S rRNA gene spacer region sequence data were collected by PCR, cloning and dideoxy sequencing. The 5S rRNA gene spacer region sequences were aligned and analyzed by maximum parsimony algorithms, distance methods and maximum likelihood methods to construct phylogenetic trees. Bootstrap analysis was used to test the robustness of the different phylogenetic reconstructions. The data indicated that 5S spacer region sequences are highly conserved within species yet differ significantly between species. Spliced leader sequences were observed in all of the 5S rDNA spacers with no sequence variation, although flanking region sequence and length heterogeneity was observed even within species. All of the various tree-building methods gave very similar results. This study identified four clades which are strongly supported by bootstrap analysis the Brugia clade; the Wuchereria clade; the Brugia-Wuchereria clade and the Onchocerca clade. The analyses indicated that L. sigmodontis and A. viteae may be the most primitive among the 16 species studied. The data did not show any close

  18. Cytogenetic Diversity and the Evolutionary Dynamics of rDNA Genes and Telomeric Sequences in the Ancistrus Genus (Loricariidae: Ancistrini).

    PubMed

    Favarato, Ramon Marin; Silva, Maelin da; Oliveira, Renildo Ribeiro de; Artoni, Roberto Ferreira; Feldberg, Eliana; Matoso, Daniele Aparecida

    2016-04-01

    The Ancistrus genus differs from other Ancistrini due to its wide karyotypic diversity, varied diploid numbers, differences in sex chromosomes, and large number of species, as well as its tendency to form small populations with low vagility. This study investigated the role of 5S and 18S rDNA and telomeric repetitive sequences in the evolution of the karyotypic macrostructure of seven species of the genus Ancistrus from the Central Amazon. The results indicate a strong correlation between the location of ribosomal sites and fragile sites in the genome, particularly of 5S rDNA sequences, which are associated, in some species, with telomeric sequences at the sites of chromosomal healing. Moreover, the occurrence of two lineages was observed with regard to the synteny of ribosomal genes. The species of the genus Ancistrus showed high chromosomal lability associated with breakpoints, which was characterized by the presence of repetitive DNA sequences and this process is suggested to be an evolutionary model for the rapid fixation of structural rearrangements. PMID:26829587

  19. Randomly Detected Genetically Modified (GM) Maize (Zea mays L.) near a Transport Route Revealed a Fragile 45S rDNA Phenotype

    PubMed Central

    Waminal, Nomar Espinosa; Ryu, Ki Hyun; Choi, Sun-Hee; Kim, Hyun Hee

    2013-01-01

    Monitoring of genetically modified (GM) crops has been emphasized to prevent their potential effects on the environment and human health. Monitoring of the inadvertent dispersal of transgenic maize in several fields and transport routes in Korea was carried out by qualitative multiplex PCR, and molecular analyses were conducted to identify the events of the collected GM maize. Cytogenetic investigations through fluorescence in situ hybridization (FISH) of the GM maize were performed to check for possible changes in the 45S rDNA cluster because this cluster was reported to be sensitive to replication and transcription stress. Three GM maize kernels were collected from a transport route near Incheon port, Korea, and each was found to contain NK603, stacked MON863 x NK603, and stacked NK603 x MON810 inserts, respectively. Cytogenetic analysis of the GM maize containing the stacked NK603 x MON810 insert revealed two normal compact 5S rDNA signals, but the 45S rDNA showed a fragile phenotype, demonstrating a “beads-on-a-string” fragmentation pattern, which seems to be a consequence of genetic modification. Implications of the 45S rDNA cluster fragility in GM maize are also discussed. PMID:24040165

  20. Dysfunction of Chromatin Assembly Factor 1 Induces Shortening of Telomeres and Loss of 45S rDNA in Arabidopsis thaliana[W][OA

    PubMed Central

    Mozgová, Iva; Mokroš, Petr; Fajkus, Jiří

    2010-01-01

    Chromatin Assembly Factor 1 (CAF1) is a three-subunit H3/H4 histone chaperone responsible for replication-dependent nucleosome assembly. It is composed of CAC 1-3 in yeast; p155, p60, and p48 in humans; and FASCIATA1 (FAS1), FAS2, and MULTICOPY SUPPRESSOR OF IRA1 in Arabidopsis thaliana. We report that disruption of CAF1 function by fas mutations in Arabidopsis results in telomere shortening and loss of 45S rDNA, while other repetitive sequences (5S rDNA, centromeric 180-bp repeat, CACTA, and Athila) are unaffected. Substantial telomere shortening occurs immediately after the loss of functional CAF1 and slows down at telomeres shortened to median lengths around 1 to 1.5 kb. The 45S rDNA loss is progressive, leaving 10 to 15% of the original number of repeats in the 5th generation of mutants affecting CAF1, but the level of the 45S rRNA transcripts is not altered in these mutants. Increasing severity of the fas phenotype is accompanied by accumulation of anaphase bridges, reduced viability, and plant sterility. Our results show that appropriate replication-dependent chromatin assembly is specifically required for stable maintenance of telomeres and 45S rDNA. PMID:20699390

  1. Chromosomal organization of the 18S and 5S rRNAs and histone H3 genes in Scarabaeinae coleopterans: insights into the evolutionary dynamics of multigene families and heterochromatin

    PubMed Central

    2011-01-01

    Background Scarabaeinae beetles show a high level of macro-chromosomal variability, although the karyotypic organization of heterochromatin and multigene families (rDNAs and histone genes) is poorly understood in this group. To better understand the chromosomal organization and evolution in this group, we analyzed the karyotypes, heterochromatin distribution and chromosomal locations of the rRNAs and histone H3 genes in beetles belonging to eight tribes from the Scarabaeinae subfamily (Coleoptera, Scarabaeidae). Results The number of 18S rRNA gene (a member of the 45S rDNA unit) sites varied from one to 16 and were located on the autosomes, sex chromosomes or both, although two clusters were most common. Comparison of the 45S rDNA cluster number and the diploid numbers revealed a low correlation value. However, a comparison between the number of 45S rDNA sites per genome and the quantity of heterochromatin revealed (i) species presenting heterochromatin restricted to the centromeric/pericentromeric region that contained few rDNA sites and (ii) species with a high quantity of heterochromatin and a higher number of rDNA sites. In contrast to the high variability for heterochromatin and 45S rDNA cluster, the presence of two clusters (one bivalent cluster) co-located on autosomal chromosomes with the 5S rRNA and histone H3 genes was highly conserved. Conclusions Our results indicate that the variability of the 45S rDNA chromosomal clusters is not associated with macro-chromosomal rearrangements but are instead related to the spread of heterochromatin. The data obtained also indicate that both heterochromatin and the 45S rDNA loci could be constrained by similar evolutionary forces regulating spreading in the distinct Scarabaeinae subfamily lineages. For the 5S rRNA and the histone H3 genes, a similar chromosomal organization could be attributed to their association/co-localization in the Scarabaeinae karyotypes. These data provide evidence that different evolutionary

  2. Compilation of 5S rRNA and 5S rRNA gene sequences

    PubMed Central

    Specht, Thomas; Wolters, Jörn; Erdmann, Volker A.

    1990-01-01

    The BERLIN RNA DATABANK as of Dezember 31, 1989, contains a total of 667 sequences of 5S rRNAs or their genes, which is an increase of 114 new sequence entries over the last compilation (1). It covers sequences from 44 archaebacteria, 267 eubacteria, 20 plastids, 6 mitochondria, 319 eukaryotes and 11 eukaryotic pseudogenes. The hardcopy shows only the list (Table 1) of those organisms whose sequences have been determined. The BERLIN RNA DATABANK uses the format of the EMBL Nucleotide Sequence Data Library complemented by a Sequence Alignment (SA) field including secondary structure information. PMID:1692116

  3. Chromosomal mapping of H3 histone and 5S rRNA genes in eight species of Astyanax (Pisces, Characiformes) with different diploid numbers: syntenic conservation of repetitive genes.

    PubMed

    Piscor, Diovani; Parise-Maltempi, Patricia Pasquali

    2016-03-01

    The genus Astyanax is widely distributed from the southern United States to northern Patagonia, Argentina. While cytogenetic studies have been performed for this genus, little is known about the histone gene families. The aim of this study was to examine the chromosomal relationships among the different species of Astyanax. The chromosomal locations of the 5S rRNA and H3 histone genes were determined in A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, A. mexicanus (all 2n = 50), A. fasciatus (2n = 46), and A. schubarti (2n = 36). All eight species exhibited H3 histone clusters on two chromosome pairs. In six species (A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, and A. fasciatus), syntenic clusters of H3 histone and 5S rDNA were observed on metacentric (m) or submetacentric (sm) chromosomes. In seven species, clusters of 5S rDNA sequences were located on one or two chromosome pairs. In A. mexicanus, 5S rDNA clusters were located on four chromosome pairs. This study demonstrates that H3 histone clusters are conserved on two chromosome pairs in the genus Astyanax, and specific chromosomal features may contribute to the genomic organization of the H3 histone and 5S rRNA genes. PMID:26835745

  4. Conserved Organisation of 45S rDNA Sites and rDNA Gene Copy Number among Major Clades of Early Land Plants.

    PubMed

    Rosato, Marcela; Kovařík, Aleš; Garilleti, Ricardo; Rosselló, Josep A

    2016-01-01

    Genes encoding ribosomal RNA (rDNA) are universal key constituents of eukaryotic genomes, and the nuclear genome harbours hundreds to several thousand copies of each species. Knowledge about the number of rDNA loci and gene copy number provides information for comparative studies of organismal and molecular evolution at various phylogenetic levels. With the exception of seed plants, the range of 45S rDNA locus (encoding 18S, 5.8S and 26S rRNA) and gene copy number variation within key evolutionary plant groups is largely unknown. This is especially true for the three earliest land plant lineages Marchantiophyta (liverworts), Bryophyta (mosses), and Anthocerotophyta (hornworts). In this work, we report the extent of rDNA variation in early land plants, assessing the number of 45S rDNA loci and gene copy number in 106 species and 25 species, respectively, of mosses, liverworts and hornworts. Unexpectedly, the results show a narrow range of ribosomal locus variation (one or two 45S rDNA loci) and gene copies not present in vascular plant lineages, where a wide spectrum is recorded. Mutation analysis of whole genomic reads showed higher (3-fold) intragenomic heterogeneity of Marchantia polymorpha (Marchantiophyta) rDNA compared to Physcomitrella patens (Bryophyta) and two angiosperms (Arabidopsis thaliana and Nicotiana tomentosifomis) suggesting the presence of rDNA pseudogenes in its genome. No association between phylogenetic position, taxonomic adscription and the number of rDNA loci and gene copy number was found. Our results suggest a likely evolutionary rDNA stasis during land colonisation and diversification across 480 myr of bryophyte evolution. We hypothesise that strong selection forces may be acting against ribosomal gene locus amplification. Despite showing a predominant haploid phase and infrequent meiosis, overall rDNA homogeneity is not severely compromised in bryophytes. PMID:27622766

  5. Male meiosis, heterochromatin characterization and chromosomal location of rDNA in Microtomus lunifer (Berg, 1900) (Hemiptera: Reduviidae: Hammacerinae)

    PubMed Central

    Poggio, María Georgina; Bressa, María José; Papeschi, Alba Graciela

    2011-01-01

    Abstract In the present work, we analysed the male meiosis, the content and distribution of heterochromatin and the number and location of nucleolus organizing regions in Microtomus lunifer (Berg, 1900) by means of standard technique, C- and fluorescent bandings, and fluorescent in situ hybridization with an 18S rDNA probe. This species is the second one cytogenetically analysed within the Hammacerinae. Its male diploid chromosome number is 31 (2n=28+X1X2Y), including a minute pair of m-chromosomes. The diploid autosomal number and the presence of m-chromosomes are similar to those reported in Microtomus conspicillaris (Drury, 1782) (2n=28+XY). However, Microtomus lunifer has a multiple sex chromosome system X1X2Y (male) that could have originated by fragmentation of the ancestral X chromosome. Taking into account that Microtomus conspicillaris and Microtomus lunifer are the only two species within Reduviidae that possess m-chromosomes, the presence of this pair could be a synapomorphy for the species of this genus. C- and fluorescent bandings showed that the amount of heterochromatin in Microtomus lunifer was small, and only a small CMA3 bright band was observed in the largest autosomal pair at one terminal region. FISH with the 18S rDNA probe demonstrated that ribosomal genes were terminally placed on the largest autosomal pair. Our present results led us to propose that the location of rDNA genes could be associated with variants of the sex chromosome systems in relation with a kind of the sex chromosome systems within this family. Furthermore, the terminal location of NOR in the largest autosomal pair allowed us to use it as a chromosome marker and, thus, to infer that the kinetic activity of both ends is not a random process, and there is an inversion of this activity. PMID:24260616

  6. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    NASA Technical Reports Server (NTRS)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.

    1982-01-01

    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  7. Mouse Oocytes Transcribe Injected Xenopus 5S RNA Gene

    PubMed Central

    Brinster, Ralph L.; Chen, Howard Y.; Trumbauer, Myrna E.

    2016-01-01

    Transcripts produced after injection of the Xenopus 5S RNA gene into oocyte germinal vesicles of mice migrate electrophoretically with the 5S RNA marker, an indication that the gene is transcribed and processed with considerable accuracy, Approximately two 5S RNA molecules are transcribed per gene per hour. This system may be useful in studying DNA processing and gene regulation by the mammalian ovum and might be modified to allow permanent incorporation of specific genes into mice. PMID:7194505

  8. Nucleolin: dual roles in rDNA chromatin transcription.

    PubMed

    Durut, Nathalie; Sáez-Vásquez, Julio

    2015-02-01

    Nucleolin is a major nucleolar protein conserved in all eukaryotic organisms. It is a multifunctional protein involved in different cellular aspects like chromatin organization and stability, DNA and RNA metabolism, assembly of ribonucleoprotein complexes, cytokinesis, cell proliferation and stress response. The multifunctionality of nucleolin is linked to its tripartite structure, post-translational modifications and its ability of shuttling from and to the nucleolus/nucleoplasm and cytoplasm. Nucleolin has been now studied for many years and its activities and properties have been described in a number of excellent reviews. Here, we overview the role of nucleolin in RNA polymerase I (RNAPI) transcription and describe recent results concerning its functional interaction with rDNA chromatin organization. For a long time, nucleolin has been associated with rRNA gene expression and pre-rRNA processing. However, the functional connection between nucleolin and active versus inactive rRNA genes is still not fully understood. Novel evidence indicates that the nucleolin protein might be required for controlling the transcriptional ON/OFF states of rDNA chromatin in both mammals and plants. PMID:25225127

  9. 5SRNAdb: an information resource for 5S ribosomal RNAs.

    PubMed

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  10. 5SRNAdb: an information resource for 5S ribosomal RNAs

    PubMed Central

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A.; Karlowski, Wojciech M.

    2016-01-01

    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA–protein interactions and molecular phylogeny. 5SRNAdb (http://combio.pl/5srnadb/) is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  11. Cytogenetic Analysis and Chromosomal Characteristics of the Polymorphic 18S rDNA of Haliotis discus hannai from Fujian, China

    PubMed Central

    Wang, Haishan; Luo, Xuan; You, Weiwei; Dong, Yunwei; Ke, Caihuan

    2015-01-01

    We report on novel chromosomal characteristics of Haliotis discus hannai from a breeding population at Fujian, China. The karyotypes of H. discus hannai we obtained from an abalone farm include a common type 2n = 36 = 10M + 8SM (82%) and two rare types 2n = 36 = 11M + 7SM (14%) and 2n = 36 = 10M + 7SM + 1ST (4%). The results of silver staining showed that the NORs of H. discus hannai were usually located terminally on the long arms of chromosome pairs 14 and 17, NORs were also sometimes located terminally on the short arms of other chromosomes, either metacentric or submetacentric pairs. The number of Ag-nucleoli ranged from 2 to 8, and the mean number was 3.61 ± 0.93. Among the scored interphase cells, 41% had 3 detectable nucleoli and 37% had 4 nucleoli. The 18S rDNA FISH result is the first report of the location of 18S rDNA genes in H. discus hannai. The 18S rDNA locations were highly polymorphic in this species. Copies of the gene were observed in the terminal of long or/and short arms of submetacentric or/and metacentric chromosomes. Using FISH with probe for vertebrate-like telomeric sequences (CCCTAA)3 displayed positive green FITC signals at telomere regions of all analyzed chromosome types. We found about 7% of chromosomes had breaks in prophase. A special form of nucleolus not previously described from H. discus hannai was observed in some interphase cells. It consists of many small silver-stained nucleoli gathered together to form a larger nucleolus and may correspond to prenucleolar bodies. PMID:25699679

  12. 5S RNA sequence from the Philosamia silkworm: evidence for variable evolutionary rates in insect 5S RNA.

    PubMed Central

    Xian-Rong, G; Nicoghosian, K; Cedergren, R J

    1982-01-01

    The primary structure of 5S RNA isolated from the posterior silkgland of Philosamia cynthia ricini was determined using three in vitro labelling techniques. The derived sequence consists of 119 nucleotides and can be folded into the secondary structure model proposed for eukaryotic 5S RNAs. This 5S RNA differs from the Bombyx mori molecule in 9 positions and from the Drosophila melanogaster sequence in 14 positions. The comparison of evolutionary rates in insect 5S RNA with inferred rates in other eukaryotic phyla leads to the conclusion that 5S RNA evolution is not constant in different eukaryotic branches, a condition which must be taken into account in phylogenetic tree constructions. Images PMID:7145713

  13. Myc-induced anchorage of the rDNA IGS region to nucleolar matrix modulates growth-stimulated changes in higher-order rDNA architecture.

    PubMed

    Shiue, Chiou-Nan; Nematollahi-Mahani, Amir; Wright, Anthony P H

    2014-05-01

    Chromatin domain organization and the compartmentalized distribution of chromosomal regions are essential for packaging of deoxyribonucleic acid (DNA) in the eukaryotic nucleus as well as regulated gene expression. Nucleoli are the most prominent morphological structures of cell nuclei and nucleolar organization is coupled to cell growth. It has been shown that nuclear scaffold/matrix attachment regions often define the base of looped chromosomal domains in vivo and that they are thereby critical for correct chromosome architecture and gene expression. Here, we show regulated organization of mammalian ribosomal ribonucleic acid genes into distinct chromatin loops by tethering to nucleolar matrix via the non-transcribed inter-genic spacer region of the ribosomal DNA (rDNA). The rDNA gene loop structures are induced specifically upon growth stimulation and are dependent on the activity of the c-Myc protein. Matrix-attached rDNA genes are hypomethylated at the promoter and are thus available for transcriptional activation. rDNA genes silenced by methylation are not recruited to the matrix. c-Myc, which has been shown to induce rDNA transcription directly, is physically associated with rDNA gene looping structures and the intergenic spacer sequence in growing cells. Such a role of Myc proteins in gene activation has not been reported previously. PMID:24609384

  14. rDNA Copy Number Variants Are Frequent Passenger Mutations in Saccharomyces cerevisiae Deletion Collections and de Novo Transformants

    PubMed Central

    Kwan, Elizabeth X.; Wang, Xiaobin S.; Amemiya, Haley M.; Brewer, Bonita J.; Raghuraman, M. K.

    2016-01-01

    The Saccharomyces cerevisiae ribosomal DNA (rDNA) locus is known to exhibit greater instability relative to the rest of the genome. However, wild-type cells preferentially maintain a stable number of rDNA copies, suggesting underlying genetic control of the size of this locus. We performed a screen of a subset of the Yeast Knock-Out (YKO) single gene deletion collection to identify genetic regulators of this locus and to determine if rDNA copy number correlates with yeast replicative lifespan. While we found no correlation between replicative lifespan and rDNA size, we identified 64 candidate strains with significant rDNA copy number differences. However, in the process of validating candidate rDNA variants, we observed that independent isolates of our de novo gene deletion strains had unsolicited but significant changes in rDNA copy number. Moreover, we were not able to recapitulate rDNA phenotypes from the YKO yeast deletion collection. Instead, we found that the standard lithium acetate transformation protocol is a significant source of rDNA copy number variation, with lithium acetate exposure being the treatment causing variable rDNA copy number events after transformation. As the effects of variable rDNA copy number are being increasingly reported, our finding that rDNA is affected by lithium acetate exposure suggested that rDNA copy number variants may be influential passenger mutations in standard strain construction in S. cerevisiae. PMID:27449518

  15. Contrasting Patterns of rDNA Homogenization within the Zygosaccharomyces rouxii Species Complex.

    PubMed

    Chand Dakal, Tikam; Giudici, Paolo; Solieri, Lisa

    2016-01-01

    Arrays of repetitive ribosomal DNA (rDNA) sequences are generally expected to evolve as a coherent family, where repeats within such a family are more similar to each other than to orthologs in related species. The continuous homogenization of repeats within individual genomes is a recombination process termed concerted evolution. Here, we investigated the extent and the direction of concerted evolution in 43 yeast strains of the Zygosaccharomyces rouxii species complex (Z. rouxii, Z. sapae, Z. mellis), by analyzing two portions of the 35S rDNA cistron, namely the D1/D2 domains at the 5' end of the 26S rRNA gene and the segment including the internal transcribed spacers (ITS) 1 and 2 (ITS regions). We demonstrate that intra-genomic rDNA sequence variation is unusually frequent in this clade and that rDNA arrays in single genomes consist of an intermixing of Z. rouxii, Z. sapae and Z. mellis-like sequences, putatively evolved by reticulate evolutionary events that involved repeated hybridization between lineages. The levels and distribution of sequence polymorphisms vary across rDNA repeats in different individuals, reflecting four patterns of rDNA evolution: I) rDNA repeats that are homogeneous within a genome but are chimeras derived from two parental lineages via recombination: Z. rouxii in the ITS region and Z. sapae in the D1/D2 region; II) intra-genomic rDNA repeats that retain polymorphisms only in ITS regions; III) rDNA repeats that vary only in their D1/D2 domains; IV) heterogeneous rDNA arrays that have both polymorphic ITS and D1/D2 regions. We argue that an ongoing process of homogenization following allodiplodization or incomplete lineage sorting gave rise to divergent evolutionary trajectories in different strains, depending upon temporal, structural and functional constraints. We discuss the consequences of these findings for Zygosaccharomyces species delineation and, more in general, for yeast barcoding. PMID:27501051

  16. Sequence analysis of the rDNA internal transcribed spacer 2 of five species of South American human malaria mosquitoes.

    PubMed

    Fritz, G N

    1998-03-01

    The rDNA internal transcribed spacer 2 (ITS2) was sequenced for 5 species of mosquitoes that may be important vectors of human malaria in certain regions of South America and are difficult to distinguish by morphology: Anopheles evansae, An. nuneztovari, An. rangeli, An. strodei and An. trinkae. ITS2 sequences from samples collected in Ecuador, Bolivia, Venezuela and Brazil were aligned and compared in order to determine the usefulness of this spacer for the elaboration of species specific primers and DNA probes. The ITS2 was found to be different in size (ranging from 333 to 397 bp) and sequence between all pairs of species. Highly variable regions were found primarily at the 3' end of the spacer and were interspersed with relatively conserved sites. Instraspecific sequence variation was limited to a single transversion between specimens of An. rangeli from distant geographic locations suggesting concerted evolution and homogenization of the ITS2. PMID:10520449

  17. Simple detection of the 5S ribosomal RNA of Pneumocystis carinii using in situ hybridisation.

    PubMed Central

    Kobayashi, M; Urata, T; Ikezoe, T; Hakoda, E; Uemura, Y; Sonobe, H; Ohtsuki, Y; Manabe, T; Miyagi, S; Miyoshi, I

    1996-01-01

    AIMS: To investigate the effectiveness of digoxigenin incorporated double stranded DNA probes produced by the polymerase chain reaction (PCR), for the detection of Pneumocystis carinii, using in situ hybridisation (ISH). METHODS: Formalin fixed, paraffin wax embedded sections of 26 human lung samples from 11 patients with P carinii pneumonia (PCP), and 15 with various types of fungal and viral pneumonia, were obtained during necropsy or transbronchial lung biopsy. Three additional PCP induced rat lung samples were also tested. PCR probes were prepared using the digoxigenin labelling mixture, and they were amplified from the DNA of a PCP induced rat lung after administration of dexamethasone, on the basis that 5S ribosomal RNA sequences are identical in human and rat P carinii. ISH was performed using this probe, and visualised using the digoxigenin nucleic acid detection kit. An immunohistochemical study using anti-human Pneumocystis monoclonal antibody was also carried out in parallel. RESULTS: ISH positively stained eight (of eight) lung necropsy specimens from patients with PCP, three (of three) transbronchial lung biopsy specimens from patients with PCP, and none of the three PCP induced rat lung specimens. In contrast, none of the specimens from patients with pneumonia caused by Aspergillus sp (n = 5), Candida sp (n = 4), Cryptococcus sp (n = 2), mucormycosis (n = 2), or cytomegalovirus (n = 2) were positive on ISH or immunohistochemistry. CONCLUSIONS: Using a digoxigenin labelled PCR probe for the entire 5S rRNA sequence in conjunction with conventional staining, ISH is highly reactive and specific for the diagnosis of PCP. Images PMID:9038753

  18. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

    2013-10-01

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status. PMID:23933480

  19. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.

    PubMed

    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon

    2012-07-17

    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment. PMID:22724546

  20. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  1. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  2. Physical mapping of 18S and 5S genes in pelagic species of the genera Caranx and Carangoides (Carangidae).

    PubMed

    Jacobina, U P; Bertollo, L A C; Bello Cioffi, M; Molina, W F

    2014-01-01

    In Carangidae, Caranx is taxonomically controversial because of slight morphological differences among species, as well as because of its relationship with the genus Carangoides. Cytogenetic data has contributed to taxonomic and phylogenetic classification for some groups of fish. In this study, we examined the chromosomes of Caranx latus, Caranx lugubris, and Carangoides bartholomaei using classical methods, including conventional staining, C-banding, silver staining for nuclear organizer regions, base-specific fluorochrome, and 18S and 5S ribosomal sequence mapping using in situ hybridization. These 3 species showed chromosome numbers of 2n = 48, simple nuclear organizer regions (pair 1), and mainly centromeric heterochomatin. However, C. latus (NF = 50) and C. bartholomaei (NF = 50) showed a structurally conserved karyotype compared with C. lugubris (NF = 54), with a larger number of 2-armed chromosomes. The richness of GC-positive heterochromatic segments and sites in 5S rDNA in specific locations compared to the other 2 species reinforce the higher evolutionary dynamism in C. lugubris. Cytogenetic aspects shared between C. latus and C. bartholomaei confirm the remarkable phylogenetic proximity between these genera. PMID:25501173

  3. Analyzing Digital Library Initiatives: 5S Theory Perspective

    ERIC Educational Resources Information Center

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko

    2015-01-01

    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  4. Probe assembly

    SciTech Connect

    Avera, C.J.

    1981-01-06

    A hand-held probe assembly, suitable for monitoring a radioactive fibrinogen tracer, is disclosed comprising a substantially cylindrically shaped probe handle having an open end. The probe handle is adapted to be interconnected with electrical circuitry for monitoring radioactivity that is sensed or detected by the probe assembly. Mounted within the probe handle is a probe body assembly that includes a cylindrically shaped probe body inserted through the open end of the probe handle. The probe body includes a photomultiplier tube that is electrically connected with a male connector positioned at the rearward end of the probe body. Mounted at the opposite end of the probe body is a probe head which supports an optical coupler therewithin. The probe head is interconnected with a probe cap which supports a detecting crystal. The probe body assembly, which consists of the probe body, the probe head, and the probe cap is supported within the probe handle by means of a pair of compressible o-rings which permit the probe assembly to be freely rotatable, preferably through 360*, within the probe handle and removable therefrom without requiring any disassembly.

  5. Investigating bacterial populations in styrene-degrading biofilters by 16S rDNA tag pyrosequencing.

    PubMed

    Portune, Kevin J; Pérez, M Carmen; Álvarez-Hornos, F Javier; Gabaldón, Carmen

    2015-01-01

    Microbial biofilms are essential components in the elimination of pollutants within biofilters, yet still little is known regarding the complex relationships between microbial community structure and biodegradation function within these engineered ecosystems. To further explore this relationship, 16S rDNA tag pyrosequencing was applied to samples taken at four time points from a styrene-degrading biofilter undergoing variable operating conditions. Changes in microbial structure were observed between different stages of biofilter operation, and the level of styrene concentration was revealed to be a critical factor affecting these changes. Bacterial genera Azoarcus and Pseudomonas were among the dominant classified genera in the biofilter. Canonical correspondence analysis (CCA) and correlation analysis revealed that the genera Brevundimonas, Hydrogenophaga, and Achromobacter may play important roles in styrene degradation under increasing styrene concentrations. No significant correlations (P > 0.05) could be detected between biofilter operational/functional parameters and biodiversity measurements, although biological heterogeneity within biofilms and/or technical variability within pyrosequencing may have considerably affected these results. Percentages of selected bacterial taxonomic groups detected by fluorescence in situ hybridization (FISH) were compared to results from pyrosequencing in order to assess the effectiveness and limitations of each method for identifying each microbial taxon. Comparison of results revealed discrepancies between the two methods in the detected percentages of numerous taxonomic groups. Biases and technical limitations of both FISH and pyrosequencing, such as the binding of FISH probes to non-target microbial groups and lack of classification of sequences for defined taxonomic groups from pyrosequencing, may partially explain some differences between the two methods. PMID:24950754

  6. macroH2A1 histone variant represses rDNA transcription.

    PubMed

    Cong, Rong; Das, Sadhan; Douet, Julien; Wong, Jiemin; Buschbeck, Marcus; Mongelard, Fabien; Bouvet, Philippe

    2014-01-01

    The regulation of ribosomal DNA transcription is an important step for the control of cell growth. Epigenetic marks such as DNA methylation and posttranslational modifications of canonical histones have been involved in this regulation, but much less is known about the role of histone variants. In this work, we show that the histone variant macroH2A1 is present on the promoter of methylated rDNA genes. The inhibition of the expression of macroH2A1 in human HeLa and HepG2 cells and in a mouse ES cell line resulted in an up to 5-fold increase of pre-rRNA levels. This increased accumulation of pre-rRNA is accompanied by an increase of the loading of RNA polymerase I and UBF on the rDNA without any changes in the number of active rDNA genes. The inhibition of RNA polymerase I transcription by actinomycin D or by knocking down nucleolin, induces the recruitment of macroH2A1 on the rDNA and the relocalization of macroH2A1 in the nucleolus. Interestingly, the inhibition of rDNA transcription induced by nucleolin depletion is alleviated by the inactivation of macroH2A1. These results demonstrate that macroH2A1 is a new factor involved in the regulation of rDNA transcription. PMID:24071584

  7. Protein kinase NII and the regulation of rDNA transcription in mammalian cells.

    PubMed Central

    Belenguer, P; Baldin, V; Mathieu, C; Prats, H; Bensaid, M; Bouche, G; Amalric, F

    1989-01-01

    Transcription of ribosomal RNA genes is generally accepted to correlate with cell growth. Using primary cultures of adult bovine aortic endothelial (ABAE) cells, we have shown that transcription of rDNA in confluent cells falls to 5% of the transcription level in growing cells. Protein kinase NII appears to be a limiting factor to promote rDNA transcription in isolated nuclei of confluent cells. Protein kinase NII was detected by immunocytochemistry in the cytoplasm, nuclei and nucleoli of growing cells while it was no longer present in nucleoli of confluent cells. The kinase activity, in isolated nuclei, was estimated by endogenous phosphorylation of a specific substrate, nucleolin. A 10% residual activity was present in confluent cell nuclei compared to growing cell nuclei. Concomitantly, the transcription 'in vitro' of rDNA in the corresponding nuclei was also highly reduced (by 85%). Addition of exogenous protein kinase NII to confluent cell nuclei induced a strong increase in the phosphorylation of specific proteins including nucleolin. In parallel, the transcription of rDNA was increased by a factor of 5, to nearly the level observed in nuclei prepared from growing cells. These data suggest that, in confluent cells, factors necessary for rDNA transcription machinery are present but inactive in the nucleolus and that the phosphorylation of one or several of these factors (nucleolin, topoisomerase I,...) by protein kinase NII is a key event in the regulation of rDNA transcription. Images PMID:2780290

  8. Physical studies of 5S RNA variants at position 66.

    PubMed Central

    Zhang, P; Popieniek, P; Moore, P B

    1989-01-01

    Two variants of the 5S RNA of E. coli have been examined by imino proton NMR spectroscopy, one of them a deletion of A66 (Christiansen, J., Douthwaite, S.R., Christensen, A. and Garrett, R.A. (1985) EMBO J. 4, 1019-1024) and the other a replacement of A66 with a C (Goringer, H.U. and Wagner, R. (1986) Biol. Chem. Hoppe-Seyler 367, 769-780). Both are of interest because the role the bulged A in helix II of 5S RNA is supposed to play in interactions with ribosomal protein L18. The data show that the structural perturbations that result from these mutations are minimal, and assign the resonances of some of the imino protons around position 66. Some mutations at or near position 66 greatly reduce the L18-dependent increase in the circular dichroism of 5S RNA at 267 nm first observed by Bear and coworkers (Bear, D.G., Schleich, T., Noller, H.F. and Garrett, R.A. (1977) Nucl. Acids Res. 4, 2511-2526). PMID:2479908

  9. Conformation of 4.5S RNA in the signal recognition particle and on the 30S ribosomal subunit

    PubMed Central

    GU, SHAN-QING; JÖCKEL, JOHANNES; BEINKER, PHILIPP; WARNECKE, JENS; SEMENKOV, YURI P.; RODNINA, MARINA V.; WINTERMEYER, WOLFGANG

    2005-01-01

    The signal recognition particle (SRP) from Escherichia coli consists of 4.5S RNA and protein Ffh. It is essential for targeting ribosomes that are translating integral membrane proteins to the translocation pore in the plasma membrane. Independently of Ffh, 4.5S RNA also interacts with elongation factor G (EF-G) and the 30S ribosomal subunit. Here we use a cross-linking approach to probe the conformation of 4.5S RNA in SRP and in the complex with the 30S ribosomal subunit and to map the binding site. The UV-activatable cross-linker p-azidophenacyl bromide (AzP) was attached to positions 1, 21, and 54 of wild-type or modified 4.5S RNA. In SRP, cross-links to Ffh were formed from AzP in all three positions in 4.5S RNA, indicating a strongly bent conformation in which the 5′ end (position 1) and the tetraloop region (including position 54) of the molecule are close to one another and to Ffh. In ribosomal complexes of 4.5S RNA, AzP in both positions 1 and 54 formed cross-links to the 30S ribosomal subunit, independently of the presence of Ffh. The major cross-linking target on the ribosome was protein S7; minor cross-links were formed to S2, S18, and S21. There were no cross-links from 4.5S RNA to the 50S subunit, where the primary binding site of SRP is located close to the peptide exit. The functional role of 4.5S RNA binding to the 30S subunit is unclear, as the RNA had no effect on translation or tRNA translocation on the ribosome. PMID:16043501

  10. Xenopus transcription factor IIIA binds primarily at junctions between double helical stems and internal loops in oocyte 5S RNA.

    PubMed Central

    Christiansen, J; Brown, R S; Sproat, B S; Garrett, R A

    1987-01-01

    RNases and chemical probes were used to study the accessibility of each nucleotide of 5S RNA in the native and reconstituted 7S particle from Xenopus laevis oocytes. RNase or chemically treated 5S RNA from intact 7S particles was isolated and analysed using an oligodeoxynucleotide primer and reverse transcriptase. The results were superimposed on a cylindrical projection of an RNA double helix and the protection effects were shown to cluster at two regions on the molecular surface. A three-dimensional model is proposed for the 7S particle in which protein-RNA contacts occur mainly in the major groove of 5S RNA. Images Fig. 1. Fig. 2. PMID:3582366

  11. Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization.

    PubMed

    Dingman, Douglas W

    2012-07-01

    Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions. PMID:22510214

  12. Contrasting Patterns of rDNA Homogenization within the Zygosaccharomyces rouxii Species Complex

    PubMed Central

    Chand Dakal, Tikam; Giudici, Paolo; Solieri, Lisa

    2016-01-01

    Arrays of repetitive ribosomal DNA (rDNA) sequences are generally expected to evolve as a coherent family, where repeats within such a family are more similar to each other than to orthologs in related species. The continuous homogenization of repeats within individual genomes is a recombination process termed concerted evolution. Here, we investigated the extent and the direction of concerted evolution in 43 yeast strains of the Zygosaccharomyces rouxii species complex (Z. rouxii, Z. sapae, Z. mellis), by analyzing two portions of the 35S rDNA cistron, namely the D1/D2 domains at the 5’ end of the 26S rRNA gene and the segment including the internal transcribed spacers (ITS) 1 and 2 (ITS regions). We demonstrate that intra-genomic rDNA sequence variation is unusually frequent in this clade and that rDNA arrays in single genomes consist of an intermixing of Z. rouxii, Z. sapae and Z. mellis-like sequences, putatively evolved by reticulate evolutionary events that involved repeated hybridization between lineages. The levels and distribution of sequence polymorphisms vary across rDNA repeats in different individuals, reflecting four patterns of rDNA evolution: I) rDNA repeats that are homogeneous within a genome but are chimeras derived from two parental lineages via recombination: Z. rouxii in the ITS region and Z. sapae in the D1/D2 region; II) intra-genomic rDNA repeats that retain polymorphisms only in ITS regions; III) rDNA repeats that vary only in their D1/D2 domains; IV) heterogeneous rDNA arrays that have both polymorphic ITS and D1/D2 regions. We argue that an ongoing process of homogenization following allodiplodization or incomplete lineage sorting gave rise to divergent evolutionary trajectories in different strains, depending upon temporal, structural and functional constraints. We discuss the consequences of these findings for Zygosaccharomyces species delineation and, more in general, for yeast barcoding. PMID:27501051

  13. Molecular phylogeny and barcoding of Caulerpa (Bryopsidales) based on the tufA, rbcL, 18S rDNA and ITS rDNA genes.

    PubMed

    Kazi, Mudassar Anisoddin; Reddy, C R K; Jha, Bhavanath

    2013-01-01

    The biodiversity assessment of different taxa of the genus Caulerpa is of interest from the context of morphological plasticity, invasive potential of some species and biotechnological and pharmacological applications. The present study investigated the identification and molecular phylogeny of different species of Caulerpa occurring along the Indian coast inferred from tufA, rbcL, 18S rDNA and ITS rDNA nucleotide sequences. Molecular data confirmed the identification of 10 distinct Caulerpa species: C. veravalensis, C. verticillata, C. racemosa, C. microphysa, C. taxifolia, C. sertularioides, C. scalpelliformis, C. serrulata, C. peltata and C. mexicana. All datasets significantly supported the sister relationship between C. veravalensis and C. racemosa var. cylindracea. It was also concluded from the results that the specimen identified previously as C. microphysa and C. lentillifera could not be considered as separate species. The molecular data revealed the presence of multiple lineages for C. racemosa which can be resolved into separate species. All four markers were used to ascertain their utility for DNA barcoding. The tufA gene proved a better marker with monophyletic association as the main criteria for identification at the species level. The results also support the use of 18S rDNA insertion sequences to delineate the Caulerpa species through character-based barcoding. The ITS rDNA (5.8S-ITS2) phylogenetic analysis also served as another supporting tool. Further, more sequences from additional Caulerpa specimens will need to be analysed in order to support the role of these two markers (ITS rDNA and 18S insertion sequence) in identification of Caulerpa species. The present study revealed the phylogeny of Caulerpa as complete as possible using the currently available data, which is the first comprehensive report illustrating the molecular phylogeny and barcoding of the genus Caulerpa from Indian waters. PMID:24340028

  14. Molecular Phylogeny and Barcoding of Caulerpa (Bryopsidales) Based on the tufA, rbcL, 18S rDNA and ITS rDNA Genes

    PubMed Central

    Kazi, Mudassar Anisoddin; Reddy, C. R. K.; Jha, Bhavanath

    2013-01-01

    The biodiversity assessment of different taxa of the genus Caulerpa is of interest from the context of morphological plasticity, invasive potential of some species and biotechnological and pharmacological applications. The present study investigated the identification and molecular phylogeny of different species of Caulerpa occurring along the Indian coast inferred from tufA, rbcL, 18S rDNA and ITS rDNA nucleotide sequences. Molecular data confirmed the identification of 10 distinct Caulerpa species: C. veravalensis, C. verticillata, C. racemosa, C. microphysa, C. taxifolia, C. sertularioides, C. scalpelliformis, C. serrulata, C. peltata and C. mexicana. All datasets significantly supported the sister relationship between C. veravalensis and C. racemosa var. cylindracea. It was also concluded from the results that the specimen identified previously as C. microphysa and C. lentillifera could not be considered as separate species. The molecular data revealed the presence of multiple lineages for C. racemosa which can be resolved into separate species. All four markers were used to ascertain their utility for DNA barcoding. The tufA gene proved a better marker with monophyletic association as the main criteria for identification at the species level. The results also support the use of 18S rDNA insertion sequences to delineate the Caulerpa species through character-based barcoding. The ITS rDNA (5.8S-ITS2) phylogenetic analysis also served as another supporting tool. Further, more sequences from additional Caulerpa specimens will need to be analysed in order to support the role of these two markers (ITS rDNA and 18S insertion sequence) in identification of Caulerpa species. The present study revealed the phylogeny of Caulerpa as complete as possible using the currently available data, which is the first comprehensive report illustrating the molecular phylogeny and barcoding of the genus Caulerpa from Indian waters. PMID:24340028

  15. Copy Number of the Transposon, Pokey, in rDNA Is Positively Correlated with rDNA Copy Number in Daphnia obtusa

    PubMed Central

    LeRiche, Kaitlynn; Eagle, Shannon H. C.; Crease, Teresa J.

    2014-01-01

    Pokey is a class II DNA transposon that inserts into 28S ribosomal RNA (rRNA) genes and other genomic regions of species in the subgenus, Daphnia. Two divergent lineages, PokeyA and PokeyB have been identified. Recombination between misaligned rRNA genes changes their number and the number of Pokey elements. We used quantitative PCR (qPCR) to estimate rRNA gene and Pokey number in isolates from natural populations of Daphnia obtusa, and in clonally-propagated mutation accumulation lines (MAL) initiated from a single D. obtusa female. The change in direction and magnitude of Pokey and rRNA gene number did not show a consistent pattern across ∼87 generations in the MAL; however, Pokey and rRNA gene number changed in concert. PokeyA and 28S gene number were positively correlated in the isolates from both natural populations and the MAL. PokeyB number was much lower than PokeyA in both MAL and natural population isolates, and showed no correlation with 28S gene number. Preliminary analysis did not detect PokeyB outside rDNA in any isolates and detected only 0 to 4 copies of PokeyA outside rDNA indicating that Pokey may be primarily an rDNA element in D. obtusa. The recombination rate in this species is high and the average size of the rDNA locus is about twice as large as that in other Daphnia species such as D. pulicaria and D. pulex, which may have facilitated expansion of PokeyA to much higher numbers in D. obtusa rDNA than these other species. PMID:25490398

  16. Copy number of the transposon, Pokey, in rDNA is positively correlated with rDNA copy number in Daphnia obtuse [corrected].

    PubMed

    LeRiche, Kaitlynn; Eagle, Shannon H C; Crease, Teresa J

    2014-01-01

    Pokey is a class II DNA transposon that inserts into 28S ribosomal RNA (rRNA) genes and other genomic regions of species in the subgenus, Daphnia. Two divergent lineages, PokeyA and PokeyB have been identified. Recombination between misaligned rRNA genes changes their number and the number of Pokey elements. We used quantitative PCR (qPCR) to estimate rRNA gene and Pokey number in isolates from natural populations of Daphnia obtusa, and in clonally-propagated mutation accumulation lines (MAL) initiated from a single D. obtusa female. The change in direction and magnitude of Pokey and rRNA gene number did not show a consistent pattern across ∼ 87 generations in the MAL; however, Pokey and rRNA gene number changed in concert. PokeyA and 28S gene number were positively correlated in the isolates from both natural populations and the MAL. PokeyB number was much lower than PokeyA in both MAL and natural population isolates, and showed no correlation with 28S gene number. Preliminary analysis did not detect PokeyB outside rDNA in any isolates and detected only 0 to 4 copies of PokeyA outside rDNA indicating that Pokey may be primarily an rDNA element in D. obtusa. The recombination rate in this species is high and the average size of the rDNA locus is about twice as large as that in other Daphnia species such as D. pulicaria and D. pulex, which may have facilitated expansion of PokeyA to much higher numbers in D. obtusa rDNA than these other species. PMID:25490398

  17. Assessment of four DNA fragments (COI, 16S rDNA, ITS2, 12S rDNA) for species identification of the Ixodida (Acari: Ixodida)

    PubMed Central

    2014-01-01

    Background The 5’ region of cytochrome oxidase I (COI) is the standard marker for DNA barcoding. However, COI has proved to be of limited use in identifying some species, and for some taxa, the coding sequence is not efficiently amplified by PCR. These deficiencies lead to uncertainty as to whether COI is the most suitable barcoding fragment for species identification of ticks. Methods In this study, we directly compared the relative effectiveness of COI, 16S ribosomal DNA (rDNA), nuclear ribosomal internal transcribed spacer 2 (ITS2) and 12S rDNA for tick species identification. A total of 307 sequences from 84 specimens representing eight tick species were acquired by PCR. Besides the 1,834 published sequences of 189 tick species from GenBank and the Barcode of Life Database, 430 unpublished sequences representing 59 tick species were also successfully screened by Bayesian analyses. Thereafter, the performance of the four DNA markers to identify tick species was evaluated by identification success rates given by these markers using nearest neighbour (NN), BLASTn, liberal tree-based or liberal tree-based (+threshold) methods. Results Genetic divergence analyses showed that the intra-specific divergence of each marker was much lower than the inter-specific divergence. Our results indicated that the rates of correct sequence identification for all four markers (COI, 16S rDNA, ITS2, 12S rDNA) were very high (> 96%) when using the NN methodology. We also found that COI was not significantly better than the other markers in terms of its rate of correct sequence identification. Overall, BLASTn and NN methods produced higher rates of correct species identification than that produced by the liberal tree-based methods (+threshold or otherwise). Conclusions As the standard DNA barcode, COI should be the first choice for tick species identification, while 16S rDNA, ITS2, and 12S rDNA could be used when COI does not produce reliable results. Besides, NN and BLASTn are

  18. Next generation sequencing analysis reveals a relationship between rDNA unit diversity and locus number in Nicotiana diploids

    PubMed Central

    2012-01-01

    Background Tandemly arranged nuclear ribosomal DNA (rDNA), encoding 18S, 5.8S and 26S ribosomal RNA (rRNA), exhibit concerted evolution, a pattern thought to result from the homogenisation of rDNA arrays. However rDNA homogeneity at the single nucleotide polymorphism (SNP) level has not been detailed in organisms with more than a few hundred copies of the rDNA unit. Here we study rDNA complexity in species with arrays consisting of thousands of units. Methods We examined homogeneity of genic (18S) and non-coding internally transcribed spacer (ITS1) regions of rDNA using Roche 454 and/or Illumina platforms in four angiosperm species, Nicotiana sylvestris, N. tomentosiformis, N. otophora and N. kawakamii. We compared the data with Southern blot hybridisation revealing the structure of intergenic spacer (IGS) sequences and with the number and distribution of rDNA loci. Results and Conclusions In all four species the intragenomic homogeneity of the 18S gene was high; a single ribotype makes up over 90% of the genes. However greater variation was observed in the ITS1 region, particularly in species with two or more rDNA loci, where >55% of rDNA units were a single ribotype, with the second most abundant variant accounted for >18% of units. IGS heterogeneity was high in all species. The increased number of ribotypes in ITS1 compared with 18S sequences may reflect rounds of incomplete homogenisation with strong selection for functional genic regions and relaxed selection on ITS1 variants. The relationship between the number of ITS1 ribotypes and the number of rDNA loci leads us to propose that rDNA evolution and complexity is influenced by locus number and/or amplification of orphaned rDNA units at new chromosomal locations. PMID:23259460

  19. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).

    PubMed

    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A

    2016-02-01

    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA. PMID:26853884

  20. Phylogeny and genetic diversity of Bridgeoporus nobilissimus inferred using mitochondrial and nuclear rDNA sequences

    USGS Publications Warehouse

    Redberg, G.L.; Hibbett, D.S.; Ammirati, J.F., Jr.; Rodriguez, R.J.

    2003-01-01

    The genetic diversity and phylogeny of Bridgeoporus nobilissimus have been analyzed. DNA was extracted from spores collected from individual fruiting bodies representing six geographically distinct populations in Oregon and Washington. Spore samples collected contained low levels of bacteria, yeast and a filamentous fungal species. Using taxon-specific PCR primers, it was possible to discriminate among rDNA from bacteria, yeast, a filamentous associate and B. nobilissimus. Nuclear rDNA internal transcribed spacer (ITS) region sequences of B. nobilissimus were compared among individuals representing six populations and were found to have less than 2% variation. These sequences also were used to design dual and nested PCR primers for B. nobilissimus-specific amplification. Mitochondrial small-subunit rDNA sequences were used in a phylogenetic analysis that placed B. nobilissimus in the hymenochaetoid clade, where it was associated with Oxyporus and Schizopora.

  1. Fragile sites of 45S rDNA of Lolium multiflorum are not hotspots for chromosomal breakages induced by X-ray.

    PubMed

    Rocha, Laiane Corsini; Mittelmann, Andrea; Houben, Andreas; Techio, Vânia Helena

    2016-07-01

    Sites of 45S rDNA of Lolium are regions denominated fragile sites (FSs), constituting regions slightly stained with DAPI due to increased DNA unpacking in metaphasic chromosomes. Considered to be fragile regions in the genome, the FSs might be more responsive to induced breaks and result in chromosomal fragments and rearrangements, unless repairing mechanisms such as recombination or de novo telomere formation play a role at the break site of the DNA. Thus, this study aimed at investigating if SFs from Lolium are hotspots for the occurrence of breakages induced by X-ray and if they are regions favorable to synthesize new telomeres, using Hordeum vulgare as a comparative model. Lolium multiflorum and H. vulgare seedlings were irradiated with 20 and 50 Gy X-ray and evaluated one day following the irradiation and at 7-days intervals for a 28-days period, using FISH technique with 45S rDNA and Arabidopsis-type telomere probes in order to investigate the presence of chromosomal breakages and new telomere formation. H. vulgare did not survive after a few days of irradiation due to the increased rate of abnormalities. L. multiflorum also exhibited chromosomal abnormalities following the exposure, yet over the 28-days trial it had a decrease in the chromosomal damage rate and formation of de novo telomere has not been detected along this time. Despite being considered to be fragile regions in the genome, the 45S rDNA sites of Lolium are not hotspots to chromosomal breakages after the induction of breakages. PMID:27174104

  2. Spectrophotometric probe

    DOEpatents

    Prather, W.S.; O'Rourke, P.E.

    1994-08-02

    A support structure is described bearing at least one probe for making spectrophotometric measurements of a fluid using a source of light and a spectrophotometer. The probe includes a housing with two optical fibers and a planoconvex lens. A sleeve bearing a mirror surrounds the housing. The lens is separated from the mirror by a fixed distance, defining an interior space for receiving a volume of the fluid sample. A plurality of throughholes extending through the sleeve communicate between the sample volume and the exterior of the probe, all but one hole bearing a screen. A protective jacket surrounds the probe. A hollow conduit bearing a tube is formed in the wall of the probe for venting any air in the interior space when fluid enters. The probe is held at an acute angle so the optic fibers carrying the light to and from the probe are not bent severely on emergence from the probe. 3 figs.

  3. Spectrophotometric probe

    DOEpatents

    Prather, William S.; O'Rourke, Patrick E.

    1994-01-01

    A support structure bearing at least one probe for making spectrophotometric measurements of a fluid using a source of light and a spectrophotometer. The probe includes a housing with two optical fibers and a planoconvex lens. A sleeve bearing a mirror surrounds the housing. The lens is separated from the mirror by a fixed distance, defining an interior space for receiving a volume of the fluid sample. A plurality of throughholes extending through the sleeve communicate between the sample volume and the exterior of the probe, all but one hole bearing a screen. A protective jacket surrounds the probe. A hollow conduit bearing a tube is formed in the wall of the probe for venting any air in the interior space when fluid enters. The probe is held at an acute angle so the optic fibers carrying the light to and from the probe are not bent severely on emergence from the probe.

  4. Robertsonian polymorphism in the marine gastropod, Nucella lapillus: advances in karyology using rDNA loci and NORs.

    PubMed

    Pascoe, P L; Patton, S J; Critcher, R; Dixon, D R

    1996-03-01

    Previous studies of the Robertsonian polymorphism in the Atlantic dog-whelk, Nucella lapillus (2n = 26-36), have been limited by the inability to identify unequivocally individual chromosomes in the karyotype. This species, as with many other marine invertebrates, has proven largely refractory to the standard (mammalian) chromosome-banding techniques. In this study, fluorescence in situ hybridization (FISH) using a rDNA probe was applied to the metaphase chromosomes of the 2n = 26 and 2n = 36 forms of N. lapillus. The results were compared with silver-staining of the nucleolar organizer regions (NORs). The FISH technique was shown to be more sensitive and less intrinsically prone to variation than the silver-staining method. An additional NOR/rDNA locus was observed in the 2n = 36 form which, to date, has not been seen in any 2n = 26 population. The 2n = 36 karyotype is described for a south-west UK population that differs from that reported previously in the literature. After fission, Robertsonian metacentrics are shown to correspond to at least one subtelocentric product. PMID:8601340

  5. A Natural Polymorphism in rDNA Replication Origins Links Origin Activation with Calorie Restriction and Lifespan

    PubMed Central

    Kwan, Elizabeth X.; Foss, Eric J.; Tsuchiyama, Scott; Alvino, Gina M.; Kruglyak, Leonid; Kaeberlein, Matt; Raghuraman, M. K.; Brewer, Bonita J.; Kennedy, Brian K.; Bedalov, Antonio

    2013-01-01

    Aging and longevity are complex traits influenced by genetic and environmental factors. To identify quantitative trait loci (QTLs) that control replicative lifespan, we employed an outbred Saccharomyces cerevisiae model, generated by crossing a vineyard and a laboratory strain. The predominant QTL mapped to the rDNA, with the vineyard rDNA conferring a lifespan increase of 41%. The lifespan extension was independent of Sir2 and Fob1, but depended on a polymorphism in the rDNA origin of replication from the vineyard strain that reduced origin activation relative to the laboratory origin. Strains carrying vineyard rDNA origins have increased capacity for replication initiation at weak plasmid and genomic origins, suggesting that inability to complete genome replication presents a major impediment to replicative lifespan. Calorie restriction, a conserved mediator of lifespan extension that is also independent of Sir2 and Fob1, reduces rDNA origin firing in both laboratory and vineyard rDNA. Our results are consistent with the possibility that calorie restriction, similarly to the vineyard rDNA polymorphism, modulates replicative lifespan through control of rDNA origin activation, which in turn affects genome replication dynamics. PMID:23505383

  6. Photocarrier dynamics in transition metal dichalcogenide alloy Mo0.5W0.5S2.

    PubMed

    He, Jiaqi; He, Dawei; Wang, Yongsheng; Zhao, Hui

    2015-12-28

    We report a transient absorption study of photocarrier dynamics in transition metal dichalcogenide alloy, Mo0.5W0.5S2. Photocarriers were injected by a 400-nm pump pulse and detected by a 660-nm probe pulse. We observed a fast energy relaxation process of about 0.7 ps. The photocarrier lifetime is in the range of 50 - 100 ps, which weakly depends on the injected photocarrier density and is a few times shorter than MoS2 and WS2, reflecting the relatively lower crystalline quality of the alloy. Saturable absorption was also observed in Mo0.5W0.5S2, with a saturation energy fluence of 32 μJ cm(-2). These results provide important parameters on photocarrier properties of transition metal dichalcogenide alloys. PMID:26832001

  7. Differentiation of anaerobic polycentric fungi by rDNA PCR-RFLP.

    PubMed

    Fliegerová, K; Mrázek, J; Voigt, K

    2006-01-01

    The suitability of restriction fragment length polymorphism (RFLP) analysis of the ribosomal DNA cluster for discriminating two genera of anaerobic polycentric fungi, Orpinomyces and Anaeromyces, was determined. Three PCR-amplified DNA fragments--nuclear small subunit (SSU; 18S rDNA), the nuclear large subunit (LSU; 28S rDNA) and internal transcribed spacer (ITS)--were restricted with endonucleases AluI, DraI, HinfI and MboI. Although the SSU DNA fragment could be restricted successfully by all four enzymes, no differences were observed between restriction patterns of Orpinomyces and Anaeromyces. The most polymorphic restriction pattern between Orpinomyces and Anaeromyces resulted from cleavage of LSU rDNA fragments cut by AluI and HinfI and ITS fragment cut by DraI and HinfI. Genus-specific RFLP patterns were determined for Orpinomyces and Anaeromyces genera; the results showed that the PCR-RFLP analysis of rDNA offers an easy and rapid tool for differentiation of two polycentric genera of anaerobic fungi, which could be hardly separated on the basis of morphology. PMID:17007423

  8. Phylogenetic relationships of land plants using mitochondrial small-subunit rDNA sequences.

    PubMed

    Duff, R J; Nickrent, D L

    1999-03-01

    Phylogenetic relationships among embryophytes (tracheophytes, mosses, liverworts, and hornworts) were examined using 21 newly generated mitochondrial small-subunit (19S) rDNA sequences. The "core" 19S rDNA contained more phylogenetically informative sites and lower homoplasy than either nuclear 18S or plastid 16S rDNA. Results of phylogenetic analyses using parsimony (MP) and likelihood (ML) were generally congruent. Using MP, two trees were obtained that resolved either liverworts or hornworts as the basal land plant clade. The optimal ML tree showed hornworts as basal. That topology was not statistically different from the two MP trees, thus both appear to be equally viable evolutionary hypotheses. High bootstrap support was obtained for the majority of higher level embryophyte clades named in a recent morphologically based classification, e.g., Tracheophyta, Euphyllophytina, Lycophytina, and Spermatophytata. Strong support was also obtained for the following monophyletic groups: hornworts, liverworts, mosses, lycopsids, leptosporangiate and eusporangiate ferns, gymnosperms and angiosperms. This molecular analysis supported a sister relationship between Equisetum and leptosporangiate ferns and a monophyletic gymnosperms sister to angiosperms. The topologies of deeper clades were affected by taxon inclusion (particularly hornworts) as demonstrated by jackknife analyses. This study represents the first use of mitochondrial 19S rDNA for phylogenetic purposes and it appears well-suited for examining intermediate to deep evolutionary relationships among embryophytes. PMID:10077500

  9. Top2 and Sgs1-Top3 Act Redundantly to Ensure rDNA Replication Termination

    PubMed Central

    Fredsøe, Jacob; Nielsen, Ida; Pedersen, Jakob Madsen; Bentsen, Iben Bach; Lisby, Michael; Bjergbaek, Lotte; Andersen, Anni H

    2015-01-01

    Faithful DNA replication with correct termination is essential for genome stability and transmission of genetic information. Here we have investigated the potential roles of Topoisomerase II (Top2) and the RecQ helicase Sgs1 during late stages of replication. We find that cells lacking Top2 and Sgs1 (or Top3) display two different characteristics during late S/G2 phase, checkpoint activation and accumulation of asymmetric X-structures, which are both independent of homologous recombination. Our data demonstrate that checkpoint activation is caused by a DNA structure formed at the strongest rDNA replication fork barrier (RFB) during replication termination, and consistently, checkpoint activation is dependent on the RFB binding protein, Fob1. In contrast, asymmetric X-structures are formed independent of Fob1 at less strong rDNA replication fork barriers. However, both checkpoint activation and formation of asymmetric X-structures are sensitive to conditions, which facilitate fork merging and progression of replication forks through replication fork barriers. Our data are consistent with a redundant role of Top2 and Sgs1 together with Top3 (Sgs1-Top3) in replication fork merging at rDNA barriers. At RFB either Top2 or Sgs1-Top3 is essential to prevent formation of a checkpoint activating DNA structure during termination, but at less strong rDNA barriers absence of the enzymes merely delays replication fork merging, causing an accumulation of asymmetric termination structures, which are solved over time. PMID:26630413

  10. Evolutionary pattern of rDNA following polyploidy in Leymus (Triticeae: Poaceae).

    PubMed

    Fan, Xing; Liu, Jing; Sha, Li-Na; Sun, Gen-Lou; Hu, Zhi-Qin; Zeng, Jian; Kang, Hou-Yang; Zhang, Hai-Qin; Wang, Yi; Wang, Xiao-Li; Zhang, Li; Ding, Chun-Bang; Yang, Rui-Wu; Zheng, You-Liang; Zhou, Yong-Hong

    2014-08-01

    Ribosomal ITS polymorphism and its ancestral genome origin of polyploid Leymus were examined to infer the evolutionary outcome of rDNA gene following allopolyploid speciation and to elucidate the geographic pattern of ITS variation. The results demonstrated that different polyploids have experienced varying fates, including maintenance or homogenization of divergent arrays, occurrence of chimeric repeats and potential pseudogenes. Our data suggested that (1) the Ns, P/F, and St genomic types in Leymus were originated from Psathyrostachys, Agropyron/Eremopyrum, and Pseudoroegneria, respectively; (2) the occurrence of a higher proportion of Leymus species with predominant uniparental rDNA type might associate with the segmental allopolyploid origin, nucleolar dominance of alloploids, and rapid radiation of Leymus; (3) maintenance of multiple parental ITS types in allopolyploid might result from long generation times associated to vegetative multiplication, number and chromosomal location of ribosomal loci and/or recurrent hybridization; (4) the rDNA genealogical structure of Leymus species might associate with the geographic origins; and (5) ITS sequence clade shared by Leymus species from Central Asia, North America, and Nordic might be an outcome of ancestral ITS homogenization. Our results shed new light on understanding evolutionary outcomes of rDNA following allopolyploid speciation and geographic isolation. PMID:24780748

  11. Clinorotation influences rDNA and NopA100 localization in nucleoli

    NASA Astrophysics Data System (ADS)

    Sobol, M. A.; González-Camacho, F.; Rodríguez-Vilariño, V.; Kordyum, E. L.; Medina, F. J.

    The nucleolus is the transcription site of rRNA genes as well as the site of processing and initial packaging of their transcripts. The plant nucleolin homologue NopA100 is involved in the regulation of r-chromatin condensation/expansion and rDNA transcription as well as in rRNA processing. We have investigated with immunogold electron microscopy the location of nucleolar DNA and NopA100 in cress root meristematic cells grown under slow horizontal clinorotation, reproducing an important feature of microgravity, namely the absence of an orienting action of a gravity vector, compared to control conditions. We demonstrate redistribution of both rDNA and NopA100 in nucleolar subcomponents induced by clinorotation. Ribosomal DNA concentrated predominantly in fibrillar centers in the form of condensed r-chromatin inclusions and internal non condensed fibrils, redistributing from the dense fibrillar component and the transition zone between fibrillar centers and the dense fibrillar component, recognized as the loci of rDNA transcription. The content of NopA100 was much higher in the inner space of fibrillar centers and reduced in the dense fibrillar component as compared to the control. Based on these data, an effect of slow horizontal clinorotation in lowering the level of rDNA transcription as well as rRNA processing is suggested.

  12. Molecular rDNA phylogeny of Telotylenchidae Siddiqi, 1960 and evaluation of tail termini

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Three stunt nematode species, Tylenchorhynchus leviterminalis, T. claytoni and Bitylenchus dubius were characterized with segments of small subunit 18S and large subunit 28S rDNA sequences and placed in molecular phylogenetic context with other taxa of Telotylechidae in GenBank. In 18S trees, the sp...

  13. Relationships between rDNA, Nop1 and Sir complex in biotechnologically relevant distillery yeasts.

    PubMed

    Adamczyk, Jagoda; Deregowska, Anna; Potocki, Leszek; Kuna, Ewelina; Kaplan, Jakub; Pabian, Sylwia; Kwiatkowska, Aleksandra; Lewinska, Anna; Wnuk, Maciej

    2016-09-01

    Distillery yeasts are poorly characterized physiological group among the Saccharomyces sensu stricto complex. As industrial yeasts are under constant environmental stress during fermentation processes and the nucleolus is a stress sensor, in the present study, nucleolus-related parameters were evaluated in 22 commercially available distillery yeast strains. Distillery yeasts were found to be a heterogeneous group with a variable content and length of rDNA and degree of nucleolus fragmentation. The levels of rDNA were negatively correlated with Nop1 (r = -0.59, p = 0.0038). Moreover, the protein levels of Sir transcriptional silencing complex and longevity regulators, namely Sir1, Sir2, Sir3 and Fob1, were studied and negative correlations between Sir2 and Nop1 (r = -0.45, p = 0.0332), and between Sir2 and Fob1 (r = -0.49, p = 0.0211) were revealed. In general, S. paradoxus group of distillery yeasts with higher rDNA pools and Sir2 level than S. bayanus group was found to be more tolerant to fermentation-associated stress stimuli, namely mild cold/heat stresses and KCl treatment. We postulate that rDNA state may be considered as a novel factor that may modulate a biotechnological process. PMID:27329282

  14. Aberrant DNA Methylation of rDNA and PRIMA1 in Borderline Personality Disorder.

    PubMed

    Teschler, Stefanie; Gotthardt, Julia; Dammann, Gerhard; Dammann, Reinhard H

    2016-01-01

    Borderline personality disorder (BPD) is a serious psychic disease with a high risk for suicide. DNA methylation is a hallmark for aberrant epigenetic regulation and could be involved in the etiology of BPD. Previously, it has been reported that increased DNA methylation of neuropsychiatric genes is found in the blood of patients with BPD compared to healthy controls. Here, we analyzed DNA methylation patterns of the ribosomal RNA gene (rDNA promoter region and 5'-external transcribed spacer/5'ETS) and the promoter of the proline rich membrane anchor 1 gene (PRIMA1) in peripheral blood samples of 24 female patients (mean age (33 ± 11) years) diagnosed with DSM-IV BPD and in 11 female controls (mean age (32 ± 7) years). A significant aberrant methylation of rDNA and PRIMA1 was revealed for BPD patients using pyrosequencing. For the promoter of PRIMA1, the average methylation of six CpG sites was 1.6-fold higher in BPD patients compared to controls. In contrast, the methylation levels of the rDNA promoter region and the 5'ETS were significantly lower (0.9-fold) in patients with BPD compared to controls. Thus, for nine CpGs located in the rDNA promoter region and for four CpGs at the 5'ETS decreased methylation was found in peripheral blood of patients compared to controls. Our results suggest that aberrant methylation of rDNA and PRIMA1 is associated with the pathogenesis of BPD. PMID:26742039

  15. Distribution of 45S rDNA sites in chromosomes of plants: Structural and evolutionary implications

    PubMed Central

    2012-01-01

    Background 45S rDNA sites are the most widely documented chromosomal regions in eukaryotes. The analysis of the distribution of these sites along the chromosome in several genera has suggested some bias in their distribution. In order to evaluate if these loci are in fact non-randomly distributed and what is the influence of some chromosomal and karyotypic features on the distribution of these sites, a database was built with the position and number of 45S rDNA sites obtained by FISH together with other karyotypic data from 846 plant species. Results In angiosperms the most frequent numbers of sites per diploid karyotype were two and four, suggesting that in spite of the wide dispersion capacity of these sequences the number of rDNA sites tends to be restricted. The sites showed a preferential distribution on the short arms, mainly in the terminal regions. Curiously, these sites were frequently found on the short arms of acrocentric chromosomes where they usually occupy the whole arm. The trend to occupy the terminal region is especially evident in holokinetic chromosomes, where all of them were terminally located. In polyploids there is a trend towards reduction in the number of sites per monoploid complement. In gymnosperms, however, the distribution of rDNA sites varied strongly among the sampled families. Conclusions The location of 45S rDNA sites do not vary randomly, occurring preferentially on the short arm and in the terminal region of chromosomes in angiosperms. The meaning of this preferential location is not known, but some hypotheses are considered and the observed trends are discussed. PMID:23181612

  16. Aberrant DNA Methylation of rDNA and PRIMA1 in Borderline Personality Disorder

    PubMed Central

    Teschler, Stefanie; Gotthardt, Julia; Dammann, Gerhard; Dammann, Reinhard H.

    2016-01-01

    Borderline personality disorder (BPD) is a serious psychic disease with a high risk for suicide. DNA methylation is a hallmark for aberrant epigenetic regulation and could be involved in the etiology of BPD. Previously, it has been reported that increased DNA methylation of neuropsychiatric genes is found in the blood of patients with BPD compared to healthy controls. Here, we analyzed DNA methylation patterns of the ribosomal RNA gene (rDNA promoter region and 5′-external transcribed spacer/5′ETS) and the promoter of the proline rich membrane anchor 1 gene (PRIMA1) in peripheral blood samples of 24 female patients (mean age (33 ± 11) years) diagnosed with DSM-IV BPD and in 11 female controls (mean age (32 ± 7) years). A significant aberrant methylation of rDNA and PRIMA1 was revealed for BPD patients using pyrosequencing. For the promoter of PRIMA1, the average methylation of six CpG sites was 1.6-fold higher in BPD patients compared to controls. In contrast, the methylation levels of the rDNA promoter region and the 5′ETS were significantly lower (0.9-fold) in patients with BPD compared to controls. Thus, for nine CpGs located in the rDNA promoter region and for four CpGs at the 5′ETS decreased methylation was found in peripheral blood of patients compared to controls. Our results suggest that aberrant methylation of rDNA and PRIMA1 is associated with the pathogenesis of BPD. PMID:26742039

  17. rDNA genetic imbalance and nucleolar chromatin restructuring is induced by distant hybridization between Raphanus sativus and Brassica alboglabra.

    PubMed

    Long, Hong; Chen, Chunli; Wang, Bing; Feng, Yanni

    2015-01-01

    The expression of rDNA in hybrids inherited from only one progenitor refers to nucleolar dominance. The molecular basis for choosing which genes to silence remains unclear. We report genetic imbalance induced by distant hybridization correlates with formation of rDNA genes (NORs) in the hybrids between Raphanus sativus L. and Brassica alboglabra Bailey. Moreover, increased CCGG methylation of rDNA in F1 hybrids is concomitant with Raphanus-derived rDNA gene silencing and rDNA transcriptional inactivity revealed by nucleolar configuration restriction. Newly formed rDNA gene locus occurred through chromosomal in F1 hybrids via chromosomal imbalance. NORs are gained de novo, lost, and/or transposed in the new genome. Inhibition of methyltransferases leads to changes in nucleolar architecture, implicating a key role of methylation in control of nucleolar dominance and vital nucleolar configuration transition. Our findings suggest that gene imbalance and methylation-related chromatin restructuring is important for rDNA gene silencing that may be crucial for synthesis of specific proteins. PMID:25723542

  18. RNA Polymerase I and Fob1 contributions to transcriptional silencing at the yeast rDNA locus.

    PubMed

    Buck, Stephen W; Maqani, Nazif; Matecic, Mirela; Hontz, Robert D; Fine, Ryan D; Li, Mingguang; Smith, Jeffrey S

    2016-07-27

    RNA polymerase II (Pol II)-transcribed genes embedded within the yeast rDNA locus are repressed through a Sir2-dependent process called 'rDNA silencing'. Sir2 is recruited to the rDNA promoter through interactions with RNA polymerase I (Pol I), and to a pair of DNA replication fork block sites (Ter1 and Ter2) through interaction with Fob1. We utilized a reporter gene (mURA3) integrated adjacent to the leftmost rDNA gene to investigate localized Pol I and Fob1 functions in silencing. Silencing was attenuated by loss of Pol I subunits or insertion of an ectopic Pol I terminator within the adjacent rDNA gene. Silencing left of the rDNA array is naturally attenuated by the presence of only one intact Fob1 binding site (Ter2). Repair of the 2nd Fob1 binding site (Ter1) dramatically strengthens silencing such that it is no longer impacted by local Pol I transcription defects. Global loss of Pol I activity, however, negatively affects Fob1 association with the rDNA. Loss of Ter2 almost completely eliminates localized silencing, but is restored by artificially targeting Fob1 or Sir2 as Gal4 DNA binding domain fusions. We conclude that Fob1 and Pol I make independent contributions to establishment of silencing, though Pol I also reinforces Fob1-dependent silencing. PMID:27060141

  19. Homology-dependent repair is involved in 45S rDNA loss in plant CAF-1 mutants

    PubMed Central

    Muchová, Veronika; Amiard, Simon; Mozgová, Iva; Dvořáčková, Martina; Gallego, Maria E; White, Charles; Fajkus, Jiří

    2015-01-01

    Arabidopsis thaliana mutants in FAS1 and FAS2 subunits of chromatin assembly factor 1 (CAF1) show progressive loss of 45S rDNA copies and telomeres. We hypothesized that homology-dependent DNA damage repair (HDR) may contribute to the loss of these repeats in fas mutants. To test this, we generated double mutants by crossing fas mutants with knock-out mutants in RAD51B, one of the Rad51 paralogs of A. thaliana. Our results show that the absence of RAD51B decreases the rate of rDNA loss, confirming the implication of RAD51B-dependent recombination in rDNA loss in the CAF1 mutants. Interestingly, this effect is not observed for telomeric repeat loss, which thus differs from that acting in rDNA loss. Involvement of DNA damage repair in rDNA dynamics in fas mutants is further supported by accumulation of double-stranded breaks (measured as γ-H2AX foci) in 45S rDNA. Occurrence of the foci is not specific for S-phase, and is ATM-independent. While the foci in fas mutants occur both in the transcribed (intranucleolar) and non-transcribed (nucleoplasmic) fraction of rDNA, double fas rad51b mutants show a specific increase in the number of the intranucleolar foci. These results suggest that the repair of double-stranded breaks present in the transcribed rDNA region is RAD51B dependent and that this contributes to rDNA repeat loss in fas mutants, presumably via the single-stranded annealing recombination pathway. Our results also highlight the importance of proper chromatin assembly in the maintenance of genome stability. PMID:25359579

  20. When molecules support morphology: Phylogenetic reconstruction of the family Onuphidae (Eunicida, Annelida) based on 16S rDNA and 18S rDNA.

    PubMed

    Budaeva, Nataliya; Schepetov, Dmitry; Zanol, Joana; Neretina, Tatiana; Willassen, Endre

    2016-01-01

    Onuphid polychaetes are tubicolous marine worms commonly reported worldwide from intertidal areas to hadal depths. They often dominate in benthic communities and have economic importance in aquaculture and recreational fishing. Here we report the phylogeny of the family Onuphidae based on the combined analyses of nuclear (18S rDNA) and mitochondrial (16S rDNA) genes. Results of Bayesian and Maximum Likelihood analyses supported the monophyly of Onuphidae and its traditional subdivision into two monophyletic subfamilies: Onuphinae and Hyalinoeciinae. Ten of 22 recognized genera were monophyletic with strong node support; four more genera included in this study were either monotypic or represented by a single species. None of the genera appeared para- or polyphyletic and this indicates a strong congruence between the traditional morphology-based systematics of the family and the newly obtained molecular-based phylogenetic reconstructions. Intergeneric relationships within Hyalinoeciinae were not resolved. Two strongly supported monophyletic groups of genera were recovered within Onuphinae: ((Onuphis, Aponuphis), Diopatra, Paradiopatra) and (Hirsutonuphis, (Paxtonia, (Kinbergonuphis, Mooreonuphis))). A previously accepted hypothesis on the subdivision of Onuphinae into the Onuphis group of genera and the Diopatra group of genera was largely rejected. PMID:26497420

  1. Structural polymorphism in the major groove of a 5S RNA gene complements the zinc finger domains of transcription factor IIIA.

    PubMed Central

    Huber, P W; Morii, T; Mei, H Y; Barton, J K

    1991-01-01

    Metal complexes that bind to DNA on the basis of shape-selection have been used to map the conformational features of the DNA binding site for transcription factor IIIA. Conformationally distinct segments are detected on the 5S rRNA gene that correspond closely to the binding sites identified for the individual zinc finger domains of the protein. The local conformations are characterized by a major groove opened because of a change in base pair inclination and/or displacement at a central 5'-pyrimidine-purine-3' step, flanked by a widened minor groove, as would arise at the junctions between alternating B- and A-like DNA segments. Docking experiments with a consensus structure of a zinc finger reveal that the mixed A-B binding site accommodates the peptide domain better than either canonical B- or A-DNA helices. The close structural matching of the conformational variations in the 5S rDNA both to the proposed sites of zinc finger binding and to the shape of an individual zinc finger domain points to DNA structural polymorphism as providing an important determinant in recognition. In particular, shape selection in the 5' half of the internal control region may orient the multiple finger domains. Images PMID:1961749

  2. D5S351 and D5S1414 located at the spinal muscular atrophy critical region represent novel informative markers in the Iranian population

    PubMed Central

    Sedghi, Maryam; Vallian, Sadeq

    2015-01-01

    Spinal muscular atrophy (SMA) is a degenerative neuromuscular disease associated with progressive symmetric weakness and atrophy of the limb muscles. In view of the involvement of numerous point mutations and deletions associated with the disease, the application of polymorphic markers flanking the SMA critical region could be valuable in molecular diagnosis of the disease. In the present study, D5S351 and D5S1414 polymorphic markers located at the SMA critical region in the Iranian populations were characterized. Genotyping of the markers indicated the presence of six and nine different alleles for D5S351 and D5S1414, respectively. Haplotype frequency estimation in 25 trios families and 75 unrelated individuals indicated the presence of six informative haplotypes with frequency higher than 0.05 in the studied population. Furthermore, the D′ coefficient and the χ2 value for D5S351 and D5S1414 markers revealed the presence of linkage disequilibrium between the two markers in the Iranians. These data suggested that D5S351 and D5S1414 could be suggested as informative markers for linkage analysis and molecular diagnosis of SMA in the Iranian population. PMID:26693404

  3. Assessment of Helminth Biodiversity in Wild Rats Using 18S rDNA Based Metagenomics

    PubMed Central

    Tsai, Isheng J.; Palomares-Rius, Juan Emilio; Yoshida, Ayako; Ogura, Yoshitoshi; Hayashi, Tetsuya; Maruyama, Haruhiko; Kikuchi, Taisei

    2014-01-01

    Parasite diversity has important implications in several research fields including ecology, evolutionary biology and epidemiology. Wide-ranging analysis has been restricted because of the difficult, highly specialised and time-consuming processes involved in parasite identification. In this study, we assessed parasite diversity in wild rats using 18S rDNA-based metagenomics. 18S rDNA PCR products were sequenced using an Illumina MiSeq sequencer and the analysis of the sequences using the QIIME software successfully classified them into several parasite groups. The comparison of the results with those obtained using standard methods including microscopic observation of helminth parasites in the rat intestines and PCR amplification/sequencing of 18S rDNA from isolated single worms suggests that this new technique is reliable and useful to investigate parasite diversity. PMID:25340824

  4. Secondary structure of Tetrahymena thermophilia 5S ribosomal RNA as revealed by enzymatic digestion and microdensitometric analysis.

    PubMed Central

    Sneath, B; Vary, C; Pavlakis, G; Vournakis, J

    1986-01-01

    The secondary structure of [32P] end-labeled 5S rRNA from Tetrahymena thermophilia (strain B) has been investigated using the enzymes S1 nuclease, cobra venom ribonuclease and T2 ribonuclease. The results, analyzed by scanning microdensitometry and illustrated by three-dimensional computer graphics, support the secondary structure model of Curtiss and Vournakis for 5S rRNA. Aberrent mobility of certain RNA fragments on sequencing gels was observed as regions of band compression. These regions are postulated to be caused by stable internal base-pairing. The molecule was probed with T2 RNase in neutral (pH 7.5) and acidic (pH 4.5) buffers and only minor structural differences were revealed. One of the helices was found to be susceptible to enzymatic attack by both the single-strand and double-strand specific enzymes. These observations are evidence for the existence of dynamic structural equilibria in 5S rRNA. Images PMID:3005972

  5. Interpopulation hybridization generates meiotically stable rDNA epigenetic variants in allotetraploid Tragopogon mirus.

    PubMed

    Matyášek, Roman; Dobešová, Eva; Húska, Dalibor; Ježková, Ivana; Soltis, Pamela S; Soltis, Douglas E; Kovařík, Aleš

    2016-02-01

    Uniparental silencing of 35S rRNA genes (rDNA), known as nucleolar dominance (ND), is common in interspecific hybrids. Allotetraploid Tragopogon mirus composed of Tragopogon dubius (d) and Tragopogon porrifolius (p) genomes shows highly variable ND. To examine the molecular basis of such variation, we studied the genetic and epigenetic features of rDNA homeologs in several lines derived from recently and independently formed natural populations. Inbred lines derived from T. mirus with a dominant d-rDNA homeolog transmitted this expression pattern over generations, which may explain why it is prevalent among natural populations. In contrast, lines derived from the p-rDNA dominant progenitor were meiotically unstable, frequently switching to co-dominance. Interpopulation crosses between progenitors displaying reciprocal ND resulted in d-rDNA dominance, indicating immediate suppression of p-homeologs in F1 hybrids. Original p-rDNA dominance was not restored in later generations, even in those segregants that inherited the corresponding parental rDNA genotype, thus indicating the generation of additional p-rDNA and d-rDNA epigenetic variants. Despite preserved intergenic spacer (IGS) structure, they showed altered cytosine methylation and chromatin condensation patterns, and a correlation between expression, hypomethylation of RNA Pol I promoters and chromatin decondensation was apparent. Reversion of such epigenetic variants occurred rarely, resulting in co-dominance maintained in individuals with distinct genotypes. Generally, interpopulation crosses may generate epialleles that are not present in natural populations, underlying epigenetic dynamics in young allopolyploids. We hypothesize that highly expressed variants with distinct IGS features may induce heritable epigenetic reprogramming of the partner rDNA arrays, harmonizing the expression of thousands of genes in allopolyploids. PMID:26711705

  6. Quantum speciation in Aegilops: Molecular cytogenetic evidence from rDNA cluster variability in natural populations

    PubMed Central

    Raskina, Olga; Belyayev, Alexander; Nevo, Eviatar

    2004-01-01

    Data are presented on quantum speciation in the Sitopsis section of the genus Aegilops (Poaceae, Monocotyledones). Two small, peripheral, isolated, wild populations of annual cross-pollinated Ae. speltoides and annual self-pollinated Ae. sharonensis are located 30 m apart on different soil types. Despite the close proximity of the two species and their close relatedness, no mixed groups are known. Comparative molecular cytogenetic analysis based on the intrapopulation variability of rRNA-encoding DNA (rDNA) chromosomal patterns of individual Ae. speltoides geno-types revealed an ongoing dynamic process of permanent chromosomal rearrangements. Chromosomal mutations can arise de novo and can be eliminated. Analysis of the progeny of the investigated genotypes testifies that inheritance of de novo rDNA sites happens frequently. Heterologous recombination and/or transposable elements-mediated rDNA transfer seem to be the mechanisms for observed chromosomal repatterning. Consequently, several modified genomic forms, intermediate between Ae. speltoides and Ae. sharonensis, permanently arise in the studied wild population of Ae. speltoides, which make it possible to recognize Ae. sharonensis as a derivative species of Ae. speltoides, as well as to propose rapidness and canalization of quantum speciation in Sitopsis species. PMID:15466712

  7. Phylogeny of the Eustigmatophyceae Based upon 18S rDNA, with Emphasis on Nannochloropsis.

    PubMed

    Andersen, R A; Brett, R W; Potter, D; Sexton, J P

    1998-02-01

    Complete 18S rDNA sequences were determined for 25 strains representing five genera of the Eustigmatophyceae, including re-examination of three strains with previously published sequences. Parsimony analysis of these and 44 published sequences for other heterokont chromophytes (unalignable sites removed) revealed that the Eustigmatophyceae were a monophyletic group. Analysis of eustigmatophyte taxa only (complete gene analyzed) supported the current familial classification scheme. Twenty one strains of Nannochloropsis were also examined using light microscopy. Gross morphology of cells was variable and overlapped among the strains; cell size was consistent within strains but sometimes varied considerably among strains of a species. The 18S rDNA of N. gaditana, N. oculata and N. salina was re-sequenced for strains used in previous publications and one or more nucleotide differences were found. Nucleotide sequences for Nannochloropsis species varied by up to 32 nucleotides. Identical sequences were found for six strains of N. salina, five strains of N. gadifana, four strains of N. granulata, and two strains of N. oculata, respectively. Four strains could not be assigned to described species and may represent two new species. The unique 18S rDNA sequences for each sibling species of Nannochloropsis demonstrates the presence of considerable genetic diversity despite the extremely simple morphology in this genus. PMID:23196114

  8. Optical probe

    DOEpatents

    Hencken, Kenneth; Flower, William L.

    1999-01-01

    A compact optical probe is disclosed particularly useful for analysis of emissions in industrial environments. The instant invention provides a geometry for optically-based measurements that allows all optical components (source, detector, rely optics, etc.) to be located in proximity to one another. The geometry of the probe disclosed herein provides a means for making optical measurements in environments where it is difficult and/or expensive to gain access to the vicinity of a flow stream to be measured. Significantly, the lens geometry of the optical probe allows the analysis location within a flow stream being monitored to be moved while maintaining optical alignment of all components even when the optical probe is focused on a plurality of different analysis points within the flow stream.

  9. BEND3 represses rDNA transcription by stabilizing a NoRC component via USP21 deubiquitinase

    PubMed Central

    Khan, Abid; Giri, Sumanprava; Wang, Yating; Chakraborty, Arindam; Ghosh, Archit K.; Anantharaman, Aparna; Aggarwal, Vasudha; Sathyan, Kizhakke M.; Ha, Taekjip; Prasanth, Kannanganattu V.; Prasanth, Supriya G.

    2015-01-01

    Ribosome biogenesis dictates the translational capacity of cells. Several mechanisms establish and maintain transcriptional output from eukaryotic ribosomal DNA (rDNA) loci. rDNA silencing is one such mechanism that ensures the inactivity and hence the maintenance of a silenced state of a subset of rRNA gene copies. Whereas oncogenic agents stimulate rRNA gene transcription, tumor suppressors decrease rRNA gene transcription. We demonstrate in mammalian cells that BANP, E5R, and Nac1 (BEN) domain 3 (BEND3), a quadruple BEN domain-containing protein, localizes in nucleoli and binds to ribosomal RNA gene promoters to help repress rRNA genes. Loss of BEND3 increases histone H3K4 trimethylation and, correspondingly, decreases rDNA promoter DNA methylation, consistent with a role for BEND3 in rDNA silencing. BEND3 associates with the nucleolar-remodeling complex (NoRC), and SUMOylated BEND3 stabilizes NoRC component TTF-1–interacting protein 5 via association with ubiquitin specific protease 21 (USP21) debiquitinase. Our results provide mechanistic insights into how the novel rDNA transcription repressor BEND3 acts together with NoRC to actively coordinate the establishment of rDNA silencing. PMID:26100909

  10. BEND3 represses rDNA transcription by stabilizing a NoRC component via USP21 deubiquitinase.

    PubMed

    Khan, Abid; Giri, Sumanprava; Wang, Yating; Chakraborty, Arindam; Ghosh, Archit K; Anantharaman, Aparna; Aggarwal, Vasudha; Sathyan, Kizhakke M; Ha, Taekjip; Prasanth, Kannanganattu V; Prasanth, Supriya G

    2015-07-01

    Ribosome biogenesis dictates the translational capacity of cells. Several mechanisms establish and maintain transcriptional output from eukaryotic ribosomal DNA (rDNA) loci. rDNA silencing is one such mechanism that ensures the inactivity and hence the maintenance of a silenced state of a subset of rRNA gene copies. Whereas oncogenic agents stimulate rRNA gene transcription, tumor suppressors decrease rRNA gene transcription. We demonstrate in mammalian cells that BANP, E5R, and Nac1 (BEN) domain 3 (BEND3), a quadruple BEN domain-containing protein, localizes in nucleoli and binds to ribosomal RNA gene promoters to help repress rRNA genes. Loss of BEND3 increases histone H3K4 trimethylation and, correspondingly, decreases rDNA promoter DNA methylation, consistent with a role for BEND3 in rDNA silencing. BEND3 associates with the nucleolar-remodeling complex (NoRC), and SUMOylated BEND3 stabilizes NoRC component TTF-1-interacting protein 5 via association with ubiquitin specific protease 21 (USP21) debiquitinase. Our results provide mechanistic insights into how the novel rDNA transcription repressor BEND3 acts together with NoRC to actively coordinate the establishment of rDNA silencing. PMID:26100909

  11. Molecular analysis of complete ssu to lsu rdna sequence in the harmful dinoflagellate alexandrium tamarense (korean isolate, HY970328M)

    NASA Astrophysics Data System (ADS)

    Ki, Jang-Seu; Han, Myung-Soo

    2005-09-01

    New PCR primers (N=18) were designed for the isolation of complete SSU to LSU rDNA sequences from the dinoflagellate Alexandrium tamarense. Standard PCR, employing each primer set selected for amplifications of less than 1.5 kb, successfully amplified the expected rDNA regions of A. tamarense (Korean isolate, HY970328M). Complete SSU, LSU rDNAs and ITS sequences, including 5.8S rDNA, were recorded at 1,800 bp, 520 bp and 3,393 bp, respectively. The LSU rDNA sequence was the first report in Alexandrium genus. No intron was found in the LSU rRNA coding region. Twelve D-domains within the LSU rDNA were put together into 1,879 bp (44.4% G+C), and cores into 1514 bp (42.8% G+C). The core sequence was significantly different (0.0867 of genetic distance, 91% sequence similarity) in comparison with Prorocentrum micans (GenBank access. no. X16108). The D2 region was the longest in length (300 bp) and highly variable among the 12 D-domains. In a phylogenetic analysis using complete LSU rDNA sequences of a variety of phytoplankton, A tamarense was clearly separated with high resolution against other species. The result suggests that the sequence may resolve the taxonomic ambiguities of Alexandrium genus, particularly of the tamarensis complex.

  12. Dynamics of R1 and R2 elements in the rDNA locus of Drosophila simulans.

    PubMed Central

    Pérez-González, C E; Eickbush, T H

    2001-01-01

    The mobile elements R1 and R2 insert specifically into the rRNA gene locus (rDNA locus) of arthropods, a locus known to undergo concerted evolution, the recombinational processes that preserve the sequence homogeneity of all repeats. To monitor how rapidly individual R1 and R2 insertions are turned over in the rDNA locus by these processes, we have taken advantage of the many 5' truncation variants that are generated during the target-primed reverse transcription mechanism used by these non-LTR retrotransposons for their integration. A simple PCR assay was designed to reveal the pattern of the 5' variants present in the rDNA loci of individual X chromosomes in a population of Drosophila simulans. Each rDNA locus in this population was found to have a large, unique collection of 5' variants. Each variant was present at low copy number, usually one copy per chromosome, and was seldom distributed to other chromosomes in the population. The failure of these variants to spread to other units in the same rDNA locus suggests a strong recombinational bias against R1 and R2 that results in the individual copies of these elements being rapidly lost from the rDNA locus. This bias suggests a significantly higher frequency of R1 and R2 retrotransposition than we have previously suggested. PMID:11514447

  13. Conductivity Probe

    NASA Technical Reports Server (NTRS)

    2008-01-01

    The Thermal and Electrical Conductivity Probe (TECP) for NASA's Phoenix Mars Lander took measurements in Martian soil and in the air.

    The needles on the end of the instrument were inserted into the Martian soil, allowing TECP to measure the propagation of both thermal and electrical energy. TECP also measured the humidity in the surrounding air.

    The needles on the probe are 15 millimeters (0.6 inch) long.

    The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is by NASA's Jet Propulsion Laboratory, Pasadena, Calif. Spacecraft development is by Lockheed Martin Space Systems, Denver.

  14. Distribution of a limited Sir2 protein pool regulates the strength of yeast rDNA silencing and is modulated by Sir4p.

    PubMed Central

    Smith, J S; Brachmann, C B; Pillus, L; Boeke, J D

    1998-01-01

    Transcriptional silencing in Saccharomyces cerevisiae occurs at the silent mating-type loci HML and HMR, at telomeres, and at the ribosomal DNA (rDNA) locus RDN1. Silencing in the rDNA occurs by a novel mechanism that depends on a single Silent Information Regulator (SIR) gene, SIR2. SIR4, essential for other silenced loci, paradoxically inhibits rDNA silencing. In this study, we elucidate a regulatory mechanism for rDNA silencing based on the finding that rDNA silencing strength directly correlates with cellular Sir2 protein levels. The endogenous level of Sir2p was shown to be limiting for rDNA silencing. Furthermore, small changes in Sir2p levels altered rDNA silencing strength. In rDNA silencing phenotypes, sir2 mutations were shown to be epistatic to sir4 mutations, indicating that SIR4 inhibition of rDNA silencing is mediated through SIR2. Furthermore, rDNA silencing is insensitive to SIR3 overexpression, but is severely reduced by overexpression of full-length Sir4p or a fragment of Sir4p that interacts with Sir2p. This negative effect of SIR4 overexpression was overridden by co-overexpression of SIR2, suggesting that SIR4 directly inhibits the rDNA silencing function of SIR2. Finally, genetic manipulations of SIR4 previously shown to promote extended life span also resulted in enhanced rDNA silencing. We propose a simple model in which telomeres act as regulators of rDNA silencing by competing for limiting amounts of Sir2 protein. PMID:9649515

  15. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.

    2005-01-01

    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  16. Strain identification and 5S rRNA gene characterization of the hyperthermophilic archaebacterium Sulfolobus acidocaldarius.

    PubMed Central

    Durovic, P; Kutay, U; Schleper, C; Dennis, P P

    1994-01-01

    A commonly used laboratory Sulfolobus strain has been unambiguously identified as Sulfolobus acidocaldarius DSM639. The 5S rRNA gene from this strain was cloned and sequenced. It differs at 17 of 124 positions from the identical 5S rRNA sequences from Sulfolobus solfataricus and a strain apparently misidentified as S. acidocaldarius. Analysis of the transcripts from the 5S rRNA gene failed to identify any precursor extending a significant distance beyond the 5' or 3' boundary of the 5S rRNA-coding sequence. This result suggests that the primary transcript of the 5S rRNA gene corresponds in length (within 1 or 2 nucleotides) to the mature 5S rRNA sequence found in 50S ribosomal subunits. Images PMID:8288546

  17. Intraspecific polymorphism of rDNA among five Nosema bombycis isolates from different geographic regions in China.

    PubMed

    Liu, Handeng; Pan, Guoqing; Luo, Bo; Li, Tian; Yang, Qiong; Vossbrinck, Charles R; Debrunner-Vossbrinck, Bettina A; Zhou, Zeyang

    2013-05-01

    The microsporidian Nosema bombycis is the causative agent of pébrine, a highly infectious disease of the silkworm Bombyx mori. Three regions of the multicopy rDNA gene were examined in order to investigate the relationships among five Nosema isolates from various regions of China. Ribosomal DNA alleles are present on each of the 18 chromosomes of N. bombycis and show a high degree of variation. In this study the small subunit (SSU) rDNA, internal transcribed spacer (ITS) and intergenic spacer (IGS) regions for up to 10 different rDNA copies from each N. bombycis isolate were cloned and sequenced. As expected we see greater polymorphism in the ITS region (88 variable sites in 179 nucleotides) and IGS (200 variable sites in 279 nucleotides) than in the SSU rDNA (24 variable sites in 1232 nucleotides). Phylogenetic analysis shows greater differences between alleles within an isolate than between the same alleles from different isolates. The data reveal two very different groups, one from the Sichuan province and the other with a broad distribution including four provinces in southeast China and Japan. The Sichuan isolate does not have any rDNA alleles with sequences identical to those in the other isolates, implying that it is a separate, non-intermixing, population or perhaps a separate species from the other isolates. In light of the polymorphic nature of the rDNA alleles in N. bombycis and their presence on every chromosome, the rDNA gene may be useful for understanding the movement and ultimately the source of pébrine infections. PMID:23399511

  18. Phylogenetic relationships among higher Nemertean (Nemertea) Taxa inferred from 18S rDNA sequences.

    PubMed

    Sundberg, P; Turbeville, J M; Lindh, S

    2001-09-01

    We estimated the phylogenetic relationships of 15 nemertean (phylum Nemertea) species from the four subclasses Hoplo-, Hetero-, Palaeo-, and Bdellonemertea with 18S rDNA sequence data. Three outgroup taxa were used for rooting: Annelida, Platyhelminthes, and Mollusca. Parsimony and maximum-likelihood analyses supported the monophyletic status of the Heteronemertea and a taxon consisting of hoplonemerteans and Bdellonemertea, while indicating that Palaeonemertea is paraphyletic. The monophyletic status of the two nemertean classes Anopla and Enopla is not supported by the data. The unambiguous clades are well supported, as assessed by a randomization test (bootstrapping) and branch support values. PMID:11527461

  19. Pollution Probe.

    ERIC Educational Resources Information Center

    Chant, Donald A.

    This book is written as a statement of concern about pollution by members of Pollution Probe, a citizens' anti-pollution group in Canada. Its purpose is to create public awareness and pressure for the eventual solution to pollution problems. The need for effective government policies to control the population explosion, conserve natural resources,…

  20. Effects of 16S rDNA sampling on estimates of the number of endosymbiont lineages in sucking lice.

    PubMed

    Allen, Julie M; Burleigh, J Gordon; Light, Jessica E; Reed, David L

    2016-01-01

    Phylogenetic trees can reveal the origins of endosymbiotic lineages of bacteria and detect patterns of co-evolution with their hosts. Although taxon sampling can greatly affect phylogenetic and co-evolutionary inference, most hypotheses of endosymbiont relationships are based on few available bacterial sequences. Here we examined how different sampling strategies of Gammaproteobacteria sequences affect estimates of the number of endosymbiont lineages in parasitic sucking lice (Insecta: Phthirapatera: Anoplura). We estimated the number of louse endosymbiont lineages using both newly obtained and previously sequenced 16S rDNA bacterial sequences and more than 42,000 16S rDNA sequences from other Gammaproteobacteria. We also performed parametric and nonparametric bootstrapping experiments to examine the effects of phylogenetic error and uncertainty on these estimates. Sampling of 16S rDNA sequences affects the estimates of endosymbiont diversity in sucking lice until we reach a threshold of genetic diversity, the size of which depends on the sampling strategy. Sampling by maximizing the diversity of 16S rDNA sequences is more efficient than randomly sampling available 16S rDNA sequences. Although simulation results validate estimates of multiple endosymbiont lineages in sucking lice, the bootstrap results suggest that the precise number of endosymbiont origins is still uncertain. PMID:27547523

  1. Hot spots of DNA double-strand breaks in human rDNA units are produced in vivo.

    PubMed

    Tchurikov, Nickolai A; Yudkin, Dmitry V; Gorbacheva, Maria A; Kulemzina, Anastasia I; Grischenko, Irina V; Fedoseeva, Daria M; Sosin, Dmitri V; Kravatsky, Yuri V; Kretova, Olga V

    2016-01-01

    Endogenous hot spots of DNA double-strand breaks (DSBs) are tightly linked with transcription patterns and cancer genomics(1,2). There are nine hot spots of DSBs located in human rDNA units(3-6). Here we describe that the profiles of these hot spots coincide with the profiles of γ-H2AX or H2AX, strongly suggesting a high level of in vivo breakage inside rDNA genes. The data were confirmed by microscopic observation of the largest γ-H2AX foci inside nucleoli in interphase chromosomes. In metaphase chromosomes, we observed that only some portion of rDNA clusters possess γ-H2AX foci and that all γ-H2AX foci co-localize with UBF-1 binding sites, which strongly suggests that only active rDNA units possess the hot spots of DSBs. Both γ-H2AX and UBF-1 are epigenetically inherited and thus indicate the rDNA units that were active in the previous cell cycle. These results have implications for diverse fields, including epigenetics and cancer genomics. PMID:27160357

  2. Chromosomal localization of 18S rDNA and telomere sequence in the aye-aye, Daubentonia madagascariensis.

    PubMed

    Rakotoarisoa, G; Hirai, Y; Go, Y; Kawamoto, Y; Shima, T; Koyama, N; Randrianjafy, A; Mora, R; Hirai, H

    2000-10-01

    Chromosomal localization of 18S rDNA and telomere sequence was attempted on the chromosomes of the aye-aye (2n = 30) using fluorescence in situ hybridization (FISH) and primed in situ labeling (PRINS), respectively. The rDNA was localized at the tip or whole of the short arm of acrocentric chromosomes 13 and 14 in all spreads observed. However, post-FISH silver-nitrate (Ag) staining showed that transcriptional activity of the rRNA genes was variable, particularly in chromosome 14, which was most frequently negative in one homologue carrying the smaller copy number of rDNA. This observation supports, at the molecular cytogenetic level, previous data concerning the relationship between the copy number of rDNA and its trancriptional activity. On the other hand, telomere sequence was localized only at the telomeric region of all chromosomes, the so-called telomere-only pattern, a characteristic similar to that of the greater bushbaby. These data may provide information on the chromosomal evolution of the lemur, because locations of rDNA and telomere sequences frequently offer important clues in reconstruction of karyotype differentiation. PMID:11245223

  3. Retrotransposable elements R1 and R2 in the rDNA units of Drosophila mercatorum: abnormal abdomen revisited.

    PubMed Central

    Malik, H S; Eickbush, T H

    1999-01-01

    R1 and R2 retrotransposable elements are stable components of the 28S rRNA genes of arthropods. While each retrotransposition event leads to incremental losses of rDNA unit expression, little is known about the selective consequences of these elements on the host genome. Previous reports suggested that in the abnormal abdomen (aa) phenotype of Drosophila mercatorum, high levels of rDNA insertions (R1) in conjunction with the under-replication locus (ur), enable the utilization of different ecological conditions via a population level shift to younger age. We have sequenced the R1 and R2 elements of D. mercatorum and show that the levels of R1- and R2-inserted rDNA units were inaccurately scored in the original studies of aa, leading to several misinterpretations. In particular, contrary to earlier reports, aa flies differentially underreplicate R1- and R2-inserted rDNA units, like other species of Drosophila. However, aa flies do not undergo the lower level of underreplication of their functional rDNA units (general underreplication) that is seen in wild-type strains. The lack of general underreplication is expected to confer a selective advantage and, thus, can be interpreted as an adaptation to overcome high levels of R1 and R2 insertions. These results allow us to reconcile some of the apparently contradictory effects of aa and the bobbed phenotype found in other species of Drosophila. PMID:9927458

  4. More than 10% of yeast genes are related to genome stability and influence cellular senescence via rDNA maintenance.

    PubMed

    Saka, Kimiko; Takahashi, Akihiro; Sasaki, Mariko; Kobayashi, Takehiko

    2016-05-19

    Genome instability triggers cellular senescence and is a common cause of cancer. The ribosomal RNA genes (rDNA), due to their repetitive structure, form a fragile site with frequent rearrangements. To identify eukaryotic factors that connect reduced genome stability to senescence we screened 4,876 strains of a Saccharomyces cerevisiae deletion library for aberrant rDNA and found 708 genes that contribute to its upkeep. 28 mutants caused abnormalities in non-rDNA chromosomes and among them 12 mutants have abnormalities both in rDNA and in non-rDNA chromosomes. Many mutated genes have not previously been implicated with genome maintenance nor their homologues with tumorigenesis in mammals. The link between rDNA state and senescence was broken after deletion of factors related with DNA polymerase ϵ. These mutations also suppressed the short lifespan phenotype of a sir2 mutant, suggesting a model in which molecular events at the heart of the replication fork induce abnormal rDNA recombination and are responsible for the emergence of an aging signal. PMID:26912831

  5. Hot spots of DNA double-strand breaks in human rDNA units are produced in vivo

    PubMed Central

    Tchurikov, Nickolai A.; Yudkin, Dmitry V.; Gorbacheva, Maria A.; Kulemzina, Anastasia I.; Grischenko, Irina V.; Fedoseeva, Daria M.; Sosin, Dmitri V.; Kravatsky, Yuri V.; Kretova, Olga V.

    2016-01-01

    Endogenous hot spots of DNA double-strand breaks (DSBs) are tightly linked with transcription patterns and cancer genomics1,2. There are nine hot spots of DSBs located in human rDNA units3–6. Here we describe that the profiles of these hot spots coincide with the profiles of γ-H2AX or H2AX, strongly suggesting a high level of in vivo breakage inside rDNA genes. The data were confirmed by microscopic observation of the largest γ-H2AX foci inside nucleoli in interphase chromosomes. In metaphase chromosomes, we observed that only some portion of rDNA clusters possess γ-H2AX foci and that all γ-H2AX foci co-localize with UBF-1 binding sites, which strongly suggests that only active rDNA units possess the hot spots of DSBs. Both γ-H2AX and UBF-1 are epigenetically inherited and thus indicate the rDNA units that were active in the previous cell cycle. These results have implications for diverse fields, including epigenetics and cancer genomics. PMID:27160357

  6. Effects of 16S rDNA sampling on estimates of the number of endosymbiont lineages in sucking lice

    PubMed Central

    Burleigh, J. Gordon; Light, Jessica E.; Reed, David L.

    2016-01-01

    Phylogenetic trees can reveal the origins of endosymbiotic lineages of bacteria and detect patterns of co-evolution with their hosts. Although taxon sampling can greatly affect phylogenetic and co-evolutionary inference, most hypotheses of endosymbiont relationships are based on few available bacterial sequences. Here we examined how different sampling strategies of Gammaproteobacteria sequences affect estimates of the number of endosymbiont lineages in parasitic sucking lice (Insecta: Phthirapatera: Anoplura). We estimated the number of louse endosymbiont lineages using both newly obtained and previously sequenced 16S rDNA bacterial sequences and more than 42,000 16S rDNA sequences from other Gammaproteobacteria. We also performed parametric and nonparametric bootstrapping experiments to examine the effects of phylogenetic error and uncertainty on these estimates. Sampling of 16S rDNA sequences affects the estimates of endosymbiont diversity in sucking lice until we reach a threshold of genetic diversity, the size of which depends on the sampling strategy. Sampling by maximizing the diversity of 16S rDNA sequences is more efficient than randomly sampling available 16S rDNA sequences. Although simulation results validate estimates of multiple endosymbiont lineages in sucking lice, the bootstrap results suggest that the precise number of endosymbiont origins is still uncertain. PMID:27547523

  7. Obtaining long 16S rDNA sequences using multiple primers and its application on dioxin-containing samples

    PubMed Central

    2015-01-01

    Background Next-generation sequencing (NGS) technology has transformed metagenomics because the high-throughput data allow an in-depth exploration of a complex microbial community. However, accurate species identification with NGS data is challenging because NGS sequences are relatively short. Assembling 16S rDNA segments into longer sequences has been proposed for improving species identification. Current approaches, however, either suffer from amplification bias due to one single primer or insufficient 16S rDNA reads in whole genome sequencing data. Results Multiple primers were used to amplify different 16S rDNA segments for 454 sequencing, followed by 454 read classification and assembly. This permitted targeted sequencing while reducing primer bias. For test samples containing four known bacteria, accurate and near full-length 16S rDNAs of three known bacteria were obtained. For real soil and sediment samples containing dioxins in various concentrations, 16S rDNA sequences were lengthened by 50% for about half of the non-rare microbes, and 16S rDNAs of several microbes reached more than 1000 bp. In addition, reduced primer bias using multiple primers was illustrated. Conclusions A new experimental and computational pipeline for obtaining long 16S rDNA sequences was proposed. The capability of the pipeline was validated on test samples and illustrated on real samples. For dioxin-containing samples, the pipeline revealed several microbes suitable for future studies of dioxin chemistry. PMID:26681335

  8. Using an intervening sequence of Faecalibacterium 16S rDNA to identify poultry feces.

    PubMed

    Shen, Zhenyu; Duan, Chuanren; Zhang, Chao; Carson, Andrew; Xu, Dong; Zheng, Guolu

    2013-10-15

    This study was designed to identify poultry feces-specific marker(s) within sequences of Faecalibacterium 16S rDNA for detecting poultry fecal pollution in water. Bioinformatics tools were used in the comparative analysis of 7,458 sequences of Faecalibacterium 16S rDNA, reportedly associated with various poultry (chicken and turkey) and animal species. One intervening sequence (IVS) within between the hypervariable region 1 and the conserved region 2, designated as IVS-p, was found to be unique to poultry feces. Based on this sequence, a PCR assay (PCR-p) was developed. The PCR-p produced an amplicon of 132 bp only in the test when fecal or wastewater samples from poultry were used, but not when using fecal or wastewater samples from other sources. The non-poultry sources included feces of beef or dairy cattle, dog, horse, human, domestic or wild geese, seagull, sheep, swine, and wild turkey. These data indicate that IVS-p may prove to be a useful genetic marker for the specific identification of poultry fecal pollution in environmental waterways. Furthermore, results of data mining and PCR assay indicate that the IVS-p may have a broad geographic distribution. This report represents initial evidence of the potential utility of ribosomal intervening sequences as genetic markers for tracking host sources of fecal pollution in waterways. PMID:24011842

  9. Asymmetric Epigenetic Modification and Elimination of rDNA Sequences by Polyploidization in Wheat[W

    PubMed Central

    Guo, Xiang

    2014-01-01

    rRNA genes consist of long tandem repeats clustered on chromosomes, and their products are important functional components of the ribosome. In common wheat (Triticum aestivum), rDNA loci from the A and D genomes were largely lost during the evolutionary process. This biased DNA elimination may be related to asymmetric transcription and epigenetic modifications caused by the polyploid formation. Here, we observed both sets of parental nucleolus organizing regions (NORs) were expressed after hybridization, but asymmetric silencing of one parental NOR was immediately induced by chromosome doubling, and reversing the ploidy status could not reactivate silenced NORs. Furthermore, increased CHG and CHH DNA methylation on promoters was accompanied by asymmetric silencing of NORs. Enrichment of H3K27me3 and H3K9me2 modifications was also observed to be a direct response to increased DNA methylation and transcriptional inactivation of NOR loci. Both A and D genome NOR loci with these modifications started to disappear in the S4 generation and were completely eliminated by the S7 generation in synthetic tetraploid wheat. Our results indicated that asymmetric epigenetic modification and elimination of rDNA sequences between different donor genomes may lead to stable allopolyploid wheat with increased differentiation and diversity. PMID:25415973

  10. Investigation of the validity of species status of Ixodes dammini (Acari: Ixodidae) using rDNA.

    PubMed Central

    Wesson, D M; McLain, D K; Oliver, J H; Piesman, J; Collins, F H

    1993-01-01

    The two internal transcribed spacers (ITS1 and ITS2) of rDNA of three members of the Ixodes ricinus "complex" (Acari: Ixodidae) were sequenced. Sequence variation was assessed for the North American species I. scapularis, I. dammini, and I. pacificus at three levels: within individual/population, between individuals of different geographic origin within a species, and between species. Both spacers are highly variable, particularly with regard to small deletions and additions which may arise via replication slippage. Homogenization of rDNA multigene arrays for particular sequence variants appears to occur at a relatively rapid rate, since I. pacificus sequences differ from the others at numerous invariant sites, facilitating the use of these sequences to assess sibling species relationships. Based on maximum parsimony and two distance methods (unweighted pair-group with arithmetic means and neighbor-joining), sequence variation in ITS1 and ITS2 suggests that I. scapularis and I. dammini are not distinct species and that even individuals from geographically isolated locations are very similar. Individuals from geographically separated populations of I. pacificus appear to be relatively less closely related to each other but distinct from those of I. scapularis/dammini. In I. scapularis/dammini, diversity within and between individuals from geographic populations contributed equally to total sequence diversity. PMID:8234280

  11. Protein purification in multicompartment electrolyzers for crystal growth of r-DNA products in microgravity

    NASA Technical Reports Server (NTRS)

    Righetti, Pier Giorgio; Casale, Elena; Carter, Daniel; Snyder, Robert S.; Wenisch, Elisabeth; Faupel, Michel

    1990-01-01

    Recombinant-DNA (deoxyribonucleic acid) (r-DNA) proteins, produced in large quantities for human consumption, are now available in sufficient amounts for crystal growth. Crystallographic analysis is the only method now available for defining the atomic arrangements within complex biological molecules and decoding, e.g., the structure of the active site. Growing protein crystals in microgravity has become an important aspect of biology in space, since crystals that are large enough and of sufficient quality to permit complete structure determinations are usually obtained. However even small amounts of impurities in a protein preparation are anathema for the growth of a regular crystal lattice. A multicompartment electrolyzer with isoelectric, immobiline membranes, able to purify large quantities of r-DNA proteins is described. The electrolyzer consists of a stack of flow cells, delimited by membranes of very precise isoelectric point (pI, consisting of polyacrylamide supported by glass fiber filters containing Immobiline buffers and titrants to uniquely define a pI value) and very high buffering power, able to titrate all proteins tangent or crossing such membranes. By properly selecting the pI values of two membranes delimiting a flow chamber, a single protein can be kept isoelectric in a single flow chamber and thus, be purified to homogeneity (by the most stringent criterion, charge homogeneity).

  12. Asymmetric epigenetic modification and elimination of rDNA sequences by polyploidization in wheat.

    PubMed

    Guo, Xiang; Han, Fangpu

    2014-11-01

    rRNA genes consist of long tandem repeats clustered on chromosomes, and their products are important functional components of the ribosome. In common wheat (Triticum aestivum), rDNA loci from the A and D genomes were largely lost during the evolutionary process. This biased DNA elimination may be related to asymmetric transcription and epigenetic modifications caused by the polyploid formation. Here, we observed both sets of parental nucleolus organizing regions (NORs) were expressed after hybridization, but asymmetric silencing of one parental NOR was immediately induced by chromosome doubling, and reversing the ploidy status could not reactivate silenced NORs. Furthermore, increased CHG and CHH DNA methylation on promoters was accompanied by asymmetric silencing of NORs. Enrichment of H3K27me3 and H3K9me2 modifications was also observed to be a direct response to increased DNA methylation and transcriptional inactivation of NOR loci. Both A and D genome NOR loci with these modifications started to disappear in the S4 generation and were completely eliminated by the S7 generation in synthetic tetraploid wheat. Our results indicated that asymmetric epigenetic modification and elimination of rDNA sequences between different donor genomes may lead to stable allopolyploid wheat with increased differentiation and diversity. PMID:25415973

  13. Phylogenetic relationships between Bacillus species and related genera inferred from 16s rDNA sequences

    PubMed Central

    Wei Wang, Mi Sun

    2009-01-01

    Neighbor-joining, maximum-parsimony, minimum-evolution, maximum-likelihood and Bayesian trees constructed based on 16S rDNA sequences of 181 type strains of Bacillus species and related taxa manifested nine phylogenetic groups. The phylogenetic analysis showed that Bacillus was not a monophyletic group. B. subtilis was in Group 1. Group 4, 6 and 8 respectively consisted of thermophiles, halophilic or halotolerant bacilli and alkaliphilic bacilli. Group 2, 4 and 8 consisting of Bacillus species and related genera demonstrated that the current taxonomic system did not agree well with the 16S rDNA evolutionary trees. The position of Caryophanaceae and Planococcaceae in Group 2 suggested that they might be transferred into Bacillaceae, and the heterogeneity of Group 2 implied that some Bacillus species in it might belong to several new genera. Group 9 was mainly comprised of the genera (excluding Bacillus) of Bacillaceae, so some Bacillus species in Group 9: B. salarius, B. qingdaonensis and B. thermcloacae might not belong to Bacillus. Four Bacillus species, B. schlegelii, B. tusciae, B. edaphicus and B. mucilaginosus were clearly placed outside the nine groups. PMID:24031394

  14. Discriminatory profile of rDNA sites and trend for acrocentric chromosome formation in the genus Trachinotus Lacépède, 1801 (Perciformes, Carangidae).

    PubMed

    Jacobina, Uedson Pereira; Vicari, Marcelo Ricardo; Bertollo, Luiz Antonio Carlos; Molina, Wagner Franco

    2012-01-01

    Chromosomal traits have provided valuable information for phylogeny and taxonomy of several fish groups. Three Atlantic Carangidae species of the genus Trachinotus Lacépède, 1801 (Trachinotus goodei Jordan et Evermann, 1896, Trachinotus carolinus (Linnaeus, 1766)and Trachinotus falcatus (Linnaeus, 1758)) were investigated, having 2n=48 chromosomes but different chromosomal arms (FN number), i.e., 52, 56 and 58, respectively, in view of the different number of two-armed chromosomes found in their karyotypes. Thus, Trachinotus goodei, Trachinotus carolinus and Trachinotus falcatus present a progressive distancefrom the probable basal karyotype proposed for Perciformes (2n=48 acrocentrics, FN=48). At first sight, these findings do not agree with the phylogenetic hypothesis based on mitochondrial sequences, where Trachinotus goodei appear as the most derived species, followed by Trachinotus falcatus and Trachinotus carolinus, respectively. However, the chromosomal mapping of ribosomal DNAs was informative for clarifying this apparent conflict. Indeed, the multiple 5S and 18S rDNA sites found in Trachinotus goodei corroborate the most derived condition for this species. In this sense, the occurrence of the unexpected number of two-armed chromosomes and FN value for this species, as well as for Trachinotus carolinus, must be due to additional rounds of acrocentric formation in these species, modifying the macrostructure of their karyotypes. PMID:24260676

  15. Discriminatory profile of rDNA sites and trend for acrocentric chromosome formation in the genus Trachinotus Lacépède, 1801 (Perciformes, Carangidae)

    PubMed Central

    Jacobina, Uedson Pereira; Vicari, Marcelo Ricardo; Bertollo, Luiz Antonio Carlos; Molina, Wagner Franco

    2012-01-01

    Abstract Chromosomal traits have provided valuable information for phylogeny and taxonomy of several fish groups. Three Atlantic Carangidae species of the genus Trachinotus Lacépède, 1801 (Trachinotus goodei Jordan et Evermann, 1896, Trachinotus carolinus (Linnaeus, 1766)and Trachinotus falcatus (Linnaeus, 1758)) were investigated, having 2n=48 chromosomes but different chromosomal arms (FN number), i.e., 52, 56 and 58, respectively, in view of the different number of two-armed chromosomes found in their karyotypes. Thus, Trachinotus goodei, Trachinotus carolinus and Trachinotus falcatus present a progressive distancefrom the probable basal karyotype proposed for Perciformes (2n=48 acrocentrics, FN=48). At first sight, these findings do not agree with the phylogenetic hypothesis based on mitochondrial sequences, where Trachinotus goodei appear as the most derived species, followed by Trachinotus falcatus and Trachinotus carolinus, respectively. However, the chromosomal mapping of ribosomal DNAs was informative for clarifying this apparent conflict. Indeed, the multiple 5S and 18S rDNA sites found in Trachinotus goodei corroborate the most derived condition for this species. In this sense, the occurrence of the unexpected number of two-armed chromosomes and FN value for this species, as well as for Trachinotus carolinus, must be due to additional rounds of acrocentric formation in these species, modifying the macrostructure of their karyotypes. PMID:24260676

  16. Altered gravity influences rDNA and NopA100 localization in nucleoli

    NASA Astrophysics Data System (ADS)

    Sobol, M. A.; Kordyum, E. L.

    Fundamental discovery of gravisensitivity of cells no specified to gravity perception focused increasing attention on an elucidation of the mechanisms involved in altered gravity effects at the cellular and subcellular levels. The nucleolus is the transcription site of rRNA genes as well as the site of processing and initial packaging of their transcripts with ribosomal and nonribosomal proteins. The mechanisms inducing the changes in the subcomponents of the nucleolus that is morphologically defined yet highly dynamic structure are still unknown in detail. To understand the functional organization of the nucleolus as in the control as under altered gravity conditions it is essential to determine both the precise location of rDNA and the proteins playing the key role in rRNA processing. Lepidium sativum seeds were germinated in 1% agar medium on the slow horizontal clinostat (2 rpm) and in the stationary conditions. We investigated the root meristematic cells dissected from the seedlings grown in darkness for two days. The investigations were carried out with anti-DNA and anti-NopA100 antibodies labeling as well as with TdT procedure, and immunogold electron microscopy. In the stationary growth conditions, the anti-DNA antibody as well TdT procedure were capable of detecting fibrillar centers (FCs) and the dense fibrillar component (DFC) in the nucleolus. In FCs, gold particles were revealed on the condensed chromatin inclusions, internal fibrils of decondensed rDNA and the transition zone FC-DFC. Quantitatively, FCs appeared 1,5 times more densely labeled than DFC. NopA100 was localized in FCs and in DFC. In FCs, the most of protein was revealed in the transition zone FC-DFC. After a quantitative study, FCs and the transition zone FC-DFC appeared to contain NopA100 1,7 times more than DFC. Under the conditions of altered gravity, quantitative data clearly showed a redistribution of nucleolar DNA and NopA100 between FCs and DFC in comparison with the control. In

  17. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  18. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  19. A search for the Bs meson in Υ(5S) decays

    NASA Astrophysics Data System (ADS)

    Shipsey, Ian

    2004-05-01

    The CLEO III detector has recorded approximately 0.5 fb-1 of e^+ e^- annihilation data at the Υ(5S) resonance. Using this data sample, we have searched for fully reconstructed Bs mesons in the reaction Υ(5S) arrow B_s^(*) barB_s^(*)

  20. Evidence for the presence of 5S rRNA in mammalian mitochondria.

    PubMed

    Magalhães, P J; Andreu, A L; Schon, E A

    1998-09-01

    Mammalian mitochondrial ribosomes contain two prokaryotic-like rRNAs, 12S and 16S, both encoded by mitochondrial DNA. As opposed to cytosolic ribosomes, however, these ribosomes are not thought to contain 5S rRNA. For this reason, it has been unclear whether 5S rRNA, which can be detected in mitochondrial preparations, is an authentic organellar species imported from the cytosol or is merely a copurifying cytosol-derived contaminant. We now show that 5S rRNA is tightly associated with highly purified mitochondrial fractions of human and rat cells and that 5S rRNA transcripts derived from a synthetic gene transfected transiently into human cells are both expressed in vivo and present in highly purified mitochondria and mitoplasts. We conclude that 5S rRNA is imported into mammalian mitochondria, but its function there still remains to be clarified. PMID:9725900

  1. The 5S lean method as a tool of industrial management performances

    NASA Astrophysics Data System (ADS)

    Filip, F. C.; Marascu-Klein, V.

    2015-11-01

    Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

  2. Mitochondrial Enzyme Rhodanese Is Essential for 5 S Ribosomal RNA Import into Human Mitochondria*

    PubMed Central

    Smirnov, Alexandre; Comte, Caroline; Mager-Heckel, Anne-Marie; Addis, Vanessa; Krasheninnikov, Igor A.; Martin, Robert P.; Entelis, Nina; Tarassov, Ivan

    2010-01-01

    5 S rRNA is an essential component of ribosomes. In eukaryotic cells, it is distinguished by particularly complex intracellular traffic, including nuclear export and re-import. The finding that in mammalian cells 5 S rRNA can eventually escape its usual circuit toward nascent ribosomes to get imported into mitochondria has made the scheme more complex, and it has raised questions about both the mechanism of 5 S rRNA mitochondrial targeting and its function inside the organelle. Previously, we showed that import of 5 S rRNA into mitochondria requires unknown cytosolic proteins. Here, one of them was identified as mitochondrial thiosulfate sulfurtransferase, rhodanese. Rhodanese in its misfolded form was found to possess a strong and specific 5 S rRNA binding activity, exploiting sites found earlier to function as signals of 5 S rRNA mitochondrial localization. The interaction with 5 S rRNA occurs cotranslationally and results in formation of a stable complex in which rhodanese is preserved in a compact enzymatically inactive conformation. Human 5 S rRNA in a branched Mg2+-free form, upon its interaction with misfolded rhodanese, demonstrates characteristic functional traits of Hsp40 cochaperones implicated in mitochondrial precursor protein targeting, suggesting that it may use this mechanism to ensure its own mitochondrial localization. Finally, silencing of the rhodanese gene caused not only a proportional decrease of 5 S rRNA import but also a general inhibition of mitochondrial translation, indicating the functional importance of the imported 5 S rRNA inside the organelle. PMID:20663881

  3. Initial results on the molecular phylogeny of the Nudibranchia (Gastropoda, Opisthobranchia) based on 18S rDNA data.

    PubMed

    Wollscheid, E; Wägele, H

    1999-11-01

    This study investigated nudibranch phylogeny on the basis of 18S rDNA sequence data. 18S rDNA sequence data of 19 taxa representing the major living orders and families of the Nudibranchia were analyzed. Representatives of the Cephalaspidea, Anaspidea, Gymnomorpha, Prosobranchia, and Pulmonata were also sequenced and used as outgroups. An additional 28 gastropod sequences taken from GenBank were also included in our analyses. Phylogenetic analyses of these more than 50 gastropod taxa provide strong evidence for support of the monophyly of the Nudibranchia. The monophyly of the Doridoidea, Cladobranchia, and Aeolidoidea within the Nudibranchia are also strongly supported. Phylogenetic utility and information content of the 18S rDNA sequences for Nudibranchia, and Opisthobranchia in general, are examined using the program SplitsTree as well as phylogenetic reconstructions using distance and parsimony approaches. 0Results based on these molecular data are compared with hypotheses about nudibranch phylogeny inferred from morphological data. PMID:10603252

  4. Early-life nutrition modulates the epigenetic state of specific rDNA genetic variants in mice.

    PubMed

    Holland, Michelle L; Lowe, Robert; Caton, Paul W; Gemma, Carolina; Carbajosa, Guillermo; Danson, Amy F; Carpenter, Asha A M; Loche, Elena; Ozanne, Susan E; Rakyan, Vardhman K

    2016-07-29

    A suboptimal early-life environment, due to poor nutrition or stress during pregnancy, can influence lifelong phenotypes in the progeny. Epigenetic factors are thought to be key mediators of these effects. We show that protein restriction in mice from conception until weaning induces a linear correlation between growth restriction and DNA methylation at ribosomal DNA (rDNA). This epigenetic response remains into adulthood and is restricted to rDNA copies associated with a specific genetic variant within the promoter. Related effects are also found in models of maternal high-fat or obesogenic diets. Our work identifies environmentally induced epigenetic dynamics that are dependent on underlying genetic variation and establishes rDNA as a genomic target of nutritional insults. PMID:27386920

  5. Electron microscopic in situ hybridization and autoradiography: Localization and transcription of rDNA in human lymphocyte nucleoli

    SciTech Connect

    Wachtler, F.; Mosgoeller, W.S.; Schwarzacher, H.G. )

    1990-04-01

    The distribution of ribosomal DNA (rDNA) in the nucleoli of human lymphocytes was revealed by in situ hybridization with a nonautoradiographic procedure at the electron microscopic level. rDNA is located in the dense fibrillar component of the nucleolus but not in the fibrillar centers. In the same cells the incorporation of tritiated uridine takes place in the dense fibrillar component of the nucleolus as seen by autoradiography followed by gold latensification. From these findings it can be concluded that the transcription of ribosomal DNA takes place in the dense fibrillar component of the nucleolus.

  6. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

    PubMed Central

    Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R

    2006-01-01

    As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

  7. Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

    PubMed Central

    Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B

    1978-01-01

    A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

  8. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    SciTech Connect

    Hirose, Yutaka Harada, Fumio

    2008-01-04

    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus.

  9. Mouse nucleolin binds to 4.5S RNAh, a small noncoding RNA.

    PubMed

    Hirose, Yutaka; Harada, Fumio

    2008-01-01

    4.5S RNAh is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAh is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAh-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAhin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAh-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAh recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAh was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus. PMID:17971306

  10. 18S rRNA Gene Variation among Common Airborne Fungi, and Development of Specific Oligonucleotide Probes for the Detection of Fungal Isolates

    PubMed Central

    Wu, Zhihong; Tsumura, Yoshihiko; Blomquist, Göran; Wang, Xiao-Ru

    2003-01-01

    In this study, we sequenced 18S rRNA genes (rDNA) from 49 fungal strains representing 31 species from 15 genera. Most of these species are common airborne fungi and pathogens that may cause various public health concerns. Sequence analysis revealed distinct divergence between Zygomycota and Ascomycota. Within Ascomycota, several strongly supported clades were identified that facilitate the taxonomic placement of several little-studied fungi. Wallemia appeared as the group most diverged from all the other Ascomycota species. Based on the 18S rDNA sequence variation, 108 oligonucleotide probes were designed for each genus and species included in this study. After homology searches and DNA hybridization evaluations, 33 probes were verified as genus or species specific. The optimal hybridization temperatures to achieve the best specificity for these 33 probes were determined. These new probes can contribute to the molecular diagnostic research for environmental monitoring. PMID:12957927

  11. Molecular characterization of Gastrodiscoides hominis (Platyhelminthes: Trematoda: Digenea) inferred from ITS rDNA sequence analysis.

    PubMed

    Goswami, L M; Prasad, P K; Tandon, V; Chatterjee, A

    2009-06-01

    Gastrodiscoides hominis (Digenea: Paramphistomata: Gastrodiscidae) is an amphistomid intestinal fluke of pigs causing gastrodiscoidiosis. With the use of molecular tools assisting the conventional diagnostic procedures, we aimed at finding out molecular characterization of G. hominis using PCR amplifications of rDNA ITS (1, 2) sequences. The sequences obtained (GenBank accession numbers EF027096, EF027097, EF027098, EU887294, and EU887295) were compared with available sequences of other digenean parasites, particularly those having a zoonotic potential in the northeastern region of India. The BLAST search revealed a close similarity with members of the family Paramphistomidae, showing maximum similarity with the amphistome, Homalogaster paloniae (subfamily Paramphistominae). Based on various tree construction methods, phylogeny of G. hominis is discussed. PMID:19198879

  12. Molecular Taxonomy of Ganoderma cupreum from Southern India Inferred from ITS rDNA Sequences Analysis

    PubMed Central

    2013-01-01

    Ganoderma is a cosmopolitan wood-rot basidiomycete that has been extensively studied for its pathogencity and medicinal properties. Identification of Ganoderma based on macro-microscopic features led to large number of synonyms which resulted in 250 taxonomic names. A Ganoderma species collected from Courtallam, Tamil Nadu was identified as G. cupreum. Phylogenetic analysis inferred from internal transcribed spacer rDNA region resolved the Indian isolate MYC1 as Ganoderma cupreum which clustered with Australian and Asian "cupreum" clade with 85% bootstrap support BS and shared 99% and 98% nucleotide similarity with Malaysian and Australian 'cupreum' respectively. This study represents the first molecular evidence of G. cupreum from Asian origin. PMID:24493948

  13. 18S rDNA dataset profiling microeukaryotic populations within Chicago area nearshore waters

    PubMed Central

    Searle, Daniel; Sible, Emily; Cooper, Alexandria; Putonti, Catherine

    2016-01-01

    Despite their critical role in the aquatic food web and nutrient cycling, microeukaryotes within freshwater environments are under-studied. Herein we present the first high-throughput molecular survey of microeukaryotes within Lake Michigan. Every two weeks from May 13 to August 5, 2014, we collected surface water samples from the nearshore waters of four Chicago area beaches: Gillson Park, Montrose Beach, 57th Street Beach, and Calumet Beach. Four biological replicates were collected for each sampling date and location, resulting in 112 samples. Eighty-nine of these samples were surveyed through targeted sequencing of the V7 and V8 regions of the 18S rDNA gene. Both technical and biological replicates were sequenced and are included in this dataset. Raw sequence data is available via NCBI’s SRA database (BioProject PRJNA294919). PMID:26904716

  14. 18S rDNA dataset profiling microeukaryotic populations within Chicago area nearshore waters.

    PubMed

    Searle, Daniel; Sible, Emily; Cooper, Alexandria; Putonti, Catherine

    2016-03-01

    Despite their critical role in the aquatic food web and nutrient cycling, microeukaryotes within freshwater environments are under-studied. Herein we present the first high-throughput molecular survey of microeukaryotes within Lake Michigan. Every two weeks from May 13 to August 5, 2014, we collected surface water samples from the nearshore waters of four Chicago area beaches: Gillson Park, Montrose Beach, 57th Street Beach, and Calumet Beach. Four biological replicates were collected for each sampling date and location, resulting in 112 samples. Eighty-nine of these samples were surveyed through targeted sequencing of the V7 and V8 regions of the 18S rDNA gene. Both technical and biological replicates were sequenced and are included in this dataset. Raw sequence data is available via NCBI's SRA database (BioProject PRJNA294919). PMID:26904716

  15. Combining denaturing gradient gel electrophoresis of 16S rDNA V3 region and 16S-23S rDNA spacer region polymorphism analyses for the identification of staphylococci from Italian fermented sausages.

    PubMed

    Blaiotta, Giuseppe; Pennacchia, Carmelina; Ercolini, Danilo; Moschetti, Giancarlo; Villani, Francesco

    2003-09-01

    Separation of amplified V3 region from 16S rDNA by denaturing gradient gel electrophoresis (PCR-DGGE) and 16S-23S rDNA intergenic spacer region polymorphism (ISR-PCR) analyses were tested as tool for differentiation of staphylococcal strains commonly isolated from fermented sausages. Variable V3 regions of 25 staphylococcal reference strains and 96 wild strains of species belonging to the genera Staphylococcus, Micrococcus and Kocuria were analyzed. PCR-DGGE profiles obtained were species-specific for S. sciuri, S. haemolyticus, S. hominis, S. auricularis, S. condimenti, S. kloosi, S. vitulus, S. succinus, S. pasteuri, S. capitis and S. (Macrococcus) caseolyticus. Moreover, 7 groups could be distinguished gathering the remaining species as result of the separation of the V3 rDNA amplicons in DGGE. Furthermore, the combination of the results obtained by PCR-DGGE and ISR-PCR analyses allowed a clear differentiation of all the staphylococcal species analysed, with exception of the pairs S. equorum-S. cohnii and S. carnosus-S. schleiferi. The suitability of both molecular techniques and of the combination their results for the identification of staphylococci was validated analysing partial nucleotide sequence of the 16S rDNA of a representative number of wild strains. PMID:14529185

  16. Complete structure of nuclear rDNA of the obligate plant parasite Plasmodiophora brassicae: intraspecific polymorphisms in the exon and group I intron of the large subunit rDNA.

    PubMed

    Niwa, Rieko; Kawahara, Ai; Murakami, Hiroharu; Tanaka, Shuhei; Ezawa, Tatsuhiro

    2011-07-01

    Plasmodiophora brassicae is a soil-borne obligate intracellular parasite in the phylum Cercozoa of the Rhizaria that causes clubroot disease of crucifer crops. To control the disease, understanding the distribution and infection routes of the pathogen is essential, and thus development of reliable molecular markers to discriminate geographic populations is required. In this study, the nuclear ribosomal RNA gene (rDNA) repeat unit of P. brassicae was determined, with particular emphasis on the structure of large subunit (LSU) rDNA, in which polymorphic regions were expected to be present. The complete rDNA complex was 9513bp long, which included the small subunit, 5.8S and LSU rDNAs as well as the internal transcribed spacer and intergenic spacer regions. Among eight field populations collected from throughout Honshu Island, Japan, a 1.1 kbp region of the LSU rDNA, including the divergent 8 domain, exhibited intraspecific polymorphisms that reflected geographic isolation of the populations. Two new group I introns were found in this region in six out of the eight populations, and the sequences also reflected their geographic isolation. The polymorphic region found in this study may have potential for the development of molecular markers for discrimination of field populations/isolates of this organism. PMID:21497131

  17. Species markers for equine strongyles detected in intergenic rDNA by PCR-RFLP.

    PubMed

    Gasser, R B; Stevenson, L A; Chilton, N B; Nansen, P; Bucknell, D G; Beveridge, I

    1996-10-01

    Five species of equine strongyle belonging to the subfamily Strongylinae (Strongylus edentatus, S. equinus, S. vulgaris, Oesophagodontus robustus and Triodontophorus serratus) and 11 species belonging to the subfamily Cyathostominae (Poteriostomum imparidentatum, P. ratzii, Cylicocyclus insignis, Cc. leptostomus, Cc. nassatus, Cylicostephanus calicatus, Cs. longibursatus, Cs. goldi, Cyathostomum catinatum, Cy. labiatum and Cy. pateratum) were characterized using a polymerase chain reaction-linked restriction fragment length polymorphism technique (PCR-RFLP). Internal transcribed spacer ribosomal DNA was amplified from genomic DNA by polymerase chain reaction (PCR) using conserved primers, digested separately with six restriction endonucleases (AluI, BfaI, CfoI, Hae III, VSpI and XbaI) and the fragments separated by agarose gel electrophoresis. The PCR products of the three Strongylus species were approx. 90-100 bp smaller in size compared with those of the other 13 species. The PCR-RFLP analysis of the rDNA region spanning the first and second internal transcribed spacers plus the 5.85 rDNA gene (ITS+) produced characteristic patterns for each of the 16 species examined, and no variation in RFLP patterns was detected within the species Cy. catinatum, where multiple isolates were analysed. The study demonstrates that the internal transcribed spacer sequences provide genetic markers for the species identification of a range of equine strongyles. These markers will be of use for the identification of egg and larval stages, where morphological characters alone are unreliable. The results also indicate that the spacer sequences will be of use to study the systematics of equine strongyles. PMID:8910892

  18. Molecular rDNA phylogeny of Telotylenchidae Siddiqi, 1960 and evaluation of tail termini

    PubMed Central

    Carta, L. K.; Skantar, A. M.; Handoo, Z. A.

    2010-01-01

    Three stunt nematode species, Tylenchorhynchus leviterminalis, T. dubius and T. claytoni were characterized with segments of small subunit 18S and large subunit 28S rDNA sequence and placed in molecular phylogenetic context with other polyphyletic taxa of Telotylenchidae. Based upon comparably sized phylogenetic breadth of outgroups and ingroups, the 28S rDNA contained three times the number of phylogenetically informative alignment characters relative to the alignment total compared to the larger 18S dataset even though there were fewer than half the number of taxa represented. Tail shapes and hyaline termini were characterized for taxa within these subfamily trees, and variability discussed for some related species. In 18S trees, similar terminal tail thickness was found in a well-supported clade of three Tylenchorhynchus: broad-tailed T. leviterminalis branched outside relatively narrow-tailed T. claytoni and T. nudus. Terminal tail thickness within Merliniinae, Telotylenchinae and related taxa showed a mosaic distribution. Thick-tailed Trophurus, Macrotrophurus and putative Paratrophurus did not group together in the 18S tree. Extremely thickened tail termini arose at least once in Amplimerlinius and Pratylenchoides among ten species of Merliniinae plus three Pratylenchoides, and three times within twelve taxa of Telotylenchinae and Trophurinae. Conflicting generic and family nomenclature based on characters such as pharyngeal overlap are discussed in light of current molecular phylogeny. Contrary to some expectations from current taxonomy, Telotylenchus and Tylenchorhynchus cf. robustus did not cluster with three Tylenchorhynchus spp. Two putative species of Neodolichorhynchus failed to group together, and two populations of Scutylenchus quadrifer demonstrated as much or greater genetic distance between them than among three related species of Merlinius. PMID:22736870

  19. Phylogenetic analysis of Demodex caprae based on mitochondrial 16S rDNA sequence.

    PubMed

    Zhao, Ya-E; Hu, Li; Ma, Jun-Xian

    2013-11-01

    Demodex caprae infests the hair follicles and sebaceous glands of goats worldwide, which not only seriously impairs goat farming, but also causes a big economic loss. However, there are few reports on the DNA level of D. caprae. To reveal the taxonomic position of D. caprae within the genus Demodex, the present study conducted phylogenetic analysis of D. caprae based on mt16S rDNA sequence data. D. caprae adults and eggs were obtained from a skin nodule of the goat suffering demodicidosis. The mt16S rDNA sequences of individual mite were amplified using specific primers, and then cloned, sequenced, and aligned. The sequence divergence, genetic distance, and transition/transversion rate were computed, and the phylogenetic trees in Demodex were reconstructed. Results revealed the 339-bp partial sequences of six D. caprae isolates were obtained, and the sequence identity was 100% among isolates. The pairwise divergences between D. caprae and Demodex canis or Demodex folliculorum or Demodex brevis were 22.2-24.0%, 24.0-24.9%, and 22.9-23.2%, respectively. The corresponding average genetic distances were 2.840, 2.926, and 2.665, and the average transition/transversion rates were 0.70, 0.55, and 0.54, respectively. The divergences, genetic distances, and transition/transversion rates of D. caprae versus the other three species all reached interspecies level. The five phylogenetic trees all presented that D. caprae clustered with D. brevis first, and then with D. canis, D. folliculorum, and Demodex injai in sequence. In conclusion, D. caprae is an independent species, and it is closer to D. brevis than to D. canis, D. folliculorum, or D. injai. PMID:23996126

  20. Important role of the tetraloop region of 4.5S RNA in SRP binding to its receptor FtsY.

    PubMed Central

    Jagath, J R; Matassova, N B; de Leeuw, E; Warnecke, J M; Lentzen, G; Rodnina, M V; Luirink, J; Wintermeyer, W

    2001-01-01

    Binding of Escherichia coli signal recognition particle (SRP) to its receptor, FtsY, requires the presence of 4.5S RNA, although FtsY alone does not interact with 4.5S RNA. In this study, we report that the exchange of the GGAA tetraloop sequence in domain IV of 4.5S RNA for UUCG abolishes SRP-FtsY interaction, as determined by gel retardation and membrane targeting experiments, whereas replacements with other GNRA-type tetraloops have no effect. A number of other base exchanges in the tetraloop sequence have minor or intermediate inhibitory effects. Base pair disruptions in the stem adjacent to the tetraloop or replacement of the closing C-G base pair with G-C partially restored function of the otherwise inactive UUCG mutant. Chemical probing by hydroxyl radical cleavage of 4.5S RNA variants show that replacing GGAA with UUCG in the tetraloop sequence leads to structural changes both within the tetraloop and in the adjacent stem; the latter change is reversed upon reverting the C-G closing base pair to G-C. These results show that the SRP-FtsY interaction is strongly influenced by the structure of the tetraloop region of SRP RNA, in particular the tetraloop stem, and suggest that both SRP RNA and Ffh undergo mutual structural adaptation to form SRP that is functional in the interaction with the receptor, FtsY. PMID:11233986

  1. 104. JOB NO. 1347F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    104. JOB NO. 1347-F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD MOTOR COMPANY; LONGITUDINAL SECTION AND TRUSS DETAILS - Ford Motor Company Long Beach Assembly Plant, Assembly Building, 700 Henry Ford Avenue, Long Beach, Los Angeles County, CA

  2. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    NASA Technical Reports Server (NTRS)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  3. Nucleotide sequence of 5S ribosomal RNA from Aspergillus nidulans and Neurospora crassa.

    PubMed Central

    Piechulla, B; Hahn, U; McLaughlin, L W; Küntzel, H

    1981-01-01

    The nucleotide sequences of 5S rRNA molecules isolated from the cytosol and the mitochondria of the ascomycetes A. nidulans and N. crassa were determined by partial chemical cleavage of 3'-terminally labelled RNA. The sequence identity of the cytosolic and mitochondrial RNA preparations confirms the absence of mitochondrion-specific 5S rRNA in these fungi. The sequences of the two organisms differ in 35 positions, and each sequence differs from yeast 5S rRNA in 44 positions. Both molecules contain the sequence GCUC in place of GAAC or GAUY found in all other 5S rRNAs, indicating that this region is not universally involved in base-pairing to the invariant GTpsiC sequence of tRNAs. Images PMID:6453331

  4. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].

    PubMed

    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem

    2014-04-01

    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p< 0.001). After the implementation of 5S it was observed and determined that facilitating the job and setting up a safe environment created

  5. Cytogenetic analysis on geographically distant parthenogenetic populations of Tityus trivittatus Kraepelin, 1898 (Scorpiones, Buthidae): karyotype, constitutive heterochromatin and rDNA localization

    PubMed Central

    Adilardi, Renzo Sebastián; Affilastro, Andrés Alejandro Ojanguren; Martí, Dardo Andrea; Mola, Liliana María

    2014-01-01

    Abstract Tityus trivittatus Kraepelin, 1898 is the most medically important scorpion species of Argentina, and parthenogenetic populations are present in the major cities of this country. We performed a detailed cytogenetic analysis of specimens of three synanthropic parthenogenetic populations, all distant about 900 km from each other, using Ag-NOR, C-banding, DAPI/CMA3 staining and FISH with autologous 28S rDNA probes. The karyotype of females and embryos from the three populations showed 2n=6, with two large and four middle-sized holokinetic chromosomes. Constitutive heterochromatin was found in terminal and interstitial location and its pattern allowed the identification of three chromosome pairs. NORs were found on the terminal heterochromatic region of one pair of middle-sized chromosomes. The use of fluorochromes to characterize heterochromatin showed the absence of GC-rich heterochromatin and a low and variable number of AT-rich heterochromatic regions. We propose that a possible explanation for the lack of karyotypic variation between these geographically distant populations could be a recent colonization of urban areas by human means of synanthropic specimens from a single lineage of northeastern Argentina. PMID:25147621

  6. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  7. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  8. One-stage surgery through posterior approach-for L5-S1 spondyloptosis

    PubMed Central

    Suslu, Hikmet Turan; Celikoglu, Erhan; Borekcı, Ali; Hıcdonmez, Tufan; Suslu, Hüsnü

    2011-01-01

    Grade 5 spondylolisthesis or spondyloptosis is a rare condition. Generally, the surgical management of spondyloptosis includes multi-staged procedures instead of one-staged procedures. One-stage treatment for spondyloptosis is very rare. A 15-year-old girl with L5-S1 spondyloptosis was admitted with severe low back pain. There was no history of trauma. The patient underwent L5 laminectomy, L5-S1 discectomy, resection of sacral dome, reduction, L3-L4-L5-S1 pedicular screw fixation, and interbody-posterolateral fusion through the posterior approach. The reduction was maintained with bilateral L5-S1 discectomy, resection of the sacral dome, and transpedicular instrumentation from L3 to S1. In this particular case, one-staged approach was adequate for the treatment of L5-S1 spondyloptosis. One-staged surgery using the posterior approach may be adequate for the treatment of L5-S1 spondyloptosis while avoiding the risks inherent in anterior approaches. PMID:23125496

  9. Direct 5S rRNA Assay for Monitoring Mixed-Culture Bioprocesses

    PubMed Central

    Stoner, D. L.; Browning, C. K.; Bulmer, D. K.; Ward, T. E.; MacDonell, M. T.

    1996-01-01

    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species extracted from collected biomass. Separation is based on the unique migration behavior of each 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the genera Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. PMID:16535333

  10. Microbial rRNA: rDNA gene ratios may be unexpectedly low due to extracellular DNA preservation in soils

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We tested a method of estimating the activity of detectable individual bacterial and archaeal OTUs within a community by calculating ratios of absolute 16S rRNA to rDNA copy numbers. We investigated phylogenetically coherent patterns of activity among soil prokaryotes in non-growing soil communitie...

  11. ASSESSMENT OF FECAL POLLUTION SOURCES IN PLUM CREEK WATERSHED USING BACTEROIDETES 16S RDNA-BASED ASSAYS

    EPA Science Inventory

    Recently, 16S rDNA Bacteroidetes-targeted PCR assays were developed to discriminate between ruminant and human fecal pollution. These assays are rapid and relatively inexpensive but have been used in a limited number of studies. In this study, we evaluated the efficacy o...

  12. Bacterial diversity in the rumen of Indian Surti buffalo (Bubalus bubalis), assessed by 16S rDNA analysis.

    PubMed

    Pandya, P R; Singh, K M; Parnerkar, S; Tripathi, A K; Mehta, H H; Rank, D N; Kothari, R K; Joshi, C G

    2010-01-01

    Bacterial communities in buffalo rumen were characterized using a culture-independent approach for a pooled sample of rumen fluid from 3 adult Surti buffaloes. Buffalo rumen is likely to include species of various bacterial phyla, so 16S rDNA sequences were amplified and cloned from the sample. A total of 191 clones were sequenced and similarities to known 16S rDNA sequences were examined. About 62.82% sequences (120 clones) had >90% similarity to the 16S rDNA database sequences. Furthermore, about 34.03% of the sequences (65 clones) were 85-89% similar to 16S rDNA database sequences. For the remaining 3.14%; the similarity was lower than 85% Phylogenetic analyses were also used to infer the makeup of bacterial communities in the rumen of Surti buffalo. As a result, we distinguished 42 operational taxonomic units (OTUs) based on unique 16S r DNA sequences: 19 OTUs affiliated to an unidentified group (45.23% of total OTUs), 11 OTUs of the phylum Firmicutes, also known as the low G+C group (26.19%), 7 OTUs of the Cytophaga-Flexibacter-Bacteroides phylum (16.66%), 4 OTUs of Spirochaetes (9.52%), and 1 OTU of Actinobacteria (2.38%). These include 10 single-clone OTUs, so Good's coverage (94.76%) of 16S rRNA libraries indicated that sequences identified in the libraries represent the majority of bacterial diversity present in rumen. PMID:20720314

  13. Methanogen diversity in the rumen of Indian Surti buffalo (Bubalus bubalis), assessed by 16S rDNA analysis.

    PubMed

    Singh, K M; Tripathi, A K; Pandya, P R; Parnerkar, S; Rank, D N; Kothari, R K; Joshi, C G

    2012-06-01

    The methanogenic communities in buffalo rumen were characterized using a culture-independent approach of a pooled sample of rumen fluid from three adult Surti buffaloes. Buffalo rumen is likely to include species of various methanogens, so 16S rDNA sequences were amplified and cloned from the sample. A total of 171 clones were sequenced to examine 16S rDNA sequence similarity. About 52.63% sequences (90 clones) had ≥ 90% similarity, whereas, 46.78% of the sequences (81 clones) were 75-89% similar to 16S rDNA database sequences, respectively. Phylogenetic analyses were also used to infer the makeup of methanogenic communities in the rumen of Surti buffalo. As a result, we distinguished 23 operational taxonomic units (OTUs) based on unique 16S rDNA sequences: 12 OTUs (52.17%) affiliated to Methanomicrobiales order, 10 OTUs (43.47%) of the order Methanobacteriales and one OTU (4.34%) of Methanosarcina barkeri like clone, respectively. In addition, the population of Methanomicrobiales and Methabacteriales orders were also observed, accounting 4% and 2.17% of total archea. This study has revealed the largest assortment of hydrogenotrophic methanogens phylotypes ever identified from rumen of Surti buffaloes. PMID:21507441

  14. ASSESSMENT OF FECAL POLLUTION SOURCES IN PLUM CREEK WATERSHED USING PCR AND PHYLOGENETIC ANALYSES OF BACTEROIDETES 16S RDNA

    EPA Science Inventory

    Traditional methods for assessing fecal pollution in environmental systems, such as monitoring for fecal coliforms are not capable of discriminating between different sources fecal pollution. Recently, 16S rDNA Bacteroidetes-targeted PCR assays were developed to discriminate betw...

  15. Macrolide Resistance in Treponema pallidum Correlates With 23S rDNA Mutations in Recently Isolated Clinical Strains

    PubMed Central

    Molini, Barbara J.; Tantalo, Lauren C.; Sahi, Sharon K.; Rodriguez, Veronica I.; Brandt, Stephanie L.; Fernandez, Mark C.; Godornes, Charmie B.; Marra, Christina M.; Lukehart, Sheila A.

    2016-01-01

    Background High rates of 23S rDNA mutations implicated in macrolide resistance have been identified in Treponema pallidum samples from syphilis patients in many countries. Nonetheless, some clinicians have been reluctant to abandon azithromycin as a treatment for syphilis, citing the lack of a causal association between these mutations and clinical evidence of drug resistance. Although azithromycin resistance has been demonstrated in vivo for the historical Street 14 strain, no recent T. pallidum isolates have been tested. We used the well-established rabbit model of syphilis to determine the in vivo efficacy of azithromycin against 23S rDNA mutant strains collected in 2004 to 2005 from patients with syphilis in Seattle, Wash. Methods Groups of 9 rabbits were each infected with a strain containing 23S rDNA mutation A2058G (strains UW074B, UW189B, UW391B) or A2059G (strains UW228B, UW254B, and UW330B), or with 1 wild type strain (Chicago, Bal 3, and Mexico A). After documentation of infection, 3 animals per strain were treated with azithromycin, 3 were treated with benzathine penicillin G, and 3 served as untreated control groups. Treatment efficacy was documented by darkfield microscopic evidence of T. pallidum, serological response, and rabbit infectivity test. Results Azithromycin uniformly failed to cure rabbits infected with strains harboring either 23S rDNA mutation, although benzathine penicillin G was effective. Infections caused by wild type strains were successfully treated by either azithromycin or benzathine penicillin G. Conclusions A macrolide resistant phenotype was demonstrated for all strains harboring a 23S rDNA mutation, demonstrating that either A2058G or A2059G mutation confers in vivo drug resistance. PMID:27513385

  16. [Rapid detection of Pseudomonas aeruginosa by the fluorescence quantitative PCR assay targeting 16S rDNA].

    PubMed

    Xue, Li-Jun; Wang, Yong-Zhi; Ren, Hao; Tong, Yi-Min; Zhao, Ping; Zhu, Shi-Ying; Qi, Zhong-Tian

    2006-09-01

    The 16S rDNA specific primers were designed for rapid detection of Pseudomonas aeruginosa (PA) by the fluorescence quantitative PCR (FQ-PCR) assay, based upon multiple sequence alignment and phylogenetic tree analysis of the 16S rDNAs of over 20 bacteria. After extraction of PA genomic DNA, the target 16S rDNA fragment was amplified by PCR with specific primers, and used to construct recombinant pMDT-Pfr plasmid, the dilution gradients of which were subjected to the standard quantitation curve in FQ-PCR assay. Different concentrations of PA genomic DNA were detected by FQ-PCR in a 20microL of reaction system with SYBR Green I. At the same time, various genomic DNAs of Staphylococcus aureus, Salmonella typhi, Shigella flexneri, Proteus vulgaris, Staphylococcus epidermidis, Escherichia coli, and Mycobacterium tuberculosis were used as negative controls to confirm specificity of the FQ-PCR detection assay. Results demonstrated that the predicted amplified product of designed primers was of high homology only with PA 16S rDNA, and that sensitivity of the FQ-PCR assay was of 3.6pg/microL of bacterial DNA or (2.1 x 10(3) +/- 3.1 x 10(2)) copies/microL of 16S rDNA, accompanied with high specificity, and that the whole detection process including DNA extraction could be completed in about two hours. In contrast to traditional culture method, the FQ-PCR assay targeting 16S rDNA gene can be used to detect PA rapidly, which exhibits perfect application prospect in future. PMID:17037203

  17. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.

    2003-01-01

    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  18. Chromosomal localization and sequence variation of 5S rRNA gene in five Capsicum species.

    PubMed

    Park, Y K; Park, K C; Park, C H; Kim, N S

    2000-02-29

    Chromosomal localization and sequence analysis of the 5S rRNA gene were carried out in five Capsicum species. Fluorescence in situ hybridization revealed that chromosomal location of the 5S rRNA gene was conserved in a single locus at a chromosome which was assigned to chromosome 1 by the synteny relationship with tomato. In sequence analysis, the repeating units of the 5S rRNA genes in the Capsicum species were variable in size from 278 bp to 300 bp. In sequence comparison of our results to the results with other Solanaceae plants as published by others, the coding region was highly conserved, but the spacer regions varied in size and sequence. T stretch regions, just after the end of the coding sequences, were more prominant in the Capsicum species than in two other plants. High G x C rich regions, which might have similar functions as that of the GC islands in the genes transcribed by RNA PolII, were observed after the T stretch region. Although we could not observe the TATA like sequences, an AT rich segment at -27 to -18 was detected in the 5S rRNA genes of the Capsicum species. Species relationship among the Capsicum species was also studied by the sequence comparison of the 5S rRNA genes. While C. chinense, C. frutescens, and C. annuum formed one lineage, C. baccatum was revealed to be an intermediate species between the former three species and C. pubescens. PMID:10774742

  19. Affinity chromatography of Drosophila melanogaster ribosomal proteins to 5S rRNA.

    PubMed

    Stark, B C; Chooi, W Y

    1985-02-20

    The binding of Drosophila melanogaster ribosomal proteins to D. melanogaster 5S rRNA was studied using affinity chromatography of total ribosomal proteins (TP80) on 5S rRNA linked via adipic acid dihydrazide to Sepharose 4B. Ribosomal proteins which bound 5S rRNA at 0.3 M potassium chloride and were eluted at 1 M potassium chloride were identified as proteins 1, L4, 2/3, L14/L16, and S1, S2, S3, S4, S5, by two-dimensional polyacrylamide gel electrophoresis. Using poly A-Sepharose 4B columns as a model of non-specific binding, we found that a subset of TP80 proteins is also bound. This subset, while containing some of the proteins bound by 5S rRNA columns, was distinctly different from the latter subset, indicating that the binding to 5S rRNA was specific for that RNA species. PMID:3923010

  20. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    PubMed Central

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  1. Photoionization study of Xe 5s: ionization cross sections and photoelectron angular distributions

    NASA Astrophysics Data System (ADS)

    Aarthi, G.; Jose, J.; Deshmukh, S.; Radojevic, V.; Deshmukh, P. C.; Manson, S. T.

    2014-01-01

    We report studies of photoelectron angular distribution and cross-section for photoionization of xenon 5s electrons using the relativistic multiconfiguration Tamm-Dancoff (MCTD) approximation. We find that MCTD provides a significantly improved agreement with experiment, compared to some of the other relativistic many body approximations such as the relativistic random phase approximation and the relativistic random phase approximation with relaxation, over the entire photon energy region bracketing the near-threshold 5s Cooper minimum, from the 5s threshold up to about 70 eV. The MCTD results in the length form are in much better agreement with the experiment than those in the velocity form, suggesting residual correlations that must be of importance.

  2. 4.5S ribonucleic acid, a novel ribosome component in the chloroplasts of flowering plants.

    PubMed Central

    Bowman, C M; Dyer, T A

    1979-01-01

    A species of low-molecular-weight ribosomal RNA, referred to as '4.5S rRNA', was found in addition to 5S rRNA in the large subunit of chloroplast ribosomes of a wide range of flowering plants. It was shown by sequence analysis that several variants of this RNA may occur in a plant. Furthermore, although in most flowering plants the predominant variant contains about 100 nucleotides, in the broad bean it has less than 80. It seems, therefore, to be much more diverse in size and sequence than the other ribosomal RNA species. Like 5S rRNA , it does not contain modified nucleotides and it is also unusual in having an unphosphorylated 5'-end. It is apparently neither a homologue of cytosol 5.8S rRNA nor a fragment of 23S rRNA. Images Fig. 1. Fig. 3. Fig. 4. PMID:540035

  3. Diversity of 5S rRNA genes within individual prokaryotic genomes

    PubMed Central

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V.; Parsons, Tamasha; Yang, Liying; Gerz, Erika A.; Lee, Peng; Xiang, Charlie; Nossa, Carlos W.; Pei, Zhiheng

    2012-01-01

    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1168 genomes from 779 unique species, 96 species exhibited >3% diversity. Twenty seven species with >10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there were tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level. There is supplementary material. PMID:22765222

  4. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    NASA Technical Reports Server (NTRS)

    Luehrsen, K. R.; Fox, G. E.

    1981-01-01

    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  5. Development of a PNA Probe for Fluorescence In Situ Hybridization Detection of Prorocentrum donghaiense

    PubMed Central

    Chen, Guofu; Zhang, Chunyu; Zhang, Baoyu; Wang, Guangce; Lu, Douding; Xu, Zhong; Yan, Peishen

    2011-01-01

    Prorocentrum donghaiense is a common but dominant harmful algal bloom (HAB) species, which is widely distributed along the China Sea coast. Development of methods for rapid and precise identification and quantification is prerequisite for early-stage warning and monitoring of blooms due to P. donghaiense. In this study, sequences representing the partial large subunit rDNA (D1–D2), small subunit rDNA and internal transcribed spacer region (ITS-1, 5.8S rDNA and ITS-2) of P. donghaiense were firstly obtained, and then seven candidate DNA probes were designed for performing fluorescence in situ hybridization (FISH) tests on P. donghaiense. Based on the fluorescent intensity of P. donghaiense cells labeled by the DNA probes, the probe DP0443A displayed the best hybridization performance. Therefore, a PNA probe (PP0443A) analogous to DP0443A was used in the further study. The cells labeled with the PNA probe displayed more intensive green fluorescence than that labeled with its DNA analog. The PNA probe was used to hybridize with thirteen microalgae belonging to five families, i.e., Dinophyceae, Prymnesiophyceae, Raphidophyceae, Chlorophyceae and Bacillariophyceae, and showed no visible cross-reaction. Finally, FISH with the probes PP0443A and DP0443A and light microscopy (LM) analysis aiming at enumerating P. donghaiense cells were performed on the field samples. Statistical comparisons of the cell densities (cells/L) of P. donghaiense in the natural samples determined by FISH and LM were performed using one-way ANOVA and Duncan's multiple comparisons of the means. The P. donghaiense cell densities determined by LM and the PNA probe are remarkably higher than (p<0.05) that determined by the DNA probe, while no significant difference is observed between LM and the PNA probe. All results suggest that the PNA probe is more sensitive that its DNA analog, and therefore is promising for the monitoring of harmful algal blooms of P. donghaiense in the future. PMID:22022408

  6. Characterization of the L4-L5-S1 motion segment using the stepwise reduction method.

    PubMed

    Jaramillo, Héctor Enrique; Puttlitz, Christian M; McGilvray, Kirk; García, José J

    2016-05-01

    The two aims of this study were to generate data for a more accurate calibration of finite element models including the L5-S1 segment, and to find mechanical differences between the L4-L5 and L5-S1 segments. Then, the range of motion (ROM) and facet forces for the L4-S1 segment were measured using the stepwise reduction method. This consists of sequentially testing and reducing each segment in nine stages by cutting the ligaments, facet capsules, and removing the nucleus. Five L4-S1 human segments (median: 65 years, range: 53-84 years, SD=11.0 years) were loaded under a maximum pure moment of 8Nm. The ROM was measured using stereo-photogrammetry via tracking of three markers and the facet contact forces (CF) were measured using a Tekscan system. The ROM for the L4-L5 segment and all stages showed good agreement with published data. The major differences in ROM between the L4-L5 and L5-S1 segments were found for lateral bending and all stages, for which the L4-L5 ROM was about 1.5-3 times higher than that of the L5-S1 segment, consistent with L5-S1 facet CF about 1.3 to 4 times higher than those measured for the L4-L5 segment. For the other movements and few stages, the L4-L5 ROM was significantly lower that of the L5-S1 segment. ROM and CF provide important baseline data for more accurate calibration of FE models and to understand the role that their structures play in lower lumbar spine mechanics. PMID:27017302

  7. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    NASA Technical Reports Server (NTRS)

    Delihas, N.; Fox, G. E.

    1987-01-01

    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  8. The Pattern of R2 Retrotransposon Activity in Natural Populations of Drosophila simulans Reflects the Dynamic Nature of the rDNA Locus

    PubMed Central

    Zhou, Jun; Eickbush, Thomas H.

    2009-01-01

    The pattern and frequency of insertions that enable transposable elements to remain active in a population are poorly understood. The retrotransposable element R2 exclusively inserts into the 28S rRNA genes where it establishes long-term, stable relationships with its animal hosts. Previous studies with laboratory stocks of Drosophila simulans have suggested that control over R2 retrotransposition resides within the rDNA loci. In this report, we sampled 180 rDNA loci of animals collected from two natural populations of D. simulans. The two populations were found to have similar patterns of R2 activity. About half of the rDNA loci supported no or very low levels of R2 transcripts with no evidence of R2 retrotransposition. The remaining half of the rDNA loci had levels of R2 transcripts that varied in a continuous manner over almost a 100-fold range and did support new retrotransposition events. Structural analysis of the rDNA loci in 18 lines that spanned the range of R2 transcript levels in these populations revealed that R2 number and rDNA locus size varied 2-fold; however, R2 activity was not readily correlated with either of these parameters. Instead R2 activity was best correlated with the distribution of elements within the rDNA locus. Loci with no activity had larger contiguous blocks of rDNA units free of R2-insertions. These data suggest a model in which frequent recombination within the rDNA locus continually redistributes R2-inserted units resulting in changing levels of R2 activity within individual loci and persistent R2 activity within the population. PMID:19229317

  9. Molecular phylogeny of endophytic isolates of Ampelomyces from Iran based on rDNA ITS sequences.

    PubMed

    Jamali, Samad

    2015-01-01

    During 2012, five isolates of pycnidial fungi were recovered from roots of tomato (Solanum lycopersicum) plants in Iran. Based on morphological characteristics the presence of Ampelomyces was documented. To confirm morphological identification and clarify the placement of endophytic isolates of Ampelomyces, DNA was extracted from isolates using a genomic DNA purification Kit. Region of internal transcribed spacers 1, 2 and 5.8S genes of rDNA were amplified using ITS4 and ITS1 universal primer set. Amplicons were purified, sequenced and submitted to the GenBank. The resulting sequence (600 bp) was submitted to a BLAST search to find most similar sequences in GenBank. The ITS sequences of isolates obtained in Iran were compared to those of other related authentic sequences obtained from GenBank. Iranian endophytic isolates had 100 % similarity of among themselves, while all isolates of Ampelomyces sequences analyzed had an average of 95.2 % (range 87-100 %) similarity. When Ampelomyces ITS sequences were analyzed by both distance-based and maximum parsimony methods, the Ampelomyces isolates were segregate into 11 distinct clades. The ITS sequences of endophytic isolates obtained in Iran were identical with endophytic isolates from other country including USA, Australia, Hungary and Spain. Our analyses of phylogenetic data showed that endophytic isolates from Iran and other countries are distinct group. The high ITS sequence-divergence values and the phylogenetic analysis suggested the isolates of Ampelomyces in the clades are not closely related and indeed a problematic species complex. PMID:25245955

  10. Characterization of viable bacteria from Siberian permafrost by 16S rDNA sequencing

    NASA Technical Reports Server (NTRS)

    Shi, T.; Reeves, R. H.; Gilichinsky, D. A.; Friedmann, E. I.

    1997-01-01

    Viable bacteria were found in permafrost core samples from the Kolyma-Indigirka lowland of northeast Siberia. The samples were obtained at different depths; the deepest was about 3 million years old. The average temperature of the permafrost is -10 degrees C. Twenty-nine bacterial isolates were characterized by 16S rDNA sequencing and phylogenetic analysis, cell morphology, Gram staining, endospore formation, and growth at 30 degrees C. The majority of the bacterial isolates were rod shaped and grew well at 30 degrees C; but two of them did not grow at or above 28 degrees C, and had optimum growth temperatures around 20 degrees C. Thirty percent of the isolates could form endospores. Phylogenetic analysis revealed that the isolates fell into four categories: high-GC Gram-positive bacteria, beta-proteobacteria, gamma-proteobacteria, and low-GC Gram-positive bacteria. Most high-GC Gram-positive bacteria and beta-proteobacteria, and all gamma-proteobacteria, came from samples with an estimated age of 1.8-3.0 million years (Olyor suite). Most low-GC Gram-positive bacteria came from samples with an estimated age of 5,000-8,000 years (Alas suite).

  11. Identification of a potential fungal species by 18S rDNA for ligninases production.

    PubMed

    Ferhan, M; Santos, S N; Melo, I S; Yan, N; Sain, M

    2013-12-01

    Fungal species for ligninases production was investigated by 18S ribosomal DNA sequence analysis. Two primer sets were chosen to amplify a major part of the 18S rDNA, which resulted in intense PCR product of approximately 550-820 bp in size per sample. The results suggest that the 18S rDNA-based approach is a useful tool for identification of unknown potential fungal species for ligninases production. The isolated fungal species produces mainly manganese peroxidase (MnP). The enzyme oxidized a variety of the usual MnP substrates, including lignin related polyphenols. Time course studies showed that maximum production of ligninolytic enzymes MnP (64 IU L⁻¹), lignin peroxidase (26.35 IU L⁻¹), and laccase (5.44 IU L⁻¹), respectively, were achieved after 10 days of cultivation under optimum conditions. Furthermore, the biological decolorization of Remazol Brilliant Blue R dye following 10 days of cultivation was 94 %. NCBI BLAST was used to search for closest matched sequences in the GenBank database and based on sequence homology the first BLAST hit was Dothioraceae sp. LM572 with accession number EF060858.1. PMID:23744034

  12. Ectomycorrhizal iconoclasts: the ITS rDNA diversity and nitrophilic tendencies of fetid Russula.

    PubMed

    Avis, Peter G

    2012-01-01

    Fetid Russula are frequently dominant ectomycorrhizal fungi, and some appear to be especially nitrophilic. However, little is known about their phylogenetic relationships or how common nitrophilic traits are in this group. This study addresses this gap and presents a phylogenetic analysis of ITS rDNA sequences and a meta-analysis of studies that examine ectomycorrhizal fungi response to nitrogen increase. The phylogenetic analysis indicates that (i) this lineage contains numerous unidentified taxa; (ii) the taxa have distinct geographic distributions; and (iii) the misuse of names such as R amoenolens, R. foetens or R. pectinatoides is common. Twenty-three well supported phylotypes were identified and include clades specific to western North America, eastern North America, Europe and Asia, while morphologically similar collections from tropical-equatorial regions are distinct. The metaanalysis shows that nitrophilic tendencies appear throughout fetid Russulas suggesting that this character is not an isolated trait within this subgenus but instead is a more general feature of the group overall. Mapping these tendencies across a broader portion of the Russulaceae shows that this trait is more regularly found in the basal Russula lineages and Lactarius spp., suggesting that this ability evolved early in these fungi. PMID:22495448

  13. Molecular Analysis of Methanogen Richness in Landfill and Marshland Targeting 16S rDNA Sequences

    PubMed Central

    Yadav, Shailendra; Kundu, Sharbadeb; Ghosh, Sankar K.; Maitra, S. S.

    2015-01-01

    Methanogens, a key contributor in global carbon cycling, methane emission, and alternative energy production, generate methane gas via anaerobic digestion of organic matter. The methane emission potential depends upon methanogenic diversity and activity. Since they are anaerobes and difficult to isolate and culture, their diversity present in the landfill sites of Delhi and marshlands of Southern Assam, India, was analyzed using molecular techniques like 16S rDNA sequencing, DGGE, and qPCR. The sequencing results indicated the presence of methanogens belonging to the seventh order and also the order Methanomicrobiales in the Ghazipur and Bhalsawa landfill sites of Delhi. Sequences, related to the phyla Crenarchaeota (thermophilic) and Thaumarchaeota (mesophilic), were detected from marshland sites of Southern Assam, India. Jaccard analysis of DGGE gel using Gel2K showed three main clusters depending on the number and similarity of band patterns. The copy number analysis of hydrogenotrophic methanogens using qPCR indicates higher abundance in landfill sites of Delhi as compared to the marshlands of Southern Assam. The knowledge about “methanogenic archaea composition” and “abundance” in the contrasting ecosystems like “landfill” and “marshland” may reorient our understanding of the Archaea inhabitants. This study could shed light on the relationship between methane-dynamics and the global warming process. PMID:26568700

  14. TP53INP2/DOR, a mediator of cell autophagy, promotes rDNA transcription via facilitating the assembly of the POLR1/RNA polymerase I preinitiation complex at rDNA promoters.

    PubMed

    Xu, Yinfeng; Wan, Wei; Shou, Xin; Huang, Rui; You, Zhiyuan; Shou, Yanhong; Wang, Lingling; Zhou, Tianhua; Liu, Wei

    2016-07-01

    Cells control their metabolism through modulating the anabolic and catabolic pathways. TP53INP2/DOR (tumor protein p53 inducible nuclear protein 2), participates in cell catabolism by serving as a promoter of autophagy. Here we uncover a novel function of TP53INP2 in protein synthesis, a major biosynthetic and energy-consuming anabolic process. TP53INP2 localizes to the nucleolus through its nucleolar localization signal (NoLS) located at the C-terminal domain. Chromatin immunoprecipitation (ChIP) assays detected an association of TP53INP2 with the ribosomal DNA (rDNA), when exclusion of TP53INP2 from the nucleolus repressed rDNA promoter activity and the production of ribosomal RNA (rRNA) and proteins. The removal of TP53INP2 also impaired the association of the POLR1/RNA polymerase I preinitiation complex (PIC) with rDNA. Further, TP53INP2 interacts directly with POLR1 PIC, and is required for the assembly of the complex. These data indicate that TP53INP2 promotes ribosome biogenesis through facilitating rRNA synthesis at the nucleolus, suggesting a dual role of TP53INP2 in cell metabolism, assisting anabolism on the nucleolus, and stimulating catabolism off the nucleolus. PMID:27172002

  15. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON QSAR

    EPA Science Inventory

    Dyer, S.D., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to predict HC5's Based on QSARs (Abstract). To be presented at the SETAC Europe 14th Annual Meeting: Environmental Science Solution: A Pan-European Perspective, 18-...

  16. Sacrum fracture following L5-S1 stand-alone interbody fusion for isthmic spondylolisthesis.

    PubMed

    Phan, Kevin; Mobbs, Ralph J

    2015-11-01

    We report a 72-year-old man with a rare sacral fracture following stand-alone L5-S1 anterior lumbar interbody fusion for isthmic spondylolisthesis. The man underwent a minimally invasive management strategy using posterior percutaneous pedicle fixation and partial reduction of the deformity. We also discuss the current literature on fusion procedures for isthmic spondylolisthesis. PMID:26100158

  17. 5. S U.S. HIGHWAY 34 AND EAST (ILLINOIS) APPROACH TO ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. S U.S. HIGHWAY 34 AND EAST (ILLINOIS) APPROACH TO BRIDGE WITH EAST BRIDGE HOUSE IN RIGHT FOREGROUND. VIEW TO WEST. - MacArthur Bridge, Spanning Mississippi River on Highway 34 between IA & IL, Burlington, Des Moines County, IA

  18. USE OF INTERSPECIES CORRELATION ESTIMATIONS TO PREDICT HC5'S BASED ON MINIMAL DATA

    EPA Science Inventory

    Dyer, S., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to Predict HC5's Based on Minimal Data (Abstract). To be presented at the SETAC Fourth World Congress, 14-18 November 2004, Portland, OR. 1 p. (ERL,GB R1013).

  19. Nucleotide sequences of 5S rRNAs from four jellyfishes.

    PubMed

    Hori, H; Ohama, T; Kumazaki, T; Osawa, S

    1982-11-25

    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica. PMID:6130512

  20. Adaptation of the S-5-S pendulum seismometer for measurement of rotational ground motion

    NASA Astrophysics Data System (ADS)

    Knejzlík, Jaromír; Kaláb, Zdeněk; Rambouský, Zdeněk

    2012-10-01

    The Russian electrodynamic seismometer model S-5-S has been adapted for the measurement of rotational ground motion. The mechanical system of the original S-5-S seismometer consists of electrodynamic sensing and damping transducer coils mounted on an asymmetrical double-arm pendulum. This pendulum is suspended on a footing using two pairs of crossed flat springs, which operate as the axis of rotation. The pendulum is stabilised by an additional spring. The S-5-S can be used either as a vertical or as a horizontal sensor. The adaptation of the S-5-S seismometer described below involves removal of the additional spring and installation of an additional mass on the damping arm. Strain gauge angle sensors are installed on one pair of the crossed flat springs. The main dynamic parameters of the rotational seismometer created in this way, i.e. the natural period and damping, are controlled electronically by feedback currents proportional to the angular displacement and angular velocity, both fed to the damping transducer coil. This new seismometer, named the S-5-SR, enables measurement of the rotational component of ground motion around the horizontal or the vertical axes. The output signal from this S-5-SR seismometer can be proportional either to rotational displacement or rotational velocity.

  1. Molecular analysis of a NOR site polymorphism in brown trout (Salmo trutta): organization of rDNA intergenic spacers.

    PubMed

    Castro, J; Sánchez, L; Martínez, P; Lucchini, S D; Nardi, I

    1997-12-01

    Using restriction endonuclease mapping, we have analyzed the organization of rDNA (DNA coding for ribosomal RNA (rRNA)) units in the salmonid fish Salmo trutta, as an initial step toward understand the molecular basis of a nucleolar organizer region (NOR) site polymorphism detected in this species. The size of the rDNA units ranged between 15 and 23 kb, with remarkable variation both within individuals and between populations. Three regions of internal tandem repetitiveness responsible for this length polymorphism were located to the intergenic spacers. NOR site polymorphic individuals showed a higher number of length classes, in some cases forming a complete 1 kb fragment ladder. The amount of rRNA genes was as much as 8-fold higher in polymorphic individuals compared with standard individuals. All individuals from the most polymorphic population showed a 14-kb insertion of unknown nature in a small proportion (below 25%) of the 28S rRNA genes. PMID:18464877

  2. Secondray structure and sequence of ITS2-rDNA of the Egyptian malaria vector Anopheles pharoensis (Theobald).

    PubMed

    Wassim, Nahla M

    2014-04-01

    Out of the twelve Anophelines present in Egypt, only five species known to be malaria vectors. Anopheles (An.) pharoensis proved to be the important vector all over Egypt, especially in the Delta. Anopheles sergenti proved to be the primary vector in the Oases of the Western Desert, An. multicolor in Faiyoum, An. stephensi in the Red Sea Coast, and An. superpictus in Sinai. Genomic DNA was isolated from single adult mosquito of An. pharoensis (Sahel Sudanese form), PCR was performed to amplify ITS2 region of rDNA using specific primers for 5.8S and 28S rDNA genes. The amplicons were purified, directly sequenced and aligned to the sequence of the same region of An. gambiae, using clustalw2. The length of ITS2-rDNA of An. pharoensis was 411bp. The GC content of the ITS2 reported 53% is consistent with spacer base composition in Anopheles species. The similarity between the two species was 52% and genetic distance was 0.46.Variable simple sequence repeats (SSRs) are found at low frequency. The secondary structure of rDNA-ITS2was predicted by MFOLD and was -192; 60 to-195.32 kilocalories/mole. PMID:24961025

  3. Molecular characterization of Stictodora tridactyla (Trematoda: Heterophyidae) from Kuwait Bay using rDNA ITS and mtCO1.

    PubMed

    Al-Kandari, Wafa Y; Alnaqeeb, Majed A; Isaac, Asha M; Al-Bustan, Suzanne A

    2015-11-01

    Stictodora tridactyla is an intestinal fluke in the family Heterophyidae that parasitizes shorebirds and mammals, including humans. Its metacercarial cyst stage was reported in the Arabian killifish, Aphanius dispar, at Kuwait Bay. In the present study, Cerithidea cingulata was found to serve as the first intermediate host of S. tridactyla. In order to establish the snail-fish link in the life cycle of S. tridactyla, complete sequences of ribosomal DNA internal transcribed spacer region 1 and 2 (rDNA ITS1 and ITS2) and partial sequence of cytochrome oxidase subunit 1 were obtained for metacercarial cysts isolated from the fish A. dispar and rediae isolated from the snail C. cingulata. Sequence alignment demonstrated that these larval stages belong to the same heterophyid species, S. tridactyla. Phylogenetic analysis based on rDNA ITS1, ITS2, and mtCO1 confirmed the position of S. tridactyla within the Heterophyidae and found it to cluster with Haplorchis spp. The present study represents the first molecular study correlating the larval stages of S. tridactyla using rDNA ITS1, ITS2, and mtCO1 and examining the phylogenetic relationships of S. tridactyla with different heterophyid species. PMID:26268569

  4. Comparison of rDNA sequences from colchicine treated and untreated sporocysts of Phyllodistomum folium and Bucephalus polymorphus (Digenea).

    PubMed

    Stunzenas, Virmantas; Cryan, Jason R; Molloy, Daniel P

    2004-09-01

    The most frequently used antimitotic agent in cytogenetic studies is colchicine. We investigated whether the initial treatment of trematodes for karyological analysis with colchicine would have mutagenic or degradational effect on rDNA sequences. Dreissena polymorpha is the intermediate host of Phyllodistomum folium and Bucephalus polymorphus, and the sporocyst stage of these trematode species develop, respectively, in the gills and gonads of this mussel. Sporocysts of P. folium and B. polymorphus were obtained from D. polymorpha collected from waterbodies in Belarus and in Lithuania. 5.8S and 28S rDNA genes, ITS1 and ITS2 of P folium and B. polymorphus were sequenced and compared, and no nucleotide sequence differences between colchicine treated and untreated trematodes were found. Based on these results, we conclude that colchicine treatment for 3-5 h has no mutagenic or degradational effect on rDNA sequences. During the course of this investigation, two genetically different P. folium samples were noted in Belarus. PMID:15468529

  5. A nested array of rRNA targeted probes for the detection and identification of enterococci by reverse hybridization.

    PubMed

    Behr, T; Koob, C; Schedl, M; Mehlen, A; Meier, H; Knopp, D; Frahm, E; Obst, U; Schleifer, K; Niessner, R; Ludwig, W

    2000-12-01

    Complete 23S and almost complete 16S rRNA gene sequences were determined for the type strains of the validly described Enterococcus species, Melissococcus pluton and Tetragenococcus halophilus. A comprehensive set of rRNA targeted specific oligonucleotide hybridization probes was designed according to the multiple probe concept. In silico probe design and evaluation was performed using the respective tools of the ARB program package in combination with the ARB databases comprising the currently available 16S as well as 23S rRNA primary structures. The probes were optimized with respect to their application for reverse hybridization in microplate format. The target comprising 16S and 23S rDNA was amplified and labeled by PCR (polymerase chain reaction) using general primers targeting a wide spectrum of bacteria. Alternatively, amplification of two adjacent rDNA fragments of enterococci was performed by using specific primers. In vitro evaluation of the probe set was done including all Enterococcus type strains, and a selection of other representatives of the gram-positive bacteria with a low genomic DNA G+C content. The optimized probe set was used to analyze enriched drinking water samples as well as original samples from waste water treatment plants. PMID:11249027

  6. Hydrodynamic ultrasonic probe

    DOEpatents

    Day, Robert A.; Conti, Armond E.

    1980-01-01

    An improved probe for in-service ultrasonic inspection of long lengths of a workpiece, such as small diameter tubing from the interior. The improved probe utilizes a conventional transducer or transducers configured to inspect the tubing for flaws and/or wall thickness variations. The probe utilizes a hydraulic technique, in place of the conventional mechanical guides or bushings, which allows the probe to move rectilinearly or rotationally while preventing cocking thereof in the tube and provides damping vibration of the probe. The probe thus has lower friction and higher inspection speed than presently known probes.

  7. 18S rDNA Sequences from Microeukaryotes Reveal Oil Indicators in Mangrove Sediment

    PubMed Central

    Santos, Henrique F.; Cury, Juliano C.; Carmo, Flavia L.; Rosado, Alexandre S.; Peixoto, Raquel S.

    2010-01-01

    Background Microeukaryotes are an effective indicator of the presence of environmental contaminants. However, the characterisation of these organisms by conventional tools is often inefficient, and recent molecular studies have revealed a great diversity of microeukaryotes. The full extent of this diversity is unknown, and therefore, the distribution, ecological role and responses to anthropogenic effects of microeukaryotes are rather obscure. The majority of oil from oceanic oil spills (e.g., the May 2010 accident in the Gulf of Mexico) converges on coastal ecosystems such as mangroves, which are threatened with worldwide disappearance, highlighting the need for efficient tools to indicate the presence of oil in these environments. However, no studies have used molecular methods to assess the effects of oil contamination in mangrove sediment on microeukaryotes as a group. Methodology/Principal Findings We evaluated the population dynamics and the prevailing 18S rDNA phylotypes of microeukaryotes in mangrove sediment microcosms with and without oil contamination, using PCR/DGGE and clone libraries. We found that microeukaryotes are useful for monitoring oil contamination in mangroves. Our clone library analysis revealed a decrease in both diversity and species richness after contamination. The phylogenetic group that showed the greatest sensitivity to oil was the Nematoda. After contamination, a large increase in the abundance of the groups Bacillariophyta (diatoms) and Biosoecida was detected. The oil-contaminated samples were almost entirely dominated by organisms related to Bacillariophyta sp. and Cafeteria minima, which indicates that these groups are possible targets for biomonitoring oil in mangroves. The DGGE fingerprints also indicated shifts in microeukaryote profiles; specific band sequencing indicated the appearance of Bacillariophyta sp. only in contaminated samples and Nematoda only in non-contaminated sediment. Conclusions/Significance We believe that

  8. Analysis of the unexplored features of rrs (16S rDNA) of the Genus Clostridium

    PubMed Central

    2011-01-01

    Background Bacterial taxonomy and phylogeny based on rrs (16S rDNA) sequencing is being vigorously pursued. In fact, it has been stated that novel biological findings are driven by comparison and integration of massive data sets. In spite of a large reservoir of rrs sequencing data of 1,237,963 entries, this analysis invariably needs supplementation with other genes. The need is to divide the genetic variability within a taxa or genus at their rrs phylogenetic boundaries and to discover those fundamental features, which will enable the bacteria to naturally fall within them. Within the large bacterial community, Clostridium represents a large genus of around 110 species of significant biotechnological and medical importance. Certain Clostridium strains produce some of the deadliest toxins, which cause heavy economic losses. We have targeted this genus because of its high genetic diversity, which does not allow accurate typing with the available molecular methods. Results Seven hundred sixty five rrs sequences (> 1200 nucleotides, nts) belonging to 110 Clostridium species were analyzed. On the basis of 404 rrs sequences belonging to 15 Clostridium species, we have developed species specific: (i) phylogenetic framework, (ii) signatures (30 nts) and (iii) in silico restriction enzyme (14 Type II REs) digestion patterns. These tools allowed: (i) species level identification of 95 Clostridium sp. which are presently classified up to genus level, (ii) identification of 84 novel Clostridium spp. and (iii) potential reduction in the number of Clostridium species represented by small populations. Conclusions This integrated approach is quite sensitive and can be easily extended as a molecular tool for diagnostic and taxonomic identification of any microbe of importance to food industries and health services. Since rapid and correct identification allows quicker diagnosis and consequently treatment as well, it is likely to lead to reduction in economic losses and mortality

  9. 1s2s2p2 5p3 5S transition in B ii

    NASA Astrophysics Data System (ADS)

    Mannervik, S.; Cederquist, H.; Martinson, I.; Brage, T.; Froese Fischer, C.

    1987-04-01

    An experimental and theoretical study has been made of the 1s2s2p2 5P-1s2p3 5S transition in B ii. The experimental wavelength and lifetime (1323.92+/-0.07 Å and 0.65+/-0.01 ns), determined by beam-foil spectroscopy, are more than five times more accurate than previous experimental results. Our theoretical data, from multiconfiguration Hartree-Fock calculations, 1311.6 Å and 0.601 ns, are in excellent agreement with previous theoretical predictions of Beck and Nicolaides [Phys. Lett. 61A, 227 (1977)]. We have also observed the 1s2p3 5S-1s2p23s 5P transition, at 857.7+/-0.2 Å, in accord with the theoretical value 859.1 Å.

  10. Phylogenetic analysis of the genera Thiobacillus and Thiomicrospira by 5S rRNA sequences.

    PubMed Central

    Lane, D J; Stahl, D A; Olsen, G J; Heller, D J; Pace, N R

    1985-01-01

    5S rRNA nucleotide sequences from Thiobacillus neapolitanus, Thiobacillus ferrooxidans, Thiobacillus thiooxidans, Thiobacillus intermedius, Thiobacillus perometabolis, Thiobacillus thioparus, Thiobacillus versutus, Thiobacillus novellus, Thiobacillus acidophilus, Thiomicrospira pelophila, Thiomicrospira sp. strain L-12, and Acidiphilium cryptum were determined. A phylogenetic tree, based upon comparison of these and other related 5S rRNA sequences, is presented. The results place the thiobacilli, Thiomicrospira spp., and Acidiphilium spp. in the "purple photosynthetic" bacterial grouping which also includes the enteric, vibrio, pseudomonad, and other familiar eubacterial groups in addition to the purple photosynthetic bacteria. The genus Thiobacillus is not an evolutionarily coherent grouping but rather spans the full breadth of the purple photosynthetic bacteria. PMID:3924899

  11. Optical characterization of CuIn5S8 crystals by ellipsometry measurements

    NASA Astrophysics Data System (ADS)

    Isik, Mehmet; Gasanly, Nizami

    2016-04-01

    Optical properties of CuIn5S8 crystals grown by Bridgman method were investigated by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficients were obtained from the analysis of ellipsometry experiments performed in the 1.2-6.2 eV spectral region. Analysis of spectral dependence of the absorption coefficient revealed the existence of direct band gap transitions with energy 1.53 eV. Wemple-DiDomenico and Spitzer-Fan models were used to find the oscillator energy, dispersion energy, zero-frequency refractive index and high-frequency dielectric constant values. Structural properties of the CuIn5S8 crystals were investigated using X-ray diffraction and energy dispersive spectroscopy analysis.

  12. Ellipsometry study of optical parameters of AgIn5S8 crystals

    NASA Astrophysics Data System (ADS)

    Isik, Mehmet; Gasanly, Nizami

    2015-12-01

    AgIn5S8 crystals grown by Bridgman method were characterized for optical properties by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficient were obtained from ellipsometry experiments carried out in the 1.2-6.2 eV range. Direct band gap energy of 1.84 eV was found from the analysis of absorption coefficient vs. photon energy. The oscillator energy, dispersion energy and zero-frequency refractive index, high-frequency dielectric constant values were found from the analysis of the experimental data using Wemple-DiDomenico and Spitzer-Fan models. Crystal structure and atomic composition ratio of the constituent elements in the AgIn5S8 crystal were revealed from structural characterization techniques of X-ray diffraction and energy dispersive spectroscopy.

  13. Three-step laser excitation of the odd-parity 5s5d 3D → 5s nf 3F states of cadmium

    NASA Astrophysics Data System (ADS)

    Nadeem, Ali; Shah, M.; Haq, S. U.; Shahzada, S.; Mumtaz, M.; Waheed, A.; Nawaz, M.; Ahmed, M.; Baig, M. A.

    2014-07-01

    We report new experimental data on the term energies and effective quantum numbers of the highly excited odd parity states of cadmium in the 71 773-72 500 cm-1 energy range. The experiment was performed using three dye lasers simultaneously pumped by the second harmonic (532 nm) of the Nd;YAG laser. The vapor containment and detection system was a thermionic diode ion detector working in a space charge limited mode. The new observations include the 5snf3F3 (12 ⩽ n ⩽ 52), 5snf3F4 (13 ⩽ n ⩽ 33) and 5snf3F2 (12 ⩽ n ⩽ 22) Rydberg series excited from the 5s5d3D multiplet. A two parameter fit to the transitions energies of the 5snf3F3 series yields the binding energy of the 5snd 2D2 level as 13 042.178 ± 0.02 cm-1 and consequently the first ionization of cadmium is determined as 72 540.05 ± 0.13 cm-1, which is in good agreement with the previously reported value.

  14. Global determinants of mortality in under 5s: 10 year worldwide longitudinal study

    PubMed Central

    Nacher, Mathieu; Guihenneuc, Chantal; Tubert-Bitter, Pascale; Chavance, Michel

    2013-01-01

    Objective To assess at country level the association of mortality in under 5s with a large set of determinants. Design Longitudinal study. Setting 193 United Nations member countries, 2000-09. Methods Yearly data between 2000 and 2009 based on 12 world development indicators were used in a multivariable general additive mixed model allowing for non-linear relations and lag effects. Main outcome measure National rate of deaths in under 5s per 1000 live births Results The model retained the variables: gross domestic product per capita; percentage of the population having access to improved water sources, having access to improved sanitation facilities, and living in urban areas; adolescent fertility rate; public health expenditure per capita; prevalence of HIV; perceived level of corruption and of violence; and mean number of years in school for women of reproductive age. Most of these variables exhibited non-linear behaviours and lag effects. Conclusions By providing a unified framework for mortality in under 5s, encompassing both high and low income countries this study showed non-linear behaviours and lag effects of known or suspected determinants of mortality in this age group. Although some of the determinants presented a linear action on log mortality indicating that whatever the context, acting on them would be a pertinent strategy to effectively reduce mortality, others had a threshold based relation potentially mediated by lag effects. These findings could help designing efficient strategies to achieve maximum progress towards millennium development goal 4, which aims to reduce mortality in under 5s by two thirds between 1990 and 2015. PMID:24212105

  15. Analysis of a 5S rRNA gene cloned from Euplotes eurstomus

    SciTech Connect

    Roberson, A.E.; Wolffe, A.; Olins, D.E.

    1987-05-01

    The macronucleus of the hypotrichous ciliated protozoan Euplotes eurystomus lends itself to the study of eukaryotic gene and chromatin structure because native macronuclear DNA exists as linear, gene-sized fragments between 400 and 20,000 bp in length. The macronuclear chromatin, while arranged in a typical nucleosomal structure, is freely soluble in low ionic strength buffers without treatment by nucleases. Thus, specific genes may be enriched as native, intact chromatin molecules. The 5S rRNA gene from Euplotes has been cloned to facilitate investigation of 5S gene-chromatin following characterization of the gene at the DNA level. It has been demonstrated that the gene, while in circular or linear form, can be transcribed in vitro by a Xenopus oocyte nuclear extract. The transcript generated in vitro is 120 nucleotides in length and is synthesized by RNA polymerase III. Anti-Xenopus TFIIIA antibodies recognize a Euplotes macronuclear chromatin-associated protein which is approx. 80 KD in size. It has been established that the sequence of the telomere flanking the 5S gene in Euplotes eurystomus is the same telomeric sequence published for Euplotes aediculatus.

  16. When fathers are instant losers: homogenization of rDNA loci in recently formed Cardamine × schulzii trigenomic allopolyploid.

    PubMed

    Zozomová-Lihová, Judita; Mandáková, Terezie; Kovaříková, Alena; Mühlhausen, Andreas; Mummenhoff, Klaus; Lysak, Martin A; Kovařík, Aleš

    2014-09-01

    Recently formed allopolyploids represent an excellent system to study the impacts of hybridization and genomic duplication on genome structure and evolution. Here we explored the 35SrRNA genes (rDNA) in the Cardamine × schulzii allohexaploid that was formed by two subsequent hybridization events within the past c. 150 yr. The rDNA loci were analyzed by cloning, next generation sequencing (NGS), RT-PCR and FISH methods. The primary C. × insueta triploid hybrid derived from C. rivularis (♀) and C. amara (♂) had gene ratios highly skewed towards maternal sequences. Similarly, C. × schulzii, originating from the secondary hybridization event involving C. × insueta (♀) and C. pratensis (♂), showed a reduction in paternal rDNA homeologs despite an excess of chromosomes inherited from C. pratensis. We also identified novel rDNA loci in C. × schulzii, suggesting that lost loci might be slowly reinstalled by translocation (but not recombination) of genes from partner genomes. Prevalent clonal propagation of allopolyploids, C. × insueta and C. × schulzii, indicates that concerted evolution of rDNA may occur in the absence of extensive meiotic cycles. Adoption of NGS in rDNA variant analysis is highly informative for deciphering the evolutionary histories of allopolyploid species with ongoing homogenization processes. PMID:24916080

  17. Two spatially separated phases in semiconducting Rb0.8Fe1.5S2

    DOE PAGESBeta

    Wang, Meng; Tian, Wei; Valdivia, P.; Chi, Songxue; Bourret-Courchesne, E.; Dai, Pengcheng; Birgeneau, R. J.

    2014-09-26

    We report neutron scattering and transport measurements on semiconducting Rb0.8Fe1.5S2, a compound isostructural and isoelectronic to the well-studied A0.8FeySe2(A = K, Rb, Cs, Tl/K) superconducting systems. Both resistivity and DC susceptibility measurements reveal a magnetic phase transition at T = 275 K. Neutron diffraction studies show that the 275 K transition originates from a phase with rhombic iron vacancy order which exhibits an in-plane stripe antiferromagnetic ordering below 275 K. In addition, the stripe antiferromagnetic phase interdigitates mesoscopically with an ubiquitous phase with √5 x√5 iron vacancy order. This phase has a magnetic transition at TN = 425 K andmore » an iron vacancy order-disorder transition at TS = 600 K. These two different structural phases are closely similar to those observed in the isomorphous Se materials. Based on the close similarities of the in-plane antiferromagnetic structures, moments sizes, and ordering temperatures in semiconducting Rb0.8Fe1.5S2 and K0.81Fe1.58Se2, we argue that the in-plane antiferromagnetic order arises from strong coupling between local moments. Superconductivity, previously observed in the A0.8FeySe2₋ zSz system, is absent in A0.8Fe1.5S2, which has a semiconducting ground state. We discuss the implied relationship between stripe and block antiferromagnetism and superconductivity in these materials as well as a strategy for further investigation.« less

  18. SAXS investigation on the temperature dependence of the conformation of Carcinus aestuarii 5S hemocyanin subunit

    NASA Astrophysics Data System (ADS)

    Beltramini, M.; Di Muro, P.; Favilla, R.; La Monaca, A.; Mariani, P.; Sabatucci, A. L.; Salvato, B.; Solari, P. L.

    1999-01-01

    The small-angle X-ray scattering technique has been used to study the spatial distribution of a subunit isolated from Carcinus hemocyanin, in solution at pH 7.5 in the 20°C-40°C temperature range. From the obtained scattering profiles, two species with different gyration radius have been detected by Guinier approximation: one species with Rg1≈25 Å is assigned to the 75 kDa 5S subunit whereas a second species with Rg2≈48 Å, and accounting for ≈3% of the total protein, is attributed to the 450 kDa 16S hexamer. Whereas Rg2 decreases slightly (≈10%) and reversibly on increasing the temperature, Rg2 decreases more markedly (≈30%), but irreversibly. The scattering data have been analysed also on the basis of the impenetrable spheres model and by means of the distance distribution function: the temperature dependence of the geometrical dimensions of the particles is confirmed. In addition, for the 5S subunit also the cross-section gyration radius decreases appreciably (15%) and reversibly with temperature. These results are interpreted on the basis of temperature induced structural rearrangements among the three domains of 5S subunit leading to an increased compactness of the molecule and a more elongated form. In contrast, the effect on the hexamer is assigned to its irreversible dissociation to monomers. This interpretation agrees with the analysis of the distance distribution functions, calculated from the Fourier's transforms of the scattering curves at the different temperatures.

  19. Molecular probes and microarrays for the detection of toxic algae in the genera Dinophysis and Phalacroma (Dinophyta).

    PubMed

    Edvardsen, Bente; Dittami, Simon M; Groben, René; Brubak, Sissel; Escalera, Laura; Rodríguez, Francisco; Reguera, Beatriz; Chen, Jixin; Medlin, Linda K

    2013-10-01

    Dinophysis and Phalacroma species containing diarrheic shellfish toxins and pectenotoxins occur in coastal temperate waters all year round and prevent the harvesting of mussels during several months each year in regions in Europe, Chile, Japan, and New Zealand. Toxicity varies among morphologically similar species, and a precise identification is needed for early warning systems. Molecular techniques using ribosomal DNA sequences offer a means to identify and detect precisely the potentially toxic species. We designed molecular probes targeting the 18S rDNA at the family and genus levels for Dinophysis and Phalacroma and at the species level for Dinophysis acuminata, Dinophysis acuta, and Dinophysis norvegica, the most commonly occurring, potentially toxic species of these genera in Western European waters. Dot blot hybridizations with polymerase chain reaction (PCR)-amplified rDNA from 17 microalgae were used to demonstrate probe specificity. The probes were modified along with other published fluorescence in situ hybridization and PCR probes and tested for a microarray platform within the MIDTAL project ( http://www.midtal.com ). The microarray was applied to field samples from Norway and Spain and compared to microscopic cell counts. These probes may be useful for early warning systems and monitoring and can also be used in population dynamic studies to distinguish species and life cycle stages, such as cysts, and their distribution in time and space. PMID:23263760

  20. Magic wavelengths for the 5 s -18 s transition in rubidium

    NASA Astrophysics Data System (ADS)

    Goldschmidt, E. A.; Norris, D. G.; Koller, S. B.; Wyllie, R.; Brown, R. C.; Porto, J. V.; Safronova, U. I.; Safronova, M. S.

    2015-03-01

    Magic wavelengths, for which there is no differential ac Stark shift for the ground and excited state of the atom, allow trapping of excited Rydberg atoms without broadening the optical transition. This is an important tool for implementing quantum gates and other quantum information protocols with Rydberg atoms, and reliable theoretical methods to find such magic wavelengths are thus extremely useful. We use a high-precision all-order method to calculate magic wavelengths for the 5 s -18 s transition of rubidium, and compare the calculation to experiment by measuring the light shift for atoms held in an optical dipole trap at a range of wavelengths near a calculated magic value.

  1. Nucleotide sequences of 5S ribosomal RNA from four oomycete and chytrid water molds.

    PubMed

    Walker, W F; Doolittle, W F

    1982-09-25

    The nucleotide sequences of the 5S rRNAs of the oomycete water molds Saprolegnia ferax and Pythium hydnosporum and of the chytrid water molds Blastocladiella simplex and Phlyctochytrium irregulare were determined by chemical and enzymatic partial degradation of 3' and 5' end-labelled molecules, followed by gel sequence analysis. The two oomycete sequences differed in 24 positions and the two chytrid sequences differed in 27 positions. These pairs differed in a mean of 44 positions. The chytrid sequences clearly most resemble the sequence from the zygomycete Phycomyces, while the oomycete sequences appear to be allied with those from protozoa and slime molds. PMID:6890670

  2. Minimally invasive L5-S1 oblique lumbar interbody fusion with anterior plate.

    PubMed

    Pham, Martin H; Jakoi, Andre M; Hsieh, Patrick C

    2016-07-01

    Lumbar interbody fusion is an important technique for the treatment of degenerative disc disease and degenerative scoliosis. The oblique lumbar interbody fusion (OLIF) establishes a minimally invasive retroperitoneal exposure anterior to the psoas and lumbar plexus. In this video case presentation, the authors demonstrate the techniques of the OLIF at L5-S1 performed on a 69-year-old female with degenerative scoliosis as one component of an overall strategy for her deformity correction. The video can be found here: https://youtu.be/VMUYWKLAl0g . PMID:27364428

  3. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    PubMed

    Eastman, Alexander W; Yuan, Ze-Chun

    2014-01-01

    Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing projects. PMID

  4. Analysis of Sir2p domains required for rDNA and telomeric silencing in Saccharomyces cerevisiae.

    PubMed Central

    Cockell, M M; Perrod, S; Gasser, S M

    2000-01-01

    Silent information regulator (Sir) 2 is a limiting component of the Sir2/3/4 complex, which represses transcription at subtelomeric and HM loci. Sir2p also acts independently of Sir3p and Sir4p to influence chromatin organization in the rDNA locus. Deleted and mutated forms of Sir2p have been tested for their ability to complement and/or to disrupt silencing. The highly conserved C-terminal domain of Sir2p (aa 199-562) is insufficient to restore repression at either telomeric or rDNA reporters in a sir2Delta background and fails to nucleate silencing when targeted to an appropriate reporter gene. However, its expression in an otherwise wild-type strain disrupts telomeric repression. Similarly, a point mutation (P394L) within this conserved core inactivates the full-length protein but renders it dominant negative for all types of silencing. Deletion of aa 1-198 from Sir2(394L) eliminates its dominant negative effect. Thus we define two distinct functional domains in Sir2p, both essential for telomeric and rDNA repression: the conserved core domain found within aa 199-562 and a second domain that encompasses aa 94-198. Immunolocalization and two-hybrid studies show that aa 94-198 are required for the binding of Sir2p to Sir4p and for the targeting of Sir2p to the nucleolus through another ligand. The globular core domain provides an essential silencing function distinct from that of targeting or Sir complex formation that may reflect its reported mono-ADP-ribosyl transferase activity. PMID:10757754

  5. Molecular microbial diversity of an anaerobic digestor as determined by small-subunit rDNA sequence analysis.

    PubMed Central

    Godon, J J; Zumstein, E; Dabert, P; Habouzit, F; Moletta, R

    1997-01-01

    The bacterial community structure of a fluidized-bed reactor fed by vinasses (wine distillation waste) was analyzed. After PCR amplification, four small-subunit (SSU) rDNA clone libraries of Bacteria, Archaea, Procarya, and Eucarya populations were established. The community structure was determined by operational taxonomic unit (OTU) phylogenetic analyses of 579 partial rDNA sequences (about 500 bp long). A total of 146 OTUs were found, comprising 133, 6, and 7 from the Bacteria, Archaea, and Eucarya domains, respectively. A total of 117 bacterial OTU were affiliated with major phyla: low-G+C gram-positive bacteria, Cytophaga-Flexibacter-Bacteroides, Proteobacteria, high-G+C gram-positive bacteria, and Spirochaetes, where the clone distribution was 34, 26, 17, 6, and 4%, respectively. The other 16 bacterial OTUs represent 13% of the clones. They were either affiliated with narrow phyla such as Planctomyces-Chlamydia, green nonsulfur bacteria, or Synergistes, or deeply branched on the phylogenetic tree. A large number of bacterial OTUs are not closely related to any other hitherto determined sequences. The most frequent bacterial OTUs represents less than 5% of the total bacterial SSU rDNA sequences. However, the 20 more frequent bacterial OTUs describe at least 50% of these sequences. Three of the six Archaea OTUs correspond to 95% of the Archaea population and are very similar to already known methanogenic species: Methanosarcina barkeri, Methanosarcina frisius, and Methanobacterium formicicum. In contrast, the three other Archaea OTUs are unusual and are related to thermophilic microorganisms such as Crenarchaea or Thermoplasma spp. Five percent of the sequences analyzed were chimeras and were removed from the analysis. PMID:9212428

  6. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing

    PubMed Central

    Eastman, Alexander W.; Yuan, Ze-Chun

    2015-01-01

    Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing projects. PMID

  7. Molecular systematics of the genus Troglophilus (Rhaphidophoridae, Orthoptera) in Turkey: mitochondrial 16S rDNA evidences

    PubMed Central

    Taylan, Mehmet Sait; Russo, Claudio Di; Rampini, Mauro; Ketmaier, Valerio

    2013-01-01

    Abstract This study focuses on the evolutionary relationships among Turkish species of the cave cricket genus Troglophilus.Fifteen populations were studied for sequence variation in a fragment (543 base pairs) of the mitochondrial DNA (mtDNA) 16S rDNA gene (16S) to reconstruct their phylogenetic relationships and biogeographic history. Genetic data retrieved three main clades and at least three divergent lineages that could not be attributed to any of the taxa known for the area. Molecular time estimates suggest that the diversification of the group took place between the Messinian and the Plio-Pleistocene. PMID:23653493

  8. PCR amplification of 16S rDNA from lyophilized cell cultures facilitates studies in molecular systematics

    NASA Technical Reports Server (NTRS)

    Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.

    1990-01-01

    The sequence of the major portion of a Bacillus cycloheptanicus strain SCH(T) 16S rRNA gene is reported. This sequence suggests that B. cycloheptanicus is genetically quite distinct from traditional Bacillus strains (e.g., B. subtilis) and may be properly regarded as belonging to a different genus. The sequence was determined from DNA that was produced by direct amplification of ribosomal DNA from a lyophilized cell pellet with straightforward polymerase chain reaction (PCR) procedures. By obviating the need to revive cell cultures from the lyophile pellet, this approach facilitates rapid 16S rDNA sequencing and thereby advances studies in molecular systematics.

  9. 16S and 23S plastid rDNA phylogenies of Prototheca species and their auxanographic phenotypes1

    PubMed Central

    Ewing, Aren; Brubaker, Shane; Somanchi, Aravind; Yu, Esther; Rudenko, George; Reyes, Nina; Espina, Karen; Grossman, Arthur; Franklin, Scott

    2014-01-01

    Because algae have become more accepted as sources of human nutrition, phylogenetic analysis can help resolve the taxonomy of taxa that have not been well studied. This can help establish algal evolutionary relationships. Here, we compare Auxenochlorella protothecoides and 23 strains of Prototheca based on their complete 16S and partial 23S plastid rDNA sequences along with nutrient utilization (auxanographic) profiles. These data demonstrate that some of the species groupings are not in agreement with the molecular phylogenetic analyses and that auxanographic profiles are poor predictors of phylogenetic relationships. PMID:25937672

  10. Refinement of the spinal muscular atrophy locus to the interval between D5S435 and MAP1B

    SciTech Connect

    Soares, V.M.; Brzustowicz, L.M.; Kleyn, P.W.; Knowles, J.A.; Palmer, D.A.; Asokan, S.; Penchaszadeh, G.K.; Gilliam, T.C. ); Munsat, T.L. )

    1993-02-01

    The childhood-onset SMA locus has been mapped to chromosome 5q13, in a region bounded by the proximal locus, D5S6, and the closely linked distal loci, D5S112 and MAP1B. We now describe a highly polymorphic, tightly linked microsatellite marker (D5S435) that is very likely the closet proximal marker to the SMA locus. Multipoint linkage analysis firmly establishes the following order of markers at 5q13; centromere-D5S76-D5S6-D5S435-MAP1B/D5S112-D5S39-telomere. The data indicate that SMA resides in an approximately 0.7-cM (range 01.-2.1) region between D5S435 and MAP1B. This finding reduces by approximately fourfold the genetic region that most likely harbors the SMA locus and will facilitate the physical mapping and cloning of the disease gene region. 24 refs., 3 figs., 1 tab.

  11. Galileo Probe Battery System

    NASA Technical Reports Server (NTRS)

    Dagarin, B. P.; Taenaka, R. K.; Stofel, E. J.

    1997-01-01

    The conclusions of the Galileo probe battery system are: the battery performance met mission requirements with margin; extensive ground-based and flight tests of batteries prior to probe separation from orbiter provided good prediction of actual entry performance at Jupiter; and the Li-SO2 battery was an important choice for the probe's main power.

  12. Deactivation of krypton atoms in the metastable 5s({sup 3}P{sub 2}) state in collisions with krypton and argon atoms

    SciTech Connect

    Zayarnyi, D A; L'dov, A Yu; Kholin, I V

    2009-09-30

    The collision deactivation of the metastable 5s[3/2]{sub 2}{sup o}({sup 3}P{sub 2}) state of krypton atoms is studied by the absorption probe method in electron-beam-excited high-pressure Ar-Kr mixtures with a low krypton content. The rate constants of plasma-chemical reactions Kr* + Kr + Ar {yields} Kr{sub 2}* + Ar [(4.1{+-}0.4)x10{sup -33} cm{sup 6} s{sup -1}] and Kr* + 2Ar {yields} ArKr* + Ar (less than 10{sup -35} cm{sup 6} s{sup -1}) are measured for the first time and the rate constant of the reaction Kr* + Ar {yields} products + Ar [(3.8{+-}0.4)x10{sup -15} cm{sup 3} s{sup -1}] is refined. (active media)

  13. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    NASA Astrophysics Data System (ADS)

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-03-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system.

  14. Intraspecific and Interspecific Variation in 5s RNA Genes Are Decoupled in Diploid Wheat Relatives

    PubMed Central

    Kellogg, E. A.; Appels, R.

    1995-01-01

    5S RNAs form part of the ribosome in most organisms. In some, e.g., prokaryotes and some fungi, the genes are part of the ribosomal operon, but in most eukaryotes they are in tandem arrays of hundreds to thousands of copies separate from the main ribosomal array. 5S RNA genes can be aligned across kingdoms. We were therefore surprised to find that, for 28 diploid species of the wheat tribe (Triticeae), nucleotide diversity within an array is up to 6.2% in the genes, not significantly different from that of the nontranscribed spacers. Rates of concerted evolution must therefore be insufficient to homogenize the entire array. Between species, there are significantly fewer fixed differences in the gene than would be expected, given the high within-species variation. In contrast, the amount of variation between species in the spacer is the same as or greater than that within individuals. This leads to a paradox. High variation within an individual suggests that there is little selection on any particular gene within an array. But conservation of the gene across species implies that polymorphisms are periodically eliminated at a rate approximately equal to or greater than that of speciation. Levels of intraspecific polymorphism and interspecific divergence are thus decoupled. This implies that selective mechanisms exist to eliminate mutations in the gene without also affecting the spacer. PMID:7635297

  15. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure.

    PubMed

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-01-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30-70 K in pressure range of 100-170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50-70 K in pressure range of 100-150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  16. Magnetization reversal phenomena in (Cr0.70Ti0.30)5S6

    NASA Astrophysics Data System (ADS)

    Hashimoto, Satoshi; Matsuda, Yuji; Sato, Tetsuya; Anzai, Shuichiro

    2005-12-01

    Magnetization reversal phenomena (MRP) along magnetic order-order transitions have recently been reported on impurity-doped magnetic systems. Because imperfect long-range magnetic order exists in these systems, it is expected that a systematic investigation of MRP will give physical information on thermomagnetic processes of magnetic systems in the range from the micro- to nanoscales. As a typical order-order transition (a state doubly modulated by helical and canting orders to a collinear ferrimagnetic state) has been known to occur on Cr5S6 at a transition temperature Tt, we investigate the magnetizations of (Cr0.70Ti0.30)5S6 on heating and cooling runs in various magnetic fields. At 20Oe, the field-cooled magnetization just below the Curie temperature has a positive sign; the sign turns negative below the compensation temperature TCM (first step) and finally returns to positive below Tt (second step). The first-step MRP observed in this system is explained by the potential barriers resulting from anisotropy energy when the preferred direction of collinear ferrimagnetic moment reverses. The proposed mechanism for second-step MRP is the pinning effect caused by the impurity atoms (Ti) in the helical long-range-order chains. Comparing other examples of MRPs, we discuss the roles of local impurity centers in the thermomagnetic process in magnetic order-order transitions.

  17. Construction of the mycoplasma evolutionary tree from 5S rRNA sequence data.

    PubMed Central

    Rogers, M J; Simmons, J; Walker, R T; Weisburg, W G; Woese, C R; Tanner, R S; Robinson, I M; Stahl, D A; Olsen, G; Leach, R H

    1985-01-01

    The 5S rRNA sequences of eubacteria and mycoplasmas have been analyzed and a phylogenetic tree constructed. We determined the sequences of 5S rRNA from Clostridium innocuum, Acholeplasma laidlawii, Acholeplasma modicum, Anaeroplasma bactoclasticum, Anaeroplasma abactoclasticum, Ureaplasma urealyticum, Mycoplasma mycoides mycoides, Mycoplasma pneumoniae, and Mycoplasma gallisepticum. Analysis of these and published sequences shows that mycoplasmas form a coherent phylogenetic group that, with C. innocuum, arose as a branch of the low G+C Gram-positive tree, near the lactobacilli and streptococci. The initial event in mycoplasma phylogeny was formation of the Acholeplasma branch; hence, loss of cell wall probably occurred at the time of genome reduction to approximately to 1000 MDa. A subsequent branch produced the Spiroplasma. This branch appears to have been the origin of sterol-requiring mycoplasmas. During development of the Spiroplasma branch there were several independent genome reductions, each to approximately 500 MDa, resulting in Mycoplasma and Ureaplasma species. Mycoplasmas, particularly species with the smallest genomes, have high mutation rates, suggesting that they are in a state of rapid evolution. PMID:2579388

  18. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    PubMed Central

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi

    2016-01-01

    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  19. A new genotype of Trypanosoma cruzi associated with bats evidenced by phylogenetic analyses using SSU rDNA, cytochrome b and Histone H2B genes and genotyping based on ITS1 rDNA.

    PubMed

    Marcili, A; Lima, L; Cavazzana, M; Junqueira, A C V; Veludo, H H; Maia Da Silva, F; Campaner, M; Paiva, F; Nunes, V L B; Teixeira, M M G

    2009-05-01

    We characterized 15 Trypanosoma cruzi isolates from bats captured in the Amazon, Central and Southeast Brazilian regions. Phylogenetic relationships among T. cruzi lineages using SSU rDNA, cytochrome b, and Histone H2B genes positioned all Amazonian isolates into T. cruzi I (TCI). However, bat isolates from the other regions, which had been genotyped as T. cruzi II (TC II) by the traditional genotyping method based on mini-exon gene employed in this study, were not nested within any of the previously defined TCII sublineages, constituting a new genotype designated as TCbat. Phylogenetic analyses demonstrated that TCbat indeed belongs to T. cruzi and not to other closely related bat trypanosomes of the subgenus Schizotrypanum, and that although separated by large genetic distances TCbat is closest to lineage TCI. A genotyping method targeting ITS1 rDNA distinguished TCbat from established T. cruzi lineages, and from other Schizotrypanum species. In experimentally infected mice, TCbat lacked virulence and yielded low parasitaemias. Isolates of TCbat presented distinctive morphological features and behaviour in triatomines. To date, TCbat genotype was found only in bats from anthropic environments of Central and Southeast Brazil. Our findings indicate that the complexity of T. cruzi is larger than currently known, and confirmed bats as important reservoirs and potential source of T. cruzi infections to humans. PMID:19368741

  20. A Selective Medium and a Specific Probe for Detection of Vibrio vulnificus

    PubMed Central

    Cerdà-Cuéllar, Marta; Jofre, Joan; Blanch, Anicet R.

    2000-01-01

    A selective medium (VVM) and a specific 16S rRNA gene (rDNA) probe (V3VV) for the detection of Vibrio vulnificus were developed. The medium contains d-(+)-cellobiose as the main carbon source and electrolytes (MgCl2-6H2O and KCl), which stimulate bacterial growth. Polymyxin B, colistin, and moderate alkalinity and salinity provide selectivity properties. V. vulnificus grows on VVM as flat, bright yellow colonies. Other Vibrio species tested either did not grow or showed green-bluish colonies, with the exception of V. campbelli, V. carchariae, and V. navarrensis. There is a higher colony count on VVM agar than on cellobiose-colistin agar or on modified cellobiose-polymyxin B-colistin agar. The specific probe was evaluated by colony hybridization and dot blot hybridization with PCR-amplified 16S rDNA using collection strains and environmental isolates. No strain studied other than V. vulnificus showed positive hybridization with this oligonucleotide. The combined use of VVM agar and the V3VV probe provided the recovery of V. vulnificus from mixed bacterial suspensions and spiked mussels. PMID:10653765

  1. Quenching of the resonance 5s({sup 3}P{sub 1}) state of krypton atoms in collisions with krypton and helium atoms

    SciTech Connect

    Zayarnyi, D A; L'dov, A Yu; Kholin, I V

    2014-11-30

    The processes of collision quenching of the resonance 5s[3/2]{sub 1}{sup o}({sup 3}P{sub 1}) state of the krypton atom are studied by the absorption probe method in electron-beam-excited high-pressure He – Kr mixtures with a low content of krypton. The rate constants of plasmochemical reactions Kr* + Kr + He → Kr*{sub 2} + He [(4.21 ± 0.42) × 10{sup -33} cm{sup 6} s{sup -1}], Kr* + 2He → HeKr* + He [(4.5 ± 1.2) × 10{sup -36} cm{sup 6} s{sup -1}] and Kr* + He → products + He [(2.21 ± 0.22) × 10{sup -15} cm{sup 3} s{sup -1}] are measured for the first time. The rate constants of similar reactions are refined for krypton in the metastable 5s[3/2]{sub 2}{sup o} ({sup 3}P{sub 2}) state. (laser applications and other topics in quantum electronics)

  2. Heat pipe cooled probe

    NASA Technical Reports Server (NTRS)

    Camarda, C. J. (Inventor); Couch, L. M.

    1984-01-01

    The basic heat pipe principle is employed to provide a self-contained passively cooled probe that may be placed into a high temperature environment. The probe consists of an evaporator region of a heat pipe and a sensing instrument. Heat is absorbed as the working fluid evaporates in the probe. The vapor is transported to the vapor space of the condenser region. Heat is dissipated from the condenser region and fins causing condensation of the working fluid, which returns to the probe by gravity and the capillary action of the wick. Working fluid, wick and condenser configurations and structure materials can be selected to maintain the probe within an acceptable temperature range.

  3. Repair of rDNA in Saccharomyces cerevisiae: RAD4-independent strand-specific nucleotide excision repair of RNA polymerase I transcribed genes.

    PubMed Central

    Verhage, R A; Van de Putte, P; Brouwer, J

    1996-01-01

    Removal of UV-induced pyrimidine dimers from the individual strands of the rDNA locus in Saccharomyces cerevisiae was studied. Yeast rDNA, that is transcribed by RNA polymerase I(RNA pol I), is repaired efficiently, slightly strand-specific and independently of RAD26, which has been implicated in transcription-coupled repair of the RNA pol II transcribed RPB2 gene. No repair of rDNA is observed in rad1,2,3 and 14 mutants, demonstrating that dimer removal from this highly repetitive DNA is accomplished by nucleotide excision repair (NER). In rad7 and rad16 mutants, which are specifically deficient in repair of non-transcribed DNA, there is a clear preferential repair of the transcribed strand of rDNA, indicating that strand-specific and therefore probably transcription-coupled repair of RNA pol I transcribed genes does exist in yeast. Unexpectedly, the transcribed but not the non-transcribed strand of rDNA can be repaired in rad4 mutants, which seem otherwise completely NER-deficient. PMID:8604332

  4. Molecular phylogenetics at the Felsenstein zone: approaching the Strepsiptera problem using 5.8S and 28S rDNA sequences.

    PubMed

    Hwang, U W; Kim, W; Tautz, D; Friedrich, M

    1998-06-01

    Recent efforts to reconstruct the phylogenetic position of the insect order Strepsiptera have elicited a major controversy in molecular phylogenetics. We sequenced the 5.8S rDNA and major parts of the 28S rDNA 5' region of the strepsipteran species Stylops melittae. Their evolutionary dynamics were analyzed together with previously published insect rDNA sequences to identify tree estimation bias risks and to explore additional sources of phylogenetic information. Several major secondary structure changes were found as being autapomorphic for the Diptera, the Strepsiptera, or the Archaeognatha. Besides elevated substitution rates a significant AT bias was present in dipteran and strepsipteran 28S rDNA which, however, was restricted to stem sites in the Diptera while also affecting single-stranded sites in the Strepsiptera. When dipteran taxa were excluded from tree estimation all methods consistently supported the placement of Strepsiptera to within the Holometabola. When dipteran taxa were included maximum likelihood continued to favor a sister-group relationship of Strepsiptera with Mecoptera while remaining methods strongly supported a sister-group relationship with Diptera. Parametric bootstrap analysis revealed maximum likelihood as a consistent estimator if rate heterogeneity across sites was taken into account. Though the position of Strepsiptera within Holometabola remains elusive, we conclude that the evolution of dipteran and strepsipteran rDNA involved similar yet independent changes of substitution parameters. PMID:9667995

  5. Sharp switches between regular and swinger mitochondrial replication: 16S rDNA systematically exchanging nucleotides A<->T+C<->G in the mitogenome of Kamimuria wangi.

    PubMed

    Seligmann, Hervé

    2016-07-01

    Swinger DNAs are sequences whose homology with known sequences is detected only by assuming systematic exchanges between nucleotides. Nine symmetric (X<->Y, i.e. A<->C) and fourteen asymmetric (X->Y->Z, i.e. A->C->G) exchanges exist. All swinger DNA previously detected in GenBank follow the A<->T+C<->G exchange, while mitochondrial swinger RNAs distribute among different swinger types. Here different alignment criteria detect 87 additional swinger mitochondrial DNAs (86 from insects), including the first swinger gene embedded within a complete genome, corresponding to the mitochondrial 16S rDNA of the stonefly Kamimuria wangi. Other Kamimuria mt genome regions are "regular", stressing unanswered questions on (a) swinger polymerization regulation; (b) swinger 16S rDNA functions; and (c) specificity to rDNA, in particular 16S rDNA. Sharp switches between regular and swinger replication, together with previous observations on swinger transcription, suggest that swinger replication might be due to a switch in polymerization mode of regular polymerases and the possibility of swinger-encoded information, predicted in primordial genes such as rDNA. PMID:25865623

  6. R1 and R2 retrotransposition and deletion in the rDNA loci on the X and Y chromosomes of Drosophila melanogaster.

    PubMed Central

    Pérez-González, César E; Burke, William D; Eickbush, Thomas H

    2003-01-01

    The non-LTR retrotransposons R1 and R2 insert into the 28S rRNA genes of arthropods. Comparisons among Drosophila lineages have shown that these elements are vertically inherited, while studies within species have indicated a rapid turnover of individual copies (elimination of old copies and the insertion of new copies). To better understand the turnover of R1 and R2, 200 retrotranspositions and nearly 100 eliminations have been scored in the Harwich mutation-accumulation lines of Drosophila melanogaster. Because the rDNA arrays in D. melanogaster are present on the X and Y chromosomes and no exchanges were detected in these lines, it was possible to show that R1 retrotranspositions occur predominantly in the male germ line, while R2 retrotranspositions were more evenly divided between the germ lines of both sexes. The rate of elimination of elements from the Y rDNA array was twice that of the X rDNA array with both chromosomal loci containing regions where the rate of elimination was on average eight times higher. Most R1 and R2 eliminations appear to occur by large intrachromosomal events (i.e., loop-out events) that involve multiple rDNA units. These findings are interpreted in light of the known abundance of R1 and R2 elements in the X and Y rDNA loci of D. melanogaster. PMID:14573479

  7. Ultrafast scanning probe microscopy

    DOEpatents

    Weiss, Shimon; Chemla, Daniel S.; Ogletree, D. Frank; Botkin, David

    1995-01-01

    An ultrafast scanning probe microscopy method for achieving subpicosecond-temporal resolution and submicron-spatial resolution of an observation sample. In one embodiment of the present claimed invention, a single short optical pulse is generated and is split into first and second pulses. One of the pulses is delayed using variable time delay means. The first pulse is then directed at an observation sample located proximate to the probe of a scanning probe microscope. The scanning probe microscope produces probe-sample signals indicative of the response of the probe to characteristics of the sample. The second pulse is used to modulate the probe of the scanning probe microscope. The time delay between the first and second pulses is then varied. The probe-sample response signal is recorded at each of the various time delays created between the first and second pulses. The probe-sample response signal is then plotted as a function of time delay to produce a cross-correlation of the probe sample response. In so doing, the present invention provides simultaneous subpicosecond-temporal resolution and submicron-spatial resolution of the sample.

  8. Traversing probe system

    DOEpatents

    Mashburn, Douglas N.; Stevens, Richard H.; Woodall, Harold C.

    1977-01-01

    This invention comprises a rotatable annular probe-positioner which carries at least one radially disposed sensing probe, such as a Pitot tube having a right-angled tip. The positioner can be coaxially and rotatably mounted within a compressor casing or the like and then actuated to orient the sensing probe as required to make measurements at selected stations in the annulus between the positioner and compressor casing. The positioner can be actuated to (a) selectively move the probe along its own axis, (b) adjust the yaw angle of the right-angled probe tip, and (c) revolve the probe about the axis common to the positioner and casing. A cam plate engages a cam-follower portion of the probe and normally rotates with the positioner. The positioner includes a first-motor-driven ring gear which effects slidable movement of the probe by rotating the positioner at a time when an external pneumatic cylinder is actuated to engage the cam plate and hold it stationary. When the pneumatic cylinder is not actuated, this ring gear can be driven to revolve the positioner and thus the probe to a desired circumferential location about the above-mentioned common axis. A second motor-driven ring gear included in the positioner can be driven to rotate the probe about its axis, thus adjusting the yaw angle of the probe tip. The positioner can be used in highly corrosive atmosphere, such as gaseous uranium hexafluoride.

  9. Ultrafast scanning probe microscopy

    DOEpatents

    Weiss, S.; Chemla, D.S.; Ogletree, D.F.; Botkin, D.

    1995-05-16

    An ultrafast scanning probe microscopy method is described for achieving subpicosecond-temporal resolution and submicron-spatial resolution of an observation sample. In one embodiment of the present claimed invention, a single short optical pulse is generated and is split into first and second pulses. One of the pulses is delayed using variable time delay means. The first pulse is then directed at an observation sample located proximate to the probe of a scanning probe microscope. The scanning probe microscope produces probe-sample signals indicative of the response of the probe to characteristics of the sample. The second pulse is used to modulate the probe of the scanning probe microscope. The time delay between the first and second pulses is then varied. The probe-sample response signal is recorded at each of the various time delays created between the first and second pulses. The probe-sample response signal is then plotted as a function of time delay to produce a cross-correlation of the probe sample response. In so doing, the present invention provides simultaneous subpicosecond-temporal resolution and submicron-spatial resolution of the sample. 6 Figs.

  10. Electrical resistivity probes

    DOEpatents

    Lee, Ki Ha; Becker, Alex; Faybishenko, Boris A.; Solbau, Ray D.

    2003-10-21

    A miniaturized electrical resistivity (ER) probe based on a known current-voltage (I-V) electrode structure, the Wenner array, is designed for local (point) measurement. A pair of voltage measuring electrodes are positioned between a pair of current carrying electrodes. The electrodes are typically about 1 cm long, separated by 1 cm, so the probe is only about 1 inch long. The electrodes are mounted to a rigid tube with electrical wires in the tube and a sand bag may be placed around the electrodes to protect the electrodes. The probes can be positioned in a borehole or on the surface. The electrodes make contact with the surrounding medium. In a dual mode system, individual probes of a plurality of spaced probes can be used to measure local resistance, i.e. point measurements, but the system can select different probes to make interval measurements between probes and between boreholes.

  11. Encephalitozoon cuniculi (Microspora) genome: physical map and evidence for telomere-associated rDNA units on all chromosomes

    PubMed Central

    Brugère, Jean-François; Cornillot, Emmanuel; Méténier, Guy; Bensimon, Aaron; Vivarès, Christian P.

    2000-01-01

    A restriction map of the 2.8-Mb genome of the unicellular eukaryote Encephalitozoon cuniculi (phylum Microspora), a mammal-infecting intracellular parasite, has been constructed using two restriction enzymes with 6 bp recognition sites (BssHII and MluI). The fragments resulting from either single digestions of the whole molecular karyotype or double digestions of 11 individual chromosomes have been separated by two-dimensional pulsed field gel electrophoresis (2D-PFGE) procedures. The average distance between successive restriction sites is ~19 kb. The terminal regions of the chromosomes show a common pattern covering ~15 kb and including one 16S–23S rDNA unit. Results of hybridisation and molecular combing experiments indicate a palindromic-like orientation of the two subtelomeric rDNA copies on each chromosome. We have also located 67 DNA markers (clones from a partial E.cuniculi genomic library) by hybridisation to restriction fragments. Partial or complete sequencing has revealed homologies with known protein-coding genes for 32 of these clones. Evidence for two homologous chromosomes III, with a size difference (3 kb) related to a subtelomeric deletion/insertion event, argues for diploidy of E.cuniculi. The physical map should be useful for both the whole genome sequencing project and studies on genome plasticity of this widespread parasite. PMID:10773069

  12. Use of acetate for enrichment of electrochemically active microorganisms and their 16S rDNA analyses.

    PubMed

    Lee, Jiyoung; Phung, Nguyet Thu; Chang, In Seop; Kim, Byung Hong; Sung, Ha Chin

    2003-06-27

    A fuel cell-type electrochemical device has been used to enrich microbes oxidizing acetate with concomitant electricity generation without using an electron mediator from activated sludge. The device generated a stable current of around 5 mA with complete oxidation of 5 mM acetate at the hydraulic retention time of 2.5 h after 4 weeks of enrichment. Over 70% of electrons available from acetate oxidation was recovered as current. Carbon monoxide or hydrogen did not influence acetate oxidation or current generation from the microbial fuel cell (MFC). Denaturing gradient gel electrophoresis showed that DNA extracted from the acetate-enriched MFC had different 16S rDNA patterns from those of sludge or glucose+glutamate-enriched MFCs. Nearly complete 16S rDNA sequence analyses showed that diverse bacteria were enriched in the MFC fed with acetate. Electron microscopic observations showed biofilm developed on the electrode, but not microbial clumps observed in MFCs fed with complex fuel such as glucose and wastewater from a corn-processing factory. PMID:12829284

  13. Assessing diversity of the female urine microbiota by high throughput sequencing of 16S rDNA amplicons

    PubMed Central

    2011-01-01

    Background Urine within the urinary tract is commonly regarded as "sterile" in cultivation terms. Here, we present a comprehensive in-depth study of bacterial 16S rDNA sequences associated with urine from healthy females by means of culture-independent high-throughput sequencing techniques. Results Sequencing of the V1V2 and V6 regions of the 16S ribosomal RNA gene using the 454 GS FLX system was performed to characterize the possible bacterial composition in 8 culture-negative (<100,000 CFU/ml) healthy female urine specimens. Sequences were compared to 16S rRNA databases and showed significant diversity, with the predominant genera detected being Lactobacillus, Prevotella and Gardnerella. The bacterial profiles in the female urine samples studied were complex; considerable variation between individuals was observed and a common microbial signature was not evident. Notably, a significant amount of sequences belonging to bacteria with a known pathogenic potential was observed. The number of operational taxonomic units (OTUs) for individual samples varied substantially and was in the range of 20 - 500. Conclusions Normal female urine displays a noticeable and variable bacterial 16S rDNA sequence richness, which includes fastidious and anaerobic bacteria previously shown to be associated with female urogenital pathology. PMID:22047020

  14. Identification of Thiobacillus ferrooxidans strains based on restriction fragment length polymorphism analysis of 16S rDNA.

    PubMed

    Kamimura, K; Wakai, S; Sugio, T

    2001-01-01

    The 16S rDNA sequences from ten strains of Thiobacillus ferrooxidans were amplified by PCR. The products were compared by performing restriction fragment length polymorphism (RFLP) analysis with restriction endonucleases Alu I, Hap II, Hha I, and Hae III. The RFLP patterns revealed that T. ferrooxidans could be distinguished from other iron- or sulphur-oxidizing bacteria such as T. thiooxidans NB1-3, T. caldus GO-1, Leptospirillum ferrooxidans and the marine iron-oxidizing bacterium strain KU2-11. The RFLP patterns obtained with Alu I, Hap II, and Hae III were the same for nine strains of T. ferrooxidans except for strain ATCC 13661. The RFLP patterns for strains NASF-1 and ATCC 13661 with Hha I were distinct from those for other T. ferrooxidans strains. The 16S rDNA sequence of T. ferrooxidans NASF-1 possessed an additional restriction site for Hha I. These results show that iron-oxidizing bacteria isolated from natural environments were rapidly identified as T. ferrooxidans by the method combining RFLP analysis with physiological analysis. PMID:11414499

  15. Studying long 16S rDNA sequences with ultrafast-metagenomic sequence classification using exact alignments (Kraken).

    PubMed

    Valenzuela-González, Fabiola; Martínez-Porchas, Marcel; Villalpando-Canchola, Enrique; Vargas-Albores, Francisco

    2016-03-01

    Ultrafast-metagenomic sequence classification using exact alignments (Kraken) is a novel approach to classify 16S rDNA sequences. The classifier is based on mapping short sequences to the lowest ancestor and performing alignments to form subtrees with specific weights in each taxon node. This study aimed to evaluate the classification performance of Kraken with long 16S rDNA random environmental sequences produced by cloning and then Sanger sequenced. A total of 480 clones were isolated and expanded, and 264 of these clones formed contigs (1352 ± 153 bp). The same sequences were analyzed using the Ribosomal Database Project (RDP) classifier. Deeper classification performance was achieved by Kraken than by the RDP: 73% of the contigs were classified up to the species or variety levels, whereas 67% of these contigs were classified no further than the genus level by the RDP. The results also demonstrated that unassembled sequences analyzed by Kraken provide similar or inclusively deeper information. Moreover, sequences that did not form contigs, which are usually discarded by other programs, provided meaningful information when analyzed by Kraken. Finally, it appears that the assembly step for Sanger sequences can be eliminated when using Kraken. Kraken cumulates the information of both sequence senses, providing additional elements for the classification. In conclusion, the results demonstrate that Kraken is an excellent choice for use in the taxonomic assignment of sequences obtained by Sanger sequencing or based on third generation sequencing, of which the main goal is to generate larger sequences. PMID:26812576

  16. Freshwater Perkinsea and marine-freshwater colonizations revealed by pyrosequencing and phylogeny of environmental rDNA.

    PubMed

    Bråte, Jon; Logares, Ramiro; Berney, Cédric; Ree, Dan Kristofer; Klaveness, Dag; Jakobsen, Kjetill S; Shalchian-Tabrizi, Kamran

    2010-09-01

    Protist parasites are ecologically important, as they can have great impact on host population dynamics and functioning of entire ecosystems. Nevertheless, little is known about their prevalence in aquatic habitats. Here, we investigate the diversity and distributional patterns of the protist parasites Perkinsus and Parvilucifera (Perkinsea). Our approach included 454 pyrosequencing of the 18S rDNA gene obtained from a high-altitude lake (Lake Finsevatn, Norway) and phylogenetic analyses of all publicly available sequences related to Perkinsea. The applied PCR primers target a 450 bp region that encompass the variable V4 region of the 18S rDNA gene and have been optimized for the Titanium upgrade of the 454 technology. Nearly 5000 sequences longer than 150 bp were recovered from nearly all eukaryotic supergroups, and of those, 13 unique sequences were affiliated to Perkinsea. Thus, our new strategy for 454 amplicon sequencing was able to recover a large diversity of distantly related eukaryotes and previously unknown species of Perkinsea. In addition, we identified 40 Perkinsea sequences in GenBank generated by other recent diversity surveys. Importantly, phylogenetic analyses of these sequences identified 17 habitat-specific marine and freshwater clades (PERK 1-17). Hence, only a few successful transitions between these habitats have taken place over the entire history of Perkinsea, suggesting that the boundary between marine and fresh waters may constitute a barrier to cross-colonizations for intracellular parasites. PMID:20393574

  17. Genus-specific profile of acetic acid bacteria by 16S rDNA PCR-DGGE.

    PubMed

    De Vero, Luciana; Giudici, Paolo

    2008-06-30

    An effective method for grouping acetic acid bacteria (AAB) genera was defined and evaluated as a tool for preliminary screening of the major AAB species involved in vinegar production. Acetobacter, Gluconobacter, Gluconacetobacter, Asaia, Neoasaia, Saccharibacter, Frateuria and Kozakia AAB strains were screened on the basis of the 16S rDNA sequences using polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) technique. The DGGE profile of all the strains tested, consisted of one single band of approximately 330 bp for each strain and allowed their clustering. The results obtained clearly reflected in silico phylogenetic analysis of the AAB species used in this study, in fact, the species with a higher 16S rDNA sequence homology showed a similar electrophoretic profile. In particular almost all the species belonging to the genus Gluconacetobacter showed a DGGE pattern nearly identical and well distinct from all the other AAB genera. Furthermore by PCR-DGGE it was possible to clearly group the species more frequently recovered from vinegar fermentation which are mainly distributed in the genera Acetobacter, Gluconobacter and Gluconacetobacter. PMID:17919758

  18. Telonemia-specific environmental 18S rDNA PCR reveals unknown diversity and multiple marine-freshwater colonizations

    PubMed Central

    2010-01-01

    Background Recent surveys of eukaryote 18S rDNA diversity in marine habitats have uncovered worldwide distribution of the heterotrophic eukaryote phylum Telonemia. Here we investigate the diversity and geographic distribution of Telonemia sequences by in-depth sequencing of several new 18S rDNA clone libraries from both marine and freshwater sites by using a Telonemia-specific PCR strategy. Results In contrast to earlier studies that have employed eukaryote-wide PCR design, we identified a large and unknown diversity of phylotypes and the first rigorous evidence for several freshwater species, altogether comprising 91 unique sequences. Phylogenies of these and publicly available sequences showed 20 statistically supported sub-clades as well as several solitary phylotypes with no clear phylogenetic affiliation. Most of these sub-clades were composed of phylotypes from different geographic regions. Conclusions By using specific PCR primers we reveal a much larger diversity of Telonemia from environmental samples than previously uncovered by eukaryote-wide primers. The new data substantially diminish the geographic structuring of clades identified in earlier studies. Nevertheless, since these clades comprise several distinct phylotypes we cannot exclude endemicity at species level. We identified two freshwater clades and a few solitary phylotypes, implying that Telonemia have colonized freshwater habitats and adapted to the different environmental and ecological conditions at independent occasions. PMID:20534135

  19. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site

    PubMed Central

    Calviño, Fabiola R.; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-01-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1–RpL5-N–RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1–RpL5–RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP. PMID:25849277

  20. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.

    PubMed

    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard

    2015-01-01

    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP. PMID:25849277

  1. Electric-dipole 5s - 5p Transitions in Promethiumlike Ions

    SciTech Connect

    Vilkas, M J; Ishikawa, Y; Trabert, E

    2008-02-29

    The 5s-5p electric-dipole resonance transitions in highly ionized promethiumlike ions have been studied applying relativistic multi-reference Moeller-Plesset second-order perturbation theory. The transition wavelengths are determined to within 0.2 {angstrom} in the more highly charged ions, where the level degeneracies are small. For somewhat lighter ions a very large reference space was used in order to account for the many degeneracies. In order to calculate transition probabilities and lifetimes, correlation corrections have been added to the transition operator in the next order. The contributions from the higher orders of the theory, that is, frequency-dependent Breit correction, Lamb shift, and mass shifts, have been estimated. The results are used to re-assess spectroscopic data from beam-foil, electron beam ion trap, and tokamak observations.

  2. Solution-Based Processing of the Phase-Change Material KSb5S8

    SciTech Connect

    Mitzi,D.; Raoux, S.; Schrott, A.; Copel, M.; Kellock, A.; Jordan-Sweet, J.

    2006-01-01

    A hydrazine-based process for solution-depositing phase-change materials (PCMs) is demonstrated, using KSb{sub 5}S{sub 8} (KSS) as an example. The process involves dissolving the elemental metals and chalcogen in hydrazine at room temperature and spin-coating the solution onto a substrate, followed by a short low-temperature (T {<=} 250 C) anneal. The spin-coated KSS films, which range in thickness from 10 to 90 nm, are examined using variable temperature X-ray diffraction, medium energy ion scattering (MEIS), Rutherford backscattering spectroscopy (RBS), and scanning electron microscopy (SEM). The spin-coated KSS films exhibit a reversible amorphous-crystalline transition with a relatively high crystallization temperature ({approx}280 C). Selected other chalcogenide-based PCMs are also expected to be suitable for thin-film deposition using this approach.

  3. Minimally Invasive Approach For Extraforaminal Synovial Cyst L5-S1

    PubMed Central

    Torres Campa-Santamarina, Jose; Towne, Sara; Alimi, Marjan; Härtl, Roger

    2015-01-01

    Symptoms from synovial cysts are produced by neural compression in the spinal canal or the foramen. Few cases of extraforaminal synovial cyst have been published in the literature. This is a case report of a 65-year-old female who presented with a three-month history of sciatic pain and no relief with conservative treatment. MRI showed a left-sided extraforaminal synovial cyst at L5-S1 with compression of the L5 nerve root at the lateral portion of the foramen. Minimally invasive surgery for resection was performed using an extraforaminal tubular microscopic endoscopy-assisted approach. The patient improved clinically and remained symptom-free for the entire follow-up of 30 months. PMID:26623217

  4. Magic wavelengths for the 5 s - 18 s transition in rubidium

    NASA Astrophysics Data System (ADS)

    Goldschmidt, Elizabeth; Norris, David; Koller, Silvio; Wyllie, Robert; Brown, Roger; Porto, Trey; Safronova, Ulyana; Safronova, Marianna

    2015-05-01

    Magic wavelengths, for which there is no differential ac Stark shift for the ground and excited state of the atom, allow trapping of excited Rydberg atoms without broadening the optical transition. This is an important tool for implementing quantum gates and other quantum information protocols with Rydberg atoms, and reliable theoretical methods to find such magic wavelengths are thus extremely useful. We use a high-precision all-order method to calculate magic wavelengths for the 5 s - 18 s transition of rubidium near the 18 s - 6 p resonances. We compare the calculation to experiment by measuring the light shift for atoms held in a crossed optical dipole trap with wavelength tuned around the 18 s - 6p3 / 2 resonance at the experimentally convenient wavelength of 1064 nm.

  5. Phylogenetic tree derived from bacterial, cytosol and organelle 5S rRNA sequences.

    PubMed Central

    Küntzel, H; Heidrich, M; Piechulla, B

    1981-01-01

    A phylogenetic tree was constructed by computer analysis of 47 completely determined 5S rRNA sequences. The wheat mitochondrial sequence is significantly more related to prokaryotic than to eukaryotic sequences, and its affinity to that of the thermophilic Gram-negative bacterium Thermus aquaticus is comparable to the affinity between Anacystis nidulans and chloroplastic sequences. This strongly supports the idea of an endosymbiotic origin of plant mitochondria. A comparison of the plant cytosol and chloroplast sub-trees suggests a similar rate of nucleotide substitution in nuclear genes and chloroplastic genes. Other features of the tree are a common precursor of protozoa and metazoa, which appears to be more related to the fungal than to the plant protosequence, and an early divergence of the archebacterial sequence (Halobacterium cutirubrum) from the prokaryotic branch. PMID:6785727

  6. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    NASA Technical Reports Server (NTRS)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  7. Classification of 5-S Epileptic EEG Recordings Using Distribution Entropy and Sample Entropy

    PubMed Central

    Li, Peng; Karmakar, Chandan; Yan, Chang; Palaniswami, Marimuthu; Liu, Changchun

    2016-01-01

    Epilepsy is an electrophysiological disorder of the brain, the hallmark of which is recurrent and unprovoked seizures. Electroencephalogram (EEG) measures electrical activity of the brain that is commonly applied as a non-invasive technique for seizure detection. Although a vast number of publications have been published on intelligent algorithms to classify interictal and ictal EEG, it remains an open question whether they can be detected using short-length EEG recordings. In this study, we proposed three protocols to select 5 s EEG segment for classifying interictal and ictal EEG from normal. We used the publicly-accessible Bonn database, which consists of normal, interical, and ictal EEG signals with a length of 4097 sampling points (23.6 s) per record. In this study, we selected three segments of 868 points (5 s) length from each recordings and evaluated results for each of them separately. The well-studied irregularity measure—sample entropy (SampEn)—and a more recently proposed complexity measure—distribution entropy (DistEn)—were used as classification features. A total of 20 combinations of input parameters m and τ for the calculation of SampEn and DistEn were selected for compatibility. Results showed that SampEn was undefined for half of the used combinations of input parameters and indicated a large intra-class variance. Moreover, DistEn performed robustly for short-length EEG data indicating relative independence from input parameters and small intra-class fluctuations. In addition, it showed acceptable performance for all three classification problems (interictal EEG from normal, ictal EEG from normal, and ictal EEG from interictal) compared to SampEn, which showed better results only for distinguishing normal EEG from interictal and ictal. Both SampEn and DistEn showed good reproducibility and consistency, as evidenced by the independence of results on analysing protocol. PMID:27148074

  8. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells

    PubMed Central

    Cao, Weibiao

    2016-01-01

    Mechanisms of the progression from Barrett’s esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK) inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby contribute to the progression from BE to EA. PMID:26901778

  9. Imaging targeted-agent binding in vivo with two probes

    NASA Astrophysics Data System (ADS)

    Pogue, Brian W.; Samkoe, Kimberley S.; Hextrum, Shannon; O'Hara, Julia A.; Jermyn, Michael; Srinivasan, Subhadra; Hasan, Tayyaba

    2010-05-01

    An approach to quantitatively image targeted-agent binding rate in vivo is demonstrated with dual-probe injection of both targeted and nontargeted fluorescent dyes. Images of a binding rate constant are created that reveal lower than expected uptake of epidermal growth factor in an orthotopic xenograft pancreas tumor (2.3×10-5 s-1), as compared to the normal pancreas (3.4×10-5 s-1). This approach allows noninvasive assessment of tumor receptor targeting in vivo to determine the expected contrast, spatial localization, and efficacy in therapeutic agent delivery.

  10. Comparative analysis of the genes encoding 23S-5S rRNA intergenic spacer regions of Lactobacillus casei-related strains.

    PubMed

    Chen, H; Lim, C K; Lee, Y K; Chan, Y N

    2000-03-01

    In this study, investigations into the 23S-5S rRNA intergenic spacer regions (ISRs) of the Lactobacillus casei group were performed. A 1.6 kb fragment, from Lactobacillus paracasei strain ATCC 27092, containing part of the 5S rRNA gene (60 bp), the 5S-23S spacer region (198 bp) and part of the 23S rRNA gene (1295 bp) was cloned and sequenced (GenBank no. AF098107). This fragment was used as a probe to determine the rRNA restriction fragment length polymorphism (RFLP) patterns of nine strains belonging to the Lactobacillus casei group, along with four other non-Lactobacillus casei lactobacilli species. A pair of PCR primers, 23-Fl and 5-Ru, was designed and used for PCR amplification of the 23S-5S rRNA ISRs of these strains. The ISR length and sequence polymorphisms provided additional information for the taxonomic study of the Lactobacillus casei group. The spacer-length polymorphism of Lactobacillus rhamnosus was distinct from those of the other strains and this observation is consistent with the classification of Lactobacillus rhamnosus proposed by Mori et al. For all Lactobacillus casei and Lactobacillus paracasei strains, two major bands (approx. 250 and 170 bp in size) were obtained except in the case of Lactobacillus paracasei subsp. tolerans strain NCIMB 9709T, which yielded only one amplified product (250 bp). The sequencing data of the PCR products of seven well-characterized Lactobacillus casei and Lactobacillus paracasei strains revealed the presence of a 76/80 bp insertion/deletion with some random, single-base substitutions between the longer and shorter spacers for each respective strain. A few base variations were also detected within different strains in this group although the overall sequence similarity was very high (95.9-99.5%). The rRNA RFLP and the spacer sequence of Lactobacillus casei type strain ATCC 393T exhibited unique identities in this cluster. On the other hand, Lactobacillus casei strain ATCC 334 showed a high level of similarity

  11. Functional probes for scanning probe microscopy

    NASA Astrophysics Data System (ADS)

    Hasegawa, Yukio; Akiyama, Kotone; Hamada, Masayuki; Eguchi, Toyoaki; An, Toshu; Fujikawa, Yasunori; Sakurai, Toshio

    2008-03-01

    Inspite of importance of the probe in scanning probe microscopy (SPM), little attention was paid for the SPM probes for most of the measurements of SPM. We developed sharp metal-tip cantilevers with a typical curvature radius better than 5nm using focused ion beam (FIB) suitable for Kelvin probe force microscopy (KFM)^1. We obtained atomically resolved KFM images with an energy resolution less than 3meV with the probe^2. We also developed a glass-coated tungsten tip for synchrotron radiation-scanning tunneling microscopy with the FIB method^3 and obtained elementally resolved images in a resolution less than 20nm^4. We are now developing a precise atomic force microscope (AFM) lithography^5 with the FIB-milled tip attached to a quartz tuning fork controlled by noncontact AFM. We will present recent results of our AFM lithography, such as an Au line with a width of 20˜30 nm and characters drawn with Au nano dots on a Si surface. 1 K. Akiyama et al., RSI 76, 033705 (2005) 2 T. Eguchi, K. Akiyama et al., PRL 93, 266102 (2004) 3 K. Akiyama et al., RSI 76, 083711 (2005) 4 T. Eguchi, K. Akiyama et al., APL 89, 243119 (2006) 5 K. Akiyama et al., JP 61, 22 (2007).

  12. Periodontal probing: a review.

    PubMed

    Al Shayeb, Kwthar Nassar A; Turner, Wendy; Gillam, David G

    2014-08-01

    Periodontal probes are the main instruments that are used to assess the status of the periodontium, either for screening purposes or to evaluate periodontal changes throughout the treatment process. With increased knowledge and understanding of periodontal disease, the probes have evolved from a unidimensional manual shape into a more sophisticated computerised instrument. This is due to the need to increase the accuracy and reproducibility of readings and to improve efficiency (time, effort, money). Each probe has characteristic features that makes it unique and, in some cases, specific and limited to use. The aim of this paper is to present a brief introduction to periodontal disease and the methodology of measuring it, followed by probing limitations. The paper will also discuss the methodology of reducing probing error, examiner calibration and probing reproducibility. PMID:25198634

  13. High temperature probe

    DOEpatents

    Swan, Raymond A.

    1994-01-01

    A high temperature probe for sampling, for example, smokestack fumes, and is able to withstand temperatures of 3000.degree. F. The probe is constructed so as to prevent leakage via the seal by placing the seal inside the water jacket whereby the seal is not exposed to high temperature, which destroys the seal. The sample inlet of the probe is also provided with cooling fins about the area of the seal to provide additional cooling to prevent the seal from being destroyed. Also, a heated jacket is provided for maintaining the temperature of the gas being tested as it passes through the probe. The probe includes pressure sensing means for determining the flow velocity of an efficient being sampled. In addition, thermocouples are located in various places on the probe to monitor the temperature of the gas passing there through.

  14. Distribution and 16S rDNA sequences of Argas monachus (Acari: Argasidae), a soft tick parasite of Myiopsitta monachus (Aves: Psittacidae).

    PubMed

    Mastropaolo, Mariano; Turienzo, Paola; Di Iorio, Osvaldo; Nava, Santiago; Venzal, José M; Guglielmone, Alberto A; Mangold, Atilio J

    2011-11-01

    Specimens of Argas monachus Keirans et al. were collected from Myiopsitta monachus nests in 42 localities in Argentina and Paraguay from 2006 to 2010. A list of localities where this tick has been found is presented. 16S rDNA sequences of specimens of A. monachus from different localities were compared to confirm whether they belong to the same specific taxon. Argas monachus is present in the phytogeographic provinces of Chaco, Espinal, and Monte, but not in the Pampa (all from de Chaco Domain) where the host is well distributed. No differences were found among 16S rDNA sequences of geographically distant specimens. PMID:21739257

  15. The nature of Z_b states from a combined analysis of Upsilon (5S)rightarrow h_b(mP) π ^+ π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{(*)}π

    NASA Astrophysics Data System (ADS)

    Huo, Wen-Sheng; Chen, Guo-Ying

    2016-03-01

    With a combined analysis of data on Upsilon (5S)rightarrow h_b(1P,2P)π ^+π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{(*)}π in an effective field theory approach, we determine resonance parameters of Z_b states in two scenarios. In one scenario we assume that Z_b states are pure molecular states, while in the other one we assume that Z_b states contain compact components. We find that the present data favor that there should be some compact components inside Z_b^{(' )} associated with the molecular components. By fitting the invariant mass spectra of Upsilon (5S)rightarrow h_b(1P,2P)π ^+π ^- and Upsilon (5S)rightarrow B^{(*)}bar{B}^{*}π , we determine that the probability of finding the compact components in Z_b states may be as large as about 40 %.

  16. Titan Probe navigation analysis

    NASA Technical Reports Server (NTRS)

    Vijayaraghavan, A.; Wood, L. J.

    1986-01-01

    In the proposed Cassini mission, a combined Saturn Orbiter/Titan Probe spacecraft will be launched from the Space Shuttle to arrive at Saturn around 2002, by means of a delta-VEGA trajectory. After Saturn-orbit insertion and a pericrone raise maneuver, the probe will be released to enter the Titan atmosphere and impact onto its surface. During its descent phase and impact onto Titan, the probe will maintain radio contact with the orbiter. Since the Titan-probe experimental phase lasts for only about four hours, probe-orbiter geometry and probe-delivery accuracy are critical to successful completion of this part of the mission. From a preliminary navigation analysis for probe delivery accuracy, it seems feasible to deliver the probe within 50 km (1-sigma value) of the desired aim-point in the Titan B-plane. The covariance study, however, clearly indicates the need for optical data, in addition to radio metric data. A Monte Carlo study indicates that a Delta-V capability of 98 m/sec for trajectory correction maneuvers will be sufficient to cover 99 percent of all contingencies during the segment from Saturn-orbit insertion to Titan-probe release.

  17. Development and Validation of an Improved PCR Method Using the 23S-5S Intergenic Spacer for Detection of Rickettsiae in Dermacentor variabilis Ticks and Tissue Samples from Humans and Laboratory Animals.

    PubMed

    Kakumanu, Madhavi L; Ponnusamy, Loganathan; Sutton, Haley T; Meshnick, Steven R; Nicholson, William L; Apperson, Charles S

    2016-04-01

    A novel nested PCR assay was developed to detectRickettsiaspp. in ticks and tissue samples from humans and laboratory animals. Primers were designed for the nested run to amplify a variable region of the 23S-5S intergenic spacer (IGS) ofRickettsiaspp. The newly designed primers were evaluated using genomic DNA from 11Rickettsiaspecies belonging to the spotted fever, typhus, and ancestral groups and, in parallel, compared to otherRickettsia-specific PCR targets (ompA,gltA, and the 17-kDa protein gene). The new 23S-5S IGS nested PCR assay amplified all 11Rickettsiaspp., but the assays employing other PCR targets did not. The novel nested assay was sensitive enough to detect one copy of a cloned 23S-5S IGS fragment from "CandidatusRickettsia amblyommii." Subsequently, the detection efficiency of the 23S-5S IGS nested assay was compared to those of the other three assays using genomic DNA extracted from 40 adultDermacentor variabilisticks. The nested 23S-5S IGS assay detectedRickettsiaDNA in 45% of the ticks, while the amplification rates of the other three assays ranged between 5 and 20%. The novel PCR assay was validated using clinical samples from humans and laboratory animals that were known to be infected with pathogenic species ofRickettsia The nested 23S-5S IGS PCR assay was coupled with reverse line blot hybridization with species-specific probes for high-throughput detection and simultaneous identification of the species ofRickettsiain the ticks. "CandidatusRickettsia amblyommii,"R. montanensis,R. felis, andR. belliiwere frequently identified species, along with some potentially novelRickettsiastrains that were closely related toR. belliiandR. conorii. PMID:26818674

  18. Development and Validation of an Improved PCR Method Using the 23S-5S Intergenic Spacer for Detection of Rickettsiae in Dermacentor variabilis Ticks and Tissue Samples from Humans and Laboratory Animals

    PubMed Central

    Kakumanu, Madhavi L.; Ponnusamy, Loganathan; Sutton, Haley T.; Meshnick, Steven R.; Nicholson, William L.

    2016-01-01

    A novel nested PCR assay was developed to detect Rickettsia spp. in ticks and tissue samples from humans and laboratory animals. Primers were designed for the nested run to amplify a variable region of the 23S-5S intergenic spacer (IGS) of Rickettsia spp. The newly designed primers were evaluated using genomic DNA from 11 Rickettsia species belonging to the spotted fever, typhus, and ancestral groups and, in parallel, compared to other Rickettsia-specific PCR targets (ompA, gltA, and the 17-kDa protein gene). The new 23S-5S IGS nested PCR assay amplified all 11 Rickettsia spp., but the assays employing other PCR targets did not. The novel nested assay was sensitive enough to detect one copy of a cloned 23S-5S IGS fragment from “Candidatus Rickettsia amblyommii.” Subsequently, the detection efficiency of the 23S-5S IGS nested assay was compared to those of the other three assays using genomic DNA extracted from 40 adult Dermacentor variabilis ticks. The nested 23S-5S IGS assay detected Rickettsia DNA in 45% of the ticks, while the amplification rates of the other three assays ranged between 5 and 20%. The novel PCR assay was validated using clinical samples from humans and laboratory animals that were known to be infected with pathogenic species of Rickettsia. The nested 23S-5S IGS PCR assay was coupled with reverse line blot hybridization with species-specific probes for high-throughput detection and simultaneous identification of the species of Rickettsia in the ticks. “Candidatus Rickettsia amblyommii,” R. montanensis, R. felis, and R. bellii were frequently identified species, along with some potentially novel Rickettsia strains that were closely related to R. bellii and R. conorii. PMID:26818674

  19. Origin and evolution of organisms as deduced from 5S ribosomal RNA sequences.

    PubMed

    Hori, H; Osawa, S

    1987-09-01

    A phylogenetic tree of most of the major groups of organisms has been constructed from the 352 5S ribosomal RNA sequences now available. The tree suggests that there are several major groups of eubacteria that diverged during the early stages of their evolution. Metabacteria (= archaebacteria) and eukaryotes separated after the emergence of eubacteria. Among eukaryotes, red algae emerged first; and, later, thraustochytrids (a Proctista group), ascomycetes (yeast), green plants (green algae and land plants), "yellow algae" (brown algae, diatoms, and chrysophyte algae), basidiomycetes (mushrooms and rusts), slime- and water molds, various protozoans, and animals emerged, approximately in that order. Three major types of photosynthetic eukaryotes--i.e., red algae (= Chlorophyll a group), green plants (Chl. a + b group) and yellow algae (Chl. a + c)--are remotely related to one another. Other photosynthetic unicellular protozoans--such as Cyanophora (Chl. a), Euglenophyta (Chl. a + b), Cryptophyta (Chl. a + c), and Dinophyta (Chl. a + c)--seem to have separated shortly after the emergence of the yellow algae. PMID:2452957

  20. Evolution of green plants as deduced from 5S rRNA sequences

    PubMed Central

    Hori, Hiroshi; Lim, Byung-Lak; Osawa, Syozo

    1985-01-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  1. Evolution of green plants as deduced from 5S rRNA sequences.

    PubMed

    Hori, H; Lim, B L; Osawa, S

    1985-02-01

    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  2. Hard X-ray XAFS beamline, BL5S1, at AichiSR

    NASA Astrophysics Data System (ADS)

    Tabuchi, M.; Asakura, H.; Morimoto, H.; Watanabe, N.; Takeda, Y.

    2016-05-01

    A XAFS beamline, BL5S1, had been operated at Aichi Synchrotron Radiation Center, Japan since March 2013. The beamline was designed for the measurements in the energy range from 5 to 20 keV. The photon flux of 6 x 1010 at around 9 keV and beam spot size of 0.5 x 0.3 mm at sample position are as good as designed. For the standard transmission XAFS measurement, both of the step- and quick- scan modes are available. Energy resolution at around 9keV is good enough to discuss the energy shift of the order of 0.1 eV or higher even when the measurements are conducted in the quick-scan mode. With several kinds of detectors for fluorescence and/or CEY detection mode measurements, and various kinds of sample holders which are supported by the XAFS measurement software, users easily obtain spectra for their samples. Such a standard, well operated and easy to access XAFS beamline must be very important to broaden the base of the XAFS society further.

  3. Design and performance of a 1 MW-5 s high temperature superconductor magnetic energy storage system

    NASA Astrophysics Data System (ADS)

    Morandi, Antonio; Gholizad, Babak; Fabbri, Massimo

    2016-01-01

    The feasibility of a 1 MW-5 s superconducting magnetic energy storage (SMES) system based on state-of-the-art high-temperature superconductor (HTS) materials is investigated in detail. Both YBCO coated conductors and MgB2 are considered. A procedure for the electromagnetic design of the coil is introduced and the final layout is arrived at and compared for the two materials. The choice of the inductance of the coil is carried out as part of the design procedure. Both low-field (3 T) and high-field (8 T) designs are considered for the YBCO. AC losses during a complete charge/discharge cycle at full power are estimated and the cooling power needed for continuous operation is derived. The power conditioning system and control algorithms needed to carry out various operations are discussed in detail. Performances of the SMES system during voltage sag compensation, load leveling and power factor correction are investigated by means of numerical simulation.

  4. Secondary structure and domain architecture of the 23S and 5S rRNAs

    PubMed Central

    Petrov, Anton S.; Bernier, Chad R.; Hershkovits, Eli; Xue, Yuzhen; Waterbury, Chris C.; Hsiao, Chiaolong; Stepanov, Victor G.; Gaucher, Eric A.; Grover, Martha A.; Harvey, Stephen C.; Hud, Nicholas V.; Wartell, Roger M.; Fox, George E.; Williams, Loren Dean

    2013-01-01

    We present a de novo re-determination of the secondary (2°) structure and domain architecture of the 23S and 5S rRNAs, using 3D structures, determined by X-ray diffraction, as input. In the traditional 2° structure, the center of the 23S rRNA is an extended single strand, which in 3D is seen to be compact and double helical. Accurately assigning nucleotides to helices compels a revision of the 23S rRNA 2° structure. Unlike the traditional 2° structure, the revised 2° structure of the 23S rRNA shows architectural similarity with the 16S rRNA. The revised 2° structure also reveals a clear relationship with the 3D structure and is generalizable to rRNAs of other species from all three domains of life. The 2° structure revision required us to reconsider the domain architecture. We partitioned the 23S rRNA into domains through analysis of molecular interactions, calculations of 2D folding propensities and compactness. The best domain model for the 23S rRNA contains seven domains, not six as previously ascribed. Domain 0 forms the core of the 23S rRNA, to which the other six domains are rooted. Editable 2° structures mapped with various data are provided (http://apollo.chemistry.gatech.edu/RibosomeGallery). PMID:23771137

  5. Radio frequency-compensated Langmuir probe with auxiliary double probes

    SciTech Connect

    Oh, Se-Jin; Oh, Seung-Ju; Chung, Chin-Wook

    2010-09-15

    A radio frequency (rf) compensation design using auxiliary double probes connected in parallel with a main measurement probe was developed for Langmuir probe diagnostics. This probe structure can reduce the sheath impedance of the main probe. In our probe design, the sheath capacitance of the probe can be increased and its sheath resistance can be decreased with increasing dc bias differential voltage between the auxiliary double probes. The I-V characteristic curve and electron energy distribution functions measured by our probe system had sufficient rf compensation performance in inductively coupled plasmas.

  6. Radio frequency-compensated Langmuir probe with auxiliary double probes.

    PubMed

    Oh, Se-Jin; Oh, Seung-Ju; Chung, Chin-Wook

    2010-09-01

    A radio frequency (rf) compensation design using auxiliary double probes connected in parallel with a main measurement probe was developed for Langmuir probe diagnostics. This probe structure can reduce the sheath impedance of the main probe. In our probe design, the sheath capacitance of the probe can be increased and its sheath resistance can be decreased with increasing dc bias differential voltage between the auxiliary double probes. The I-V characteristic curve and electron energy distribution functions measured by our probe system had sufficient rf compensation performance in inductively coupled plasmas. PMID:20886976

  7. Details of the evolutionary history from invertebrates to vertebrates, as deduced from the sequences of 18S rDNA.

    PubMed Central

    Wada, H; Satoh, N

    1994-01-01

    Almost the entire sequences of 18S rDNA were determined for two chaetognaths, five echinoderms, a hemichordate, and two urochordates (a larvacean and a salp). Phylogenetic comparisons of the sequences, together with those of other deuterostomes (an ascidian, a cephalochordate, and vertebrates) and protostomes (an arthropod and a mollusc), suggest the monophyly of the deuterostomes, with the exception of the chaetognaths. Chaetognaths may not be a group of deuterostomes. The deuterostome group closest to vertebrates was the group of cephalochordates. Ascidians, larvaceans, and salps seem to form a discrete group (urochordates), in which the early divergence of larvaceans is evident. These results support the hypothesis that chordates evolved from free-living ancestors. PMID:8127885

  8. 28s rDNA group-I introns: a powerful tool for identifying strains of Beauveria brongniartii.

    PubMed

    Neuvéglise, C; Brygoo, Y; Riba, G

    1997-04-01

    The nuclear ribosomal DNA of the entomopathogenic fungus Beauveria brongniartii is polymorphic in terms of both restriction site and length. Insertions of 350-450 bp long, identified as group-I introns, were detected in the 28s rDNA. A panel of 47 strains of B. brongniartii, two B. bassiana and one Metarhizium anisopliae of various geographical and biological origins were found to contain 14 variant forms of intron differing in size and restriction pattern, at four different positions. Twelve types of ribosomal large subunit were defined on the basis of variant distribution and compared with strain clustering based on internal transcribed spacers analysis. There was a correlation between the characteristic introns and isolates collected from the sugar cane pest Hoplochelus marginalis. Primers for polymerase chain reaction amplification were chosen from these variants, and used to develop a specific method for detecting strains pathogenic towards Hoplochelus. PMID:9131812

  9. Description of the male, redescription of the female and 16S rDNA sequence of Ixodes aulacodi (Ixodidae).

    PubMed

    Chiţimia-Dobler, Lidia; D'Amico, Gianluca; Yao, Patrick Kouassi; Kalmár, Zsuzsa; Gherman, Călin Mircea; Mihalca, Andrei Daniel; Estrada-Peña, Agustin

    2016-04-01

    Ixodes (Afrixodes) aulacodiArthur, 1956 is a poorly known species that has been recorded predominantly in the wet countries of western and central Africa, mainly associated to the greater cane rat Thryonomys swinderianus (Temmink). We herein redescribe the female, describe the male (ascribed to the species from specimens found in copula) and provide the 16S rDNA sequence. We also provide complete illustrations of the adults based on specimens found on greater cane rats in Ivory Coast. Ixodes aulacodi is included in the group of species of the subgenus Afrixodes that have horseshoe shaped anal groove, and which lack auriculae and cornua. The female is easily separated when compared with other species because of a unique combination of characters: All the coxae have internal spurs, coxa II has two external spurs, syncoxae are absent, and trochanters I-III have one spur each. The male has a notched hypostome and lacks syncoxae, auriculae and cornua. PMID:26803353

  10. Three Group-I introns in 18S rDNA of Endosymbiotic Algae of Paramecium bursaria from Japan

    NASA Astrophysics Data System (ADS)

    Hoshina, Ryo; Kamako, Shin-ichiro; Imamura, Nobutaka

    2004-08-01

    In the nuclear encoded small subunit ribosomal DNA (18S rDNA) of symbiotic alga of Paramecium bursaria (F36 collected in Japan) possesses three intron-like insertions (Hoshina et al., unpubl. data, 2003). The present study confirmed these exact lengths and insertion sites by reverse transcription-PCR. Two of them were inserted at Escherichia coli 16S rRNA genic position 943 and 1512 that are frequent intron insertion positions, but another insertion position (nearly 1370) was the first finding. Their secondary structures suggested they belong to Group-I intron; one belongs to subgroup IE, others belong to subgroup IC1. Similarity search indicated these introns are ancestral ones.

  11. Loop mediated isothermal amplification of 5.8S rDNA for specific detection of Tritrichomonas foetus.

    PubMed

    Oyhenart, Jorge; Martínez, Florencia; Ramírez, Rosana; Fort, Marcelo; Breccia, Javier D

    2013-03-31

    Tritrichomonas foetus is the causative agent of bovine trichomonosis, a sexually transmitted disease leading to infertility and abortion. A test based on loop mediated isothermal amplification (LAMP) targeting the 5.8S rDNA subunit was designed for the specific identification of T. foetus. The LAMP assay was validated using 28 T. foetus and 35 non-T. foetus trichomonads strains. It did not exhibit cross-reaction with closely related parasites commonly found in smegma cultures like Tetratrichomonas spp. and Pentatrichomonas hominis. Bovine smegma did not show interferences for the detection of the parasite and, the sensitivity of the method (4×10(3) CFU/mL, approximately 10 cells/reaction) was slightly higher than that found for PCR amplification with TFR3 and TFR4 primers. The LAMP approach has potential applications for diagnosis and control of T. foetus and, practical use for low skill operators in rural areas. PMID:23265811

  12. Short communication: Genetic variants of Sarcocystis cruzi in infected Malaysian cattle based on 18S rDNA.

    PubMed

    Ng, Yit Han; Fong, Mun Yik; Subramaniam, Vellayan; Shahari, Shahhaziq; Lau, Yee Ling

    2015-12-01

    Sarcocystis species are pathogenic parasites that infect a wide range of animals, including cattle. A high prevalence of cattle sarcocystosis has been reported worldwide, but its status is unknown in Malaysia. This study focused on utilizing 18S rDNA to identify Sarcocystis species in Malaysian cattle and to determine their genetic variants. In this study, only Sarcocystis cruzi was detected in Malaysian cattle. The intra-species S. cruzi phylogenetic tree analysis and principal coordinate analysis (PCoA), respectively displayed two minor groups among the parasite isolates. This finding was supported by high Wright FST value (FST=0.647). The definitive hosts (dogs) may play a fundamental role in the development of S. cruzi genetic variants. Additionally, the existence of microheterogeneity within the S. cruzi merozoites and/or distinct genetic variants arisen from independent merozoites in mature sarcocysts, possibly contributed to the existence of intra-species variations within the population. PMID:26679818

  13. RNAP-II molecules participate in the anchoring of the ORC to rDNA replication origins.

    PubMed

    Mayan, Maria D

    2013-01-01

    The replication of genomic DNA is limited to a single round per cell cycle. The first component, which recognises and remains bound to origins from recognition until activation and replication elongation, is the origin recognition complex. How origin recognition complex (ORC) proteins remain associated with chromatin throughout the cell cycle is not yet completely understood. Several genome-wide studies have undoubtedly demonstrated that RNA polymerase II (RNAP-II) binding sites overlap with replication origins and with the binding sites of the replication components. RNAP-II is no longer merely associated with transcription elongation. Several reports have demonstrated that RNAP-II molecules affect chromatin structure, transcription, mRNA processing, recombination and DNA repair, among others. Most of these activities have been reported to directly depend on the interaction of proteins with the C-terminal domain (CTD) of RNAP-II. Two-dimensional gels results and ChIP analysis presented herein suggest that stalled RNAP-II molecules bound to the rDNA chromatin participate in the anchoring of ORC proteins to origins during the G1 and S-phases. The results show that in the absence of RNAP-II, Orc1p, Orc2p and Cdc6p do not bind to origins. Moreover, co-immunoprecipitation experiments suggest that Ser2P-CTD and hypophosphorylated RNAP-II interact with Orc1p. In the context of rDNA, cryptic transcription by RNAP-II did not negatively interfere with DNA replication. However, the results indicate that RNAP-II is not necessary to maintain the binding of ORCs to the origins during metaphase. These findings highlight for the first time the potential importance of stalled RNAP-II in the regulation of DNA replication. PMID:23308214

  14. Morphology and 18S rDNA of Henneguya gurlei (Myxosporea) from Ameiurus nebulosus (Siluriformes) in North Carolina

    USGS Publications Warehouse

    Iwanowicz, L.R.; Iwanowicz, D.D.; Pote, L.M.; Blazer, V.S.; Schill, W.B.

    2008-01-01

    Henneguya gurlei was isolated from Ameiurus nebulosus captured in North Carolina and redescribed using critical morphological features and 18S small-subunit ribosomal RNA (SSU rDNA) gene sequence. Plasmodia are white, spherical, or subspherical, occur in clusters, measure up to 1.8 mm in length, and are located on the dorsal, pectoral, and anal fins. Histologically, plasmodia are located in the dermis and subdermally, and the larger cysts disrupt the melanocyte pigment layer. The spore body is lanceolate, 18.2 ?? 0.3 ??m (range 15.7-20.3) in length, and 5.4 ?? 0.1 ??m (range 3.8-6.1) in width in valvular view. The caudal appendages are 41.1 ?? 1.1 ??m (range 34.0-49.7) in length. Polar capsules are pyriform and of unequal size. The longer polar capsule measures 6.2 ?? 0.1 ??m (range 5.48-7.06), while the shorter is 5.7 ?? 0.1 ??m (range 4.8-6.4) in length. Polar capsule width is 1.2 ?? 0.03 ??m (range 1.0-1.54). The total length of the spore is 60.9 ?? 1.2 ??m (range 48.7-68.5). Morphologically, this species is similar to other species of Henneguya that are known to infect ictalurids. Based on SSU rDNA sequences, this species is most closely related to H. exilis and H. ictaluri, which infect Ictalurus punctatus. ?? American Society of Parasitologists 2008.

  15. In β-actin knockouts, epigenetic reprogramming and rDNA transcription inactivation lead to growth and proliferation defects.

    PubMed

    Almuzzaini, Bader; Sarshad, Aishe A; Rahmanto, Aldwin S; Hansson, Magnus L; Von Euler, Anne; Sangfelt, Olle; Visa, Neus; Farrants, Ann-Kristin Östlund; Percipalle, Piergiorgio

    2016-08-01

    Actin and nuclear myosin 1 (NM1) are regulators of transcription and chromatin organization. Using a genome-wide approach, we report here that β-actin binds intergenic and genic regions across the mammalian genome, associated with both protein-coding and rRNA genes. Within the rDNA, the distribution of β-actin correlated with NM1 and the other subunits of the B-WICH complex, WSTF and SNF2h. In β-actin(-/-) mouse embryonic fibroblasts (MEFs), we found that rRNA synthesis levels decreased concomitantly with drops in RNA polymerase I (Pol I) and NM1 occupancies across the rRNA gene. Reintroduction of wild-type β-actin, in contrast to mutated forms with polymerization defects, efficiently rescued rRNA synthesis underscoring the direct role for a polymerization-competent form of β-actin in Pol I transcription. The rRNA synthesis defects in the β-actin(-/-) MEFs are a consequence of epigenetic reprogramming with up-regulation of the repressive mark H3K4me1 (monomethylation of lys4 on histone H3) and enhanced chromatin compaction at promoter-proximal enhancer (T0 sequence), which disturb binding of the transcription factor TTF1. We propose a novel genome-wide mechanism where the polymerase-associated β-actin synergizes with NM1 to coordinate permissive chromatin with Pol I transcription, cell growth, and proliferation.-Almuzzaini, B., Sarshad, A. A. , Rahmanto, A. S., Hansson, M. L., Von Euler, A., Sangfelt, O., Visa, N., Farrants, A.-K. Ö., Percipalle, P. In β-actin knockouts, epigenetic reprogramming and rDNA transcription inactivation lead to growth and proliferation defects. PMID:27127100

  16. Identification of signature and primers specific to genus Pseudomonas using mismatched patterns of 16S rDNA sequences

    PubMed Central

    Purohit, HJ; Raje, DV; Kapley, A

    2003-01-01

    Background Pseudomonas, a soil bacterium, has been observed as a dominant genus that survives in different habitats with wide hostile conditions. We had a basic assumption that the species level variation in 16S rDNA sequences of a bacterial genus is mainly due to substitutions rather than insertion or deletion of bases. Keeping this in view, the aim was to identify a region of 16S rDNA sequence and within that focus on substitution prone stretches indicating species level variation and to derive patterns from these stretches that are specific to the genus. Results Repeating elements that are highly conserved across different species of Pseudomonas were considered as guiding markers to locate a region within the 16S gene. Four repeating patterns showing more than 80% consistency across fifty different species of Pseudomonas were identified. The sub-sequences between the repeating patterns yielded a continuous region of 495 bases. The sub-sequences after alignment and using Shanon's entropy measure yielded a consensus pattern. A stretch of 24 base positions in this region, showing maximum variations across the sampled sequences was focused for possible genus specific patterns. Nine patterns in this stretch showed nearly 70% specificity to the target genus. These patterns were further used to obtain a signature that is highly specific to Pseudomonas. The signature region was used to design PCR primers, which yielded a PCR product of 150 bp whose specificity was validated through a sample experiment. Conclusions The developed approach was successfully applied to genus Pseudomonas. It could be tried in other bacterial genera to obtain respective signature patterns and thereby PCR primers, for their rapid tracking in the environmental samples. PMID:12769821

  17. 5S rRNA sequences from four marine invertebrates and implications for base pairing models of metazoan sequences.

    PubMed

    Walker, W F; Doolittle, W F

    1983-08-11

    The nucleotide sequences of 5S rRNAs from the starfish Asterias vulgaris, the squid Illex illecebrosus, the sipunculid Phascolopsis gouldii and the jellyfish Aurelia aurita were determined. The sequence from Asterias lends support for one of two previous base pairing models for helix E in metazoan sequences. The Aurelia sequence differs by five nucleotides from that previously reported and does not violate the consensus secondary structure model for eukaryotic 5S rRNA. PMID:6136024

  18. Nucleotide sequences of 5S rRNAs from sponge Halichondria japonica and tunicate Halocynthia roretzi and their phylogenetic positions

    PubMed Central

    Komiya, Hiroyuki; Hasegawa, Masami; Takemura, Shosuke

    1983-01-01

    The nucleotide sequences of 5S rRNAs from sponge Halichondria japonica and tunicate Halocynthia roretzi were determined by chemical and enzymatic gel methods. Their phylogenetic positions among metazoans were derived from the 5S rRNA sequences by a computer analysis based on the maximum parsimony principle. It was suggested that the sponge is closely related to several invertebrates and the tunicate has affinity to vertebrates rather than invertebrates. PMID:6835845

  19. Formative Assessment Probes

    ERIC Educational Resources Information Center

    Eberle, Francis; Keeley, Page

    2008-01-01

    Formative assessment probes can be effective tools to help teachers build a bridge between students' initial ideas and scientific ones. In this article, the authors describe how using two formative assessment probes can help teachers determine the extent to which students make similar connections between developing a concept of matter and a…

  20. Magnetically driven filament probe.

    PubMed

    Schmid, A; Herrmann, A; Rohde, V; Maraschek, M; Müller, H W

    2007-05-01

    A radially movable probe has been developed for studies of filamentary transport in ASDEX Upgrade during edge localized modes (ELMs) by means of Langmuir tips and magnetic pickup coils. The probe is permanently installed at the low field side in the ASDEX Upgrade vacuum vessel and is not subject to limitations in probe size, as, for example, probes on a shared manipulator are. The probe is moved by a magnetic drive, which allows for easy installation in the vessel, and has moderate machine requirements, as it will only require an electric feedthrough and an external power supply. The drive gives a linear motion with a radial range of 5 cm within 50 ms, where range and velocity can be largely scaled according to experimental requirements. The probe has been installed in the outer midplane of the ASDEX Upgrade vessel, where ELM filaments are expected to have their maximum amplitude. Filaments are coherent substructures within an ELM, carrying a fraction of the ELM released energy towards the wall. The new probe allows to measure the structure of these filaments, in particular, parameters such as filament rotation (by time delay measurements) and size (by peak width analysis). Activating the drive moves the probe from a safe position behind the limiter to a position in front of the limiters, i.e., exposes the Langmuir pins to the scrape-off layer plasma. PMID:17552815

  1. Phylogenetic origins of the plant mitochondrion based on a comparative analysis of 5S ribosomal RNA sequences

    NASA Technical Reports Server (NTRS)

    Villanueva, E.; Delihas, N.; Luehrsen, K. R.; Fox, G. E.; Gibson, J.

    1985-01-01

    The complete nucleotide sequences of 5S ribosomal RNAs from Rhodocyclus gelatinosa, Rhodobacter sphaeroides, and Pseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains. Rhodobacter sphaeroides is specifically related to Paracoccus denitrificans and Rc. gelatinosa is related to Ps. cepacia. These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found in P. denitrificans are present also in the 5S RNA of Rb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of obtaining these new sequences is that it is possible to clarify the phylogenetic origins of the plant mitochondrion. In particular, a close phylogenetic relationship is found between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely, Rb. sphaeroides, P. denitrificans, and Rhodospirillum rubrum.

  2. PDV Probe Alignment Technique

    SciTech Connect

    Whitworth, T L; May, C M; Strand, O T

    2007-10-26

    This alignment technique was developed while performing heterodyne velocimetry measurements at LLNL. There are a few minor items needed, such as a white card with aperture in center, visible alignment laser, IR back reflection meter, and a microscope to view the bridge surface. The work was performed on KCP flyers that were 6 and 8 mils wide. The probes used were Oz Optics manufactured with focal distances of 42mm and 26mm. Both probes provide a spot size of approximately 80?m at 1550nm. The 42mm probes were specified to provide an internal back reflection of -35 to -40dB, and the probe back reflections were measured to be -37dB and -33dB. The 26mm probes were specified as -30dB and both measured -30.5dB. The probe is initially aligned normal to the flyer/bridge surface. This provides a very high return signal, up to -2dB, due to the bridge reflectivity. A white card with a hole in the center as an aperture can be used to check the reflected beam position relative to the probe and launch beam, and the alignment laser spot centered on the bridge, see Figure 1 and Figure 2. The IR back reflection meter is used to measure the dB return from the probe and surface, and a white card or similar object is inserted between the probe and surface to block surface reflection. It may take several iterations between the visible alignment laser and the IR back reflection meter to complete this alignment procedure. Once aligned normal to the surface, the probe should be tilted to position the visible alignment beam as shown in Figure 3, and the flyer should be translated in the X and Y axis to reposition the alignment beam onto the flyer as shown in Figure 4. This tilting of the probe minimizes the amount of light from the bridge reflection into the fiber within the probe while maintaining the alignment as near normal to the flyer surface as possible. When the back reflection is measured after the tilt adjustment, the level should be about -3dB to -6dB higher than the probes

  3. Circumferential pressure probe

    NASA Technical Reports Server (NTRS)

    Holmes, Harlan K. (Inventor); Moore, Thomas C. (Inventor); Fantl, Andrew J. (Inventor)

    1989-01-01

    A probe for measuring circumferential pressure inside a body cavity is disclosed. In the preferred embodiment, a urodynamic pressure measurement probe for evaluating human urinary sphincter function is disclosed. Along the length of the probe are disposed a multiplicity of deformable wall sensors which typically comprise support tube sections with flexible side wall areas. These are arranged along the length of the probe in two areas, one just proximal to the tip for the sensing of fluid pressure inside the bladder, and five in the sensing section which is positioned within the urethra at the point at which the urinary sphincter constricts to control the flow of urine. The remainder of the length of the probe comprises multiple rigid support tube sections interspersed with flexible support tube sections in the form of bellows to provide flexibility.

  4. The Relationship Between Human Nucleolar Organizer Regions and Nucleoli, Probed by 3D-ImmunoFISH.

    PubMed

    van Sluis, Marjolein; van Vuuren, Chelly; McStay, Brian

    2016-01-01

    3D-immunoFISH is a valuable technique to compare the localization of DNA sequences and proteins in cells where three-dimensional structure has been preserved. As nucleoli contain a multitude of protein factors dedicated to ribosome biogenesis and form around specific chromosomal loci, 3D-immunoFISH is a particularly relevant technique for their study. In human cells, nucleoli form around transcriptionally active ribosomal gene (rDNA) arrays termed nucleolar organizer regions (NORs) positioned on the p-arms of each of the acrocentric chromosomes. Here, we provide a protocol for fixing and permeabilizing human cells grown on microscope slides such that nucleolar proteins can be visualized using antibodies and NORs visualized by DNA FISH. Antibodies against UBF recognize transcriptionally active rDNA/NORs and NOP52 antibodies provide a convenient way of visualizing the nucleolar volume. We describe a probe designed to visualize rDNA and introduce a probe comprised of NOR distal sequences, which can be used to identify or count individual NORs. PMID:27576706

  5. Variation in copy number of the 28S rDNA of Aspergillus fumigatus measured by droplet digital PCR and analog quantitative real-time PCR.

    PubMed

    Alanio, Alexandre; Sturny-Leclère, Aude; Benabou, Marion; Guigue, Nicolas; Bretagne, Stéphane

    2016-08-01

    Droplet digital PCR (ddPCR) after DNA digestion yielded a 28S rDNA copy number of 61 to 86 copies/genome when testing 10 unrelated Aspergillus fumigatus isolates, higher than with quantitative PCR. Unfortunately, ddPCR after DNA digestion did not improve the sensitivity of our PCR assay when testing serum patients with invasive aspergillosis. PMID:27316653

  6. Chromosomal localization of 45S rDNA, sex-specific C values, and heterochromatin distribution in Coccinia grandis (L.) Voigt.

    PubMed

    Bhowmick, Biplab Kumar; Yamamoto, Masashi; Jha, Sumita

    2016-01-01

    Coccinia grandis is a widely distributed dioecious cucurbit in India, with heteromorphic sex chromosomes and X-Y sex determination mode. The present study aids in the cytogenetic characterization of four native populations of this plant employing distribution patterns of 45S rDNA on chromosomes and guanine-cytosine (GC)-rich heterochromatin in the genome coupled with flow cytometric determination of genome sizes. Existence of four nucleolar chromosomes could be confirmed by the presence of four telomeric 45S rDNA signals in both male and female plants. All four 45S rDNA sites are rich in heterochromatin evident from the co-localization of telomeric chromomycin A (CMA)(+ve) signals. The size of 45S rDNA signal was found to differ between the homologues of one nucleolar chromosome pair. The distribution of heterochromatin is found to differ among the male and female populations. The average GC-rich heterochromatin content of male and female populations is 23.27 and 29.86 %, respectively. Moreover, the male plants have a genome size of 0.92 pg/2C while the female plants have a size of 0.73 pg/2C, reflecting a huge genomic divergence between the genders. The great variation in genome size is owing to the presence of Y chromosome in the male populations, playing a multifaceted role in sexual divergence in C. grandis. PMID:25795278

  7. A duplicated NUCLEOLIN gene with antagonistic activity is required for chromatin organization of silent 45S rDNA in Arabidopsis.

    PubMed

    Durut, Nathalie; Abou-Ellail, Mohamed; Pontvianne, Frédéric; Das, Sadhan; Kojima, Hisae; Ukai, Seiko; de Bures, Anne; Comella, Pascale; Nidelet, Sabine; Rialle, Stéphanie; Merret, Remy; Echeverria, Manuel; Bouvet, Philippe; Nakamura, Kenzo; Sáez-Vásquez, Julio

    2014-03-01

    In plants as well as in animals, hundreds to thousands of 45S rRNA gene copies localize in Nucleolus Organizer Regions (NORs), and the activation or repression of specific sets of rDNA depends on epigenetic mechanisms. Previously, we reported that the Arabidopsis thaliana nucleolin protein NUC1, an abundant and evolutionarily conserved nucleolar protein in eukaryotic organisms, is required for maintaining DNA methylation levels and for controlling the expression of specific rDNA variants in Arabidopsis. Interestingly, in contrast with animal or yeast cells, plants contain a second nucleolin gene. Here, we report that Arabidopsis NUC1 and NUC2 nucleolin genes are both required for plant growth and survival and that NUC2 disruption represses flowering. However, these genes seem to be functionally antagonistic. In contrast with NUC1, disruption of NUC2 induces CG hypermethylation of rDNA and NOR association with the nucleolus. Moreover, NUC2 loss of function triggers major changes in rDNA spatial organization, expression, and transgenerational stability. Our analyses indicate that silencing of specific rRNA genes is mostly determined by the active or repressed state of the NORs and that nucleolin proteins play a key role in the developmental control of this process. PMID:24668745

  8. Pioneer Jupiter orbiter probe mission 1980, probe description

    NASA Technical Reports Server (NTRS)

    Defrees, R. E.

    1974-01-01

    The adaptation of the Saturn-Uranus Atmospheric Entry Probe (SUAEP) to a Jupiter entry probe is summarized. This report is extracted from a comprehensive study of Jovian missions, atmospheric model definitions and probe subsystem alternatives.

  9. [Comparative cytogenetic study of the tetraploid Matricaria chamomilla L. and Matricaria inodora L].

    PubMed

    Samatadze, T E; Amosova, A V; Mel'nikova, N V; Suslina, S N; Zagumennikova, T N; Zelenin, A V; Bykov, V A; Muravenko, O N

    2014-01-01

    A comparative cytogenetic study of the autotetraploid breed of Matricaria chamomilla L. (M. recutita L.) and Matricaria inodora L. was carried out by DAPI-banding, fluorescent hybridization in situ (FISH) with 26S and 5S rDNA probes, and analysis of meiosis. All chromosomes were identified in both karyotypeson the basis of DAPI-banding images and 26S and 5S rDNA distribution, and species-specific idiograms were composed for both M. chamomilla and M. indora taking into account the polymorphous variants of DAPI-banding images, showing the location of the 26S and 5S rDNA sites. PMID:25735163

  10. Introduction of a novel 18S rDNA gene arrangement along with distinct ITS region in the saline water microalga Dunaliella

    PubMed Central

    2010-01-01

    Comparison of 18S rDNA gene sequences is a very promising method for identification and classification of living organisms. Molecular identification and discrimination of different Dunaliella species were carried out based on the size of 18S rDNA gene and, number and position of introns in the gene. Three types of 18S rDNA structure have already been reported: the gene with a size of ~1770 bp lacking any intron, with a size of ~2170 bp consisting one intron near 5' terminus, and with a size of ~2570 bp harbouring two introns near 5' and 3' termini. Hereby, we report a new 18S rDNA gene arrangement in terms of intron localization and nucleotide sequence in a Dunaliella isolated from Iranian salt lakes (ABRIINW-M1/2). PCR amplification with genus-specific primers resulted in production of a ~2170 bp DNA band, which is similar to that of D. salina 18S rDNA gene containing only one intron near 5' terminus. Whilst, sequence composition of the gene revealed the lack of any intron near 5' terminus in our isolate. Furthermore, another alteration was observed due to the presence of a 440 bp DNA fragment near 3' terminus. Accordingly, 18S rDNA gene of the isolate is clearly different from those of D. salina and any other Dunaliella species reported so far. Moreover, analysis of ITS region sequence showed the diversity of this region compared to the previously reported species. 18S rDNA and ITS sequences of our isolate were submitted with accesion numbers of EU678868 and EU927373 in NCBI database, respectively. The optimum growth rate of this isolate occured at the salinity level of 1 M NaCl. The maximum carotenoid content under stress condition of intense light (400 μmol photon m-2 s-1), high salinity (4 M NaCl) and deficiency of nitrate and phosphate nutritions reached to 240 ng/cell after 15 days. PMID:20377865

  11. Focus: DNA probes

    SciTech Connect

    Not Available

    1986-11-01

    Progress in the development of DNA probes for the identification and quantitation of specific genetic sequences in biological samples is reviewed. Current research efforts in the development of DNA probes for the diagnosis of a wide variety of bacterial, viral, and other infectious diseases, such as herpes simplex and cytomegalovirus, and inherited genetic diseases such as cystic fibrosis and sickle cell anemia are discussed. Progress in development of DNA probe assays for cancer diagnosis, detection of Salmonella food poisoning, tissue typing (detection of histocompatibility antigens), mutagen screening, and animal diseases, among other applications is included.

  12. ALEX neutral beam probe

    SciTech Connect

    Pourrezaei, K.

    1982-01-01

    A neutral beam probe capable of measuring plasma space potential in a fully 3-dimensional magnetic field geometry has been developed. This neutral beam was successfully used to measure an arc target plasma contained within the ALEX baseball magnetic coil. A computer simulation of the experiment was performed to refine the experimental design and to develop a numerical model for scaling the ALEX neutral beam probe to other cases of fully 3-dimensional magnetic field. Based on this scaling a 30 to 50 keV neutral cesium beam probe capable of measuring space potential in the thermal barrier region of TMX Upgrade was designed.

  13. Foldable polymers as probes

    DOEpatents

    Li, Alexander D. Q.; Wang, Wei

    2007-07-03

    Disclosed herein are novel probes, which can be used to detect and identify target molecules of interest in a sample. The disclosed probes can be used to monitor conformational changes induced by molecular recognition events in addition to providing signaling the presence and/or identity of a target molecule. Methods, including solid phase synthesis techniques, for making probe molecules that exhibit changes in their optical properties upon target molecule binding are described in the disclosure. Also disclosed herein are novel chromophore moieties, which have tailored fluorescent emission spectra.

  14. Foldable polymers as probes

    DOEpatents

    Li, Alexander D. Q.; Wang, Wei

    2009-07-07

    Disclosed herein are novel probes, which can be used to detect and identify target molecules of interest in a sample. The disclosed probes can be used to monitor conformational changes induced by molecular recognition events in addition to providing signaling the presence and/or identity of a target molecule. Methods, including solid phase synthesis techniques, for making probe molecules that exhibit changes in their optical properties upon target molecule binding are described in the disclosure. Also disclosed herein are novel chromophore moieties, which have tailored fluorescent emission spectra.

  15. Chemical sensing flow probe

    DOEpatents

    Laguna, George R.; Peter, Frank J.; Butler, Michael A.

    1999-01-01

    A new chemical probe determines the properties of an analyte using the light absorption of the products of a reagent/analyte reaction. The probe places a small reaction volume in contact with a large analyte volume. Analyte diffuses into the reaction volume. Reagent is selectively supplied to the reaction volume. The light absorption of the reaction in the reaction volume indicates properties of the original analyte. The probe is suitable for repeated use in remote or hostile environments. It does not require physical sampling of the analyte or result in significant regent contamination of the analyte reservoir.

  16. Chemical sensing flow probe

    DOEpatents

    Laguna, G.R.; Peter, F.J.; Butler, M.A.

    1999-02-16

    A new chemical probe determines the properties of an analyte using the light absorption of the products of a reagent/analyte reaction. The probe places a small reaction volume in contact with a large analyte volume. Analyte diffuses into the reaction volume. Reagent is selectively supplied to the reaction volume. The light absorption of the reaction in the reaction volume indicates properties of the original analyte. The probe is suitable for repeated use in remote or hostile environments. It does not require physical sampling of the analyte or result in significant regent contamination of the analyte reservoir. 7 figs.

  17. BEAM CONTROL PROBE

    DOEpatents

    Chesterman, A.W.

    1959-03-17

    A probe is described for intercepting a desired portion of a beam of charged particles and for indicating the spatial disposition of the beam. The disclosed probe assembly includes a pair of pivotally mounted vanes moveable into a single plane with adjacent edges joining and a calibrated mechanical arrangement for pivoting the vancs apart. When the probe is disposed in the path of a charged particle beam, the vanes may be adjusted according to the beam current received in each vane to ascertain the dimension of the beam.

  18. Functional Probes for Scanning Probe Microscopy

    NASA Astrophysics Data System (ADS)

    Akiyama, Kotone; Eguchi, Toyoaki; An, Toshu; Fujikawa, Yasunori; Hasegawa, Yukio; Sakurai, Toshio

    2007-03-01

    For superior performance of scanning probe microscopy, we are working to fabricate functional probes. For Kelvin probe force microscopy, we fabricated a metal-tip cantilever by attaching a thin metal wire to a regular Si cantilever and milling it by focused ion beam (FIB)^1. By using the W tip with a curvature radius of 3.5 nm, we obtained the potential profile of Ge/Si(105) surface in atomic resolution with the energy resolution better than 3 meV^2. For synchrotron-radiation-light-irradiated scanning tunneling microscopy which aims at atomically resolved elemental analysis, we fabricated a glass-coated W tip using FIB^3. It is found that the glass coating blocks the unwanted secondary electrons, which come from large area of the sample, by a factor of 40 with respect to the case no coating. Using the tip to detect the electrons emitted just below the tip, we obtained element specific images with a spatial resolution better than 20 nm under the photo irradiation whose energy is just above the adsorption edge of the element^4. 1 K. Akiyama et al., RSI 76, 033705 (2005) 2 T. Eguchi, K. Akiyama et al., PRL 93, 266102 (2004) 3 K. Akiyama et al., RSI 76, 083711 (2005) 4 T. Eguchi, K. Akiyama et al., APL, in press

  19. Technology for Entry Probes

    NASA Technical Reports Server (NTRS)

    Cutts, James A.; Arnold, James; Venkatapathy, Ethiraj; Kolawa, Elizabeth; Munk, Michelle; Wercinski, Paul; Laub, Bernard

    2005-01-01

    A viewgraph describing technologies for entry probes is presented. The topics include: 1) Entry Phase; 2) Descent Phase; 3) Long duration atmospheric observations; 4) Survivability at high temperatures; and 5) Summary.

  20. An Ultrasonographic Periodontal Probe

    NASA Astrophysics Data System (ADS)

    Bertoncini, C. A.; Hinders, M. K.

    2010-02-01

    Periodontal disease, commonly known as gum disease, affects millions of people. The current method of detecting periodontal pocket depth is painful, invasive, and inaccurate. As an alternative to manual probing, an ultrasonographic periodontal probe is being developed to use ultrasound echo waveforms to measure periodontal pocket depth, which is the main measure of periodontal disease. Wavelet transforms and pattern classification techniques are implemented in artificial intelligence routines that can automatically detect pocket depth. The main pattern classification technique used here, called a binary classification algorithm, compares test objects with only two possible pocket depth measurements at a time and relies on dimensionality reduction for the final determination. This method correctly identifies up to 90% of the ultrasonographic probe measurements within the manual probe's tolerance.

  1. Application of PRECEDE-PROCEED model to tackle problems identified with diarrhoea burden among under-5s in Botswana.

    PubMed

    Popoola, Tosin; Mchunu, Gugu

    2015-05-01

    Diarrhoea has been identified as the second leading cause of mortality among under-5s and also claims more life than HIV, measles and malaria combined together in the same category of population. This article is a combination of literature review and personal experience of lessons learnt from past diarrhoea outbreaks in Botswana that caused significant rate of mortality among under-5s. The paper used literature review to identify contributory factors to diarrhoea burden among under-5s in Botswana and applied a community health nursing framework (PRECEDE-PROCEED) to tackle the problems identified. The study revealed that Botswana mothers are lacking in knowledge related to exclusive breastfeeding, prevention and treatment of diarrhoea disease. The paper recommends that health-care workers in Botswana be sensitized on current diarrhoea management to tailor their health education methods appropriately. PMID:26125574

  2. Transsacral transdiscal L5-S1 screws for the management of high-grade spondylolisthesis in an adolescent.

    PubMed

    Palejwala, Ali; Fridley, Jared; Jea, Andrew

    2016-06-01

    The surgical management of high-grade spondylolisthesis in adolescents remains a controversial issue. Because the basic procedure, posterolateral fusion, is associated with a significant rate of pseudarthrosis and listhesis progression, there is a pressing need for alternative surgical techniques. In the present report, the authors describe the case of an adolescent patient with significant low-back pain who was found to have Grade IV spondylolisthesis at L5-S1 that was treated with transsacral transdiscal screw fixation. Bilateral pedicle screws were placed starting from the top of the S-1 pedicle, across the L5-S1 intervertebral disc space, and into the L-5 body. At 14 months after surgery, the patient had considerable improvement in his pain and radiographic fusion across L5-S1. The authors conclude that transsacral transdiscal pedicle screws may serve as an efficacious and safe option for the correction of high-grade spondylolisthesis in adolescent patients. PMID:26894520

  3. Dissociative excitation of the N(+)(5S) state by electron impact on N2 - Excitation function and quenching

    NASA Technical Reports Server (NTRS)

    Erdman, P. W.; Zipf, E. C.

    1986-01-01

    Metastable N(+)(5S) ions were produced in the laboratory by dissociative excitation of N2 with energetic electrons. The resulting radiative decay of the N(+)(5S) state was observed with sufficient resolution to completely resolve the doublet from the nearby N2 molecular radiation. The excitation function was measured from threshold to 500 eV. The cross section peaks at a high electron energy and also exhibits a high threshold energy both of which are typical of dissociative excitation-ionization processes. This finding complicates the explanation of electron impact on N2 as the mechanism for the source of the 2145 A 'auroral mystery feature' by further increasing the required peak cross section. It is suggested that the apparent N(+)(5S) quenching in auroras may be an artifact due to the softening of the electron energy spectrum in the auroral E region.

  4. Reflections on Electric Probes

    NASA Astrophysics Data System (ADS)

    Braithwaite, Nicholas

    2007-10-01

    One of the more immediate temptations for an experimental plasma physicist is to insert some kind of refractory, conducting material into a plasma, as a simple means of probing its charge composition. Irvine Langmuir tried it in the 1920s and was one of the first to develop an electrical probe method in his early work on electrical discharge plasmas. There are now numerous variations on the theme including planar, cylindrical and spherical geometry with single, double and triple probes. There are also probes that resonate, propagate and reciprocate. Some probes are electrostatic and others are electromagnetic; some are effectively wireless; most absorb but some emit. All types can be used in steady and transient plasmas, while special schemes have been devised for RF plasmas, using passive and active compensation. Magnetised plasmas pose further challenges. Each configuration is accompanied by assumptions that constrain both their applicability and the analytical methods that translate the measured currents and voltages variously into charge densities, space potentials, particle fluxes, energy distributions and measures of collisionality. This talk will take a broad look at the options and opportunities for electric probes, principally in the environment of non-equilibrium plasma.

  5. D5S2500 is an ambiguously characterized STR: Identification and description of forensic microsatellites in the genomics age.

    PubMed

    Phillips, C; Parson, W; Amigo, J; King, J L; Coble, M D; Steffen, C R; Vallone, P M; Gettings, K B; Butler, J M; Budowle, B

    2016-07-01

    In the process of establishing short tandem repeat (STR) sequence variant nomenclature guidelines in anticipation of expanded forensic multiplexes for massively parallel sequencing (MPS), it was discovered that the STR D5S2500 has multiple positions and genomic characteristics reported. This ambiguity is because the marker named D5S2500 consists of two different microsatellites forming separate components in the capillary electrophoresis multiplexes of Qiagen's HDplex (Hilden, Germany) and AGCU ScienTech's non-CODIS STR 21plex (Wuxi, Jiangsu, China). This study outlines the genomic details used to identify each microsatellite and reveals the D5S2500 marker in HDplex has the correctly assigned STR name, while the D5S2500 marker in the AGCU 21plex, closely positioned a further 1643 nucleotides in the human reference sequence, is an unnamed microsatellite. The fact that the D5S2500 marker has existed as two distinct STR loci undetected for almost ten years, even with reported discordant genotypes for the standard control DNA, underlines the need for careful scrutiny of the genomic properties of forensic STRs, as they become adapted for sequence analysis with MPS systems. We make the recommendation that precise chromosome location data must be reported for any forensic marker under development but not in common use, so that the genomic characteristics of the locus are validated to the same level of accuracy as its allelic variation and forensic performance. To clearly differentiate each microsatellite, we propose the name D5S2800 be used to identify the Chromosome-5 STR in the AGCU 21plex. PMID:26974236

  6. Domain rearrangement of SRP protein Ffh upon binding 4.5S RNA and the SRP receptor FtsY

    PubMed Central

    BUSKIEWICZ, IWONA; KUBARENKO, ANDRIY; PESKE, FRANK; RODNINA, MARINA V.; WINTERMEYER, WOLFGANG

    2005-01-01

    The signal recognition particle (SRP) mediates membrane targeting of translating ribosomes displaying a signal-anchor sequence. In Escherichia coli, SRP consists of 4.5S RNA and a protein, Ffh, that recognizes the signal peptide emerging from the ribosome and the SRP receptor at the membrane, FtsY. In the present work, we studied the interactions between the NG and M domains in Ffh and their rearrangements upon complex formation with 4.5S RNA and/or FtsY. In free Ffh, the NG and M domains are facing one another in an orientation that allows cross-linking between positions 231 in the G domain and 377 in the M domain. There are binding interactions between the two domains, as the isolated domains form a strong complex. The interdomain contacts are disrupted upon binding of Ffh to 4.5S RNA, consuming a part of the total binding energy of 4.5S RNA-Ffh association that is roughly equivalent to the free energy of domain binding to each other. In the SRP particle, the NG domain binds to 4.5S RNA in a region adjacent to the binding site of the M domain. Ffh binding to FtsY also requires a reorientation of NG and M domains. These results suggest that in free Ffh, the binding sites for 4.5S RNA and FtsY are occluded by strong domain–domain interactions which must be disrupted for the formation of SRP or the Ffh-FtsY complex. PMID:15923378

  7. Domain rearrangement of SRP protein Ffh upon binding 4.5S RNA and the SRP receptor FtsY.

    PubMed

    Buskiewicz, Iwona; Kubarenko, Andriy; Peske, Frank; Rodnina, Marina V; Wintermeyer, Wolfgang

    2005-06-01

    The signal recognition particle (SRP) mediates membrane targeting of translating ribosomes displaying a signal-anchor sequence. In Escherichia coli, SRP consists of 4.5S RNA and a protein, Ffh, that recognizes the signal peptide emerging from the ribosome and the SRP receptor at the membrane, FtsY. In the present work, we studied the interactions between the NG and M domains in Ffh and their rearrangements upon complex formation with 4.5S RNA and/or FtsY. In free Ffh, the NG and M domains are facing one another in an orientation that allows cross-linking between positions 231 in the G domain and 377 in the M domain. There are binding interactions between the two domains, as the isolated domains form a strong complex. The interdomain contacts are disrupted upon binding of Ffh to 4.5S RNA, consuming a part of the total binding energy of 4.5S RNA-Ffh association that is roughly equivalent to the free energy of domain binding to each other. In the SRP particle, the NG domain binds to 4.5S RNA in a region adjacent to the binding site of the M domain. Ffh binding to FtsY also requires a reorientation of NG and M domains. These results suggest that in free Ffh, the binding sites for 4.5S RNA and FtsY are occluded by strong domain-domain interactions which must be disrupted for the formation of SRP or the Ffh-FtsY complex. PMID:15923378

  8. 5S Clavam Biosynthesis Is Controlled by an Atypical Two-Component Regulatory System in Streptomyces clavuligerus

    PubMed Central

    Kwong, Thomas; Zelyas, Nathan J.; Cai, Hui; Tahlan, Kapil; Wong, Annie

    2012-01-01

    Streptomyces clavuligerus produces a collection of five clavam metabolites, including the clinically important β-lactamase inhibitor clavulanic acid, as well as four structurally related metabolites called 5S clavams. The paralogue gene cluster of S. clavuligerus is one of three clusters of genes for the production of these clavam metabolites. A region downstream of the cluster was analyzed, and snk, res1, and res2, encoding elements of an atypical two-component regulatory system, were located. Mutation of any one of the three genes had no effect on clavulanic acid production, but snk and res2 mutants produced no 5S clavams, whereas res1 mutants overproduced 5S clavams. Reverse transcriptase PCR analyses showed that transcription of cvm7p (which encodes a transcriptional activator of 5S clavam biosynthesis) and 5S clavam biosynthetic genes was eliminated in snk and in res2 mutants but that snk and res2 transcription was unaffected in a cvm7p mutant. Both snk and res2 mutants could be complemented by introduction of cvm7p under the control of an independently regulated promoter. In vitro assays showed that Snk can autophosphorylate and transfer its phosphate group to both Res1 and Res2, and Snk-H365, Res1-D52, and Res2-D52 were identified as the phosphorylation sites for the system. Dephosphorylation assays indicated that Res1 stimulates dephosphorylation of Res2∼P. These results suggest a regulatory cascade in which Snk and Res2 form a two-component system controlling cvm7p transcription, with Res1 serving as a checkpoint to modulate phosphorylation levels. Cvm7P then activates transcription of 5S clavam biosynthetic genes. PMID:22751548

  9. Comparative structural analysis of eubacterial 5S rRNA by oxidation of adenines in the N-1 position.

    PubMed Central

    Pieler, T; Schreiber, A; Erdmann, V A

    1984-01-01

    Adenines in free 5S rRNA from Escherichia coli, Bacillus stearothermophilus and Thermus thermophilus have been oxidized at their N-1 position using monoperphthalic acid. The determination of the number of adenine 1-N-oxides was on the basis of UV spectroscopic data of the intact molecule. Identification of the most readily accessible nucleotides by sequencing gel analysis reveals that they are located in conserved positions within loops, exposed hairpin loops and single-base bulge loops. Implications for the structure and function of 5S rRNA will be discussed on the basis of this comparative analysis. Images PMID:6201825

  10. Investigation of histone H4 hyperacetylation dynamics in the 5S rRNA genes family by chromatin immunoprecipitation assay.

    PubMed

    Burlibașa, Liliana; Suciu, Ilinca

    2015-12-01

    Oogenesis is a critical event in the formation of female gamete, whose role in development is to transfer genomic information to the next generation. During this process, the gene expression pattern changes dramatically concomitant with genome remodelling, while genomic information is stably maintained. The aim of the present study was to investigate the presence of H4 acetylation of the oocyte and somatic 5S rRNA genes in Triturus cristatus, using chromatin immunoprecipitation assay (ChIP). Our findings suggest that some epigenetic mechanisms such as histone acetylation could be involved in the transcriptional regulation of 5S rRNA gene families. PMID:25315165

  11. Expression of a chimeric human/salmon calcitonin gene integrated into the Saccharomyces cerevisiae genome using rDNA sequences as recombination sites.

    PubMed

    Sun, Hengyi; Zang, Xiaonan; Liu, Yuantao; Cao, Xiaofei; Wu, Fei; Huang, Xiaoyun; Jiang, Minjie; Zhang, Xuecheng

    2015-12-01

    Calcitonin participates in controlling homeostasis of calcium and phosphorus and plays an important role in bone metabolism. The aim of this study was to endow an industrial strain of Saccharomyces cerevisiae with the ability to express chimeric human/salmon calcitonin (hsCT) without the use of antibiotics. To do so, a homologous recombination plasmid pUC18-rDNA2-ura3-P pgk -5hsCT-rDNA1 was constructed, which contains two segments of ribosomal DNA of 1.1 kb (rDNA1) and 1.4 kb (rDNA2), to integrate the heterologous gene into host rDNA. A DNA fragment containing five copies of a chimeric human/salmon calcitonin gene (5hsCT) under the control of the promoter for phosphoglycerate kinase (P pgk ) was constructed to express 5hsCT in S. cerevisiae using ura3 as a selectable auxotrophic marker gene. After digestion by restriction endonuclease HpaI, a linear fragment, rDNA2-ura3-P pgk -5hsCT-rDNA1, was obtained and transformed into the △ura3 mutant of S. cerevisiae by the lithium acetate method. The ura3-P pgk -5hsCT sequence was introduced into the genome at rDNA sites by homologous recombination, and the recombinant strain YS-5hsCT was obtained. Southern blot analysis revealed that the 5hsCT had been integrated successfully into the genome of S. cerevisiae. The results of Western blot and ELISA confirmed that the 5hsCT protein had been expressed in the recombinant strain YS-5hsCT. The expression level reached 2.04 % of total proteins. S. cerevisiae YS-5hsCT decreased serum calcium in mice by oral administration and even 0.01 g lyophilized S. cerevisiae YS-5hsCT/kg decreased serum calcium by 0.498 mM. This work has produced a commercial yeast strain potentially useful for the treatment of osteoporosis. PMID:26254786

  12. Quenching of krypton atoms in the metastable 5s ({sup 3}P{sub 2}) state in collisions with krypton and helium atoms

    SciTech Connect

    Zayarnyi, D A; L'dov, A Yu; Kholin, I V

    2013-08-31

    We have used the absorption probe method to study the processes of collisional quenching of the metastable 5s [3/2]{sup o}{sub 2}({sup 3}P{sub 2}) state of the krypton atom in electron-beam-excited high-pressure He – Kr mixtures with a low content of krypton. The rate constants of plasma-chemical reactions Kr* + Kr + He → Kr*{sub 2}+He [(2.88 ± 0.29) × 10{sup -33} cm{sup 6} s{sup -1}], Kr* + 2He → HeKr* + He [(4.6 ± 1.3) × 10{sup -36} cm{sup 6} s{sup -1}] and Kr* + He → products + He [(1.51 ± 0.15) × 10{sup -15} cm{sup 3} s{sup -1}] are measured for the first time. The rate constants of similar reactions in the Ar – Kr mixture are refined. (active media)

  13. Epidemiologic Study of Malassezia Yeasts in Patients with Malassezia Folliculitis by 26S rDNA PCR-RFLP Analysis

    PubMed Central

    Ko, Jong Hyun; Choe, Yong Beom; Ahn, Kyu Joong

    2011-01-01

    Background So far, studies on the inter-relationship between Malassezia and Malassezia folliculitis have been rather scarce. Objective We sought to analyze the differences in body sites, gender and age groups, and to determine whether there is a relationship between certain types of Malassezia species and Malassezia folliculitis. Methods Specimens were taken from the forehead, cheek and chest of 60 patients with Malassezia folliculitis and from the normal skin of 60 age- and gender-matched healthy controls by 26S rDNA PCR-RFLP. Results M. restricta was dominant in the patients with Malassezia folliculitis (20.6%), while M. globosa was the most common species (26.7%) in the controls. The rate of identification was the highest in the teens for the patient group, whereas it was the highest in the thirties for the control group. M. globosa was the most predominant species on the chest with 13 cases (21.7%), and M. restricta was the most commonly identified species, with 17 (28.3%) and 12 (20%) cases on the forehead and cheek, respectively, for the patient group. Conclusion Statistically significant differences were observed between the patient and control groups for the people in their teens and twenties, and in terms of the body site, on the forehead only. PMID:21747616

  14. Epidemiologic Study of Malassezia Yeasts in Acne Patients by Analysis of 26S rDNA PCR-RFLP

    PubMed Central

    Song, Young Chan; Hahn, Hyung Jin; Kim, Ji Young; Ko, Jong Hyun; Choe, Yong Beom; Ahn, Kyu Joong

    2011-01-01

    Background Although acne is a common follicular inflammatory dermatosis, studies of the relationship between Malassezia yeasts and acne have rarely been conducted. Objective We sought to identify Malassezia yeasts from acne patients and establish a relationship between specific types of species of Malassezia and acne. Methods Sixty acne patients were enrolled. Each strain obtained was identified as one of eleven species by 26S rDNA PCR-RFLP. We then compared these data with those of age- and sex-matched healthy subjects. Results Growth of Malassezia was evident in fewer patients with acne (50%) in comparison to controls (70.6%). M. restricta was dominant in patients with acne (23.9%), whereas M. globosa was most common (26.7%) in healthy controls. In the patients group, the rate was the highest (71.7%) in the twenties and, in terms of body site, the rate was the highest (60%) in the chest. In the control group, the rate was the highest (75.0%) in the thirties and in the forehead (85.0%). Conclusion The detection rate of Malassezia yeasts was conspicuously low in the acne patients group. Statistically significant differences were observed between the patient and the control groups in the twenties and thirties, and in terms of body site, in the forehead and chest. PMID:21909202

  15. Taiwanese Trichogramma of Asian Corn Borer: Morphology, ITS-2 rDNA Characterization, and Natural Wolbachia Infection

    PubMed Central

    Wu, Li-Hsin; Hoffmann, Ary A.; Thomson, Linda J.

    2016-01-01

    Egg parasitoids of the genus Trichogramma are natural enemies of many lepidopteran borers in agricultural areas around the world. It is important to identify the correct species and ideally focus on endemic Trichogramma for pest control in particular crops. In this study, Trichogramma wasps were collected from parasitized eggs of Asian corn borer in Southwestern Taiwan. Three Trichogramma species, Trichogramma ostriniae Pang and Chen, Trichogramma chilonis Ishii, and T. sp. y, were identified based on morphology and the nucleotide sequence of the internal transcribed spacer 2 (ITS-2) region of rDNA. Although T. ostriniae and T. sp. y appear to be morphologically similar, ITS-2 identity between these two taxa is only 89%. Surprisingly, a commercially released Trichogramma colony thought to be T. chilonis possessed 99% identity (ITS-2) with the field T. sp. y individuals. This suggests past contamination leading to subsitution of the laboratory-reared T. chilonis colony by T. sp. y. Natural populations of all three Trichogramma species were found to be infected by a single Wolbachia strain which was identified using a wsp gene sequence. PMID:26896674

  16. Taiwanese Trichogramma of Asian Corn Borer: Morphology, ITS-2 rDNA Characterization, and Natural Wolbachia Infection.

    PubMed

    Wu, Li-Hsin; Hoffmann, Ary A; Thomson, Linda J

    2016-01-01

    Egg parasitoids of the genus Trichogramma are natural enemies of many lepidopteran borers in agricultural areas around the world. It is important to identify the correct species and ideally focus on endemic Trichogramma for pest control in particular crops. In this study, Trichogramma wasps were collected from parasitized eggs of Asian corn borer in Southwestern Taiwan. Three Trichogramma species, Trichogramma ostriniae Pang and Chen, Trichogramma chilonis Ishii, and T. sp. y, were identified based on morphology and the nucleotide sequence of the internal transcribed spacer 2 (ITS-2) region of rDNA. Although T. ostriniae and T. sp. y appear to be morphologically similar, ITS-2 identity between these two taxa is only 89%. Surprisingly, a commercially released Trichogramma colony thought to be T. chilonis possessed 99% identity (ITS-2) with the field T. sp. y individuals. This suggests past contamination leading to subsitution of the laboratory-reared T. chilonis colony by T. sp. y. Natural populations of all three Trichogramma species were found to be infected by a single Wolbachia strain which was identified using a wsp gene sequence. PMID:26896674

  17. Development of a novel rDNA based plasmid for enhanced cell surface display on Yarrowia lipolytica

    PubMed Central

    2012-01-01

    In this study, a novel rDNA based plasmid was developed for display of heterologous proteins on the cell surface of Yarrowia lipolytica using the C-terminal end of the glycosylphosphatidylinositol (GPI) anchored Y. lipolytica cell wall protein 1 (YlCWP1). mCherry was used as a model protein to assess the efficiency of the constructed plasmid. Y. lipolytica transformants harbouring the expression cassettes showed a purple colour phenotype on selective YNB-casamino plates as compared to control cells indicating that mCherry was displayed on the cells. Expression of mCherry on cells of Y. lipolytica was confirmed by both fluorescent microscopy and flow cytometry. Furthermore, SDS-PAGE analysis and matrix-assisted laser desorption/ionization (MALDI)-time-of (TOF)-mass spectrometry (MS) peptide mass fingerprinting (PMF) confirmed that the protein cleaved from the yeast cells using enterokinase was mCherry. Efficient cleavage of mCherry reported in this work offers an alternative purification method for displayed heterologous proteins on Y. lipolytica cells using the plasmid constructed in this study. The developed displaying system offers great potential for industrial production and purification of heterologous proteins at low cost. PMID:22608131

  18. Detection of novel organisms associated with salpingitis, by use of 16S rDNA polymerase chain reaction.

    PubMed

    Hebb, Jennifer K; Cohen, Craig R; Astete, Sabina G; Bukusi, Elizabeth A; Totten, Patricia A

    2004-12-15

    Although Chlamydia trachomatis and Neisseria gonorrhoeae are established causes of salpingitis, the majority of cases have no known etiology. We used broad-range 16S rDNA polymerase chain reaction to identify novel, possibly uncultivable, bacteria associated with salpingitis and identified bacterial 16S sequences in Fallopian-tube specimens from 11 (24%) of 45 consecutive women with laparoscopically confirmed acute salpingitis (the case patients) and from 0 of 44 women seeking tubal ligations (the control subjects) at Kenyatta National Hospital, Nairobi, Kenya. Bacterial phylotypes most closely related to Leptotrichia spp. were detected as the sole phylotypes in 1, and mixed with other bacterial phylotypes in 2, specimens. Novel bacterial phylotypes and those associated with bacterial vaginosis, including Atopobium vaginae, were identified in 3 specimens. N. gonorrhoeae and Streptococcus pyogenes were identified in 2 and 1 specimens, respectively. The finding of novel phylotypes associated with salpingitis has important implications for the etiology, pathogenesis, and treatment of this important reproductive-tract disease syndrome. PMID:15551209

  19. Characterization of Lactobacillus from Algerian Goat'S Milk Based on Phenotypic, 16S rDNA Sequencing and their Technological Properties.

    PubMed

    Marroki, Ahmed; Zúñiga, Manuel; Kihal, Mabrouk; Pérez-Martínez, Gaspar

    2011-01-01

    Nineteen strains of Lactobacillus isolated from goat's milk from farms in north-west of Algeria were characterized. Isolates were identified by phenotypic, physiological and genotypic methods and some of their important technological properties were studied. Phenotypic characterization was carried out by studying physiological, morphological characteristics and carbohydrate fermentation patterns using API 50 CHL system. Isolates were also characterized by partial 16S rDNA sequencing. Results obtained with phenotypic methods were correlated with the genotypic characterization and 13 isolates were identified as L. plantarum, two isolates as L. rhamnosus and one isolate as L. fermentum. Three isolates identified as L. plantarum by phenotypic characterization were found to be L. pentosus by the genotypic method. A large diversity in technological properties (acid production in skim milk, exopolysaccharide production, aminopeptidase activity, antibacterial activity and antibiotic susceptibility) was observed. Based on these results, two strains of L. plantarum (LbMS16 and LbMS21) and one strain of L. rhamnosus (LbMF25) have been tentatively selected for use as starter cultures in the manufacture of artisanal fermented dairy products in Algeria. PMID:24031617

  20. Identification of cephalopod species from the North and Baltic Seas using morphology, COI and 18S rDNA sequences

    NASA Astrophysics Data System (ADS)

    Gebhardt, Katharina; Knebelsberger, Thomas

    2015-09-01

    We morphologically analyzed 79 cephalopod specimens from the North and Baltic Seas belonging to 13 separate species. Another 29 specimens showed morphological features of either Alloteuthis mediaor Alloteuthis subulata or were found to be in between. Reliable identification features to distinguish between A. media and A. subulata are currently not available. The analysis of the DNA barcoding region of the COI gene revealed intraspecific distances (uncorrected p) ranging from 0 to 2.13 % (average 0.1 %) and interspecific distances between 3.31 and 22 % (average 15.52 %). All species formed monophyletic clusters in a neighbor-joining analysis and were supported by bootstrap values of ≥99 %. All COI haplotypes belonging to the 29 Alloteuthis specimens were grouped in one cluster. Neither COI nor 18S rDNA sequences helped to distinguish between the different Alloteuthis morphotypes. For species identification purposes, we recommend the use of COI, as it showed higher bootstrap support of species clusters and less amplification and sequencing failure compared to 18S. Our data strongly support the assumption that the genus Alloteuthis is only represented by a single species, at least in the North Sea. It remained unclear whether this species is A. subulata or A. media. All COI sequences including important metadata were uploaded to the Barcode of Life Data Systems and can be used as reference library for the molecular identification of more than 50 % of the cephalopod fauna known from the North and Baltic Seas.

  1. The phylogeny of native and exotic scallops cultured in China based on 16S rDNA sequences

    NASA Astrophysics Data System (ADS)

    Liu, Baozhong; Dong, Bo; Xiang, Jianhai; Wang, Zaizhao

    2007-01-01

    Scallops of the Family Pectinidae are a valuable resource in marine industry of the world. Understanding the phylogeny of the family is important for the development of the industry. In this study, partial 16S mitochondrial rDNA genes were obtained from 8 scallop species that are commonly cultured indigenous and transplanted species in China. Phylogenetic relationships of Pectinidae were analyzed based on the 8 sequences and other 5 published ones in GenBank, representing 9 genera of the family. The molecular phylogeny trees were constructed using 3 methods with software PHYLIP. The results showe that total 13 species of scallops clustered in 4 clades. Pecten maximus joins P. jacobaeus then Amusium pleuronectes in cluster, indicating close relationship of genus Amusium with Pecten in evolution. P. yessoensis is close to Chlamys farreri and C. islandica. No enough material was available to single out genus Patinopecten as an independent monophyletic subfamily. The position of Adamussium colbecki indicates that it is far from genus Pecten but near to genus Chlamys in evolution.

  2. Model for resonant plasma probe.

    SciTech Connect

    Warne, Larry Kevin; Johnson, William Arthur; Hebner, Gregory Albert; Jorgenson, Roy E.; Coats, Rebecca Sue

    2007-04-01

    This report constructs simple circuit models for a hairpin shaped resonant plasma probe. Effects of the plasma sheath region surrounding the wires making up the probe are determined. Electromagnetic simulations of the probe are compared to the circuit model results. The perturbing effects of the disc cavity in which the probe operates are also found.

  3. Ultrafast carrier relaxation through Auger recombination in the topological insulator B i1.5S b0.5T e1.7S e1.3

    NASA Astrophysics Data System (ADS)

    Onishi, Yoshito; Ren, Zhi; Segawa, Kouji; Kaszub, Wawrzyniec; Lorenc, Maciej; Ando, Yoichi; Tanaka, Koichiro

    2015-02-01

    Ultrafast carrier dynamics have great significance for our understanding of the transport properties of the surface state in topological insulator (TI) materials. We report midinfrared pump-probe measurements on the intrinsic TI material B i1.5S b0.5T e1.7S e1.3 and show that the change in photoinduced reflectivity can be decomposed into a fast negative part and a slow positive part. Calculations of the dielectric function made at various carrier temperatures and densities reveal that the fast negative component corresponds to the disappearance of the phase-space filling effect due to hot carriers around the probe energy and the decay component corresponds to the recombination of carriers near the band edge. The ratio of the fast negative component to the slow positive component is larger in the excitations conducted at the higher carrier densities, which suggests that the carrier temperature increases through Auger recombination. A qualitative analysis using rate equations reinforces this assumption, so we conclude that Auger recombination is the main cause of the population relaxation at carrier densities higher than 1018c m-3 and that we determined the Auger coefficient for B i1.5S b0.5T e1.7S e1.3 as C =0.4 ×10-26c m6/s .

  4. A methylated Neurospora 5S rRNA pseudogene contains a transposable element inactivated by repeat-induced point mutation.

    PubMed Central

    Margolin, B S; Garrett-Engele, P W; Stevens, J N; Fritz, D Y; Garrett-Engele, C; Metzenberg, R L; Selker, E U

    1998-01-01

    In an analysis of 22 of the roughly 100 dispersed 5S rRNA genes in Neurospora crassa, a methylated 5S rRNA pseudogene, Psi63, was identified. We characterized the Psi63 region to better understand the control and function of DNA methylation. The 120-bp 5S rRNA-like region of Psi63 is interrupted by a 1.9-kb insertion that has characteristics of sequences that have been modified by repeat-induced point mutation (RIP). We found sequences related to this insertion in wild-type strains of N. crassa and other Neurospora species. Most showed evidence of RIP; but one, isolated from the N. crassa host of Psi63, showed no evidence of RIP. A deletion from near the center of this sequence apparently rendered it incapable of participating in RIP with the related full-length copies. The Psi63 insertion and the related sequences have features of transposons and are related to the Fot1 class of fungal transposable elements. Apparently Psi63 was generated by insertion of a previously unrecognized Neurospora transposable element into a 5S rRNA gene, followed by RIP. We name the resulting inactivated Neurospora transposon PuntRIP1 and the related sequence showing no evidence of RIP, but harboring a deletion that presumably rendered it defective for transposition, dPunt. PMID:9691037

  5. Application of Sequence-Specific Labeled 16S rRNA Gene Oligonucleotide Probes for Genetic Profiling of Cyanobacterial Abundance and Diversity by Array Hybridization

    PubMed Central

    Rudi, Knut; Skulberg, Olav M.; Skulberg, Randi; Jakobsen, Kjetill S.

    2000-01-01

    DNA sequence information for the small-subunit rRNA gene (16S rDNA) obtained from cyanobacterial cultures was used to investigate the presence of cyanobacteria and their abundance in natural habitats. Eight planktonic communities developing in lakes characterized by relatively low algal biomass (mesotrophic) and in lakes with correspondingly high biomass (eutrophic) were selected for the study. The organismal compositions of the water samples were analyzed genetically, using multiplex sequence-specific labeling of oligonucleotide probes targeted to 16S rDNA and subsequent hybridization of the labeled probes to their respective complements spotted onto a solid support (DNA array). Ten probes were established to determine the relative abundances of the discernible cyanobacteria encountered in the selected lakes. The probes were generally specific for their targets, as determined through analyses of clone cultures. Reproducible abundance profiles were established for the lakes investigated in the subsequent analyses of natural cyanobacterial communities. The results from the genetic analyses were then compared with information obtained from standard hydrobiological and hydrochemical analyses. Qualitatively, there were relatively good correlations among the groups of organisms (Nostoc, Microcystis, and Planktothrix species) found in the different lakes. The levels of correlation were lower for the quantitative data. This may, however, be due to differences in sample processing technique. The conclusions from these comparisons are that the genetic abundance profiles may provide a foundation for separating and quantifying genetically distinct groups of cyanobacteria in their natural habitats. PMID:10966421

  6. Convective heat flow probe

    DOEpatents

    Dunn, J.C.; Hardee, H.C.; Striker, R.P.

    1984-01-09

    A convective heat flow probe device is provided which measures heat flow and fluid flow magnitude in the formation surrounding a borehole. The probe comprises an elongate housing adapted to be lowered down into the borehole; a plurality of heaters extending along the probe for heating the formation surrounding the borehole; a plurality of temperature sensors arranged around the periphery of the probe for measuring the temperature of the surrounding formation after heating thereof by the heater elements. The temperature sensors and heater elements are mounted in a plurality of separate heater pads which are supported by the housing and which are adapted to be radially expanded into firm engagement with the walls of the borehole. The heat supplied by the heater elements and the temperatures measured by the temperature sensors are monitored and used in providing the desired measurements. The outer peripheral surfaces of the heater pads are configured as segments of a cylinder and form a full cylinder when taken together. A plurality of temperature sensors are located on each pad so as to extend along the length and across the width thereof, with a heating element being located in each pad beneath the temperature sensors. An expansion mechanism driven by a clamping motor provides expansion and retraction of the heater pads and expandable packet-type seals are provided along the probe above and below the heater pads.

  7. Convective heat flow probe

    DOEpatents

    Dunn, James C.; Hardee, Harry C.; Striker, Richard P.

    1985-01-01

    A convective heat flow probe device is provided which measures heat flow and fluid flow magnitude in the formation surrounding a borehole. The probe comprises an elongate housing adapted to be lowered down into the borehole; a plurality of heaters extending along the probe for heating the formation surrounding the borehole; a plurality of temperature sensors arranged around the periphery of the probe for measuring the temperature of the surrounding formation after heating thereof by the heater elements. The temperature sensors and heater elements are mounted in a plurality of separate heater pads which are supported by the housing and which are adapted to be radially expanded into firm engagement with the walls of the borehole. The heat supplied by the heater elements and the temperatures measured by the temperature sensors are monitored and used in providing the desired measurements. The outer peripheral surfaces of the heater pads are configured as segments of a cylinder and form a full cylinder when taken together. A plurality of temperature sensors are located on each pad so as to extend along the length and across the width thereof, with a heating element being located in each pad beneath the temperature sensors. An expansion mechanism driven by a clamping motor provides expansion and retraction of the heater pads and expandable packer-type seals are provided along the probe above and below the heater pads.

  8. Surgical force detection probe

    NASA Technical Reports Server (NTRS)

    Tcheng, Ping; Roberts, Paul; Scott, Charles; Prass, Richard

    1991-01-01

    The development progress of a precision electro-mechanical instrument which allows the detection and documentation of the forces and moment applied to human tissue during surgery (under actual operation room conditions), is reported. The pen-shaped prototype probe which measures 1/2 inch in diameter and 7 inches in length was fabricated using an aerodynamic balance. The aerodynamic balance, a standard wind tunnel force and moment sensing transducer, measures the forces and the moments transmitted through the surgeon's hand to the human tissue during surgery. The prototype probe which was fabricated as a development tool was tested successfully. The final version of the surgical force detection probe will be designed based on additional laboratory tests in order to establish the full scale loads. It is expected that the final product will require a simplified aerodynamic balance with two or three force components and one moment component with lighter full scale loads. A signal conditioner was fabricated to process and display the outputs from the prototype probe. This unit will be interfaced with a PC-based data system to provide automatic data acquisition, data processing, and graphics display. The expected overall accuracy of the probe is better than one percent full scale.

  9. Distribution of Mosquitoes in the South East of Argentina and First Report on the Analysis Based on 18S rDNA and COI Sequences

    PubMed Central

    Díaz-Nieto, Leonardo M.; Maciá, Arnaldo; Parisi, Gustavo; Farina, Juan L.; Vidal-Domínguez, María E.; Perotti, M. Alejandra; Berón, Corina M.

    2013-01-01

    Although Mar del Plata is the most important city on the Atlantic coast of Argentina, mosquitoes inhabiting such area are almost uncharacterized. To increase our knowledge in their distribution, we sampled specimens of natural populations. After the morphological identification based on taxonomic keys, sequences of DNA from small ribosomal subunit (18S rDNA) and cytochrome c oxidase I (COI) genes were obtained from native species and the phylogenetic analysis of these sequences were done. Fourteen species from the genera Uranotaenia, Culex, Ochlerotatus and Psorophora were found and identified. Our 18S rDNA and COI-based analysis indicates the relationships among groups at the supra-species level in concordance with mosquito taxonomy. The introduction and spread of vectors and diseases carried by them are not known in Mar del Plata, but some of the species found in this study were reported as pathogen vectors. PMID:24098700

  10. 16S rDNA sequence analysis of bacterial isolates from biodeteriorated mural paintings in the Servilia tomb (Necropolis of carmona, Seville, Spain).

    PubMed

    Heyrman, J; Swings, J

    2001-11-01

    Bacteria were isolated from damaged mural paintings of the Servilia tomb (necropolis of Carmona, Seville, Spain). Selected strains, representative for different clusters of isolates with similar fatty acid profiles, were analysed by 16S rDNA sequence analysis. Bacillus is the dominant genus among the isolates: members of the rRNA species complexes of B. megaterium, B. pumilus and B. firmus were found as well as several other Bacillus species. One group of halotolerant isolates falls in the Bacillus sensu lato group, with closest relatedness to the genera Salibacillus and Virgibacillus. Other genera found are Artbrobacter, Micrococcus, Streptomyces, Sphingomonas, Paenibacillus, and a genus closely related to Paracraurococcus. Many isolates showed low 16S rDNA sequence similarities with the closest related database entries, a strong indication for the presence of several new species among the isolates. PMID:11822679

  11. [Investigation of bacterial diversity in the biological desulfurization reactor for treating high salinity wastewater by the 16S rDNA cloning method].

    PubMed

    Liu, Wei-Guo; Liang, Cun-Zhen; Yang, Jin-Sheng; Wang, Gui-Ping; Liu, Miao-Miao

    2013-02-01

    The bacterial diversity in the biological desulfurization reactor operated continuously for 1 year was studied by the 16S rDNA cloning and sequencing method. Forty clones were randomly selected and their partial 16S rDNA genes (ca. 1,400 bp) were sequenced and blasted. The results indicated that there were dominant bacterias in the biological desulfurization reactor, where 33 clones belonged to 3 different published phyla, while 1 clone belonged to unknown phylum. The dominant bacterial community in the system was Proteobacteria, which accounted for 85.3%. The bacterial community succession was as follows: the gamma-Proteobacteria(55.9%), beta-Proteobacteria(17.6%), Actinobacteridae (8.8%), delta-Proteobacteria (5.9%) , alpha-Proteobacteria(5.9%), and Sphingobacteria (2.9%). Halothiobacillus sp. ST15 and Thiobacillus sp. UAM-I were the major desulfurization strains. PMID:23668153

  12. Characterization of bacterial diversity in pulque, a traditional Mexican alcoholic fermented beverage, as determined by 16S rDNA analysis.

    PubMed

    Escalante, Adelfo; Rodríguez, María Elena; Martínez, Alfredo; López-Munguía, Agustín; Bolívar, Francisco; Gosset, Guillermo

    2004-06-15

    The bacterial diversity in pulque, a traditional Mexican alcoholic fermented beverage, was studied in 16S rDNA clone libraries from three pulque samples. Sequenced clones identified as Lactobacillus acidophilus, Lactobacillus strain ASF360, L. kefir, L. acetotolerans, L. hilgardii, L. plantarum, Leuconostoc pseudomesenteroides, Microbacterium arborescens, Flavobacterium johnsoniae, Acetobacter pomorium, Gluconobacter oxydans, and Hafnia alvei, were detected for the first time in pulque. Identity of 16S rDNA sequenced clones showed that bacterial diversity present among pulque samples is dominated by Lactobacillus species (80.97%). Seventy-eight clones exhibited less than 95% of relatedness to NCBI database sequences, which may indicate the presence of new species in pulque samples. PMID:15183874

  13. Inhibition of DNA Methylation Alters Chromatin Organization, Nuclear Positioning and Activity of 45S rDNA Loci in Cycling Cells of Q. robur

    PubMed Central

    Horvat, Tomislav; Maglica, Željka; Vojta, Aleksandar; Zoldoš, Vlatka

    2014-01-01

    Around 2200 copies of genes encoding ribosomal RNA (rRNA) in pedunculate oak, Quercus robur, are organized into two rDNA loci, the major (NOR-1) and the minor (NOR-2) locus. We present the first cytogenetic evidence indicating that the NOR-1 represents the active nucleolar organizer responsible for rRNA synthesis, while the NOR-2 probably stays transcriptionally silent and does not participate in the formation of the nucleolus in Q. robur, which is a situation resembling the well-known phenomenon of nucleolar dominance. rDNA chromatin topology analyses in cycling root tip cells by light and electron microscopy revealed the minor locus to be highly condensed and located away from the nucleolus, while the major locus was consistently associated with the nucleolus and often exhibited different levels of condensation. In addition, silver precipitation was confined exclusively to the NOR-1 locus. Also, NOR-2 was highly methylated at cytosines and rDNA chromatin was marked with histone modifications characteristic for repressive state. After treatment of the root cells with the methylation inhibitor 5-aza-2′-deoxycytidine, we observed an increase in the total level of rRNA transcripts and a decrease in DNA methylation level at the NOR-2 locus. Also, NOR-2 sites relocalized with respect to the nuclear periphery/nucleolus, however, the relocation did not affect the contribution of this locus to nucleolar formation, nor did it affect rDNA chromatin decondensation, strongly suggesting that NOR-2 has lost the function of rRNA synthesis and nucleolar organization. PMID:25093501

  14. Inhibition of DNA methylation alters chromatin organization, nuclear positioning and activity of 45S rDNA loci in cycling cells of Q. robur.

    PubMed

    Bočkor, Vedrana Vičić; Barišić, Darko; Horvat, Tomislav; Maglica, Željka; Vojta, Aleksandar; Zoldoš, Vlatka

    2014-01-01

    Around 2200 copies of genes encoding ribosomal RNA (rRNA) in pedunculate oak, Quercus robur, are organized into two rDNA loci, the major (NOR-1) and the minor (NOR-2) locus. We present the first cytogenetic evidence indicating that the NOR-1 represents the active nucleolar organizer responsible for rRNA synthesis, while the NOR-2 probably stays transcriptionally silent and does not participate in the formation of the nucleolus in Q. robur, which is a situation resembling the well-known phenomenon of nucleolar dominance. rDNA chromatin topology analyses in cycling root tip cells by light and electron microscopy revealed the minor locus to be highly condensed and located away from the nucleolus, while the major locus was consistently associated with the nucleolus and often exhibited different levels of condensation. In addition, silver precipitation was confined exclusively to the NOR-1 locus. Also, NOR-2 was highly methylated at cytosines and rDNA chromatin was marked with histone modifications characteristic for repressive state. After treatment of the root cells with the methylation inhibitor 5-aza-2'-deoxycytidine, we observed an increase in the total level of rRNA transcripts and a decrease in DNA methylation level at the NOR-2 locus. Also, NOR-2 sites relocalized with respect to the nuclear periphery/nucleolus, however, the relocation did not affect the contribution of this locus to nucleolar formation, nor did it affect rDNA chromatin decondensation, strongly suggesting that NOR-2 has lost the function of rRNA synthesis and nucleolar organization. PMID:25093501

  15. Pressure measuring probe

    NASA Technical Reports Server (NTRS)

    Ashby, George C., Jr. (Inventor)

    1988-01-01

    The invention is a probe for measuring changes in pressure in a high velocity fluid stream over and adjacent to the surface of an object. The probe is formed of an exterior housing having a closed pressure chamber in which a piezoelectric pressure transducer is mounted. An open connector tube having a probe tip passes a portion of the fluid stream into the closed pressure chamber; any change of pressure within, which requires a settling-time to appear in the closed pressure chamber, is inversely proportional to the cross-sectional area of the connector tube. A cooling chamber formed around the pressure chamber is connected to a source of cooling fluid by means of inlet and outlet tubes.

  16. Multispectral imaging probe

    SciTech Connect

    Sandison, David R.; Platzbecker, Mark R.; Descour, Michael R.; Armour, David L.; Craig, Marcus J.; Richards-Kortum, Rebecca

    1999-01-01

    A multispectral imaging probe delivers a range of wavelengths of excitation light to a target and collects a range of expressed light wavelengths. The multispectral imaging probe is adapted for mobile use and use in confined spaces, and is sealed against the effects of hostile environments. The multispectral imaging probe comprises a housing that defines a sealed volume that is substantially sealed from the surrounding environment. A beam splitting device mounts within the sealed volume. Excitation light is directed to the beam splitting device, which directs the excitation light to a target. Expressed light from the target reaches the beam splitting device along a path coaxial with the path traveled by the excitation light from the beam splitting device to the target. The beam splitting device directs expressed light to a collection subsystem for delivery to a detector.

  17. Multispectral imaging probe

    DOEpatents

    Sandison, D.R.; Platzbecker, M.R.; Descour, M.R.; Armour, D.L.; Craig, M.J.; Richards-Kortum, R.

    1999-07-27

    A multispectral imaging probe delivers a range of wavelengths of excitation light to a target and collects a range of expressed light wavelengths. The multispectral imaging probe is adapted for mobile use and use in confined spaces, and is sealed against the effects of hostile environments. The multispectral imaging probe comprises a housing that defines a sealed volume that is substantially sealed from the surrounding environment. A beam splitting device mounts within the sealed volume. Excitation light is directed to the beam splitting device, which directs the excitation light to a target. Expressed light from the target reaches the beam splitting device along a path coaxial with the path traveled by the excitation light from the beam splitting device to the target. The beam splitting device directs expressed light to a collection subsystem for delivery to a detector. 8 figs.

  18. The establishment of species-specific primers for the molecular identification of ten stored-product psocids based on ITS2 rDNA.

    PubMed

    Zhao, Zi-Hua; Cui, Bing-Yi; Li, Zhi-Hong; Jiang, Fan; Yang, Qian-Qian; Kučerová, Zuzana; Stejskal, Václav; Opit, George; Cao, Yang; Li, Fu-Jun

    2016-01-01

    Psocids are important stored product pests found worldwide that can be spread through grain trade. Most stored-product psocids, including eggs, nymphs, and adults, are very small (~1 mm) and difficult to identify morphologically. Here, we collected 10 economically important stored-product Liposcelis spp. psocids (L. bostrychophila, L. entomophila, L. decolor, L. paeta, L. brunnea, L. corrodens, L. mendax, L. rufa, L. pearmani, and L. tricolor) from 35 geographical locations in 5 countries (China, Czech Republic, Denmark, Germany, and the United States). The ITS2 rDNA gene was extracted and sequenced. The interspecific genetic distance of the stored-product psocids was significantly higher than the intraspecific genetic distance according to the barcoding gap analysis. Ten pairs of species-specific primers based on the ITS2 rDNA were developed for psocid identification. The sensitivity estimation indicated that the species-specific primers could correctly amplify the target ITS2 gene and successfully identify psocids at 1.0 ng/mL. Additionally, these species-specific primers could quantify specificity and identify 10 stored-product psocids; this approach could also be used to accurately identify other stored-product psocids. This work provides a practical approach for the precise examination of 10 stored-product psocid species and also contributes to the development of an identification method using ITS2 rDNA. PMID:26880378

  19. The establishment of species-specific primers for the molecular identification of ten stored-product psocids based on ITS2 rDNA

    PubMed Central

    Zhao, Zi-Hua; Cui, Bing-Yi; Li, Zhi-Hong; Jiang, Fan; Yang, Qian-Qian; Kučerová, Zuzana; Stejskal, Václav; Opit, George; Cao, Yang; Li, Fu-Jun

    2016-01-01

    Psocids are important stored product pests found worldwide that can be spread through grain trade. Most stored-product psocids, including eggs, nymphs, and adults, are very small (~1 mm) and difficult to identify morphologically. Here, we collected 10 economically important stored-product Liposcelis spp. psocids (L. bostrychophila, L. entomophila, L. decolor, L. paeta, L. brunnea, L. corrodens, L. mendax, L. rufa, L. pearmani, and L. tricolor) from 35 geographical locations in 5 countries (China, Czech Republic, Denmark, Germany, and the United States). The ITS2 rDNA gene was extracted and sequenced. The interspecific genetic distance of the stored-product psocids was significantly higher than the intraspecific genetic distance according to the barcoding gap analysis. Ten pairs of species-specific primers based on the ITS2 rDNA were developed for psocid identification. The sensitivity estimation indicated that the species-specific primers could correctly amplify the target ITS2 gene and successfully identify psocids at 1.0 ng/mL. Additionally, these species-specific primers could quantify specificity and identify 10 stored-product psocids; this approach could also be used to accurately identify other stored-product psocids. This work provides a practical approach for the precise examination of 10 stored-product psocid species and also contributes to the development of an identification method using ITS2 rDNA. PMID:26880378

  20. Performance of 16s rDNA Primer Pairs in the Study of Rhizosphere and Endosphere Bacterial Microbiomes in Metabarcoding Studies

    PubMed Central

    Beckers, Bram; Op De Beeck, Michiel; Thijs, Sofie; Truyens, Sascha; Weyens, Nele; Boerjan, Wout; Vangronsveld, Jaco

    2016-01-01

    Next-generation sequencing technologies have revolutionized the methods for studying microbial ecology by enabling high-resolution community profiling. However, the use of these technologies in unraveling the plant microbiome remains challenging. Many bacterial 16S rDNA primer pairs also exhibit high affinity for non-target DNA such as plastid (mostly chloroplast) DNA and mitochondrial DNA. Therefore, we experimentally tested a series of commonly used primers for the analysis of plant-associated bacterial communities using 454 pyrosequencing. We evaluated the performance of all selected primer pairs in the study of the bacterial microbiomes present in the rhizosphere soil, root, stem and leaf endosphere of field-grown poplar trees (Populus tremula × Populus alba) based on (a) co-amplification of non-target DNA, (b) low amplification efficiency for pure chloroplast DNA (real-time PCR), (c) high retrieval of bacterial 16S rDNA, (d) high operational taxonomic unit (OTU) richness and Inverse Simpson diversity and (e) taxonomic assignment of reads. Results indicate that experimental evaluation of primers provide valuable information that could contribute in the selection of suitable primer pairs for 16S rDNA metabarcoding studies in plant-microbiota research. Furthermore, we show that primer pair 799F-1391R outperforms all other primer pairs in our study in the elimination of non-target DNA and retrieval of bacterial OTUs. PMID:27242686

  1. Performance of 16s rDNA Primer Pairs in the Study of Rhizosphere and Endosphere Bacterial Microbiomes in Metabarcoding Studies.

    PubMed

    Beckers, Bram; Op De Beeck, Michiel; Thijs, Sofie; Truyens, Sascha; Weyens, Nele; Boerjan, Wout; Vangronsveld, Jaco

    2016-01-01

    Next-generation sequencing technologies have revolutionized the methods for studying microbial ecology by enabling high-resolution community profiling. However, the use of these technologies in unraveling the plant microbiome remains challenging. Many bacterial 16S rDNA primer pairs also exhibit high affinity for non-target DNA such as plastid (mostly chloroplast) DNA and mitochondrial DNA. Therefore, we experimentally tested a series of commonly used primers for the analysis of plant-associated bacterial communities using 454 pyrosequencing. We evaluated the performance of all selected primer pairs in the study of the bacterial microbiomes present in the rhizosphere soil, root, stem and leaf endosphere of field-grown poplar trees (Populus tremula × Populus alba) based on (a) co-amplification of non-target DNA, (b) low amplification efficiency for pure chloroplast DNA (real-time PCR), (c) high retrieval of bacterial 16S rDNA, (d) high operational taxonomic unit (OTU) richness and Inverse Simpson diversity and (e) taxonomic assignment of reads. Results indicate that experimental evaluation of primers provide valuable information that could contribute in the selection of suitable primer pairs for 16S rDNA metabarcoding studies in plant-microbiota research. Furthermore, we show that primer pair 799F-1391R outperforms all other primer pairs in our study in the elimination of non-target DNA and retrieval of bacterial OTUs. PMID:27242686

  2. Targeting of the human F8 at the multicopy rDNA locus in Hemophilia A patient-derived iPSCs using TALENickases.

    PubMed

    Pang, Jialun; Wu, Yong; Li, Zhuo; Hu, Zhiqing; Wang, Xiaolin; Hu, Xuyun; Wang, Xiaoyan; Liu, Xionghao; Zhou, Miaojin; Liu, Bo; Wang, Yanchi; Feng, Mai; Liang, Desheng

    2016-03-25

    Hemophilia A (HA) is a monogenic disease due to lack of the clotting factor VIII (FVIII). This deficiency may lead to spontaneous joint hemorrhages or life-threatening bleeding but there is no cure for HA until very recently. In this study, we derived induced pluripotent stem cells (iPSCs) from patients with severe HA and used transcription activator-like effector nickases (TALENickases) to target the factor VIII gene (F8) at the multicopy ribosomal DNA (rDNA) locus in HA-iPSCs, aiming to rescue the shortage of FVIII protein. The results revealed that more than one copy of the exogenous F8 could be integrated into the rDNA locus. Importantly, we detected exogenous F8 mRNA and FVIII protein in targeted HA-iPSCs. After they were differentiated into endothelial cells (ECs), the exogenous FVIII protein was still detectable. Thus, it is showed that the multicopy rDNA locus could be utilized as an effective target site in patient-derived iPSCs for gene therapy. This strategy provides a novel iPSCs-based therapeutic option for HA and other monogenic diseases. PMID:26921444

  3. Using the Multiple Analysis Approach to Reconstruct Phylogenetic Relationships among Planktonic Foraminifera from Highly Divergent and Length-polymorphic SSU rDNA Sequences

    PubMed Central

    Aurahs, Ralf; Göker, Markus; Grimm, Guido W.; Hemleben, Vera; Hemleben, Christoph; Schiebel, Ralf; Kučera, Michal

    2009-01-01

    The high sequence divergence within the small subunit ribosomal RNA gene (SSU rDNA) of foraminifera makes it difficult to establish the homology of individual nucleotides across taxa. Alignment-based approaches so far relied on time-consuming manual alignments and discarded up to 50% of the sequenced nucleotides prior to phylogenetic inference. Here, we investigate the potential of the multiple analysis approach to infer a molecular phylogeny of all modern planktonic foraminiferal taxa by using a matrix of 146 new and 153 previously published SSU rDNA sequences. Our multiple analysis approach is based on eleven different automated alignments, analysed separately under the maximum likelihood criterion. The high degree of congruence between the phylogenies derived from our novel approach, traditional manually homologized culled alignments and the fossil record indicates that poorly resolved nucleotide homology does not represent the most significant obstacle when exploring the phylogenetic structure of the SSU rDNA in planktonic foraminifera. We show that approaches designed to extract phylogenetically valuable signals from complete sequences show more promise to resolve the backbone of the planktonic foraminifer tree than attempts to establish strictly homologous base calls in a manual alignment. PMID:20140067

  4. Reconstructing the Phylogeny of Capsosiphon fulvescens (Ulotrichales, Chlorophyta) from Korea Based on rbcL and 18S rDNA Sequences

    PubMed Central

    Sun, Sang-Mi; Yang, Seung Hwan

    2016-01-01

    Capsosiphon fulvescens is a filamentous green algae in the class Ulvophyceae. It has been consumed as food with unique flavor and soft texture to treat stomach disorders and hangovers, and its economic value justifies studying its nutritional and potential therapeutic effects. In contrast to these applications, only a few taxonomic studies have been conducted on C. fulvescens. In particular, classification and phylogenetic relationships of the C. fulvescens below the order level are controversial. To determine its phylogenetic position in the class, we used rbcL and 18S rDNA sequences as molecular markers to construct phylogenetic trees. The amplified rbcL and 18S rDNA sequences from 4 C. fulvescens isolates (Jindo, Jangheung, Wando, and Koheung, Korea) were used for phylogenetic analysis by employing three different phylogenetic methods: neighbor joining (NJ), maximum parsimony (MP), and maximum likelihood (ML). The rbcL phylogenetic tree showed that all taxa in the order Ulvales were clustered as a monophyletic group and resolved the phylogenetic position of C. fulvescens in the order Ulotrichales. The significance of our study is that the 18S rDNA phylogenetic tree shows the detailed taxonomic position of C. fulvescens. In our result, C. fulvescens is inferred as a member of Ulotrichaceae, along with Urospora and Acrosiphonia. PMID:27190985

  5. Molecular systematic of three species of Oithona (Copepoda, Cyclopoida) from the Atlantic Ocean: comparative analysis using 28S rDNA.

    PubMed

    Cepeda, Georgina D; Blanco-Bercial, Leocadio; Bucklin, Ann; Berón, Corina M; Viñas, María D

    2012-01-01

    Species of Oithona (Copepoda, Cyclopoida) are highly abundant, ecologically important, and widely distributed throughout the world oceans. Although there are valid and detailed descriptions of the species, routine species identifications remain challenging due to their small size, subtle morphological diagnostic traits, and the description of geographic forms or varieties. This study examined three species of Oithona (O. similis, O. atlantica and O. nana) occurring in the Argentine sector of the South Atlantic Ocean based on DNA sequence variation of a 575 base-pair region of 28S rDNA, with comparative analysis of these species from other North and South Atlantic regions. DNA sequence variation clearly resolved and discriminated the species, and revealed low levels of intraspecific variation among North and South Atlantic populations of each species. The 28S rDNA region was thus shown to provide an accurate and reliable means of identifying the species throughout the sampled domain. Analysis of 28S rDNA variation for additional species collected throughout the global ocean will be useful to accurately characterize biogeographical distributions of the species and to examine phylogenetic relationships among them. PMID:22558245

  6. Phylogeny of coral-inhabiting barnacles (Cirripedia; Thoracica; Pyrgomatidae) based on 12S, 16S and 18S rDNA analysis.

    PubMed

    Simon-Blecher, N; Huchon, D; Achituv, Y

    2007-09-01

    The traditional phylogeny of the coral-inhabiting barnacles, the Pyrgomatidae, is based on morphological characteristics, mainly of the hard parts. It has been difficult to establish the phylogenetic relationships among Pyrgomatidae because of the apparent convergence of morphological characteristics, and due to the use of non-cladistic systematics, which emphasize ancestor-descendant relationships rather than sister-clade relationships. We used partial sequences of two mithochondrial genes, 12S rDNA and 16S rDNA, and a nuclear gene, 18S rDNA, to infer the molecular phylogeny of the pyrgomatids. Our phylogenetic results allowed us to reject previous classifications of Pyrgomatidae based on morphological characteristics. Our results also suggested the possibility of paraphyly of the Pyrgomatidae. The hydrocoral barnacle Wanella is not found on the same clade as the other pyrgomatids, but rather, with the free-living balanids. The basal position of Megatrema and Ceratoconcha is supported. The archeaobalanid Armatobalanus is grouped with Cantellius at the base of the Indo-Pacific pyrgomatines. Fusion of the shell plate and modification of the opercular valves are homoplasious features that occurred more than three times on different clades. The monophyly of the "Savignium" group, comprising four nominal genera, is also not supported, and the different taxa are placed on different clades. PMID:17560131

  7. Pioneer III Probe

    NASA Technical Reports Server (NTRS)

    1961-01-01

    Looking more like surgeons, these technicians wearing 'cleanroom' attire inspect the Pioneer III probe before shipping it to Cape Canaveral, Florida. Pioneer III was launched on December 6, 1958 aboard a Juno II rocket at the Atlantic Missile Range, Cape Canaveral, Florida. The mission objectives were to measure the radiation intensity of the Van Allen radiation belt, test long range communication systems, the launch vehicle and other subsystems. The Juno II failed to reach proper orbital escape velocity. The probe re-entered the Earth's atmosphere on December 7th ending its brief mission.

  8. Arbuscular mycorrhizal infection changes the bacterial 16 S rDNA community composition in the rhizosphere of maize.

    PubMed

    Marschner, P; Crowley, D; Lieberei, R

    2001-12-01

    Mycorrhizal and non-mycorrhizal (NM) maize plants were grown for 4 or 7 weeks in an autoclaved quartz sand-soil mix. Half of the NM plants were supplied with soluble P (NM-HP) while the other half (NM-LP), like the mycorrhizal plants, received poorly soluble Fe and Al phosphate. The mycorrhizal plants were inoculated with Glomus mosseae or G. intraradices. Soil bacteria and those associated with the mycorrhizal inoculum were reintroduced by adding a filtrate of a low P soil and of the inocula. At 4 and 7 weeks, plants were harvested and root samples were taken from the root tip (0-1 cm), the subapical zone (1-2 cm) and the mature root zone at the site of lateral root emergence. DNA was extracted from the roots with adhering soil. At both harvests, the NM-HP plants had higher shoot dry weight than the plants grown on poorly soluble P. Mycorrhizal infection of both fungi ranged between 78% and 93% and had no effect on shoot growth or shoot P content. Eubacterial community compositions were examined by polymerase chain reaction-denaturing gradient gel electrophoresis of 16 S rDNA, digitisation of the band patterns and multivariate analysis. The community composition changed with time and was root zone specific. The differences in bacterial community composition in the rhizosphere between the NM plants and the mycorrhizal plants were greater at 7 than at 4 weeks. The two fungi had similar bacterial communities after 4 weeks, but these differed after 7 weeks. The observed differences are probably due to changes in substrate composition and amount in the rhizosphere. PMID:24549350

  9. Phylogenetic relationships of Brazilian isolates of Pythium insidiosum based on ITS rDNA and cytochrome oxidase II gene sequences.

    PubMed

    Azevedo, M I; Botton, S A; Pereira, D I B; Robe, L J; Jesus, F P K; Mahl, C D; Costa, M M; Alves, S H; Santurio, J M

    2012-09-14

    Pythium insidiosum is an aquatic oomycete that is the causative agent of pythiosis. Advances in molecular methods have enabled increased accuracy in the diagnosis of pythiosis, and in studies of the phylogenetic relationships of this oomycete. To evaluate the phylogenetic relationships among isolates of P. insidiosum from different regions of Brazil, and also regarding to other American and Thai isolates, in this study a total of thirty isolates of P. insidiosum from different regions of Brazil was used and had their ITS1, 5.8S rRNA and ITS2 rDNA (ITS) region and the partial sequence of cytochrome oxidase II (COX II) gene sequenced and analyzed. The outgroup consisted of six isolates of other Pythium species and one of Lagenidium giganteum. Phylogenetic analyses of ITS and COX II genes were conducted, both individually and in combination, using four different methods: Maximum parsimony (MP); Neighbor-joining (NJ); Maximum likelihood (ML); and Bayesian analysis (BA). Our data supported P. insidiosum as monophyletic in relation to the other Pythium species, and COX II showed that P. insidiosum appears to be subdivided into three major polytomous groups, whose arrangement provides the Thai isolates as paraphyletic in relation to the Brazilian ones. The molecular analyses performed in this study suggest an evolutionary proximity among all American isolates, including the Brazilian and the Central and North America isolates, which were grouped together in a single entirely polytomous clade. The COX II network results presented signals of a recent expansion for the American isolates, probably originated from an Asian invasion source. Here, COX II showed higher levels bias, although it was the source of higher levels of phylogenetic information when compared to ITS. Nevertheless, the two markers chosen for this study proved to be entirely congruent, at least with respect to phylogenetic relationships between different isolates of P. insidiosum. PMID:22483240

  10. Phylogeny of the eelpout genus Lycodes (Pisces, Zoarcidae) as inferred from mitochondrial cytochrome b and 12S rDNA.

    PubMed

    Møller, Peter R; Gravlund, Peter

    2003-03-01

    The bottom-dwelling and species-rich eelpout genus Lycodes Reinhardt has a great potential for the study of Arctic marine speciation. Subdivision of the genus has been based on single or few morphological characters (e.g., lateral line configuration) with contradicting results and phylogenetic approaches have not been attended. Here we present the first phylogenetic analysis of the genus employing DNA sequences of the mitochondrial genes cytochrome b and 12S rDNA (714 bp). The analysis with the two genes combined resulted in two equally parsimonious trees. In both cladograms most of the previously suggested subgroups are para- or polyphyletic, except for the so-called short-tailed Lycodes spp., with a short tail, a single mediolateral lateral line configuration and a shallow or filled otolith sulcus. The group of long-tailed Lycodes spp., with ventral or ventro-medio-lateral types of lateral line configuration and a deep otolith sulcus, appears to be paraphyletic, since Pacific and Atlantic species in this group are not each other's closest relatives. Thus, the short-tailed species are placed in a derived clade, indicating a secondary shortening of the tail, and a "slope to shore" type of evolution. This is not in accordance with earlier assumptions of the more elongate, deeper living species being the more derived. The basal position of long-tailed Pacific species supports earlier theories of Pacific origin of the genus/family. Small genetic differences between Arctic/Atlantic species indicate a rather recent radiation in these areas after the opening of the Bering Strait 3.0-3.5 million years ago. PMID:12644398

  11. Identification of species in tribe Brassiceae by dot-blot hybridization using species-specific ITS1 probes.

    PubMed

    Tonosaki, K; Nishio, Takeshi

    2010-10-01

    Simple, reliable methods for identification of species are required for management of many species and lines in a plant gene bank. Species-specific probes were designed from published sequences of the ITS1 region in rDNA of 16 species in Brassica and its related genera, and used as probes for dot-blot hybridization with plant genomic DNA. All the probes detected species-specific signals at dot-blots of genomic DNAs of the 16 species in Brassica, Diplotaxis, Eruca, and Raphanus. Signals of the Brassica digenomic species in the U's triangle, i.e., B. napus, B. juncea, and B. carinata, were detected by the probes of their parental monogenomic species, i.e., B. rapa, B. nigra, and B. oleracea. The probe for B. oleracea showed signals of B. balearica, B. cretica, B. incana, B. insularis, and B. macrocarpa, which have the C genome as B. oleracea. Eruca vesicaria DNA was detected by the probe for E. sativa, which has been classified as a subspecies of E. vescaria. DNA of leaf tissue extracted by an alkaline solution and seed DNA prepared by the NaI method can be used directly for dot-blotting. Misidentification of species was revealed in 20 accessions in the Tohoku University Brassica Seed Bank. These results indicate dot-blot hybridization to be a simple and efficient technique for identification of plant species in a gene bank. PMID:20683723

  12. Cervical Neoplasia Probe Control

    1997-01-24

    This software, which consists of a main executive and several subroutines, performs control of the optics, image acquisition, and Digital Signal Processing (DSP) of this image, of an optical based medical instrument that performs fluoresence detection of precancerous lesions (neoplasia) of the human cervix. The hardware portion of this medical instrument is known by the same name Cervical Neoplasia Probe (CNP)

  13. Endocavity Ultrasound Probe Manipulators.

    PubMed

    Stoianovici, Dan; Kim, Chunwoo; Schäfer, Felix; Huang, Chien-Ming; Zuo, Yihe; Petrisor, Doru; Han, Misop

    2013-06-01

    We developed two similar structure manipulators for medical endocavity ultrasound probes with 3 and 4 degrees of freedom (DoF). These robots allow scanning with ultrasound for 3-D imaging and enable robot-assisted image-guided procedures. Both robots use remote center of motion kinematics, characteristic of medical robots. The 4-DoF robot provides unrestricted manipulation of the endocavity probe. With the 3-DoF robot the insertion motion of the probe must be adjusted manually, but the device is simpler and may also be used to manipulate external-body probes. The robots enabled a novel surgical approach of using intraoperative image-based navigation during robot-assisted laparoscopic prostatectomy (RALP), performed with concurrent use of two robotic systems (Tandem, T-RALP). Thus far, a clinical trial for evaluation of safety and feasibility has been performed successfully on 46 patients. This paper describes the architecture and design of the robots, the two prototypes, control features related to safety, preclinical experiments, and the T-RALP procedure. PMID:24795525

  14. Ultrasonic search wheel probe

    DOEpatents

    Mikesell, Charles R.

    1978-01-01

    A device is provided for reducing internal reflections from the tire of an ultrasonic search wheel probe or from within the material being examined. The device includes a liner with an anechoic chamber within which is an ultrasonic transducer. The liner is positioned within the wheel and includes an aperture through which the ultrasonic sound from the transducer is directed.

  15. The Phoenix Pluto Probe

    NASA Technical Reports Server (NTRS)

    Gunning, George R.; Spapperi, Jeff; Wilkinson, Jeffrey P.; Eldred, Jim; Labij, Dennis; Strinni, Meredith

    1990-01-01

    A design proposal for an unmanned probe to Pluto is presented. The topics covered include: (1) scientific instrumentation; (2) mission management, planning, and costing; (3) power and propulsion system; (4) structural subsystem; (5) command, control, and communication; and (6) attitude and articulation control.

  16. Laboratory plasma probe studies

    NASA Technical Reports Server (NTRS)

    Heikkila, W. J.

    1975-01-01

    Diagnostic experiments performed in a collisionless plasma using CO2 as the working gas are described. In particular, simultaneous measurements that have been performed by means of Langmuir- and RF-probes are presented. A resonance occurring above the parallel resonance in the frequency characteristic of a two electrode system is interpreted as being due to the resonant excitation of electroacoustic waves.

  17. Probing the Solar System

    ERIC Educational Resources Information Center

    Wilkinson, John

    2013-01-01

    Humans have always had the vision to one day live on other planets. This vision existed even before the first person was put into orbit. Since the early space missions of putting humans into orbit around Earth, many advances have been made in space technology. We have now sent many space probes deep into the Solar system to explore the planets and…

  18. Experimenting with Temperature Probes.

    ERIC Educational Resources Information Center

    Roth, Wolff-Michael

    1989-01-01

    Presented are four activities which are designed to familiarize children with the multiple uses of computers and help them learn about heat and temperature using temperature probes. Included are the tempering effect of water, heat capacity, caloric content of foods, and weather. Hardware and software are discussed. (CW)

  19. Endocavity Ultrasound Probe Manipulators

    PubMed Central

    Stoianovici, Dan; Kim, Chunwoo; Schäfer, Felix; Huang, Chien-Ming; Zuo, Yihe; Petrisor, Doru; Han, Misop

    2014-01-01

    We developed two similar structure manipulators for medical endocavity ultrasound probes with 3 and 4 degrees of freedom (DoF). These robots allow scanning with ultrasound for 3-D imaging and enable robot-assisted image-guided procedures. Both robots use remote center of motion kinematics, characteristic of medical robots. The 4-DoF robot provides unrestricted manipulation of the endocavity probe. With the 3-DoF robot the insertion motion of the probe must be adjusted manually, but the device is simpler and may also be used to manipulate external-body probes. The robots enabled a novel surgical approach of using intraoperative image-based navigation during robot-assisted laparoscopic prostatectomy (RALP), performed with concurrent use of two robotic systems (Tandem, T-RALP). Thus far, a clinical trial for evaluation of safety and feasibility has been performed successfully on 46 patients. This paper describes the architecture and design of the robots, the two prototypes, control features related to safety, preclinical experiments, and the T-RALP procedure. PMID:24795525

  20. 18S rDNA analysis of alkenone-producing haptophyte(s) preserved in surface sediments of Lake Toyoni, Japan

    NASA Astrophysics Data System (ADS)

    McColl, J. L.; Couto, J.; Bendle, J. A.; Henderson, A. C.; Seki, O.; Phoenix, V. R.; Toney, J. L.

    2013-12-01

    Alkenones (long chain ketones) are readily preserved in sedimentary archives and have the potential to provide quantitative reconstructions of past water temperature. Alkenones are produced by a limited number of haptophyte algae in the marine and also some lacustrine systems. However, lakes are heterogeneous: an individual lake will have a unique combination of ecological conditions, haptophyte species and seasonal alkenone production that contributes to the sedimentary record. Haptophyte algae species have different sensitivities to temperature; therefore identifying the alkenone producer(s) prior to down-core temperature reconstructions is critical before selecting the most appropriate temperature calibration. We present a study from Lake Toyoni, a freshwater lake in Hokkaido, Japan that has alkenones preserved in surface sediments. The aim of this study is to identify the alkenone producer(s) within the lake using 18S rDNA analyses. Preserved rDNA of planktonic phototrophic algae was extracted from surface sediments of Lake Toyoni and phylogenetic analyses of the rDNA sequences suggest alkenones are produced by a single haptophyte within the class Prymnesiophyceae (order Isochrysidales). The Lake Toyoni alkenone-producer shares a distinct phylotype with a haptophyte reported from water filter samples collected in Lake BrayaSø, Greenland (D'Andrea et al., 2006). Similarity between the 18S rDNA sequences from Lake Toyoni and Lake BrayaSø provides a basis for applying (and updating) the Greenland lake temperature calibration. Applying this temperature calibration (T°C = 40.8 [UK37] + 31.8, R2=0.96; n=34) to the surface sediment alkenone unsaturation index from Lake Toyoni gives an estimated lake surface temperature (LST) of 8°C. This is in line with observed LST at Lake Toyoni, which ranges between 7 - 22°C (Apr 2011 to Nov 2011). The occurrence and identification of a single alkenone producer in Lake Toyoni means problems posed by a mixture of haptophytes in

  1. [Analysis of DNA homology and 16S rDNA sequence of rhizobia, a new phenotypic subgroup, isolated from Xizang Autonomous Region of China].

    PubMed

    Wang, Su-ying; Yang, Xiao-li; Li, Hai-feng; Liu, Jie

    2006-02-01

    Based on the studies of numerical taxonomy, the seven rhizobial strains isolated from the root nodules of leguminous plants Trigonella spp. and Astragalus spp. growing in the Xizang Autonomous Region of China constituted a new phenotypic subgroup, where wide phenotypic and genotypic diversity among legume crops had been reported due to complex terrain and various climate. The new phenotypic subgroup were further identified to clarify its taxonomic position by DNA homology analysis and 16S rDNA gene sequencing. The mol% G + C ratio of the DNA among members of the new subgroup ranged from 59.5 to 63.3 mol% as determined by T (m) assay. The levels of DNA relatedness, determined by using the DNA liquid hybridization method, among the members of the new subgroup were between 74.3% and 92.3%, while level of DNA relatedness between the central strains XZ2-3 of the new subgroup and the type strains of known species of Rhizobium was less than 47.4%. These results indicated that the new phenotypic subgroup is a DNA homological group different from described species of Rhizobium. Therefore, this new phenotypic subgroup was supposed to be a new species in the genus of Rhizobium since the strains in the same species generally exhibit levels of DNA homology ranging from 70 to 100%. A systematic identification method-16S rDNA gene sequence comparison was carried out to determine the phylogenetic relationships of the new subgroup with the described species of Rhizobium. The GenBank accession number for the 16S rDNA sequence of the central strain XZ2-3 of the new subgroup is DQ099745. The full-length 16S rDNA gene sequence were sequenced by chain terminator techniques and analyzed with PHYLIP. The phylogenetic trees were constructed by using the programs DRAWTREE. The phylogenetic analysis indicated that new subgroup occupy a independent sub-branch in phylogenetic tree. The sequence similarities between the center strain XZ2-3 and the closest relatives, strain R. leguminosarum USDA

  2. A Real-Time PCR Assay Based on 5.8S rRNA Gene (5.8S rDNA) for Rapid Detection of Candida from Whole Blood Samples.

    PubMed

    Guo, Yi; Yang, Jing-Xian; Liang, Guo-Wei

    2016-06-01

    The prevalence of Candida in bloodstream infections (BSIs) has increased. To date, the identification of Candida in BSIs still mainly relies on blood culture and serological tests, but they have various limitations. Therefore, a real-time PCR assay for the detection of Candida from whole blood is presented. The unique primers/probe system was designed on 5.8S rRNA gene (5.8S rDNA) of Candida genus. The analytical sensitivity was determined by numbers of positive PCRs in 12 repetitions. At the concentration of 10(1) CFU/ml blood, positive PCR rates of 100 % were obtained for C. albicans, C. parapsilosis, C. tropicalis, and C. krusei. The detection rate for C. glabrata was 75 % at 10(1) CFU/ml blood. The reaction specificity was 100 % when evaluating the assay using DNA samples from clinical isolates and human blood. The maximum CVs of intra-assay and inter-assay for the detection limit were 1.22 and 2.22 %, respectively. To assess the clinical applicability, 328 blood samples from 82 patients were prospectively tested and real-time PCR results were compared with results from blood culture. Diagnostic sensitivity of the PCR was 100 % using as gold standard blood culture, and specificity was 98.4 %. Our data suggest that the developed assay can be used in clinical laboratories as an accurate and rapid screening test for the Candida from whole blood. Although further evaluation is warranted, our assay holds promise for earlier diagnosis of candidemia. PMID:26687075

  3. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S

    1984-06-25

    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  4. The 9S RNA precursor of Escherichia coli 5S RNA has three structural domains: implications for processing.

    PubMed Central

    Christiansen, J

    1988-01-01

    The secondary structure of the 9S RNA precursor to ribosomal 5S RNA in Escherichia coli has been determined using chemical reagents and ribonucleases in combination with a reverse transcription procedure. The 9S RNA precursor was generated in vitro by T7 RNA polymerase, and the rrnB operon terminator, T1, was able to terminate the in vitro transcript. The secondary structure model exhibits three structural domains corresponding to a 5' region, a mature region and a terminator region. The mature domain is structurally identical to 5S RNA, and the ribosomal proteins L18 and L25 are able to bind to the precursor. The processing endoribonuclease RNase E cleaves between the structural domains. Moreover, an intramolecular refolding of the nascent transcript must take place if the current view of RNase III processing stems is correct. Images PMID:3045757

  5. Mechanosensitive membrane probes.

    PubMed

    Dal Molin, Marta; Verolet, Quentin; Soleimanpour, Saeideh; Matile, Stefan

    2015-04-13

    This article assembles pertinent insights behind the concept of planarizable push-pull probes. As a response to the planarization of their polarized ground state, a red shift of their excitation maximum is expected to report on either the disorder, the tension, or the potential of biomembranes. The combination of chromophore planarization and polarization contributes to various, usually more complex processes in nature. Examples include the color change of crabs or lobsters during cooking or the chemistry of vision, particularly color vision. The summary of lessons from nature is followed by an overview of mechanosensitive organic materials. Although often twisted and sometimes also polarized, their change of color under pressure usually originates from changes in their crystal packing. Intriguing exceptions include the planarization of several elegantly twisted phenylethynyl oligomers and polymers. Also mechanosensitive probes in plastics usually respond to stretching by disassembly. True ground-state planarization in response to molecular recognition is best exemplified with the binding of thoughtfully twisted cationic polythiophenes to single- and double-stranded oligonucleotides. Molecular rotors, en vogue as viscosity sensors in cells, operate by deplanarization of the first excited state. Pertinent recent examples are described, focusing on λ-ratiometry and intracellular targeting. Complementary to planarization of the ground state with twisted push-pull probes, molecular rotors report on environmental changes with quenching or shifts in emission rather than absorption. The labeling of mechanosensitive channels is discussed as a bioengineering approach to bypass the challenge to create molecular mechanosensitivity and use biological systems instead to sense membrane tension. With planarizable push-pull probes, this challenge is met not with twistome screening, but with "fluorescent flippers," a new concept to insert large and bright monomers into oligomeric

  6. Theoretical study on the adsorption of carbon dioxide on individual and alkali-metal doped MOF-5s

    NASA Astrophysics Data System (ADS)

    Ha, Nguyen Thi Thu; Lefedova, O. V.; Ha, Nguyen Ngoc

    2016-01-01

    Density functional theory (DFT) calculations were performed to investigate the adsorption of carbon dioxide (CO2) on metal-organic framework (MOF-5) and alkali-metal (Li, K, Na) doped MOF-5s. The adsorption energy calculation showed that metal atom adsorption is exothermic in MOF-5 system. Moreover, alkali-metal doping can significantly improve the adsorption ability of carbon dioxide on MOF-5. The best influence is observed for Li-doping.

  7. Foraminoplastic transfacet epidural endoscopic approach for removal of intraforaminal disc herniation at the L5-S1 level

    PubMed Central

    Kaczmarczyk, Jacek; Nowakowski, Andrzej; Sulewski, Adam

    2014-01-01

    Transforaminal endoscopic disc removal in the L5-S1 motion segment of the lumbar spine creates a technical challenge due to anatomical reasons and individual variability. The majority of surgeons prefer a posterior classical or minimally invasive approach. There is only one foraminoplastic modification of the technique in the literature so far. In this paper we present a new technique with a foraminoplastic transfacet approach that may be suitable in older patients with advanced degenerative disease of the spine. PMID:24729817

  8. A Tale of Two Lines: Searching for the 5s - 5p Resonance Lines in Pm-like Ion Spectra

    SciTech Connect

    Trabert, E; Vilkas, M J; Ishikawa, Y

    2008-10-24

    Highly charged ions in the promethium sequence have been suggested to show spectral features resembling the alkali sequence ions. Guided by calculations, the 5s-5p resonance lines have been sought in a variety of experiments. In the light of the most extensive calculations of Pm-like ions yet, applying relativistic multi-reference Moeller-Plesset second-order perturbation theory, the experimental evidence is reviewed and the line identification problem assessed.

  9. Describing a new syndrome in L5-S1 disc herniation: Sexual and sphincter dysfunction without pain and muscle weakness

    PubMed Central

    Akca, Nezih; Ozdemir, Bulent; Kanat, Ayhan; Batcik, Osman Ersagun; Yazar, Ugur; Zorba, Orhan Unal

    2014-01-01

    Context: Little seems to be known about the sexual dysfunction (SD) in lumbar intervertebral disc herniation. Aims: Investigation of sexual and sphincter dysfunction in patient with lumbar disc hernitions. Settings and Design: A retrospective analysis. Materials and Methods: Sexual and sphincter dysfunction in patients admitted with lumbar disc herniations between September 2012-March 2014. Statistical Analysis Used: Statistical analysis was performed using the Predictive Analytics SoftWare (PASW) Statistics 18.0 for Windows (Statistical Package for the Social Sciences, SPSS Inc., Chicago, Illinois). The statistical significance was set at P < 0.05. The Wilcoxon signed ranks test was used to evaluate the difference between patients. Results: Four patients with sexual and sphincter dysfunction were found, including two women and two men, aged between 20 and 52 years. All of them admitted without low back pain. In addition, on neurological examination, reflex and motor deficit were not found. However, almost all patients had perianal sensory deficit and sexual and sphincter dysfunction. Magnetic resonance imaging (MRI) of three patients displayed a large extruded disc fragment at L5-S1 level on the left side. In fourth patient, there were not prominent disc herniations. There was not statistically significant difference between pre-operative and post-operative sexual function, anal-urethral sphincter function, and perianal sensation score. A syndrome in L5-S1 disc herniation with sexual and sphincter dysfunction without pain and muscle weakness was noted. We think that it is crucial for neurosurgeons to early realise that paralysis of the sphincter and sexual dysfunction are possible in patients with lumbar L5-S1 disc disease. Conclusion: A syndrome with perianal sensory deficit, paralysis of the sphincter, and sexual dysfunction may occur in patients with lumbar L5-S1 disc disease. The improvement of perianal sensory deficit after surgery was counteracted by a trend

  10. The importance of ribosome production, and the 5S RNP–MDM2 pathway, in health and disease

    PubMed Central

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J.

    2016-01-01

    Ribosomes are abundant, large RNA–protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  11. Minimally Invasive Transforaminal Lumbar Interbody Fusion at L5-S1 through a Unilateral Approach: Technical Feasibility and Outcomes

    PubMed Central

    Choi, Won-Suh; Kim, Jin-Sung; Ryu, Kyeong-Sik; Hur, Jung-Woo; Seong, Ji-Hoon

    2016-01-01

    Background. Minimally invasive spinal transforaminal lumbar interbody fusion (MIS-TLIF) at L5-S1 is technically more demanding than it is at other levels because of the anatomical and biomechanical traits. Objective. To determine the clinical and radiological outcomes of MIS-TLIF for treatment of single-level spinal stenosis low-grade isthmic or degenerative spondylolisthesis at L5-S1. Methods. Radiological data and electronic medical records of patients who underwent MIS-TLIF between May 2012 and December 2014 were reviewed. Fusion rate, cage position, disc height (DH), disc angle (DA), disc slope angle, segmental lordotic angle (SLA), lumbar lordotic angle (LLA), and pelvic parameters were assessed. For functional assessment, the visual analogue scale (VAS), Oswestry disability index (ODI), and patient satisfaction rate (PSR) were utilized. Results. A total of 21 levels in 21 patients were studied. DH, DA, SLA, and LLA had increased from their preoperative measures at the final follow-up. Fusion rate was 86.7% (18/21) at 12 months' follow-up. The most common cage position was anteromedial (15/21). The mean VAS scores for back and leg pain mean ODI scores improved significantly at the final follow-up. PSR was 88%. Cage subsidence was observed in 33.3% (7/21). Conclusions. The clinical and radiologic outcomes after MIS-TLIF at L5-S1 in patients with spinal stenosis or spondylolisthesis are generally favorable. PMID:27433472

  12. Erythromycin and 5S rRNA binding properties of the spinach chloroplast ribosomal protein CL22.

    PubMed Central

    Carol, P; Rozier, C; Lazaro, E; Ballesta, J P; Mache, R

    1993-01-01

    The spinach chloroplast ribosomal protein (r-protein) CL22 contains a central region homologous to the Escherichia coli r-protein L22 plus long N- and C-terminal extensions. We show in this study that the CL22 combines two properties which in E. coli ribosome are split between two separate proteins. The CL22 which binds to the 5S rRNA can also be linked to an erythromycin derivative added to the 50S ribosomal subunit. This latter property is similar to that of the E. coli L22 and suggests a similar localization in the 50S subunit. We have overproduced the r-protein CL22 and deleted forms of this protein in E. coli. We show that the overproduced CL22 binds to the chloroplast 5S rRNA and that the deleted protein containing the N- and C-terminal extensions only has lost the 5S rRNA binding property. We suggest that the central homologous regions of the CL22 contains the RNA binding domain. Images PMID:8441674

  13. The importance of ribosome production, and the 5S RNP-MDM2 pathway, in health and disease.

    PubMed

    Pelava, Andria; Schneider, Claudia; Watkins, Nicholas J

    2016-08-15

    Ribosomes are abundant, large RNA-protein complexes that are the source of all protein synthesis in the cell. The production of ribosomes is an extremely energetically expensive cellular process that has long been linked to human health and disease. More recently, it has been shown that ribosome biogenesis is intimately linked to multiple cellular signalling pathways and that defects in ribosome production can lead to a wide variety of human diseases. Furthermore, changes in ribosome production in response to nutrient levels in the diet lead to metabolic re-programming of the liver. Reduced or abnormal ribosome production in response to cellular stress or mutations in genes encoding factors critical for ribosome biogenesis causes the activation of the tumour suppressor p53, which leads to re-programming of cellular transcription. The ribosomal assembly intermediate 5S RNP (ribonucleoprotein particle), containing RPL5, RPL11 and the 5S rRNA, accumulates when ribosome biogenesis is blocked. The excess 5S RNP binds to murine double minute 2 (MDM2), the main p53-suppressor in the cell, inhibiting its function and leading to p53 activation. Here, we discuss the involvement of ribosome biogenesis in the homoeostasis of p53 in the cell and in human health and disease. PMID:27528756

  14. Temporal and tissue specific gene expression patterns of the zebrafish kinesin-1 heavy chain family, kif5s, during development

    PubMed Central

    Campbell, Philip D.; Marlow, Florence L.

    2013-01-01

    Homo- and heterodimers of Kif5 proteins form the motor domain of Kinesin-1, a major plus-end directed microtubule motor. Kif5s have been implicated in the intracellular transport of organelles, vesicles, proteins, and RNAs in many cell types. There are three mammalian KIF5s. KIF5A and KIF5C proteins are strictly neural in mouse whereas, KIF5B is ubiquitously expressed. Mouse knockouts indicate crucial roles for KIF5 in development and human mutations in KIF5A lead to the neurodegenerative disease Hereditary Spastic Paraplegia. However, the developmental functions and the extent to which individual kif5 functions overlap have not been elucidated. Zebrafish possess five kif5 genes: kif5Aa, kif5Ab, kif5Ba, kif5Bb, and kif5C. Here we report their tissue specific expression patterns in embryonic and larval stages. Specifically, we find that kif5As are strictly zygotic and exhibit neural-specific expression. In contrast, kif5Bs exhibit strong maternal contribution and are ubiquitously expressed. Lastly, kif5C exhibits weak maternal expression followed by enrichment in neural populations. In addition, kif5s show distinct expression domains in the larval retina. PMID:23684767

  15. EDITORIAL: Probing the nanoworld Probing the nanoworld

    NASA Astrophysics Data System (ADS)

    Miles, Mervyn

    2009-10-01

    In nanotechnology, it is the unique properties arising from nanometre-scale structures that lead not only to their technological importance but also to a better understanding of the underlying science. Over the last twenty years, material properties at the nanoscale have been dominated by the properties of carbon in the form of the C60 molecule, single- and multi-wall carbon nanotubes, nanodiamonds, and recently graphene. During this period, research published in the journal Nanotechnology has revealed the amazing mechanical properties of such materials as well as their remarkable electronic properties with the promise of new devices. Furthermore, nanoparticles, nanotubes, nanorods, and nanowires from metals and dielectrics have been characterized for their electronic, mechanical, optical, chemical and catalytic properties. Scanning probe microscopy (SPM) has become the main characterization technique and atomic force microscopy (AFM) the most frequently used SPM. Over the past twenty years, SPM techniques that were previously experimental in nature have become routine. At the same time, investigations using AFM continue to yield impressive results that demonstrate the great potential of this powerful imaging tool, particularly in close to physiological conditions. In this special issue a collaboration of researchers in Europe report the use of AFM to provide high-resolution topographical images of individual carbon nanotubes immobilized on various biological membranes, including a nuclear membrane for the first time (Lamprecht C et al 2009 Nanotechnology 20 434001). Other SPM developments such as high-speed AFM appear to be making a transition from specialist laboratories to the mainstream, and perhaps the same may be said for non-contact AFM. Looking to the future, characterisation techniques involving SPM and spectroscopy, such as tip-enhanced Raman spectroscopy, could emerge as everyday methods. In all these advanced techniques, routinely available probes will

  16. Ice-Borehole Probe

    NASA Technical Reports Server (NTRS)

    Behar, Alberto; Carsey, Frank; Lane, Arthur; Engelhardt, Herman

    2006-01-01

    An instrumentation system has been developed for studying interactions between a glacier or ice sheet and the underlying rock and/or soil. Prior borehole imaging systems have been used in well-drilling and mineral-exploration applications and for studying relatively thin valley glaciers, but have not been used for studying thick ice sheets like those of Antarctica. The system includes a cylindrical imaging probe that is lowered into a hole that has been bored through the ice to the ice/bedrock interface by use of an established hot-water-jet technique. The images acquired by the cameras yield information on the movement of the ice relative to the bedrock and on visible features of the lower structure of the ice sheet, including ice layers formed at different times, bubbles, and mineralogical inclusions. At the time of reporting the information for this article, the system was just deployed in two boreholes on the Amery ice shelf in East Antarctica and after successful 2000 2001 deployments in 4 boreholes at Ice Stream C, West Antarctica, and in 2002 at Black Rapids Glacier, Alaska. The probe is designed to operate at temperatures from 40 to +40 C and to withstand the cold, wet, high-pressure [130-atm (13.20-MPa)] environment at the bottom of a water-filled borehole in ice as deep as 1.6 km. A current version is being outfitted to service 2.4-km-deep boreholes at the Rutford Ice Stream in West Antarctica. The probe (see figure) contains a sidelooking charge-coupled-device (CCD) camera that generates both a real-time analog video signal and a sequence of still-image data, and contains a digital videotape recorder. The probe also contains a downward-looking CCD analog video camera, plus halogen lamps to illuminate the fields of view of both cameras. The analog video outputs of the cameras are converted to optical signals that are transmitted to a surface station via optical fibers in a cable. Electric power is supplied to the probe through wires in the cable at a

  17. Molecular probes for cardiovascular imaging.

    PubMed

    Liang, Grace; Nguyen, Patricia K

    2016-08-01

    Molecular probes provide imaging signal and contrast for the visualization, characterization, and measurement of biological processes at the molecular level. These probes can be designed to target the cell or tissue of interest and must be retained at the imaging site until they can be detected by the appropriate imaging modality. In this article, we will discuss the basic design of molecular probes, differences among the various types of probes, and general strategies for their evaluation of cardiovascular disease. PMID:27189171

  18. Intraspecific polymorphism of ribosomal DNA loci number and morphology in Brachypodium pinnatum and Brachypodium sylvaticum.

    PubMed

    Breda, Ewa; Wolny, Elzbieta; Hasterok, Robert

    2012-12-01

    The genus Brachypodium has become the target of extensive cytomolecular studies since one of its representatives, B. distachyon, has been accepted as a model plant for temperate cereals and forage grasses. Recent preliminary studies suggested that intraspecific rDNA polymorphism can occur in at least two members of the genus, B. sylvaticum and B. pinnatum, so the aim of this study was to further analyse this phenomenon. FISH with 25S rDNA and 5S rDNA probes was performed on somatic metaphase chromosomes, supplemented by the silver staining technique which distinguishes transcriptionally active from inactive 18S-5.8S-25S rDNA loci. The number, size and chromosomal distribution of 5S rDNA loci were very constant: two loci were invariably observed in all studied diploid accessions of both species, while four 5S rDNA loci were present in the tetraploid B. pinnatum. In contrast to 5S rDNA loci, those of the 35S rDNA were more variable. Two or three loci were observed in the diploid B. pinnatum and four in tetraploid accessions. In chromosome complements of B. sylvaticum accessions from two to six 35S rDNA sites were detected. Regardless of total rDNA locus number, only two were transcriptionally active in diploid accessions of both species, while two or four were active in the tetraploid B. pinnatum. Additionally, the fluorescent CMA/DAPI banding method was used to identify the relation between rDNA sites and CMA+ bands. It was revealed that the number and chromosomal distribution of CMA+ bands are in congruence only with 35S rDNA loci which gave strong FISH signals. PMID:22893263

  19. Heavy ion beam probing

    SciTech Connect

    Hickok, R L

    1980-07-01

    This report consists of the notes distributed to the participants at the IEEE Mini-Course on Modern Plasma Diagnostics that was held in Madison, Wisconsin in May 1980. It presents an overview of Heavy Ion Beam Probing that briefly describes the principles and discuss the types of measurements that can be made. The problems associated with implementing beam probes are noted, possible variations are described, estimated costs of present day systems, and the scaling requirements for large plasma devices are presented. The final chapter illustrates typical results that have been obtained on a variety of plasma devices. No detailed calculations are included in the report, but a list of references that will provide more detailed information is included.

  20. Molecular inversion probe assay.

    PubMed

    Absalan, Farnaz; Ronaghi, Mostafa

    2007-01-01

    We have described molecular inversion probe technologies for large-scale genetic analyses. This technique provides a comprehensive and powerful tool for the analysis of genetic variation and enables affordable, large-scale studies that will help uncover the genetic basis of complex disease and explain the individual variation in response to therapeutics. Major applications of the molecular inversion probes (MIP) technologies include targeted genotyping from focused regions to whole-genome studies, and allele quantification of genomic rearrangements. The MIP technology (used in the HapMap project) provides an efficient, scalable, and affordable way to score polymorphisms in case/control populations for genetic studies. The MIP technology provides the highest commercially available multiplexing levels and assay conversion rates for targeted genotyping. This enables more informative, genome-wide studies with either the functional (direct detection) approach or the indirect detection approach. PMID:18025701

  1. Fast Langmuir probe sweeping circuit

    SciTech Connect

    Milnes, K.A.; Ehlers, K.W.; Leung, K.N.; Owren, H.M.; Williams, M.D.

    1980-06-01

    An inexpensive, simple, and fast Langmuir probe sweeping circuit is presented. This sweeper completes a probe trace in 1.4 ms and has a maximum probe current capability of 5 A. It is suitable for pulsemode plasma operation with density greater than 10/sup 12/ ions/cm/sup 3/.

  2. Scanning Probe Microscopy and Spectroscopy

    NASA Astrophysics Data System (ADS)

    Wiesendanger, Roland

    1994-09-01

    Preface; List of acronyms; Introduction; Part I. Experimental Methods and Theoretical Background of Scanning Probe Microscopy and Spectroscopy: 1. Scanning tunnelling microscopy; 2. Scanning force microscopy; 3. Related scanning probe techniques; Part II. Applications of Scanning Probe Microscopy and Spectroscopy: 4. Condensed matter physics; 5. Chemistry; 6. Organic materials; 7. Metrology and standards; 8. Nanotechnology; References; Index.

  3. Properties of Broezel static probe

    NASA Astrophysics Data System (ADS)

    Gašparovič, Peter; Semrád, Karol; Cúttová, Miroslava

    2016-03-01

    The properties of flat static probe designed by Broezel and used in sailplanes are investigated for its planned use in low speed tunnel. Both the numerical CFD model and experiment in low speed wind tunnel confirm yaw insensitivity of the static pressure measured by the probe. The results indicate that the probe is sufficiently accurate for its planned use in wind tunnel measurements.

  4. Droplet monitoring probe

    NASA Technical Reports Server (NTRS)

    Baughman, J. R.; Thys, P. C.

    1973-01-01

    A droplet monitoring system is disclosed for analysis of mixed-phase fluid flow in development of gas turbines. The system uses a probe comprising two electrical wires spaced a known distance apart and connected at one end to means for establishing a dc potential between the wires. A drop in the fluid stream momentarily contacting both wires simultaneously causes and electrical signal which is amplified, detected and counted.

  5. Space Probe Launch

    NASA Technical Reports Server (NTRS)

    1970-01-01

    Managed by Marshall Space Flight Center, the Space Tug was a reusable multipurpose space vehicle designed to transport payloads to different orbital inclinations. Utilizing mission-specific combinations of its three primary modules (crew, propulsion, and cargo) and a variety of supplementary kits, the Space Tug was capable of numerous space applications. This 1970 artist's concept depicts the Tug's propulsion module launching a space probe into lunar orbit.

  6. Cosmological probes of gravity

    NASA Astrophysics Data System (ADS)

    Rassat, Anais Marie Melanie

    This Thesis is concerned with two cosmological probes of linear gravity. The first relates to Large Scale Structure (LSS) in the Universe, probed by galaxy surveys. The second to temperature anisotropics of the Cosmic Microwave Background (CMB), probed by the Wilkinson Microwave Anisotropy Map (WMAP). Both probe the matter and dark energy distributions in the Universe and can be used to test general relativity. The first part of this Thesis (Chapters 2 to 4) is concerned with the analysis of galaxy clustering in redshift space. The second part (Chapters 5 to 7) is concerned with the Integrated Sachs-Wolfe (ISW) effect using LSS-CMB cross-correlations. Chapter 1 introduces the cosmological theory and overviews the subsequent chapters. Chapter 2 gives a review of recent results from the 2 Micron All-Sky Survey (2MASS) and its Redshift Survey (2MRS). It includes work published in Erdogdu (a) et al. (2006) and Erdogdu (b) et al. (2006). Chapter 3 quantifies the clustering of 2MRS galaxies in redshift space. Chapter 4 uses results from Chapter 3 to constrain cosmological parameters. A selection of work from Chapters 3 and 4 will shortly become available in Rassat et al. (2008), entitled 'Redshift Space Analysis of 2MRS'. Chapter 5 overviews the late-time Integrated Sachs-Wolfe effect (ISW) and cross- correlations between the LSS and the CMB. Chapter 6 is also published in Rassat et al. (2007), entitled "Cross-correlation of 2MASS and WMAP3: Implications for the Integrated Sachs-Wolfe effect". It investigates a detection of the ISW effect and correlations which may affect statistical isotropy in the CMB ('Axis of Evil'). Chapter 7 uses the ISW effect to forecast constraints on dark energy parameters and general modifications of general relativity for the next generation of galaxy surveys, particularly the Dark UNiverse Explorer (DUNE) and the Dark Energy Survey (DES). Chapter 8 presents the overall conclusions of this Thesis. Chapter 9 discusses possible extensions to

  7. Ultrafast scanning probe microscopy

    SciTech Connect

    Botkin, D.; Weiss, S.; Ogletree, D.F.; Salmeron, M.; Chemla, D.S.

    1994-01-01

    The authors have developed a general technique which combines the temporal resolution of ultrafast laser spectroscopy with the spatial resolution of scanned probe microscopy (SPM). Using this technique with scanning tunneling microscopy (STM), they have obtained simultaneous 2 ps time resolution and 50 {angstrom} spatial resolution. This improves the time resolution currently attainable with STM by nine orders of magnitude. The potential of this powerful technique for studying ultrafast dynamical phenomena on surfaces with atomic resolution is discussed.

  8. Gravity Probe B Inspection

    NASA Technical Reports Server (NTRS)

    2000-01-01

    The space vehicle Gravity Probe B (GP-B) is the relativity experiment developed at Stanford University to test two extraordinary predictions of Albert Einstein's general theory of relativity. The experiment will measure, very precisely, the expected tiny changes in the direction of the spin axes of four gyroscopes contained in an Earth-orbiting satellite at a 400-mile altitude. So free are the gyroscopes from disturbance that they will provide an almost perfect space-time reference system. They will measure how space and time are very slightly warped by the presence of the Earth, and, more profoundly, how the Earth's rotation very slightly drags space-time around with it. These effects, though small for the Earth, have far-reaching implications for the nature of matter and the structure of the Universe. GP-B is among the most thoroughly researched programs ever undertaken by NASA. This is the story of a scientific quest in which physicists and engineers have collaborated closely over many years. Inspired by their quest, they have invented a whole range of technologies that are already enlivening other branches of science and engineering. In this photograph, engineer Gary Reynolds is inspecting the inside of the probe neck during probe thermal repairs. GP-B is scheduled for launch in April 2004 and managed for NASA by the Marshall Space Flight Center. Development of the GP-B is the responsibility of Stanford University along with major subcontractor Lockheed Martin Corporation. (Image credit to Russ Leese, Gravity Probe B, Stanford University)

  9. Phoenix Conductivity Probe

    NASA Technical Reports Server (NTRS)

    2008-01-01

    This image taken by the Surface Stereo Imager on Sol 49, or the 49th Martian day of the mission (July 14, 2008), shows thermal and electrical conductivity probe on NASA's Phoenix Mars Lander's Robotic Arm.

    The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is led by NASA's Jet Propulsion Laboratory, Pasadena, Calif. Spacecraft development is by Lockheed Martin Space Systems, Denver.

  10. Galileo probe relay receiver

    NASA Technical Reports Server (NTRS)

    Prouty, D. A.; Von Der Embse, U. A.

    1982-01-01

    For the Jovian mission, the data link from the Galileo probe to the orbiter uses suppressed-carrier Manchester encoded BPSK modulation and is protected with R = 1/2, K = 7 convolutional coding. The receiver closes the link by acquiring, tracking, and demodulating the data. It has to operate in a highly stressed environment with severe frequency offset, frequency rate, wind gust, and antenna spin conditions. Salient features are described and breadboard test data presented.

  11. Icing Sensor Probe

    NASA Technical Reports Server (NTRS)

    Emery, Edward; Kok, Gregory L.

    2002-01-01

    Aircraft icing is a serious safety problem for the general aviation and some commuter transport airplanes. There has been tremendous growth in the commuter aviation industry in the last few years, Since these type of aircraft generally operate at lower altitudes they consequently spend a far greater proportion of their time operating in icing conditions. For the past thirty years airborne and ground based facilities have relied primarily on two types of cloud physics instrumentation to measure the characteristics of icing clouds: hot wire liquid water content probes and laser based particle sizing probes for the measurement of water droplet size. The instrumentation is severely limited by the technology that was developed during the 1970's and is quite large in size. The goal of this research is to develop one instrument with a wide bandwidth, better response time, higher resolution, user selectability, and small and lightweight. NASA Glenn Research Center, Droplet Measurement Technology, and Meteorology Society of Canada have developed a collaborative effort to develop such an instrument. This paper describes the development and test results of the prototype Icing Sensor Probe.

  12. Einstein Inflationary Probe (EIP)

    NASA Technical Reports Server (NTRS)

    Hinshaw, Gary

    2004-01-01

    I will discuss plans to develop a concept for the Einstein Inflation Probe: a mission to detect gravity waves from inflation via the unique signature they impart to the cosmic microwave background (CMB) polarization. A sensitive CMB polarization satellite may be the only way to probe physics at the grand-unified theory (GUT) scale, exceeding by 12 orders of magnitude the energies studied at the Large Hadron Collider. A detection of gravity waves would represent a remarkable confirmation of the inflationary paradigm and set the energy scale at which inflation occurred when the universe was a fraction of a second old. Even a strong upper limit to the gravity wave amplitude would be significant, ruling out many common models of inflation, and pointing to inflation occurring at much lower energy, if at all. Measuring gravity waves via the CMB polarization will be challenging. We will undertake a comprehensive study to identify the critical scientific requirements for the mission and their derived instrumental performance requirements. At the core of the study will be an assessment of what is scientifically and experimentally optimal within the scope and purpose of the Einstein Inflation Probe.

  13. Nanoscale thermal probing

    PubMed Central

    Yue, Yanan; Wang, Xinwei

    2012-01-01

    Nanoscale novel devices have raised the demand for nanoscale thermal characterization that is critical for evaluating the device performance and durability. Achieving nanoscale spatial resolution and high accuracy in temperature measurement is very challenging due to the limitation of measurement pathways. In this review, we discuss four methodologies currently developed in nanoscale surface imaging and temperature measurement. To overcome the restriction of the conventional methods, the scanning thermal microscopy technique is widely used. From the perspective of measuring target, the optical feature size method can be applied by using either Raman or fluorescence thermometry. The near-field optical method that measures nanoscale temperature by focusing the optical field to a nano-sized region provides a non-contact and non-destructive way for nanoscale thermal probing. Although the resistance thermometry based on nano-sized thermal sensors is possible for nanoscale thermal probing, significant effort is still needed to reduce the size of the current sensors by using advanced fabrication techniques. At the same time, the development of nanoscale imaging techniques, such as fluorescence imaging, provides a great potential solution to resolve the nanoscale thermal probing problem. PMID:22419968

  14. Comparative evaluation of probing depth and clinical attachment level using a manual probe and Florida probe

    PubMed Central

    Kour, Amandeep; Kumar, Ashish; Puri, Komal; Khatri, Manish; Bansal, Mansi; Gupta, Geeti

    2016-01-01

    Background: To compare and evaluate the intra- and inter-examiner efficacy and reproducibility of the first-generation manual (Williams) probe and the third-generation Florida probe in terms of measuring pocket probing depth (PD) and clinical attachment level (CAL). Materials and Methods: Forty subjects/4000 sites were included in this comparative, cross-sectional study. Group- and site-wise categorizations were done. Based on gingival index, PD, and CAL, patients were divided into four groups, i.e., periodontally healthy, gingivitis, mild to moderate periodontitis, and severe periodontitis. Further, based on these parameters, a total of 4000 sites, with 1000 sites in each category randomly selected from these 40 patients, were taken. Full mouth PD and CAL measurements were recorded with two probes, by Examiner 1 and on Ramfjord teeth by Examiner 2. Results: Full mouth and Ramfjord teeth group- and site-wise PD obtained with the manual probe by both the examiners were statistically significantly deeper than that obtained with the Florida probe. The full mouth and Ramfjord teeth mean CAL measurement by Florida probe was higher as compared to manual probe in mild to moderate periodontitis group and sites, whereas in severe periodontitis group and sites, manual probe recorded higher CAL as compared to Florida probe. Conclusion: Mean PD and CAL measurements were deeper with the manual probe as compared to the Florida probe in all the groups and sites, except for the mild-moderate periodontitis group and sites where the CAL measurements with the manual probe were less than the Florida probe. Manual probe was more reproducible and showed less interexaminer variability as compared to the Florida probe. PMID:27563204

  15. Endoscopic Trans-iliac Approach to L5-S1 Disc and Foramen – A Report on Clinical Experience

    PubMed Central

    Osman, Said G; Sherlekar, Sandeep; Malik, Atif; Winters, Charles; Grewal, PK; Narayanan, Malini; Gemechu, Nigussie

    2014-01-01

    Background The lumbosacral junction is a difficult area for spine surgery because of the complex anatomy. In the era of minimally invasive spine surgery, the presence of the iliac wing has, at the level of lumbosacral junction, created a major obstacle in the paths of two of the major approaches, namely, the direct lateral and percutaneous posterolateral endoscopic approaches. A trans-iliac cadaver study published by the senior author and co-workers in 1997, suggested the possibility of an alternative approach to the lumbosacral junction. Purpose To determine the feasibility of percutaneous, endoscopic trans-iliac approach to the L5-S1 disc and foramen Study Design Prospective case series study. Materials and Methods 15 consecutive patients undergoing the transiliac approach to L5-S1 disc and foramen were included in the study. Pre- and postoperative visual analogue scale (VAS); Oswestry Disability Index (ODI); and intra-operative blood loss and operative time, were obtained for the study. Preoperative MRI or CT scan was used to determine the need for trans-iliac access. The procedure was performed with the patient in prone position and under monitored sedation for decompression. Endotracheal anesthesia was used for fusion cases. The transiliac access was established with a cannulated drill or core drill through the iliac wing. Once the trans-iliac window had been created, the rest of the procedure proceeded as for percutaneous endoscopic transforaminal decompression and fusion. Results 15 patients (9 male and 6 female) participated in the study. The VAS for back and leg pain significantly improved in all patients. The ODI dropped by more than 50%. There was minimal blood loss, and transient post-operative dysesthesia in 2 cases which resolved after 3 weeks. Conclusion Endoscopic trans-iliac approach to the L5-S1 disc and foramen is feasible and safe. Decompression can be performed safely via trans-iliac access with minimal blood loss, and in a short operative time

  16. Effects of altered gravity on a distribution of rDNA and nucleolar proteins and the expression of nucleolar proteins in plants

    NASA Astrophysics Data System (ADS)

    Sobol, Margaryta; Kordyum, Elizabeth; Medina, Francisco Javier

    The nucleolus is an inner nuclear organelle originated from the activity of hundreds of rRNA genes, typically spanning several megabases. It morphologically reflects the functional events leading to ribosome biogenesis, from the transcription of rDNA through the processing of nascent pre-rRNA to the assembly of pre-ribosomes. A typical nucleolus consists of three major elements, namely fibrillar centers (FCs), the dense fibrillar component (DFC), and granular component (GC). The rate of ribosome biosynthesis and the subnucleolar structure are reliable monitors of the general level of cell metabolism and, consequently, of the rate of cellular growth, being influenced with many external factors, among which altered gravity could be included. Thus, we can hypothesize that the structural organization of the nucleolar subcomponents and the level, distribution and quantitative/qualitative characteristics of the nucleolar proteins would be changed under conditions of altered gravity. To confirm our hypothesis, we applied parallel procedures, such as cytochemistry, immunofluorescence, confocal laser microscopy, immunogold electron microscopy, monoand bi-dimensional electrophoresis and immunoblotting in root meristematic cells from two-day cress seedlings grown under slow horizontal clinorotation (2 rpm) and in stationary control. The complex model of the ultrastructural organization and functions of the nucleolus was created based on the location of rDNA and the nucleolar proteins fibrillarin, NhL90 and NhL68, these latter being cress nucleolin homologues. The principal stages of ribosome biogenesis, namely ribosomal gene activation, rDNA transcription and pre-rRNA processing were reflected in this model. Compared to the pattern shown in control ground gravity conditions, we found firstly a redistribution of both rDNA and nucleolar proteins in nucleolar subcomponents, induced by clinorotation. Under the conditions of altered gravity, nucleolar DNA concentrated

  17. Hadron physics potential of future high-luminosity B-factories at the ϒ(5S) and above

    NASA Astrophysics Data System (ADS)

    Drutskoy, A. G.; Guo, F.-K.; Llanes-Estrada, F. J.; Nefediev, A. V.; Torres-Rincon, J. M.

    2013-01-01

    We point out the physics opportunities of future high-luminosity B-factories at the ϒ(5 S) resonance and above. Currently the two B-factories, the SuperB factory in Tor Vergata, Italy and the Belle II factory in KEK, Japan, are under development and are expected to start operation in 2017 and 2016, respectively. In this paper we discuss numerous interesting investigations, which can be performed in the e + e - center-of-mass energy region from the ϒ(5 S) and up to 11.5GeV, where an efficient data taking operation should be possible with the planned B-factories. These studies include abundant Bs production and decay properties; independent confirmation and, if found, exhaustive exploration of Belle's claimed charged bottomonia; clarification of puzzles of interquarkonium dipion transitions; extraction of the light-quark mass ratio from hadronic ϒ(5 S) decays; analysis of quarkonium and exotic internal structure from open flavour decays, leading to severe SU(3) symmetry violations; clarification of whether a hybrid state has similar mass to the ϒ(5 S) bottomonium, making it a double state; searches for molecular/tetraquark states that should be more stable with heavy quarks; completion of the table of positive-parity BJ mesons and study of their basic properties; production of Λ _b bar Λ _b heavy baryon pairs, that, following weak decay, open vistas on the charmed baryon spectrum and new channels to study CP violation; confirmation or refutation of the deviation from pQCD of the pion transition form factor, by extending the Q2 reach of current analysis; and possibly reaching the threshold for the production of triply charmed baryons. If, in addition, the future colliders can be later upgraded to 12.5GeV, then the possibility of copious production of B_c bar B_c pairs opens, entailing new studies of CP violation and improved, independent tests of the CKM picture (through determination of V bc , and of effective theories for heavy quarks.

  18. Mutation of a Nopp140 gene dao-5 alters rDNA transcription and increases germ cell apoptosis in C. elegans.

    PubMed

    Lee, C-C; Tsai, Y-T; Kao, C-W; Lee, L-W; Lai, H-J; Ma, T-H; Chang, Y-S; Yeh, N-H; Lo, S J

    2014-01-01

    Human diseases of impaired ribosome biogenesis resulting from disruption of rRNA biosynthesis or loss of ribosomal components are collectively described as 'ribosomopathies'. Treacher Collins syndrome (TCS), a representative human ribosomopathy with craniofacial abnormalities, is attributed to mutations in the tcof1 gene that has a homologous gene called nopp140. Previous studies demonstrated that the dao-5 (dauer and aged animal overexpression gene 5) of Caenorhabditis elegans is a member of nopp140 gene family and plays a role in nucleogenesis in the early embryo. Here, we established a C. elegans model for studying Nopp140-associated ribosomopathy. A null dao-5 mutant ok542 with a semi-infertile phenotype showed a delay in gonadogenesis, as well as a higher incidence of germline apoptosis. These phenotypes in dao-5(ok542) are likely resulted from inefficient rDNA transcription that was observed by run-on analyses and chromatin immunoprecipitation (ChIP) assays measuring the RNA Pol I occupancy on the rDNA promoter. ChIP assays further showed that the modifications of acetylated histone 4 (H4Ac) and dimethylation at the lysine 9 of histone 3 (H3K9me2) around the rDNA promoter were altered in dao-5 mutants compared with the N2 wild type. In addition, activated CEP-1 (a C. elegans p53 homolog) activity was also linked to the loss of DAO-5 in terms of the transcriptional upregulation of two CEP-1 downstream effectors, EGL-1 and CED-13. We propose that the dao-5 mutant of C. elegans can be a valuable model for studying human Nopp140-associated ribosomopathy at the cellular and molecular levels. PMID:24722283

  19. Structural and functional exchangeability of 5 S RNA species from the eubacterium E.coli and the thermoacidophilic archaebacterium Sulfolobus solfataricus.

    PubMed Central

    Teixidò, J; Altamura, S; Londei, P; Amils, R

    1989-01-01

    The role of 5 S RNA within the large ribosomal subunit of the extremely thermophilic archaebacterium Sulfolobus solfataricus has been analysed by means of in vitro reconstitution procedures. It is shown that Sulfolobus 50 S subunits reconstituted in the absence of 5 S RNA are inactive in protein synthesis and lack 2-3 ribosomal proteins. Furthermore, it has been determined that in the course of the in vitro assembly process Sulfolobus 5 S RNA can be replaced by the correspondent RNA species of E.coli; Sulfolobus reconstituted particles containing the eubacterial 5 S molecule are stable and active in polypeptide synthesis at high temperatures. Images PMID:2493632

  20. Development of a PCR assay based on the 16S-23S rDNA internal transcribed spacer for identification of strictly anaerobic bacterium Zymophilus.

    PubMed

    Felsberg, Jurgen; Jelínková, Markéta; Kubizniaková, Petra; Matoulková, Dagmar

    2015-06-01

    PCR-primers were designed for identification of strictly anaerobic bacteria of the genus Zymophilus based on genus-specific sequences of the 16S-23S rDNA internal transcribed spacer region. The specificity of the primers was tested against 37 brewery-related non-target microorganisms that could potentially occur in the same brewery specimens. None DNA was amplified from any of the non-Zymophilus strains tested including genera from the same family (Pectinatus, Megasphaera, Selenomonas), showing thus 100% specificity. PCR assay developed in this study allows an extension of the spectra of detected beer spoilage microorganisms in brewery laboratories. PMID:25725268

  1. Li(V0.5Ti0.5)S2 as a 1 V lithium intercalation electrode

    NASA Astrophysics Data System (ADS)

    Clark, Steve J.; Wang, Da; Armstrong, A. Robert; Bruce, Peter G.

    2016-03-01

    Graphite, the dominant anode in rechargeable lithium batteries, operates at ~0.1 V versus Li+/Li and can result in lithium plating on the graphite surface, raising safety concerns. Titanates, for example, Li4Ti5O12, intercalate lithium at~1.6 V versus Li+/Li, avoiding problematic lithium plating at the expense of reduced cell voltage. There is interest in 1 V anodes, as this voltage is sufficiently high to avoid lithium plating while not significantly reducing cell potential. The sulfides, LiVS2 and LiTiS2, have been investigated as possible 1 V intercalation electrodes but suffer from capacity fading, large 1st cycle irreversible capacity or polarization. Here we report that the 50/50 solid solution, Li1+x(V0.5Ti0.5)S2, delivers a reversible capacity to store charge of 220 mAhg-1 (at 0.9 V), 99% of theoretical, at a rate of C/2, retaining 205 mAhg-1 at C-rate (92% of theoretical). Rate capability is excellent with 200 mAhg-1 at 3C. C-rate is discharge in 1 h. Polarization is low, 100 mV at C/2. To the best of our knowledge, the properties/performances of Li(V0.5Ti0.5)S2 exceed all previous 1 V electrodes.

  2. Thickness-Dependent and Magnetic-Field-Driven Suppression of Antiferromagnetic Order in Thin V5S8 Single Crystals.

    PubMed

    Hardy, Will J; Yuan, Jiangtan; Guo, Hua; Zhou, Panpan; Lou, Jun; Natelson, Douglas

    2016-06-28

    With materials approaching the 2D limit yielding many exciting systems with intriguing physical properties and promising technological functionalities, understanding and engineering magnetic order in nanoscale, layered materials is generating keen interest. One such material is V5S8, a metal with an antiferromagnetic ground state below the Néel temperature TN ∼ 32 K and a prominent spin-flop signature in the magnetoresistance (MR) when H∥c ∼ 4.2 T. Here we study nanoscale-thickness single crystals of V5S8, focusing on temperatures close to TN and the evolution of material properties in response to systematic reduction in crystal thickness. Transport measurements just below TN reveal magnetic hysteresis that we ascribe to a metamagnetic transition, the first-order magnetic-field-driven breakdown of the ordered state. The reduction of crystal thickness to ∼10 nm coincides with systematic changes in the magnetic response: TN falls, implying that antiferromagnetism is suppressed; and while the spin-flop signature remains, the hysteresis disappears, implying that the metamagnetic transition becomes second order as the thickness approaches the 2D limit. This work demonstrates that single crystals of magnetic materials with nanometer thicknesses are promising systems for future studies of magnetism in reduced dimensionality and quantum phase transitions. PMID:27163511

  3. 5S program to reduce change-over time on forming department (case study on CV Piranti Works temanggung)

    NASA Astrophysics Data System (ADS)

    Rosiana Dewi, Septika; Setiawan, Budi; P, Susatyo Nugroho W.

    2013-06-01

    Productivity is one aspect that determines the success of a company in the competitive world of business. There are seven main types of activities that do not have value-added in manufacturing processes such as overproduction, waiting time, transportation, excess inventory, unnecessary motion and defects. The whole activity is a waste (waste) that can cause harm to the Company. Therefore, in production activities is important to pay attention so that the objectives of production productivity can be achieved. Problems experienced by CV Piranti Works is a production target is not achieved resulting in a lost sale raises the cost of which can cause harm to the Company. From the analysis conducted major known cause of the problem is the length of time required for changeover. This is supported by the high non-value added activity in the changeover activities. Lean Manufacturing is an approach to make system more efficient by reducing waste. This study refers to the book compiled by Takashi Osada (2004) and several other references. In this research used method 5S (Seiri, Seiton, Seiso, Seiketsu, and Shitsuke) for the of forming departement. The purpose of this research is to design a work environment using the 5S method (Seiri, Seiton, Seiso, Seiketsu, and Shitsuke) and make arrangement of equipment and working tool cabinet design with TRIZ methods. From these results, is expected to eliminate or reduce of non-value added activity and improved the changeover time so as to meet production targets completion of the company.

  4. PROcess Based Diagnostics PROBE

    NASA Technical Reports Server (NTRS)

    Clune, T.; Schmidt, G.; Kuo, K.; Bauer, M.; Oloso, H.

    2013-01-01

    Many of the aspects of the climate system that are of the greatest interest (e.g., the sensitivity of the system to external forcings) are emergent properties that arise via the complex interplay between disparate processes. This is also true for climate models most diagnostics are not a function of an isolated portion of source code, but rather are affected by multiple components and procedures. Thus any model-observation mismatch is hard to attribute to any specific piece of code or imperfection in a specific model assumption. An alternative approach is to identify diagnostics that are more closely tied to specific processes -- implying that if a mismatch is found, it should be much easier to identify and address specific algorithmic choices that will improve the simulation. However, this approach requires looking at model output and observational data in a more sophisticated way than the more traditional production of monthly or annual mean quantities. The data must instead be filtered in time and space for examples of the specific process being targeted.We are developing a data analysis environment called PROcess-Based Explorer (PROBE) that seeks to enable efficient and systematic computation of process-based diagnostics on very large sets of data. In this environment, investigators can define arbitrarily complex filters and then seamlessly perform computations in parallel on the filtered output from their model. The same analysis can be performed on additional related data sets (e.g., reanalyses) thereby enabling routine comparisons between model and observational data. PROBE also incorporates workflow technology to automatically update computed diagnostics for subsequent executions of a model. In this presentation, we will discuss the design and current status of PROBE as well as share results from some preliminary use cases.

  5. Broadband pump-probe spectroscopy at 20-MHz modulation frequency.

    PubMed

    Preda, Fabrizio; Kumar, Vikas; Crisafi, Francesco; Figueroa Del Valle, Diana Gisell; Cerullo, Giulio; Polli, Dario

    2016-07-01

    We introduce an innovative high-sensitivity broadband pump-probe spectroscopy system, based on Fourier-transform detection, operating at 20-MHz modulation frequency. A common-mode interferometer employing birefringent wedges creates two phase-locked delayed replicas of the broadband probe pulse, interfering at a single photodetector. A single-channel lock-in amplifier demodulates the interferogram, whose Fourier transform provides the differential transmission spectrum. Our approach combines broad spectral coverage with high sensitivity, due to high-frequency modulation and detection. We demonstrate its performances by measuring two-dimensional differential transmission maps of a carbon nanotubes sample, simultaneously acquiring the signal over the entire 950-1350 nm range with 2.7·10-6  rms noise over 1.5 s integration time. PMID:27367078

  6. Experimental probes of axions

    SciTech Connect

    Chou, Aaron S.; /Fermilab

    2009-10-01

    Experimental searches for axions or axion-like particles rely on semiclassical phenomena resulting from the postulated coupling of the axion to two photons. Sensitive probes of the extremely small coupling constant can be made by exploiting familiar, coherent electromagnetic laboratory techniques, including resonant enhancement of transitions using microwave and optical cavities, Bragg scattering, and coherent photon-axion oscillations. The axion beam may either be astrophysical in origin as in the case of dark matter axion searches and solar axion searches, or created in the laboratory from laser interactions with magnetic fields. This note is meant to be a sampling of recent experimental results.

  7. Vacuum probe surface sampler

    NASA Technical Reports Server (NTRS)

    Zahlava, B. A. (Inventor)

    1973-01-01

    A vacuum probe surface sampler is described for rapidly sampling relatively large surface areas which possess relatively light loading densities of micro-organism, drug particles or the like. A vacuum head with a hollow handle connected to a suitable vacuum source is frictionally attached to a cone assembly terminating in a flared tip adapted to be passed over the surface to be sampled. A fine mesh screen carried by the vacuum head provides support for a membrane filter which collects the microorganisms or other particles. The head assembly is easily removed from the cone assembly without contacting the cone assembly with human hands.

  8. Probing magnons with RIXS

    NASA Astrophysics Data System (ADS)

    Ament, Lucas; Ghiringhelli, Giacomo; Moretti Sala, Marco; Braicovich, Lucio; van den Brink, Jeroen

    2010-03-01

    Resonant Inelastic X-ray Scattering (RIXS) at the copper L and M edge can probe single spin-flips, which makes it possible to probe the dispersion of magnetic excitations (for instance magnons) of cuprates such as the high Tc superconductors [1]. The cross section factors into a local, atomic spin flip scattering amplitude and a momentum dependent factor describing the final state excitation. Recently, the single magnon dispersion has been measured and found to coincide with earlier neutron measurements [2]. For the cuprates, these results put RIXS as a technique on the same footing as neutron scattering, opening a new window for experiments on this class of materials. [1] L.J.P. Ament, G. Ghiringhelli, M. Moretti Sala, L. Braicovich, and J. van den Brink, PRL 103, 117003 (2009) [2] L. Braicovich, J. van den Brink, V. Bisogni, M. Moretti Sala, L.J.P. Ament, N.B. Brookes, G.M. De Luca, M. Salluzzo, T. Schmitt, and G. Ghiringhelli, arXiv:0911.0621

  9. The world in a river? A preliminary analysis of the 16S rDNA variability of Tubifex species (Clitellata: Tubificidae) from the Lambro River.

    PubMed

    Crottini, Angelica; Marotta, Roberto; Barbuto, Michela; Casiraghi, Maurizio; Ferraguti, Marco

    2008-09-01

    Tubifex tubifex Müller, 1774 is a cosmopolitan freshwater tubificid widely used as a model in ecotoxicology, population dynamics and developmental biology. It is traditionally recognized as a polytypic species and in Lambro River (Milano, Northern Italy) it occurs in two of the three recognized forms, named "tubifex" and "blanchardi", alternatively considered as ecological forms or distinct species. To investigate the genetic differentiation of the populations occurring in the Lambro River we sequenced a fragment of the 16S rDNA mitochondrial gene. T. blanchardi, characterized by a low genetic diversity, was genetically segregated from the other sympatric T. tubifex. The ancestral state reconstruction was used to define the morphological traits that support its distinctness. On the contrary, the other T. tubifex from the Lambro community, although morphologically indistinguishable, revealed an astonishing degree of genetic variability, both between and within the three identified clades that proved to be genetically isolated. Using samples from the mixed Lambro River community and from other countries around the world we present an overview of the species complex' 16S rDNA variability. Our results show that the genetic variability did not sensibly increase widening the data set, suggesting that the Lambro River populations meet the species' worldwide genetic variability. PMID:18625325

  10. Formal Revision of the Alexandrium tamarense Species Complex (Dinophyceae) Taxonomy: The Introduction of Five Species with Emphasis on Molecular-based (rDNA) Classification

    PubMed Central

    John, Uwe; Litaker, R. Wayne; Montresor, Marina; Murray, Shauna; Brosnahan, Michael L.; Anderson, Donald M.

    2015-01-01

    The Alexandrium tamarense species complex is one of the most studied marine dinoflagellate groups due to its ecological, toxicological and economic importance. Several members of this complex produce saxitoxin and its congeners – potent neurotoxins that cause paralytic shellfish poisoning. Isolates from this complex are assigned to A. tamarense, A. fundyense, or A. catenella based on two main morphological characters: the ability to form chains and the presence/absence of a ventral pore between Plates 1′ and 4′. However, studies have shown that these characters are not consistent and/or distinctive. Further, phylogenies based on multiple regions in the rDNA operon indicate that the sequences from morphologically indistinguishable isolates partition into five clades. These clades were initially named based on their presumed geographic distribution, but recently were renamed as Groups I–V following the discovery of sympatry among some groups. In this study we present data on morphology, ITS/5.8S genetic distances, ITS2 compensatory base changes, mating incompatibilities, toxicity, the sxtA toxin synthesis gene, and rDNA phylogenies. All results were consistent with each group representing a distinct cryptic species. Accordingly, the groups were assigned species names as follows: Group I, A. fundyense; Group II, A. mediterraneum; Group III, A. tamarense; Group IV, A. pacificum; Group V, A. australiense. PMID:25460230

  11. Comparison of VITEK2, MALDI-TOF MS, and 16S rDNA sequencing for identification of Myroides odoratus and Myroides odoratimimus.

    PubMed

    Schröttner, Percy; Rudolph, Wolfram W; Eing, Bodo R; Bertram, Sebastian; Gunzer, Florian

    2014-06-01

    The genus Myroides comprises the 2 medically relevant species Myroides odoratus and Myroides odoratimimus that are rare opportunistic pathogens and cause infections in immunocompromised patients. A fast identification of Myroides is of importance because these bacterial strains show multiple resistance against antibiotics and therefore limit treatment options. They are associated, for instance, with urinary tract infections, sepsis, meningitis, pneumonia, and infectious cellulitis. Since more and more Myroides spp. are being described, additional potentially pathogenic bacteria may be identified in the future demanding the need for fast and reliable identification methods at species level. However, to date, only molecular approaches meet these demands. In this study, we, therefore, attempt to define an appropriate method other than DNA fingerprinting that will permit a comparable efficacy and, possibly, a more economical strain identification. For this purpose, we compared 2 widely used automated diagnostic systems (VITEK 2 [bioMérieux, Nürtingen, Germany] and Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry (MALDI-TOF MS) [Bruker Daltonics, Bremen, Germany]) and correlated the results to 16S rDNA sequencing data. In total, we analyzed 22 strains collected in the course of routine diagnostics. In this study, we demonstrate that VITEK 2 reliably identifies the genus Myroides but cannot differentiate between M. odoratimimus and M. odoratus. In contrast to this, both MALDI-TOF MS and 16S rDNA sequencing efficiently distinguish between the 2 species. PMID:24666701

  12. Ultrastructure and 18S rDNA sequence analysis of Wobblia lunata gen. et sp. nov., a new heterotrophic flagellate (Stramenopiles, Incertae sedis).

    PubMed

    Moriya, M; Nakayama, T; Inouye, I

    2000-05-01

    A new heterotrophic flagellate Wobblia lunata gen. et sp. nov. is described. This organism usually attaches to the substratum showing a wobbling motion, and sometimes glides on the substratum or swims freely in the medium. W. lunata has various features characteristic of the stramenopiles. These include a hairy flagellum with tripartite tubular hairs, a mitochondrion with tubular cristae, arrangement of flagellar apparatus components and a double helix in the flagellar transition zone. W. lunata shares a double helix with heterotrophic stramenopiles, including Developayella elegans, oomycetes, hyphochytrids, opalinids and proteromonads, and could be placed in the phylum Bigyra Cavalier-Smith. However, from 18S rDNA tree analysis, these organisms form two distantly-related clades in the stramenopiles, and Wobblia appears at the base of the stramenopiles. Evaluation of morphological features and comparison of 18S rDNA sequences indicate that W. lunata is a member of the stramenopiles, but it is distinct from any other stramenopiles so far described. Its phylogenetic position within the stramenopiles is uncertain and therefore W. lunata is described as a stramenopile incertae sedis. PMID:10896132

  13. The phylogenetic position of the Loimoidae Price, 1936 (Monogenoidea: Monocotylidea) based on analyses of partial rDNA sequences and morphological data.

    PubMed

    Boeger, W A; Kritsky, D C; Domingues, M V; Bueno-Silva, M

    2014-06-01

    Phylogenetic analyses of partial sequences of 18S and 28S rDNA of some monogenoids, including monocotylids and a specimen of Loimosina sp. collected from a hammerhead shark off Brazil, indicated that the Loimoidae (as represented by the specimen of Loimosina sp.) represents an in-group taxon of the Monocotylidae. In all analyses, the Loimoidae fell within a major monocotylid clade including species of the Heterocotylinae, Decacotylinae, and Monocotylinae. The Loimoidae formed a terminal clade with two heterocotyline species, Troglocephalus rhinobatidis and Neoheterocotyle rhinobatis, for which it represented the sister taxon. The following morphological characters supported the clade comprising the Loimoidae, Heterocotylinae, Decacotylinae and Monocotylinae: single vagina present, presence of a narrow deep anchor root, and presence of a marginal haptoral membrane. The presence of cephalic pits was identified as a putative synapomorphy for the clade (Loimoidae (T. rhinobatidis, N. rhinobatis)). Although rDNA sequence data support the rejection of the Loimoidae and incorporating its species into the Monocotylidae, this action was not recommended pending a full phylogenetic analysis of morphological data. PMID:24491371

  14. Morphology and Small Subunit rDNA Phylogeny of Two New Marine Urostylid Ciliates, Caudiholosticha marina sp. nov. and Nothoholosticha flava sp. nov. (Ciliophora, Hypotrichia).

    PubMed

    Li, Ju; Chen, Xumiao; Xu, Kuidong

    2016-07-01

    Two marine urostylid ciliates, Caudiholosticha marina sp. nov. and Nothoholosticha flava sp. nov., isolated from intertidal sediment in the Yellow Sea, are investigated using morphological and small subunit rDNA phylogenetic analyses. Caudiholosticha marina is 210-310 μm × 40-55 μm in vivo, and has 10-20 macronuclear nodules, 23-37 midventral cirral pairs extending to 5-8 transverse cirri, and two caudal cirri. It differs from congeners by its marine habitat, larger size, macronuclear arrangement pattern and high number of midventral pairs. Molecular phylogenetic analyses indicate a polyphyly of Caudiholosticha. Nothoholosticha flava is yellow to brownish and 240-320 μm × 40-60 μm sized, and has a bipartite adoral zone, six frontal cirri in atypical bicorona, usually four frontoterminal, one buccal and 5-7 transverse cirri and 28-54 midventral pairs. Phylogenetic analyses allocate N. flava as sister of N. fasciola, type of the genus. The two Nothoholosticha species differ distinctly by the presence/absence of frontoterminal cirri, a feature often used to define genera in the Hypotrichia. However, the SSU rDNA sequence similarity between these two species is 99.3%, which weakens the justification for separating the new isolate at genus level. The taxonomic significance of frontoterminal cirri is discussed based on morphological and molecular data. PMID:26663360

  15. The effective expression of xylanase gene in Candida utilis by 18S rDNA targeted homologous recombination in pGLR9K.

    PubMed

    Wei, Wang; Hong-Lan, Yang; HuiFang, Bao; Daoyuan, Zhang; Qi-mu-ge, Shan; Woof, Andrew J

    2010-07-01

    In order to test whether 18S rDNA can influence positively xylanase gene effective expression in the yeast of Candida utilis, a targeting vector pGLR9K-XA was constructed by adding an interested gene xynA from Streptomyces olivaceoviridis into the vector pGLR9K which is constructed by ourselves. pGLR9K contains the 18S rDNA, GAP promoter and CYH resistance gene sequence, all of which is from C. utilis. Then the vector pGLR9K-XA was transformed into C. utilis. To test the vector and transformed system, PCR, Southern blot and DNS methods were used. The results showed that xylanase gene can be detected in the chromosome DNA of recombinant C. utilis and the enzyme activity of xylanase is up to 60 IU ml(-1) in the study. It is suggested that this system can be used to express exogenous genes in C. utilis as a bioreactors. This is the first report that xylanase gene was expressed in C. utilis. PMID:19731075

  16. Determination of fruit origin by using 26S rDNA fingerprinting of yeast communities by PCR-DGGE: preliminary application to Physalis fruits from Egypt.

    PubMed

    El Sheikha, Aly Farag; Condur, Ana; Métayer, Isabelle; Nguyen, Doan Duy Le; Loiseau, Gérard; Montet, Didier

    2009-10-01

    The determination of geographical origin is a demand of the traceability system of import-export food products. One hypothesis for tracing the source of a product is by global analysis of the microbial communities of the food and statistical linkage of this analysis to the geographical origin of the food. For this purpose, a molecular technique employing 26S rDNA profiles generated by PCR-DGGE was used to detect the variation in yeast community structures of three species of Physalis fruit (Physalis ixocarpa Brat, Physalis pubescens L, Physalis pruinosa L) from four Egyptian regions (Qalyoubia, Minufiya, Beheira and Alexandria Governments). When the 26S rDNA profiles were analysed by multivariate analysis, distinct microbial communities were detected. The band profiles of Physalis yeasts from different Governments were specific for each location and could be used as a bar code to discriminate the origin of the fruits. This method is a new traceability tool which provides fruit products with a unique biological bar code and makes it possible to trace back the fruits to their original location. PMID:19784935

  17. Secondary structure of expansion segment D1 in LSU rDNA from Arachnida and its phylogenetic application in Eriophyoid mites and in Acari.

    PubMed

    Wang, Zheng-Hang; Zhao, Ya-E; Xu, Yang; Hu, Li; Chen, Yi-Meng

    2015-12-01

    An increasing number of researchers have applied secondary-structure based multiple alignments of rDNA genes in phylogeny. These studies mostly depended on a few valuable divergent domains in LSU and SSU rDNA. Yet other divergent domains, e.g. D1, were poorly investigated and rarely used. However, these domains might contain additional evolutionary data and play a vital role in DNA-based phylogenetic study. Here, we investigated all available D1 sequences of Arachnida taxa and predicted corresponding secondary structures to help identify homologous positions in the D1 region. Long insertions were found exclusive to Eriophyoidea and folded into three newly proposed helices. Non-Acari taxa were all GC rich. In Acari, most Trombidiformes and all Mesostigmata (Parasitiformes) taxa were AT rich and Ixodida (Parasitiformes) GC rich; however there was no consistent base bias in Sarcoptiformes sequences. For Eriophyoid mites, genera Cecidophyopsis and Aceria were both well supported in MP, NJ, ME and ML tress based on D1 sequences, and clusters of Cecidophyopsis species were identical with former study. This demonstrated that the D1 region could act as a valuable molecular marker in phylogenetic reconstruction of Eriophyoidea. Additionally, D1 has been proven suitable in phylogenetic analysis at the family and genus level in Acari, but not in Opiliones. PMID:26420464

  18. Phylogeographic structure of cotton pest Adelphocoris suturalis (Hemiptera: Miridae): strong subdivision in China inferred from mtDNA and rDNA ITS markers.

    PubMed

    Zhang, Lijuan; Li, Hu; Li, Shujuan; Zhang, Aibing; Kou, Fei; Xun, Huaizhu; Wang, Pei; Wang, Ying; Song, Fan; Cui, Jianxin; Cui, Jinjie; Gouge, Dawn H; Cai, Wanzhi

    2015-01-01

    Phylogeographic patterns of some extant plant and vertebrate species have been well studied; however, they are poorly understood in the majority of insects. The study documents analysis of mitochondrial (COI, CYTB and ND5) and nuclear (5.8S rDNA, ITS2 and 28S rDNA) data from 419 individuals of Adelphocoris suturalis, which is one of the main cotton pests found in the 31 locations in China and Japan involved in the study. Results show that the species is highly differentiated between populations from central China and peripheral China regions. Analysis of molecular variance showed a high level of geographical differentiation at different hierarchical levels. Isolation-by-distance test showed no significant correlation between genetic distance and geographical distance among A. suturalis populations, which suggested gene flow is not restricted by distance. In seven peripheral populations, the high levels of genetic differentiation and the small Nem values implied that geographic barriers were more likely restrict gene flow. Neutrality tests and the Bayesian skyline plot suggested population expansion likely happened during the cooling transition between Last Interglacial and Last Glacial Maximum. All lines of evidence suggest that physical barriers, Pleistocene climatic oscillations and geographical heterogeneity have affected the population structure and distribution of this insect in China. PMID:26388034

  19. Phylogeographic structure of cotton pest Adelphocoris suturalis (Hemiptera: Miridae): strong subdivision in China inferred from mtDNA and rDNA ITS markers

    PubMed Central

    Zhang, Lijuan; Li, Hu; Li, Shujuan; Zhang, Aibing; Kou, Fei; Xun, Huaizhu; Wang, Pei; Wang, Ying; Song, Fan; Cui, Jianxin; Cui, Jinjie; Gouge, Dawn H.; Cai, Wanzhi

    2015-01-01

    Phylogeographic patterns of some extant plant and vertebrate species have been well studied; however, they are poorly understood in the majority of insects. The study documents analysis of mitochondrial (COI, CYTB and ND5) and nuclear (5.8S rDNA, ITS2 and 28S rDNA) data from 419 individuals of Adelphocoris suturalis, which is one of the main cotton pests found in the 31 locations in China and Japan involved in the study. Results show that the species is highly differentiated between populations from central China and peripheral China regions. Analysis of molecular variance showed a high level of geographical differentiation at different hierarchical levels. Isolation-by-distance test showed no significant correlation between genetic distance and geographical distance among A. suturalis populations, which suggested gene flow is not restricted by distance. In seven peripheral populations, the high levels of genetic differentiation and the small Nem values implied that geographic barriers were more likely restrict gene flow. Neutrality tests and the Bayesian skyline plot suggested population expansion likely happened during the cooling transition between Last Interglacial and Last Glacial Maximum. All lines of evidence suggest that physical barriers, Pleistocene climatic oscillations and geographical heterogeneity have affected the population structure and distribution of this insect in China. PMID:26388034

  20. [Communities of Actynomicetes fungy in three vegetation types of the Colombian Amazon: abundance, morphotypes and the 16s rDNA gene].

    PubMed

    Cardona, Gladys Inés; Peña-Venegas, Clara Patricia; Ruiz-García, Manuel

    2009-12-01

    Among soil microorganisms, Actinomycetes play an important role in the sustainability of natural and agricultural systems: decomposition of organic matter; degradation of recalcitrant compounds like lignin; nitrogen fixation; degradation of agricultural chemicals and biological control in plants and animals. We evaluated their diversity in soils under three different vegetation covers (pasture, tropical primary forest and stubble) at two depths in the Southern Colombian Amazon border. We collected five replicates per vegetation type (in each, three samples at 0-20cm and three at 20-30cm; for a total of 30 samples). Abundance and phenotypic diversity were determined by plate counting. Genomic DNA was extracted from the isolates: the 16s rDNA gene was amplified with specific primers, and its genetic diversity was estimated by means of an amplified restriction analysis (ARDRA). Actynomicetes abundance varied with vegetation and depth, possibly reflecting presence of earthworms, macro-fauna and physico-chemical characteristics associated to fertility, as well as organic matter, total bases, and optimal capacity to cationic interchange. Primary forests had the highest diversity. Sixteen morpho-types (six genera) were identified; Streptomyces was the most abundant everywhere. The heterogeneity ofARDRA patterns prevented species identification because of the intra-species variability in sequences of 16s rDNA operons. This community is a biological indicator of landscape alteration and could include new bio-active compounds of pharmaceutical interest. PMID:20073339

  1. Culturable bacteria present in the fluid of the hooded-pitcher plant Sarracenia minor based on 16S rDNA gene sequence data.

    PubMed

    Siragusa, Alex J; Swenson, Janice E; Casamatta, Dale A

    2007-08-01

    The culturable microbial community within the pitcher fluid of 93 Sarracenia minor carnivorous plants was examined over a 2-year study. Many aspects of the plant/bacterial/insect interaction within the pitcher fluid are minimally understood because the bacterial taxa present in these pitchers have not been identified. Thirteen isolates were characterized by 16S rDNA sequencing and subsequent phylogenetic analysis. The Proteobacteria were the most abundant taxa and included representatives from Serratia, Achromobacter, and Pantoea. The Actinobacteria Micrococcus was also abundant while Bacillus, Lactococcus, Chryseobacterium, and Rhodococcus were infrequently encountered. Several isolates conformed to species identifiers (>98% rDNA gene sequence similarity) including Serratia marcescens (isolates found in 27.5% of pitchers), Achromobacter xylosoxidans (37.6%), Micrococcus luteus (40.9%), Bacillus cereus (isolates found in 10.2%), Bacillus thuringiensis (5.4%), Lactococcus lactis (17.2%), and Rhodococcus equi (2.2%). Species-area curves suggest that sampling efforts were sufficient to recover a representative culturable bacterial community. The bacteria present represent a diverse community probably as a result of introduction by insect vectors, but the ecological significance remains under explored. PMID:17380356

  2. Dynamic changes in the distribution of a satellite homologous to intergenic 26-18S rDNA spacer in the evolution of Nicotiana.

    PubMed Central

    Lim, K Y; Skalicka, K; Koukalova, B; Volkov, R A; Matyasek, R; Hemleben, V; Leitch, A R; Kovarik, A

    2004-01-01

    An approximately 135-bp sequence called the A1/A2 repeat was isolated from the transcribed region of the 26-18S rDNA intergenic spacer (IGS) of Nicotiana tomentosiformis. Fluorescence in situ hybridization (FISH) and Southern blot analysis revealed its occurrence as an independent satellite (termed an A1/A2 satellite) outside of rDNA loci in species of Nicotiana section Tomentosae. The chromosomal location, patterns of genomic dispersion, and copy numbers of its tandemly arranged units varied between the species. In more distantly related Nicotiana species the A1/A2 repeats were found only at the nucleolar organizer regions (NOR). There was a trend toward the elimination of the A1/A2 satellite in N. tabacum (tobacco), an allotetraploid with parents closely related to the diploids N. sylvestris and N. tomentosiformis. This process may have already commenced in an S(3) generation of synthetic tobacco. Cytosine residues in the IGS were significantly hypomethylated compared with the A1/A2 satellite. There was no clear separation between the IGS and satellite fractions in sequence analysis of individual clones and we found no evidence for CG suppression. Taken together the data indicate a dynamic nature of the A1/A2 repeats in Nicotiana genomes, with evidence for recurrent integration, copy number expansions, and contractions. PMID:15126410

  3. Molecular analysis of the genus Mitragyna existing in Thailand based on rDNA ITS sequences and its application to identify a narcotic species: Mitragyna speciosa.

    PubMed

    Sukrong, Suchada; Zhu, Shu; Ruangrungsi, Nijsiri; Phadungcharoen, Thatree; Palanuvej, Chanida; Komatsu, Katsuko

    2007-07-01

    In Thailand, there are four Mitragyna species; M. speciosa, M. hirsuta, M. diversifolia, and M. rotundifolia. One, M. speciosa, is a narcotic plant and has medicinal importance for its opium-like effect. Since the use of M. speciosa has been forbidden in Thailand, the leaves of M. diversifolia or others are frequently used as substitutes but are not considered as effective. Therefore, accurate authentication of M. speciosa is essential for both medicinal and forensic purposes. The nucleotide sequences of internal transcribed spacers (ITS) and the 5.8S coding region of nuclear ribosomal DNA (rDNA) of the Mitragyna species were analyzed. The whole length of ITS1-5.8S-ITS2 region was 608 bp in M. speciosa, 607 bp in the other species. Nineteen sites of nucleotide substitutions and 3 sites of 1-bp indels were observed, and M. speciosa showed specific sequence differed from the others. Based on the ITS sequences, a distinctive site recognized by a restriction enzyme XmaI in M. speciosa was found and then PCR-restriction fragment length polymorphism (RFLP) analysis was established to differentiate M. speciosa from the others. By the method, a 409-bp PCR fragment of ITS1-5.8S (partial) rDNA region from M. speciosa was cleaved into two fragments of 119 bp and 290 bp while the other species remained undigested. This method provides an effective and accurate identification of M. speciosa. PMID:17603168

  4. Genomic-Based Restriction Enzyme Selection for Specific Detection of Piscirickettsia salmonis by 16S rDNA PCR-RFLP

    PubMed Central

    Mandakovic, Dinka; Glasner, Benjamín; Maldonado, Jonathan; Aravena, Pamela; González, Mauricio; Cambiazo, Verónica; Pulgar, Rodrigo

    2016-01-01

    The gram negative facultative bacterium P. salmonis is the etiological agent of Salmonid Rickettsial Septicaemia (SRS), a severe disease that causes important economic losses in the global salmon farmer industry. Despite efforts to control this disease, the high frequency of new epizootic events indicate that the vaccine and antibiotics treatments have limited effectiveness, therefore the preventive and diagnostic approaches must be improved. A comparison of several methodologies for SRS diagnostic indicate differences in their specificity and its capacity to detect other bacteria coexisting with P. salmonis in culture media (contamination) and fish samples (coinfection), aspects relevant for research, vaccine development and clinical diagnostic. By computer-simulation analyses, we identified a group of restriction enzymes that generate unique P. salmonis 16S rDNA band patterns, distinguishable from all other bacteria. From this information, we designed and developed a PCR-RFLP (Polymerase Chain Reaction—Restriction Fragment Length Polymorphism) assay, which was validated using 16S rDNA universal primers and restriction enzyme PmaCI for the amplification and digestion, respectively. Experimental validation was performed by comparing the restriction pattern of P. salmonis with the restriction patterns generated by bacteria that cohabit with P. salmonis (fish bacterial isolates and culture media contaminants). Our results indicate that the restriction enzyme selection pipeline was suitable to design a more specific, sensible, faster and cheaper assay than the currently used P. salmonis detection methodologies. PMID:27242682

  5. Appearance and evolution of the specific chromosomal rearrangements associated with malignant transformation of mouse m5S cells

    SciTech Connect

    Kodama, S.; Okumura, Y.; Komatsu, K.; Sasaki, M.S. )

    1991-06-01

    Chromosomal alterations were studied during the acquisition of malignant phenotypes in two karyotypically distinct cells isolated from transformed foci induced by x-irradiation in mouse m5S cells. Because the transformants, despite foci origin, showed low ability to grow in agar, they were cultured in vitro with serial transfer schedules to allow further cell generations and assayed for anchorage independence (AI) at each passage level. The AI frequency increased with the cell doubling numbers. Chromosome analysis showed that a focus was one cell origin, but the transformants showed karyotypic instability during cell proliferation, giving rise to the rearrangements clustered in the distal region of the specific chromosomes. These rearrangements appeared to be directed toward the acquisition of malignant phenotypes. Analysis of the types and sites of rearrangements indicated that a mechanism exists that induces frequent rearrangements of the specific region of a chromosome during the process of transformation into the malignant state.

  6. Molecular authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii by ITS and 5S rRNA spacer sequencing.

    PubMed

    Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui

    2007-01-01

    In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii. PMID:17202681

  7. Ln3I5(S2N2)(S2)(THF)10 - a new type of molecular compounds.

    PubMed

    Fagin, A A; Fukin, G K; Cherkasov, A V; Shestakov, A F; Pushkarev, A P; Balashova, T V; Maleev, A A; Bochkarev, M N

    2016-03-21

    Unprecedented complexes of the composition Ln3I5(S2N2)(S2)(THF)10 were obtained in the reactions of neodymium and dysprosium iodide-nitrides with sulfur. The inorganic core of the molecules contains the cyclic fragments Ln(μ-S2)Ln, LnSNSN and LnSN. Ten of the fourteen atoms of the core are coplanar, the remaining four S2 and I2 atoms lie in the other two orthogonal planes. The dysprosium complex upon excitation with UV light exhibits the metal-centered luminescence characteristic of the Dy(3+) ion. Geometric parameters of the molecules, computational data, electron spectroscopy and fluorescence suggest the existence of some conjugation in the mentioned heterocycles. PMID:26842841

  8. Development and Application of Multiple-Probe Scanning Probe Microscopes

    SciTech Connect

    Nakayama, T.; Kubo, O.; Shingaya, Y.; Higuchi, S.; Hasegawa, T.; Jiang, C. S.; Okuda, T.; Kuwahara, Y.; Takami, K.; Aono, M.

    2012-04-03

    the research of advanced materials based on nanoscience and nanotechnology, it is often desirable to measure nanoscale local electrical conductivity at a designated position of a given sample. For this purpose, multiple-probe scanning probe microscopes (MP-SPMs), in which two, three or four scanning tunneling microscope (STM) or atomic force microscope (AFM) probes are operated independently, have been developed. Each probe in an MP-SPM is used not only for observing high-resolution STM or AFM images but also for forming an electrical contact enabling nanoscale local electrical conductivity measurement. The world's first double-probe STM (DP-STM) developed by the authors, which was subsequently modified to a triple-probe STM (TP-STM), has been used to measure the conductivities of one-dimensional metal nanowires and carbon nanotubes and also two-dimensional molecular films. A quadruple-probe STM (QP-STM) has also been developed and used to measure the conductivity of two-dimensional molecular films without the ambiguity of contact resistance between the probe and sample. Moreover, a quadruple-probe AFM (QP-AFM) with four conductive tuning-fork-type self-detection force sensing probes has been developed to measure the conductivity of a nanostructure on an insulating substrate. A general-purpose computer software to control four probes at the same time has also been developed and used in the operation of the QP-AFM. These developments and applications of MP-SPMs are reviewed in this paper.

  9. High pressure Raman study of layered Mo0.5W0.5S2 ternary compound

    NASA Astrophysics Data System (ADS)

    Kim, Joon-Seok; Moran, Samuel T.; Nayak, Avinash P.; Pedahzur, Shahar; Ruiz, Itzel; Ponce, Gabriela; Rodriguez, Daniela; Henny, Joanna; Liu, Jin; Lin, Jung-Fu; Akinwande, Deji

    2016-06-01

    Ternary two-dimensional (2D) transition metal dichalcogenide compounds exhibit a tunable electronic structure allowing for control of the interlayer and the intralayer atomic displacement to efficiently tune their physical and electronic properties. Using a diamond anvil cell, hydrostatic pressure was applied to Mo0.5W0.5S2 up to 40 GPa in order to study the optical phonon vibrational modes. Analysis of the high-pressure Raman spectra shows that the two in-plane E2g modes resembling that of pristine MoS2 and WS2, as well as disorder-activated longitudinal acoustic phonon mode, are hardened and suppressed as pressure increases. The two A1g modes of the ternary compound that resemble the A1g modes of pristine MoS2 and WS2, displayed similar Raman shifts to the pristine compounds as pressure increases. A Raman peak at 470 cm-1 that is close to A1g peaks emerges at ˜8 GPa, which represents a disorder-activated pressure-induced out-of-plane Raman mode observed only in the ternary compound under high pressure. At pressures above ˜30 GPa, a Raman peak at approximately 340 cm-1 is observed, signifying additional disorder-activated vibration mode. Our results reveal the enhanced interactions in the structural and vibrational behavior of the MoS2 and WS2 domains in the Mo0.5W0.5S2 compound under hydrostatic pressure. These results could have implications in understanding the electronic, optical, and structural properties of the new 2D ternary compound materials under extreme mechanical conditions.

  10. New Degenerate Cytophaga-Flexibacter-Bacteroides-Specific 16S Ribosomal DNA-Targeted Oligonucleotide Probes Reveal High Bacterial Diversity in River Taff Epilithon

    PubMed Central

    O’Sullivan, Louise A.; Weightman, Andrew J.; Fry, John C.

    2002-01-01

    River microbial communities play an important role in global nutrient cycles, and aggregated bacteria such as those in epilithic biofilms may be major contributors. In this study the bacterial diversity of River Taff epilithon in South Wales was investigated. A 16S ribosomal DNA (rDNA) clone library was constructed and analyzed by partial sequencing of 76 of 347 clones and hybridization with taxon-specific probes. The epilithon was found to be very diverse, with an estimated 59.6% of the bacterial populations not accounted for by these clones. Members of the Cytophaga-Flexibacter-Bacteroides division (CFBs) were most abundant in the library, representing 25% of clones, followed by members of the α subdivision of the division Proteobacteria (α-Proteobacteria), γ-Proteobacteria, gram-positive bacteria, Cyanobacteria, β-Proteobacteria, δ-Proteobacteria, and the Prosthecobacter group. This study concentrated on the epilithic CFB populations, and a new set of degenerate 16S rDNA probes was developed to enhance their detection, namely, CFB560, CFB562, and CFB376. The commonly used probe CF319a/b may frequently lead to the underestimation of CFB populations in environmental studies, because it does not fully detect members of the division. CFB560 had exact matches to 95.6% of CFBs listed in the Ribosomal Database Project (release 8.0) small-subunit phylogenetic trees, compared to 60% for CF319a/b. The CFB probes detected 66 of 347 epilithon TAF clones, and 60 of these were partially sequenced. They affiliated with the RDP-designated groups Cytophaga, Sphingobacterium, Lewinella, and Cytophaga aurantiaca. CFB560 and CF319a/b detected 94% (62 of 66) and 48.5% (32 of 66) of clones, respectively, and therefore CFB560 is recommended for future use. Probe design in this study illustrated that multiple degenerate positions can greatly increase target range without adversely effecting specificity or experimental performance. PMID:11772628

  11. Variable path length spectrophotometric probe

    DOEpatents

    O'Rourke, Patrick E.; McCarty, Jerry E.; Haggard, Ricky A.

    1992-01-01

    A compact, variable pathlength, fiber optic probe for spectrophotometric measurements of fluids in situ. The probe comprises a probe body with a shaft having a polished end penetrating one side of the probe, a pair of optic fibers, parallel and coterminous, entering the probe opposite the reflecting shaft, and a collimating lens to direct light from one of the fibers to the reflecting surface of the shaft and to direct the reflected light to the second optic fiber. The probe body has an inlet and an outlet port to allow the liquid to enter the probe body and pass between the lens and the reflecting surface of the shaft. A linear stepper motor is connected to the shaft to cause the shaft to advance toward or away from the lens in increments so that absorption measurements can be made at each of the incremental steps. The shaft is sealed to the probe body by a bellows seal to allow freedom of movement of the shaft and yet avoid leakage from the interior of the probe.

  12. Heat transfer probe

    DOEpatents

    Frank, Jeffrey I.; Rosengart, Axel J.; Kasza, Ken; Yu, Wenhua; Chien, Tai-Hsin; Franklin, Jeff

    2006-10-10

    Apparatuses, systems, methods, and computer code for, among other things, monitoring the health of samples such as the brain while providing local cooling or heating. A representative device is a heat transfer probe, which includes an inner channel, a tip, a concentric outer channel, a first temperature sensor, and a second temperature sensor. The inner channel is configured to transport working fluid from an inner inlet to an inner outlet. The tip is configured to receive at least a portion of the working fluid from the inner outlet. The concentric outer channel is configured to transport the working fluid from the inner outlet to an outer outlet. The first temperature sensor is coupled to the tip, and the second temperature sensor spaced apart from the first temperature sensor.

  13. Solar Probe Plus

    NASA Technical Reports Server (NTRS)

    Szabo, Adam

    2011-01-01

    The NASA Solar Probe Plus mission is planned to be launched in 2018 to study the upper solar corona with both.in-situ and remote sensing instrumentation. The mission will utilize 6 Venus gravity assist maneuver to gradually lower its perihelion to 9.5 Rs below the expected Alfven pOint to study the sub-alfvenic solar wind that is still at least partially co-rotates with the Sun. The detailed science objectives of this mission will be discussed. SPP will have a strong synergy with The ESA/NASA Solar orbiter mission to be launched a year ahead. Both missions will focus on the inner heliosphere and will have complimentary instrumentations. Strategies to exploit this synergy will be also presented.

  14. New probe of naturalness.

    PubMed

    Craig, Nathaniel; Englert, Christoph; McCullough, Matthew

    2013-09-20

    Any new scalar fields that perturbatively solve the hierarchy problem by stabilizing the Higgs boson mass also generate new contributions to the Higgs boson field-strength renormalization, irrespective of their gauge representation. These new contributions are physical, and in explicit models their magnitude can be inferred from the requirement of quadratic divergence cancellation; hence, they are directly related to the resolution of the hierarchy problem. Upon canonically normalizing the Higgs field, these new contributions lead to modifications of Higgs couplings that are typically great enough that the hierarchy problem and the concept of electroweak naturalness can be probed thoroughly within a precision Higgs boson program. Specifically, at a lepton collider this can be achieved through precision measurements of the Higgs boson associated production cross section. This would lead to indirect constraints on perturbative solutions to the hierarchy problem in the broadest sense, even if the relevant new fields are gauge singlets. PMID:24093250

  15. Trapping and Probing Antihydrogen

    SciTech Connect

    Wurtele, Jonathan

    2013-03-27

    Precision spectroscopy of antihydrogen is a promising path to sensitive tests of CPT symmetry. The most direct route to achieve this goal is to create and probe antihydrogen in a magnetic minimum trap. Antihydrogen has been synthesized and trapped for 1000s at CERN by the ALPHA Collaboration. Some of the challenges associated with achieving these milestones will be discussed, including mixing cryogenic positron and antiproton plasmas to synthesize antihydrogen with kinetic energy less than the trap potential of .5K. Recent experiments in which hyperfine transitions were resonantly induced with microwaves will be presented. The opportunity for gravitational measurements in traps based on detailed studies of antihydrogen dynamics will be described. The talk will conclude with a discussion future antihydrogen research that will use a new experimental apparatus, ALPHA-I.

  16. Nondestructive Test Probe

    NASA Technical Reports Server (NTRS)

    1996-01-01

    Under the Aircraft Structural Integrity program, Langley Research Center invented a device to detect fatigue cracks in aluminum alloy plates. Krautkramer Branson obtained an exclusive license and commercialized a hand-held device, the "CrackFinder," an electromagnetic probe for nondestructive evaluation, used to scan aircraft skins for surface breaks. The technology involves an eddy current, which is an electrical current induced by an alternating magnetic field. The CrackFinder also employs an innovative self-nulling feature, where the device automatically recalibrates to zero so that each flaw detected produces a reading. Compared to conventional testing systems, the CrackFinder is affordable, small, simple to use, and needs no calibration.

  17. Advanced Langmuir Probe (LP)

    NASA Technical Reports Server (NTRS)

    Voronka, N. R.; Block, B. P.; Carignan, G. R.

    1991-01-01

    The dynamic response of the MK-2 version of the Langmuir probe amplifier was studied. The settling time of the step response is increased by: (1) stray node-to-ground capacitance at series connections between high value feedback resistors; and (2) input capacitance due to the input cable, FET switches, and input source follower. The stray node-to-ground capacitances can be reduced to tolerable levels by elevating the string of feedback resistors above the printing board. A new feedback network was considered, with promising results. The design uses resistances having much lower nominal values, thereby minimizing the effect of stray capacitances. Faster settling times can be achieved by using an operational amplifier having a higher gain-bandwidth product.

  18. Single Probes, Double Probes, and the Structure of Memory Traces.

    ERIC Educational Resources Information Center

    Bruce, Darryl

    1980-01-01

    Memory for names was queried by single probes consisting of conceptual information about the persons or by double probes combining two single cues. Results were viewed as consistent with Jones's fragmentation hypothesis and with the general class of associative theories of memory. (Author/RD)

  19. Small rocket tornado probe

    SciTech Connect

    Colgate, S.A.

    1982-01-01

    A (less than 1 lb.) paper rock tornado probe was developed and deployed in an attempt to measure the pressure, temperature, ionization, and electric field variations along a trajectory penetrating a tornado funnel. The requirements of weight and materials were set by federal regulations and a one-meter resolution at a penetration velocity of close to Mach 1 was desired. These requirements were achieved by telemetering a strain gage transducer for pressure, micro size thermister and electric field, and ionization sensors via a pulse time telemetry to a receiver on board an aircraft that digitizes a signal and presents it to a Z80 microcomputer for recording on mini-floppy disk. Recording rate was 2 ms for 8 channels of information that also includes telemetry rf field strength, magnetic field for orientation on the rocket, zero reference voltage for the sensor op amps as well as the previously mentioned items also. The absolute pressure was recorded. Tactically, over 120 h were flown in a Cessna 210 in April and May 1981, and one tornado was encountered. Four rockets were fired at this tornado, missed, and there were many equipment problems. The equipment needs to be hardened and engineered to a significant degree, but it is believed that the feasibility of the probe, tactics, and launch platform for future tornado work has been proven. The logistics of thunderstorm chasing from a remote base in New Mexico is a major difficulty and reliability of the equipment another. Over 50 dummy rockets have been fired to prove trajectories, stability, and photographic capability. Over 25 electronically equipped rockets have been fired to prove sensors transmission, breakaway connections, etc. The pressure recovery factor was calibrated in the Air Force Academy blow-down tunnel. There is a need for more refined engineering and more logistic support.

  20. Adaptive scanning probe microscopies

    SciTech Connect

    Swartzentruber, B.S.; Bouchard, A.M.; Osbourn, G.C.

    1997-02-01

    This work is comprised of two major sections. In the first section the authors develop multivariate image classification techniques to distinguish and identify surface electronic species directly from multiple-bias scanning tunneling microscope (STM) images. Multiple measurements at each site are used to distinguish and categorize inequivalent electronic or atomic species on the surface via a computerized classification algorithm. Then, comparison with theory or other suitably chosen experimental data enables the identification of each class. They demonstrate the technique by analyzing dual-polarity constant-current topographs of the Ge(111) surface. Just two measurements, negative- and positive-bias topography height, permit pixels to be separated into seven different classes. Labeling four of the classes as adatoms, first-layer atoms, and two inequivalent rest-atom sites, they find excellent agreement with the c(2 x 8) structure. The remaining classes are associated with structural defects and contaminants. This work represents a first step toward developing a general electronic/chemical classification and identification tool for multivariate scanning probe microscopy imagery. In the second section they report measurements of the diffusion of Si dimers on the Si(001) surface at temperatures between room temperature and 128 C using a novel atom-tracking technique that can resolve every diffusion event. The atom tracker employs lateral-positioning feedback to lock the STM probe tip into position above selected atoms with sub-Angstrom precision. Once locked the STM tracks the position of the atoms as they migrate over the crystal surface. By tracking individual atoms directly, the ability of the instrument to measure dynamic events is increased by a factor of {approximately} 1,000 over conventional STM imaging techniques.