Sample records for 5s rdna sequences

  1. Comparative Studies of 5S rDNA Profiles and Cyt b Sequences in two Onychostoma Species (Cyprinidae)

    PubMed Central

    Han, Chiao-Chuan; Yen, Tsair-Bor; Chen, Nian-Cih; Tseng, Mei-Chen


    Onychostoma barbatulum and O. alticorpus, two primarily freshwater cyprinid fish, have similar morphological characters and partially overlapping ecological habitats. In order to explore the genetic differences between these two species, chromosomal characteristics and genetic variations were examined by fluorescence in situ hybridization (FISH) of 5S rDNA and cytochrome (Cyt) b gene analysis. Ten specimens of O. barbatulum and O. alticorpus were collected from the Nanzihsian Stream in southern Taiwan. FISH revealed that the 5S rDNA loci of O. barbatulum and O. alticorpus were found at a pericentromeric and subtelomeric position, respectively, in a pair of submetacentric chromosomes. Cyt b genes were amplified and sequenced from five individuals of each species. Intraspecific genetic distances ranged from 0.001–0.004 in O. barbatulum and from 0.001–0.006 in O. alticorpus. Genetic distances between these two species ranged from 0.132–0.142. The phylogenetic tree showed these two species are not sister species. In conclusion, FISH cytogenetic information and Cyt b gene analyses indicated that these two species have significantly different genetic characteristics; nevertheless, their morphological similarities may be due to environmental adaptation. PMID:26690426

  2. Karyotype divergence and spreading of 5S rDNA sequences between genomes of two species: darter and emerald gobies ( Ctenogobius , Gobiidae).


    Lima-Filho, P A; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Molina, W F


    Karyotype analyses of the cryptobenthic marine species Ctenogobius boleosoma and C. smaragdus were performed by means of classical and molecular cytogenetics, including physical mapping of the multigene 18S and 5S rDNA families. C. boleosoma has 2n = 44 chromosomes (2 submetacentrics + 42 acrocentrics; FN = 46) with a single chromosome pair each carrying 18S and 5S ribosomal sites; whereas C. smaragdus has 2n = 48 chromosomes (2 submetacentrics + 46 acrocentrics; FN = 50), also with a single pair bearing 18S rDNA, but an extensive increase in the number of GC-rich 5S rDNA sites in 21 chromosome pairs. The highly divergent karyotypes among Ctenogobius species contrast with observations in several other marine fish groups, demonstrating an accelerated rate of chromosomal evolution mediated by both chromosomal rearrangements and the extensive dispersion of 5S rDNA sequences in the genome. PMID:24643007

  3. Molecular confirmation of the genomic constitution of Douglasdeweya (Triticeae: Poaceae): demonstration of the utility of the 5S rDNA sequence as a tool for haplome identification.


    Baum, Bernard R; Johnson, Douglas A


    A new genus Douglasdeweya containing the two species, Douglasdeweya deweyi and D. wangii was published in 2005 by Yen et al. based upon the results of cytogenetical and morphological findings. The genome constitution of Douglasdeweya-PPStSt-allowed its segregation from the genus Pseudoroegneria which contains the StSt or StStStSt genomes. Our previous work had demonstrated the utility of using 5S rDNA units, especially the non-transcribed spacer sequence variation, for the resolution of genomes (haplomes) previously established by cytology. Here, we show that sequence analysis of the 5S DNA units from these species strongly supports the proposed species relationships of Yen et al. (Can J Bot 83:413-419, 2005), i.e., the PP genome from Agropyron and the StSt genome from Pseudoroegneria. Analysis of the 5S rDNA units constitutes a powerful tool for genomic research especially in the Triticeae. PMID:18421479

  4. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.


    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti


    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit. PMID:27106499

  5. Chromosomal Mapping of Repetitive DNA Sequences in Five Species of Astyanax (Characiformes, Characidae) Reveals Independent Location of U1 and U2 snRNA Sites and Association of U1 snRNA and 5S rDNA.


    Silva, Duilio M Z A; Utsunomia, Ricardo; Pansonato-Alves, José C; Oliveira, Cláudio; Foresti, Fausto


    Astyanax is a genus of Characidae fishes currently composed of 155 valid species. Previous cytogenetic studies revealed high chromosomal diversification among them, and several studies have been performed using traditional cytogenetic techniques to investigate karyotypes and chromosomal locations of 18S and 5S rDNA genes. However, only a few studies are currently available about other repetitive sequences. Here, the chromosomal location of small nuclear RNA genes, identified as U1 and U2 snRNA clusters, was established and compared to the distribution of 5S rDNA and histone clusters in 5 Astyanax species (A. paranae, A. fasciatus, A. bockmanni, A. altiparanae, and A. jordani) using FISH. The cytogenetic mapping of U1 and U2 snRNA demonstrated a conserved pattern in the number of sites per genome independent of the location in Astyanax species. The location of the U1 snRNA gene was frequently associated with 5S rDNA sequences, indicating a possible interaction between the distinct repetitive DNA families. Finally, comparisons involving the location of U1 and U2 snRNA clusters in the chromosomes of Astyanax species revealed a very diverse pattern, suggesting that many rearrangements have occurred during the diversification process of this group. PMID:26329975

  6. [Analysis of 5S rDNA changes in synthetic allopolyploids Triticum x Aegilops].


    Shcherban', A B; Sergeeva, E M; Badaeva, E D; Salina, E A


    By the example of three synthetic allopolyploids: Aegilops sharonensis x Ae. umbellulata (2n =28), Triticum urartu x Ae. tauschii (2n =28), T. dicoccoides x Ae. tauschii (2n =42) the 5S rDNA changes at the early stage of allopolyploidization were investigated. Using fluorescent in situ hybridization (FISH), the quantitative changes affecting the separate loci of one of the parental genomes were revealed in plants of S3 generation of each hybrid combination. Souther hybridization with genomic DNA of allopolyploid T. urartu x Ae. tauschii (TMU38 x TQ27) revealed lower intensity of the fragments from Ae. tauschii compared with the T. urartu fragments. It may be confirmation of the reduction of signal on 1D chromosome that was revealed in this hybrid using FISH. Both appearance of a new 5S rDNA fragments and full disappearance of fragments from parental species were not showed by Southern hybridization, as well as PCR-analysis of 5-15 plants of S2-S3 generations. The changes were not found under comparison of primary structure of nine 5S rDNA sequences of allopolyploid TMU38 x TQ27 with analogous sequences from parental species genomes. The observable similarity by FISH results of one of the studied synthetic allopolyploids with natural allopolyploid of similar genome composition indicates the early formation of unique for each allopolyploid 5S rDNA organization. PMID:18856060

  7. Molecular organization of the 5S rDNA gene type II in elasmobranchs.


    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian


    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS. PMID:26488198

  8. Analysis of 5S rDNA arrays in Arabidopsis thaliana: physical mapping and chromosome-specific polymorphisms.


    Cloix, C; Tutois, S; Mathieu, O; Cuvillier, C; Espagnol, M C; Picard, G; Tourmente, S


    A physical map of a pericentromeric region of chromosome 5 containing a 5S rDNA locus and spanning approximately 1000 kb was established using the CIC YAC clones. Three 5S rDNA arrays were resolved in this YAC contig by PFGE analysis and we have mapped different types of sequences between these three blocks. 5S rDNA units from each of these three arrays of chromosome 5, and from chromosomes 3 and 4, were isolated by PCR. A total of 38 new DNA sequences were obtained. Two types of 5S rDNA repeated units exist: the major variant with 0.5-kb repeats and one with short repeats (251 bp) only detected on YAC 11A3 from chromosome 3. Although the 38 sequences displayed noticeable heterogeneity, we were able to group them according to their 5S array origin. The presence of 5S array-specific variants was confirmed with the restriction polymorphism study of all the YACs carrying 5S units. PMID:10810091

  9. Molecular dissection of the rDNA array and of the 5S rDNA gene in Meloidogyne artiellia: phylogenetic and diagnostic implications.


    Veronico, Pasqua; De Luca, Francesca; De Giorgi, Carla


    The sequence of a 13.423 nucleotide genomic fragment has been determined for the plant parasitic nematode Meloidogyne artiellia. It contains an entire rDNA cluster, the bordering intergenic regions and portions of the flanking coding regions. The sequence analysis of the rDNA repeats suggests homogeneity in M. artiellia, thus providing a further indication of the usefulness of these genes for the diagnostic identification of this species. The comparison of the secondary structures of the internal transcribed spacer 2 region in several Meloidogyne species indicates that RNA folding predictions can be used as a tool of potential diagnostic relevance. The other ribosomal gene, 5S rDNA, has been demonstrated to be functional and located near the trans-spliced leader sequences, in the same arrangement found in the distantly related nematode Caenorhabditis elegans but never in other Meloidogyne thus providing species-specific markers for the identification of several Thylenchida parasitic nematodes. PMID:15135452

  10. A Pol V–Mediated Silencing, Independent of RNA–Directed DNA Methylation, Applies to 5S rDNA

    PubMed Central

    Douet, Julien; Tutois, Sylvie; Tourmente, Sylvette


    The plant-specific RNA polymerases Pol IV and Pol V are essential to RNA–directed DNA methylation (RdDM), which also requires activities from RDR2 (RNA–Dependent RNA Polymerase 2), DCL3 (Dicer-Like 3), AGO4 (Argonaute), and DRM2 (Domains Rearranged Methyltransferase 2). RdDM is dedicated to the methylation of target sequences which include transposable elements, regulatory regions of several protein-coding genes, and 5S rRNA–encoding DNA (rDNA) arrays. In this paper, we have studied the expression of the 5S-210 transcript, a marker of silencing release at 5S RNA genes, to show a differential impact of RNA polymerases IV and V on 5S rDNA arrays during early development of the plant. Using a combination of molecular and cytological assays, we show that Pol IV, RDR2, DRM2, and Pol V, actors of the RdDM, are required to maintain a transcriptional silencing of 5S RNA genes at chromosomes 4 and 5. Moreover, we have shown a derepression associated to chromatin decondensation specific to the 5S array from chromosome 4 and restricted to the Pol V–loss of function. In conclusion, our results highlight a new role for Pol V on 5S rDNA, which is RdDM–independent and comes specifically at chromosome 4, in addition to the RdDM pathway. PMID:19834541

  11. Interplay of RNA Pol IV and ROS1 during post-embryonic 5S rDNA chromatin remodeling.


    Douet, Julien; Blanchard, Bertrand; Cuvillier, Claudine; Tourmente, Sylvette


    We have investigated the chromatin structure of 5S rDNA, a heterochromatic pericentromeric tandemly repeated family, at 2, 3, 4 and 5 days post-germination. Our results revealed a large-scale reorganization of 5S rDNA chromatin that occurs during the first days of development. Unexpectedly, there is a decondensation followed by a 're'condensation of 5S rDNA chromatin, to obtain almost mature nuclei 5 d post-germination. The reorganization of 5S rDNA chromatin is accompanied by a rapid and active demethylation of 5S rDNA mediated by the ROS1 (repressor of silencing 1) demethylase, whereas the plant-specific RNA polymerase IV (Pol IV) is essential to the 5S chromatin 're'condensation. In conclusion, Pol IV and ROS1 collaborate to unlock the 5S rDNA chromatin inherited from the seed, and establish adult features. PMID:18845569

  12. Chromosome mapping of 18S rDNA and 5S rDNA by dual-color fluorescence in situ hybridization in the half-smooth tongue sole (Cynoglossus semilaevis).


    Jiang, L; Jiang, J; Liu, J; Yuan, J; Chen, Y; Zhang, Q; Wang, X


    Half-smooth tongue sole (Cynoglossus semilaevis) is an important aquaculture flatfish in China. Cytogenetic analysis has revealed that its sex determination system is female heterogametic (ZZ/ZW). The W chromosome is morphologically larger and has been considered evolutionarily younger than any other chromosome in the set. However, the genetic origin and evolution process of this neo-chromosome remains unclear. In this study, 2 tandem arrays of rRNA genes were chosen to address this question. Both the major rDNA (18S rDNA) and the minor rDNA (5S rDNA) were located on the C. semilaevis chromosomes by fluorescence in situ hybridization (FISH). Six 18S rDNA signals were observed on the centromeric regions of 3 pairs of autosomes in both males and females. In females, there was an additional 18S rDNA signal mapping to the telomeric region of the W chromosome long arm. With respect to the 5S rDNA, 12 signals were mapped to the centromeric regions of six pairs of autosomes. Two-color FISH further confirmed that the two pairs of the 5S rDNA signals were correspondingly located at the same positions of the same autosomes as those of the 18S rDNA signals. These results allowed us to speculate about the evolution process of the W chromosome. Chromosome fusions and repetitive sequence accumulations might have occurred in C. semilaevis. The synteny and non-synteny of C. semilaevis 18S rDNA and 5S rDNA might imply the original and evolutionary characteristics of this species. These findings will facilitate studies on karyotype evolution of the order Pleuronectiformes. PMID:25526196

  13. Sequence and organization of 5S ribosomal RNA-encoding genes of Arabidopsis thaliana.


    Campell, B R; Song, Y; Posch, T E; Cullis, C A; Town, C D


    We have isolated a genomic clone containing Arabidopsis thaliana 5S ribosomal RNA (rRNA)-encoding genes (rDNA) by screening an A. thaliana library with a 5S rDNA probe from flax. The clone isolated contains seven repeat units of 497 bp, plus 11 kb of flanking genomic sequence at one border. Sequencing of individual subcloned repeat units shows that the sequence of the 5S rRNA coding region is very similar to that reported for other flowering plants. Four A. thaliana ecotypes were found to contain approx. 1000 copies of 5S rDNA per haploid genome. Southern-blot analysis of genomic DNA indicates that 5S rDNA occurs in long tandem arrays, and shows the presence of numerous restriction-site polymorphisms among the six ecotypes studied. PMID:1348233

  14. Chromosomal Locations of 5S and 45S rDNA in Gossypium Genus and Its Phylogenetic Implications Revealed by FISH

    PubMed Central

    Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo


    We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G. incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G. raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution. PMID:23826377

  15. Phylogenetic analysis of encapsulated and non-encapsulated Trichinella species by studying the 5S rDNA tandemly repeated intergenic region.


    van der Giessen, J W B; Fonville, M; Briels, I; Pozio, E


    The identification of sequence regions in the genomes of pathogens which can be useful to distinguish among species and genotypes, is of great importance for epidemiological, molecular, and phylogenetic studies. The 5S ribosomal DNA intergenic spacer region has been identified as a good target to distinguish among eight Trichinella species and genotypes. The recent discovery of two non-encapsulated species in this genus, Trichinella papuae and Trichinella zimbabwensis, which can infect both mammals and reptiles, has suggested analyzing their 5S rDNA. Amplification of the tandem repeats of the 5S rDNA intergenic region of encapsulated species of Trichinella shows a 751bp fragment, whereas the three non-encapsulated species show a fragment of 800bp with T. pseudospiralis showing an additional fragment of 522bp. Although the size of the 800bp PCR fragments of T. papuae and T. zimbabwensis are similar to that of T. pseudospiralis, there are differences in the 5S rDNA intergenic regions among the three non-encapsulated species. Phylogenetic analysis of the 5S rDNA intergenic regions shows a clustering together of the three non-encapsulated Trichinella species that is well separated from the encapsulated ones. In addition, a single PCR-based method allows distinguishing non-encapsulated and encapsulated species. PMID:16076532

  16. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).


    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M


    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant. PMID:21364693

  17. Physical mapping of 18S and 5S rDNA loci and histone H3 gene in grasshopper species of the subfamily Gomphocerinae (Acrididae).


    Silva-Neto, L C; Bernardino, A C S; Loreto, V; Moura, R C


    In this study, fluorescence in situ hybridization (FISH) analysis was used to determine and compare the numbers and chromosomal locations of two multigene families (rDNA and histone H3) in four Neotropical species of gomphocerine grasshoppers. FISH using the 18S rDNA probe identified a single site on the S9 chromosome of Amblytropidia sp and Cauratettix borelli, a single site on chromosome M6 of Compsacris pulcher, and two sites (chromosomes L1 and L2) in Orphulella punctata. By contrast, FISH with a 5S rDNA probe identified dispersion of this sequence in the genomes of the four species, with evidence of intraspecific variations. Amblytropidia sp had six to eight FISH signals on autosomal chromosomes, while C. pulcher exhibited a signal only on the M5 bivalent. The histone H3 gene was less variable and was restricted to a single pair in all species. The conservation of the numbers and locations of 18S rDNA and H3 genes in conjunction with data from the literature was useful for evaluating karyotype evolution in this subfamily. The variation in the number and sizes of 5S rDNA sites indicates a process of recent dispersion that might have been mediated by transposition. PMID:26634462

  18. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

    PubMed Central

    Garcia, S; Kovařík, A


    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S–5.8S–26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S–18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S–5.8S–26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants. PMID:23512008

  19. Chromosomal location of 18S and 5S rDNA sites in Triportheus fish species (Characiformes, Characidae)

    PubMed Central


    The location of 18S and 5S rDNA sites was determined in eight species and populations of the fish genus Triportheus by using fluorescent in situ hybridization (FISH). The males and females of all species had 2n = 52 chromosomes and a ZZ/ZW sex chromosome system. A single 18S rDNA site that was roughly equivalent to an Ag-NOR was detected on the short arms of a submetacentric pair in nearly all species, and up to two additional sites were also observed in some species. In addition, another 18S rDNA cluster was identified in a distal region on the long arms of the W chromosome; this finding corroborated previous evidence that this cluster would be a shared feature amongst Triportheus species. In T. angulatus, a heterozygotic paracentric inversion involving the short arms of one homolog of a metacentric pair was associated with NORs. The 5S rDNA sites were located on the short arms of a single submetacentric chromosomal pair, close to the centromeres, except in T. auritus, which had up to ten 5S rDNA sites. The 18S and 5S rDNA sites were co-localized and adjacent on the short arms of a chromosomal pair in two populations of T. nematurus. Although all Triportheus species have a similar karyotypic macrostructure, the results of this work show that in some species ribosomal genes may serve as species-specific markers when used in conjunction with other putatively synapomorphic features. PMID:21637644

  20. Evidence for 5S rDNA Horizontal Transfer in the toadfish Halobatrachus didactylus (Schneider, 1801) based on the analysis of three multigene families

    PubMed Central


    Background The Batrachoididae family is a group of marine teleosts that includes several species with more complicated physiological characteristics, such as their excretory, reproductive, cardiovascular and respiratory systems. Previous studies of the 5S rDNA gene family carried out in four species from the Western Atlantic showed two types of this gene in two species but only one in the other two, under processes of concerted evolution and birth-and-death evolution with purifying selection. Here we present results of the 5S rDNA and another two gene families in Halobatrachus didactylus, an Eastern Atlantic species, and draw evolutionary inferences regarding the gene families. In addition we have also mapped the genes on the chromosomes by two-colour fluorescence in situ hybridization (FISH). Results Two types of 5S rDNA were observed, named type α and type β. Molecular analysis of the 5S rDNA indicates that H. didactylus does not share the non-transcribed spacer (NTS) sequences with four other species of the family; therefore, it must have evolved in isolation. Amplification with the type β specific primers amplified a specific band in 9 specimens of H. didactylus and two of Sparus aurata. Both types showed regulatory regions and a secondary structure which mark them as functional genes. However, the U2 snRNA gene and the ITS-1 sequence showed one electrophoretic band and with one type of sequence. The U2 snRNA sequence was the most variable of the three multigene families studied. Results from two-colour FISH showed no co-localization of the gene coding from three multigene families and provided the first map of the chromosomes of the species. Conclusions A highly significant finding was observed in the analysis of the 5S rDNA, since two such distant species as H. didactylus and Sparus aurata share a 5S rDNA type. This 5S rDNA type has been detected in other species belonging to the Batrachoidiformes and Perciformes orders, but not in the Pleuronectiformes

  1. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family

    PubMed Central


    Background In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in ~200 species representing the family diversity and other closely related groups. Results Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Conclusions Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units

  2. Identification of a 5S rDNA spacer type specific Triticum urartu and wheats containing the T. urartu genome.


    Allaby, R G; Brown, T A


    A PCR system was designed to amplify 5S spacer rDNA specifically from homeologous chromosome 1 in a variety of species representative of the Aegilops and Triticum genera. Two polymerase chain reaction (PCR) primer combinations were used, one of which appears to be apomorphic in nature and specific to chromosome 1A in Triticum urartu and tetraploid and hexaploid wheats containing the AA genome donated by T. urartu. The value of studying single repeat types to investigate the molecular evolution of 5S-rDNA arrays is considered. PMID:10791812

  3. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).


    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro


    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus. PMID:26959315

  4. Compilation of 5S rRNA and 5S rRNA gene sequences

    PubMed Central

    Specht, Thomas; Wolters, Jörn; Erdmann, Volker A.


    The BERLIN RNA DATABANK as of Dezember 31, 1989, contains a total of 667 sequences of 5S rRNAs or their genes, which is an increase of 114 new sequence entries over the last compilation (1). It covers sequences from 44 archaebacteria, 267 eubacteria, 20 plastids, 6 mitochondria, 319 eukaryotes and 11 eukaryotic pseudogenes. The hardcopy shows only the list (Table 1) of those organisms whose sequences have been determined. The BERLIN RNA DATABANK uses the format of the EMBL Nucleotide Sequence Data Library complemented by a Sequence Alignment (SA) field including secondary structure information. PMID:1692116

  5. Molecular phylogenetic studies on filarial parasites based on 5S ribosomal spacer sequences.


    Xie, H; Bain, O; Williams, S A


    This paper is the first large-scale molecular phylogenetic study on filarial parasites (family Onchocercidae) which includes 16 species of 6 genera: Brugia beaveri Ash et Little, 1962, B. buckleyi Dissanaike et Paramananthan, 1961; B. malayi (Brug, 1927) Buckley, 1960; B. pahangi (Buckley et Edeson, 1956) Buckley, 1960; B. patei (Buckley, Nelson et Heisch, 1958) Buckley, 1960; B. timori Partono et al, 1977; Wuchereria bancrofti (Cobbold, 1877) Seurat, 1921: W. kalimantani Palmieri. Purnomo, Dennis and Marwoto, 1980: Mansonella perstans (Manson, 1891) Eberhard et Orihel, 1984; loa loc, Stiles, 1905; Onchocerca volvulus (Leuckart, 1983) Railliet er Henry, 1910; O. ochengi Bwangamoi, 1969; O. gutturosa Neumann, 1910; Dirofilaria immitis (Leidy, 1856) Railliet e Henry, 1911; Acanthocheilonema viteae (Krepkogorskaya, 1933) Bain, Baker et Chabaud, 1982 and Litomosoides sigmodontis Chandler, 1931. 5S rRNA gene spacer region sequence data were collected by PCR, cloning and dideoxy sequencing. The 5S rRNA gene spacer region sequences were aligned and analyzed by maximum parsimony algorithms, distance methods and maximum likelihood methods to construct phylogenetic trees. Bootstrap analysis was used to test the robustness of the different phylogenetic reconstructions. The data indicated that 5S spacer region sequences are highly conserved within species yet differ significantly between species. Spliced leader sequences were observed in all of the 5S rDNA spacers with no sequence variation, although flanking region sequence and length heterogeneity was observed even within species. All of the various tree-building methods gave very similar results. This study identified four clades which are strongly supported by bootstrap analysis the Brugia clade; the Wuchereria clade; the Brugia-Wuchereria clade and the Onchocerca clade. The analyses indicated that L. sigmodontis and A. viteae may be the most primitive among the 16 species studied. The data did not show any close

  6. Chromosomal localization of 5S rDNA in Chinese shrimp ( Fenneropenaeus chinensis): a chromosome-specific marker for chromosome identification

    NASA Astrophysics Data System (ADS)

    Huan, Pin; Zhang, Xiaojun; Li, Fuhua; Zhao, Cui; Zhang, Chengsong; Xiang, Jianhai


    Chinese shrimp ( Fenneropenaeus chinensis) is an economically important aquaculture species in China. However, cytogenetic and genomic data is limited in the organism partly because the chromosomes are difficult to isolate and analyze. In this study, fluorescence in-situ hybridization (FISH) was used to identify the chromosomes of F. chinensis. The 5S ribosomal RNA gene (rDNA) of F. chinensis was isolated, cloned and then used as a hybridization probe. The results show that the 5S rDNA was located on one pair of homologous chromosomes in F. chinensis. In addition, triploid shrimp were used to evaluate the feasibility of chromosome identification using FISH and to validate the method. It was confirmed that 5S rDNA can be used as a chromosome-specific probe for chromosome identification in F. chinensis. The successful application of FISH in F. chinensis shows that chromosome-specific probes can be developed and this finding will facilitate further research on the chromosomes of penaeid shrimps.

  7. Physical Mapping of the 5S and 18S rDNA in Ten Species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae): Evolutionary Tendencies in the Genus

    PubMed Central

    César Venere, Paulo; Thums Konerat, Jocicléia; Henrique Zawadzki, Cláudio; Ricardo Vicari, Marcelo; Margarido, Vladimir Pavan


    Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH) with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus. PMID:25405240

  8. 5S RNA sequence from the Philosamia silkworm: evidence for variable evolutionary rates in insect 5S RNA.

    PubMed Central

    Xian-Rong, G; Nicoghosian, K; Cedergren, R J


    The primary structure of 5S RNA isolated from the posterior silkgland of Philosamia cynthia ricini was determined using three in vitro labelling techniques. The derived sequence consists of 119 nucleotides and can be folded into the secondary structure model proposed for eukaryotic 5S RNAs. This 5S RNA differs from the Bombyx mori molecule in 9 positions and from the Drosophila melanogaster sequence in 14 positions. The comparison of evolutionary rates in insect 5S RNA with inferred rates in other eukaryotic phyla leads to the conclusion that 5S RNA evolution is not constant in different eukaryotic branches, a condition which must be taken into account in phylogenetic tree constructions. Images PMID:7145713

  9. Cytogenetic Diversity and the Evolutionary Dynamics of rDNA Genes and Telomeric Sequences in the Ancistrus Genus (Loricariidae: Ancistrini).


    Favarato, Ramon Marin; Silva, Maelin da; Oliveira, Renildo Ribeiro de; Artoni, Roberto Ferreira; Feldberg, Eliana; Matoso, Daniele Aparecida


    The Ancistrus genus differs from other Ancistrini due to its wide karyotypic diversity, varied diploid numbers, differences in sex chromosomes, and large number of species, as well as its tendency to form small populations with low vagility. This study investigated the role of 5S and 18S rDNA and telomeric repetitive sequences in the evolution of the karyotypic macrostructure of seven species of the genus Ancistrus from the Central Amazon. The results indicate a strong correlation between the location of ribosomal sites and fragile sites in the genome, particularly of 5S rDNA sequences, which are associated, in some species, with telomeric sequences at the sites of chromosomal healing. Moreover, the occurrence of two lineages was observed with regard to the synteny of ribosomal genes. The species of the genus Ancistrus showed high chromosomal lability associated with breakpoints, which was characterized by the presence of repetitive DNA sequences and this process is suggested to be an evolutionary model for the rapid fixation of structural rearrangements. PMID:26829587

  10. The specific isolation of complete 5S rDNA units from chromosome 1A of hexaploid, tetraploid, and diploid wheat species using PCR with head-to-head oriented primers.


    Van Campenhout, S; Stappen, J V; Volckaert, G


    The presence of 5S rDNA units on chromosome 1A of Triticum aestivum was shown by the development of a specific PCR test, using head-to-head oriented primers. This primer set allowed the amplification of complete 5S DNA units and was used to isolate SS-Rrna-A1 sequences from polyploid and diploid wheat species. Multiple-alignment and parsimony analyses of the 132 sequences divided the sequences into four types. The isolates from T. aestivum and the tetraploid species (T. dicoccoides, T. dicoccum, T durum, T. araraticum, and T timopheevi) were all of one type, which was shown to be closely related to the type mainly characteristic for T. urartu. The other two types were isolated exclusively from the diploid species T. monococcum, T aegilopoides, T. thaoudar, and T. sinskajae and the hexaploid species T. zhukovski. Triticum monococcum was the only species for which representatives of each of the four sequence types were found to be present. Further, we discuss the possible multicluster arrangement of the 5S-Rrna-A1 array. PMID:11550886

  11. Phylogeny and genetic diversity of Bridgeoporus nobilissimus inferred using mitochondrial and nuclear rDNA sequences

    USGS Publications Warehouse

    Redberg, G.L.; Hibbett, D.S.; Ammirati, J.F., Jr.; Rodriguez, R.J.


    The genetic diversity and phylogeny of Bridgeoporus nobilissimus have been analyzed. DNA was extracted from spores collected from individual fruiting bodies representing six geographically distinct populations in Oregon and Washington. Spore samples collected contained low levels of bacteria, yeast and a filamentous fungal species. Using taxon-specific PCR primers, it was possible to discriminate among rDNA from bacteria, yeast, a filamentous associate and B. nobilissimus. Nuclear rDNA internal transcribed spacer (ITS) region sequences of B. nobilissimus were compared among individuals representing six populations and were found to have less than 2% variation. These sequences also were used to design dual and nested PCR primers for B. nobilissimus-specific amplification. Mitochondrial small-subunit rDNA sequences were used in a phylogenetic analysis that placed B. nobilissimus in the hymenochaetoid clade, where it was associated with Oxyporus and Schizopora.

  12. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    PubMed Central


    Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement) or, less commonly, linked to 35 S rDNA units (L-type). The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6) but not all species. Two species contained major L-type and minor S-type units (termed Ls-type). The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’) is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs. PMID:22716941

  13. Conservation patterns in angiosperm rDNA ITS2 sequences.

    PubMed Central

    Hershkovitz, M A; Zimmer, E A


    The two internal transcribed spacers (ITS1 and ITS2) of nuclear ribosomal DNA have become commonly exploited sources of informative variation for interspecific-/intergeneric-level phylogenetic analyses among angiosperms and other eukaryotes. We present an alignment in which one-third to one-half of the ITS2 sequence is alignable above the family level in angiosperms and a phenetic analysis showing that ITS2 contains information sufficient to diagnose lineages at several hierarchical levels. Base compositional analysis shows that angiosperm ITS2 is inherently GC-rich, and that the proportion of T is much more variable than that for other bases. We propose a general model of angiosperm ITS2 secondary structure that shows common pairing relationships for most of the conserved sequence tracts. Variations in our secondary structure predictions for sequences from different taxa indicate that compensatory mutation is not limited to paired positions. PMID:8760866

  14. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.


    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio


    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. PMID:26789074

  15. Studying long 16S rDNA sequences with ultrafast-metagenomic sequence classification using exact alignments (Kraken).


    Valenzuela-González, Fabiola; Martínez-Porchas, Marcel; Villalpando-Canchola, Enrique; Vargas-Albores, Francisco


    Ultrafast-metagenomic sequence classification using exact alignments (Kraken) is a novel approach to classify 16S rDNA sequences. The classifier is based on mapping short sequences to the lowest ancestor and performing alignments to form subtrees with specific weights in each taxon node. This study aimed to evaluate the classification performance of Kraken with long 16S rDNA random environmental sequences produced by cloning and then Sanger sequenced. A total of 480 clones were isolated and expanded, and 264 of these clones formed contigs (1352 ± 153 bp). The same sequences were analyzed using the Ribosomal Database Project (RDP) classifier. Deeper classification performance was achieved by Kraken than by the RDP: 73% of the contigs were classified up to the species or variety levels, whereas 67% of these contigs were classified no further than the genus level by the RDP. The results also demonstrated that unassembled sequences analyzed by Kraken provide similar or inclusively deeper information. Moreover, sequences that did not form contigs, which are usually discarded by other programs, provided meaningful information when analyzed by Kraken. Finally, it appears that the assembly step for Sanger sequences can be eliminated when using Kraken. Kraken cumulates the information of both sequence senses, providing additional elements for the classification. In conclusion, the results demonstrate that Kraken is an excellent choice for use in the taxonomic assignment of sequences obtained by Sanger sequencing or based on third generation sequencing, of which the main goal is to generate larger sequences. PMID:26812576

  16. Phylogenetic relationships of land plants using mitochondrial small-subunit rDNA sequences.


    Duff, R J; Nickrent, D L


    Phylogenetic relationships among embryophytes (tracheophytes, mosses, liverworts, and hornworts) were examined using 21 newly generated mitochondrial small-subunit (19S) rDNA sequences. The "core" 19S rDNA contained more phylogenetically informative sites and lower homoplasy than either nuclear 18S or plastid 16S rDNA. Results of phylogenetic analyses using parsimony (MP) and likelihood (ML) were generally congruent. Using MP, two trees were obtained that resolved either liverworts or hornworts as the basal land plant clade. The optimal ML tree showed hornworts as basal. That topology was not statistically different from the two MP trees, thus both appear to be equally viable evolutionary hypotheses. High bootstrap support was obtained for the majority of higher level embryophyte clades named in a recent morphologically based classification, e.g., Tracheophyta, Euphyllophytina, Lycophytina, and Spermatophytata. Strong support was also obtained for the following monophyletic groups: hornworts, liverworts, mosses, lycopsids, leptosporangiate and eusporangiate ferns, gymnosperms and angiosperms. This molecular analysis supported a sister relationship between Equisetum and leptosporangiate ferns and a monophyletic gymnosperms sister to angiosperms. The topologies of deeper clades were affected by taxon inclusion (particularly hornworts) as demonstrated by jackknife analyses. This study represents the first use of mitochondrial 19S rDNA for phylogenetic purposes and it appears well-suited for examining intermediate to deep evolutionary relationships among embryophytes. PMID:10077500

  17. Next generation sequencing analysis reveals a relationship between rDNA unit diversity and locus number in Nicotiana diploids

    PubMed Central


    Background Tandemly arranged nuclear ribosomal DNA (rDNA), encoding 18S, 5.8S and 26S ribosomal RNA (rRNA), exhibit concerted evolution, a pattern thought to result from the homogenisation of rDNA arrays. However rDNA homogeneity at the single nucleotide polymorphism (SNP) level has not been detailed in organisms with more than a few hundred copies of the rDNA unit. Here we study rDNA complexity in species with arrays consisting of thousands of units. Methods We examined homogeneity of genic (18S) and non-coding internally transcribed spacer (ITS1) regions of rDNA using Roche 454 and/or Illumina platforms in four angiosperm species, Nicotiana sylvestris, N. tomentosiformis, N. otophora and N. kawakamii. We compared the data with Southern blot hybridisation revealing the structure of intergenic spacer (IGS) sequences and with the number and distribution of rDNA loci. Results and Conclusions In all four species the intragenomic homogeneity of the 18S gene was high; a single ribotype makes up over 90% of the genes. However greater variation was observed in the ITS1 region, particularly in species with two or more rDNA loci, where >55% of rDNA units were a single ribotype, with the second most abundant variant accounted for >18% of units. IGS heterogeneity was high in all species. The increased number of ribotypes in ITS1 compared with 18S sequences may reflect rounds of incomplete homogenisation with strong selection for functional genic regions and relaxed selection on ITS1 variants. The relationship between the number of ITS1 ribotypes and the number of rDNA loci leads us to propose that rDNA evolution and complexity is influenced by locus number and/or amplification of orphaned rDNA units at new chromosomal locations. PMID:23259460

  18. Nucleotide sequence of 5S ribosomal RNA from Aspergillus nidulans and Neurospora crassa.

    PubMed Central

    Piechulla, B; Hahn, U; McLaughlin, L W; Küntzel, H


    The nucleotide sequences of 5S rRNA molecules isolated from the cytosol and the mitochondria of the ascomycetes A. nidulans and N. crassa were determined by partial chemical cleavage of 3'-terminally labelled RNA. The sequence identity of the cytosolic and mitochondrial RNA preparations confirms the absence of mitochondrion-specific 5S rRNA in these fungi. The sequences of the two organisms differ in 35 positions, and each sequence differs from yeast 5S rRNA in 44 positions. Both molecules contain the sequence GCUC in place of GAAC or GAUY found in all other 5S rRNAs, indicating that this region is not universally involved in base-pairing to the invariant GTpsiC sequence of tRNAs. Images PMID:6453331

  19. Molecular analysis of complete ssu to lsu rdna sequence in the harmful dinoflagellate alexandrium tamarense (korean isolate, HY970328M)

    NASA Astrophysics Data System (ADS)

    Ki, Jang-Seu; Han, Myung-Soo


    New PCR primers (N=18) were designed for the isolation of complete SSU to LSU rDNA sequences from the dinoflagellate Alexandrium tamarense. Standard PCR, employing each primer set selected for amplifications of less than 1.5 kb, successfully amplified the expected rDNA regions of A. tamarense (Korean isolate, HY970328M). Complete SSU, LSU rDNAs and ITS sequences, including 5.8S rDNA, were recorded at 1,800 bp, 520 bp and 3,393 bp, respectively. The LSU rDNA sequence was the first report in Alexandrium genus. No intron was found in the LSU rRNA coding region. Twelve D-domains within the LSU rDNA were put together into 1,879 bp (44.4% G+C), and cores into 1514 bp (42.8% G+C). The core sequence was significantly different (0.0867 of genetic distance, 91% sequence similarity) in comparison with Prorocentrum micans (GenBank access. no. X16108). The D2 region was the longest in length (300 bp) and highly variable among the 12 D-domains. In a phylogenetic analysis using complete LSU rDNA sequences of a variety of phytoplankton, A tamarense was clearly separated with high resolution against other species. The result suggests that the sequence may resolve the taxonomic ambiguities of Alexandrium genus, particularly of the tamarensis complex.

  20. Using an intervening sequence of Faecalibacterium 16S rDNA to identify poultry feces.


    Shen, Zhenyu; Duan, Chuanren; Zhang, Chao; Carson, Andrew; Xu, Dong; Zheng, Guolu


    This study was designed to identify poultry feces-specific marker(s) within sequences of Faecalibacterium 16S rDNA for detecting poultry fecal pollution in water. Bioinformatics tools were used in the comparative analysis of 7,458 sequences of Faecalibacterium 16S rDNA, reportedly associated with various poultry (chicken and turkey) and animal species. One intervening sequence (IVS) within between the hypervariable region 1 and the conserved region 2, designated as IVS-p, was found to be unique to poultry feces. Based on this sequence, a PCR assay (PCR-p) was developed. The PCR-p produced an amplicon of 132 bp only in the test when fecal or wastewater samples from poultry were used, but not when using fecal or wastewater samples from other sources. The non-poultry sources included feces of beef or dairy cattle, dog, horse, human, domestic or wild geese, seagull, sheep, swine, and wild turkey. These data indicate that IVS-p may prove to be a useful genetic marker for the specific identification of poultry fecal pollution in environmental waterways. Furthermore, results of data mining and PCR assay indicate that the IVS-p may have a broad geographic distribution. This report represents initial evidence of the potential utility of ribosomal intervening sequences as genetic markers for tracking host sources of fecal pollution in waterways. PMID:24011842

  1. 5S rRNA sequences from four marine invertebrates and implications for base pairing models of metazoan sequences.


    Walker, W F; Doolittle, W F


    The nucleotide sequences of 5S rRNAs from the starfish Asterias vulgaris, the squid Illex illecebrosus, the sipunculid Phascolopsis gouldii and the jellyfish Aurelia aurita were determined. The sequence from Asterias lends support for one of two previous base pairing models for helix E in metazoan sequences. The Aurelia sequence differs by five nucleotides from that previously reported and does not violate the consensus secondary structure model for eukaryotic 5S rRNA. PMID:6136024

  2. Obtaining long 16S rDNA sequences using multiple primers and its application on dioxin-containing samples

    PubMed Central


    Background Next-generation sequencing (NGS) technology has transformed metagenomics because the high-throughput data allow an in-depth exploration of a complex microbial community. However, accurate species identification with NGS data is challenging because NGS sequences are relatively short. Assembling 16S rDNA segments into longer sequences has been proposed for improving species identification. Current approaches, however, either suffer from amplification bias due to one single primer or insufficient 16S rDNA reads in whole genome sequencing data. Results Multiple primers were used to amplify different 16S rDNA segments for 454 sequencing, followed by 454 read classification and assembly. This permitted targeted sequencing while reducing primer bias. For test samples containing four known bacteria, accurate and near full-length 16S rDNAs of three known bacteria were obtained. For real soil and sediment samples containing dioxins in various concentrations, 16S rDNA sequences were lengthened by 50% for about half of the non-rare microbes, and 16S rDNAs of several microbes reached more than 1000 bp. In addition, reduced primer bias using multiple primers was illustrated. Conclusions A new experimental and computational pipeline for obtaining long 16S rDNA sequences was proposed. The capability of the pipeline was validated on test samples and illustrated on real samples. For dioxin-containing samples, the pipeline revealed several microbes suitable for future studies of dioxin chemistry. PMID:26681335

  3. Phylogenetic relationships among higher Nemertean (Nemertea) Taxa inferred from 18S rDNA sequences.


    Sundberg, P; Turbeville, J M; Lindh, S


    We estimated the phylogenetic relationships of 15 nemertean (phylum Nemertea) species from the four subclasses Hoplo-, Hetero-, Palaeo-, and Bdellonemertea with 18S rDNA sequence data. Three outgroup taxa were used for rooting: Annelida, Platyhelminthes, and Mollusca. Parsimony and maximum-likelihood analyses supported the monophyletic status of the Heteronemertea and a taxon consisting of hoplonemerteans and Bdellonemertea, while indicating that Palaeonemertea is paraphyletic. The monophyletic status of the two nemertean classes Anopla and Enopla is not supported by the data. The unambiguous clades are well supported, as assessed by a randomization test (bootstrapping) and branch support values. PMID:11527461

  4. Phylogenetic analysis of Demodex caprae based on mitochondrial 16S rDNA sequence.


    Zhao, Ya-E; Hu, Li; Ma, Jun-Xian


    Demodex caprae infests the hair follicles and sebaceous glands of goats worldwide, which not only seriously impairs goat farming, but also causes a big economic loss. However, there are few reports on the DNA level of D. caprae. To reveal the taxonomic position of D. caprae within the genus Demodex, the present study conducted phylogenetic analysis of D. caprae based on mt16S rDNA sequence data. D. caprae adults and eggs were obtained from a skin nodule of the goat suffering demodicidosis. The mt16S rDNA sequences of individual mite were amplified using specific primers, and then cloned, sequenced, and aligned. The sequence divergence, genetic distance, and transition/transversion rate were computed, and the phylogenetic trees in Demodex were reconstructed. Results revealed the 339-bp partial sequences of six D. caprae isolates were obtained, and the sequence identity was 100% among isolates. The pairwise divergences between D. caprae and Demodex canis or Demodex folliculorum or Demodex brevis were 22.2-24.0%, 24.0-24.9%, and 22.9-23.2%, respectively. The corresponding average genetic distances were 2.840, 2.926, and 2.665, and the average transition/transversion rates were 0.70, 0.55, and 0.54, respectively. The divergences, genetic distances, and transition/transversion rates of D. caprae versus the other three species all reached interspecies level. The five phylogenetic trees all presented that D. caprae clustered with D. brevis first, and then with D. canis, D. folliculorum, and Demodex injai in sequence. In conclusion, D. caprae is an independent species, and it is closer to D. brevis than to D. canis, D. folliculorum, or D. injai. PMID:23996126

  5. Analysis of the 5S RNA pool in Arabidopsis thaliana: RNAs are heterogeneous and only two of the genomic 5S loci produce mature 5S RNA.


    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette


    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5'- and 3'-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array. PMID:11779838

  6. Nucleotide sequences of 5S ribosomal RNA from four oomycete and chytrid water molds.


    Walker, W F; Doolittle, W F


    The nucleotide sequences of the 5S rRNAs of the oomycete water molds Saprolegnia ferax and Pythium hydnosporum and of the chytrid water molds Blastocladiella simplex and Phlyctochytrium irregulare were determined by chemical and enzymatic partial degradation of 3' and 5' end-labelled molecules, followed by gel sequence analysis. The two oomycete sequences differed in 24 positions and the two chytrid sequences differed in 27 positions. These pairs differed in a mean of 44 positions. The chytrid sequences clearly most resemble the sequence from the zygomycete Phycomyces, while the oomycete sequences appear to be allied with those from protozoa and slime molds. PMID:6890670

  7. Molecular phylogeny of endophytic isolates of Ampelomyces from Iran based on rDNA ITS sequences.


    Jamali, Samad


    During 2012, five isolates of pycnidial fungi were recovered from roots of tomato (Solanum lycopersicum) plants in Iran. Based on morphological characteristics the presence of Ampelomyces was documented. To confirm morphological identification and clarify the placement of endophytic isolates of Ampelomyces, DNA was extracted from isolates using a genomic DNA purification Kit. Region of internal transcribed spacers 1, 2 and 5.8S genes of rDNA were amplified using ITS4 and ITS1 universal primer set. Amplicons were purified, sequenced and submitted to the GenBank. The resulting sequence (600 bp) was submitted to a BLAST search to find most similar sequences in GenBank. The ITS sequences of isolates obtained in Iran were compared to those of other related authentic sequences obtained from GenBank. Iranian endophytic isolates had 100 % similarity of among themselves, while all isolates of Ampelomyces sequences analyzed had an average of 95.2 % (range 87-100 %) similarity. When Ampelomyces ITS sequences were analyzed by both distance-based and maximum parsimony methods, the Ampelomyces isolates were segregate into 11 distinct clades. The ITS sequences of endophytic isolates obtained in Iran were identical with endophytic isolates from other country including USA, Australia, Hungary and Spain. Our analyses of phylogenetic data showed that endophytic isolates from Iran and other countries are distinct group. The high ITS sequence-divergence values and the phylogenetic analysis suggested the isolates of Ampelomyces in the clades are not closely related and indeed a problematic species complex. PMID:25245955

  8. Molecular characterization of Gastrodiscoides hominis (Platyhelminthes: Trematoda: Digenea) inferred from ITS rDNA sequence analysis.


    Goswami, L M; Prasad, P K; Tandon, V; Chatterjee, A


    Gastrodiscoides hominis (Digenea: Paramphistomata: Gastrodiscidae) is an amphistomid intestinal fluke of pigs causing gastrodiscoidiosis. With the use of molecular tools assisting the conventional diagnostic procedures, we aimed at finding out molecular characterization of G. hominis using PCR amplifications of rDNA ITS (1, 2) sequences. The sequences obtained (GenBank accession numbers EF027096, EF027097, EF027098, EU887294, and EU887295) were compared with available sequences of other digenean parasites, particularly those having a zoonotic potential in the northeastern region of India. The BLAST search revealed a close similarity with members of the family Paramphistomidae, showing maximum similarity with the amphistome, Homalogaster paloniae (subfamily Paramphistominae). Based on various tree construction methods, phylogeny of G. hominis is discussed. PMID:19198879

  9. Chromosomal localization and sequence variation of 5S rRNA gene in five Capsicum species.


    Park, Y K; Park, K C; Park, C H; Kim, N S


    Chromosomal localization and sequence analysis of the 5S rRNA gene were carried out in five Capsicum species. Fluorescence in situ hybridization revealed that chromosomal location of the 5S rRNA gene was conserved in a single locus at a chromosome which was assigned to chromosome 1 by the synteny relationship with tomato. In sequence analysis, the repeating units of the 5S rRNA genes in the Capsicum species were variable in size from 278 bp to 300 bp. In sequence comparison of our results to the results with other Solanaceae plants as published by others, the coding region was highly conserved, but the spacer regions varied in size and sequence. T stretch regions, just after the end of the coding sequences, were more prominant in the Capsicum species than in two other plants. High G x C rich regions, which might have similar functions as that of the GC islands in the genes transcribed by RNA PolII, were observed after the T stretch region. Although we could not observe the TATA like sequences, an AT rich segment at -27 to -18 was detected in the 5S rRNA genes of the Capsicum species. Species relationship among the Capsicum species was also studied by the sequence comparison of the 5S rRNA genes. While C. chinense, C. frutescens, and C. annuum formed one lineage, C. baccatum was revealed to be an intermediate species between the former three species and C. pubescens. PMID:10774742

  10. Diversity within the genus Elymus (Poaceae: Triticeae) as investigated by the analysis of the nr5S rDNA variation in species with St and H haplomes.


    Baum, B R; Edwards, T; Johnson, D A


    The genus Elymus ("Ryegrass") is a repository for a range of species with a variety of haplome contents; hence the pejorative name "dustbin" genus. We have analyzed 1,059 sequences from 128 accessions representing 24 species to investigate the relationships among the StH haplomes-containing species described by Yen and Yang (Genus Elymus Beijing 5:58-362, 2013). Sequences were assigned to "unit classes" of orthologous sequences and subjected to a suite of analyses including BLAST (Basic Local Alignment Search Tool) searches, phylogenetic analysis and population genetic analysis to estimate species diversity. Our results support the genome analyses in Yen and Yang (Genus Elymus Beijing 5:58-362, 2013), i.e., genomic constitution StStHH including variants restricted to Elymus. Population genetic analysis of the 5S nrDNA sequence data revealed that the within-species variance component is roughly ±89 %; thus, we were unable to identify molecular markers capable to separate the 24 species analyzed. Separate phylogenetic analyses of the two unit classes and of all the data exhibit a trend only of the species to cluster on the phylograms. Finally, the analysis provides evidence for the multiple origins of American and Eurasian species. PMID:25248636

  11. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.


    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  12. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    NASA Technical Reports Server (NTRS)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.


    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  13. Nucleotide sequences of 5S rRNAs from four jellyfishes.


    Hori, H; Ohama, T; Kumazaki, T; Osawa, S


    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica. PMID:6130512

  14. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    NASA Technical Reports Server (NTRS)

    Luehrsen, K. R.; Fox, G. E.


    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  15. Asymmetric Epigenetic Modification and Elimination of rDNA Sequences by Polyploidization in Wheat[W

    PubMed Central

    Guo, Xiang


    rRNA genes consist of long tandem repeats clustered on chromosomes, and their products are important functional components of the ribosome. In common wheat (Triticum aestivum), rDNA loci from the A and D genomes were largely lost during the evolutionary process. This biased DNA elimination may be related to asymmetric transcription and epigenetic modifications caused by the polyploid formation. Here, we observed both sets of parental nucleolus organizing regions (NORs) were expressed after hybridization, but asymmetric silencing of one parental NOR was immediately induced by chromosome doubling, and reversing the ploidy status could not reactivate silenced NORs. Furthermore, increased CHG and CHH DNA methylation on promoters was accompanied by asymmetric silencing of NORs. Enrichment of H3K27me3 and H3K9me2 modifications was also observed to be a direct response to increased DNA methylation and transcriptional inactivation of NOR loci. Both A and D genome NOR loci with these modifications started to disappear in the S4 generation and were completely eliminated by the S7 generation in synthetic tetraploid wheat. Our results indicated that asymmetric epigenetic modification and elimination of rDNA sequences between different donor genomes may lead to stable allopolyploid wheat with increased differentiation and diversity. PMID:25415973

  16. Asymmetric epigenetic modification and elimination of rDNA sequences by polyploidization in wheat.


    Guo, Xiang; Han, Fangpu


    rRNA genes consist of long tandem repeats clustered on chromosomes, and their products are important functional components of the ribosome. In common wheat (Triticum aestivum), rDNA loci from the A and D genomes were largely lost during the evolutionary process. This biased DNA elimination may be related to asymmetric transcription and epigenetic modifications caused by the polyploid formation. Here, we observed both sets of parental nucleolus organizing regions (NORs) were expressed after hybridization, but asymmetric silencing of one parental NOR was immediately induced by chromosome doubling, and reversing the ploidy status could not reactivate silenced NORs. Furthermore, increased CHG and CHH DNA methylation on promoters was accompanied by asymmetric silencing of NORs. Enrichment of H3K27me3 and H3K9me2 modifications was also observed to be a direct response to increased DNA methylation and transcriptional inactivation of NOR loci. Both A and D genome NOR loci with these modifications started to disappear in the S4 generation and were completely eliminated by the S7 generation in synthetic tetraploid wheat. Our results indicated that asymmetric epigenetic modification and elimination of rDNA sequences between different donor genomes may lead to stable allopolyploid wheat with increased differentiation and diversity. PMID:25415973

  17. Phylogenetic relationships between Bacillus species and related genera inferred from 16s rDNA sequences

    PubMed Central

    Wei Wang, Mi Sun


    Neighbor-joining, maximum-parsimony, minimum-evolution, maximum-likelihood and Bayesian trees constructed based on 16S rDNA sequences of 181 type strains of Bacillus species and related taxa manifested nine phylogenetic groups. The phylogenetic analysis showed that Bacillus was not a monophyletic group. B. subtilis was in Group 1. Group 4, 6 and 8 respectively consisted of thermophiles, halophilic or halotolerant bacilli and alkaliphilic bacilli. Group 2, 4 and 8 consisting of Bacillus species and related genera demonstrated that the current taxonomic system did not agree well with the 16S rDNA evolutionary trees. The position of Caryophanaceae and Planococcaceae in Group 2 suggested that they might be transferred into Bacillaceae, and the heterogeneity of Group 2 implied that some Bacillus species in it might belong to several new genera. Group 9 was mainly comprised of the genera (excluding Bacillus) of Bacillaceae, so some Bacillus species in Group 9: B. salarius, B. qingdaonensis and B. thermcloacae might not belong to Bacillus. Four Bacillus species, B. schlegelii, B. tusciae, B. edaphicus and B. mucilaginosus were clearly placed outside the nine groups. PMID:24031394

  18. Chromosomal localization of 18S rDNA and telomere sequence in the aye-aye, Daubentonia madagascariensis.


    Rakotoarisoa, G; Hirai, Y; Go, Y; Kawamoto, Y; Shima, T; Koyama, N; Randrianjafy, A; Mora, R; Hirai, H


    Chromosomal localization of 18S rDNA and telomere sequence was attempted on the chromosomes of the aye-aye (2n = 30) using fluorescence in situ hybridization (FISH) and primed in situ labeling (PRINS), respectively. The rDNA was localized at the tip or whole of the short arm of acrocentric chromosomes 13 and 14 in all spreads observed. However, post-FISH silver-nitrate (Ag) staining showed that transcriptional activity of the rRNA genes was variable, particularly in chromosome 14, which was most frequently negative in one homologue carrying the smaller copy number of rDNA. This observation supports, at the molecular cytogenetic level, previous data concerning the relationship between the copy number of rDNA and its trancriptional activity. On the other hand, telomere sequence was localized only at the telomeric region of all chromosomes, the so-called telomere-only pattern, a characteristic similar to that of the greater bushbaby. These data may provide information on the chromosomal evolution of the lemur, because locations of rDNA and telomere sequences frequently offer important clues in reconstruction of karyotype differentiation. PMID:11245223

  19. Molecular Analysis of Methanogen Richness in Landfill and Marshland Targeting 16S rDNA Sequences

    PubMed Central

    Yadav, Shailendra; Kundu, Sharbadeb; Ghosh, Sankar K.; Maitra, S. S.


    Methanogens, a key contributor in global carbon cycling, methane emission, and alternative energy production, generate methane gas via anaerobic digestion of organic matter. The methane emission potential depends upon methanogenic diversity and activity. Since they are anaerobes and difficult to isolate and culture, their diversity present in the landfill sites of Delhi and marshlands of Southern Assam, India, was analyzed using molecular techniques like 16S rDNA sequencing, DGGE, and qPCR. The sequencing results indicated the presence of methanogens belonging to the seventh order and also the order Methanomicrobiales in the Ghazipur and Bhalsawa landfill sites of Delhi. Sequences, related to the phyla Crenarchaeota (thermophilic) and Thaumarchaeota (mesophilic), were detected from marshland sites of Southern Assam, India. Jaccard analysis of DGGE gel using Gel2K showed three main clusters depending on the number and similarity of band patterns. The copy number analysis of hydrogenotrophic methanogens using qPCR indicates higher abundance in landfill sites of Delhi as compared to the marshlands of Southern Assam. The knowledge about “methanogenic archaea composition” and “abundance” in the contrasting ecosystems like “landfill” and “marshland” may reorient our understanding of the Archaea inhabitants. This study could shed light on the relationship between methane-dynamics and the global warming process. PMID:26568700

  20. Phylogenetic tree derived from bacterial, cytosol and organelle 5S rRNA sequences.

    PubMed Central

    Küntzel, H; Heidrich, M; Piechulla, B


    A phylogenetic tree was constructed by computer analysis of 47 completely determined 5S rRNA sequences. The wheat mitochondrial sequence is significantly more related to prokaryotic than to eukaryotic sequences, and its affinity to that of the thermophilic Gram-negative bacterium Thermus aquaticus is comparable to the affinity between Anacystis nidulans and chloroplastic sequences. This strongly supports the idea of an endosymbiotic origin of plant mitochondria. A comparison of the plant cytosol and chloroplast sub-trees suggests a similar rate of nucleotide substitution in nuclear genes and chloroplastic genes. Other features of the tree are a common precursor of protozoa and metazoa, which appears to be more related to the fungal than to the plant protosequence, and an early divergence of the archebacterial sequence (Halobacterium cutirubrum) from the prokaryotic branch. PMID:6785727

  1. Phylogenetic analysis of the genera Thiobacillus and Thiomicrospira by 5S rRNA sequences.

    PubMed Central

    Lane, D J; Stahl, D A; Olsen, G J; Heller, D J; Pace, N R


    5S rRNA nucleotide sequences from Thiobacillus neapolitanus, Thiobacillus ferrooxidans, Thiobacillus thiooxidans, Thiobacillus intermedius, Thiobacillus perometabolis, Thiobacillus thioparus, Thiobacillus versutus, Thiobacillus novellus, Thiobacillus acidophilus, Thiomicrospira pelophila, Thiomicrospira sp. strain L-12, and Acidiphilium cryptum were determined. A phylogenetic tree, based upon comparison of these and other related 5S rRNA sequences, is presented. The results place the thiobacilli, Thiomicrospira spp., and Acidiphilium spp. in the "purple photosynthetic" bacterial grouping which also includes the enteric, vibrio, pseudomonad, and other familiar eubacterial groups in addition to the purple photosynthetic bacteria. The genus Thiobacillus is not an evolutionarily coherent grouping but rather spans the full breadth of the purple photosynthetic bacteria. PMID:3924899

  2. Cytogenetic comparison between two allopatric populations of Astyanax altiparanae Garutti et Britski, 2000 (Teleostei, Characidae), with emphasis on the localization of 18S and 5S rDNA

    PubMed Central

    Pacheco, Rosiley Berton; da Rosa, Renata; Giuliano-Caetano, Lucia; Júlio Jr., Horácio Ferreira; Dias, Ana Lúcia


    Abstract Two populations of Astyanax altiparanae (Garutti & Britski, 2000) of the Água dos Patos stream/SP and lake Igapó/PR were analyzed. All individuals showed 2n = 50, however, different karyotypic formulae were observed. The population of the Água dos Patos stream showed 8m +24sm+6st+12a (NF=88) and the population of lake Igapó, 8m+28sm+4st+10a (NF=90). Nucleolus organizing regions (AgNORs) were observed in the terminal position on the short and long arm of different chromosomes of both populations, showing a variation from 3 to 4 chromosomes. Fluorescent in situ hybridization (FISH) using 18S rDNA probes revealed only one pair of chromosomes with fluorescent signals in the terminal site on the short arm in the Igapó lake population, while the population of Água dos Patos stream showed 4 fluorescence terminal signals, characterizing a system of simple and multiple NORs, respectively. 5S rDNA fluorescent signals were detected in the interstitial position of a pair of chromosomes in the two studied populations. Some AgNOR sites revealed to be GC-rich when stained with Chromomycin A3 (CMA3), however, AT positive regions were not observed. The data obtained show that, despite the conservation of the diploid number and location of 5S DNAr, differences in both the distribution of 18S rDNA and karyotypic formula among the populations were found, thus corroborating the existing data on chromosome variability in Astyanax altiparanae that can be significant for cytotaxonomy in this group. PMID:24260632

  3. Cytogenetic comparison between two allopatric populations of Astyanax altiparanae Garutti et Britski, 2000 (Teleostei, Characidae), with emphasis on the localization of 18S and 5S rDNA.


    Pacheco, Rosiley Berton; da Rosa, Renata; Giuliano-Caetano, Lucia; Júlio, Horácio Ferreira; Dias, Ana Lúcia


    Two populations of Astyanax altiparanae (Garutti & Britski, 2000) of the Água dos Patos stream/SP and lake Igapó/PR were analyzed. All individuals showed 2n = 50, however, different karyotypic formulae were observed. The population of the Água dos Patos stream showed 8m +24sm+6st+12a (NF=88) and the population of lake Igapó, 8m+28sm+4st+10a (NF=90). Nucleolus organizing regions (AgNORs) were observed in the terminal position on the short and long arm of different chromosomes of both populations, showing a variation from 3 to 4 chromosomes. Fluorescent in situ hybridization (FISH) using 18S rDNA probes revealed only one pair of chromosomes with fluorescent signals in the terminal site on the short arm in the Igapó lake population, while the population of Água dos Patos stream showed 4 fluorescence terminal signals, characterizing a system of simple and multiple NORs, respectively. 5S rDNA fluorescent signals were detected in the interstitial position of a pair of chromosomes in the two studied populations. Some AgNOR sites revealed to be GC-rich when stained with Chromomycin A3 (CMA3), however, AT positive regions were not observed. The data obtained show that, despite the conservation of the diploid number and location of 5S DNAr, differences in both the distribution of 18S rDNA and karyotypic formula among the populations were found, thus corroborating the existing data on chromosome variability in Astyanax altiparanae that can be significant for cytotaxonomy in this group. PMID:24260632

  4. Characterization of viable bacteria from Siberian permafrost by 16S rDNA sequencing

    NASA Technical Reports Server (NTRS)

    Shi, T.; Reeves, R. H.; Gilichinsky, D. A.; Friedmann, E. I.


    Viable bacteria were found in permafrost core samples from the Kolyma-Indigirka lowland of northeast Siberia. The samples were obtained at different depths; the deepest was about 3 million years old. The average temperature of the permafrost is -10 degrees C. Twenty-nine bacterial isolates were characterized by 16S rDNA sequencing and phylogenetic analysis, cell morphology, Gram staining, endospore formation, and growth at 30 degrees C. The majority of the bacterial isolates were rod shaped and grew well at 30 degrees C; but two of them did not grow at or above 28 degrees C, and had optimum growth temperatures around 20 degrees C. Thirty percent of the isolates could form endospores. Phylogenetic analysis revealed that the isolates fell into four categories: high-GC Gram-positive bacteria, beta-proteobacteria, gamma-proteobacteria, and low-GC Gram-positive bacteria. Most high-GC Gram-positive bacteria and beta-proteobacteria, and all gamma-proteobacteria, came from samples with an estimated age of 1.8-3.0 million years (Olyor suite). Most low-GC Gram-positive bacteria came from samples with an estimated age of 5,000-8,000 years (Alas suite).

  5. Comparison of rDNA sequences from colchicine treated and untreated sporocysts of Phyllodistomum folium and Bucephalus polymorphus (Digenea).


    Stunzenas, Virmantas; Cryan, Jason R; Molloy, Daniel P


    The most frequently used antimitotic agent in cytogenetic studies is colchicine. We investigated whether the initial treatment of trematodes for karyological analysis with colchicine would have mutagenic or degradational effect on rDNA sequences. Dreissena polymorpha is the intermediate host of Phyllodistomum folium and Bucephalus polymorphus, and the sporocyst stage of these trematode species develop, respectively, in the gills and gonads of this mussel. Sporocysts of P. folium and B. polymorphus were obtained from D. polymorpha collected from waterbodies in Belarus and in Lithuania. 5.8S and 28S rDNA genes, ITS1 and ITS2 of P folium and B. polymorphus were sequenced and compared, and no nucleotide sequence differences between colchicine treated and untreated trematodes were found. Based on these results, we conclude that colchicine treatment for 3-5 h has no mutagenic or degradational effect on rDNA sequences. During the course of this investigation, two genetically different P. folium samples were noted in Belarus. PMID:15468529

  6. Construction of the mycoplasma evolutionary tree from 5S rRNA sequence data.

    PubMed Central

    Rogers, M J; Simmons, J; Walker, R T; Weisburg, W G; Woese, C R; Tanner, R S; Robinson, I M; Stahl, D A; Olsen, G; Leach, R H


    The 5S rRNA sequences of eubacteria and mycoplasmas have been analyzed and a phylogenetic tree constructed. We determined the sequences of 5S rRNA from Clostridium innocuum, Acholeplasma laidlawii, Acholeplasma modicum, Anaeroplasma bactoclasticum, Anaeroplasma abactoclasticum, Ureaplasma urealyticum, Mycoplasma mycoides mycoides, Mycoplasma pneumoniae, and Mycoplasma gallisepticum. Analysis of these and published sequences shows that mycoplasmas form a coherent phylogenetic group that, with C. innocuum, arose as a branch of the low G+C Gram-positive tree, near the lactobacilli and streptococci. The initial event in mycoplasma phylogeny was formation of the Acholeplasma branch; hence, loss of cell wall probably occurred at the time of genome reduction to approximately to 1000 MDa. A subsequent branch produced the Spiroplasma. This branch appears to have been the origin of sterol-requiring mycoplasmas. During development of the Spiroplasma branch there were several independent genome reductions, each to approximately 500 MDa, resulting in Mycoplasma and Ureaplasma species. Mycoplasmas, particularly species with the smallest genomes, have high mutation rates, suggesting that they are in a state of rapid evolution. PMID:2579388

  7. Secondray structure and sequence of ITS2-rDNA of the Egyptian malaria vector Anopheles pharoensis (Theobald).


    Wassim, Nahla M


    Out of the twelve Anophelines present in Egypt, only five species known to be malaria vectors. Anopheles (An.) pharoensis proved to be the important vector all over Egypt, especially in the Delta. Anopheles sergenti proved to be the primary vector in the Oases of the Western Desert, An. multicolor in Faiyoum, An. stephensi in the Red Sea Coast, and An. superpictus in Sinai. Genomic DNA was isolated from single adult mosquito of An. pharoensis (Sahel Sudanese form), PCR was performed to amplify ITS2 region of rDNA using specific primers for 5.8S and 28S rDNA genes. The amplicons were purified, directly sequenced and aligned to the sequence of the same region of An. gambiae, using clustalw2. The length of ITS2-rDNA of An. pharoensis was 411bp. The GC content of the ITS2 reported 53% is consistent with spacer base composition in Anopheles species. The similarity between the two species was 52% and genetic distance was 0.46.Variable simple sequence repeats (SSRs) are found at low frequency. The secondary structure of rDNA-ITS2was predicted by MFOLD and was -192; 60 to-195.32 kilocalories/mole. PMID:24961025

  8. 18S rDNA Sequences from Microeukaryotes Reveal Oil Indicators in Mangrove Sediment

    PubMed Central

    Santos, Henrique F.; Cury, Juliano C.; Carmo, Flavia L.; Rosado, Alexandre S.; Peixoto, Raquel S.


    Background Microeukaryotes are an effective indicator of the presence of environmental contaminants. However, the characterisation of these organisms by conventional tools is often inefficient, and recent molecular studies have revealed a great diversity of microeukaryotes. The full extent of this diversity is unknown, and therefore, the distribution, ecological role and responses to anthropogenic effects of microeukaryotes are rather obscure. The majority of oil from oceanic oil spills (e.g., the May 2010 accident in the Gulf of Mexico) converges on coastal ecosystems such as mangroves, which are threatened with worldwide disappearance, highlighting the need for efficient tools to indicate the presence of oil in these environments. However, no studies have used molecular methods to assess the effects of oil contamination in mangrove sediment on microeukaryotes as a group. Methodology/Principal Findings We evaluated the population dynamics and the prevailing 18S rDNA phylotypes of microeukaryotes in mangrove sediment microcosms with and without oil contamination, using PCR/DGGE and clone libraries. We found that microeukaryotes are useful for monitoring oil contamination in mangroves. Our clone library analysis revealed a decrease in both diversity and species richness after contamination. The phylogenetic group that showed the greatest sensitivity to oil was the Nematoda. After contamination, a large increase in the abundance of the groups Bacillariophyta (diatoms) and Biosoecida was detected. The oil-contaminated samples were almost entirely dominated by organisms related to Bacillariophyta sp. and Cafeteria minima, which indicates that these groups are possible targets for biomonitoring oil in mangroves. The DGGE fingerprints also indicated shifts in microeukaryote profiles; specific band sequencing indicated the appearance of Bacillariophyta sp. only in contaminated samples and Nematoda only in non-contaminated sediment. Conclusions/Significance We believe that

  9. [Organization of 5S ribosomal DNA of Melitaea trivia].


    Cherevatov, O V; Volkov, R A


    Two length variants of 5S rDNA repeated units were detected in the genome of East European butterfly Melitaea trivia. Both repeat variants contain the 5S rRNA coding region of the same length of 120 bp, but possess the intergenic spacer region (IGS) of different size, 78 and 125 bp, respectively. The level of sequence similarity between the two 5S rDNA variants amounts to 43.9-45.5% in the IGS, whereas the coding region appears to be more conservative. In the IGS, microsatellite sequence motives were found; amplification of these motives could be involved in the evolution of the 5S rDNA. PMID:21574431

  10. Assessing diversity of the female urine microbiota by high throughput sequencing of 16S rDNA amplicons

    PubMed Central


    Background Urine within the urinary tract is commonly regarded as "sterile" in cultivation terms. Here, we present a comprehensive in-depth study of bacterial 16S rDNA sequences associated with urine from healthy females by means of culture-independent high-throughput sequencing techniques. Results Sequencing of the V1V2 and V6 regions of the 16S ribosomal RNA gene using the 454 GS FLX system was performed to characterize the possible bacterial composition in 8 culture-negative (<100,000 CFU/ml) healthy female urine specimens. Sequences were compared to 16S rRNA databases and showed significant diversity, with the predominant genera detected being Lactobacillus, Prevotella and Gardnerella. The bacterial profiles in the female urine samples studied were complex; considerable variation between individuals was observed and a common microbial signature was not evident. Notably, a significant amount of sequences belonging to bacteria with a known pathogenic potential was observed. The number of operational taxonomic units (OTUs) for individual samples varied substantially and was in the range of 20 - 500. Conclusions Normal female urine displays a noticeable and variable bacterial 16S rDNA sequence richness, which includes fastidious and anaerobic bacteria previously shown to be associated with female urogenital pathology. PMID:22047020

  11. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    NASA Technical Reports Server (NTRS)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.


    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  12. Regulation of Arabidopsis thaliana 5S rRNA Genes.


    Vaillant, Isabelle; Tutois, Sylvie; Cuvillier, Claudine; Schubert, Ingo; Tourmente, Sylvette


    The Arabidopsis thaliana genome comprises around 1,000 copies of 5S rRNA genes encoding both major and minor 5S rRNAs. In mature wild-type leaves, the minor 5S rRNA genes are silent. Using different mutants of DNA methyltransferases (met1, cmt3 and met1 cmt3), components of the RNAi pathway (ago4) or post-translational histone modifier (hda6/sil1), we show that the corresponding proteins are needed to maintain proper methylation patterns at heterochromatic 5S rDNA repeats. Using reverse transcription-PCR and cytological analyses, we report that a decrease of 5S rDNA methylation at CG or CNG sites in these mutants leads to the release of 5S rRNA gene silencing which occurred without detectable changes of the 5S rDNA chromatin structure. In spite of severely reduced DNA methylation, the met1 cmt3 double mutant revealed no increase in minor 5S rRNA transcripts. Furthermore, the release of silencing of minor 5S rDNAs can be achieved without increased formation of euchromatic loops by 5S rDNA, and is independent from the global heterochromatin content. Additionally, fluorescence in situ hybridization with centromeric 180 bp repeats confirmed that these highly repetitive sequences, in spite of their elevated transcriptional activity in the DNA methyltransferase mutants (met1, cmt3 and met1 cmt3), remain within chromocenters of the mutant nuclei. PMID:17412735

  13. Molecular microbial diversity of an anaerobic digestor as determined by small-subunit rDNA sequence analysis.

    PubMed Central

    Godon, J J; Zumstein, E; Dabert, P; Habouzit, F; Moletta, R


    The bacterial community structure of a fluidized-bed reactor fed by vinasses (wine distillation waste) was analyzed. After PCR amplification, four small-subunit (SSU) rDNA clone libraries of Bacteria, Archaea, Procarya, and Eucarya populations were established. The community structure was determined by operational taxonomic unit (OTU) phylogenetic analyses of 579 partial rDNA sequences (about 500 bp long). A total of 146 OTUs were found, comprising 133, 6, and 7 from the Bacteria, Archaea, and Eucarya domains, respectively. A total of 117 bacterial OTU were affiliated with major phyla: low-G+C gram-positive bacteria, Cytophaga-Flexibacter-Bacteroides, Proteobacteria, high-G+C gram-positive bacteria, and Spirochaetes, where the clone distribution was 34, 26, 17, 6, and 4%, respectively. The other 16 bacterial OTUs represent 13% of the clones. They were either affiliated with narrow phyla such as Planctomyces-Chlamydia, green nonsulfur bacteria, or Synergistes, or deeply branched on the phylogenetic tree. A large number of bacterial OTUs are not closely related to any other hitherto determined sequences. The most frequent bacterial OTUs represents less than 5% of the total bacterial SSU rDNA sequences. However, the 20 more frequent bacterial OTUs describe at least 50% of these sequences. Three of the six Archaea OTUs correspond to 95% of the Archaea population and are very similar to already known methanogenic species: Methanosarcina barkeri, Methanosarcina frisius, and Methanobacterium formicicum. In contrast, the three other Archaea OTUs are unusual and are related to thermophilic microorganisms such as Crenarchaea or Thermoplasma spp. Five percent of the sequences analyzed were chimeras and were removed from the analysis. PMID:9212428

  14. Sequence analysis of the rDNA internal transcribed spacer 2 of five species of South American human malaria mosquitoes.


    Fritz, G N


    The rDNA internal transcribed spacer 2 (ITS2) was sequenced for 5 species of mosquitoes that may be important vectors of human malaria in certain regions of South America and are difficult to distinguish by morphology: Anopheles evansae, An. nuneztovari, An. rangeli, An. strodei and An. trinkae. ITS2 sequences from samples collected in Ecuador, Bolivia, Venezuela and Brazil were aligned and compared in order to determine the usefulness of this spacer for the elaboration of species specific primers and DNA probes. The ITS2 was found to be different in size (ranging from 333 to 397 bp) and sequence between all pairs of species. Highly variable regions were found primarily at the 3' end of the spacer and were interspersed with relatively conserved sites. Instraspecific sequence variation was limited to a single transversion between specimens of An. rangeli from distant geographic locations suggesting concerted evolution and homogenization of the ITS2. PMID:10520449

  15. Nucleotide sequences of 5S rRNAs from sponge Halichondria japonica and tunicate Halocynthia roretzi and their phylogenetic positions

    PubMed Central

    Komiya, Hiroyuki; Hasegawa, Masami; Takemura, Shosuke


    The nucleotide sequences of 5S rRNAs from sponge Halichondria japonica and tunicate Halocynthia roretzi were determined by chemical and enzymatic gel methods. Their phylogenetic positions among metazoans were derived from the 5S rRNA sequences by a computer analysis based on the maximum parsimony principle. It was suggested that the sponge is closely related to several invertebrates and the tunicate has affinity to vertebrates rather than invertebrates. PMID:6835845

  16. Origin and evolution of organisms as deduced from 5S ribosomal RNA sequences.


    Hori, H; Osawa, S


    A phylogenetic tree of most of the major groups of organisms has been constructed from the 352 5S ribosomal RNA sequences now available. The tree suggests that there are several major groups of eubacteria that diverged during the early stages of their evolution. Metabacteria (= archaebacteria) and eukaryotes separated after the emergence of eubacteria. Among eukaryotes, red algae emerged first; and, later, thraustochytrids (a Proctista group), ascomycetes (yeast), green plants (green algae and land plants), "yellow algae" (brown algae, diatoms, and chrysophyte algae), basidiomycetes (mushrooms and rusts), slime- and water molds, various protozoans, and animals emerged, approximately in that order. Three major types of photosynthetic eukaryotes--i.e., red algae (= Chlorophyll a group), green plants (Chl. a + b group) and yellow algae (Chl. a + c)--are remotely related to one another. Other photosynthetic unicellular protozoans--such as Cyanophora (Chl. a), Euglenophyta (Chl. a + b), Cryptophyta (Chl. a + c), and Dinophyta (Chl. a + c)--seem to have separated shortly after the emergence of the yellow algae. PMID:2452957

  17. Evolution of green plants as deduced from 5S rRNA sequences

    PubMed Central

    Hori, Hiroshi; Lim, Byung-Lak; Osawa, Syozo


    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  18. Evolution of green plants as deduced from 5S rRNA sequences.


    Hori, H; Lim, B L; Osawa, S


    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  19. Identification of signature and primers specific to genus Pseudomonas using mismatched patterns of 16S rDNA sequences

    PubMed Central

    Purohit, HJ; Raje, DV; Kapley, A


    Background Pseudomonas, a soil bacterium, has been observed as a dominant genus that survives in different habitats with wide hostile conditions. We had a basic assumption that the species level variation in 16S rDNA sequences of a bacterial genus is mainly due to substitutions rather than insertion or deletion of bases. Keeping this in view, the aim was to identify a region of 16S rDNA sequence and within that focus on substitution prone stretches indicating species level variation and to derive patterns from these stretches that are specific to the genus. Results Repeating elements that are highly conserved across different species of Pseudomonas were considered as guiding markers to locate a region within the 16S gene. Four repeating patterns showing more than 80% consistency across fifty different species of Pseudomonas were identified. The sub-sequences between the repeating patterns yielded a continuous region of 495 bases. The sub-sequences after alignment and using Shanon's entropy measure yielded a consensus pattern. A stretch of 24 base positions in this region, showing maximum variations across the sampled sequences was focused for possible genus specific patterns. Nine patterns in this stretch showed nearly 70% specificity to the target genus. These patterns were further used to obtain a signature that is highly specific to Pseudomonas. The signature region was used to design PCR primers, which yielded a PCR product of 150 bp whose specificity was validated through a sample experiment. Conclusions The developed approach was successfully applied to genus Pseudomonas. It could be tried in other bacterial genera to obtain respective signature patterns and thereby PCR primers, for their rapid tracking in the environmental samples. PMID:12769821

  20. Phylogenetic origins of the plant mitochondrion based on a comparative analysis of 5S ribosomal RNA sequences

    NASA Technical Reports Server (NTRS)

    Villanueva, E.; Delihas, N.; Luehrsen, K. R.; Fox, G. E.; Gibson, J.


    The complete nucleotide sequences of 5S ribosomal RNAs from Rhodocyclus gelatinosa, Rhodobacter sphaeroides, and Pseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains. Rhodobacter sphaeroides is specifically related to Paracoccus denitrificans and Rc. gelatinosa is related to Ps. cepacia. These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found in P. denitrificans are present also in the 5S RNA of Rb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of obtaining these new sequences is that it is possible to clarify the phylogenetic origins of the plant mitochondrion. In particular, a close phylogenetic relationship is found between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely, Rb. sphaeroides, P. denitrificans, and Rhodospirillum rubrum.

  1. Details of the evolutionary history from invertebrates to vertebrates, as deduced from the sequences of 18S rDNA.

    PubMed Central

    Wada, H; Satoh, N


    Almost the entire sequences of 18S rDNA were determined for two chaetognaths, five echinoderms, a hemichordate, and two urochordates (a larvacean and a salp). Phylogenetic comparisons of the sequences, together with those of other deuterostomes (an ascidian, a cephalochordate, and vertebrates) and protostomes (an arthropod and a mollusc), suggest the monophyly of the deuterostomes, with the exception of the chaetognaths. Chaetognaths may not be a group of deuterostomes. The deuterostome group closest to vertebrates was the group of cephalochordates. Ascidians, larvaceans, and salps seem to form a discrete group (urochordates), in which the early divergence of larvaceans is evident. These results support the hypothesis that chordates evolved from free-living ancestors. PMID:8127885

  2. Molecular Taxonomy of Ganoderma cupreum from Southern India Inferred from ITS rDNA Sequences Analysis

    PubMed Central


    Ganoderma is a cosmopolitan wood-rot basidiomycete that has been extensively studied for its pathogencity and medicinal properties. Identification of Ganoderma based on macro-microscopic features led to large number of synonyms which resulted in 250 taxonomic names. A Ganoderma species collected from Courtallam, Tamil Nadu was identified as G. cupreum. Phylogenetic analysis inferred from internal transcribed spacer rDNA region resolved the Indian isolate MYC1 as Ganoderma cupreum which clustered with Australian and Asian "cupreum" clade with 85% bootstrap support BS and shared 99% and 98% nucleotide similarity with Malaysian and Australian 'cupreum' respectively. This study represents the first molecular evidence of G. cupreum from Asian origin. PMID:24493948

  3. Analysis of the 5S RNA Pool in Arabidopsis thaliana: RNAs Are Heterogeneous and Only Two of the Genomic 5S Loci Produce Mature 5S RNA

    PubMed Central

    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette


    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5′- and 3′-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array. [EMBL accession nos: AF330825-AF331032; AF335777-AF335873.] PMID:11779838

  4. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.


    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto


    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes. PMID:16612546

  5. Distribution and 16S rDNA sequences of Argas monachus (Acari: Argasidae), a soft tick parasite of Myiopsitta monachus (Aves: Psittacidae).


    Mastropaolo, Mariano; Turienzo, Paola; Di Iorio, Osvaldo; Nava, Santiago; Venzal, José M; Guglielmone, Alberto A; Mangold, Atilio J


    Specimens of Argas monachus Keirans et al. were collected from Myiopsitta monachus nests in 42 localities in Argentina and Paraguay from 2006 to 2010. A list of localities where this tick has been found is presented. 16S rDNA sequences of specimens of A. monachus from different localities were compared to confirm whether they belong to the same specific taxon. Argas monachus is present in the phytogeographic provinces of Chaco, Espinal, and Monte, but not in the Pampa (all from de Chaco Domain) where the host is well distributed. No differences were found among 16S rDNA sequences of geographically distant specimens. PMID:21739257

  6. Description of the male, redescription of the female and 16S rDNA sequence of Ixodes aulacodi (Ixodidae).


    Chiţimia-Dobler, Lidia; D'Amico, Gianluca; Yao, Patrick Kouassi; Kalmár, Zsuzsa; Gherman, Călin Mircea; Mihalca, Andrei Daniel; Estrada-Peña, Agustin


    Ixodes (Afrixodes) aulacodiArthur, 1956 is a poorly known species that has been recorded predominantly in the wet countries of western and central Africa, mainly associated to the greater cane rat Thryonomys swinderianus (Temmink). We herein redescribe the female, describe the male (ascribed to the species from specimens found in copula) and provide the 16S rDNA sequence. We also provide complete illustrations of the adults based on specimens found on greater cane rats in Ivory Coast. Ixodes aulacodi is included in the group of species of the subgenus Afrixodes that have horseshoe shaped anal groove, and which lack auriculae and cornua. The female is easily separated when compared with other species because of a unique combination of characters: All the coxae have internal spurs, coxa II has two external spurs, syncoxae are absent, and trochanters I-III have one spur each. The male has a notched hypostome and lacks syncoxae, auriculae and cornua. PMID:26803353

  7. Genomic organization and evolution of the 5S ribosomal DNA in Tilapiini fishes.


    Alves-Costa, F A; Wasko, A P; Oliveira, C; Foresti, F; Martins, C


    5S rDNA sequences present an intense dynamism and have proved to be valuable as genetic markers to distinguish closed related species and also in the understanding of the evolutionary dynamic of repetitive sequences in the genomes. In order to identify patterns of 5S rDNA organization and their evolution in the genome of fish species, such genomic segment was investigated in the tilapias Oreochromis niloticus and Tilapia rendalli, and in the hybrid O. urolepis hornorum x O. mossambicus. A dual 5S rDNA system was identified in the three analyzed tilapia samples. Although each 5S rDNA class was conserved among the three samples, a distinct 5S rDNA genome organization pattern could be evidenced for each sample. The presence of a dual 5S rDNA system seems to be a general trait among non-related teleost fish orders, suggesting that evolutionary events of duplication have occurred before the divergence of the main groups of teleost fishes. PMID:16850228

  8. 18S rDNA polymerase chain reaction and sequencing in onychomycosis diagnostics.


    Walberg, Mette; Mørk, Cato; Sandven, Per; Jorde, Anne Tomine; Bjørås, Magnar; Gaustad, Peter


    Diagnostic approaches to onychomycosis have traditionally been based on a combination of culture and microscopy. In the present study clinical specimens from 346 patients with suspected onychomycosis were analysed by 18S polymerase chain reaction (detection) followed by sequencing and subsequent database search (identification) in parallel with routine culture on agar (detection and identification). In 49 samples Trichophyton rubrum was identified by culture and sequencing. In 67 additional culture negative samples, a positive dermatophyte sequence was obtained (T. rubrum in 54, T. mentagrophytes in 5, and T. species in 8 samples). Fifteen samples cultured positive while no sequence was obtained. Two hundred and seven samples were negative by culture as well as by sequencing. Nails from 10 healthy controls were negative by culture and sequencing. In conclusion, the number of specimens that were positive by polymerase chain reaction was more than double the number that were positive by culture alone. PMID:16710579

  9. Molecular phylogenetics at the Felsenstein zone: approaching the Strepsiptera problem using 5.8S and 28S rDNA sequences.


    Hwang, U W; Kim, W; Tautz, D; Friedrich, M


    Recent efforts to reconstruct the phylogenetic position of the insect order Strepsiptera have elicited a major controversy in molecular phylogenetics. We sequenced the 5.8S rDNA and major parts of the 28S rDNA 5' region of the strepsipteran species Stylops melittae. Their evolutionary dynamics were analyzed together with previously published insect rDNA sequences to identify tree estimation bias risks and to explore additional sources of phylogenetic information. Several major secondary structure changes were found as being autapomorphic for the Diptera, the Strepsiptera, or the Archaeognatha. Besides elevated substitution rates a significant AT bias was present in dipteran and strepsipteran 28S rDNA which, however, was restricted to stem sites in the Diptera while also affecting single-stranded sites in the Strepsiptera. When dipteran taxa were excluded from tree estimation all methods consistently supported the placement of Strepsiptera to within the Holometabola. When dipteran taxa were included maximum likelihood continued to favor a sister-group relationship of Strepsiptera with Mecoptera while remaining methods strongly supported a sister-group relationship with Diptera. Parametric bootstrap analysis revealed maximum likelihood as a consistent estimator if rate heterogeneity across sites was taken into account. Though the position of Strepsiptera within Holometabola remains elusive, we conclude that the evolution of dipteran and strepsipteran rDNA involved similar yet independent changes of substitution parameters. PMID:9667995

  10. Identification of cephalopod species from the North and Baltic Seas using morphology, COI and 18S rDNA sequences

    NASA Astrophysics Data System (ADS)

    Gebhardt, Katharina; Knebelsberger, Thomas


    We morphologically analyzed 79 cephalopod specimens from the North and Baltic Seas belonging to 13 separate species. Another 29 specimens showed morphological features of either Alloteuthis mediaor Alloteuthis subulata or were found to be in between. Reliable identification features to distinguish between A. media and A. subulata are currently not available. The analysis of the DNA barcoding region of the COI gene revealed intraspecific distances (uncorrected p) ranging from 0 to 2.13 % (average 0.1 %) and interspecific distances between 3.31 and 22 % (average 15.52 %). All species formed monophyletic clusters in a neighbor-joining analysis and were supported by bootstrap values of ≥99 %. All COI haplotypes belonging to the 29 Alloteuthis specimens were grouped in one cluster. Neither COI nor 18S rDNA sequences helped to distinguish between the different Alloteuthis morphotypes. For species identification purposes, we recommend the use of COI, as it showed higher bootstrap support of species clusters and less amplification and sequencing failure compared to 18S. Our data strongly support the assumption that the genus Alloteuthis is only represented by a single species, at least in the North Sea. It remained unclear whether this species is A. subulata or A. media. All COI sequences including important metadata were uploaded to the Barcode of Life Data Systems and can be used as reference library for the molecular identification of more than 50 % of the cephalopod fauna known from the North and Baltic Seas.

  11. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.


    Ohama, T; Kumazaki, T; Hori, H; Osawa, S


    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  12. Localization of 5S and 25S rRNA genes on somatic and meiotic chromosomes in Capsicum species of chili pepper.


    Kwon, Jin-Kyung; Kim, Byung-Dong


    The loci of the 5S and 45S rRNA genes were localized on chromosomes in five species of Capsicum, namely, annuum, chacoense, frutescens, baccatum, and chinense by FISH. The 5S rDNA was localized to the distal region of one chromosome in all species observed. The number of 45S rDNA loci varied among species; one in annuum, two in chacoense, frutescens, and chinense, and four in baccatum, with the exceptions that 'CM334' of annuum had three loci and 'tabasco' of frutescens had one locus. 'CM334'-derived BAC clones, 384B09 and 365P05, were screened with 5S rDNA as a probe, and BACs 278M03 and 262A23 were screened with 25S rDNA as a probe. Both ends of these BAC clones were sequenced. FISH with these BAC probes on pachytenes from 'CM334' plant showed one 5S rDNA locus and three 45S rDNA loci, consistent with the patterns on the somatic chromosomes. The 5S rDNA probe was also applied on extended DNA fibers to reveal that its coverage measured as long as 0.439 Mb in the pepper genome. FISH techniques applied on somatic and meiotic chromosomes and fibers have been established for chili to provide valuable information about the copy number variation of 45S rDNA and the actual physical size of the 5S rDNA in chili. PMID:19277503

  13. Improved performance of the PacBio SMRT technology for 16S rDNA sequencing.


    Mosher, Jennifer J; Bowman, Brett; Bernberg, Erin L; Shevchenko, Olga; Kan, Jinjun; Korlach, Jonas; Kaplan, Louis A


    Improved sequencing accuracy was obtained with 16S amplicons from environmental samples and a known pure culture when upgraded Pacific Biosciences (PacBio) hardware and enzymes were used for the single molecule, real-time (SMRT) sequencing platform. The new PacBio RS II system with P4/C2 chemistry, when used with previously constructed libraries (Mosher et al., 2013) surpassed the accuracy of Roche/454 pyrosequencing platform. With accurate read lengths of >1400 base pairs, the PacBio system opens up the possibility of identifying microorganisms to the species level in environmental samples. PMID:24978594

  14. Identification of Anoectochilus based on rDNA ITS sequences alignment and SELDI-TOF-MS.


    Gao, Chuan; Zhang, Fusheng; Zhang, Jun; Guo, Shunxing; Shao, Hongbo


    The internal transcribed spacer (ITS) sequences alignment and proteomic difference of Anoectochilus interspecies have been studied by means of ITS molecular identification and surface enhanced laser desorption ionization time of flight mass spectrography. Results showed that variety certification on Anoectochilus by ITS sequences can not determine species, and there is proteomic difference among Anoectochilus interspecies. Moreover, proteomic finger printings of five Anoectochilus species have been established for identifying species, and genetic relationships of five species within Anoectochilus have been deduced according to proteomic differences among five species. PMID:20016748

  15. Identification of Anoectochilus based on rDNA ITS sequences alignment and SELDI-TOF-MS

    PubMed Central

    Gao, Chuan; Zhang, Fusheng; Zhang, Jun; Guo, Shunxing; Shao, Hongbo


    The internal transcribed spacer (ITS) sequences alignment and proteomic difference of Anoectochilus interspecies have been studied by means of ITS molecular identification and surface enhanced laser desorption ionization time of flight mass spectrography. Results showed that variety certification on Anoectochilus by ITS sequences can not determine species, and there is proteomic difference among Anoectochilus interspecies. Moreover, proteomic finger printings of five Anoectochilus species have been established for identifying species, and genetic relationships of five species within Anoectochilus have been deduced according to proteomic differences among five species. PMID:20016748

  16. Intraspecific diversity within Diaporthe helianthi: evidence from rDNA intergenic spacer (IGS) sequence analysis.


    Pecchia, Susanna; Mercatelli, Elisabetta; Vannacci, Giovanni


    Diaporthe helianthi is the causal agent of sunflower stem canker, a serious pathogen of sunflower in Europe but recorded sporadically in Italy. The genetic diversity of D. helianthi isolates from different geographic origins (Argentina, France, Italy, Yugoslavia, Romania) was investigated using IGS sequences. A 400 bp fragment of the portion of the IGS region flanking the 5' end of the 18S gene was amplified from each isolate. The aligned nucleotide sequences showed intraspecific sequence homology from 99-100% among French/Yugoslavian isolates to 95-100% among Italian isolates. French/Yugoslavian isolates shared 90-92% sequence homology with Italian isolates. The phylogenetic tree obtained from the aligned data revealed three separate groups. Group 1 included all isolates from France and former Yugoslavia and one isolate from Argentina; Group 2 included all Italian isolates and one isolate from Argentina. The most distantly related isolate was that from Romania (Group 3). The average genetic distances among isolates within Group 1 and within Group 2 were 0.22 and 3.29 respectively. The analysis showed that all isolates originating from countries where severe outbreaks of the disease are reported annually (France and former Yugoslavia) form a well defined taxon characterized by relatively low variability. This group is distinct from the group formed by isolates originating from Italy, whose variability is relatively much higher. Results obtained revealed a marked differentiation among pathogen isolates, and members of Group 1 seem not yet to have spread into Italian sunflower-growing areas. PMID:15180160

  17. Photobiont diversity in lichens from metal-rich substrata based on ITS rDNA sequences.


    Backor, Martin; Peksa, Ondrej; Skaloud, Pavel; Backorová, Miriam


    The photobiont is considered as the more sensitive partner of lichen symbiosis in metal pollution. For this reason the presence of a metal tolerant photobiont in lichens may be a key factor of ecological success of lichens growing on metal polluted substrata. The photobiont inventory was examined for terricolous lichen community growing in Cu mine-spoil heaps derived by historical mining. Sequences of internal transcribed spacer (ITS) were phylogenetically analyzed using maximum likelihood analyses. A total of 50 ITS algal sequences were obtained from 22 selected lichen taxa collected at three Cu mine-spoil heaps and two control localities. Algae associated with Cladonia and Stereocaulon were identified as members of several Asterochloris lineages, photobionts of cetrarioid lichens clustered with Trebouxia hypogymniae ined. We did not find close relationship between heavy metal content (in localities as well as lichen thalli) and photobiont diversity. Presence of multiple algal genotypes in single lichen thallus has been confirmed. PMID:20031214

  18. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    PubMed Central

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich


    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  19. Characterization of Lactobacillus from Algerian Goat'S Milk Based on Phenotypic, 16S rDNA Sequencing and their Technological Properties.


    Marroki, Ahmed; Zúñiga, Manuel; Kihal, Mabrouk; Pérez-Martínez, Gaspar


    Nineteen strains of Lactobacillus isolated from goat's milk from farms in north-west of Algeria were characterized. Isolates were identified by phenotypic, physiological and genotypic methods and some of their important technological properties were studied. Phenotypic characterization was carried out by studying physiological, morphological characteristics and carbohydrate fermentation patterns using API 50 CHL system. Isolates were also characterized by partial 16S rDNA sequencing. Results obtained with phenotypic methods were correlated with the genotypic characterization and 13 isolates were identified as L. plantarum, two isolates as L. rhamnosus and one isolate as L. fermentum. Three isolates identified as L. plantarum by phenotypic characterization were found to be L. pentosus by the genotypic method. A large diversity in technological properties (acid production in skim milk, exopolysaccharide production, aminopeptidase activity, antibacterial activity and antibiotic susceptibility) was observed. Based on these results, two strains of L. plantarum (LbMS16 and LbMS21) and one strain of L. rhamnosus (LbMF25) have been tentatively selected for use as starter cultures in the manufacture of artisanal fermented dairy products in Algeria. PMID:24031617

  20. The phylogeny of native and exotic scallops cultured in China based on 16S rDNA sequences

    NASA Astrophysics Data System (ADS)

    Liu, Baozhong; Dong, Bo; Xiang, Jianhai; Wang, Zaizhao


    Scallops of the Family Pectinidae are a valuable resource in marine industry of the world. Understanding the phylogeny of the family is important for the development of the industry. In this study, partial 16S mitochondrial rDNA genes were obtained from 8 scallop species that are commonly cultured indigenous and transplanted species in China. Phylogenetic relationships of Pectinidae were analyzed based on the 8 sequences and other 5 published ones in GenBank, representing 9 genera of the family. The molecular phylogeny trees were constructed using 3 methods with software PHYLIP. The results showe that total 13 species of scallops clustered in 4 clades. Pecten maximus joins P. jacobaeus then Amusium pleuronectes in cluster, indicating close relationship of genus Amusium with Pecten in evolution. P. yessoensis is close to Chlamys farreri and C. islandica. No enough material was available to single out genus Patinopecten as an independent monophyletic subfamily. The position of Adamussium colbecki indicates that it is far from genus Pecten but near to genus Chlamys in evolution.

  1. Phylogenetic relationships of Brazilian isolates of Pythium insidiosum based on ITS rDNA and cytochrome oxidase II gene sequences.


    Azevedo, M I; Botton, S A; Pereira, D I B; Robe, L J; Jesus, F P K; Mahl, C D; Costa, M M; Alves, S H; Santurio, J M


    Pythium insidiosum is an aquatic oomycete that is the causative agent of pythiosis. Advances in molecular methods have enabled increased accuracy in the diagnosis of pythiosis, and in studies of the phylogenetic relationships of this oomycete. To evaluate the phylogenetic relationships among isolates of P. insidiosum from different regions of Brazil, and also regarding to other American and Thai isolates, in this study a total of thirty isolates of P. insidiosum from different regions of Brazil was used and had their ITS1, 5.8S rRNA and ITS2 rDNA (ITS) region and the partial sequence of cytochrome oxidase II (COX II) gene sequenced and analyzed. The outgroup consisted of six isolates of other Pythium species and one of Lagenidium giganteum. Phylogenetic analyses of ITS and COX II genes were conducted, both individually and in combination, using four different methods: Maximum parsimony (MP); Neighbor-joining (NJ); Maximum likelihood (ML); and Bayesian analysis (BA). Our data supported P. insidiosum as monophyletic in relation to the other Pythium species, and COX II showed that P. insidiosum appears to be subdivided into three major polytomous groups, whose arrangement provides the Thai isolates as paraphyletic in relation to the Brazilian ones. The molecular analyses performed in this study suggest an evolutionary proximity among all American isolates, including the Brazilian and the Central and North America isolates, which were grouped together in a single entirely polytomous clade. The COX II network results presented signals of a recent expansion for the American isolates, probably originated from an Asian invasion source. Here, COX II showed higher levels bias, although it was the source of higher levels of phylogenetic information when compared to ITS. Nevertheless, the two markers chosen for this study proved to be entirely congruent, at least with respect to phylogenetic relationships between different isolates of P. insidiosum. PMID:22483240

  2. Molecular authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii by ITS and 5S rRNA spacer sequencing.


    Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui


    In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii. PMID:17202681

  3. Using the Multiple Analysis Approach to Reconstruct Phylogenetic Relationships among Planktonic Foraminifera from Highly Divergent and Length-polymorphic SSU rDNA Sequences

    PubMed Central

    Aurahs, Ralf; Göker, Markus; Grimm, Guido W.; Hemleben, Vera; Hemleben, Christoph; Schiebel, Ralf; Kučera, Michal


    The high sequence divergence within the small subunit ribosomal RNA gene (SSU rDNA) of foraminifera makes it difficult to establish the homology of individual nucleotides across taxa. Alignment-based approaches so far relied on time-consuming manual alignments and discarded up to 50% of the sequenced nucleotides prior to phylogenetic inference. Here, we investigate the potential of the multiple analysis approach to infer a molecular phylogeny of all modern planktonic foraminiferal taxa by using a matrix of 146 new and 153 previously published SSU rDNA sequences. Our multiple analysis approach is based on eleven different automated alignments, analysed separately under the maximum likelihood criterion. The high degree of congruence between the phylogenies derived from our novel approach, traditional manually homologized culled alignments and the fossil record indicates that poorly resolved nucleotide homology does not represent the most significant obstacle when exploring the phylogenetic structure of the SSU rDNA in planktonic foraminifera. We show that approaches designed to extract phylogenetically valuable signals from complete sequences show more promise to resolve the backbone of the planktonic foraminifer tree than attempts to establish strictly homologous base calls in a manual alignment. PMID:20140067

  4. Distribution of Mosquitoes in the South East of Argentina and First Report on the Analysis Based on 18S rDNA and COI Sequences

    PubMed Central

    Díaz-Nieto, Leonardo M.; Maciá, Arnaldo; Parisi, Gustavo; Farina, Juan L.; Vidal-Domínguez, María E.; Perotti, M. Alejandra; Berón, Corina M.


    Although Mar del Plata is the most important city on the Atlantic coast of Argentina, mosquitoes inhabiting such area are almost uncharacterized. To increase our knowledge in their distribution, we sampled specimens of natural populations. After the morphological identification based on taxonomic keys, sequences of DNA from small ribosomal subunit (18S rDNA) and cytochrome c oxidase I (COI) genes were obtained from native species and the phylogenetic analysis of these sequences were done. Fourteen species from the genera Uranotaenia, Culex, Ochlerotatus and Psorophora were found and identified. Our 18S rDNA and COI-based analysis indicates the relationships among groups at the supra-species level in concordance with mosquito taxonomy. The introduction and spread of vectors and diseases carried by them are not known in Mar del Plata, but some of the species found in this study were reported as pathogen vectors. PMID:24098700

  5. 16S rDNA sequence analysis of bacterial isolates from biodeteriorated mural paintings in the Servilia tomb (Necropolis of carmona, Seville, Spain).


    Heyrman, J; Swings, J


    Bacteria were isolated from damaged mural paintings of the Servilia tomb (necropolis of Carmona, Seville, Spain). Selected strains, representative for different clusters of isolates with similar fatty acid profiles, were analysed by 16S rDNA sequence analysis. Bacillus is the dominant genus among the isolates: members of the rRNA species complexes of B. megaterium, B. pumilus and B. firmus were found as well as several other Bacillus species. One group of halotolerant isolates falls in the Bacillus sensu lato group, with closest relatedness to the genera Salibacillus and Virgibacillus. Other genera found are Artbrobacter, Micrococcus, Streptomyces, Sphingomonas, Paenibacillus, and a genus closely related to Paracraurococcus. Many isolates showed low 16S rDNA sequence similarities with the closest related database entries, a strong indication for the presence of several new species among the isolates. PMID:11822679

  6. [Analysis of DNA homology and 16S rDNA sequence of rhizobia, a new phenotypic subgroup, isolated from Xizang Autonomous Region of China].


    Wang, Su-ying; Yang, Xiao-li; Li, Hai-feng; Liu, Jie


    Based on the studies of numerical taxonomy, the seven rhizobial strains isolated from the root nodules of leguminous plants Trigonella spp. and Astragalus spp. growing in the Xizang Autonomous Region of China constituted a new phenotypic subgroup, where wide phenotypic and genotypic diversity among legume crops had been reported due to complex terrain and various climate. The new phenotypic subgroup were further identified to clarify its taxonomic position by DNA homology analysis and 16S rDNA gene sequencing. The mol% G + C ratio of the DNA among members of the new subgroup ranged from 59.5 to 63.3 mol% as determined by T (m) assay. The levels of DNA relatedness, determined by using the DNA liquid hybridization method, among the members of the new subgroup were between 74.3% and 92.3%, while level of DNA relatedness between the central strains XZ2-3 of the new subgroup and the type strains of known species of Rhizobium was less than 47.4%. These results indicated that the new phenotypic subgroup is a DNA homological group different from described species of Rhizobium. Therefore, this new phenotypic subgroup was supposed to be a new species in the genus of Rhizobium since the strains in the same species generally exhibit levels of DNA homology ranging from 70 to 100%. A systematic identification method-16S rDNA gene sequence comparison was carried out to determine the phylogenetic relationships of the new subgroup with the described species of Rhizobium. The GenBank accession number for the 16S rDNA sequence of the central strain XZ2-3 of the new subgroup is DQ099745. The full-length 16S rDNA gene sequence were sequenced by chain terminator techniques and analyzed with PHYLIP. The phylogenetic trees were constructed by using the programs DRAWTREE. The phylogenetic analysis indicated that new subgroup occupy a independent sub-branch in phylogenetic tree. The sequence similarities between the center strain XZ2-3 and the closest relatives, strain R. leguminosarum USDA

  7. Comet-FISH with rDNA probes for the analysis of mutagen-induced DNA damage in plant cells.


    Kwasniewska, Jolanta; Grabowska, Marta; Kwasniewski, Miroslaw; Kolano, Bozena


    We used comet-fluorescence in situ hybridization (FISH) in the model plant species Crepis capillaris following exposure of seedlings to maleic hydrazide (MH). FISH with 5S and 25S rDNA probes was applied to comets obtained under alkaline conditions to establish whether these DNA regions were preferentially involved in comet tail formation. MH treatment induced significant fragmentation of nuclear DNA and of rDNA loci. A 24-h post-treatment recovery period allowed a partial reversibility of MH-induced damage on nuclear and rDNA regions. Analyses of FISH signals demonstrated that rDNA sequences were always involved in tail formation and that 5S rDNA was more frequently present in the tail than 25S rDNA, regardless of treatment. The involvement of 25S rDNA in nucleolus formation and differences in chromatin structure between the two loci may explain the different susceptibility of the 25S and 5S rDNA regions to migrate into the tail. This work is the first report on the application of FISH to comet preparations from plants to analyze the distribution and repair of DNA damage within specific genomic regions after mutagenic treatment. Moreover, our work suggests that comet-FISH in plants may be a useful tool for environmental monitoring assessment. PMID:22556029

  8. Identification of the Bacterial Community of Maple Sap by Using Amplified Ribosomal DNA (rDNA) Restriction Analysis and rDNA Sequencing

    PubMed Central

    Lagacé, L.; Pitre, M.; Jacques, M.; Roy, D.


    The bacterial community of maple sap was characterized by analysis of samples obtained at the taphole of maple trees for the 2001 and 2002 seasons. Among the 190 bacterial isolates, 32 groups were formed according to the similarity of the banding patterns obtained by amplified ribosomal DNA restriction analysis (ARDRA). A subset of representative isolates for each ARDRA group was identified by 16S rRNA gene fragment sequencing. Results showed a wide variety of organisms, with 22 different genera encountered. Pseudomonas and Ralstonia, of the γ- and β-Proteobacteria, respectively, were the most frequently encountered genera. Gram-positive bacteria were also observed, and Staphylococcus, Plantibacter, and Bacillus were the most highly represented genera. The sampling period corresponding to 50% of the cumulative sap flow percentage presented the greatest bacterial diversity according to its Shannon diversity index value (1.1). γ-Proteobacteria were found to be dominant almost from the beginning of the season to the end. These results are providing interesting insights on maple sap microflora that will be useful for further investigation related to microbial contamination and quality of maple products and also for guiding new strategies on taphole contamination control. PMID:15066796

  9. Reconstructing the Phylogeny of Capsosiphon fulvescens (Ulotrichales, Chlorophyta) from Korea Based on rbcL and 18S rDNA Sequences

    PubMed Central

    Sun, Sang-Mi; Yang, Seung Hwan


    Capsosiphon fulvescens is a filamentous green algae in the class Ulvophyceae. It has been consumed as food with unique flavor and soft texture to treat stomach disorders and hangovers, and its economic value justifies studying its nutritional and potential therapeutic effects. In contrast to these applications, only a few taxonomic studies have been conducted on C. fulvescens. In particular, classification and phylogenetic relationships of the C. fulvescens below the order level are controversial. To determine its phylogenetic position in the class, we used rbcL and 18S rDNA sequences as molecular markers to construct phylogenetic trees. The amplified rbcL and 18S rDNA sequences from 4 C. fulvescens isolates (Jindo, Jangheung, Wando, and Koheung, Korea) were used for phylogenetic analysis by employing three different phylogenetic methods: neighbor joining (NJ), maximum parsimony (MP), and maximum likelihood (ML). The rbcL phylogenetic tree showed that all taxa in the order Ulvales were clustered as a monophyletic group and resolved the phylogenetic position of C. fulvescens in the order Ulotrichales. The significance of our study is that the 18S rDNA phylogenetic tree shows the detailed taxonomic position of C. fulvescens. In our result, C. fulvescens is inferred as a member of Ulotrichaceae, along with Urospora and Acrosiphonia. PMID:27190985

  10. Expression of a chimeric human/salmon calcitonin gene integrated into the Saccharomyces cerevisiae genome using rDNA sequences as recombination sites.


    Sun, Hengyi; Zang, Xiaonan; Liu, Yuantao; Cao, Xiaofei; Wu, Fei; Huang, Xiaoyun; Jiang, Minjie; Zhang, Xuecheng


    Calcitonin participates in controlling homeostasis of calcium and phosphorus and plays an important role in bone metabolism. The aim of this study was to endow an industrial strain of Saccharomyces cerevisiae with the ability to express chimeric human/salmon calcitonin (hsCT) without the use of antibiotics. To do so, a homologous recombination plasmid pUC18-rDNA2-ura3-P pgk -5hsCT-rDNA1 was constructed, which contains two segments of ribosomal DNA of 1.1 kb (rDNA1) and 1.4 kb (rDNA2), to integrate the heterologous gene into host rDNA. A DNA fragment containing five copies of a chimeric human/salmon calcitonin gene (5hsCT) under the control of the promoter for phosphoglycerate kinase (P pgk ) was constructed to express 5hsCT in S. cerevisiae using ura3 as a selectable auxotrophic marker gene. After digestion by restriction endonuclease HpaI, a linear fragment, rDNA2-ura3-P pgk -5hsCT-rDNA1, was obtained and transformed into the △ura3 mutant of S. cerevisiae by the lithium acetate method. The ura3-P pgk -5hsCT sequence was introduced into the genome at rDNA sites by homologous recombination, and the recombinant strain YS-5hsCT was obtained. Southern blot analysis revealed that the 5hsCT had been integrated successfully into the genome of S. cerevisiae. The results of Western blot and ELISA confirmed that the 5hsCT protein had been expressed in the recombinant strain YS-5hsCT. The expression level reached 2.04 % of total proteins. S. cerevisiae YS-5hsCT decreased serum calcium in mice by oral administration and even 0.01 g lyophilized S. cerevisiae YS-5hsCT/kg decreased serum calcium by 0.498 mM. This work has produced a commercial yeast strain potentially useful for the treatment of osteoporosis. PMID:26254786

  11. Molecular analysis of the genus Mitragyna existing in Thailand based on rDNA ITS sequences and its application to identify a narcotic species: Mitragyna speciosa.


    Sukrong, Suchada; Zhu, Shu; Ruangrungsi, Nijsiri; Phadungcharoen, Thatree; Palanuvej, Chanida; Komatsu, Katsuko


    In Thailand, there are four Mitragyna species; M. speciosa, M. hirsuta, M. diversifolia, and M. rotundifolia. One, M. speciosa, is a narcotic plant and has medicinal importance for its opium-like effect. Since the use of M. speciosa has been forbidden in Thailand, the leaves of M. diversifolia or others are frequently used as substitutes but are not considered as effective. Therefore, accurate authentication of M. speciosa is essential for both medicinal and forensic purposes. The nucleotide sequences of internal transcribed spacers (ITS) and the 5.8S coding region of nuclear ribosomal DNA (rDNA) of the Mitragyna species were analyzed. The whole length of ITS1-5.8S-ITS2 region was 608 bp in M. speciosa, 607 bp in the other species. Nineteen sites of nucleotide substitutions and 3 sites of 1-bp indels were observed, and M. speciosa showed specific sequence differed from the others. Based on the ITS sequences, a distinctive site recognized by a restriction enzyme XmaI in M. speciosa was found and then PCR-restriction fragment length polymorphism (RFLP) analysis was established to differentiate M. speciosa from the others. By the method, a 409-bp PCR fragment of ITS1-5.8S (partial) rDNA region from M. speciosa was cleaved into two fragments of 119 bp and 290 bp while the other species remained undigested. This method provides an effective and accurate identification of M. speciosa. PMID:17603168

  12. Haplotype Detection from Next-Generation Sequencing in High-Ploidy-Level Species: 45S rDNA Gene Copies in the Hexaploid Spartina maritima

    PubMed Central

    Boutte, Julien; Aliaga, Benoît; Lima, Oscar; Ferreira de Carvalho, Julie; Ainouche, Abdelkader; Macas, Jiri; Rousseau-Gueutin, Mathieu; Coriton, Olivier; Ainouche, Malika; Salmon, Armel


    Gene and whole-genome duplications are widespread in plant nuclear genomes, resulting in sequence heterogeneity. Identification of duplicated genes may be particularly challenging in highly redundant genomes, especially when there are no diploid parents as a reference. Here, we developed a pipeline to detect the different copies in the ribosomal RNA gene family in the hexaploid grass Spartina maritima from next-generation sequencing (Roche-454) reads. The heterogeneity of the different domains of the highly repeated 45S unit was explored by identifying single nucleotide polymorphisms (SNPs) and assembling reads based on shared polymorphisms. SNPs were validated using comparisons with Illumina sequence data sets and by cloning and Sanger (re)sequencing. Using this approach, 29 validated polymorphisms and 11 validated haplotypes were reported (out of 34 and 20, respectively, that were initially predicted by our program). The rDNA domains of S. maritima have similar lengths as those found in other Poaceae, apart from the 5′-ETS, which is approximately two-times longer in S. maritima. Sequence homogeneity was encountered in coding regions and both internal transcribed spacers (ITS), whereas high intragenomic variability was detected in the intergenic spacer (IGS) and the external transcribed spacer (ETS). Molecular cytogenetic analysis by fluorescent in situ hybridization (FISH) revealed the presence of one pair of 45S rDNA signals on the chromosomes of S. maritima instead of three expected pairs for a hexaploid genome, indicating loss of duplicated homeologous loci through the diploidization process. The procedure developed here may be used at any ploidy level and using different sequencing technologies. PMID:26530424

  13. Comparison of VITEK2, MALDI-TOF MS, and 16S rDNA sequencing for identification of Myroides odoratus and Myroides odoratimimus.


    Schröttner, Percy; Rudolph, Wolfram W; Eing, Bodo R; Bertram, Sebastian; Gunzer, Florian


    The genus Myroides comprises the 2 medically relevant species Myroides odoratus and Myroides odoratimimus that are rare opportunistic pathogens and cause infections in immunocompromised patients. A fast identification of Myroides is of importance because these bacterial strains show multiple resistance against antibiotics and therefore limit treatment options. They are associated, for instance, with urinary tract infections, sepsis, meningitis, pneumonia, and infectious cellulitis. Since more and more Myroides spp. are being described, additional potentially pathogenic bacteria may be identified in the future demanding the need for fast and reliable identification methods at species level. However, to date, only molecular approaches meet these demands. In this study, we, therefore, attempt to define an appropriate method other than DNA fingerprinting that will permit a comparable efficacy and, possibly, a more economical strain identification. For this purpose, we compared 2 widely used automated diagnostic systems (VITEK 2 [bioMérieux, Nürtingen, Germany] and Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry (MALDI-TOF MS) [Bruker Daltonics, Bremen, Germany]) and correlated the results to 16S rDNA sequencing data. In total, we analyzed 22 strains collected in the course of routine diagnostics. In this study, we demonstrate that VITEK 2 reliably identifies the genus Myroides but cannot differentiate between M. odoratimimus and M. odoratus. In contrast to this, both MALDI-TOF MS and 16S rDNA sequencing efficiently distinguish between the 2 species. PMID:24666701

  14. The phylogenetic position of the Loimoidae Price, 1936 (Monogenoidea: Monocotylidea) based on analyses of partial rDNA sequences and morphological data.


    Boeger, W A; Kritsky, D C; Domingues, M V; Bueno-Silva, M


    Phylogenetic analyses of partial sequences of 18S and 28S rDNA of some monogenoids, including monocotylids and a specimen of Loimosina sp. collected from a hammerhead shark off Brazil, indicated that the Loimoidae (as represented by the specimen of Loimosina sp.) represents an in-group taxon of the Monocotylidae. In all analyses, the Loimoidae fell within a major monocotylid clade including species of the Heterocotylinae, Decacotylinae, and Monocotylinae. The Loimoidae formed a terminal clade with two heterocotyline species, Troglocephalus rhinobatidis and Neoheterocotyle rhinobatis, for which it represented the sister taxon. The following morphological characters supported the clade comprising the Loimoidae, Heterocotylinae, Decacotylinae and Monocotylinae: single vagina present, presence of a narrow deep anchor root, and presence of a marginal haptoral membrane. The presence of cephalic pits was identified as a putative synapomorphy for the clade (Loimoidae (T. rhinobatidis, N. rhinobatis)). Although rDNA sequence data support the rejection of the Loimoidae and incorporating its species into the Monocotylidae, this action was not recommended pending a full phylogenetic analysis of morphological data. PMID:24491371

  15. Culturable bacteria present in the fluid of the hooded-pitcher plant Sarracenia minor based on 16S rDNA gene sequence data.


    Siragusa, Alex J; Swenson, Janice E; Casamatta, Dale A


    The culturable microbial community within the pitcher fluid of 93 Sarracenia minor carnivorous plants was examined over a 2-year study. Many aspects of the plant/bacterial/insect interaction within the pitcher fluid are minimally understood because the bacterial taxa present in these pitchers have not been identified. Thirteen isolates were characterized by 16S rDNA sequencing and subsequent phylogenetic analysis. The Proteobacteria were the most abundant taxa and included representatives from Serratia, Achromobacter, and Pantoea. The Actinobacteria Micrococcus was also abundant while Bacillus, Lactococcus, Chryseobacterium, and Rhodococcus were infrequently encountered. Several isolates conformed to species identifiers (>98% rDNA gene sequence similarity) including Serratia marcescens (isolates found in 27.5% of pitchers), Achromobacter xylosoxidans (37.6%), Micrococcus luteus (40.9%), Bacillus cereus (isolates found in 10.2%), Bacillus thuringiensis (5.4%), Lactococcus lactis (17.2%), and Rhodococcus equi (2.2%). Species-area curves suggest that sampling efforts were sufficient to recover a representative culturable bacterial community. The bacteria present represent a diverse community probably as a result of introduction by insect vectors, but the ecological significance remains under explored. PMID:17380356

  16. Isolation and analysis of (Gp)nXp sequences of rat liver 5S RNA by means of restricted ribonuclease T2 hydrolysis

    PubMed Central

    Willems, R.; Avdonina, T.; Lund, A.; Kisselev, L.L.


    Essentual difficulties arise when base number in oligoguanylic blocks and location of these blocks along the polynucleotide chain need to be determined in the course of determination of the nucleotide sequences in ribonucleic acids. To overcome this difficulty it is suggested to take advantage of a recently discovered resistance of phosphodiester bond between kethoxalated G and its 3′-neighbour against T2 RNase hydrolysis 1,2. The approach is illustrated by analysis of 5S RNA from rat liver. Sequences of general formula (Gp)nXp were isolated from T2 RNase hydrolysate of 5 S RNA rapidly and quantitatively. The information obtained greatly facilitates the whole procedure of sequencing. It is expected that the method proposed would be effective for analysis of 5 S and 4 S RNA and for highmolecular weight fragments of ribosomal and viral RNAs. PMID:4453523

  17. Ultrastructure and 18S rDNA sequence analysis of Wobblia lunata gen. et sp. nov., a new heterotrophic flagellate (Stramenopiles, Incertae sedis).


    Moriya, M; Nakayama, T; Inouye, I


    A new heterotrophic flagellate Wobblia lunata gen. et sp. nov. is described. This organism usually attaches to the substratum showing a wobbling motion, and sometimes glides on the substratum or swims freely in the medium. W. lunata has various features characteristic of the stramenopiles. These include a hairy flagellum with tripartite tubular hairs, a mitochondrion with tubular cristae, arrangement of flagellar apparatus components and a double helix in the flagellar transition zone. W. lunata shares a double helix with heterotrophic stramenopiles, including Developayella elegans, oomycetes, hyphochytrids, opalinids and proteromonads, and could be placed in the phylum Bigyra Cavalier-Smith. However, from 18S rDNA tree analysis, these organisms form two distantly-related clades in the stramenopiles, and Wobblia appears at the base of the stramenopiles. Evaluation of morphological features and comparison of 18S rDNA sequences indicate that W. lunata is a member of the stramenopiles, but it is distinct from any other stramenopiles so far described. Its phylogenetic position within the stramenopiles is uncertain and therefore W. lunata is described as a stramenopile incertae sedis. PMID:10896132

  18. Genetic variation and relationships in Laetiporus sulphureus s. lat., as determined by ITS rDNA sequences and in vitro growth rate.


    Vasaitis, Rimvydas; Menkis, Audrius; Lim, Young Woon; Seok, Soonja; Tomsovsky, Michal; Jankovsky, Libor; Lygis, Vaidotas; Slippers, Bernard; Stenlid, Jan


    The aim of this study was to characterise the genetic variation and molecular relationships of the brown rot polypore, Laetiporus sulphureus s. lat., from Europe, South America, Africa, and Asia, using ITS sequences of the nu-rDNA and by comparing the growth rate in vitro. In a NJ analysis of the sequences of 130 individuals of L. sulphureus s. lat., eight distinct clusters emerged, supported by BS values of 70-100%. Within each cluster, the ITS rDNA sequence variation was below 3%. The sequences were also analysed together with Laetiporus sequences available from GenBank. Results demonstrated the possible presence of L. huroniensis in Europe (invalidly named L. montanus) and L. gilbertsonii in South America, and provided more information on the Pan-American and European distribution of one of the clades, currently known in North America as L. sulphureus. L. conifericola formed a separate distinct clade. Moreover, the analysis revealed two unknown Laetiporus taxa in Korea, one in South Africa, and one in Europe. As L. sulphureus is described from Europe (France), and we show that more than one taxon exist here, it is presently not possible to define L. sulphureus s. str. Certain biological differences between some of the clades (in vitro growth rates, chemical composition, and pigmentation) were demonstrated and discussed. PMID:19073254

  19. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    NASA Technical Reports Server (NTRS)

    Fox, G. E.


    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  20. Phylogenetic position of the Phacotaceae within the Chlamydophyceaeas revealed by analysis of 18S rDNA and rbcL sequences.


    Hepperle, D; Nozaki, H; Hohenberger, S; Huss, V A; Morita, E; Krienitz, L


    Four genera of the Phacotaceae (Phacotus, Pteromonas, Wislouchiella, Dysmorphococcus), a family of loricated green algal flagellates within the Volvocales, were investigated by means of transmission electron microscopy and analysis of the nuclear encoded small-subunit ribosomal RNA (18S rRNA) genes and the plastid-encoded rbcL genes. Additionally, the 18S rDNA of Haematococcus pluvialis and the rbcL sequences of Chlorogonium elongatum, C. euchlorum, Dunaliella parva, Chloromonas serbinowii, Chlamydomonas radiata, and C. tetragama were determined. Analysis of ultrastructural data justified the separation of the Phacotaceae into two groups. Phacotus, Pteromonas, and Wislouchiella generally shared the following characters: egg-shaped protoplasts, a single pyrenoid with planar thylakoid double-lamellae, three-layered lorica, flagellar channels as part of the central lorica layer, mitochondria located in the central cytoplasm, lorica development that occurs in mucilaginous zoosporangia that are to be lysed, and no acid-resistant cell walls. Dysmorphococcus was clearly different in each of the characters mentioned. Direct comparison of sequences of Phacotus lenticularis, Pteromonas sp., Pteromonas protracta, and Wislouchiella planctonica revealed DNA sequence homologies of >/=98. 0% within the 18S gene and 93.9% within the rbcL gene. D. globosus was quite different from these species, with a maximum of 92.9% homology in the 18S rRNA and rDNA of Dunaliella salina, with 95.3%, and to the rbcL sequence of Chlamydomonas tetragama, with 90.3% sequence homology. Additionally, the Phacotaceae sensu stricto exclusively shared 10 (rbcL: 4) characters which were present neither in other Chlamydomonadales nor in Dysmorphococcus globosus. Different phylogenetic analysis methods confirmed the hypothesis that the Phacotaceae are polyphyletic. The Phacotaceae sensu stricto form a stable cluster with affinities to the


    EPA Science Inventory

    The major objective of the research was to provide appropriate sequences and to assemble a DNA arrays of oligonucleotides to be used for rapid profiling of microbial populations, from polluted areas and from areas of other interest. The sequences to be assigned to the DNA array a...

  2. Evaluation of direct 16S rDNA sequencing as a metagenomics-based approach to screening bacteria in bottled water.


    Hansen, Trine; Skånseng, Beate; Hoorfar, Jeffrey; Löfström, Charlotta


    Deliberate or accidental contamination of food, feed, and water supplies poses a threat to human health worldwide. A rapid and sensitive detection technique that could replace the current labor-intensive and time-consuming culture-based methods is highly desirable. In addition to species-specific assays, such as PCR, there is a need for generic methods to screen for unknown pathogenic microorganisms in samples. This work presents a metagenomics-based direct-sequencing approach for detecting unknown microorganisms, using Bacillus cereus (as a model organism for B. anthracis) in bottled water as an example. Total DNA extraction and 16S rDNA gene sequencing were used in combination with principle component analysis and multicurve resolution to study detection level and possibility for identification. Results showed a detection level of 10(5) to 10(6) CFU/L. Using this method, it was possible to separate 2 B. cereus strains by the principal component plot, despite the close sequence resemblance. A linear correlation between the artificial contamination level and the relative amount of the Bacillus artificial contaminant in the metagenome was observed, and a relative amount value above 0.5 confirmed the presence of Bacillus. The analysis also revealed that background flora in the bottled water varied between the different water types that were included in the study. This method has the potential to be adapted to other biological matrices and bacterial pathogens for fast screening of unknown bacterial threats in outbreak situations. PMID:23971801

  3. Molecular Profiling of Microbial Communities from Contaminated Sources: Use of Subtractive Cloning Methods and rDNA Spacer Sequences

    SciTech Connect

    Robb, Frank T.


    The major objective of this research was to provide appropriate sequences and assemble a DNA array of oligonucleotides to be used for rapid profiling of microbial populations from polluted areas and other areas of interest. The sequences to be assigned to the DNA array were chosen from cloned genomic DNA taken from groundwater sites having well characterized pollutant histories at Hanford Nuclear Plant and Lawrence Livermore Site 300. Glass-slide arrays were made and tested; and a new multiplexed, bead-based method was developed that uses nucleic acid hybridization on the surface of microscopic polystyrene spheres to identify specific sequences in heterogeneous mixtures of DNA sequences. The test data revealed considerable strain variation between sample sites showing a striking distribution of sequences. It also suggests that diversity varies greatly with bioremediation, and that there are many bacterial intergenic spacer region sequences that can indicate its effects. The bead method exhibited superior sequence discrimination and has features for easier and more accurate measurement.

  4. Triploblastic relationships with emphasis on the acoelomates and the position of Gnathostomulida, Cycliophora, Plathelminthes, and Chaetognatha: a combined approach of 18S rDNA sequences and morphology.


    Giribet, G; Distel, D L; Polz, M; Sterrer, W; Wheeler, W C


    Triploblastic relationships were examined in the light of molecular and morphological evidence. Representatives for all triploblastic "phyla" (except Loricifera) were represented by both sources of phylogenetic data. The 18S ribosomal (rDNA) sequence data for 145 terminal taxa and 276 morphological characters coded for 36 supraspecific taxa were combined in a total evidence regime to determine the most consistent picture of triploblastic relationships for these data. Only triploblastic taxa are used to avoid rooting with distant outgroups, which seems to happen because of the extreme distance that separates diploblastic from triploblastic taxa according to the 18S rDNA data. Multiple phylogenetic analyses performed with variable analysis parameters yield largely inconsistent results for certain groups such as Chaetognatha, Acoela, and Nemertodermatida. A normalized incongruence length metric is used to assay the relative merit of the multiple analyses. The combined analysis having the least character incongruence yields the following scheme of relationships of four main clades: (1) Deuterostomia [((Echinodermata + Enteropneusta) (Cephalochordata (Urochordata + Vertebrata)))]; (2) Ecdysozoa [(((Priapulida + Kinorhyncha) (Nematoda + Nematomorpha)) ((Onychophora + Tardigrada) Arthropoda))]; (3) Trochozoa [((Phoronida + Brachiopoda) (Entoprocta (Nemertea (Sipuncula (Mollusca (Pogonophora (Echiura + Annelida)))))))]; and (4) Platyzoa [((Gnathostomulida (Cycliophora + Syndermata)) (Gastrotricha + Plathelminthes))]. Chaetognatha, Nemertodermatida, and Bryozoa cannot be assigned to any one of these four groups. For the first time, a data analysis recognizes a clade of acoelomates, the Platyzoa (sensu Cavalier-Smith, Biol. Rev. 73:203-266, 1998). Other relationships that corroborate some morphological analyses are the existence of a clade that groups Gnathostomulida + Syndermata (= Gnathifera), which is expanded to include the enigmatic phylum Cycliophora, as sister group

  5. Population genetic structure of the parasitic nematode Camallanus cotti inferred from DNA sequences of ITS1 rDNA and the mitochondrial COI gene.


    Wu, Shan G; Wang, Gui T; Xi, Bing W; Xiong, Fan; Liu, Tao; Nie, Pin


    The population genetic structure of fish parasitic nematode, Camallanus cotti, collected from the Yangtze River, Pearl River and Minjiang River in China was investigated. From these parasites, the approximately 730 bp of the first internal transcribed spacer of ribosomal DNA (ITS1 rDNA) and the 428bp of mitochondrial cytochrome c oxidase subunit I (COI) gene were sequenced. For the ITS1 rDNA data set, highly significant Fst values and low rates of migration were detected between the Pearl River group and both the Yangtze River (Fst=0.70, P<0.00001; Nm=0.21) and Minjiang River (Fst=0.73, P<0.00001; Nm=0.18) groups, while low Fst value (Fst=0.018, P>0.05) and high rate of migration (Nm=28.42) were found between the Minjiang and the Yangtze rivers. When different host/locality populations (subpopulations) within each river were considered, subpopulations between the Yangtze River and Minjiang River had low Fst values (3.72), while Pearl River subpopulations were significantly different from the Yangtze River and Minjiang River subpopulations (Fst>or=0.59; Nm<1). The COI gene data set revealed a similar genetic structure. Both phylogenetic analyses and a statistical parsimony network grouped the Pearl River haplotypes into one phylogroup, while the Yangtze River and Minjiang River haplotypes formed a second group. These results suggested that the Yangtze River and Minjiang River subpopulations constituted a single reproductive pool that was distinct from the Pearl River subpopulations. In addition, the present study did not find host-related genetic differentiation occurring in the same drainage. PMID:19632785

  6. Monitoring of Fasciola Species Contamination in Water Dropwort by cox1 Mitochondrial and ITS-2 rDNA Sequencing Analysis

    PubMed Central

    Choi, In-Wook; Kim, Hwang-Yong; Quan, Juan-Hua; Ryu, Jae-Gee; Sun, Rubing; Lee, Young-Ha


    Fascioliasis, a food-borne trematode zoonosis, is a disease primarily in cattle and sheep and occasionally in humans. Water dropwort (Oenanthe javanica), an aquatic perennial herb, is a common second intermediate host of Fasciola, and the fresh stems and leaves are widely used as a seasoning in the Korean diet. However, no information regarding Fasciola species contamination in water dropwort is available. Here, we collected 500 samples of water dropwort in 3 areas in Korea during February and March 2015, and the water dropwort contamination of Fasciola species was monitored by DNA sequencing analysis of the Fasciola hepatica and Fasciola gigantica specific mitochondrial cytochrome c oxidase subunit 1 (cox1) and nuclear ribosomal internal transcribed spacer 2 (ITS-2). Among the 500 samples assessed, the presence of F. hepatica cox1 and 1TS-2 markers were detected in 2 samples, and F. hepatica contamination was confirmed by sequencing analysis. The nucleotide sequences of cox1 PCR products from the 2 F. hepatica-contaminated samples were 96.5% identical to the F. hepatica cox1 sequences in GenBank, whereas F. gigantica cox1 sequences were 46.8% similar with the sequence detected from the cox1 positive samples. However, F. gigantica cox1 and ITS-2 markers were not detected by PCR in the 500 samples of water dropwort. Collectively, in this survey of the water dropwort contamination with Fasciola species, very low prevalence of F. hepatica contamination was detected in the samples. PMID:26537044

  7. Monitoring of Fasciola Species Contamination in Water Dropwort by cox1 Mitochondrial and ITS-2 rDNA Sequencing Analysis.


    Choi, In-Wook; Kim, Hwang-Yong; Quan, Juan-Hua; Ryu, Jae-Gee; Sun, Rubing; Lee, Young-Ha


    Fascioliasis, a food-borne trematode zoonosis, is a disease primarily in cattle and sheep and occasionally in humans. Water dropwort (Oenanthe javanica), an aquatic perennial herb, is a common second intermediate host of Fasciola, and the fresh stems and leaves are widely used as a seasoning in the Korean diet. However, no information regarding Fasciola species contamination in water dropwort is available. Here, we collected 500 samples of water dropwort in 3 areas in Korea during February and March 2015, and the water dropwort contamination of Fasciola species was monitored by DNA sequencing analysis of the Fasciola hepatica and Fasciola gigantica specific mitochondrial cytochrome c oxidase subunit 1 (cox1) and nuclear ribosomal internal transcribed spacer 2 (ITS-2). Among the 500 samples assessed, the presence of F. hepatica cox1 and 1TS-2 markers were detected in 2 samples, and F. hepatica contamination was confirmed by sequencing analysis. The nucleotide sequences of cox1 PCR products from the 2 F. hepatica-contaminated samples were 96.5% identical to the F. hepatica cox1 sequences in GenBank, whereas F. gigantica cox1 sequences were 46.8% similar with the sequence detected from the cox1 positive samples. However, F. gigantica cox1 and ITS-2 markers were not detected by PCR in the 500 samples of water dropwort. Collectively, in this survey of the water dropwort contamination with Fasciola species, very low prevalence of F. hepatica contamination was detected in the samples. PMID:26537044

  8. Morphology and SSU rDNA sequence analysis of two hypotrichous ciliates (Protozoa, Ciliophora, Hypotrichia) including the new species Metaurostylopsis parastruederkypkeae n. sp.

    NASA Astrophysics Data System (ADS)

    Lu, Borong; Wang, Chundi; Huang, Jie; Shi, Yuhong; Chen, Xiangrui


    The morphology and phylogeny of two hypotrichous ciliates, Metaurostylopsis parastruederkypkeae n. sp. and Neourostylopsis flavicana (Wang et al., 2011) Chen et al., 2013 were investigated based on morphology, infraciliature and the small subunit (SSU) ribosomal RNA gene (rRNA) sequence. The new species, M. parastruederkypkeae n. sp. was identified according to its characteristics: body shape ellipsoidal, size about (165-200) × (45-60) μm in vivo, cell color reddish; two types of cortical granules including wheat grain-like and yellow-greenish larger ones along the marginal cirri rows and dorsal kineties and dot-like and reddish smaller ones, grouped around marginal cirri on ventral side and arranged in short lines on dorsal side; 26-41 adoral membranelles; three frontal and one parabuccal, five to seven frontoterminal, one buccal, and three to six transverse cirri; seven to thirteen midventral pairs; five to nine unpaired ventral cirri, five to seven left and three to five right marginal rows; and three complete dorsal kineties. Phylogenetic analysis based on SSU rDNA sequences showed that both Metaurostylopsis and Neourostylopsis are monophyletic. As the internal relationship between and within both genera are not clear, further studies on the species in these two genera are necessary. The key characteristics of all known twelve Metaurostylopsis-Apourostylopsis-Neourostylopsis species complex were updated.

  9. Phylogenetic relationships of the soybean sudden death syndrome pathogen Fusarium solani f. sp. phaseoli inferred from rDNA sequence data and PCR primers for its identification.


    O'Donnell, K; Gray, L E


    Phylogenetic relationships of several species within the Fusarium solani-complex were investigated using characters from the nuclear ribosomal DNA. Genetic variation within 24 isolates, including 5 soybean sudden death syndrome (SDS) strains, was assessed using rDNA sequence data and restriction fragment length polymorphic markers. By these techniques, the causal agent of soybean SDS was identified as F. solani f. sp. phaseoli. In separate cladistic analyses, Plectosphaerella cucumerina and Nectria cinnabarina or F. ventricosum were used for rooting purposes. Monophyly of the F. solani-complex was strongly supported by bootstrap and decay analyses. Parsimony analysis indicates that this complex is composed of a number of phylogenetically distinct species, including Neocosmospora vasinfecta, F. solani f. sp. phaseoli, and biological species designated as MPI, MPV, and MPVI of N. haematococca. The results demonstrate complete congruence between biological and phylogenetic species within the N. haematococca-complex. In addition, DNA sequence data were used to design a PCR primer pair which could specifically amplify DNA from isolates of the SDS pathogen from infected plants. PMID:7579615

  10. Molecular phylogenetic studies based on rDNA ITS, cpDNA trnL intron sequence and cladode characteristics in nine Protasparagus taxa.


    Saha, Partha Sarathi; Ray, Sudipta; Sengupta, Mainak; Jha, Sumita


    The genus Asparagus comprises three subgenera of cladode bearing plants: Protasparagus, Asparagus, and Myrsiphyllum. The interspecific delimitation of the subgenus Protasparagus is ill-defined till date. In the present study, interspecific phylogenetic relationships among nine taxa of Protasparagus based on ribosomal DNA internal transcribed spacer region (ITS1-5.8S-ITS2) sequence and the chloroplast DNA trnL intron sequence conservation with their cladode morphology, anatomy, and stomatal characteristics have been analyzed for the first time. The monophyletic subgenus Protasparagus could be resolved into four strongly supported distinct subclades (I, II, III and IV) suggesting that the rDNA and cpDNA molecular phylogenies are explicitly congruent with the cladode characteristics of the subgenus Protasparagus. The present study also confirms the existing subgeneric classification of the genus Asparagus with the monophyletic origin of the dioecious subgenus Asparagus. The present work brings out phylogenetic and taxonomic relationships within the studied taxa of the subgenus Protasparagus therefore providing important background information for further studies on biogeography of a wide range of species. PMID:25534258

  11. Comparative characterization of Santolina insularis chemotypes by essential oil composition, 5S-rRNA-NTS sequencing and EcoRV RFLP-PCR.


    Gnavi, Giorgio; Bertea, Cinzia M; Usai, Marianna; Maffei, Massimo E


    Santolina insularis (Genn ex Fiori) Arrig. is a medicinal plant whose essential oil shows antiviral and antibacterial activities and potent and selective cytotoxic activity against the human colon carcinoma cell line. The occurrence of several chemotypes makes the taxonomic identification of S. insularis hard to achieve. GC-MS essential oil analyses of four chemotypes (SI1, SI2, SI3 and SI4) revealed the presence of different percentages of santolina triene, beta-pinene, myrcene, beta-phellandrene, artemisia ketone and cis-chrysanthemol, allowing a chemical discrimination. Single fragments of the 5S-rRNA-NTS region of approximately 150, 170, 260 and 280bp were produced by SI1, SI2, SI3 and SI4, respectively, and the sequence alignment of the 5S-rRNA spacer region flanked by the 3'-and 5'-ends of the coding region confirmed a consistent difference between chemotypes. Furthermore, a PCR-RFLP method was applied. From the identified sequences, an EcoRV site could be found in chemotypes SI1, SI2 and SI3 in the 5S-rRNA spacer regions at 81 bp position; however, this site was absent in the chemotype SI4. This study, by showing remarkable chemical variation in the terpenoid profile and consistent genomic difference in the 5S-rRNA spacer regions, identified four chemotypes of S. insularis which could be grouped into two ecotypes, based on chemical and genomic analyses. The identification of specific gene sequences of the 5S-rRNA-NTS region and of a EcoRV site identified in this work can be used for a rapid and precise identification of the plant chemo-/ecotypes, complementing the essential oil chemical analysis. PMID:20350730

  12. Eukaryotic diversity in premise drinking water using 18S rDNA sequencing: implications for health risks

    EPA Science Inventory

    The goal of this study was to characterize microbial eukaryotes over a 12 month period, so as to provide insight into the occurrence of potentially important predators and bacterial hosts in hot and cold premise plumbing. Nearly 6,300 partial (600 bp) 18S rRNA gene sequences from...


    EPA Science Inventory

    This research addresses the development and testing of molecular methods that will allow rapid characterization of microbial communities in perturbed or contaminated ecosystems. The major objective of the research is to provide appropriate sequences and to assemble a high-density...

  14. An evaluation of LSU rDNA D1-D2 sequences for their use in species identification

    PubMed Central

    Sonnenberg, Rainer; Nolte, Arne W; Tautz, Diethard


    Background Identification of species via DNA sequences is the basis for DNA taxonomy and DNA barcoding. Currently there is a strong focus on using a mitochondrial marker for this purpose, in particular a fragment from the cytochrome oxidase I gene (COI). While there is ample evidence that this marker is indeed suitable across a broad taxonomic range to delineate species, it has also become clear that a complementation by a nuclear marker system could be advantageous. Ribosomal RNA genes could be suitable for this purpose, because of their global occurrence and the possibility to design universal primers. However, it has so far been assumed that these genes are too highly conserved to allow resolution at, or even beyond the species level. On the other hand, it is known that ribosomal gene regions harbour also highly divergent parts. We explore here the information content of two adjacent divergence regions of the large subunit ribosomal gene, the D1-D2 region. Results Universal primers were designed to amplify the D1-D2 region from all metazoa. We show that amplification products in the size between 800–1300 bp can be obtained across a broad range of animal taxa, provided some optimizations of the PCR procedure are implemented. Although the ribosomal genes occur in multiple copies in the genomes, we find generally very little intra-individual polymorphism (<< 0.1% on average) indicating that concerted evolution is very effective in most cases. Studies in two fish taxa (genus Cottus and genus Aphyosemion) show that the D1-D2 LSU sequence can resolve even very closely related species with the same fidelity as COI sequences. In one case we can even show that a mitochondrial transfer must have occurred, since the nuclear sequence confirms the taxonomic assignment, while the mitochondrial sequence would have led to the wrong classification. We have further explored whether hybrids between species can be detected with the nuclear sequence and we show for a test case of

  15. A universal DNA extraction and PCR amplification method for fungal rDNA sequence-based identification.


    Romanelli, A M; Fu, J; Herrera, M L; Wickes, B L


    Accurate identification of fungal pathogens using a sequence-based approach requires an extraction method that yields template DNA pure enough for polymerase chain reaction (PCR) or other types of amplification. Therefore, the objective of this study was to develop and standardise a rapid, inexpensive DNA extraction protocol applicable to the major fungal phyla, which would yield sufficient template DNA pure enough for PCR and sequencing. A total of 519 clinical and culture collection strains, comprised of both yeast and filamentous fungi, were prepared using our extraction method to determine its applicability for PCR, which targeted the ITS and D1/D2 regions in a single PCR amplicon. All templates were successfully amplified and found to yield the correct strain identification when sequenced. This protocol could be completed in approximately 30 min and utilised a combination of physical and chemical extraction methods but did not require organic solvents nor ethanol precipitation. The method reduces the number of tube manipulations and yielded suitable template DNA for PCR amplification from all phyla that were tested. PMID:24865530

  16. Phylogenetic relationships of Albugo species (white blister rusts) based on LSU rDNA sequence and oospore data.


    Voglmayr, Hermann; Riethmüller, Alexandra


    Phylogenetic maximum parsimony and Bayesian analyses of 60 collections belonging to 12 species of Albugo (Peronosporales) and two species of Pythium (Pythiales) were performed using nuclear large subunit ribosomal DNA sequences containing the D1 and D2 regions. These data were supplemented with detailed light and scanning electron microscopical analyses of oospore morphology, and the morphological data of insufficiently studied taxa (e.g. A. caryophyllacearum, A. gomphrenae) are revised. Molecular data revealed two main clades: one containing the collections from hosts belonging to the Caryophyllales and Asteraceae, and the other containing the collections from hosts belonging to the Brassicaceae and Convolvulaceae. Separation into these two clades was also corroborated by oospore morphology. Whereas the Albugo collections from Caryophyllales did not form a monophyletic lineage, the collections originating from Brassicaceae, Convolvulaceae and Asteraceae each formed highly supported monophyletic clades. According to DNA sequence data and oospore morphology, the host genus Amaranthus harbors two distinct species, Albugo amaranthi and Albugo bliti. The DNA sequence data further indicate that Albugo candida and Albugo tragopogonis each may consist of several distinct lineages, but additional data need to be collected before further taxonomic conclusions can be made. PMID:16376066

  17. The evolutionary history of the genus Timarcha (Coleoptera, Chrysomelidae) inferred from mitochondrial COII gene and partial 16S rDNA sequences.


    Gómez-Zurita, J; Juan, C; Petitpierre, E


    The apterous genus Timarcha consists of three subgenera and more than 100 species in its Palearctic distribution, with specialized feeding on few plant families. Fifty-four sequences sampled from 31 taxa of the genus plus three outgroup leaf beetles were studied for their complete cytochrome oxidase II (COII) and a fragment of 16S rDNA mitochondrial genes, representing a total of about 1200 bp. Phylogenetic analyses using maximum-parsimony and distance methods for each gene separately and for the combined data set gave compatible topologies. The subgenus Metallotimarcha consistently appears in a basal position and is well differentiated from the remaining Timarcha, but no clear monophyletic grouping of Timarchostoma and Timarcha s. str. subgenera can be deduced from our analysis. Calibration of the molecular clock has been done using the opening of the Gibraltar Strait after the Messinian salinity crisis (about 5.5 MYA) as the biogeographic event causing disjunction of two particular taxa. Accordingly, the COII evolutionary rate has been estimated to be of 0.76 x 10(-8) substitution/site/year in Timarcha. Relation between phylogeny and host-plant use indicates widening of trophic regime as a derived character in Timarcha. PMID:10679162

  18. Phylogeny of the ectomycorrhizal mushroom genus Alnicola (Basidiomycota, Cortinariaceae) based on rDNA sequences with special emphasis on host specificity and morphological characters.


    Moreau, Pierre-Arthur; Peintner, Ursula; Gardes, Monique


    Alnicola (=Naucoria, pro parte) is a mushroom genus of strictly temperate, obligately ectomycorrhizal species, traditionally included in the family Cortinariaceae. Most Alnicola spp. are primarily host specific on Alnus, although a few are mycobionts of Salix or other hosts. The different species of Alnicola exhibit unique morphological (cystidia, pileipellis) and cytological (dikaryotic or monokaryotic hyphae) characters. This makes the genus Alnicola of particular interest for studying the evolution of host specificity and morphological characters in ectomycorrhizal basidiomycetes. We used a combination of classical morphological and phylogenetic methods (rDNA ITS and LSU sequences) to address the following questions: (i) Is Alnicola monophyletic? And (ii) Are characters like host specificity or microscopical structures synapomorphic for certain clades? The study included nearly all currently known European Alnicola sp. Our results demonstrated that, on one hand, the genus Alnicola is polyphyletic, with sistergroup relationships to Hebeloma, Anamika or the clades /Hymenogaster I and /Hymenogaster II. On the other hand, Alnicola splits into three well-supported clades corresponding to the sections Alnicola, Submelinoides, and Salicicolae. The strict host-specificity to Alnus is a derived character and has occurred at least twice. The following morphological characters are synapomorphic for defined clades: the spindle-shaped hymenial cystidia for sect. Alnicola, the hymeniform pileipellis for sect. Submelinoides, and monocaryotic/clampless hyphae for sect. Salicicolae and its sistergroup /Hymenogaster II. As a taxonomical consequence, polyphyly of Alnicola implies that the sects. Submelinoides and Salicicolae need to be segregated from Alnicola. PMID:16314113

  19. Cryptic diversity of free-living parabasalids, Pseudotrichomonas keilini and Lacusteria cypriaca n. g., n. sp., as inferred from small subunit rDNA sequences.


    Yubuki, Naoji; Céza, Vít; Cepicka, Ivan; Yabuki, Akinori; Inagaki, Yuji; Nakayama, Takeshi; Inouye, Isao; Leander, Brian S


    Ultrastructural and molecular phylogenetic evidence indicate that the Parabasalia consists of seven main subgroups: the Trichomonadida, Honigbergiellida, Hypotrichomonadida, Tritrichomonadida, Cristamonadida, Spirotrichonymphida, and Trichonymphida. Only five species of free-living parabasalids are known: Monotrichomonas carabina, Ditrichomonas honigbergii, Honigbergiella sp., Tetratrichomonas undula, and Pseudotrichomonas keilini. Phylogenetic analyses show that free-living species do not form a clade and instead branch in several different positions within the context of their parasitic relatives. Because the diversity of free-living parabasalids is poorly understood, the systematics of these lineages is in a significant state of disarray. In order to better understand the phylogenetic distribution of free-living parabasalids, we sequenced the small subunit rDNA from three different strains reminiscent of P. keilini; the strains were isolated from different geographical locations: (1) mangrove sediments in Japan and (2) sediments in Cyprus. These data demonstrated that the free-living parabasalids P. keilini and Lacusteria cypriaca n. g., n. sp., form a paraphyletic assemblage near the origin of a clade consisting mostly of parasitic trichomonadids (e.g. Trichomonas vaginalis). This paraphyletic distribution of similar morphotypes indicates that free-living trichomonadids represent a compelling example of morphostasis that provides insight into the suite of features present in the most recent free-living ancestor of their parasitic relatives. PMID:20880033

  20. Deodorization of pig slurry and characterization of bacterial diversity using 16S rDNA sequence analysis.


    Hwang, Ok-Hwa; Raveendar, Sebastian; Kim, Young-Ju; Kim, Ji-Hun; Choi, Jung-Woo; Kim, Tae-Hun; Choi, Dong-Yoon; Jeon, Che Ok; Cho, Sung-Back; Lee, Kyung-Tai


    The concentration of major odor-causing compounds including phenols, indoles, short-chain fatty acids (SCFAs) and branched chain fatty acids (BCFAs) in response to the addition of powdered horse radish (PHR) and spent mushroom compost (SMC) was compared with control non-treated slurry (CNS) samples. A total of 97,465 rDNAs sequence reads were generated from three different samples (CNS, n = 2; PHR, n = 3; SMC, n = 3) using bar-coded pyrosequencing. The number of operational taxonomic units (OTUs) was lower in the PHR slurry compared with the other samples. A total of 11 phyla were observed in the slurry samples, while the phylogenetic analysis revealed that the slurry microbiome predominantly comprised members of the Bacteroidetes, Firmicutes, and Proteobacteria phyla. The rarefaction analysis showed the bacterial species richness varied among the treated samples. Overall, at the OTU level, 2,558 individual genera were classified, 276 genera were found among the three samples, and 1,832 additional genera were identified in the individual samples. A principal component analysis revealed the differences in microbial communities among the CNS, PHR, and SMC pig slurries. Correlation of the bacterial community structure with the Kyoto Encyclopedia of Genes and Genomes (KEGG) predicted pathways showed that the treatments altered the metabolic capabilities of the slurry microbiota. Overall, these results demonstrated that the PHR and S MC treatments significantly reduced the malodor compounds in pig slurry (P < 0.05). PMID:25359269

  1. Genetic variability and mycohost association of Ampelomyces quisqualis isolates inferred from phylogenetic analyses of ITS rDNA and actin gene sequences.


    Park, Mi-Jeong; Choi, Young-Joon; Hong, Seung-Beom; Shin, Hyeon-Dong


    Ampelomyces quisqualis complex is well known as the most common and widespread hyperparasite of the family Erysiphaceae, the cause of powdery mildew diseases. As commercial biopesticide products it is widely used to control the disease in field and plastic houses. Although genetic diversity within Ampelomyces isolates has been previously recognized, a single name A. quisqualis is still applied to all pycnidial intracellular hyperparasites of powdery mildew fungi. In this study, the phylogenetic relationships among Ampelomyces isolates originating from various powdery mildew fungi in Korea were inferred from Bayesian and maximum parsimony analyses of the sequences of ITS rDNA region and actin gene. In the phylogenetic trees, the Ampelomyces isolates could be divided into four distinct groups with high sequence divergences in both regions. The largest group, Clade 1, mostly accommodated Ampelomyces isolates originating from the mycohost Podosphaera spp. (sect. Sphaerotheca). Clade 2 comprised isolates from several genera of powdery mildews, Golovinomyces, Erysiphe (sect. Erysiphe), Arthrocladiella, and Phyllactinia, and was further divided into two subclades. An isolate obtained from Podosphaera (sect. Sphaerotheca) pannosa was clustered into Clade 3, with those from powdery mildews infecting rosaceous hosts. The mycohosts of Ampelomyces isolates in Clade 4 mostly consisted of species of Erysiphe (sect. Erysiphe, sect. Microsphaera, and sect. Uncinula). The present phylogenetic study demonstrates that Ampelomyces hyperparasite is indeed an assemblage of several distinct lineages rather than a sole species. Although the correlation between Ampelomyces isolates and their mycohosts is not obviously clear, the isolates show not only some degree of host specialization but also adaptation to their mycohosts during the evolution of the hyperparasite. PMID:20943134

  2. Evaluation of the effects of intrapartum antibiotic prophylaxis on newborn intestinal microbiota using a sequencing approach targeted to multi hypervariable 16S rDNA regions.


    Aloisio, Irene; Quagliariello, Andrea; De Fanti, Sara; Luiselli, Donata; De Filippo, Carlotta; Albanese, Davide; Corvaglia, Luigi Tommaso; Faldella, Giacomo; Di Gioia, Diana


    Different factors are known to influence the early gut colonization in newborns, among them the perinatal use of antibiotics. On the other hand, the effect on the baby of the administration of antibiotics to the mother during labor, referred to as intrapartum antibiotic prophylaxis (IAP), has received less attention, although routinely used in group B Streptococcus positive women to prevent the infection in newborns. In this work, the fecal microbiota of neonates born to mothers receiving IAP and of control subjects were compared taking advantage for the first time of high-throughput DNA sequencing technology. Seven different 16S rDNA hypervariable regions (V2, V3, V4, V6 + V7, V8, and V9) were amplified and sequenced using the Ion Torrent Personal Genome Machine. The results obtained showed significant differences in the microbial composition of newborns born to mothers who had received IAP, with a lower abundance of Actinobacteria and Bacteroidetes as well as an overrepresentation of Proteobacteria. Considering that the seven hypervariable regions showed different discriminant ability in the taxonomic identification, further analyses were performed on the V4 region evidencing in IAP infants a reduced microbial richness and biodiversity, as well as a lower number of bacterial families with a predominance of Enterobacteriaceae members. In addition, this analysis pointed out a significant reduction in Bifidobacterium spp. strains. The reduced abundance of these beneficial microorganisms, together with the increased amount of potentially pathogenic bacteria, may suggest that IAP infants are more exposed to gastrointestinal or generally health disorders later in age. PMID:26971496

  3. The karyotype and 5S rRNA genes from Spanish individuals of the bat species Rhinolophus hipposideros (Rhinolophidae; Chiroptera).


    Puerma, Eva; Acosta, Manuel J; Barragán, Maria José L; Martínez, Sergio; Marchal, Juan Alberto; Bullejos, Mónica; Sánchez, Antonio


    The karyotype of individuals of the species Rhinolophus hipposideros from Spain present a chromosome number of 2n = 54 (NFa = 62). The described karyotype for these specimens is very similar to another previously described in individual from Bulgaria. However, the presence of one additional pair of autosomal acrocentric chromosomes in the Bulgarian karyotype and the differences in X chromosome morphology indicated that we have described a new karyotype variant in this species. In addition, we have analyzed several clones of 1.4 and 1 kb of a PstI repeated DNA sequence from the genome of R. hipposideros. The repeated sequence included a region with high identity with the 5S rDNA genes and flanking regions, with no homology with GenBank sequences. Search for polymerase III regulatory elements demonstrated the presence of type I promoter elements (A-box, Intermediate Element and C-box) in the 5S rDNA region. In addition, upstream regulatory elements, as a D-box and Sp1 binding sequences, were present in flanking regions. All data indicated that the cloned repeated sequences are the functional rDNA genes from this species. Finally, FISH demonstrated the presence of rDNA in nine chromosome pairs, which is surprising as most mammals have only one carrier chromosome pair. PMID:18066670

  4. Phylogenetic relationships in genus Arachis based on ITS and 5.8S rDNA sequences

    PubMed Central


    Background The genus Arachis comprises 80 species and it is subdivided into nine taxonomic sections (Arachis, Caulorrhizae, Erectoides, Extranervosae, Heteranthae, Procumbentes, Rhizomatosae, Trierectoides, and Triseminatae). This genus is naturally confined to South America and most of its species are native to Brazil. In order to provide a better understanding of the evolution of the genus, we reconstructed the phylogeny of 45 species using the variation observed on nucleotide sequences in internal transcribed spacer regions (ITS1 and ITS2) and 5.8 S of nuclear ribosomal DNA. Results Intraspecific variation was detected, but in general it was not enough to place accessions of the same species in different clades. Our data support the view that Arachis is a monophyletic group and suggested Heteranthae as the most primitive section of genus Arachis. The results confirmed the circumscriptions of some sections (Caulorrhizae, Extranervosae), but raised questions about others. Sections Erectoides, Trierectoides and Procumbentes were not well defined, while sections Arachis and Rhizomatosae seem to include species that could be moved to different sections. The division of section Arachis into A and B genome species was also observed in the phylogenetic tree and these two groups of species may not have a monophyletic origin. The 2n = 2x = 18 species of section Arachis (A. praecox, A. palustris and A. decora) were all placed in the same clade, indicating they are closely related to each other, and their genomes are more related to B genome than to the A genome. Data also allowed insights on the origin of tetraploid A. glabrata, suggesting rhizome appeared twice within the genus and raising questions about the placement of that species in section Rhizomatosae. Conclusion The main clades established in this study in general agreed with many other studies that have used other types of evidences and sets of species, being some of them included in our study and some not. Thus

  5. Phylogenetic position of the genus Cyrtostrombidium, with a description of Cyrtostrombidium paralongisomum nov. spec. and a redescription of Cyrtostrombidium longisomum Lynn & Gilron, 1993 (Protozoa, Ciliophora) based on live observation, protargol impregnation, and 18S rDNA sequences.


    Tsai, Sheng-Fang; Chen, Wei-Ting; Chiang, Kuo-Ping


    We redescribe Cyrtostrombidium longisomum Lynn & Gilron, 1993, the type species of the genus Cyrtostrombidium, and describe the new species Cyrtostrombidium paralongisomum n. sp. using live observation, protargol staining and molecular data. The morphological characters of these two species are clearly distinct, i.e., dikinetid numbers in the girdle and ventral kineties; however, it is difficult to separate them by 18S rDNA sequences because they differ by only 8 bp, indicating that 18S rDNA sequences are insufficient for separating different species in the genus Cyrtostrombidium. We not only observed the position of the oral primordium in the genus Cyrtostrombidium but also observed a possibly homoplasious trait, a dorsal split in the girdle kinety, in (1) Apostrombidium, (2) Varistrombidium, and (3) Cyrtostrombidium/Williophrya. This partially supports the hypothesis of somatic ciliary pattern evolution recently put forth by Agatha and Strüder-Kypke. PMID:25227509

  6. Integrated next-generation sequencing of 16S rDNA and metaproteomics differentiate the healthy urine microbiome from asymptomatic bacteriuria in neuropathic bladder associated with spinal cord injury

    PubMed Central


    Background Clinical dogma is that healthy urine is sterile and the presence of bacteria with an inflammatory response is indicative of urinary tract infection (UTI). Asymptomatic bacteriuria (ABU) represents the state in which bacteria are present but the inflammatory response is negligible. Differentiating ABU from UTI is diagnostically challenging, but critical because overtreatment of ABU can perpetuate antimicrobial resistance while undertreatment of UTI can result in increased morbidity and mortality. In this study, we describe key characteristics of the healthy and ABU urine microbiomes utilizing 16S rRNA gene (16S rDNA) sequencing and metaproteomics, with the future goal of utilizing this information to personalize the treatment of UTI based on key individual characteristics. Methods A cross-sectional study of 26 healthy controls and 27 healthy subjects at risk for ABU due to spinal cord injury-related neuropathic bladder (NB) was conducted. Of the 27 subjects with NB, 8 voided normally, 8 utilized intermittent catheterization, and 11 utilized indwelling Foley urethral catheterization for bladder drainage. Urine was obtained by clean catch in voiders, or directly from the catheter in subjects utilizing catheters. Urinalysis, urine culture and 16S rDNA sequencing were performed on all samples, with metaproteomic analysis performed on a subsample. Results A total of 589454 quality-filtered 16S rDNA sequence reads were processed through a NextGen 16S rDNA analysis pipeline. Urine microbiomes differ by normal bladder function vs. NB, gender, type of bladder catheter utilized, and duration of NB. The top ten bacterial taxa showing the most relative abundance and change among samples were Lactobacillales, Enterobacteriales, Actinomycetales, Bacillales, Clostridiales, Bacteroidales, Burkholderiales, Pseudomonadales, Bifidobacteriales and Coriobacteriales. Metaproteomics confirmed the 16S rDNA results, and functional human protein-pathogen interactions were noted in

  7. Isolation and molecular identification of Vibrio spp. by sequencing of 16S rDNA from seafood, meat and meat products in Libya

    PubMed Central

    Azwai, S.M.; Alfallani, E.A.; Abolghait, S.K.; Garbaj, A.M.; Naas, H.T.; Moawad, A.A.; Gammoudi, F.T.; Rayes, H.M.; Barbieri, I.; Eldaghayes, I.M.


    The genus Vibrio includes several food-borne pathogens that cause a spectrum of clinical conditions including septicemia, cholera and milder forms of gastroenteritis. Several Vibrio spp. are commonly associated with food-borne transmission including Vibrio cholerae, Vibrio parahemolyticus, and Vibrio vulnificus. Microbiological analysis for enumeration and isolation of Vibrio spp. were carried out for a total of 93 samples of seafood, meat and meat products from different geographic localities in Libya (Tripoli, Regdalin, Janzour and Tobruk). Vibrio spp. were detected by conventional cultural and molecular method using PCR and sequencing of 16S rDNA. Out of the 93 cultured samples only 48 (51.6%) yielded colonies on Thiosulfate Citrate Bile Salt agar (TCBS) with culture characteristics of Vibrio spp. More than half (n=27) of processed seafood samples (n=46) yielded colonies on TCBS, while only 44.6 % of samples of meat and meat products showed colonies on TCBS. Among cultured seafood samples, the highest bacterial count was recorded in clam with a count of 3.8 ×104 CFU\\g. Chicken burger samples showed the highest bacterial count with 6.5 ×104 CFU\\g. Molecular analysis of the isolates obtained in this study, showed that 11 samples out of 48 (22.9%) were Vibrio spp. Vibrio parahemolyticus was isolated from camel meat for the first time. This study is an initial step to provide a baseline for future molecular research targeting Vibrio spp. foodborne illnesses. This data will be used to provide information on the magnitude of such pathogens in Libyan seafood, meat and meat products. PMID:27004169

  8. Sequencer-Based Capillary Gel Electrophoresis (SCGE) Targeting the rDNA Internal Transcribed Spacer (ITS) Regions for Accurate Identification of Clinically Important Yeast Species

    PubMed Central

    Chen, Sharon C.-A.; Wang, He; Zhang, Li; Fan, Xin; Xu, Zhi-Peng; Cheng, Jing-Wei; Kong, Fanrong; Zhao, Yu-Pei; Xu, Ying-Chun


    Accurate species identification of Candida, Cryptococcus, Trichosporon and other yeast pathogens is important for clinical management. In the present study, we developed and evaluated a yeast species identification scheme by determining the rDNA internal transcribed spacer (ITS) region length types (LTs) using a sequencer-based capillary gel electrophoresis (SCGE) approach. A total of 156 yeast isolates encompassing 32 species were first used to establish a reference SCGE ITS LT database. Evaluation of the ITS LT database was then performed on (i) a separate set of (n = 97) clinical isolates by SCGE, and (ii) 41 isolates of 41 additional yeast species from GenBank by in silico analysis. Of 156 isolates used to build the reference database, 41 ITS LTs were identified, which correctly identified 29 of the 32 (90.6%) species, with the exception of Trichosporon asahii, Trichosporon japonicum and Trichosporon asteroides. In addition, eight of the 32 species revealed different electropherograms and were subtyped into 2–3 different ITS LTs each. Of the 97 test isolates used to evaluate the ITS LT scheme, 96 (99.0%) were correctly identified to species level, with the remaining isolate having a novel ITS LT. Of the additional 41 isolates for in silico analysis, none was misidentified by the ITS LT database except for Trichosporon mucoides whose ITS LT profile was identical to that of Trichosporon dermatis. In conclusion, yeast identification by the present SCGE ITS LT assay is a fast, reproducible and accurate alternative for the identification of clinically important yeasts with the exception of Trichosporon species. PMID:27105313

  9. Isolation and molecular identification of Vibrio spp. by sequencing of 16S rDNA from seafood, meat and meat products in Libya.


    Azwai, S M; Alfallani, E A; Abolghait, S K; Garbaj, A M; Naas, H T; Moawad, A A; Gammoudi, F T; Rayes, H M; Barbieri, I; Eldaghayes, I M


    The genus Vibrio includes several food-borne pathogens that cause a spectrum of clinical conditions including septicemia, cholera and milder forms of gastroenteritis. Several Vibrio spp. are commonly associated with food-borne transmission including Vibrio cholerae, Vibrio parahemolyticus, and Vibrio vulnificus. Microbiological analysis for enumeration and isolation of Vibrio spp. were carried out for a total of 93 samples of seafood, meat and meat products from different geographic localities in Libya (Tripoli, Regdalin, Janzour and Tobruk). Vibrio spp. were detected by conventional cultural and molecular method using PCR and sequencing of 16S rDNA. Out of the 93 cultured samples only 48 (51.6%) yielded colonies on Thiosulfate Citrate Bile Salt agar (TCBS) with culture characteristics of Vibrio spp. More than half (n=27) of processed seafood samples (n=46) yielded colonies on TCBS, while only 44.6 % of samples of meat and meat products showed colonies on TCBS. Among cultured seafood samples, the highest bacterial count was recorded in clam with a count of 3.8 ×10(4) CFU\\g. Chicken burger samples showed the highest bacterial count with 6.5 ×10(4) CFU\\g. Molecular analysis of the isolates obtained in this study, showed that 11 samples out of 48 (22.9%) were Vibrio spp. Vibrio parahemolyticus was isolated from camel meat for the first time. This study is an initial step to provide a baseline for future molecular research targeting Vibrio spp. foodborne illnesses. This data will be used to provide information on the magnitude of such pathogens in Libyan seafood, meat and meat products. PMID:27004169

  10. Evolutionary Dynamics of rDNA Clusters in Chromosomes of Five Clam Species Belonging to the Family Veneridae (Mollusca, Bivalvia)

    PubMed Central

    Pérez-García, Concepción; Hurtado, Ninoska S.; Morán, Paloma; Pasantes, Juan J.


    The chromosomal changes accompanying bivalve evolution are an area about which few reports have been published. To improve our understanding on chromosome evolution in Veneridae, ribosomal RNA gene clusters were mapped by fluorescent in situ hybridization (FISH) to chromosomes of five species of venerid clams (Venerupis corrugata, Ruditapes philippinarum, Ruditapes decussatus, Dosinia exoleta, and Venus verrucosa). The results were anchored to the most comprehensive molecular phylogenetic tree currently available for Veneridae. While a single major rDNA cluster was found in each of the five species, the number of 5S rDNA clusters showed high interspecies variation. Major rDNA was either subterminal to the short arms or intercalary to the long arms of metacentric or submetacentric chromosomes, whereas minor rDNA signals showed higher variability. Major and minor rDNAs map to different chromosome pairs in all species, but in R. decussatus one of the minor rDNA gene clusters and the major rDNA cluster were located in the same position on a single chromosome pair. This interspersion of both sequences was confirmed by fiber FISH. Telomeric signals appeared at both ends of every chromosome in all species. FISH mapping data are discussed in relation to the molecular phylogenetic trees currently available for Veneridae. PMID:24967400

  11. Non-random distribution of methyl-CpG sites and non-CpG methylation in the human rDNA promoter identified by next generation bisulfite sequencing.


    Pietrzak, Maciej; Rempala, Grzegorz A; Nelson, Peter T; Hetman, Michal


    A next generation bisulfite sequencing (NGBS) was used to study rDNA promoter methylation in human brain using postmortem samples of the parietal cortex. Qualitative analysis of patterns of CpG methylation was performed at the individual rDNA unit level. CpG site-specific differences in methylation frequency were observed with the core promoter harboring three out of four most methylated CpGs. Moreover, there was an overall trend towards co-methylation for all possible pairs of 26 CpG sites. The hypermethylated CpGs from the core promoter were also most likely to be co-methylated. Finally, although rare, non-CpG (CpH) methylation was detected at several sites with one of them confirmed using the PspGI-qPCR assay. Similar trends were observed in samples from control individuals as well as patients suffering of Alzheimer's disease (AD), mild cognitive impairment (MCI) or ataxia telangiectasia (AT). Taken together, while some methyl-CpG sites including those in the core promoter may have relatively greater inhibitory effect on rRNA transcription, co-methylation at multiple sites may be required for full and/or long lasting silencing of human rDNA. PMID:27008990

  12. Nuclear rDNA and chloroplast rbcL, rbcS and IGS sequence data, and their implications from the Japanese, Korean, and North American harmful algae, Heterosigma akashiwo (Raphidophyceae)

    SciTech Connect

    Ki, Jang-Seu . E-mail:; Han, Myung-Soo


    The toxic Heterosigma akashiwo has been found in coastal environments and its algal blooms have been associated with mass mortality in marine organisms and farmed fish. Over the last two decades, H. akashiwo has expanded its geographical range on a worldwide scale, though all populations are suspected to be a single species. To find strong molecular evidence, supporting this hypothesis we determined nuclear 18S , ITS and LSU rDNA, and chloroplast rbcL, rbcS and flanking IGS sequences from six isolates located in North America, Japan and Korea. We compared individual loci from molecular regions (e.g., 26.7 kbp of DNA sequence) and found all the isolates to have an identical genotype. Further, the long sequences allow us to compare all the partial sequences that have been reported from samples obtained in ten countries. All these sequence are nearly identical. This suggests that they have dispersed recently from one location. The sequences revealed here can be used as an additional option for making molecular comparisons of sequences from the same isolate.

  13. Checklist of the species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) in fishes and turtles in Middle-America, and their delimitation based on sequences of the 28S rDNA.


    Pinacho-Pinacho, Carlos Daniel; Sereno-Uribe, Ana L; De León, Gerardo Pérez-Ponce; García-Varela, Martín


    Among the acanthocephalans, Neoechinorhynchus is one of the most speciose genera, with 116 described species distributed worldwide. The adults of Neoechinorhynchus are found in the intestine of freshwater and brackish water fish, as well as in freshwater turtles. In this study, a checklist of the congeneric species of Neoechinorhynchus occurring in Middle-American fish and turtles is presented. The checklist contains the records established in all published accounts, as well as novel data from survey work conducted in the region comprising Neotropical areas of Mexico, as well as some localities in Central America. The species delimitation criteria used to discriminate among species is based on molecular data. In the last years, a large database derived from sequences of the D2 + D3 domains of the large subunit of rDNA (28S) was generated for 262 specimens corresponding to nine species of Neoechinorhynchus. This molecular marker has shown to be useful in establishing species limits within Neoechinorhynchus and in resolving phylogenetic relationships at species level. Based on our results, the domains D2 + D3 of the 28S rDNA could be considered as potential DNA barcodes to complement mitochondrial DNA to discriminate among acanthocephalan species. PMID:26250025

  14. Reassignment of the land tortoise haemogregarine Haemogregarina fitzsimonsi Dias 1953 (Adeleorina: Haemogregarinidae) to the genus Hepatozoon Miller 1908 (Adeleorina: Hepatozoidae) based on parasite morphology, life cycle and phylogenetic analysis of 18S rDNA sequence fragments.


    Cook, Courtney A; Lawton, Scott P; Davies, Angela J; Smit, Nico J


    SUMMARY Research was undertaken to clarify the true taxonomic position of the terrestrial tortoise apicomplexan, Haemogregarina fitzsimonsi (Dias, 1953). Thin blood films were screened from 275 wild and captive South African tortoises of 6 genera and 10 species between 2009-2011. Apicomplexan parasites within films were identified, with a focus on H. fitzsimonsi. Ticks from wild tortoises, especially Amblyomma sylvaticum and Amblyomma marmoreum were also screened, and sporogonic stages were identified on dissection of adult ticks of both species taken from H. fitzsimonsi infected and apparently non-infected tortoises. Parasite DNA was extracted from fixed, Giemsa-stained tortoise blood films and from both fresh and fixed ticks, and PCR was undertaken with two primer sets, HEMO1/HEMO2, and HepF300/HepR900, to amplify parasite 18S rDNA. Results indicated that apicomplexan DNA extracted from tortoise blood films and both species of tick had been amplified by one or both primer sets. Haemogregarina  fitzsimonsi 18S rDNA sequences from tortoise blood aligned with those of species of Hepatozoon, rather than those of species of Haemogregarina or Hemolivia. It is recommended therefore that this haemogregarine be re-assigned to the genus Hepatozoon, making Hepatozoon fitzsimonsi (Dias, 1953) the only Hepatozoon known currently from any terrestrial chelonian. Ticks are its likely vectors. PMID:24923767

  15. Distribution of 5-methylcytosine residues in 5S rRNA genes in Arabidopsis thaliana and Secale cereale.


    Fulnecek, J; Matyásek, R; Kovarík, A


    Bisulfite genomic sequencing was used to localise 5-methylcytosine residues (mC) in 5S rRNA genes of Arabidopsis thaliana and Secale cereale. The maps of mC distribution were compared with the previously published map of the corresponding region in Nicotiana tabacum. In all three species, the level of methylation of 5S rRNA genes was generally higher than the average for the entire genome. The ratio of 5S rDNA methylation to average overall methylation was 44%/30-33% for N. tabacum, 27%/4-6% for A. thaliana and 24%/20-22% for S. cereale. With the exception of one clone from S. cereale, no methylation-free 5S rDNA was detected. The level of methylation at different sequence motifs in 5S rDNA was calculated for N. tabacum/A. thaliana/ S. cereale, and this analysis yielded the following values (expressed as a percentage of total C): mCG 90%/78%/85%, mCWG 89%/41%/53%, mCmCG 72%/32%/16%, mCCG 4%/2%/0%, mCHH 15%/6%/1%, where W=A or T, and H=A or C or T. Non-symmetrical methylation was almost negligible in the large genome of S. cereale but relatively frequent in N. tabacum and A. thaliana, suggesting that the strict correlation between genome size and cytosine methylation might be violated for this type of methylation. Among non-symmetrical motifs the mCWA triplets were significantly over-represented in Arabidopsis, while in tobacco this preference was not as pronounced. The differences in methylation levels in different sequence contexts might be of phylogenetic significance, but further species in related and different taxa need to be studied before firm conclusions can be drawn. PMID:12471448

  16. Molecular Cytogenetics in Digenean Parasites: Linked and Unlinked Major and 5S rDNAs, B Chromosomes and Karyotype Diversification.


    García-Souto, Daniel; Pasantes, Juan J


    Digenetic trematodes are the largest group of internal metazoan parasites, but their chromosomes are poorly studied. Although chromosome numbers and/or karyotypes are known for about 300 of the 18,000 described species, molecular cytogenetic knowledge is mostly limited to the mapping of telomeric sequences and/or of major rDNA clusters in 9 species. In this work we mapped major and 5S rDNA clusters and telomeric sequences in chromosomes of Bucephalus minimus, B. australis, Prosorhynchoides carvajali (Bucephaloidea), Monascus filiformis (Gymnophalloidea), Parorchis acanthus (Echinostomatoidea), Cryptocotyle lingua (Opisthorchioidea), Cercaria longicaudata, Monorchis parvus (Monorchioidea), Diphterostomum brusinae, and Bacciger bacciger (Microphalloidea). Whilst single major and minor rDNA clusters were mapped to different chromosome pairs in B. minimus and P. acanthus, overlapping signals were detected on a single chromosome pair in the remaining taxa. FISH experiments using major rDNA and telomeric probes clearly demonstrated the presence of highly stretched NORs in most of the digenean taxa analyzed. B chromosomes were detected in the B. bacciger samples hosted by Ruditapes decussatus. Although the cercariae specimens obtained from Donax trunculus, Tellina tenuis, and R. decussatus were in agreement with B. bacciger, their karyotypes showed striking morphological differences in agreement with the proposed assignation of these cercariae to different species of the genus Bacciger. Results are discussed in comparison with previous data on digenean chromosomes. PMID:26680763

  17. Identification of airborne bacterial and fungal species in the clinical microbiology laboratory of a university teaching hospital employing ribosomal DNA (rDNA) PCR and gene sequencing techniques.


    Nagano, Yuriko; Walker, Jim; Loughrey, Anne; Millar, Cherie; Goldsmith, Colin; Rooney, Paul; Elborn, Stuart; Moore, John


    Universal or "broad-range" PCR-based ribosomal DNA (rDNA) was performed on a collection of 58 isolates (n = 30 bacteria + 28 fungi), originating from environmental air from several locations within a busy clinical microbiology laboratory, supporting a university teaching hospital. A total of 10 bacterial genera were identified including both Gram-positive and Gram-negative genera. Gram-positive organisms accounted for 27/30 (90%) of total bacterial species, consisting of seven genera and included (in descending order of frequency) Staphylococcus, Micrococcus, Corynebacterium, Paenibacillus, Arthrobacter, Janibacter and Rothia. Gram-negative organisms were less frequently isolated 3/30 (10%) and comprised three genera, including Moraxella, Psychrobacter and Haloanella. Eight fungal genera were identified among the 28 fungal organisms isolated, including (in descending order of frequency) Cladosporium, Penicillium, Aspergillus, Thanatephorus, Absidia, Eurotium, Paraphaeosphaeria and Tritirachium, with Cladosporium accounting for 10/28 (35.7%) of the total fungal isolates. In conclusion, this study identified the presence of 10 bacterial and eight fungal genera in the air within the laboratory sampled. Although this reflected diversity of the microorganisms present, none of these organisms have been described previously as having an inhalational route of laboratory-acquired infection. Therefore, we believe that the species of organisms identified and the concentration levels of these airborne contaminants determined, do not pose a significant health and safety threat for immunocompotent laboratory personnel and visitors. PMID:20183192

  18. Variation in rDNA locus number and position among legume species and detection of 2 linked rDNA loci in the model Medicago truncatula by FISH.


    Abirached-Darmency, Mona; Prado-Vivant, Emilce; Chelysheva, Liudmila; Pouthier, Thomas


    Within Fabaceae, legume species have a variable genome size, chromosome number, and ploidy level. The genome distribution of ribosomal genes, easily detectable by fluorescent in situ hybridization (FISH), is a good tool for anchoring physical and genetic comparative maps. The organisation of 45S rDNA and 5S loci was analysed by FISH in the 4 closely related species: Pisum sativum, Medicago truncatula, Medicago sativa (2 diploid taxa), and Lathyrus sativus. The 2 types of rDNA arrays displayed interspecific variation in locus number and location, but little intraspecific variation was detected. In the model legume, M. truncatula, the presence of 2 adjacent 45S rDNA loci was demonstrated, and the location of the rDNA loci was independent of the general evolution of the genome DNA. The different parameters relative to clustering of the rDNA loci in specific chromosome regions and the possible basis of rDNA instability are discussed. PMID:16121252

  19. Two thraustochytrid 5S ribosomal RNAs.

    PubMed Central

    MacKay, R M; Doolittle, W F


    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  20. Two thraustochytrid 5S ribosomal RNAs.


    MacKay, R M; Doolittle, W F


    The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs. PMID:7162992

  1. Bacterial diversity assessment in soil of an active Brazilian copper mine using high-throughput sequencing of 16S rDNA amplicons.


    Rodrigues, Viviane D; Torres, Tatiana T; Ottoboni, Laura M M


    Mining activities pose severe environmental risks worldwide, generating extreme pH conditions and high concentrations of heavy metals, which can have major impacts on the survival of organisms. In this work, pyrosequencing of the V3 region of the 16S rDNA was used to analyze the bacterial communities in soil samples from a Brazilian copper mine. For the analysis, soil samples were collected from the slopes (geotechnical structures) and the surrounding drainage of the Sossego mine (comprising the Sossego and Sequeirinho deposits). The results revealed complex bacterial diversity, and there was no influence of deposit geographic location on the composition of the communities. However, the environment type played an important role in bacterial community divergence; the composition and frequency of OTUs in the slope samples were different from those of the surrounding drainage samples, and Acidobacteria, Chloroflexi, Firmicutes, and Gammaproteobacteria were responsible for the observed difference. Chemical analysis indicated that both types of sample presented a high metal content, while the amounts of organic matter and water were higher in the surrounding drainage samples. Non-metric multidimensional scaling (N-MDS) analysis identified organic matter and water as important distinguishing factors between the bacterial communities from the two types of mine environment. Although habitat-specific OTUs were found in both environments, they were more abundant in the surrounding drainage samples (around 50 %), and contributed to the higher bacterial diversity found in this habitat. The slope samples were dominated by a smaller number of phyla, especially Firmicutes. The bacterial communities from the slope and surrounding drainage samples were different in structure and composition, and the organic matter and water present in these environments contributed to the observed differences. PMID:25129578

  2. Comparative sequence analyses on the 16S rRNA (rDNA) of Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus and proposal for creation of a new genus, Alicyclobacillus gen. nov

    NASA Technical Reports Server (NTRS)

    Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.; Deinhard, G.; Poralla, K.


    Comparative 16S rRNA (rDNA) sequence analyses performed on the thermophilic Bacillus species Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus revealed that these organisms are sufficiently different from the traditional Bacillus species to warrant reclassification in a new genus, Alicyclobacillus gen. nov. An analysis of 16S rRNA sequences established that these three thermoacidophiles cluster in a group that differs markedly from both the obligately thermophilic organisms Bacillus stearothermophilus and the facultatively thermophilic organism Bacillus coagulans, as well as many other common mesophilic and thermophilic Bacillus species. The thermoacidophilic Bacillus species B. acidocaldarius, B. acidoterrestris, and B. cycloheptanicus also are unique in that they possess omega-alicylic fatty acid as the major natural membranous lipid component, which is a rare phenotype that has not been found in any other Bacillus species characterized to date. This phenotype, along with the 16S rRNA sequence data, suggests that these thermoacidophiles are biochemically and genetically unique and supports the proposal that they should be reclassified in the new genus Alicyclobacillus.

  3. Quick identification of acetic acid bacteria based on nucleotide sequences of the 16S-23S rDNA internal transcribed spacer region and of the PQQ-dependent alcohol dehydrogenase gene.


    Trcek, Janja


    Acetic acid bacteria (AAB) are well known for oxidizing different ethanol-containing substrates into various types of vinegar. They are also used for production of some biotechnologically important products, such as sorbose and gluconic acids. However, their presence is not always appreciated since certain species also spoil wine, juice, beer and fruits. To be able to follow AAB in all these processes, the species involved must be identified accurately and quickly. Because of inaccuracy and very time-consuming phenotypic analysis of AAB, the application of molecular methods is necessary. Since the pairwise comparison among the 16S rRNA gene sequences of AAB shows very high similarity (up to 99.9%) other DNA-targets should be used. Our previous studies showed that the restriction analysis of 16S-23S rDNA internal transcribed spacer region is a suitable approach for quick affiliation of an acetic acid bacterium to a distinct group of restriction types and also for quick identification of a potentially novel species of acetic acid bacterium (Trcek & Teuber 2002; Trcek 2002). However, with the exception of two conserved genes, encoding tRNAIle and tRNAAla, the sequences of 16S-23S rDNA are highly divergent among AAB species. For this reason we analyzed in this study a gene encoding PQQ-dependent ADH as a possible DNA-target. First we confirmed the expression of subunit I of PQQ-dependent ADH (AdhA) also in Asaia, the only genus of AAB which exhibits little or no ADH-activity. Further we analyzed the partial sequences of adhA among some representative species of the genera Acetobacter, Gluconobacter and Gluconacetobacter. The conserved and variable regions in these sequences made possible the construction of A. acetispecific oligonucleotide the specificity of which was confirmed in PCR-reaction using 45 well-defined strains of AAB as DNA-templates. The primer was also successfully used in direct identification of A. aceti from home made cider vinegar as well as for

  4. Molecular profiling of microbial communities from contaminated sources: Use of subtractive cloning methods and rDNA spacer sequences. 1998 annual progress report

    SciTech Connect

    Robb, F.T.


    'The major objective of the research is to provide appropriate sequences and to assemble a high-density DNA array of oligonucleotides that can be used for rapid profiling of microbial populations from polluted areas. The sequences to be assigned to the DNA array are chosen from from cloned genomic DNA sequences (the ribosomal operon, described below) from groundwater at DOE sites containing organic solvents. The sites, Hanford Nuclear Plant and Lawrence Livermore Site 300, have well characterized pollutant histories, which have been provided by the collaborators. At this mid-point of the project, over 60 unique sequence classes of intergenic spacer region have been idedntified from the first sample site. The use of these sequences as hybridization probes, and their frequency of occurrence, allow a clear distinction between bacterial communities before and after remediation by acetate/nitrate pumping. The authors have developed the hybridization conditions for identifying PCR products in a 96 well format, a versatile alignment and visualization program (acronym: MALIGN) developed by Dr. Dennis Maeder, has been used to align the ISRs, which are variable in length and sometimes in position of the tRNAs. Finally, in collaboration with Dr. W. Chen and Dr. J. Zhou at ORNL, they have significant evidence that mass spectrometer analysis can be used to determine the lengths of PCR amplified intergenic spacer DNA.'

  5. Bacterial Diversity and Community Structure in the Pine Wood Nematode Bursaphelenchus xylophilus and B. mucronatus with Different Virulence by High-Throughput Sequencing of the 16S rDNA.


    Xiang, Yang; Wu, Xiao-Qin; Zhou, Ai-Dong


    Bursaphelenchus xylophilus is the pathogen of pine wilt disease. Bursaphelenchus mucronatus is similar to B. xylophilus in morphology. Both species share a common niche, but they are quite different in pathogenicity. Presently, the role of bacteria in pine wilt disease development has been widely speculated. The diversity of bacteria associated with B. xylophilus and B. mucronatus with different virulence remains unclear. In this study, virulence of four B. xylophilus and four B. mucronatus strains were evaluated by inoculating Pinus thunbergii. High-throughput sequencing targeted 16S rDNA of different virulence nematode strains was carried out. The associated bacterial community structures of the eight strains were analyzed. The results showed that 634,051 high-quality sequences were obtained from the eight nematode strains. The number of OTUs of bacteria associated with B. mucronatus was generally greater than those of B. xylophilus. The richness of the community of bacteria associated with high virulent B. xylophilus ZL1 and AmA3 was higher than moderately virulent B. xylophilus AA3, HE2, and all B. mucronatus strains. While the diversity of bacteria associated with B. mucronatus was higher than B. xylophilus. Stenotrophomonas, Pseudomonadaceae_Unclassified or Rhizobiaceae_Unclassified were predominant in the nematode strains with different virulence. Oxalobacteraceae and Achromobacter were found more abundant in the low virulent B. xylophilus and non-virulent B. mucronatus strains. PMID:26372013

  6. Bacterial Diversity and Community Structure in the Pine Wood Nematode Bursaphelenchus xylophilus and B. mucronatus with Different Virulence by High-Throughput Sequencing of the 16S rDNA

    PubMed Central

    Xiang, Yang; Wu, Xiao-Qin; Zhou, Ai-Dong


    Bursaphelenchus xylophilus is the pathogen of pine wilt disease. Bursaphelenchus mucronatus is similar to B. xylophilus in morphology. Both species share a common niche, but they are quite different in pathogenicity. Presently, the role of bacteria in pine wilt disease development has been widely speculated. The diversity of bacteria associated with B. xylophilus and B. mucronatus with different virulence remains unclear. In this study, virulence of four B. xylophilus and four B. mucronatus strains were evaluated by inoculating Pinus thunbergii. High-throughput sequencing targeted 16S rDNA of different virulence nematode strains was carried out. The associated bacterial community structures of the eight strains were analyzed. The results showed that 634,051 high-quality sequences were obtained from the eight nematode strains. The number of OTUs of bacteria associated with B. mucronatus was generally greater than those of B. xylophilus. The richness of the community of bacteria associated with high virulent B. xylophilus ZL1 and AmA3 was higher than moderately virulent B. xylophilus AA3, HE2, and all B. mucronatus strains. While the diversity of bacteria associated with B. mucronatus was higher than B. xylophilus. Stenotrophomonas, Pseudomonadaceae_Unclassified or Rhizobiaceae_Unclassified were predominant in the nematode strains with different virulence. Oxalobacteraceae and Achromobacter were found more abundant in the low virulent B. xylophilus and non-virulent B. mucronatus strains. PMID:26372013

  7. A case of Beauveria bassiana keratitis confirmed by internal transcribed spacer and LSU rDNA D1–D2 sequencing

    PubMed Central

    Ligozzi, M; Maccacaro, L; Passilongo, M; Pedrotti, E; Marchini, G; Koncan, R; Cornaglia, G; Centonze, A R; Lo Cascio, G


    We describe a case of fungal keratitis due to Beauveria bassiana in a farmer with Fuchs' dystrophy, treated with amphotericin B. Surgery with penetrating keratoplasty was necessary to resolve the lesions. Susceptibility testing and molecular sequencing permitted the identification and treatment of this rare aetiological agent of invasive fungal disease. PMID:25356350

  8. Assessment of bacterial diversity in agricultural by-product compost by sequencing of cultivated isolates and amplified rDNA restriction analysis.


    Chandna, Piyush; Mallik, Sarita; Kuhad, Ramesh Chander


    An investigation of bacterial diversity in compost was performed using molecular chronometer in order to reveal its phylogeny. Thirty-three bacterial isolates isolated from compost were analyzed by 16S rRNA gene sequencing which revealed phylogenetic lineage of class Bacilli, γ, β-Proteobacteria, and Actinobacteria. Among these lineages, isolates belonging to class Bacilli consisted of species from genera Staphylococcus, Bacillus, Terribacillus, and Lysinibacillus. From phylum Actinobacteria: Microbacterium barkeri and Kocuria sp. were identified. Other bacterial groups had phylogenetic linkage with genera Comamonas and Acidovorax (class β-Proteobacteria); Serratia, Klebsiella, and Enterobacter (class γ-Proteobacteria). Similar isolates were analyzed through ARDRA. Amplified product of 16S rRNA gene from each isolates was subjected to cleavage by enzymes HpaII, HinfI, and MspI in separate reaction tubes. HpaII generated 2-6 bands ranging from 90-688 bp, HinfI generated 2-5 bands of 71-1,038 bp, and MspI 2-7 bands of 69-793 bp. The restriction patterns from HpaII, HinfI, and MspI were normalized separately and combined by means of pattern recognition software "Diversity Database." HpaII had highest discrimination index (0.72) than HinfI (0.68) and MspI (0.65), and the combination of all three showed discrimination index (0.69). Numerical analysis of ARDRA patterns demonstrated sufficient phylogenetic information for characterizing bacterial diversity. Phylogenetic relationship obtained among isolates through ARDRA was compared with 16S rRNA gene sequence and ARDRA results showed sufficiently similar 16S rRNA gene sequence analysis, but not an overlapping. It has been observed that ARDRA technique facilitates the identification of bacteria in less than 36 h as compared to traditional 16S rRNA gene sequencing. PMID:23053087

  9. Soil fungal communities underneath willow canopies on a primary successional glacier forefront: rDNA sequence results can be affected by primer selection and chimeric data.


    Jumpponen, Ari


    Soil fungal communities underneath willow canopies that had established on the forefront of a receding glacier were analyzed by cloning the polymerase chain reaction (PCR)-amplified partial small subunit (18S) of the ribosomal (rRNA) genes. Congruence between two sets of fungus-specific primers targeting the same gene region was analyzed by comparisons of inferred neighbor-joining topologies. The importance of chimeric sequences was evaluated by Chimera Check (Ribosomal Database Project) and by data reanalyses after omission of potentially chimeric regions at the 5'- and 3'-ends of the cloned amplicons. Diverse communities of fungi representing Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota were detected. Ectomycorrhizal fungi comprised a major component in the early plant communities in primary successional ecosystems, as both primer sets frequently detected basidiomycetes (Russulaceae and Thelephoraceae) forming mycorrhizal symbioses. Various ascomycetes (Ophiostomatales, Pezizales, and Sordariales) of uncertain function dominated the clone libraries amplified from the willow canopy soil with one set of primers, whereas the clone libraries of the amplicons generated with the second primer set were dominated by basidiomycetes. Accordingly, primer bias is an important factor in fungal community analyses using DNA extracted from environmental samples. A large proportion (>30%) of the cloned sequences were concluded to be chimeric based on their changing positions in inferred phylogenies after omission of possibly chimeric data. Many chimeric sequences were positioned basal to existing classes of fungi, suggesting that PCR artifacts may cause frequent discovery of new, higher level taxa (order, class) in direct PCR analyses. Longer extension times during the PCR amplification and a smaller number of PCR cycles are necessary precautions to allow collection of reliable environmental sequence data. PMID:17106807

  10. Evaluation of the taxonomic status of water dropwort (Oenanthe, Apiaceae) accessions from East Asia based on nuclear rDNA internal transcribed spacer sequences.


    Fu, S; Li, L N; Long, Z C; Ke, W D; Ye, A H; Guo, Y H; Chen, J M


    Oenanthe L. is a taxonomically complex genus, several species of which have long been used as vegetables and traditional medicines in East Asia. In order to clarify the taxonomic status of Oenanthe accessions and provide baseline data for the sustainable use of its genetic resources, we examined sequence variations in the internal transcribed spacer (ITS) region of Oenanthe accessions collected from a wide geographical area in China and its neighboring countries. For comparison, ITS sequences in GenBank for almost all currently reported species of Oenanthe were also included in our analyses. Both phylogenetic tree construction methods (Bayesian inference and maximum likelihood) revealed that the accessions tended to cluster into two groups, which were closely related to O. mildbraedii and O. sarmentosa. However, these two species have never been recorded in China or its neighboring countries. Therefore, it seems probable that in our sampled locations, Oenanthe accessions have been given an incorrect name, such as O. javanica. Future studies should carefully check the morphological characteristics of other Oenanthe species and sequence their ITS regions in order to clarify the taxonomic status of the genus. PMID:27173234

  11. Taxonomic identity of type E botulinum toxin-producing Clostridium butyricum strains by sequencing of a short 16S rDNA region.


    Pourshaban, Manoocheher; Franciosa, Giovanna; Fenicia, Lucia; Aureli, Paolo


    Several micro-organisms capable of producing botulinum neurotoxin type E, though phenotypically similar to Clostridium butyricum (a normally non-neurotoxigenic organism), have recently been isolated in Italy and China. Some of these micro-organisms had been implicated in food-borne botulism, a serious neuroparalytic disease. The taxonomic identity of the type E botulinum toxin-producing strains is confirmed here, through sequencing of a genus- and species-specific segment of the 16S rRNA gene. Confirmation leads to the conclusion that neurotoxigenic C. butyricum must be regarded as an emergent food-borne pathogen. PMID:12204382

  12. Molecular profiling of microbial communities from contaminated sources: Use of substractive cloning methods and rDNA spacer sequences. 1997 annual progress report

    SciTech Connect


    'This project is to develop molecular methods for rapid characterization of microbial communities in contaminated ecosystems. The authors are exploring the use of {sup 16}s ribosomal DNA intergenic spacer regions (ISRs) to profile community composition. The choice proves to be a good one: there are 200--550 bases of 1 to 3 variable regions from which to choose species-specific probes, as well as 2--4 stretches of conserved sequence from which to develop universal PCR (polymerase chain reaction) primers. Preliminary community characterization is complete, and several types of arrays are under development to determine the types of bacteria present and the status of the ground water. Profiling the community composition of polluted groundwater will impact the broad field of microbial ecology as well as mixed-waste bioremediation. Results The samples the authors have been analysing were provided by Dr. Fred Brockman from Pacific Northwest Laboratory, and were collected at the US DOE Hanford site, Washington state. The samples were microbial filtrates from ground water polluted with 2 mg/L carbon tetrachloride and 250 mg/L nitrate and subjected to enrichment (acetate + nitrate) and recirculation. This project is described in some detail in PNNL-11113, Accelerated In Situ Bioremediation of Groundwater, by M.J. Truex, B.S. Hooker, and D.B. Anderson, July 1996.'

  13. Letter to the Editor: Diagnostic Criteria in Urological Diseases do not Always Match with Findings by Extended Culture Techniques and Metagenomic Sequencing of 16S rDNA

    PubMed Central

    Smelov, Vitaly; Naber, Kurt; Bjerklund Johansen, Truls E.


    Some diseases of the urinary tract are defined by the presence of microorganisms while others are defined by their absence. The underlying idea has always been that urine from healthy subjects is sterile and a negative urine culture has usually been taken as discriminative for an infection to be absent. Several disorders with symptoms that resemble infections are regarded as separate entities based on the exclusion of bacterial growth such as overactive neurogenic bladder and pelvic pain syndromes. During the recent years two paradigmata related to the role of bacteria in urological disease classification have changed completely. Firstly, bacteriuria does not necessarily mean an infection, and secondly, if extended sets of culture media for identification of fastidious and anaerobic bacteria or culture-independent metagenomic sequencing (MGS) is applied, a broad range of even non-culturable bacteria has been detected in the ”sterile” bladder urine in healthy individuals. The aim of this editorial is to initiate a discussion to redefine the criteria for urinary tract infections and non-infectious urological disorders with similar symptoms. Clinical studies, in which extended sets of culture media and MGS are integrated, are needed to clarify the pathogenesis of urological disorders where bacteria may play a role. The pure detection of bacteria in the urine does not by itself prove an infectious etiology of a specific disorder. It is important to avoid that results of new technologies lead to unnecessary antibiotic consumption with unwanted collateral damage and adverse events. PMID:27006726

  14. Detection and phylogenetic relationships of Puccinia emaculata and Uromyces graminicola (Pucciniales) on switchgrass in New York State using rDNA sequence information.


    Kenaley, Shawn C; Hudler, George W; Bergstrom, Gary C


    The species of rust fungi (Pucciniales) inciting disease on switchgrass (Panicum virgatum) grown in bioenergy feedstock systems across the north-central and eastern United States remain unclear. In the present study, the species number and phylogenetic relationships of rust species affecting switchgrass were examined in 2011-2013 at two sites in New York State as well as selected sites in Alabama, Iowa, Nebraska, Pennsylvania, South Dakota, and West Virginia using ribosomal RNA gene data (partial internal transcribed spacer [ITS] 1, complete 5.8 subunit [S] and ITS2, and partial 28S). Uredinial group and teliospore morphology were also utilized to delimit taxa in collection years 2012 and 2013. Maximum likelihood, maximum parsimony, and Bayesian analyses demonstrated two monophyletic clades. Clade I consisted of Puccinia emaculata and included the majority of single-sorus samples across sites, whereas, Clade II included multiple samples from Iowa, Nebraska, and South Dakota. Single-telial samples for Clade I possessed only two-celled teliospores while Clade II samples possessed only one-celled teliospores, and hence, were readily diagnosed morphologically to P. emaculata and Uromyces graminicola, respectively. No U. graminicola sequences exist in GenBank to compare with our Clade II samples; however, based on teliospore morphology, the identity of Clade II taxa is U. graminicola. PMID:27109375

  15. Discovery of Pseudozyma rugulosa NBRC 10877 as a novel producer of the glycolipid biosurfactants, mannosylerythritol lipids, based on rDNA sequence.


    Morita, Tomotake; Konishi, Masaaki; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai


    The search for a novel producer of glycolipid biosurfactants, mannosylerythritol lipids (MEL) was undertaken based on the analysis of ribosomal DNA sequences on the yeast strains of the genus Pseudozyma. Pseudozyma rugulosa NBRC 10877 was found to produce a large amount of glycolipids from soybean oil. Fluorescence microscopic observation also demonstrated that the strain significantly accumulates polar lipids in the cells. The structure of the glycolipids produced by the strain was analyzed by (1)H and (13)C nuclear magnetic resonance and gas chromatography-mass spectrometry methods, and was determined to be the same as MEL produced by Pseudozyma antarctica, a well-known MEL producer. The major fatty acids of the present MEL consisted of C8 and C10 acids. Based on high performance liquid chromatography, the composition of the produced MEL was as follows: MEL-A (68%), MEL-B (12%), and MEL-C (20%). To enhance the production of MEL by the novel strain, factors affecting the production, such as carbon and nitrogen sources, were further examined. Soybean oil and sodium nitrate were the best carbon and nitrogen sources, respectively. The supplementation of a MEL precursor, such as erythritol, drastically enhanced the production yield from soybean oil at a rate of 70 to 90%. Under the optimal conditions in a shake culture, a maximum yield, productivity, and yield coefficient (on a weight basis to soybean oil supplied) of 142 g l(-1), 5.0 g l(-1) day(-1), and 0.5 g g(-1) were achieved by intermittent feeding of soybean oil and erythritol using the yeast. PMID:16733733

  16. Pedological and mineralogical investigations on a soil-paleosoil sequence within Andosols in the Western Cordillera of the Peruvian Andes (region Laramate, 14.5S)

    NASA Astrophysics Data System (ADS)

    Leceta Gobitz, Fernando; Mächtle, Bertil; Schukraft, Gerd; Meyer, Hans-Peter; Eitel, Bernhard


    An integrated research project of environmental sciences focuses on a group of four Andosol profiles in Western flank of the Peruvian southern Andes. Aim of this study is to contribute to the reconstruction of the paleo environmental conditions in the Western Cordillera of the Peruvian Andes. Standard pedological and sedimentological analysis has been conducted in order to identify morphological and geochemical features generated by climatic variations during the middle and late Holocene. Though a provenance analysis of sediments, all potential lithological sources around the town of Laramate are being examined under the scanning electron microscope, in order to find significant mineralogical associations downward the soil-profile. Preliminary results reveal two edaphic cycles within a soil-paleo soil-sequence: a relative poor developed "Ah" topsoil, mostly composed by fine grain sediments, is underlain by a well preserved "2Ah" paleo soil; a "2Bwt" subsoil exhibits signs of alteration and clay translocation; parent material in slight weathered statement at "2C" culminates the sequence. Mineralogical analytical data supports the premise, that materials in the uppermost horizons are relatable to distal geological units of the Western and Eastern Cordillera, therefore also related to other described aeolian archives from the region: "Desert Margin Loess" at the Andean foot-zone and "Mixed Loess" in the Puna grassland. The amphibole varieties Actinolite, Mg-Hornblende and Edenite could be only distinguished within the soil sediments. The fluvial transport to its current position is excluded, insofar mentioned varieties stem from the granodiorites of Coastal Batholite (downstream the study area), and the vulcanites of the Anta und Andahuaylas Formation (eastward the continental divide). References: Eitel, B., et al. (2005). "Geoarchaeological evidence from desert loess in the Nazca-Palpa region, southern Peru : Palaeoenvironmental changes and their impact on Pre

  17. Chromosomal mapping of H3 histone and 5S rRNA genes in eight species of Astyanax (Pisces, Characiformes) with different diploid numbers: syntenic conservation of repetitive genes.


    Piscor, Diovani; Parise-Maltempi, Patricia Pasquali


    The genus Astyanax is widely distributed from the southern United States to northern Patagonia, Argentina. While cytogenetic studies have been performed for this genus, little is known about the histone gene families. The aim of this study was to examine the chromosomal relationships among the different species of Astyanax. The chromosomal locations of the 5S rRNA and H3 histone genes were determined in A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, A. mexicanus (all 2n = 50), A. fasciatus (2n = 46), and A. schubarti (2n = 36). All eight species exhibited H3 histone clusters on two chromosome pairs. In six species (A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, and A. fasciatus), syntenic clusters of H3 histone and 5S rDNA were observed on metacentric (m) or submetacentric (sm) chromosomes. In seven species, clusters of 5S rDNA sequences were located on one or two chromosome pairs. In A. mexicanus, 5S rDNA clusters were located on four chromosome pairs. This study demonstrates that H3 histone clusters are conserved on two chromosome pairs in the genus Astyanax, and specific chromosomal features may contribute to the genomic organization of the H3 histone and 5S rRNA genes. PMID:26835745

  18. The 5S genes of Drosophila melanogaster.


    Artavanis-Tsakonas, S; Schedl, P; Tschudi, C; Pirrotta, V; Steward, R; Gehring, W J


    We have cloned embryonic Drosophila DNA using the poly (dA-DT) connector method (Lobban and Kaiser, 1973) and the ampicillin-resistant plasmid pSF2124 (So, Gill and Falkow, 1975) as a cloning vehicle. Two clones, containing hybrid plasmids with sequences complementary to a 5S RNA probe isolated from Drosophila tissue culture cells, were identified by the Grunstein and Hogness (1975) colony hybridization procedure. One hybrid plasmid has a Drosophila insert which is comprised solely of tandem repeats of the 5S gene plus spacer sequences. The other plasmid contains an insert which has about 20 tandem 5S repeat units plus an additional 4 kilobases of adjacent sequences. The size of the 5S repeat unit was determined by gel electrophoresis and was found to be approximately 375 base pairs. We present a restriction map of both plasmids, and a detailed map of of the5S repeat unit. The 5S repat unit shows slight length and sequence heterogeneity. We present evidence suggesting that the 5S genes in Drosophila melanogaster may be arranged in a single continuous cluster. PMID:413625

  19. Plant rDNA database: update and new features

    PubMed Central

    Garcia, Sònia; Gálvez, Francisco; Gras, Airy; Kovařík, Aleš; Garnatje, Teresa


    The Plant rDNA database ( is an open access online resource providing detailed information on numbers, structures and positions of 5S and 18S-5.8S-26S (35S) ribosomal DNA loci. The data have been obtained from >600 publications on plant molecular cytogenetics, mostly based on fluorescent in situ hybridization (FISH). This edition of the database contains information on 1609 species derived from 2839 records, which means an expansion of 55.76 and 94.45%, respectively. It holds the data for angiosperms, gymnosperms, bryophytes and pteridophytes available as of June 2013. Information from publications reporting data for a single rDNA (either 5S or 35S alone) and annotation regarding transcriptional activity of 35S loci now appears in the database. Preliminary analyses suggest greater variability in the number of rDNA loci in gymnosperms than in angiosperms. New applications provide ideograms of the species showing the positions of rDNA loci as well as a visual representation of their genome sizes. We have also introduced other features to boost the usability of the Web interface, such as an application for convenient data export and a new section with rDNA–FISH-related information (mostly detailing protocols and reagents). In addition, we upgraded and/or proofread tabs and links and modified the website for a more dynamic appearance. This manuscript provides a synopsis of these changes and developments. Database URL: PMID:24980131

  20. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.


    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng


    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location. PMID:27334092

  1. Dysfunction of Chromatin Assembly Factor 1 Induces Shortening of Telomeres and Loss of 45S rDNA in Arabidopsis thaliana[W][OA

    PubMed Central

    Mozgová, Iva; Mokroš, Petr; Fajkus, Jiří


    Chromatin Assembly Factor 1 (CAF1) is a three-subunit H3/H4 histone chaperone responsible for replication-dependent nucleosome assembly. It is composed of CAC 1-3 in yeast; p155, p60, and p48 in humans; and FASCIATA1 (FAS1), FAS2, and MULTICOPY SUPPRESSOR OF IRA1 in Arabidopsis thaliana. We report that disruption of CAF1 function by fas mutations in Arabidopsis results in telomere shortening and loss of 45S rDNA, while other repetitive sequences (5S rDNA, centromeric 180-bp repeat, CACTA, and Athila) are unaffected. Substantial telomere shortening occurs immediately after the loss of functional CAF1 and slows down at telomeres shortened to median lengths around 1 to 1.5 kb. The 45S rDNA loss is progressive, leaving 10 to 15% of the original number of repeats in the 5th generation of mutants affecting CAF1, but the level of the 45S rRNA transcripts is not altered in these mutants. Increasing severity of the fas phenotype is accompanied by accumulation of anaphase bridges, reduced viability, and plant sterility. Our results show that appropriate replication-dependent chromatin assembly is specifically required for stable maintenance of telomeres and 45S rDNA. PMID:20699390

  2. [Unusual motifs of the nucleotide sequence adjacent to the putative transcription initiation site in the rDNA intergenic spacer of diploid wheat Triticum urartu Thum. ex Gandil, T. boeoticum Boiss, and T. monococcum L].


    Akhunov, E D; Chemeris, A V; Vakhitov, V A


    In the intergenic spacer (IGS) of rDNA of diploid wheats Triticum urartu, T. boeoticum, and T. monococcum, the uncommon motives adjacent to the site of transcription initiation (TIS) are revealed. They are located in the region from -6 to +1 relative to the putative TIS and are not encountered in cereals studied earlier. In T. urartu and T. boeoticum, the motif TACTATG has been revealed, in T. monococcum--TATTATG, while diploid Aegilops speltoides has the motif TATAGTA, typical of the remaining cereal species. The TIS-surrounding rDNA IGS region of diploid wheats was compared to the correspondent known rDNA IGS regions of different plant and animal species. PMID:9480224

  3. Chromosomal localization and molecular characterization of three different 5S ribosomal DNA clusters in the sea urchin Paracentrotus lividus.


    Caradonna, Fabio; Bellavia, Daniele; Clemente, Ann Maria; Sisino, Giorgia; Barbieri, Rainer


    In this paper the chromosomal localization and molecular cloning and characterization of three 5S rDNA clusters of 700 bp (base pairs), 900 bp, and 950 bp in the sea urchin Paracentrotus lividus are reported. Southern blot hybridization demonstrated the existence of three 5S rDNA repeats of differing length in the P. lividus genome. Fluorescence in situ hybridization analysis, performed in parallel on both haploid and diploid metaphases and interphase nuclei using different 5S rDNA units as probes, localized these 5S rDNA clusters in 3 different pairs of P. lividus chromosomes. This is the first complete gene mapping not only in a sea urchin but also in the phylum of echinoderms as a whole. PMID:17893727

  4. Physical and genetic maps of the Leptospira interrogans serovar icterohaemorrhagiae strain Ictero no.1 chromosome and sequencing of a 19-kb region of the genome containing the 5S rRNA gene.


    Takahashi, Y; Akase, K; Hirano, H; Fukunaga, M


    We report the construction of physical and genetic maps of the chromosome of Leptospira interrogans serovar icterohaemorrhagiae strain Ictero No.1 using pulsed-field gel electrophoresis of DNA fragments generated by digestion with enzymes SrfI, AscI, FseI, and NotI and using reciprocal hybridization. We also sequenced the 19-kilobase (kb) DNA segment including the one gene for 5S rRNA (rrf) of pathogenic Leptospira. The size of the chromosome of the strain Ictero No.1 was estimated to be 4673kb and was found to be similar to those of the chromosomes of the leptospira strains Verdun (serovar icterohaemorrhagiae) and RZ11 (serovar pomona). The strains Verdun and RZ11 carry a small 350-kb replicon (minichromosome), and the strain Ictero No.1 also contained the same kind of molecule together with the chromosome. The physical maps of the strains Ictero No.1 and Verdun were almost identical, as were the locations of the selected genes, except for the location of one of the 16S rRNA genes. Overall, the genetic organization appeared to be conserved within the serovar icterohaemorrhagiae strains. In the sequenced region, we identified 10 putative ORFs and one rrf sequence, and the transcription orientations were all the same. A homology search for the products deduced from the sequenced data revealed that the orf H exhibited high similarity to malic acid enzyme of Haemophilus influenzae and fumarate hydratase of Escherichia coli (orf J). The rest of the putative products encoded by ORFs in the sequenced region showed little similarity with the proteins contained in the databases and were considered to be unknown proteins. PMID:9666070

  5. Contrasting Patterns of rDNA Homogenization within the Zygosaccharomyces rouxii Species Complex.


    Chand Dakal, Tikam; Giudici, Paolo; Solieri, Lisa


    Arrays of repetitive ribosomal DNA (rDNA) sequences are generally expected to evolve as a coherent family, where repeats within such a family are more similar to each other than to orthologs in related species. The continuous homogenization of repeats within individual genomes is a recombination process termed concerted evolution. Here, we investigated the extent and the direction of concerted evolution in 43 yeast strains of the Zygosaccharomyces rouxii species complex (Z. rouxii, Z. sapae, Z. mellis), by analyzing two portions of the 35S rDNA cistron, namely the D1/D2 domains at the 5' end of the 26S rRNA gene and the segment including the internal transcribed spacers (ITS) 1 and 2 (ITS regions). We demonstrate that intra-genomic rDNA sequence variation is unusually frequent in this clade and that rDNA arrays in single genomes consist of an intermixing of Z. rouxii, Z. sapae and Z. mellis-like sequences, putatively evolved by reticulate evolutionary events that involved repeated hybridization between lineages. The levels and distribution of sequence polymorphisms vary across rDNA repeats in different individuals, reflecting four patterns of rDNA evolution: I) rDNA repeats that are homogeneous within a genome but are chimeras derived from two parental lineages via recombination: Z. rouxii in the ITS region and Z. sapae in the D1/D2 region; II) intra-genomic rDNA repeats that retain polymorphisms only in ITS regions; III) rDNA repeats that vary only in their D1/D2 domains; IV) heterogeneous rDNA arrays that have both polymorphic ITS and D1/D2 regions. We argue that an ongoing process of homogenization following allodiplodization or incomplete lineage sorting gave rise to divergent evolutionary trajectories in different strains, depending upon temporal, structural and functional constraints. We discuss the consequences of these findings for Zygosaccharomyces species delineation and, more in general, for yeast barcoding. PMID:27501051

  6. Chaperoning 5S RNA assembly

    PubMed Central

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas


    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998

  7. 5 S Rrna Is Involved in Fidelity of Translational Reading Frame

    PubMed Central

    Dinman, J. D.; Wickner, R. B.


    Chromosomal mutants (maintenance of frame = mof) in which the efficiency of -1 ribosomal frame-shifting is increased can be isolated using constructs in which lacZ expression is dependent upon a -1 shift of reading frame. We isolate a new mof mutation, mof9, in Saccharomyces cerevisiae and show that it is complemented by both single and multi-copy 5 S rDNA clones. Two independent insertion mutations in the rDNA locus (rDNA::LEU2 and rDNA::URA3) also display the Mof(-) phenotype and are also complemented by single and multi-copy 5 S rDNA clones. Mutant 5 S rRNAs expressed from a plasmid as 20-50% of total 5 S rRNA in a wild-type host also induced the Mof(-) phenotype. The increase in frameshifting is greatest when the lacZ reporter gene is expressed on a high copy, episomal vector. No differences were found in 5 S rRNA copy number or electrophoretic mobilities in mof9 strains. Both mof9 and rDNA::LEU2 increase the efficiency of +1 frameshifting as well but have no effect on readthrough of UAG or UAA termination codons, indicating that not all translational specificity is affected. These data suggest a role for 5 S rRNA in the maintenance of frame in translation. PMID:8536994

  8. Myc-induced anchorage of the rDNA IGS region to nucleolar matrix modulates growth-stimulated changes in higher-order rDNA architecture.


    Shiue, Chiou-Nan; Nematollahi-Mahani, Amir; Wright, Anthony P H


    Chromatin domain organization and the compartmentalized distribution of chromosomal regions are essential for packaging of deoxyribonucleic acid (DNA) in the eukaryotic nucleus as well as regulated gene expression. Nucleoli are the most prominent morphological structures of cell nuclei and nucleolar organization is coupled to cell growth. It has been shown that nuclear scaffold/matrix attachment regions often define the base of looped chromosomal domains in vivo and that they are thereby critical for correct chromosome architecture and gene expression. Here, we show regulated organization of mammalian ribosomal ribonucleic acid genes into distinct chromatin loops by tethering to nucleolar matrix via the non-transcribed inter-genic spacer region of the ribosomal DNA (rDNA). The rDNA gene loop structures are induced specifically upon growth stimulation and are dependent on the activity of the c-Myc protein. Matrix-attached rDNA genes are hypomethylated at the promoter and are thus available for transcriptional activation. rDNA genes silenced by methylation are not recruited to the matrix. c-Myc, which has been shown to induce rDNA transcription directly, is physically associated with rDNA gene looping structures and the intergenic spacer sequence in growing cells. Such a role of Myc proteins in gene activation has not been reported previously. PMID:24609384

  9. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    NASA Technical Reports Server (NTRS)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.


    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  10. Contrasting Patterns of rDNA Homogenization within the Zygosaccharomyces rouxii Species Complex

    PubMed Central

    Chand Dakal, Tikam; Giudici, Paolo; Solieri, Lisa


    Arrays of repetitive ribosomal DNA (rDNA) sequences are generally expected to evolve as a coherent family, where repeats within such a family are more similar to each other than to orthologs in related species. The continuous homogenization of repeats within individual genomes is a recombination process termed concerted evolution. Here, we investigated the extent and the direction of concerted evolution in 43 yeast strains of the Zygosaccharomyces rouxii species complex (Z. rouxii, Z. sapae, Z. mellis), by analyzing two portions of the 35S rDNA cistron, namely the D1/D2 domains at the 5’ end of the 26S rRNA gene and the segment including the internal transcribed spacers (ITS) 1 and 2 (ITS regions). We demonstrate that intra-genomic rDNA sequence variation is unusually frequent in this clade and that rDNA arrays in single genomes consist of an intermixing of Z. rouxii, Z. sapae and Z. mellis-like sequences, putatively evolved by reticulate evolutionary events that involved repeated hybridization between lineages. The levels and distribution of sequence polymorphisms vary across rDNA repeats in different individuals, reflecting four patterns of rDNA evolution: I) rDNA repeats that are homogeneous within a genome but are chimeras derived from two parental lineages via recombination: Z. rouxii in the ITS region and Z. sapae in the D1/D2 region; II) intra-genomic rDNA repeats that retain polymorphisms only in ITS regions; III) rDNA repeats that vary only in their D1/D2 domains; IV) heterogeneous rDNA arrays that have both polymorphic ITS and D1/D2 regions. We argue that an ongoing process of homogenization following allodiplodization or incomplete lineage sorting gave rise to divergent evolutionary trajectories in different strains, depending upon temporal, structural and functional constraints. We discuss the consequences of these findings for Zygosaccharomyces species delineation and, more in general, for yeast barcoding. PMID:27501051

  11. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y


    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  12. Assessing Fungal Population in Soil Planted with Cry1Ac and CPTI Transgenic Cotton and Its Conventional Parental Line Using 18S and ITS rDNA Sequences over Four Seasons.


    Qi, Xiemin; Liu, Biao; Song, Qinxin; Zou, Bingjie; Bu, Ying; Wu, Haiping; Ding, Li; Zhou, Guohua


    Long-term growth of genetically modified plants (GMPs) has raised concerns regarding their ecological effects. Here, FLX-pyrosequencing of region I (18S) and region II (ITS1, 5.8S, and ITS2) rDNA was used to characterize fungal communities in soil samples after 10-year monoculture of one representative transgenic cotton line (TC-10) and 15-year plantation of various transgenic cotton cultivars (TC-15mix) over four seasons. Soil fungal communities in the rhizosphere of non-transgenic control (CC) were also compared. No notable differences were observed in soil fertility variables among CC, TC-10, and TC-15mix. Within seasons, the different estimations were statistically indistinguishable. There were 411 and 2 067 fungal operational taxonomic units in the two regions, respectively. More than 75% of fungal taxa were stable in both CC and TC except for individual taxa with significantly different abundance between TC and CC. Statistical analysis revealed no significant differences between CC and TC-10, while discrimination of separating TC-15mix from CC and TC-10 with 37.86% explained variance in PCoA and a significant difference of Shannon indexes between TC-10 and TC-15mix were observed in region II. As TC-15mix planted with a mixture of transgenic cottons (Zhongmian-29, 30, and 33B) for over 5 years, different genetic modifications may introduce variations in fungal diversity. Further clarification is necessary by detecting the fungal dynamic changes in sites planted in monoculture of various transgenic cottons. Overall, we conclude that monoculture of one representative transgenic cotton cultivar may have no effect on fungal diversity compared with conventional cotton. Furthermore, the choice of amplified region and methodology has potential to affect the outcome of the comparison between GM-crop and its parental line. PMID:27462344

  13. Assessing Fungal Population in Soil Planted with Cry1Ac and CPTI Transgenic Cotton and Its Conventional Parental Line Using 18S and ITS rDNA Sequences over Four Seasons

    PubMed Central

    Qi, Xiemin; Liu, Biao; Song, Qinxin; Zou, Bingjie; Bu, Ying; Wu, Haiping; Ding, Li; Zhou, Guohua


    Long-term growth of genetically modified plants (GMPs) has raised concerns regarding their ecological effects. Here, FLX-pyrosequencing of region I (18S) and region II (ITS1, 5.8S, and ITS2) rDNA was used to characterize fungal communities in soil samples after 10-year monoculture of one representative transgenic cotton line (TC-10) and 15-year plantation of various transgenic cotton cultivars (TC-15mix) over four seasons. Soil fungal communities in the rhizosphere of non-transgenic control (CC) were also compared. No notable differences were observed in soil fertility variables among CC, TC-10, and TC-15mix. Within seasons, the different estimations were statistically indistinguishable. There were 411 and 2 067 fungal operational taxonomic units in the two regions, respectively. More than 75% of fungal taxa were stable in both CC and TC except for individual taxa with significantly different abundance between TC and CC. Statistical analysis revealed no significant differences between CC and TC-10, while discrimination of separating TC-15mix from CC and TC-10 with 37.86% explained variance in PCoA and a significant difference of Shannon indexes between TC-10 and TC-15mix were observed in region II. As TC-15mix planted with a mixture of transgenic cottons (Zhongmian-29, 30, and 33B) for over 5 years, different genetic modifications may introduce variations in fungal diversity. Further clarification is necessary by detecting the fungal dynamic changes in sites planted in monoculture of various transgenic cottons. Overall, we conclude that monoculture of one representative transgenic cotton cultivar may have no effect on fungal diversity compared with conventional cotton. Furthermore, the choice of amplified region and methodology has potential to affect the outcome of the comparison between GM-crop and its parental line. PMID:27462344

  14. Effects of 16S rDNA sampling on estimates of the number of endosymbiont lineages in sucking lice.


    Allen, Julie M; Burleigh, J Gordon; Light, Jessica E; Reed, David L


    Phylogenetic trees can reveal the origins of endosymbiotic lineages of bacteria and detect patterns of co-evolution with their hosts. Although taxon sampling can greatly affect phylogenetic and co-evolutionary inference, most hypotheses of endosymbiont relationships are based on few available bacterial sequences. Here we examined how different sampling strategies of Gammaproteobacteria sequences affect estimates of the number of endosymbiont lineages in parasitic sucking lice (Insecta: Phthirapatera: Anoplura). We estimated the number of louse endosymbiont lineages using both newly obtained and previously sequenced 16S rDNA bacterial sequences and more than 42,000 16S rDNA sequences from other Gammaproteobacteria. We also performed parametric and nonparametric bootstrapping experiments to examine the effects of phylogenetic error and uncertainty on these estimates. Sampling of 16S rDNA sequences affects the estimates of endosymbiont diversity in sucking lice until we reach a threshold of genetic diversity, the size of which depends on the sampling strategy. Sampling by maximizing the diversity of 16S rDNA sequences is more efficient than randomly sampling available 16S rDNA sequences. Although simulation results validate estimates of multiple endosymbiont lineages in sucking lice, the bootstrap results suggest that the precise number of endosymbiont origins is still uncertain. PMID:27547523

  15. Effects of 16S rDNA sampling on estimates of the number of endosymbiont lineages in sucking lice

    PubMed Central

    Burleigh, J. Gordon; Light, Jessica E.; Reed, David L.


    Phylogenetic trees can reveal the origins of endosymbiotic lineages of bacteria and detect patterns of co-evolution with their hosts. Although taxon sampling can greatly affect phylogenetic and co-evolutionary inference, most hypotheses of endosymbiont relationships are based on few available bacterial sequences. Here we examined how different sampling strategies of Gammaproteobacteria sequences affect estimates of the number of endosymbiont lineages in parasitic sucking lice (Insecta: Phthirapatera: Anoplura). We estimated the number of louse endosymbiont lineages using both newly obtained and previously sequenced 16S rDNA bacterial sequences and more than 42,000 16S rDNA sequences from other Gammaproteobacteria. We also performed parametric and nonparametric bootstrapping experiments to examine the effects of phylogenetic error and uncertainty on these estimates. Sampling of 16S rDNA sequences affects the estimates of endosymbiont diversity in sucking lice until we reach a threshold of genetic diversity, the size of which depends on the sampling strategy. Sampling by maximizing the diversity of 16S rDNA sequences is more efficient than randomly sampling available 16S rDNA sequences. Although simulation results validate estimates of multiple endosymbiont lineages in sucking lice, the bootstrap results suggest that the precise number of endosymbiont origins is still uncertain. PMID:27547523

  16. Molecular phylogeny and barcoding of Caulerpa (Bryopsidales) based on the tufA, rbcL, 18S rDNA and ITS rDNA genes.


    Kazi, Mudassar Anisoddin; Reddy, C R K; Jha, Bhavanath


    The biodiversity assessment of different taxa of the genus Caulerpa is of interest from the context of morphological plasticity, invasive potential of some species and biotechnological and pharmacological applications. The present study investigated the identification and molecular phylogeny of different species of Caulerpa occurring along the Indian coast inferred from tufA, rbcL, 18S rDNA and ITS rDNA nucleotide sequences. Molecular data confirmed the identification of 10 distinct Caulerpa species: C. veravalensis, C. verticillata, C. racemosa, C. microphysa, C. taxifolia, C. sertularioides, C. scalpelliformis, C. serrulata, C. peltata and C. mexicana. All datasets significantly supported the sister relationship between C. veravalensis and C. racemosa var. cylindracea. It was also concluded from the results that the specimen identified previously as C. microphysa and C. lentillifera could not be considered as separate species. The molecular data revealed the presence of multiple lineages for C. racemosa which can be resolved into separate species. All four markers were used to ascertain their utility for DNA barcoding. The tufA gene proved a better marker with monophyletic association as the main criteria for identification at the species level. The results also support the use of 18S rDNA insertion sequences to delineate the Caulerpa species through character-based barcoding. The ITS rDNA (5.8S-ITS2) phylogenetic analysis also served as another supporting tool. Further, more sequences from additional Caulerpa specimens will need to be analysed in order to support the role of these two markers (ITS rDNA and 18S insertion sequence) in identification of Caulerpa species. The present study revealed the phylogeny of Caulerpa as complete as possible using the currently available data, which is the first comprehensive report illustrating the molecular phylogeny and barcoding of the genus Caulerpa from Indian waters. PMID:24340028

  17. Molecular Phylogeny and Barcoding of Caulerpa (Bryopsidales) Based on the tufA, rbcL, 18S rDNA and ITS rDNA Genes

    PubMed Central

    Kazi, Mudassar Anisoddin; Reddy, C. R. K.; Jha, Bhavanath


    The biodiversity assessment of different taxa of the genus Caulerpa is of interest from the context of morphological plasticity, invasive potential of some species and biotechnological and pharmacological applications. The present study investigated the identification and molecular phylogeny of different species of Caulerpa occurring along the Indian coast inferred from tufA, rbcL, 18S rDNA and ITS rDNA nucleotide sequences. Molecular data confirmed the identification of 10 distinct Caulerpa species: C. veravalensis, C. verticillata, C. racemosa, C. microphysa, C. taxifolia, C. sertularioides, C. scalpelliformis, C. serrulata, C. peltata and C. mexicana. All datasets significantly supported the sister relationship between C. veravalensis and C. racemosa var. cylindracea. It was also concluded from the results that the specimen identified previously as C. microphysa and C. lentillifera could not be considered as separate species. The molecular data revealed the presence of multiple lineages for C. racemosa which can be resolved into separate species. All four markers were used to ascertain their utility for DNA barcoding. The tufA gene proved a better marker with monophyletic association as the main criteria for identification at the species level. The results also support the use of 18S rDNA insertion sequences to delineate the Caulerpa species through character-based barcoding. The ITS rDNA (5.8S-ITS2) phylogenetic analysis also served as another supporting tool. Further, more sequences from additional Caulerpa specimens will need to be analysed in order to support the role of these two markers (ITS rDNA and 18S insertion sequence) in identification of Caulerpa species. The present study revealed the phylogeny of Caulerpa as complete as possible using the currently available data, which is the first comprehensive report illustrating the molecular phylogeny and barcoding of the genus Caulerpa from Indian waters. PMID:24340028

  18. Molecular cytogenetic analysis of the Appenine endemic cyprinid fish Squalius lucumonis and three other Italian leuciscines using chromosome banding and FISH with rDNA probes.


    Rossi, Anna Rita; Milana, Valentina; Hett, Anne Kathrin; Tancioni, Lorenzo


    Karyotype and other chromosomal characteristics of the Appenine endemic cyprinid fish, Toscana stream chub Squalius lucumonis, were analysed using conventional banding and FISH with 45S and 5S rDNA probes. The diploid chromosome number (2n = 50) and karyotype characteristics including pericentromeric heterochromatic blocks and GC-rich CMA(3)-positive sites corresponding to both positive Ag-NORs and 45S rDNA loci on the short arms of a single medium-sized submetacentric chromosome pair were consistent with those found in most European leuciscine cyprinids. On other hand, 5S rDNA FISH in the Toscana stream chub and three other Italian leuciscines, S. squalus, Rutilus rubilio and Telestes muticellus, revealed a species-specific hybridization pattern, i.e. signals on four (S. lucumonis), three (S. squalus and R. rubilio) and two (T. muticellus) chromosome pairs. Whereas all the species shared the 5S rDNA loci on the largest subtelocentric chromosome pair, a "leuciscine" cytotaxonomic marker, S. lucumonis showed both classes of rDNA loci tandem aligned on the short arms of chromosome pair No. 12. The present findings suggest that the observed high variability of 5S rDNA loci provides a powerful tool for investigation of karyotype differentiation in karyologically conservative leuciscine fishes. PMID:23238894

  19. Utility of internally transcribed spacer region of rDNA (ITS) and β-tubulin gene sequences to infer genetic diversity and migration patterns of Colletotrichum truncatum infecting Capsicum spp.


    Rampersad, Kandyce; Ramdial, Hema; Rampersad, Sephra N


    Anthracnose is among the most economically important diseases affecting pepper (Capsicum spp.) production in the tropics and subtropics. Of the three species of Colletotrichum implicated as causal agents of pepper anthracnose, C. truncatum is considered to be the most destructive in agro-ecosystems worldwide. However, the genetic variation and the migration potential of C. truncatum infecting pepper are not known. Five populations were selected for study and a two-locus (internally transcribed spacer region, ITS1-5.8S-ITS2, and β-tubulin, β-TUB) sequence data set was generated and used in the analyses. Sequences of the ITS region were less informative than β -tubulin gene sequences based on comparisons of DNA polymorphism indices. Trinidad had the highest genetic diversity and also had the largest effective population size in pairwise comparisons with the other populations. The Trinidad population also demonstrated significant genetic differentiation from the other populations. AMOVA and STRUCTURE analyses both suggested significant genetic variation within populations more so than among populations. A consensus Maximum Likelihood tree based on β-TUB gene sequences revealed very little intraspecific diversity for all isolates except for Trinidad. Two clades consisting solely of Trinidad isolates may have diverged earlier than the other isolates. There was also evidence of directional migration among the five populations. These findings may have a direct impact on the development of integrated disease management strategies to control C. truncatum infection in pepper. PMID:26843942

  20. Physical mapping of 18S and 5S genes in pelagic species of the genera Caranx and Carangoides (Carangidae).


    Jacobina, U P; Bertollo, L A C; Bello Cioffi, M; Molina, W F


    In Carangidae, Caranx is taxonomically controversial because of slight morphological differences among species, as well as because of its relationship with the genus Carangoides. Cytogenetic data has contributed to taxonomic and phylogenetic classification for some groups of fish. In this study, we examined the chromosomes of Caranx latus, Caranx lugubris, and Carangoides bartholomaei using classical methods, including conventional staining, C-banding, silver staining for nuclear organizer regions, base-specific fluorochrome, and 18S and 5S ribosomal sequence mapping using in situ hybridization. These 3 species showed chromosome numbers of 2n = 48, simple nuclear organizer regions (pair 1), and mainly centromeric heterochomatin. However, C. latus (NF = 50) and C. bartholomaei (NF = 50) showed a structurally conserved karyotype compared with C. lugubris (NF = 54), with a larger number of 2-armed chromosomes. The richness of GC-positive heterochromatic segments and sites in 5S rDNA in specific locations compared to the other 2 species reinforce the higher evolutionary dynamism in C. lugubris. Cytogenetic aspects shared between C. latus and C. bartholomaei confirm the remarkable phylogenetic proximity between these genera. PMID:25501173

  1. Molecular rDNA phylogeny of Telotylenchidae Siddiqi, 1960 and evaluation of tail termini

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Three stunt nematode species, Tylenchorhynchus leviterminalis, T. claytoni and Bitylenchus dubius were characterized with segments of small subunit 18S and large subunit 28S rDNA sequences and placed in molecular phylogenetic context with other taxa of Telotylechidae in GenBank. In 18S trees, the sp...

  2. Initial results on the molecular phylogeny of the Nudibranchia (Gastropoda, Opisthobranchia) based on 18S rDNA data.


    Wollscheid, E; Wägele, H


    This study investigated nudibranch phylogeny on the basis of 18S rDNA sequence data. 18S rDNA sequence data of 19 taxa representing the major living orders and families of the Nudibranchia were analyzed. Representatives of the Cephalaspidea, Anaspidea, Gymnomorpha, Prosobranchia, and Pulmonata were also sequenced and used as outgroups. An additional 28 gastropod sequences taken from GenBank were also included in our analyses. Phylogenetic analyses of these more than 50 gastropod taxa provide strong evidence for support of the monophyly of the Nudibranchia. The monophyly of the Doridoidea, Cladobranchia, and Aeolidoidea within the Nudibranchia are also strongly supported. Phylogenetic utility and information content of the 18S rDNA sequences for Nudibranchia, and Opisthobranchia in general, are examined using the program SplitsTree as well as phylogenetic reconstructions using distance and parsimony approaches. 0Results based on these molecular data are compared with hypotheses about nudibranch phylogeny inferred from morphological data. PMID:10603252

  3. Assessment of four DNA fragments (COI, 16S rDNA, ITS2, 12S rDNA) for species identification of the Ixodida (Acari: Ixodida)

    PubMed Central


    Background The 5’ region of cytochrome oxidase I (COI) is the standard marker for DNA barcoding. However, COI has proved to be of limited use in identifying some species, and for some taxa, the coding sequence is not efficiently amplified by PCR. These deficiencies lead to uncertainty as to whether COI is the most suitable barcoding fragment for species identification of ticks. Methods In this study, we directly compared the relative effectiveness of COI, 16S ribosomal DNA (rDNA), nuclear ribosomal internal transcribed spacer 2 (ITS2) and 12S rDNA for tick species identification. A total of 307 sequences from 84 specimens representing eight tick species were acquired by PCR. Besides the 1,834 published sequences of 189 tick species from GenBank and the Barcode of Life Database, 430 unpublished sequences representing 59 tick species were also successfully screened by Bayesian analyses. Thereafter, the performance of the four DNA markers to identify tick species was evaluated by identification success rates given by these markers using nearest neighbour (NN), BLASTn, liberal tree-based or liberal tree-based (+threshold) methods. Results Genetic divergence analyses showed that the intra-specific divergence of each marker was much lower than the inter-specific divergence. Our results indicated that the rates of correct sequence identification for all four markers (COI, 16S rDNA, ITS2, 12S rDNA) were very high (> 96%) when using the NN methodology. We also found that COI was not significantly better than the other markers in terms of its rate of correct sequence identification. Overall, BLASTn and NN methods produced higher rates of correct species identification than that produced by the liberal tree-based methods (+threshold or otherwise). Conclusions As the standard DNA barcode, COI should be the first choice for tick species identification, while 16S rDNA, ITS2, and 12S rDNA could be used when COI does not produce reliable results. Besides, NN and BLASTn are

  4. Phylogenetic position of Magnivitellinum Kloss, 1966 and Perezitrema Baruš & Moravec, 1967 (Trematoda: Plagiorchioidea: Macroderoididae) inferred from partial 28S rDNA sequences, with the establishment of Alloglossidiidae n. fam.


    Hernández-Mena, David Iván; Mendoza-Garfias, Berenit; Ornelas-García, Claudia Patricia; Pérez-Ponce de León, Gerardo


    The systematic position of two genera of Macroderoididae McMullen, 1937, Perezitrema Baruš & Moravec, 1967 and Magnivitellinum Kloss, 1966 is reviewed based on a phylogenetic analysis of the interrelationships of 15 species of the family allocated into six genera, along with 44 species of plagiorchioid trematodes, using partial sequences of the 28S rRNA gene. Sequences were analysed through parsimony, maximum likelihood and Bayesian inference. The obtained topologies show Perezitrema as the sister taxon of three species of Macroderoides Pearse, 1924; the latter genus appears to be paraphyletic since another three species are not included in this group. Instead, Magnivitellinum was placed as the sister taxon of Alloglossidium Simer, 1929. These relationships are well supported by high bootstrap and posterior probability values. The resulting trees demonstrate that the family Macroderoididae, as currently conceived in taxonomic treatments, is not monophyletic. Magnivitellinum simplex Kloss, 1966 and Alloglossidium spp. were nested as sister taxa of members of the family Leptophallidae Dayal, 1938, whereas Perezitrema bychowskii Baruš & Moravec, 1967 and species of Macroderoides and Paramacroderoides Venard, 1941 were grouped with Auridistomum chelydrae (Stafford, 1900), a monotypic member of Auridistomidae Stunkard, 1924. Based on our results, a new family, Alloglossidiidae n. fam. was established to accommodate the genera Magnivitellinum and Alloglossidium. PMID:27307166

  5. Real-Time PCR and Sequencing Assays for Rapid Detection and Identification of Avian Schistosomes in Environmental Samples

    PubMed Central

    Mull, Bonnie J.; Brant, Sara V.; Loker, Eric S.; Collinson, Jeremy; Secor, W. Evan; Hill, Vincent R.


    Cercarial dermatitis, also known as swimmer's itch, is an allergenic skin reaction followed by intense itching caused by schistosome cercariae penetrating human skin. Cercarial dermatitis outbreaks occur globally and are frequently associated with freshwater lakes and are occasionally associated with marine or estuarine waters where birds reside year-round or where migratory birds reside. In this study, a broadly reactive TaqMan assay targeting 18S rRNA gene (ribosomal DNA [rDNA]) sequences that was based on a genetically diverse panel of schistosome isolates representing 13 genera and 20 species (the 18S rDNA TaqMan assay) was developed. A PCR assay was also developed to amplify a 28S rDNA region for subsequent sequencing to identify schistosomes. When applied to surface water samples seeded with Schistosoma mansoni cercariae, the 18S rDNA TaqMan assay enabled detection at a level of 5 S. mansoni cercariae in 100 liters of lake water. The 18S rDNA TaqMan and 28S rDNA PCR sequencing assays were also applied to 100-liter water samples collected from lakes in Nebraska and Wisconsin where there were reported dermatitis outbreaks. Avian schistosome DNA was detected in 11 of 34 lake water samples using the TaqMan assay. Further 28S rDNA sequence analysis of positive samples confirmed the presence of avian schistosome DNA and provided a preliminary identification of the avian schistosomes in 10 of the 11 samples. These data indicate that the broadly schistosome-reactive TaqMan assay can be effective for rapid screening of large-volume water samples for detection of avian schistosomes, thereby facilitating timely response actions to mitigate or prevent dermatitis outbreaks. Additionally, samples positive by the 18S rDNA TaqMan assay can be further assayed using the 28S rDNA sequencing assay to both confirm the presence of schistosomes and contribute to their identification. PMID:25862226

  6. Phylogeny of the Eustigmatophyceae Based upon 18S rDNA, with Emphasis on Nannochloropsis.


    Andersen, R A; Brett, R W; Potter, D; Sexton, J P


    Complete 18S rDNA sequences were determined for 25 strains representing five genera of the Eustigmatophyceae, including re-examination of three strains with previously published sequences. Parsimony analysis of these and 44 published sequences for other heterokont chromophytes (unalignable sites removed) revealed that the Eustigmatophyceae were a monophyletic group. Analysis of eustigmatophyte taxa only (complete gene analyzed) supported the current familial classification scheme. Twenty one strains of Nannochloropsis were also examined using light microscopy. Gross morphology of cells was variable and overlapped among the strains; cell size was consistent within strains but sometimes varied considerably among strains of a species. The 18S rDNA of N. gaditana, N. oculata and N. salina was re-sequenced for strains used in previous publications and one or more nucleotide differences were found. Nucleotide sequences for Nannochloropsis species varied by up to 32 nucleotides. Identical sequences were found for six strains of N. salina, five strains of N. gadifana, four strains of N. granulata, and two strains of N. oculata, respectively. Four strains could not be assigned to described species and may represent two new species. The unique 18S rDNA sequences for each sibling species of Nannochloropsis demonstrates the presence of considerable genetic diversity despite the extremely simple morphology in this genus. PMID:23196114

  7. Assessment of Helminth Biodiversity in Wild Rats Using 18S rDNA Based Metagenomics

    PubMed Central

    Tsai, Isheng J.; Palomares-Rius, Juan Emilio; Yoshida, Ayako; Ogura, Yoshitoshi; Hayashi, Tetsuya; Maruyama, Haruhiko; Kikuchi, Taisei


    Parasite diversity has important implications in several research fields including ecology, evolutionary biology and epidemiology. Wide-ranging analysis has been restricted because of the difficult, highly specialised and time-consuming processes involved in parasite identification. In this study, we assessed parasite diversity in wild rats using 18S rDNA-based metagenomics. 18S rDNA PCR products were sequenced using an Illumina MiSeq sequencer and the analysis of the sequences using the QIIME software successfully classified them into several parasite groups. The comparison of the results with those obtained using standard methods including microscopic observation of helminth parasites in the rat intestines and PCR amplification/sequencing of 18S rDNA from isolated single worms suggests that this new technique is reliable and useful to investigate parasite diversity. PMID:25340824

  8. Bacterial diversity in the rumen of Indian Surti buffalo (Bubalus bubalis), assessed by 16S rDNA analysis.


    Pandya, P R; Singh, K M; Parnerkar, S; Tripathi, A K; Mehta, H H; Rank, D N; Kothari, R K; Joshi, C G


    Bacterial communities in buffalo rumen were characterized using a culture-independent approach for a pooled sample of rumen fluid from 3 adult Surti buffaloes. Buffalo rumen is likely to include species of various bacterial phyla, so 16S rDNA sequences were amplified and cloned from the sample. A total of 191 clones were sequenced and similarities to known 16S rDNA sequences were examined. About 62.82% sequences (120 clones) had >90% similarity to the 16S rDNA database sequences. Furthermore, about 34.03% of the sequences (65 clones) were 85-89% similar to 16S rDNA database sequences. For the remaining 3.14%; the similarity was lower than 85% Phylogenetic analyses were also used to infer the makeup of bacterial communities in the rumen of Surti buffalo. As a result, we distinguished 42 operational taxonomic units (OTUs) based on unique 16S r DNA sequences: 19 OTUs affiliated to an unidentified group (45.23% of total OTUs), 11 OTUs of the phylum Firmicutes, also known as the low G+C group (26.19%), 7 OTUs of the Cytophaga-Flexibacter-Bacteroides phylum (16.66%), 4 OTUs of Spirochaetes (9.52%), and 1 OTU of Actinobacteria (2.38%). These include 10 single-clone OTUs, so Good's coverage (94.76%) of 16S rRNA libraries indicated that sequences identified in the libraries represent the majority of bacterial diversity present in rumen. PMID:20720314

  9. Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization.


    Dingman, Douglas W


    Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions. PMID:22510214

  10. High diversity of bacterial pathogens and antibiotic resistance in salmonid fish farm pond water as determined by molecular identification employing 16S rDNA PCR, gene sequencing and total antibiotic susceptibility techniques.


    Moore, John E; Huang, Junhua; Yu, Pengbo; Ma, Chaofeng; Moore, Peter Ja; Millar, Beverley C; Goldsmith, Colin E; Xu, Jiru


    The aim of this study was to examine the microbiological and related parameters (antibiotic resistance and pathogen identification) of water at two salmonid fish farms in Northern Ireland. Total Bacterial Counts at the Movanagher Fish Farm was 1730 colony forming units (cfu)/ml water (log10 3.24cfu/ml) and 3260cfu/ml (log10 3.51cfu/ml) at the Bushmills Salmon Station. Examination of resulting organisms revealed 10 morphological phenotypes, which were subsequently sequenced to determine their identification. All these organisms were Gram-negative and no Gram-positive organisms were isolated from any water sample. From these phenotypes, eight different genera were identified including Acinetobacter, Aeromonas, Chryseobacterium, Erwinia, Flavobacterium, Pseudomonas and Rheinheimera. One unnamed novel taxon was identified from water at the Movanagher Fish Farm, belonging to the genus Acinetobacter and has been tentatively named Acinetobacter movanagherensis. No other novel taxa were observed. All but one of these environmental organisms (Erwinia) are potential pathogens of fish disease. Total antibiotic resistance was observed to varying degrees in water specimens. The most resistant populations were observed in water taken from the Bushmills Salmon Station inlet, followed by water from the Movanagher Fish Farm. No resistance was observed against tetracycline and there was only one occurrence of resistance against ciprofloxacin. Overall, this study indicates that potential fish pathogens made up the majority of environmental organisms identified, even in the absence of recorded fish disease. There was also relatively high levels of total antibiotic resistance in the bacterial water populations examined, where tetracycline was the only antibiotic with zero resistance. These data indicate that the threat of bacterial disease is relatively close due to the indigenous colonization of farm water and that husbandry standards should be maintained at a high standard to avert

  11. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

    PubMed Central

    Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R


    As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

  12. Chromosome mapping of repetitive sequences in four Serrasalmidae species (Characiformes)

    PubMed Central

    Ribeiro, Leila Braga; Matoso, Daniele Aparecida; Feldberg, Eliana


    The Serrasalmidae family is composed of a number of commercially interesting species, mainly in the Amazon region where most of these fishes occur. In the present study, we investigated the genomic organization of the 18S and 5S rDNA and telomeric sequences in mitotic chromosomes of four species from the basal clade of the Serrasalmidae family: Colossoma macropomum, Mylossoma aureum, M. duriventre, and Piaractus mesopotamicus, in order to understand the chromosomal evolution in the family. All the species studied had diploid numbers 2n = 54 and exclusively biarmed chromosomes, but variations of the karyotypic formulas were observed. C-banding resulted in similar patterns among the analyzed species, with heterochromatic blocks mainly present in centromeric regions. The 18S rDNA mapping of C. macropomum and P. mesopotamicus revealed multiple sites of this gene; 5S rDNA sites were detected in two chromosome pairs in all species, although not all of them were homeologs. Hybridization with a telomeric probe revealed signals in the terminal portions of chromosomes in all the species and an interstitial signal was observed in one pair of C. macropomum. PMID:24688290

  13. Development of genome-specific 5S rDNA markers in Brassica and related species for hybrid testing.


    La Mura, Maurizio; Norris, Carol; Sporle, Sue; Jayaweera, Dasuni; Greenland, Andy; Lee, David


    The Brassicaceae are targets for DNA manipulation to modify oil content and composition. However, any strategy for creating novel products using genetic modification or traditional breeding must take into account the potential for hybridization with other Brassica species, many of which are important sources of edible oils. In this study we have tested Brassica carinata, a possible target for oil modification, to establish whether it can cross with other Brassica species and related genera, and we have developed molecular DNA assays to confirm hybridization. PMID:20725152

  14. Methanogen diversity in the rumen of Indian Surti buffalo (Bubalus bubalis), assessed by 16S rDNA analysis.


    Singh, K M; Tripathi, A K; Pandya, P R; Parnerkar, S; Rank, D N; Kothari, R K; Joshi, C G


    The methanogenic communities in buffalo rumen were characterized using a culture-independent approach of a pooled sample of rumen fluid from three adult Surti buffaloes. Buffalo rumen is likely to include species of various methanogens, so 16S rDNA sequences were amplified and cloned from the sample. A total of 171 clones were sequenced to examine 16S rDNA sequence similarity. About 52.63% sequences (90 clones) had ≥ 90% similarity, whereas, 46.78% of the sequences (81 clones) were 75-89% similar to 16S rDNA database sequences, respectively. Phylogenetic analyses were also used to infer the makeup of methanogenic communities in the rumen of Surti buffalo. As a result, we distinguished 23 operational taxonomic units (OTUs) based on unique 16S rDNA sequences: 12 OTUs (52.17%) affiliated to Methanomicrobiales order, 10 OTUs (43.47%) of the order Methanobacteriales and one OTU (4.34%) of Methanosarcina barkeri like clone, respectively. In addition, the population of Methanomicrobiales and Methabacteriales orders were also observed, accounting 4% and 2.17% of total archea. This study has revealed the largest assortment of hydrogenotrophic methanogens phylotypes ever identified from rumen of Surti buffaloes. PMID:21507441

  15. Divergent effects of oxidatively induced modification to the C8 of 2'-deoxyadenosine on transcription factor binding: 8,5'(S)-cyclo-2'-deoxyadenosine inhibits the binding of multiple sequence specific transcription factors, while 8-oxo-2'-deoxyadenosine increases binding of CREB and NF-kappa B to DNA.


    Abraham, Jessy; Brooks, Philip J


    DNA is exposed to endogenous and environmental factors that can form stable lesions. If not repaired, these lesions can lead to transcription/replication blocking or mutagenic bypass. Our previous work has focused on 8,5'-cyclopurine 2'-deoxyribonucleosides, a unique class of oxidatively induced DNA lesions that are specifically repaired by the NER pathway (see Brooks PJ [2008]: DNA Repair 7:1168-1179). Here we used EMSA to monitor the ability of sequence-specific transcription factors, HSF1, CREB, and NF-kappaB and "architectural" transcription factor, HMGA, to bind to their target sequences when 8, 5'(S)-cyclo-2'-deoxyadenosine (cyclo-dAdo) is present within their recognition sequences. For comparison, we also tested the effect of 8-oxo-7,8-dihydro-2'-deoxyadenosine (8-oxo-dAdo) in the same recognition sequences. The presence of a cyclo-dAdo lesion in the target sequence essentially eliminated the binding activity of HSF1, CREB, and NF-kappa B whereas HMGA retained some of its binding activity. In contrast, 8-oxo-dAdo had no obvious effect on the binding activity of HSF1 and HMGA in comparison to lesion-free DNA. Notably, though, CREB and NFκB binding increased when an 8-oxo-dAdo lesion was present in their target sequence. Competition EMSA showed about 2-3-fold increased affinity of both proteins for the 8-oxo-dAdo containing target sequence compared to lesion-free DNA. Molecular modeling of the lesions in the NF-kappaB sequence indicated that 8-oxo-dAdo may form an additional hydrogen bond with the protein, thereby strengthening the binding of NF-kappa B to its DNA target. The cyclo-dAdo lesion, in contrast, distorted the DNA structure, providing an explanation for the inhibition of NF-kappaB binding. PMID:20872830

  16. Dynamics of R1 and R2 elements in the rDNA locus of Drosophila simulans.

    PubMed Central

    Pérez-González, C E; Eickbush, T H


    The mobile elements R1 and R2 insert specifically into the rRNA gene locus (rDNA locus) of arthropods, a locus known to undergo concerted evolution, the recombinational processes that preserve the sequence homogeneity of all repeats. To monitor how rapidly individual R1 and R2 insertions are turned over in the rDNA locus by these processes, we have taken advantage of the many 5' truncation variants that are generated during the target-primed reverse transcription mechanism used by these non-LTR retrotransposons for their integration. A simple PCR assay was designed to reveal the pattern of the 5' variants present in the rDNA loci of individual X chromosomes in a population of Drosophila simulans. Each rDNA locus in this population was found to have a large, unique collection of 5' variants. Each variant was present at low copy number, usually one copy per chromosome, and was seldom distributed to other chromosomes in the population. The failure of these variants to spread to other units in the same rDNA locus suggests a strong recombinational bias against R1 and R2 that results in the individual copies of these elements being rapidly lost from the rDNA locus. This bias suggests a significantly higher frequency of R1 and R2 retrotransposition than we have previously suggested. PMID:11514447

  17. Strain identification and 5S rRNA gene characterization of the hyperthermophilic archaebacterium Sulfolobus acidocaldarius.

    PubMed Central

    Durovic, P; Kutay, U; Schleper, C; Dennis, P P


    A commonly used laboratory Sulfolobus strain has been unambiguously identified as Sulfolobus acidocaldarius DSM639. The 5S rRNA gene from this strain was cloned and sequenced. It differs at 17 of 124 positions from the identical 5S rRNA sequences from Sulfolobus solfataricus and a strain apparently misidentified as S. acidocaldarius. Analysis of the transcripts from the 5S rRNA gene failed to identify any precursor extending a significant distance beyond the 5' or 3' boundary of the 5S rRNA-coding sequence. This result suggests that the primary transcript of the 5S rRNA gene corresponds in length (within 1 or 2 nucleotides) to the mature 5S rRNA sequence found in 50S ribosomal subunits. Images PMID:8288546

  18. Evolutionary pattern of rDNA following polyploidy in Leymus (Triticeae: Poaceae).


    Fan, Xing; Liu, Jing; Sha, Li-Na; Sun, Gen-Lou; Hu, Zhi-Qin; Zeng, Jian; Kang, Hou-Yang; Zhang, Hai-Qin; Wang, Yi; Wang, Xiao-Li; Zhang, Li; Ding, Chun-Bang; Yang, Rui-Wu; Zheng, You-Liang; Zhou, Yong-Hong


    Ribosomal ITS polymorphism and its ancestral genome origin of polyploid Leymus were examined to infer the evolutionary outcome of rDNA gene following allopolyploid speciation and to elucidate the geographic pattern of ITS variation. The results demonstrated that different polyploids have experienced varying fates, including maintenance or homogenization of divergent arrays, occurrence of chimeric repeats and potential pseudogenes. Our data suggested that (1) the Ns, P/F, and St genomic types in Leymus were originated from Psathyrostachys, Agropyron/Eremopyrum, and Pseudoroegneria, respectively; (2) the occurrence of a higher proportion of Leymus species with predominant uniparental rDNA type might associate with the segmental allopolyploid origin, nucleolar dominance of alloploids, and rapid radiation of Leymus; (3) maintenance of multiple parental ITS types in allopolyploid might result from long generation times associated to vegetative multiplication, number and chromosomal location of ribosomal loci and/or recurrent hybridization; (4) the rDNA genealogical structure of Leymus species might associate with the geographic origins; and (5) ITS sequence clade shared by Leymus species from Central Asia, North America, and Nordic might be an outcome of ancestral ITS homogenization. Our results shed new light on understanding evolutionary outcomes of rDNA following allopolyploid speciation and geographic isolation. PMID:24780748

  19. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae)

    PubMed Central

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo


    Abstract Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 ‘Azul’, Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700

  20. Complete Sequence Construction of the Highly Repetitive Ribosomal RNA Gene Repeats in Eukaryotes Using Whole Genome Sequence Data.


    Agrawal, Saumya; Ganley, Austen R D


    The ribosomal RNA genes (rDNA) encode the major rRNA species of the ribosome, and thus are essential across life. These genes are highly repetitive in most eukaryotes, forming blocks of tandem repeats that form the core of nucleoli. The primary role of the rDNA in encoding rRNA has been long understood, but more recently the rDNA has been implicated in a number of other important biological phenomena, including genome stability, cell cycle, and epigenetic silencing. Noncoding elements, primarily located in the intergenic spacer region, appear to mediate many of these phenomena. Although sequence information is available for the genomes of many organisms, in almost all cases rDNA repeat sequences are lacking, primarily due to problems in assembling these intriguing regions during whole genome assemblies. Here, we present a method to obtain complete rDNA repeat unit sequences from whole genome assemblies. Limitations of next generation sequencing (NGS) data make them unsuitable for assembling complete rDNA unit sequences; therefore, the method we present relies on the use of Sanger whole genome sequence data. Our method makes use of the Arachne assembler, which can assemble highly repetitive regions such as the rDNA in a memory-efficient way. We provide a detailed step-by-step protocol for generating rDNA sequences from whole genome Sanger sequence data using Arachne, for refining complete rDNA unit sequences, and for validating the sequences obtained. In principle, our method will work for any species where the rDNA is organized into tandem repeats. This will help researchers working on species without a complete rDNA sequence, those working on evolutionary aspects of the rDNA, and those interested in conducting phylogenetic footprinting studies with the rDNA. PMID:27576718

  1. Intraspecific polymorphism of rDNA among five Nosema bombycis isolates from different geographic regions in China.


    Liu, Handeng; Pan, Guoqing; Luo, Bo; Li, Tian; Yang, Qiong; Vossbrinck, Charles R; Debrunner-Vossbrinck, Bettina A; Zhou, Zeyang


    The microsporidian Nosema bombycis is the causative agent of pébrine, a highly infectious disease of the silkworm Bombyx mori. Three regions of the multicopy rDNA gene were examined in order to investigate the relationships among five Nosema isolates from various regions of China. Ribosomal DNA alleles are present on each of the 18 chromosomes of N. bombycis and show a high degree of variation. In this study the small subunit (SSU) rDNA, internal transcribed spacer (ITS) and intergenic spacer (IGS) regions for up to 10 different rDNA copies from each N. bombycis isolate were cloned and sequenced. As expected we see greater polymorphism in the ITS region (88 variable sites in 179 nucleotides) and IGS (200 variable sites in 279 nucleotides) than in the SSU rDNA (24 variable sites in 1232 nucleotides). Phylogenetic analysis shows greater differences between alleles within an isolate than between the same alleles from different isolates. The data reveal two very different groups, one from the Sichuan province and the other with a broad distribution including four provinces in southeast China and Japan. The Sichuan isolate does not have any rDNA alleles with sequences identical to those in the other isolates, implying that it is a separate, non-intermixing, population or perhaps a separate species from the other isolates. In light of the polymorphic nature of the rDNA alleles in N. bombycis and their presence on every chromosome, the rDNA gene may be useful for understanding the movement and ultimately the source of pébrine infections. PMID:23399511

  2. Nucleotide excision repair of the 5 S ribosomal RNA gene assembled into a nucleosome.


    Liu, X; Smerdon, M J


    A-175-base pair fragment containing the Xenopus borealis somatic 5 S ribosomal RNA gene was used as a model system to determine the effect of nucleosome assembly on nucleotide excision repair (NER) of the major UV photoproduct (cyclobutane pyrimidine dimer (CPD)) in DNA. Xenopus oocyte nuclear extracts were used to carry out repair in vitro on reconstituted, positioned 5 S rDNA nucleosomes. Nucleosome structure strongly inhibits NER at many CPD sites in the 5 S rDNA fragment while having little effect at a few sites. The time course of CPD removal at 35 different sites indicates that >85% of the CPDs in the naked DNA fragment have t(12) values <2 h, whereas <26% of the t(12) values in nucleosomes are <2 h, and 15% are >8 h. Moreover, removal of histone tails from these mononucleosomes has little effect on the repair rates. Finally, nucleosome inhibition of repair shows no correlation with the rotational setting of a 14-nucleotide-long pyrimidine tract located 30 base pairs from the nucleosome dyad. These results suggest that inhibition of NER by mononucleosomes is not significantly influenced by the rotational orientation of CPDs on the histone surface, and histone tails play little (or no) role in this inhibition. PMID:10821833

  3. Distribution of 45S rDNA sites in chromosomes of plants: Structural and evolutionary implications

    PubMed Central


    Background 45S rDNA sites are the most widely documented chromosomal regions in eukaryotes. The analysis of the distribution of these sites along the chromosome in several genera has suggested some bias in their distribution. In order to evaluate if these loci are in fact non-randomly distributed and what is the influence of some chromosomal and karyotypic features on the distribution of these sites, a database was built with the position and number of 45S rDNA sites obtained by FISH together with other karyotypic data from 846 plant species. Results In angiosperms the most frequent numbers of sites per diploid karyotype were two and four, suggesting that in spite of the wide dispersion capacity of these sequences the number of rDNA sites tends to be restricted. The sites showed a preferential distribution on the short arms, mainly in the terminal regions. Curiously, these sites were frequently found on the short arms of acrocentric chromosomes where they usually occupy the whole arm. The trend to occupy the terminal region is especially evident in holokinetic chromosomes, where all of them were terminally located. In polyploids there is a trend towards reduction in the number of sites per monoploid complement. In gymnosperms, however, the distribution of rDNA sites varied strongly among the sampled families. Conclusions The location of 45S rDNA sites do not vary randomly, occurring preferentially on the short arm and in the terminal region of chromosomes in angiosperms. The meaning of this preferential location is not known, but some hypotheses are considered and the observed trends are discussed. PMID:23181612

  4. Evolution of the tetraploid Anemone multifida (2n = 32) and hexaploid A. baldensis (2n = 48) (Ranunculaceae) was accompanied by rDNA loci loss and intergenomic translocation: evidence for their common genome origin

    PubMed Central

    Mlinarec, J.; Šatović, Z.; Malenica, N.; Ivančić-Baće, I.; Besendorfer, V.


    Background and Aims In the genus Anemone two small groups of taxa occur with the highest ploidy levels 2n = 6x = 48, belonging to the closely related clades: the montane/alpine Baldensis clade and the more temperate Multifida clade. To understand the formation of polyploids within these groups, the evolution of allohexaploid A. baldensis (AABBDD, 2n = 6x = 48) from Europe and allotetraploid Anemone multifida (BBDD, 2n = 4x = 32) from America was analysed. Methods Internal transcribed spacer and non-transcribed spacer sequences were used as molecular markers for phylogenetic analyses. Cytogenetic studies, including genomic in situ hybridization with genomic DNA of potential parental species as probe, fluorescence in situ hybridization with 5S and 18S rDNA as probes and 18S rDNA restriction analyses, were used to identify the parental origin of chromosomes and to study genomic changes following polyploidization. Key Results This study shows that A. multifida (BBDD, 2n= 4x = 32) and A. baldensis (AABBDD, 2n = 6x = 48) are allopolyploids originating from the crosses of diploid members of the Multifida (donor of the A and B subgenomes) and Baldensis groups (donor of the D subgenome). The A and B subgenomes are closely related to the genomes of A. sylvestris, A. virginiana and A. cylindrica, indicating that these species or their progeny might be the ancestral donors of the B subgenome of A. multifida and A and B subgenomes of A. baldensis. Both polyploids have undergone genomic changes such as interchromosomal translocation affecting B and D subgenomes and changes at rDNA sites. Anemone multifida has lost the 35S rDNA loci characteristic of the maternal donor (B subgenome) and maintained only the rDNA loci of the paternal donor (D subgenome). Conclusions It is proposed that A. multifida and A. baldensis probably had a common ancestor and their evolution was facilitated by vegetation changes during the Quaternary, resulting in their present disjunctive distribution. PMID

  5. Investigation of the validity of species status of Ixodes dammini (Acari: Ixodidae) using rDNA.

    PubMed Central

    Wesson, D M; McLain, D K; Oliver, J H; Piesman, J; Collins, F H


    The two internal transcribed spacers (ITS1 and ITS2) of rDNA of three members of the Ixodes ricinus "complex" (Acari: Ixodidae) were sequenced. Sequence variation was assessed for the North American species I. scapularis, I. dammini, and I. pacificus at three levels: within individual/population, between individuals of different geographic origin within a species, and between species. Both spacers are highly variable, particularly with regard to small deletions and additions which may arise via replication slippage. Homogenization of rDNA multigene arrays for particular sequence variants appears to occur at a relatively rapid rate, since I. pacificus sequences differ from the others at numerous invariant sites, facilitating the use of these sequences to assess sibling species relationships. Based on maximum parsimony and two distance methods (unweighted pair-group with arithmetic means and neighbor-joining), sequence variation in ITS1 and ITS2 suggests that I. scapularis and I. dammini are not distinct species and that even individuals from geographically isolated locations are very similar. Individuals from geographically separated populations of I. pacificus appear to be relatively less closely related to each other but distinct from those of I. scapularis/dammini. In I. scapularis/dammini, diversity within and between individuals from geographic populations contributed equally to total sequence diversity. PMID:8234280

  6. Retrotransposable elements R1 and R2 in the rDNA units of Drosophila mercatorum: abnormal abdomen revisited.

    PubMed Central

    Malik, H S; Eickbush, T H


    R1 and R2 retrotransposable elements are stable components of the 28S rRNA genes of arthropods. While each retrotransposition event leads to incremental losses of rDNA unit expression, little is known about the selective consequences of these elements on the host genome. Previous reports suggested that in the abnormal abdomen (aa) phenotype of Drosophila mercatorum, high levels of rDNA insertions (R1) in conjunction with the under-replication locus (ur), enable the utilization of different ecological conditions via a population level shift to younger age. We have sequenced the R1 and R2 elements of D. mercatorum and show that the levels of R1- and R2-inserted rDNA units were inaccurately scored in the original studies of aa, leading to several misinterpretations. In particular, contrary to earlier reports, aa flies differentially underreplicate R1- and R2-inserted rDNA units, like other species of Drosophila. However, aa flies do not undergo the lower level of underreplication of their functional rDNA units (general underreplication) that is seen in wild-type strains. The lack of general underreplication is expected to confer a selective advantage and, thus, can be interpreted as an adaptation to overcome high levels of R1 and R2 insertions. These results allow us to reconcile some of the apparently contradictory effects of aa and the bobbed phenotype found in other species of Drosophila. PMID:9927458

  7. Chromosomal localization of two novel repetitive sequences isolated from the Chenopodium quinoa Willd. genome.


    Kolano, B; Gardunia, B W; Michalska, M; Bonifacio, A; Fairbanks, D; Maughan, P J; Coleman, C E; Stevens, M R; Jellen, E N; Maluszynska, J


    The chromosomal organization of two novel repetitive DNA sequences isolated from the Chenopodium quinoa Willd. genome was analyzed across the genomes of selected Chenopodium species. Fluorescence in situ hybridization (FISH) analysis with the repetitive DNA clone 18-24J in the closely related allotetraploids C. quinoa and Chenopodium berlandieri Moq. (2n = 4x = 36) evidenced hybridization signals that were mainly present on 18 chromosomes; however, in the allohexaploid Chenopodium album L. (2n = 6x = 54), cross-hybridization was observed on all of the chromosomes. In situ hybridization with rRNA gene probes indicated that during the evolution of polyploidy, the chenopods lost some of their rDNA loci. Reprobing with rDNA indicated that in the subgenome labeled with 18-24J, one 35S rRNA locus and at least half of the 5S rDNA loci were present. A second analyzed sequence, 12-13P, localized exclusively in pericentromeric regions of each chromosome of C. quinoa and related species. The intensity of the FISH signals differed considerably among chromosomes. The pattern observed on C. quinoa chromosomes after FISH with 12-13P was very similar to GISH results, suggesting that the 12-13P sequence constitutes a major part of the repetitive DNA of C. quinoa. PMID:21848446

  8. Molecular cytogenetic analysis of the crucian carp, Carassius carassius (Linnaeus, 1758) (Teleostei, Cyprinidae), using chromosome staining and fluorescence in situ hybridisation with rDNA probes

    PubMed Central

    Spoz, Aneta; Boron, Alicja; Porycka, Katarzyna; Karolewska, Monika; Ito, Daisuke; Abe, Syuiti; Kirtiklis, Lech; Juchno, Dorota


    Abstract The crucian carp Carassius carassius (Linnaeus, 1758) is a species with restricted and decreasing distribution in Europe. Six males and six females of the species from the Baltic Sea basin in Poland were examined to show sequentially CMA3/AgNO3 staining pattern, DAPI staining, and, for the first time in literature, molecular cytogenetic analysis using double-colour fluorescence in situ hybridisation (FISH) with 28S and 5S rDNA probes. The karyotype consisted of 20 m, 36 sm and 44 sta chromosomes, NF=156. The AgNO3 stained NORs were most frequently located terminally in the short arms of two sm and two sta elements, and CMA3-positive sites were also observed suggesting abundant GC-rich repetitive DNA in the regions. Other CMA3-positive sites in the short arms of six to ten sm and sta chromosomes were detected. The results based on 28S rDNA FISH confirmed the location of rDNA sites. DAPI-negative staining of NORs suggested the scarcity of AT-rich DNA in the regions. FISH with 5S rDNA probe revealed 8–14 loci (ten and 12 in respectively 49 and 29% of metaphases). They were located in two sm and eight to ten sta chromosomes and six of them were larger than others. Simultaneously, mapping of the two rDNA families on the chromosomes of C. carassius revealed that both 28S and 5S rDNA probes were located in different chromosomes. Molecular cytogenetic data of C. carassius presented here for the first time give an important insight into the structure of chromosomes of this polyploid and declining species and may be useful in its systematics. PMID:25349674

  9. When fathers are instant losers: homogenization of rDNA loci in recently formed Cardamine × schulzii trigenomic allopolyploid.


    Zozomová-Lihová, Judita; Mandáková, Terezie; Kovaříková, Alena; Mühlhausen, Andreas; Mummenhoff, Klaus; Lysak, Martin A; Kovařík, Aleš


    Recently formed allopolyploids represent an excellent system to study the impacts of hybridization and genomic duplication on genome structure and evolution. Here we explored the 35SrRNA genes (rDNA) in the Cardamine × schulzii allohexaploid that was formed by two subsequent hybridization events within the past c. 150 yr. The rDNA loci were analyzed by cloning, next generation sequencing (NGS), RT-PCR and FISH methods. The primary C. × insueta triploid hybrid derived from C. rivularis (♀) and C. amara (♂) had gene ratios highly skewed towards maternal sequences. Similarly, C. × schulzii, originating from the secondary hybridization event involving C. × insueta (♀) and C. pratensis (♂), showed a reduction in paternal rDNA homeologs despite an excess of chromosomes inherited from C. pratensis. We also identified novel rDNA loci in C. × schulzii, suggesting that lost loci might be slowly reinstalled by translocation (but not recombination) of genes from partner genomes. Prevalent clonal propagation of allopolyploids, C. × insueta and C. × schulzii, indicates that concerted evolution of rDNA may occur in the absence of extensive meiotic cycles. Adoption of NGS in rDNA variant analysis is highly informative for deciphering the evolutionary histories of allopolyploid species with ongoing homogenization processes. PMID:24916080

  10. PCR amplification of 16S rDNA from lyophilized cell cultures facilitates studies in molecular systematics

    NASA Technical Reports Server (NTRS)

    Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.


    The sequence of the major portion of a Bacillus cycloheptanicus strain SCH(T) 16S rRNA gene is reported. This sequence suggests that B. cycloheptanicus is genetically quite distinct from traditional Bacillus strains (e.g., B. subtilis) and may be properly regarded as belonging to a different genus. The sequence was determined from DNA that was produced by direct amplification of ribosomal DNA from a lyophilized cell pellet with straightforward polymerase chain reaction (PCR) procedures. By obviating the need to revive cell cultures from the lyophile pellet, this approach facilitates rapid 16S rDNA sequencing and thereby advances studies in molecular systematics.

  11. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.


    Eastman, Alexander W; Yuan, Ze-Chun


    Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing projects. PMID

  12. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing

    PubMed Central

    Eastman, Alexander W.; Yuan, Ze-Chun


    Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing projects. PMID

  13. Functional variants of 5S rRNA in the ribosomes of common sea urchin Paracentrotus lividus.


    Dimarco, Eufrosina; Cascone, Eleonora; Bellavia, Daniele; Caradonna, Fabio


    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus; this study, performed at DNA level only, lends itself as starting point to verify that these clusters could contain transcribed genes, then, to demonstrate the presence of heterogeneity at functional RNA level, also. In the present work we report in P. lividus ribosomes the existence of several transcribed variants of the 5S rRNA and we associate all transcribed variants to the cluster to which belong. Our finding is the first demonstration of the presence of high heterogeneity in functional 5S rRNA molecules in animal ribosomes, a feature that had been considered a peculiarity of some plants. PMID:22967708

  14. Combining denaturing gradient gel electrophoresis of 16S rDNA V3 region and 16S-23S rDNA spacer region polymorphism analyses for the identification of staphylococci from Italian fermented sausages.


    Blaiotta, Giuseppe; Pennacchia, Carmelina; Ercolini, Danilo; Moschetti, Giancarlo; Villani, Francesco


    Separation of amplified V3 region from 16S rDNA by denaturing gradient gel electrophoresis (PCR-DGGE) and 16S-23S rDNA intergenic spacer region polymorphism (ISR-PCR) analyses were tested as tool for differentiation of staphylococcal strains commonly isolated from fermented sausages. Variable V3 regions of 25 staphylococcal reference strains and 96 wild strains of species belonging to the genera Staphylococcus, Micrococcus and Kocuria were analyzed. PCR-DGGE profiles obtained were species-specific for S. sciuri, S. haemolyticus, S. hominis, S. auricularis, S. condimenti, S. kloosi, S. vitulus, S. succinus, S. pasteuri, S. capitis and S. (Macrococcus) caseolyticus. Moreover, 7 groups could be distinguished gathering the remaining species as result of the separation of the V3 rDNA amplicons in DGGE. Furthermore, the combination of the results obtained by PCR-DGGE and ISR-PCR analyses allowed a clear differentiation of all the staphylococcal species analysed, with exception of the pairs S. equorum-S. cohnii and S. carnosus-S. schleiferi. The suitability of both molecular techniques and of the combination their results for the identification of staphylococci was validated analysing partial nucleotide sequence of the 16S rDNA of a representative number of wild strains. PMID:14529185

  15. Complete structure of nuclear rDNA of the obligate plant parasite Plasmodiophora brassicae: intraspecific polymorphisms in the exon and group I intron of the large subunit rDNA.


    Niwa, Rieko; Kawahara, Ai; Murakami, Hiroharu; Tanaka, Shuhei; Ezawa, Tatsuhiro


    Plasmodiophora brassicae is a soil-borne obligate intracellular parasite in the phylum Cercozoa of the Rhizaria that causes clubroot disease of crucifer crops. To control the disease, understanding the distribution and infection routes of the pathogen is essential, and thus development of reliable molecular markers to discriminate geographic populations is required. In this study, the nuclear ribosomal RNA gene (rDNA) repeat unit of P. brassicae was determined, with particular emphasis on the structure of large subunit (LSU) rDNA, in which polymorphic regions were expected to be present. The complete rDNA complex was 9513bp long, which included the small subunit, 5.8S and LSU rDNAs as well as the internal transcribed spacer and intergenic spacer regions. Among eight field populations collected from throughout Honshu Island, Japan, a 1.1 kbp region of the LSU rDNA, including the divergent 8 domain, exhibited intraspecific polymorphisms that reflected geographic isolation of the populations. Two new group I introns were found in this region in six out of the eight populations, and the sequences also reflected their geographic isolation. The polymorphic region found in this study may have potential for the development of molecular markers for discrimination of field populations/isolates of this organism. PMID:21497131

  16. Discriminatory profile of rDNA sites and trend for acrocentric chromosome formation in the genus Trachinotus Lacépède, 1801 (Perciformes, Carangidae).


    Jacobina, Uedson Pereira; Vicari, Marcelo Ricardo; Bertollo, Luiz Antonio Carlos; Molina, Wagner Franco


    Chromosomal traits have provided valuable information for phylogeny and taxonomy of several fish groups. Three Atlantic Carangidae species of the genus Trachinotus Lacépède, 1801 (Trachinotus goodei Jordan et Evermann, 1896, Trachinotus carolinus (Linnaeus, 1766)and Trachinotus falcatus (Linnaeus, 1758)) were investigated, having 2n=48 chromosomes but different chromosomal arms (FN number), i.e., 52, 56 and 58, respectively, in view of the different number of two-armed chromosomes found in their karyotypes. Thus, Trachinotus goodei, Trachinotus carolinus and Trachinotus falcatus present a progressive distancefrom the probable basal karyotype proposed for Perciformes (2n=48 acrocentrics, FN=48). At first sight, these findings do not agree with the phylogenetic hypothesis based on mitochondrial sequences, where Trachinotus goodei appear as the most derived species, followed by Trachinotus falcatus and Trachinotus carolinus, respectively. However, the chromosomal mapping of ribosomal DNAs was informative for clarifying this apparent conflict. Indeed, the multiple 5S and 18S rDNA sites found in Trachinotus goodei corroborate the most derived condition for this species. In this sense, the occurrence of the unexpected number of two-armed chromosomes and FN value for this species, as well as for Trachinotus carolinus, must be due to additional rounds of acrocentric formation in these species, modifying the macrostructure of their karyotypes. PMID:24260676

  17. Discriminatory profile of rDNA sites and trend for acrocentric chromosome formation in the genus Trachinotus Lacépède, 1801 (Perciformes, Carangidae)

    PubMed Central

    Jacobina, Uedson Pereira; Vicari, Marcelo Ricardo; Bertollo, Luiz Antonio Carlos; Molina, Wagner Franco


    Abstract Chromosomal traits have provided valuable information for phylogeny and taxonomy of several fish groups. Three Atlantic Carangidae species of the genus Trachinotus Lacépède, 1801 (Trachinotus goodei Jordan et Evermann, 1896, Trachinotus carolinus (Linnaeus, 1766)and Trachinotus falcatus (Linnaeus, 1758)) were investigated, having 2n=48 chromosomes but different chromosomal arms (FN number), i.e., 52, 56 and 58, respectively, in view of the different number of two-armed chromosomes found in their karyotypes. Thus, Trachinotus goodei, Trachinotus carolinus and Trachinotus falcatus present a progressive distancefrom the probable basal karyotype proposed for Perciformes (2n=48 acrocentrics, FN=48). At first sight, these findings do not agree with the phylogenetic hypothesis based on mitochondrial sequences, where Trachinotus goodei appear as the most derived species, followed by Trachinotus falcatus and Trachinotus carolinus, respectively. However, the chromosomal mapping of ribosomal DNAs was informative for clarifying this apparent conflict. Indeed, the multiple 5S and 18S rDNA sites found in Trachinotus goodei corroborate the most derived condition for this species. In this sense, the occurrence of the unexpected number of two-armed chromosomes and FN value for this species, as well as for Trachinotus carolinus, must be due to additional rounds of acrocentric formation in these species, modifying the macrostructure of their karyotypes. PMID:24260676

  18. 18S rDNA dataset profiling microeukaryotic populations within Chicago area nearshore waters

    PubMed Central

    Searle, Daniel; Sible, Emily; Cooper, Alexandria; Putonti, Catherine


    Despite their critical role in the aquatic food web and nutrient cycling, microeukaryotes within freshwater environments are under-studied. Herein we present the first high-throughput molecular survey of microeukaryotes within Lake Michigan. Every two weeks from May 13 to August 5, 2014, we collected surface water samples from the nearshore waters of four Chicago area beaches: Gillson Park, Montrose Beach, 57th Street Beach, and Calumet Beach. Four biological replicates were collected for each sampling date and location, resulting in 112 samples. Eighty-nine of these samples were surveyed through targeted sequencing of the V7 and V8 regions of the 18S rDNA gene. Both technical and biological replicates were sequenced and are included in this dataset. Raw sequence data is available via NCBI’s SRA database (BioProject PRJNA294919). PMID:26904716

  19. 18S rDNA dataset profiling microeukaryotic populations within Chicago area nearshore waters.


    Searle, Daniel; Sible, Emily; Cooper, Alexandria; Putonti, Catherine


    Despite their critical role in the aquatic food web and nutrient cycling, microeukaryotes within freshwater environments are under-studied. Herein we present the first high-throughput molecular survey of microeukaryotes within Lake Michigan. Every two weeks from May 13 to August 5, 2014, we collected surface water samples from the nearshore waters of four Chicago area beaches: Gillson Park, Montrose Beach, 57th Street Beach, and Calumet Beach. Four biological replicates were collected for each sampling date and location, resulting in 112 samples. Eighty-nine of these samples were surveyed through targeted sequencing of the V7 and V8 regions of the 18S rDNA gene. Both technical and biological replicates were sequenced and are included in this dataset. Raw sequence data is available via NCBI's SRA database (BioProject PRJNA294919). PMID:26904716

  20. Building a model: developing genomic resources for common milkweed (Asclepias syriaca) with low coverage genome sequencing

    PubMed Central


    Background Milkweeds (Asclepias L.) have been extensively investigated in diverse areas of evolutionary biology and ecology; however, there are few genetic resources available to facilitate and compliment these studies. This study explored how low coverage genome sequencing of the common milkweed (Asclepias syriaca L.) could be useful in characterizing the genome of a plant without prior genomic information and for development of genomic resources as a step toward further developing A. syriaca as a model in ecology and evolution. Results A 0.5× genome of A. syriaca was produced using Illumina sequencing. A virtually complete chloroplast genome of 158,598 bp was assembled, revealing few repeats and loss of three genes: accD, clpP, and ycf1. A nearly complete rDNA cistron (18S-5.8S-26S; 7,541 bp) and 5S rDNA (120 bp) sequence were obtained. Assessment of polymorphism revealed that the rDNA cistron and 5S rDNA had 0.3% and 26.7% polymorphic sites, respectively. A partial mitochondrial genome sequence (130,764 bp), with identical gene content to tobacco, was also assembled. An initial characterization of repeat content indicated that Ty1/copia-like retroelements are the most common repeat type in the milkweed genome. At least one A. syriaca microread hit 88% of Catharanthus roseus (Apocynaceae) unigenes (median coverage of 0.29×) and 66% of single copy orthologs (COSII) in asterids (median coverage of 0.14×). From this partial characterization of the A. syriaca genome, markers for population genetics (microsatellites) and phylogenetics (low-copy nuclear genes) studies were developed. Conclusions The results highlight the promise of next generation sequencing for development of genomic resources for any organism. Low coverage genome sequencing allows characterization of the high copy fraction of the genome and exploration of the low copy fraction of the genome, which facilitate the development of molecular tools for further study of a target species and its relatives

  1. Sharp switches between regular and swinger mitochondrial replication: 16S rDNA systematically exchanging nucleotides A<->T+C<->G in the mitogenome of Kamimuria wangi.


    Seligmann, Hervé


    Swinger DNAs are sequences whose homology with known sequences is detected only by assuming systematic exchanges between nucleotides. Nine symmetric (X<->Y, i.e. A<->C) and fourteen asymmetric (X->Y->Z, i.e. A->C->G) exchanges exist. All swinger DNA previously detected in GenBank follow the A<->T+C<->G exchange, while mitochondrial swinger RNAs distribute among different swinger types. Here different alignment criteria detect 87 additional swinger mitochondrial DNAs (86 from insects), including the first swinger gene embedded within a complete genome, corresponding to the mitochondrial 16S rDNA of the stonefly Kamimuria wangi. Other Kamimuria mt genome regions are "regular", stressing unanswered questions on (a) swinger polymerization regulation; (b) swinger 16S rDNA functions; and (c) specificity to rDNA, in particular 16S rDNA. Sharp switches between regular and swinger replication, together with previous observations on swinger transcription, suggest that swinger replication might be due to a switch in polymerization mode of regular polymerases and the possibility of swinger-encoded information, predicted in primordial genes such as rDNA. PMID:25865623

  2. Molecular characterization of Stictodora tridactyla (Trematoda: Heterophyidae) from Kuwait Bay using rDNA ITS and mtCO1.


    Al-Kandari, Wafa Y; Alnaqeeb, Majed A; Isaac, Asha M; Al-Bustan, Suzanne A


    Stictodora tridactyla is an intestinal fluke in the family Heterophyidae that parasitizes shorebirds and mammals, including humans. Its metacercarial cyst stage was reported in the Arabian killifish, Aphanius dispar, at Kuwait Bay. In the present study, Cerithidea cingulata was found to serve as the first intermediate host of S. tridactyla. In order to establish the snail-fish link in the life cycle of S. tridactyla, complete sequences of ribosomal DNA internal transcribed spacer region 1 and 2 (rDNA ITS1 and ITS2) and partial sequence of cytochrome oxidase subunit 1 were obtained for metacercarial cysts isolated from the fish A. dispar and rediae isolated from the snail C. cingulata. Sequence alignment demonstrated that these larval stages belong to the same heterophyid species, S. tridactyla. Phylogenetic analysis based on rDNA ITS1, ITS2, and mtCO1 confirmed the position of S. tridactyla within the Heterophyidae and found it to cluster with Haplorchis spp. The present study represents the first molecular study correlating the larval stages of S. tridactyla using rDNA ITS1, ITS2, and mtCO1 and examining the phylogenetic relationships of S. tridactyla with different heterophyid species. PMID:26268569

  3. Physical localisation of repetitive DNA sequences in Alstroemeria: karyotyping of two species with species-specific and ribosomal DNA.


    Kamstra, S A; Kuipers, A G; De Jeu, M J; Ramanna, M S; Jacobsen, E


    Fluorescence in situ hybridization (FISH) was used to localise two species-specific repetitive DNA sequences, A001-I and D32-13, and two highly conserved 25S and 5S rDNA sequences on the metaphase chromosomes of two species of Alstroemeria. The Chilean species, Alstroemeria aurea (2n = 16), has abundant constitutive heterochromatin, whereas the Brazilian species, Alstroemeria inodora, has hardly any heterochromatin. The A. aurea specific A001-I probe hybridized specifically to the C-band regions on all chromosomes. The FISH patterns on A. inodora chromosomes using species-specific probe D32-13 resembled the C-banding pattern and the A001-I pattern on A. aurea chromosomes. There were notable differences in number and distribution of rDNA sites between the two species. The 25S rDNA probe revealed 16 sites in A. aurea that closely colocalised with A001-I sites and 12 in A. inodora that were predominantly detected in the centromeric regions. FISH karyotypes of the two Alstroemeria species were constructed accordingly, enabling full identification of all individual chromosomes. These FISH karyotypes will be useful for monitoring the chromosomes of both Alstroemeria species in hybrids and backcross derivatives. PMID:9352644

  4. [Rapid detection of Pseudomonas aeruginosa by the fluorescence quantitative PCR assay targeting 16S rDNA].


    Xue, Li-Jun; Wang, Yong-Zhi; Ren, Hao; Tong, Yi-Min; Zhao, Ping; Zhu, Shi-Ying; Qi, Zhong-Tian


    The 16S rDNA specific primers were designed for rapid detection of Pseudomonas aeruginosa (PA) by the fluorescence quantitative PCR (FQ-PCR) assay, based upon multiple sequence alignment and phylogenetic tree analysis of the 16S rDNAs of over 20 bacteria. After extraction of PA genomic DNA, the target 16S rDNA fragment was amplified by PCR with specific primers, and used to construct recombinant pMDT-Pfr plasmid, the dilution gradients of which were subjected to the standard quantitation curve in FQ-PCR assay. Different concentrations of PA genomic DNA were detected by FQ-PCR in a 20microL of reaction system with SYBR Green I. At the same time, various genomic DNAs of Staphylococcus aureus, Salmonella typhi, Shigella flexneri, Proteus vulgaris, Staphylococcus epidermidis, Escherichia coli, and Mycobacterium tuberculosis were used as negative controls to confirm specificity of the FQ-PCR detection assay. Results demonstrated that the predicted amplified product of designed primers was of high homology only with PA 16S rDNA, and that sensitivity of the FQ-PCR assay was of 3.6pg/microL of bacterial DNA or (2.1 x 10(3) +/- 3.1 x 10(2)) copies/microL of 16S rDNA, accompanied with high specificity, and that the whole detection process including DNA extraction could be completed in about two hours. In contrast to traditional culture method, the FQ-PCR assay targeting 16S rDNA gene can be used to detect PA rapidly, which exhibits perfect application prospect in future. PMID:17037203

  5. Physical mapping of 5S and 18S-5.8S-26S RNA gene families in polyploid series of Cenchrus ciliaris Linnaeus, 1771 (Poaceae)

    PubMed Central

    Kharrat-Souissi, Amina; Siljak-Yakovlev, Sonja; Pustahija, Fatima; Chaieb, Mohamed


    Abstract The Buffelgrass (Cenchrus ciliaris L., Poaceae) is one of the most important pasturage grasses due to its high productivity and good forage qualities. This species possess a high adaptability to bioclimatic constraints of arid zones and may be used for the restoration of degraded arid ecosystems. Tunisian populations present three ploidy levels (4x, 5x and 6x) with a basic chromosome number x=9. This study reported for the first time the distribution of the ribosomal genes (rRNA) for pentaploid and hexaploid cytotypes of Cenchrus ciliaris. Molecular cytogenetic study using double fluorescence in situ hybridization has shown that the two rDNA families, 5S and 18S-5.8S-26S (18S), displayed intraspecific variation in number of loci among different ploidy levels. Each ploidy level was characterized by specific number of both 5S and 18S rDNA loci (two loci in tetraploid, five in pentaploid and six in hexaploid level). For three studied cytotypes (4x, 5x and 6x) all 5S rDNA loci were localized on the subcentromeric region of chromosomes, while 18S loci were situated on the telomeric region of short chromosome arms. Data of the FISH experiments show proportional increase of ribosomal loci number during polyploidization processes. PMID:24260668

  6. Freshwater Perkinsea and marine-freshwater colonizations revealed by pyrosequencing and phylogeny of environmental rDNA.


    Bråte, Jon; Logares, Ramiro; Berney, Cédric; Ree, Dan Kristofer; Klaveness, Dag; Jakobsen, Kjetill S; Shalchian-Tabrizi, Kamran


    Protist parasites are ecologically important, as they can have great impact on host population dynamics and functioning of entire ecosystems. Nevertheless, little is known about their prevalence in aquatic habitats. Here, we investigate the diversity and distributional patterns of the protist parasites Perkinsus and Parvilucifera (Perkinsea). Our approach included 454 pyrosequencing of the 18S rDNA gene obtained from a high-altitude lake (Lake Finsevatn, Norway) and phylogenetic analyses of all publicly available sequences related to Perkinsea. The applied PCR primers target a 450 bp region that encompass the variable V4 region of the 18S rDNA gene and have been optimized for the Titanium upgrade of the 454 technology. Nearly 5000 sequences longer than 150 bp were recovered from nearly all eukaryotic supergroups, and of those, 13 unique sequences were affiliated to Perkinsea. Thus, our new strategy for 454 amplicon sequencing was able to recover a large diversity of distantly related eukaryotes and previously unknown species of Perkinsea. In addition, we identified 40 Perkinsea sequences in GenBank generated by other recent diversity surveys. Importantly, phylogenetic analyses of these sequences identified 17 habitat-specific marine and freshwater clades (PERK 1-17). Hence, only a few successful transitions between these habitats have taken place over the entire history of Perkinsea, suggesting that the boundary between marine and fresh waters may constitute a barrier to cross-colonizations for intracellular parasites. PMID:20393574

  7. Variability of 18rDNA loci in four lace bug species (Hemiptera, Tingidae) with the same chromosome number

    PubMed Central

    Golub, Natalia V.; Golub, Viktor B.; Kuznetsova, Valentina G.


    Abstract Male karyotypes of Elasmotropis testacea (Herrich-Schaeffer, 1835), Tingis cardui (Linnaeus, 1758), Tingis crispata (Herrich-Schaeffer, 1838), and Agramma femorale Thomson, 1871 (Heteroptera, Cimicomorpha, Tingidae) were analyzed using conventional chromosome staining and FISH with 18S rDNA and (TTAGG)n telomeric probes. The FISH technique was applied for the first time in the Tingidae. In spite of the fact that all species showed the same chromosome number (2n = 12 + XY), they have significant differences in the number and position of rDNA loci. FISH with the classical insect (TTAGG)n probe produced no signals on chromosomes suggesting telomeres in lace bugs to be of some other molecular composition. Tingidae share absence of the (TTAGG)n telomeric sequence with all so far studied taxa of the advanced true bug infraorders Cimicomorpha and Pentatomomorpha. PMID:26753071

  8. Randomly Detected Genetically Modified (GM) Maize (Zea mays L.) near a Transport Route Revealed a Fragile 45S rDNA Phenotype

    PubMed Central

    Waminal, Nomar Espinosa; Ryu, Ki Hyun; Choi, Sun-Hee; Kim, Hyun Hee


    Monitoring of genetically modified (GM) crops has been emphasized to prevent their potential effects on the environment and human health. Monitoring of the inadvertent dispersal of transgenic maize in several fields and transport routes in Korea was carried out by qualitative multiplex PCR, and molecular analyses were conducted to identify the events of the collected GM maize. Cytogenetic investigations through fluorescence in situ hybridization (FISH) of the GM maize were performed to check for possible changes in the 45S rDNA cluster because this cluster was reported to be sensitive to replication and transcription stress. Three GM maize kernels were collected from a transport route near Incheon port, Korea, and each was found to contain NK603, stacked MON863 x NK603, and stacked NK603 x MON810 inserts, respectively. Cytogenetic analysis of the GM maize containing the stacked NK603 x MON810 insert revealed two normal compact 5S rDNA signals, but the 45S rDNA showed a fragile phenotype, demonstrating a “beads-on-a-string” fragmentation pattern, which seems to be a consequence of genetic modification. Implications of the 45S rDNA cluster fragility in GM maize are also discussed. PMID:24040165


    EPA Science Inventory

    Phylogenetic divergence among sulfate-reducing bacteria in an estuarine sediment sample was investigated by PCR amplification and comparison of partial 16S rDNA sequences. wenty unique 16S RDNA sequences were found, 12 from delta subclass bacteria based on overall sequence simila...

  10. Chromosomal organization of the 18S and 5S rRNAs and histone H3 genes in Scarabaeinae coleopterans: insights into the evolutionary dynamics of multigene families and heterochromatin

    PubMed Central


    Background Scarabaeinae beetles show a high level of macro-chromosomal variability, although the karyotypic organization of heterochromatin and multigene families (rDNAs and histone genes) is poorly understood in this group. To better understand the chromosomal organization and evolution in this group, we analyzed the karyotypes, heterochromatin distribution and chromosomal locations of the rRNAs and histone H3 genes in beetles belonging to eight tribes from the Scarabaeinae subfamily (Coleoptera, Scarabaeidae). Results The number of 18S rRNA gene (a member of the 45S rDNA unit) sites varied from one to 16 and were located on the autosomes, sex chromosomes or both, although two clusters were most common. Comparison of the 45S rDNA cluster number and the diploid numbers revealed a low correlation value. However, a comparison between the number of 45S rDNA sites per genome and the quantity of heterochromatin revealed (i) species presenting heterochromatin restricted to the centromeric/pericentromeric region that contained few rDNA sites and (ii) species with a high quantity of heterochromatin and a higher number of rDNA sites. In contrast to the high variability for heterochromatin and 45S rDNA cluster, the presence of two clusters (one bivalent cluster) co-located on autosomal chromosomes with the 5S rRNA and histone H3 genes was highly conserved. Conclusions Our results indicate that the variability of the 45S rDNA chromosomal clusters is not associated with macro-chromosomal rearrangements but are instead related to the spread of heterochromatin. The data obtained also indicate that both heterochromatin and the 45S rDNA loci could be constrained by similar evolutionary forces regulating spreading in the distinct Scarabaeinae subfamily lineages. For the 5S rRNA and the histone H3 genes, a similar chromosomal organization could be attributed to their association/co-localization in the Scarabaeinae karyotypes. These data provide evidence that different evolutionary

  11. Introduction of a novel 18S rDNA gene arrangement along with distinct ITS region in the saline water microalga Dunaliella

    PubMed Central


    Comparison of 18S rDNA gene sequences is a very promising method for identification and classification of living organisms. Molecular identification and discrimination of different Dunaliella species were carried out based on the size of 18S rDNA gene and, number and position of introns in the gene. Three types of 18S rDNA structure have already been reported: the gene with a size of ~1770 bp lacking any intron, with a size of ~2170 bp consisting one intron near 5' terminus, and with a size of ~2570 bp harbouring two introns near 5' and 3' termini. Hereby, we report a new 18S rDNA gene arrangement in terms of intron localization and nucleotide sequence in a Dunaliella isolated from Iranian salt lakes (ABRIINW-M1/2). PCR amplification with genus-specific primers resulted in production of a ~2170 bp DNA band, which is similar to that of D. salina 18S rDNA gene containing only one intron near 5' terminus. Whilst, sequence composition of the gene revealed the lack of any intron near 5' terminus in our isolate. Furthermore, another alteration was observed due to the presence of a 440 bp DNA fragment near 3' terminus. Accordingly, 18S rDNA gene of the isolate is clearly different from those of D. salina and any other Dunaliella species reported so far. Moreover, analysis of ITS region sequence showed the diversity of this region compared to the previously reported species. 18S rDNA and ITS sequences of our isolate were submitted with accesion numbers of EU678868 and EU927373 in NCBI database, respectively. The optimum growth rate of this isolate occured at the salinity level of 1 M NaCl. The maximum carotenoid content under stress condition of intense light (400 μmol photon m-2 s-1), high salinity (4 M NaCl) and deficiency of nitrate and phosphate nutritions reached to 240 ng/cell after 15 days. PMID:20377865

  12. Conserved Organisation of 45S rDNA Sites and rDNA Gene Copy Number among Major Clades of Early Land Plants.


    Rosato, Marcela; Kovařík, Aleš; Garilleti, Ricardo; Rosselló, Josep A


    Genes encoding ribosomal RNA (rDNA) are universal key constituents of eukaryotic genomes, and the nuclear genome harbours hundreds to several thousand copies of each species. Knowledge about the number of rDNA loci and gene copy number provides information for comparative studies of organismal and molecular evolution at various phylogenetic levels. With the exception of seed plants, the range of 45S rDNA locus (encoding 18S, 5.8S and 26S rRNA) and gene copy number variation within key evolutionary plant groups is largely unknown. This is especially true for the three earliest land plant lineages Marchantiophyta (liverworts), Bryophyta (mosses), and Anthocerotophyta (hornworts). In this work, we report the extent of rDNA variation in early land plants, assessing the number of 45S rDNA loci and gene copy number in 106 species and 25 species, respectively, of mosses, liverworts and hornworts. Unexpectedly, the results show a narrow range of ribosomal locus variation (one or two 45S rDNA loci) and gene copies not present in vascular plant lineages, where a wide spectrum is recorded. Mutation analysis of whole genomic reads showed higher (3-fold) intragenomic heterogeneity of Marchantia polymorpha (Marchantiophyta) rDNA compared to Physcomitrella patens (Bryophyta) and two angiosperms (Arabidopsis thaliana and Nicotiana tomentosifomis) suggesting the presence of rDNA pseudogenes in its genome. No association between phylogenetic position, taxonomic adscription and the number of rDNA loci and gene copy number was found. Our results suggest a likely evolutionary rDNA stasis during land colonisation and diversification across 480 myr of bryophyte evolution. We hypothesise that strong selection forces may be acting against ribosomal gene locus amplification. Despite showing a predominant haploid phase and infrequent meiosis, overall rDNA homogeneity is not severely compromised in bryophytes. PMID:27622766

  13. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.


    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  14. Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

    PubMed Central

    Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B


    A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

  15. 4.5S ribonucleic acid, a novel ribosome component in the chloroplasts of flowering plants.

    PubMed Central

    Bowman, C M; Dyer, T A


    A species of low-molecular-weight ribosomal RNA, referred to as '4.5S rRNA', was found in addition to 5S rRNA in the large subunit of chloroplast ribosomes of a wide range of flowering plants. It was shown by sequence analysis that several variants of this RNA may occur in a plant. Furthermore, although in most flowering plants the predominant variant contains about 100 nucleotides, in the broad bean it has less than 80. It seems, therefore, to be much more diverse in size and sequence than the other ribosomal RNA species. Like 5S rRNA , it does not contain modified nucleotides and it is also unusual in having an unphosphorylated 5'-end. It is apparently neither a homologue of cytosol 5.8S rRNA nor a fragment of 23S rRNA. Images Fig. 1. Fig. 3. Fig. 4. PMID:540035

  16. Telonemia-specific environmental 18S rDNA PCR reveals unknown diversity and multiple marine-freshwater colonizations

    PubMed Central


    Background Recent surveys of eukaryote 18S rDNA diversity in marine habitats have uncovered worldwide distribution of the heterotrophic eukaryote phylum Telonemia. Here we investigate the diversity and geographic distribution of Telonemia sequences by in-depth sequencing of several new 18S rDNA clone libraries from both marine and freshwater sites by using a Telonemia-specific PCR strategy. Results In contrast to earlier studies that have employed eukaryote-wide PCR design, we identified a large and unknown diversity of phylotypes and the first rigorous evidence for several freshwater species, altogether comprising 91 unique sequences. Phylogenies of these and publicly available sequences showed 20 statistically supported sub-clades as well as several solitary phylotypes with no clear phylogenetic affiliation. Most of these sub-clades were composed of phylotypes from different geographic regions. Conclusions By using specific PCR primers we reveal a much larger diversity of Telonemia from environmental samples than previously uncovered by eukaryote-wide primers. The new data substantially diminish the geographic structuring of clades identified in earlier studies. Nevertheless, since these clades comprise several distinct phylotypes we cannot exclude endemicity at species level. We identified two freshwater clades and a few solitary phylotypes, implying that Telonemia have colonized freshwater habitats and adapted to the different environmental and ecological conditions at independent occasions. PMID:20534135

  17. Species markers for equine strongyles detected in intergenic rDNA by PCR-RFLP.


    Gasser, R B; Stevenson, L A; Chilton, N B; Nansen, P; Bucknell, D G; Beveridge, I


    Five species of equine strongyle belonging to the subfamily Strongylinae (Strongylus edentatus, S. equinus, S. vulgaris, Oesophagodontus robustus and Triodontophorus serratus) and 11 species belonging to the subfamily Cyathostominae (Poteriostomum imparidentatum, P. ratzii, Cylicocyclus insignis, Cc. leptostomus, Cc. nassatus, Cylicostephanus calicatus, Cs. longibursatus, Cs. goldi, Cyathostomum catinatum, Cy. labiatum and Cy. pateratum) were characterized using a polymerase chain reaction-linked restriction fragment length polymorphism technique (PCR-RFLP). Internal transcribed spacer ribosomal DNA was amplified from genomic DNA by polymerase chain reaction (PCR) using conserved primers, digested separately with six restriction endonucleases (AluI, BfaI, CfoI, Hae III, VSpI and XbaI) and the fragments separated by agarose gel electrophoresis. The PCR products of the three Strongylus species were approx. 90-100 bp smaller in size compared with those of the other 13 species. The PCR-RFLP analysis of the rDNA region spanning the first and second internal transcribed spacers plus the 5.85 rDNA gene (ITS+) produced characteristic patterns for each of the 16 species examined, and no variation in RFLP patterns was detected within the species Cy. catinatum, where multiple isolates were analysed. The study demonstrates that the internal transcribed spacer sequences provide genetic markers for the species identification of a range of equine strongyles. These markers will be of use for the identification of egg and larval stages, where morphological characters alone are unreliable. The results also indicate that the spacer sequences will be of use to study the systematics of equine strongyles. PMID:8910892

  18. Characterization of bacterial diversity in pulque, a traditional Mexican alcoholic fermented beverage, as determined by 16S rDNA analysis.


    Escalante, Adelfo; Rodríguez, María Elena; Martínez, Alfredo; López-Munguía, Agustín; Bolívar, Francisco; Gosset, Guillermo


    The bacterial diversity in pulque, a traditional Mexican alcoholic fermented beverage, was studied in 16S rDNA clone libraries from three pulque samples. Sequenced clones identified as Lactobacillus acidophilus, Lactobacillus strain ASF360, L. kefir, L. acetotolerans, L. hilgardii, L. plantarum, Leuconostoc pseudomesenteroides, Microbacterium arborescens, Flavobacterium johnsoniae, Acetobacter pomorium, Gluconobacter oxydans, and Hafnia alvei, were detected for the first time in pulque. Identity of 16S rDNA sequenced clones showed that bacterial diversity present among pulque samples is dominated by Lactobacillus species (80.97%). Seventy-eight clones exhibited less than 95% of relatedness to NCBI database sequences, which may indicate the presence of new species in pulque samples. PMID:15183874

  19. Mouse Oocytes Transcribe Injected Xenopus 5S RNA Gene

    PubMed Central

    Brinster, Ralph L.; Chen, Howard Y.; Trumbauer, Myrna E.


    Transcripts produced after injection of the Xenopus 5S RNA gene into oocyte germinal vesicles of mice migrate electrophoretically with the 5S RNA marker, an indication that the gene is transcribed and processed with considerable accuracy, Approximately two 5S RNA molecules are transcribed per gene per hour. This system may be useful in studying DNA processing and gene regulation by the mammalian ovum and might be modified to allow permanent incorporation of specific genes into mice. PMID:7194505

  20. Molecular systematics of the genus Troglophilus (Rhaphidophoridae, Orthoptera) in Turkey: mitochondrial 16S rDNA evidences

    PubMed Central

    Taylan, Mehmet Sait; Russo, Claudio Di; Rampini, Mauro; Ketmaier, Valerio


    Abstract This study focuses on the evolutionary relationships among Turkish species of the cave cricket genus Troglophilus.Fifteen populations were studied for sequence variation in a fragment (543 base pairs) of the mitochondrial DNA (mtDNA) 16S rDNA gene (16S) to reconstruct their phylogenetic relationships and biogeographic history. Genetic data retrieved three main clades and at least three divergent lineages that could not be attributed to any of the taxa known for the area. Molecular time estimates suggest that the diversification of the group took place between the Messinian and the Plio-Pleistocene. PMID:23653493

  1. 16S and 23S plastid rDNA phylogenies of Prototheca species and their auxanographic phenotypes1

    PubMed Central

    Ewing, Aren; Brubaker, Shane; Somanchi, Aravind; Yu, Esther; Rudenko, George; Reyes, Nina; Espina, Karen; Grossman, Arthur; Franklin, Scott


    Because algae have become more accepted as sources of human nutrition, phylogenetic analysis can help resolve the taxonomy of taxa that have not been well studied. This can help establish algal evolutionary relationships. Here, we compare Auxenochlorella protothecoides and 23 strains of Prototheca based on their complete 16S and partial 23S plastid rDNA sequences along with nutrient utilization (auxanographic) profiles. These data demonstrate that some of the species groupings are not in agreement with the molecular phylogenetic analyses and that auxanographic profiles are poor predictors of phylogenetic relationships. PMID:25937672

  2. Identification of a potential fungal species by 18S rDNA for ligninases production.


    Ferhan, M; Santos, S N; Melo, I S; Yan, N; Sain, M


    Fungal species for ligninases production was investigated by 18S ribosomal DNA sequence analysis. Two primer sets were chosen to amplify a major part of the 18S rDNA, which resulted in intense PCR product of approximately 550-820 bp in size per sample. The results suggest that the 18S rDNA-based approach is a useful tool for identification of unknown potential fungal species for ligninases production. The isolated fungal species produces mainly manganese peroxidase (MnP). The enzyme oxidized a variety of the usual MnP substrates, including lignin related polyphenols. Time course studies showed that maximum production of ligninolytic enzymes MnP (64 IU L⁻¹), lignin peroxidase (26.35 IU L⁻¹), and laccase (5.44 IU L⁻¹), respectively, were achieved after 10 days of cultivation under optimum conditions. Furthermore, the biological decolorization of Remazol Brilliant Blue R dye following 10 days of cultivation was 94 %. NCBI BLAST was used to search for closest matched sequences in the GenBank database and based on sequence homology the first BLAST hit was Dothioraceae sp. LM572 with accession number EF060858.1. PMID:23744034

  3. Nucleolin: dual roles in rDNA chromatin transcription.


    Durut, Nathalie; Sáez-Vásquez, Julio


    Nucleolin is a major nucleolar protein conserved in all eukaryotic organisms. It is a multifunctional protein involved in different cellular aspects like chromatin organization and stability, DNA and RNA metabolism, assembly of ribonucleoprotein complexes, cytokinesis, cell proliferation and stress response. The multifunctionality of nucleolin is linked to its tripartite structure, post-translational modifications and its ability of shuttling from and to the nucleolus/nucleoplasm and cytoplasm. Nucleolin has been now studied for many years and its activities and properties have been described in a number of excellent reviews. Here, we overview the role of nucleolin in RNA polymerase I (RNAPI) transcription and describe recent results concerning its functional interaction with rDNA chromatin organization. For a long time, nucleolin has been associated with rRNA gene expression and pre-rRNA processing. However, the functional connection between nucleolin and active versus inactive rRNA genes is still not fully understood. Novel evidence indicates that the nucleolin protein might be required for controlling the transcriptional ON/OFF states of rDNA chromatin in both mammals and plants. PMID:25225127

  4. Molecular rDNA phylogeny of Telotylenchidae Siddiqi, 1960 and evaluation of tail termini

    PubMed Central

    Carta, L. K.; Skantar, A. M.; Handoo, Z. A.


    Three stunt nematode species, Tylenchorhynchus leviterminalis, T. dubius and T. claytoni were characterized with segments of small subunit 18S and large subunit 28S rDNA sequence and placed in molecular phylogenetic context with other polyphyletic taxa of Telotylenchidae. Based upon comparably sized phylogenetic breadth of outgroups and ingroups, the 28S rDNA contained three times the number of phylogenetically informative alignment characters relative to the alignment total compared to the larger 18S dataset even though there were fewer than half the number of taxa represented. Tail shapes and hyaline termini were characterized for taxa within these subfamily trees, and variability discussed for some related species. In 18S trees, similar terminal tail thickness was found in a well-supported clade of three Tylenchorhynchus: broad-tailed T. leviterminalis branched outside relatively narrow-tailed T. claytoni and T. nudus. Terminal tail thickness within Merliniinae, Telotylenchinae and related taxa showed a mosaic distribution. Thick-tailed Trophurus, Macrotrophurus and putative Paratrophurus did not group together in the 18S tree. Extremely thickened tail termini arose at least once in Amplimerlinius and Pratylenchoides among ten species of Merliniinae plus three Pratylenchoides, and three times within twelve taxa of Telotylenchinae and Trophurinae. Conflicting generic and family nomenclature based on characters such as pharyngeal overlap are discussed in light of current molecular phylogeny. Contrary to some expectations from current taxonomy, Telotylenchus and Tylenchorhynchus cf. robustus did not cluster with three Tylenchorhynchus spp. Two putative species of Neodolichorhynchus failed to group together, and two populations of Scutylenchus quadrifer demonstrated as much or greater genetic distance between them than among three related species of Merlinius. PMID:22736870

  5. 5SRNAdb: an information resource for 5S ribosomal RNAs.


    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M


    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb ( is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  6. 5SRNAdb: an information resource for 5S ribosomal RNAs

    PubMed Central

    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A.; Karlowski, Wojciech M.


    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA–protein interactions and molecular phylogeny. 5SRNAdb ( is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  7. [Investigation of bacterial diversity in the biological desulfurization reactor for treating high salinity wastewater by the 16S rDNA cloning method].


    Liu, Wei-Guo; Liang, Cun-Zhen; Yang, Jin-Sheng; Wang, Gui-Ping; Liu, Miao-Miao


    The bacterial diversity in the biological desulfurization reactor operated continuously for 1 year was studied by the 16S rDNA cloning and sequencing method. Forty clones were randomly selected and their partial 16S rDNA genes (ca. 1,400 bp) were sequenced and blasted. The results indicated that there were dominant bacterias in the biological desulfurization reactor, where 33 clones belonged to 3 different published phyla, while 1 clone belonged to unknown phylum. The dominant bacterial community in the system was Proteobacteria, which accounted for 85.3%. The bacterial community succession was as follows: the gamma-Proteobacteria(55.9%), beta-Proteobacteria(17.6%), Actinobacteridae (8.8%), delta-Proteobacteria (5.9%) , alpha-Proteobacteria(5.9%), and Sphingobacteria (2.9%). Halothiobacillus sp. ST15 and Thiobacillus sp. UAM-I were the major desulfurization strains. PMID:23668153

  8. Development of a mitochondrial 12S rDNA analysis for distinguishing Sciuridae species with potential to transmit Ehrlichia and Borrelia species to feeding Amblyomma americanum (Acari: Ixodidae).


    Goessling, Lisa S; Allan, Brian F; Mandelbaum, Rachel S; Thach, Robert E


    Unique oligonucleotide probes were synthesized to distinguish among closely related vertebrate mitochondrial rDNA sequences present in residual bloodmeals in emergent Amblyomma americanum (L.) (Acari: Ixodidae) nymph life-stage ticks. Use of these probes enabled the identification of the Eastern gray squirrel as an important bloodmeal source in nymphs harboring Ehrlichia and Borrelia species. These results were confirmed by identifying these same bacterial genera in Eastern gray squirrel tissues. PMID:22679888

  9. Encephalitozoon cuniculi (Microspora) genome: physical map and evidence for telomere-associated rDNA units on all chromosomes

    PubMed Central

    Brugère, Jean-François; Cornillot, Emmanuel; Méténier, Guy; Bensimon, Aaron; Vivarès, Christian P.


    A restriction map of the 2.8-Mb genome of the unicellular eukaryote Encephalitozoon cuniculi (phylum Microspora), a mammal-infecting intracellular parasite, has been constructed using two restriction enzymes with 6 bp recognition sites (BssHII and MluI). The fragments resulting from either single digestions of the whole molecular karyotype or double digestions of 11 individual chromosomes have been separated by two-dimensional pulsed field gel electrophoresis (2D-PFGE) procedures. The average distance between successive restriction sites is ~19 kb. The terminal regions of the chromosomes show a common pattern covering ~15 kb and including one 16S–23S rDNA unit. Results of hybridisation and molecular combing experiments indicate a palindromic-like orientation of the two subtelomeric rDNA copies on each chromosome. We have also located 67 DNA markers (clones from a partial E.cuniculi genomic library) by hybridisation to restriction fragments. Partial or complete sequencing has revealed homologies with known protein-coding genes for 32 of these clones. Evidence for two homologous chromosomes III, with a size difference (3 kb) related to a subtelomeric deletion/insertion event, argues for diploidy of E.cuniculi. The physical map should be useful for both the whole genome sequencing project and studies on genome plasticity of this widespread parasite. PMID:10773069

  10. Identification of Thiobacillus ferrooxidans strains based on restriction fragment length polymorphism analysis of 16S rDNA.


    Kamimura, K; Wakai, S; Sugio, T


    The 16S rDNA sequences from ten strains of Thiobacillus ferrooxidans were amplified by PCR. The products were compared by performing restriction fragment length polymorphism (RFLP) analysis with restriction endonucleases Alu I, Hap II, Hha I, and Hae III. The RFLP patterns revealed that T. ferrooxidans could be distinguished from other iron- or sulphur-oxidizing bacteria such as T. thiooxidans NB1-3, T. caldus GO-1, Leptospirillum ferrooxidans and the marine iron-oxidizing bacterium strain KU2-11. The RFLP patterns obtained with Alu I, Hap II, and Hae III were the same for nine strains of T. ferrooxidans except for strain ATCC 13661. The RFLP patterns for strains NASF-1 and ATCC 13661 with Hha I were distinct from those for other T. ferrooxidans strains. The 16S rDNA sequence of T. ferrooxidans NASF-1 possessed an additional restriction site for Hha I. These results show that iron-oxidizing bacteria isolated from natural environments were rapidly identified as T. ferrooxidans by the method combining RFLP analysis with physiological analysis. PMID:11414499

  11. Genus-specific profile of acetic acid bacteria by 16S rDNA PCR-DGGE.


    De Vero, Luciana; Giudici, Paolo


    An effective method for grouping acetic acid bacteria (AAB) genera was defined and evaluated as a tool for preliminary screening of the major AAB species involved in vinegar production. Acetobacter, Gluconobacter, Gluconacetobacter, Asaia, Neoasaia, Saccharibacter, Frateuria and Kozakia AAB strains were screened on the basis of the 16S rDNA sequences using polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) technique. The DGGE profile of all the strains tested, consisted of one single band of approximately 330 bp for each strain and allowed their clustering. The results obtained clearly reflected in silico phylogenetic analysis of the AAB species used in this study, in fact, the species with a higher 16S rDNA sequence homology showed a similar electrophoretic profile. In particular almost all the species belonging to the genus Gluconacetobacter showed a DGGE pattern nearly identical and well distinct from all the other AAB genera. Furthermore by PCR-DGGE it was possible to clearly group the species more frequently recovered from vinegar fermentation which are mainly distributed in the genera Acetobacter, Gluconobacter and Gluconacetobacter. PMID:17919758

  12. Analysis of the unexplored features of rrs (16S rDNA) of the Genus Clostridium

    PubMed Central


    Background Bacterial taxonomy and phylogeny based on rrs (16S rDNA) sequencing is being vigorously pursued. In fact, it has been stated that novel biological findings are driven by comparison and integration of massive data sets. In spite of a large reservoir of rrs sequencing data of 1,237,963 entries, this analysis invariably needs supplementation with other genes. The need is to divide the genetic variability within a taxa or genus at their rrs phylogenetic boundaries and to discover those fundamental features, which will enable the bacteria to naturally fall within them. Within the large bacterial community, Clostridium represents a large genus of around 110 species of significant biotechnological and medical importance. Certain Clostridium strains produce some of the deadliest toxins, which cause heavy economic losses. We have targeted this genus because of its high genetic diversity, which does not allow accurate typing with the available molecular methods. Results Seven hundred sixty five rrs sequences (> 1200 nucleotides, nts) belonging to 110 Clostridium species were analyzed. On the basis of 404 rrs sequences belonging to 15 Clostridium species, we have developed species specific: (i) phylogenetic framework, (ii) signatures (30 nts) and (iii) in silico restriction enzyme (14 Type II REs) digestion patterns. These tools allowed: (i) species level identification of 95 Clostridium sp. which are presently classified up to genus level, (ii) identification of 84 novel Clostridium spp. and (iii) potential reduction in the number of Clostridium species represented by small populations. Conclusions This integrated approach is quite sensitive and can be easily extended as a molecular tool for diagnostic and taxonomic identification of any microbe of importance to food industries and health services. Since rapid and correct identification allows quicker diagnosis and consequently treatment as well, it is likely to lead to reduction in economic losses and mortality

  13. rDNA Copy Number Variants Are Frequent Passenger Mutations in Saccharomyces cerevisiae Deletion Collections and de Novo Transformants

    PubMed Central

    Kwan, Elizabeth X.; Wang, Xiaobin S.; Amemiya, Haley M.; Brewer, Bonita J.; Raghuraman, M. K.


    The Saccharomyces cerevisiae ribosomal DNA (rDNA) locus is known to exhibit greater instability relative to the rest of the genome. However, wild-type cells preferentially maintain a stable number of rDNA copies, suggesting underlying genetic control of the size of this locus. We performed a screen of a subset of the Yeast Knock-Out (YKO) single gene deletion collection to identify genetic regulators of this locus and to determine if rDNA copy number correlates with yeast replicative lifespan. While we found no correlation between replicative lifespan and rDNA size, we identified 64 candidate strains with significant rDNA copy number differences. However, in the process of validating candidate rDNA variants, we observed that independent isolates of our de novo gene deletion strains had unsolicited but significant changes in rDNA copy number. Moreover, we were not able to recapitulate rDNA phenotypes from the YKO yeast deletion collection. Instead, we found that the standard lithium acetate transformation protocol is a significant source of rDNA copy number variation, with lithium acetate exposure being the treatment causing variable rDNA copy number events after transformation. As the effects of variable rDNA copy number are being increasingly reported, our finding that rDNA is affected by lithium acetate exposure suggested that rDNA copy number variants may be influential passenger mutations in standard strain construction in S. cerevisiae. PMID:27449518

  14. Cytogenetic Analysis and Chromosomal Characteristics of the Polymorphic 18S rDNA of Haliotis discus hannai from Fujian, China

    PubMed Central

    Wang, Haishan; Luo, Xuan; You, Weiwei; Dong, Yunwei; Ke, Caihuan


    We report on novel chromosomal characteristics of Haliotis discus hannai from a breeding population at Fujian, China. The karyotypes of H. discus hannai we obtained from an abalone farm include a common type 2n = 36 = 10M + 8SM (82%) and two rare types 2n = 36 = 11M + 7SM (14%) and 2n = 36 = 10M + 7SM + 1ST (4%). The results of silver staining showed that the NORs of H. discus hannai were usually located terminally on the long arms of chromosome pairs 14 and 17, NORs were also sometimes located terminally on the short arms of other chromosomes, either metacentric or submetacentric pairs. The number of Ag-nucleoli ranged from 2 to 8, and the mean number was 3.61 ± 0.93. Among the scored interphase cells, 41% had 3 detectable nucleoli and 37% had 4 nucleoli. The 18S rDNA FISH result is the first report of the location of 18S rDNA genes in H. discus hannai. The 18S rDNA locations were highly polymorphic in this species. Copies of the gene were observed in the terminal of long or/and short arms of submetacentric or/and metacentric chromosomes. Using FISH with probe for vertebrate-like telomeric sequences (CCCTAA)3 displayed positive green FITC signals at telomere regions of all analyzed chromosome types. We found about 7% of chromosomes had breaks in prophase. A special form of nucleolus not previously described from H. discus hannai was observed in some interphase cells. It consists of many small silver-stained nucleoli gathered together to form a larger nucleolus and may correspond to prenucleolar bodies. PMID:25699679

  15. Molecular systematic of three species of Oithona (Copepoda, Cyclopoida) from the Atlantic Ocean: comparative analysis using 28S rDNA.


    Cepeda, Georgina D; Blanco-Bercial, Leocadio; Bucklin, Ann; Berón, Corina M; Viñas, María D


    Species of Oithona (Copepoda, Cyclopoida) are highly abundant, ecologically important, and widely distributed throughout the world oceans. Although there are valid and detailed descriptions of the species, routine species identifications remain challenging due to their small size, subtle morphological diagnostic traits, and the description of geographic forms or varieties. This study examined three species of Oithona (O. similis, O. atlantica and O. nana) occurring in the Argentine sector of the South Atlantic Ocean based on DNA sequence variation of a 575 base-pair region of 28S rDNA, with comparative analysis of these species from other North and South Atlantic regions. DNA sequence variation clearly resolved and discriminated the species, and revealed low levels of intraspecific variation among North and South Atlantic populations of each species. The 28S rDNA region was thus shown to provide an accurate and reliable means of identifying the species throughout the sampled domain. Analysis of 28S rDNA variation for additional species collected throughout the global ocean will be useful to accurately characterize biogeographical distributions of the species and to examine phylogenetic relationships among them. PMID:22558245

  16. Karyotyping and in situ chromosomal localization of rDNA sites in black cumin Bunium persicum (Boiss) B. Fedtsch,1915 (Apiaceae)

    PubMed Central

    Chahota, R. K.; Mukai, Y.; Chaudhary, H.K.; Kishore, Naval; Sharma, T.R.


    Abstract The fluorescent in situ hybridization (FISH) technique has been applied to somatic chromosomes in the medicinally important species, Bunium persicum, to elucidate its karyotypes. The bicolour FISH technique involving 18S-5.8S-26S and 5S ribosomal RNA genes as probes was used to assign physical localization and measurement of rDNA sites on homologous pairs of chromosomes. The two 18S-5.8S-26S rRNA gene sites were at the terminal regions of the short arms of the chromosomes 1 and 2 involving NOR region of chromosome 1. The 5S rDNA sites were found on subtelomeric region of the long arm of the chromosome number 5 and at interstitial regions of the short arm of chromosome 7. Based on direct visual analysis of chromosome length, morphology and position of FISH signals, a pioneer attempt has been made to construct metaphase karyotype in Bunium persicum, an endangered medicinal plant of North Western Himalayas. PMID:24260640

  17. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.


    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio


    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status. PMID:23933480

  18. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.


    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon


    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment. PMID:22724546

  19. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2010 CFR


    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  20. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2011 CFR


    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  1. Use of acetate for enrichment of electrochemically active microorganisms and their 16S rDNA analyses.


    Lee, Jiyoung; Phung, Nguyet Thu; Chang, In Seop; Kim, Byung Hong; Sung, Ha Chin


    A fuel cell-type electrochemical device has been used to enrich microbes oxidizing acetate with concomitant electricity generation without using an electron mediator from activated sludge. The device generated a stable current of around 5 mA with complete oxidation of 5 mM acetate at the hydraulic retention time of 2.5 h after 4 weeks of enrichment. Over 70% of electrons available from acetate oxidation was recovered as current. Carbon monoxide or hydrogen did not influence acetate oxidation or current generation from the microbial fuel cell (MFC). Denaturing gradient gel electrophoresis showed that DNA extracted from the acetate-enriched MFC had different 16S rDNA patterns from those of sludge or glucose+glutamate-enriched MFCs. Nearly complete 16S rDNA sequence analyses showed that diverse bacteria were enriched in the MFC fed with acetate. Electron microscopic observations showed biofilm developed on the electrode, but not microbial clumps observed in MFCs fed with complex fuel such as glucose and wastewater from a corn-processing factory. PMID:12829284

  2. Comparative cytogenetics of giant trahiras Hoplias aimara and H. intermedius (Characiformes, Erythrinidae): chromosomal characteristics of minor and major ribosomal DNA and cross-species repetitive centromeric sequences mapping differ among morphologically identical karyotypes.


    Blanco, D R; Lui, R L; Vicari, M R; Bertollo, L A C; Moreira-Filho, O


    Karyotype and cytogenetic characteristics of 2 species of giant trahiras, Hopliasintermedius, São Francisco river basin, and Hopliasaimara, Arinos river (Amazon basin), were examined by conventional (C-banding, Ag-NOR, DAPI/CMA(3) double-staining) and fluorescent in situ hybridization (FISH) with 5S, 18S rDNA probes and cross-species Cot-1 DNA probing. Both species invariably had diploid chromosome number 2n = 50 and identical karyotypes composed of 10 pairs of metacentric and 15 pairs of submetacentric chromosomes. On the other hand, staining with base-specific fluorochromes (CMA(3), DAPI) and FISH mapping of repetitive DNA sequences showed extensive interspecific differences: while the genome of H. aimara had one submetacentric pair bearing CMA(3)-positive (DAPI-negative) sites, that of H. intermedius had 4 such pairs; while FISH with a 5S rDNA probe showed one (likely homologous) signal-bearing pair, that with 18S rDNA displayed one signal-bearing pair in H. intermedius and 2 such pairs in H. aimara. Cross-species FISH probing with Cot-1 DNA prepared from total DNA of both species showed no signals of Cot-1 DNA from H. aimara on chromosomes of H. intermedius but reciprocally (Cot-1 DNA from H. intermedius on chromosomes of H. aimara) displayed signals on at least 4 chromosome pairs. Present findings indicate (i) different composition of repetitive sequences around centromeres, (ii) different NOR phenotypes and (iii) distinct taxonomic status of both giant trahira species. PMID:20924165

  3. Ectomycorrhizal iconoclasts: the ITS rDNA diversity and nitrophilic tendencies of fetid Russula.


    Avis, Peter G


    Fetid Russula are frequently dominant ectomycorrhizal fungi, and some appear to be especially nitrophilic. However, little is known about their phylogenetic relationships or how common nitrophilic traits are in this group. This study addresses this gap and presents a phylogenetic analysis of ITS rDNA sequences and a meta-analysis of studies that examine ectomycorrhizal fungi response to nitrogen increase. The phylogenetic analysis indicates that (i) this lineage contains numerous unidentified taxa; (ii) the taxa have distinct geographic distributions; and (iii) the misuse of names such as R amoenolens, R. foetens or R. pectinatoides is common. Twenty-three well supported phylotypes were identified and include clades specific to western North America, eastern North America, Europe and Asia, while morphologically similar collections from tropical-equatorial regions are distinct. The metaanalysis shows that nitrophilic tendencies appear throughout fetid Russulas suggesting that this character is not an isolated trait within this subgenus but instead is a more general feature of the group overall. Mapping these tendencies across a broader portion of the Russulaceae shows that this trait is more regularly found in the basal Russula lineages and Lactarius spp., suggesting that this ability evolved early in these fungi. PMID:22495448

  4. Analysis of a 5S rRNA gene cloned from Euplotes eurstomus

    SciTech Connect

    Roberson, A.E.; Wolffe, A.; Olins, D.E.


    The macronucleus of the hypotrichous ciliated protozoan Euplotes eurystomus lends itself to the study of eukaryotic gene and chromatin structure because native macronuclear DNA exists as linear, gene-sized fragments between 400 and 20,000 bp in length. The macronuclear chromatin, while arranged in a typical nucleosomal structure, is freely soluble in low ionic strength buffers without treatment by nucleases. Thus, specific genes may be enriched as native, intact chromatin molecules. The 5S rRNA gene from Euplotes has been cloned to facilitate investigation of 5S gene-chromatin following characterization of the gene at the DNA level. It has been demonstrated that the gene, while in circular or linear form, can be transcribed in vitro by a Xenopus oocyte nuclear extract. The transcript generated in vitro is 120 nucleotides in length and is synthesized by RNA polymerase III. Anti-Xenopus TFIIIA antibodies recognize a Euplotes macronuclear chromatin-associated protein which is approx. 80 KD in size. It has been established that the sequence of the telomere flanking the 5S gene in Euplotes eurystomus is the same telomeric sequence published for Euplotes aediculatus.

  5. Analyzing Digital Library Initiatives: 5S Theory Perspective

    ERIC Educational Resources Information Center

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko


    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  6. A methylated Neurospora 5S rRNA pseudogene contains a transposable element inactivated by repeat-induced point mutation.

    PubMed Central

    Margolin, B S; Garrett-Engele, P W; Stevens, J N; Fritz, D Y; Garrett-Engele, C; Metzenberg, R L; Selker, E U


    In an analysis of 22 of the roughly 100 dispersed 5S rRNA genes in Neurospora crassa, a methylated 5S rRNA pseudogene, Psi63, was identified. We characterized the Psi63 region to better understand the control and function of DNA methylation. The 120-bp 5S rRNA-like region of Psi63 is interrupted by a 1.9-kb insertion that has characteristics of sequences that have been modified by repeat-induced point mutation (RIP). We found sequences related to this insertion in wild-type strains of N. crassa and other Neurospora species. Most showed evidence of RIP; but one, isolated from the N. crassa host of Psi63, showed no evidence of RIP. A deletion from near the center of this sequence apparently rendered it incapable of participating in RIP with the related full-length copies. The Psi63 insertion and the related sequences have features of transposons and are related to the Fot1 class of fungal transposable elements. Apparently Psi63 was generated by insertion of a previously unrecognized Neurospora transposable element into a 5S rRNA gene, followed by RIP. We name the resulting inactivated Neurospora transposon PuntRIP1 and the related sequence showing no evidence of RIP, but harboring a deletion that presumably rendered it defective for transposition, dPunt. PMID:9691037

  7. macroH2A1 histone variant represses rDNA transcription.


    Cong, Rong; Das, Sadhan; Douet, Julien; Wong, Jiemin; Buschbeck, Marcus; Mongelard, Fabien; Bouvet, Philippe


    The regulation of ribosomal DNA transcription is an important step for the control of cell growth. Epigenetic marks such as DNA methylation and posttranslational modifications of canonical histones have been involved in this regulation, but much less is known about the role of histone variants. In this work, we show that the histone variant macroH2A1 is present on the promoter of methylated rDNA genes. The inhibition of the expression of macroH2A1 in human HeLa and HepG2 cells and in a mouse ES cell line resulted in an up to 5-fold increase of pre-rRNA levels. This increased accumulation of pre-rRNA is accompanied by an increase of the loading of RNA polymerase I and UBF on the rDNA without any changes in the number of active rDNA genes. The inhibition of RNA polymerase I transcription by actinomycin D or by knocking down nucleolin, induces the recruitment of macroH2A1 on the rDNA and the relocalization of macroH2A1 in the nucleolus. Interestingly, the inhibition of rDNA transcription induced by nucleolin depletion is alleviated by the inactivation of macroH2A1. These results demonstrate that macroH2A1 is a new factor involved in the regulation of rDNA transcription. PMID:24071584

  8. Protein kinase NII and the regulation of rDNA transcription in mammalian cells.

    PubMed Central

    Belenguer, P; Baldin, V; Mathieu, C; Prats, H; Bensaid, M; Bouche, G; Amalric, F


    Transcription of ribosomal RNA genes is generally accepted to correlate with cell growth. Using primary cultures of adult bovine aortic endothelial (ABAE) cells, we have shown that transcription of rDNA in confluent cells falls to 5% of the transcription level in growing cells. Protein kinase NII appears to be a limiting factor to promote rDNA transcription in isolated nuclei of confluent cells. Protein kinase NII was detected by immunocytochemistry in the cytoplasm, nuclei and nucleoli of growing cells while it was no longer present in nucleoli of confluent cells. The kinase activity, in isolated nuclei, was estimated by endogenous phosphorylation of a specific substrate, nucleolin. A 10% residual activity was present in confluent cell nuclei compared to growing cell nuclei. Concomitantly, the transcription 'in vitro' of rDNA in the corresponding nuclei was also highly reduced (by 85%). Addition of exogenous protein kinase NII to confluent cell nuclei induced a strong increase in the phosphorylation of specific proteins including nucleolin. In parallel, the transcription of rDNA was increased by a factor of 5, to nearly the level observed in nuclei prepared from growing cells. These data suggest that, in confluent cells, factors necessary for rDNA transcription machinery are present but inactive in the nucleolus and that the phosphorylation of one or several of these factors (nucleolin, topoisomerase I,...) by protein kinase NII is a key event in the regulation of rDNA transcription. Images PMID:2780290

  9. The establishment of species-specific primers for the molecular identification of ten stored-product psocids based on ITS2 rDNA.


    Zhao, Zi-Hua; Cui, Bing-Yi; Li, Zhi-Hong; Jiang, Fan; Yang, Qian-Qian; Kučerová, Zuzana; Stejskal, Václav; Opit, George; Cao, Yang; Li, Fu-Jun


    Psocids are important stored product pests found worldwide that can be spread through grain trade. Most stored-product psocids, including eggs, nymphs, and adults, are very small (~1 mm) and difficult to identify morphologically. Here, we collected 10 economically important stored-product Liposcelis spp. psocids (L. bostrychophila, L. entomophila, L. decolor, L. paeta, L. brunnea, L. corrodens, L. mendax, L. rufa, L. pearmani, and L. tricolor) from 35 geographical locations in 5 countries (China, Czech Republic, Denmark, Germany, and the United States). The ITS2 rDNA gene was extracted and sequenced. The interspecific genetic distance of the stored-product psocids was significantly higher than the intraspecific genetic distance according to the barcoding gap analysis. Ten pairs of species-specific primers based on the ITS2 rDNA were developed for psocid identification. The sensitivity estimation indicated that the species-specific primers could correctly amplify the target ITS2 gene and successfully identify psocids at 1.0 ng/mL. Additionally, these species-specific primers could quantify specificity and identify 10 stored-product psocids; this approach could also be used to accurately identify other stored-product psocids. This work provides a practical approach for the precise examination of 10 stored-product psocid species and also contributes to the development of an identification method using ITS2 rDNA. PMID:26880378

  10. The establishment of species-specific primers for the molecular identification of ten stored-product psocids based on ITS2 rDNA

    PubMed Central

    Zhao, Zi-Hua; Cui, Bing-Yi; Li, Zhi-Hong; Jiang, Fan; Yang, Qian-Qian; Kučerová, Zuzana; Stejskal, Václav; Opit, George; Cao, Yang; Li, Fu-Jun


    Psocids are important stored product pests found worldwide that can be spread through grain trade. Most stored-product psocids, including eggs, nymphs, and adults, are very small (~1 mm) and difficult to identify morphologically. Here, we collected 10 economically important stored-product Liposcelis spp. psocids (L. bostrychophila, L. entomophila, L. decolor, L. paeta, L. brunnea, L. corrodens, L. mendax, L. rufa, L. pearmani, and L. tricolor) from 35 geographical locations in 5 countries (China, Czech Republic, Denmark, Germany, and the United States). The ITS2 rDNA gene was extracted and sequenced. The interspecific genetic distance of the stored-product psocids was significantly higher than the intraspecific genetic distance according to the barcoding gap analysis. Ten pairs of species-specific primers based on the ITS2 rDNA were developed for psocid identification. The sensitivity estimation indicated that the species-specific primers could correctly amplify the target ITS2 gene and successfully identify psocids at 1.0 ng/mL. Additionally, these species-specific primers could quantify specificity and identify 10 stored-product psocids; this approach could also be used to accurately identify other stored-product psocids. This work provides a practical approach for the precise examination of 10 stored-product psocid species and also contributes to the development of an identification method using ITS2 rDNA. PMID:26880378

  11. Performance of 16s rDNA Primer Pairs in the Study of Rhizosphere and Endosphere Bacterial Microbiomes in Metabarcoding Studies

    PubMed Central

    Beckers, Bram; Op De Beeck, Michiel; Thijs, Sofie; Truyens, Sascha; Weyens, Nele; Boerjan, Wout; Vangronsveld, Jaco


    Next-generation sequencing technologies have revolutionized the methods for studying microbial ecology by enabling high-resolution community profiling. However, the use of these technologies in unraveling the plant microbiome remains challenging. Many bacterial 16S rDNA primer pairs also exhibit high affinity for non-target DNA such as plastid (mostly chloroplast) DNA and mitochondrial DNA. Therefore, we experimentally tested a series of commonly used primers for the analysis of plant-associated bacterial communities using 454 pyrosequencing. We evaluated the performance of all selected primer pairs in the study of the bacterial microbiomes present in the rhizosphere soil, root, stem and leaf endosphere of field-grown poplar trees (Populus tremula × Populus alba) based on (a) co-amplification of non-target DNA, (b) low amplification efficiency for pure chloroplast DNA (real-time PCR), (c) high retrieval of bacterial 16S rDNA, (d) high operational taxonomic unit (OTU) richness and Inverse Simpson diversity and (e) taxonomic assignment of reads. Results indicate that experimental evaluation of primers provide valuable information that could contribute in the selection of suitable primer pairs for 16S rDNA metabarcoding studies in plant-microbiota research. Furthermore, we show that primer pair 799F-1391R outperforms all other primer pairs in our study in the elimination of non-target DNA and retrieval of bacterial OTUs. PMID:27242686

  12. Performance of 16s rDNA Primer Pairs in the Study of Rhizosphere and Endosphere Bacterial Microbiomes in Metabarcoding Studies.


    Beckers, Bram; Op De Beeck, Michiel; Thijs, Sofie; Truyens, Sascha; Weyens, Nele; Boerjan, Wout; Vangronsveld, Jaco


    Next-generation sequencing technologies have revolutionized the methods for studying microbial ecology by enabling high-resolution community profiling. However, the use of these technologies in unraveling the plant microbiome remains challenging. Many bacterial 16S rDNA primer pairs also exhibit high affinity for non-target DNA such as plastid (mostly chloroplast) DNA and mitochondrial DNA. Therefore, we experimentally tested a series of commonly used primers for the analysis of plant-associated bacterial communities using 454 pyrosequencing. We evaluated the performance of all selected primer pairs in the study of the bacterial microbiomes present in the rhizosphere soil, root, stem and leaf endosphere of field-grown poplar trees (Populus tremula × Populus alba) based on (a) co-amplification of non-target DNA, (b) low amplification efficiency for pure chloroplast DNA (real-time PCR), (c) high retrieval of bacterial 16S rDNA, (d) high operational taxonomic unit (OTU) richness and Inverse Simpson diversity and (e) taxonomic assignment of reads. Results indicate that experimental evaluation of primers provide valuable information that could contribute in the selection of suitable primer pairs for 16S rDNA metabarcoding studies in plant-microbiota research. Furthermore, we show that primer pair 799F-1391R outperforms all other primer pairs in our study in the elimination of non-target DNA and retrieval of bacterial OTUs. PMID:27242686

  13. Phylogeny of coral-inhabiting barnacles (Cirripedia; Thoracica; Pyrgomatidae) based on 12S, 16S and 18S rDNA analysis.


    Simon-Blecher, N; Huchon, D; Achituv, Y


    The traditional phylogeny of the coral-inhabiting barnacles, the Pyrgomatidae, is based on morphological characteristics, mainly of the hard parts. It has been difficult to establish the phylogenetic relationships among Pyrgomatidae because of the apparent convergence of morphological characteristics, and due to the use of non-cladistic systematics, which emphasize ancestor-descendant relationships rather than sister-clade relationships. We used partial sequences of two mithochondrial genes, 12S rDNA and 16S rDNA, and a nuclear gene, 18S rDNA, to infer the molecular phylogeny of the pyrgomatids. Our phylogenetic results allowed us to reject previous classifications of Pyrgomatidae based on morphological characteristics. Our results also suggested the possibility of paraphyly of the Pyrgomatidae. The hydrocoral barnacle Wanella is not found on the same clade as the other pyrgomatids, but rather, with the free-living balanids. The basal position of Megatrema and Ceratoconcha is supported. The archeaobalanid Armatobalanus is grouped with Cantellius at the base of the Indo-Pacific pyrgomatines. Fusion of the shell plate and modification of the opercular valves are homoplasious features that occurred more than three times on different clades. The monophyly of the "Savignium" group, comprising four nominal genera, is also not supported, and the different taxa are placed on different clades. PMID:17560131

  14. Molecular characterization and chromosomal distribution of species-specific repetitive DNA sequences from Beta corolliflora, a wild relative of sugar beet.


    Gao, D; Schmidt, T; Jung, C


    Repetitive DNA sequences have been isolated from a Sau3AI plasmid library of tetraploid Beta corolliflora (2n = 4x = 36), a wild relative of sugar beet (B. vulgaris). The library was screened by differential hybridization with genomic DNA of B. corolliflora and B. vulgaris. When used as probes for Southern hybridization of genomic DNA, six clones were determined to represent highly repetitive DNA families present only in the B. corolliflora genome. Five other sequences were highly repetitive in B. corolliflora and low or single copy in B. vulgaris. The insert size varied between 43 bp and 448 bp. Two sequences pBC1279 and pBC1944 displayed strong homology to a previously cloned satellite DNA from B. nana. With one exception, sequences are tandemly arranged as revealed by a typical ladder pattern after genomic Southern hybridization. The chromosomal distribution of five probes was determined by fluorescence in situ hybridization (FISH) of mitotic metaphases from B. corolliflora and a triploid hybrid between B. vulgaris and B. corolliflora. Three sequences were spread along all chromosome arms of B. corolliflora while one sequence was present on only six chromosomes. The chromosome-specific sequence pBC216 was found in close vicinity to the 5S rDNA located on B. corolliflora chromosome IV. This set of species-specific sequences has the potential to be used as probes for the identification of monosomic alien addition lines and for marker-assisted gene transfer from wild beet to cultivated beet. PMID:11195340

  15. Physical studies of 5S RNA variants at position 66.

    PubMed Central

    Zhang, P; Popieniek, P; Moore, P B


    Two variants of the 5S RNA of E. coli have been examined by imino proton NMR spectroscopy, one of them a deletion of A66 (Christiansen, J., Douthwaite, S.R., Christensen, A. and Garrett, R.A. (1985) EMBO J. 4, 1019-1024) and the other a replacement of A66 with a C (Goringer, H.U. and Wagner, R. (1986) Biol. Chem. Hoppe-Seyler 367, 769-780). Both are of interest because the role the bulged A in helix II of 5S RNA is supposed to play in interactions with ribosomal protein L18. The data show that the structural perturbations that result from these mutations are minimal, and assign the resonances of some of the imino protons around position 66. Some mutations at or near position 66 greatly reduce the L18-dependent increase in the circular dichroism of 5S RNA at 267 nm first observed by Bear and coworkers (Bear, D.G., Schleich, T., Noller, H.F. and Garrett, R.A. (1977) Nucl. Acids Res. 4, 2511-2526). PMID:2479908

  16. A Tale of Two Lines: Searching for the 5s - 5p Resonance Lines in Pm-like Ion Spectra

    SciTech Connect

    Trabert, E; Vilkas, M J; Ishikawa, Y


    Highly charged ions in the promethium sequence have been suggested to show spectral features resembling the alkali sequence ions. Guided by calculations, the 5s-5p resonance lines have been sought in a variety of experiments. In the light of the most extensive calculations of Pm-like ions yet, applying relativistic multi-reference Moeller-Plesset second-order perturbation theory, the experimental evidence is reviewed and the line identification problem assessed.


    EPA Science Inventory

    In a previously described study, only 15% of the bacterial strains isolated from a water distribution system (WDS) grown on R2A agar were identifiable using fatty acid methyl esthers (FAME) profiling. The lack of success was attributed to the use of fatty acid databases of bacter...

  18. How well do ITS rDNA sequences differentiate species of true morels (Morchella)?

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Arguably more mycophiles hunt true morels (Morchella) during their brief fruiting season each spring in the Northern Hemisphere than any other wild edible fungus. Concerns about overharvesting by individual collectors and commercial enterprises make it essential that science-based management practic...


    EPA Science Inventory

    Turkey feces are an important source of fecal waste in the United States. With the exception of isolated studies on bacterial pathogens, little is known about the type of bacteria inhabiting the turkey gut. In order to understand the microbial diversity and functional genes assoc...

  20. Morphology and 18S rDNA of Henneguya gurlei (Myxosporea) from Ameiurus nebulosus (Siluriformes) in North Carolina

    USGS Publications Warehouse

    Iwanowicz, L.R.; Iwanowicz, D.D.; Pote, L.M.; Blazer, V.S.; Schill, W.B.


    Henneguya gurlei was isolated from Ameiurus nebulosus captured in North Carolina and redescribed using critical morphological features and 18S small-subunit ribosomal RNA (SSU rDNA) gene sequence. Plasmodia are white, spherical, or subspherical, occur in clusters, measure up to 1.8 mm in length, and are located on the dorsal, pectoral, and anal fins. Histologically, plasmodia are located in the dermis and subdermally, and the larger cysts disrupt the melanocyte pigment layer. The spore body is lanceolate, 18.2 ?? 0.3 ??m (range 15.7-20.3) in length, and 5.4 ?? 0.1 ??m (range 3.8-6.1) in width in valvular view. The caudal appendages are 41.1 ?? 1.1 ??m (range 34.0-49.7) in length. Polar capsules are pyriform and of unequal size. The longer polar capsule measures 6.2 ?? 0.1 ??m (range 5.48-7.06), while the shorter is 5.7 ?? 0.1 ??m (range 4.8-6.4) in length. Polar capsule width is 1.2 ?? 0.03 ??m (range 1.0-1.54). The total length of the spore is 60.9 ?? 1.2 ??m (range 48.7-68.5). Morphologically, this species is similar to other species of Henneguya that are known to infect ictalurids. Based on SSU rDNA sequences, this species is most closely related to H. exilis and H. ictaluri, which infect Ictalurus punctatus. ?? American Society of Parasitologists 2008.

  1. D5S2500 is an ambiguously characterized STR: Identification and description of forensic microsatellites in the genomics age.


    Phillips, C; Parson, W; Amigo, J; King, J L; Coble, M D; Steffen, C R; Vallone, P M; Gettings, K B; Butler, J M; Budowle, B


    In the process of establishing short tandem repeat (STR) sequence variant nomenclature guidelines in anticipation of expanded forensic multiplexes for massively parallel sequencing (MPS), it was discovered that the STR D5S2500 has multiple positions and genomic characteristics reported. This ambiguity is because the marker named D5S2500 consists of two different microsatellites forming separate components in the capillary electrophoresis multiplexes of Qiagen's HDplex (Hilden, Germany) and AGCU ScienTech's non-CODIS STR 21plex (Wuxi, Jiangsu, China). This study outlines the genomic details used to identify each microsatellite and reveals the D5S2500 marker in HDplex has the correctly assigned STR name, while the D5S2500 marker in the AGCU 21plex, closely positioned a further 1643 nucleotides in the human reference sequence, is an unnamed microsatellite. The fact that the D5S2500 marker has existed as two distinct STR loci undetected for almost ten years, even with reported discordant genotypes for the standard control DNA, underlines the need for careful scrutiny of the genomic properties of forensic STRs, as they become adapted for sequence analysis with MPS systems. We make the recommendation that precise chromosome location data must be reported for any forensic marker under development but not in common use, so that the genomic characteristics of the locus are validated to the same level of accuracy as its allelic variation and forensic performance. To clearly differentiate each microsatellite, we propose the name D5S2800 be used to identify the Chromosome-5 STR in the AGCU 21plex. PMID:26974236

  2. 18S rDNA analysis of alkenone-producing haptophyte(s) preserved in surface sediments of Lake Toyoni, Japan

    NASA Astrophysics Data System (ADS)

    McColl, J. L.; Couto, J.; Bendle, J. A.; Henderson, A. C.; Seki, O.; Phoenix, V. R.; Toney, J. L.


    Alkenones (long chain ketones) are readily preserved in sedimentary archives and have the potential to provide quantitative reconstructions of past water temperature. Alkenones are produced by a limited number of haptophyte algae in the marine and also some lacustrine systems. However, lakes are heterogeneous: an individual lake will have a unique combination of ecological conditions, haptophyte species and seasonal alkenone production that contributes to the sedimentary record. Haptophyte algae species have different sensitivities to temperature; therefore identifying the alkenone producer(s) prior to down-core temperature reconstructions is critical before selecting the most appropriate temperature calibration. We present a study from Lake Toyoni, a freshwater lake in Hokkaido, Japan that has alkenones preserved in surface sediments. The aim of this study is to identify the alkenone producer(s) within the lake using 18S rDNA analyses. Preserved rDNA of planktonic phototrophic algae was extracted from surface sediments of Lake Toyoni and phylogenetic analyses of the rDNA sequences suggest alkenones are produced by a single haptophyte within the class Prymnesiophyceae (order Isochrysidales). The Lake Toyoni alkenone-producer shares a distinct phylotype with a haptophyte reported from water filter samples collected in Lake BrayaSø, Greenland (D'Andrea et al., 2006). Similarity between the 18S rDNA sequences from Lake Toyoni and Lake BrayaSø provides a basis for applying (and updating) the Greenland lake temperature calibration. Applying this temperature calibration (T°C = 40.8 [UK37] + 31.8, R2=0.96; n=34) to the surface sediment alkenone unsaturation index from Lake Toyoni gives an estimated lake surface temperature (LST) of 8°C. This is in line with observed LST at Lake Toyoni, which ranges between 7 - 22°C (Apr 2011 to Nov 2011). The occurrence and identification of a single alkenone producer in Lake Toyoni means problems posed by a mixture of haptophytes in

  3. Copy Number of the Transposon, Pokey, in rDNA Is Positively Correlated with rDNA Copy Number in Daphnia obtusa

    PubMed Central

    LeRiche, Kaitlynn; Eagle, Shannon H. C.; Crease, Teresa J.


    Pokey is a class II DNA transposon that inserts into 28S ribosomal RNA (rRNA) genes and other genomic regions of species in the subgenus, Daphnia. Two divergent lineages, PokeyA and PokeyB have been identified. Recombination between misaligned rRNA genes changes their number and the number of Pokey elements. We used quantitative PCR (qPCR) to estimate rRNA gene and Pokey number in isolates from natural populations of Daphnia obtusa, and in clonally-propagated mutation accumulation lines (MAL) initiated from a single D. obtusa female. The change in direction and magnitude of Pokey and rRNA gene number did not show a consistent pattern across ∼87 generations in the MAL; however, Pokey and rRNA gene number changed in concert. PokeyA and 28S gene number were positively correlated in the isolates from both natural populations and the MAL. PokeyB number was much lower than PokeyA in both MAL and natural population isolates, and showed no correlation with 28S gene number. Preliminary analysis did not detect PokeyB outside rDNA in any isolates and detected only 0 to 4 copies of PokeyA outside rDNA indicating that Pokey may be primarily an rDNA element in D. obtusa. The recombination rate in this species is high and the average size of the rDNA locus is about twice as large as that in other Daphnia species such as D. pulicaria and D. pulex, which may have facilitated expansion of PokeyA to much higher numbers in D. obtusa rDNA than these other species. PMID:25490398

  4. Copy number of the transposon, Pokey, in rDNA is positively correlated with rDNA copy number in Daphnia obtuse [corrected].


    LeRiche, Kaitlynn; Eagle, Shannon H C; Crease, Teresa J


    Pokey is a class II DNA transposon that inserts into 28S ribosomal RNA (rRNA) genes and other genomic regions of species in the subgenus, Daphnia. Two divergent lineages, PokeyA and PokeyB have been identified. Recombination between misaligned rRNA genes changes their number and the number of Pokey elements. We used quantitative PCR (qPCR) to estimate rRNA gene and Pokey number in isolates from natural populations of Daphnia obtusa, and in clonally-propagated mutation accumulation lines (MAL) initiated from a single D. obtusa female. The change in direction and magnitude of Pokey and rRNA gene number did not show a consistent pattern across ∼ 87 generations in the MAL; however, Pokey and rRNA gene number changed in concert. PokeyA and 28S gene number were positively correlated in the isolates from both natural populations and the MAL. PokeyB number was much lower than PokeyA in both MAL and natural population isolates, and showed no correlation with 28S gene number. Preliminary analysis did not detect PokeyB outside rDNA in any isolates and detected only 0 to 4 copies of PokeyA outside rDNA indicating that Pokey may be primarily an rDNA element in D. obtusa. The recombination rate in this species is high and the average size of the rDNA locus is about twice as large as that in other Daphnia species such as D. pulicaria and D. pulex, which may have facilitated expansion of PokeyA to much higher numbers in D. obtusa rDNA than these other species. PMID:25490398

  5. Development of a PCR assay based on the 16S-23S rDNA internal transcribed spacer for identification of strictly anaerobic bacterium Zymophilus.


    Felsberg, Jurgen; Jelínková, Markéta; Kubizniaková, Petra; Matoulková, Dagmar


    PCR-primers were designed for identification of strictly anaerobic bacteria of the genus Zymophilus based on genus-specific sequences of the 16S-23S rDNA internal transcribed spacer region. The specificity of the primers was tested against 37 brewery-related non-target microorganisms that could potentially occur in the same brewery specimens. None DNA was amplified from any of the non-Zymophilus strains tested including genera from the same family (Pectinatus, Megasphaera, Selenomonas), showing thus 100% specificity. PCR assay developed in this study allows an extension of the spectra of detected beer spoilage microorganisms in brewery laboratories. PMID:25725268

  6. Investigating bacterial populations in styrene-degrading biofilters by 16S rDNA tag pyrosequencing.


    Portune, Kevin J; Pérez, M Carmen; Álvarez-Hornos, F Javier; Gabaldón, Carmen


    Microbial biofilms are essential components in the elimination of pollutants within biofilters, yet still little is known regarding the complex relationships between microbial community structure and biodegradation function within these engineered ecosystems. To further explore this relationship, 16S rDNA tag pyrosequencing was applied to samples taken at four time points from a styrene-degrading biofilter undergoing variable operating conditions. Changes in microbial structure were observed between different stages of biofilter operation, and the level of styrene concentration was revealed to be a critical factor affecting these changes. Bacterial genera Azoarcus and Pseudomonas were among the dominant classified genera in the biofilter. Canonical correspondence analysis (CCA) and correlation analysis revealed that the genera Brevundimonas, Hydrogenophaga, and Achromobacter may play important roles in styrene degradation under increasing styrene concentrations. No significant correlations (P > 0.05) could be detected between biofilter operational/functional parameters and biodiversity measurements, although biological heterogeneity within biofilms and/or technical variability within pyrosequencing may have considerably affected these results. Percentages of selected bacterial taxonomic groups detected by fluorescence in situ hybridization (FISH) were compared to results from pyrosequencing in order to assess the effectiveness and limitations of each method for identifying each microbial taxon. Comparison of results revealed discrepancies between the two methods in the detected percentages of numerous taxonomic groups. Biases and technical limitations of both FISH and pyrosequencing, such as the binding of FISH probes to non-target microbial groups and lack of classification of sequences for defined taxonomic groups from pyrosequencing, may partially explain some differences between the two methods. PMID:24950754

  7. Secondary structure of expansion segment D1 in LSU rDNA from Arachnida and its phylogenetic application in Eriophyoid mites and in Acari.


    Wang, Zheng-Hang; Zhao, Ya-E; Xu, Yang; Hu, Li; Chen, Yi-Meng


    An increasing number of researchers have applied secondary-structure based multiple alignments of rDNA genes in phylogeny. These studies mostly depended on a few valuable divergent domains in LSU and SSU rDNA. Yet other divergent domains, e.g. D1, were poorly investigated and rarely used. However, these domains might contain additional evolutionary data and play a vital role in DNA-based phylogenetic study. Here, we investigated all available D1 sequences of Arachnida taxa and predicted corresponding secondary structures to help identify homologous positions in the D1 region. Long insertions were found exclusive to Eriophyoidea and folded into three newly proposed helices. Non-Acari taxa were all GC rich. In Acari, most Trombidiformes and all Mesostigmata (Parasitiformes) taxa were AT rich and Ixodida (Parasitiformes) GC rich; however there was no consistent base bias in Sarcoptiformes sequences. For Eriophyoid mites, genera Cecidophyopsis and Aceria were both well supported in MP, NJ, ME and ML tress based on D1 sequences, and clusters of Cecidophyopsis species were identical with former study. This demonstrated that the D1 region could act as a valuable molecular marker in phylogenetic reconstruction of Eriophyoidea. Additionally, D1 has been proven suitable in phylogenetic analysis at the family and genus level in Acari, but not in Opiliones. PMID:26420464

  8. Comparative structural analysis of eubacterial 5S rRNA by oxidation of adenines in the N-1 position.

    PubMed Central

    Pieler, T; Schreiber, A; Erdmann, V A


    Adenines in free 5S rRNA from Escherichia coli, Bacillus stearothermophilus and Thermus thermophilus have been oxidized at their N-1 position using monoperphthalic acid. The determination of the number of adenine 1-N-oxides was on the basis of UV spectroscopic data of the intact molecule. Identification of the most readily accessible nucleotides by sequencing gel analysis reveals that they are located in conserved positions within loops, exposed hairpin loops and single-base bulge loops. Implications for the structure and function of 5S rRNA will be discussed on the basis of this comparative analysis. Images PMID:6201825

  9. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).


    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A


    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA. PMID:26853884

  10. In β-actin knockouts, epigenetic reprogramming and rDNA transcription inactivation lead to growth and proliferation defects.


    Almuzzaini, Bader; Sarshad, Aishe A; Rahmanto, Aldwin S; Hansson, Magnus L; Von Euler, Anne; Sangfelt, Olle; Visa, Neus; Farrants, Ann-Kristin Östlund; Percipalle, Piergiorgio


    Actin and nuclear myosin 1 (NM1) are regulators of transcription and chromatin organization. Using a genome-wide approach, we report here that β-actin binds intergenic and genic regions across the mammalian genome, associated with both protein-coding and rRNA genes. Within the rDNA, the distribution of β-actin correlated with NM1 and the other subunits of the B-WICH complex, WSTF and SNF2h. In β-actin(-/-) mouse embryonic fibroblasts (MEFs), we found that rRNA synthesis levels decreased concomitantly with drops in RNA polymerase I (Pol I) and NM1 occupancies across the rRNA gene. Reintroduction of wild-type β-actin, in contrast to mutated forms with polymerization defects, efficiently rescued rRNA synthesis underscoring the direct role for a polymerization-competent form of β-actin in Pol I transcription. The rRNA synthesis defects in the β-actin(-/-) MEFs are a consequence of epigenetic reprogramming with up-regulation of the repressive mark H3K4me1 (monomethylation of lys4 on histone H3) and enhanced chromatin compaction at promoter-proximal enhancer (T0 sequence), which disturb binding of the transcription factor TTF1. We propose a novel genome-wide mechanism where the polymerase-associated β-actin synergizes with NM1 to coordinate permissive chromatin with Pol I transcription, cell growth, and proliferation.-Almuzzaini, B., Sarshad, A. A. , Rahmanto, A. S., Hansson, M. L., Von Euler, A., Sangfelt, O., Visa, N., Farrants, A.-K. Ö., Percipalle, P. In β-actin knockouts, epigenetic reprogramming and rDNA transcription inactivation lead to growth and proliferation defects. PMID:27127100

  11. Genetic and cytogenetic analyses of the A genome of Triticum monococcum. VIII. Localization of rDNAs and characterization of 5S rRNA genes.


    Kim, N S; Kuspira, J; Armstrong, K; Bhambhani, R


    In situ hybridization with [3H]dCTP labelled pScT7 (5S rDNA) and pTa80 (18S + 26S rDNA) indicated that both hybridized to the terminal regions of two pairs of chromosomes in Triticum monococcum. When the hybridization was performed with a mixture of both probes, only two pairs of chromosome arms were labelled, which suggested that the loci of both genes were located in juxtaposition to one another. Both probes labelled one pair of sites more heavily than the other. Southern analysis of 5S with BamHI-digested DNA from 12 accessions of T. monococcum (including T. urartu) produced two superimposed ladders of approximate sizes of 500 and 330 bp, which differ from T. aestivum in which 500- and 420-bp ladders were found. The 500-bp ladder is derived from chromosome 5A (5SDna-A2) and the 330-bp ladder from chromosome 1A (5SDna-A1). The recognition site for SstI was present in the long spacer region but absent in the short spacer as in T. aestivum; however, unlike T. aestivum, there were HaeIII (GGCC) and HindIII (AAGCTT) recognition sites in the short spacer region. The TaqI recognition sites (TCGA) in the long and short spacer regions are probably more highly methylated in T. monococcum than in T. aestivum. The results have implications regarding the evolutionary changes that occurred in the A genome of the hexaploid compared with the diploid. PMID:18469972

  12. Dynamic changes in the distribution of a satellite homologous to intergenic 26-18S rDNA spacer in the evolution of Nicotiana.

    PubMed Central

    Lim, K Y; Skalicka, K; Koukalova, B; Volkov, R A; Matyasek, R; Hemleben, V; Leitch, A R; Kovarik, A


    An approximately 135-bp sequence called the A1/A2 repeat was isolated from the transcribed region of the 26-18S rDNA intergenic spacer (IGS) of Nicotiana tomentosiformis. Fluorescence in situ hybridization (FISH) and Southern blot analysis revealed its occurrence as an independent satellite (termed an A1/A2 satellite) outside of rDNA loci in species of Nicotiana section Tomentosae. The chromosomal location, patterns of genomic dispersion, and copy numbers of its tandemly arranged units varied between the species. In more distantly related Nicotiana species the A1/A2 repeats were found only at the nucleolar organizer regions (NOR). There was a trend toward the elimination of the A1/A2 satellite in N. tabacum (tobacco), an allotetraploid with parents closely related to the diploids N. sylvestris and N. tomentosiformis. This process may have already commenced in an S(3) generation of synthetic tobacco. Cytosine residues in the IGS were significantly hypomethylated compared with the A1/A2 satellite. There was no clear separation between the IGS and satellite fractions in sequence analysis of individual clones and we found no evidence for CG suppression. Taken together the data indicate a dynamic nature of the A1/A2 repeats in Nicotiana genomes, with evidence for recurrent integration, copy number expansions, and contractions. PMID:15126410

  13. Taiwanese Trichogramma of Asian Corn Borer: Morphology, ITS-2 rDNA Characterization, and Natural Wolbachia Infection

    PubMed Central

    Wu, Li-Hsin; Hoffmann, Ary A.; Thomson, Linda J.


    Egg parasitoids of the genus Trichogramma are natural enemies of many lepidopteran borers in agricultural areas around the world. It is important to identify the correct species and ideally focus on endemic Trichogramma for pest control in particular crops. In this study, Trichogramma wasps were collected from parasitized eggs of Asian corn borer in Southwestern Taiwan. Three Trichogramma species, Trichogramma ostriniae Pang and Chen, Trichogramma chilonis Ishii, and T. sp. y, were identified based on morphology and the nucleotide sequence of the internal transcribed spacer 2 (ITS-2) region of rDNA. Although T. ostriniae and T. sp. y appear to be morphologically similar, ITS-2 identity between these two taxa is only 89%. Surprisingly, a commercially released Trichogramma colony thought to be T. chilonis possessed 99% identity (ITS-2) with the field T. sp. y individuals. This suggests past contamination leading to subsitution of the laboratory-reared T. chilonis colony by T. sp. y. Natural populations of all three Trichogramma species were found to be infected by a single Wolbachia strain which was identified using a wsp gene sequence. PMID:26896674

  14. Taiwanese Trichogramma of Asian Corn Borer: Morphology, ITS-2 rDNA Characterization, and Natural Wolbachia Infection.


    Wu, Li-Hsin; Hoffmann, Ary A; Thomson, Linda J


    Egg parasitoids of the genus Trichogramma are natural enemies of many lepidopteran borers in agricultural areas around the world. It is important to identify the correct species and ideally focus on endemic Trichogramma for pest control in particular crops. In this study, Trichogramma wasps were collected from parasitized eggs of Asian corn borer in Southwestern Taiwan. Three Trichogramma species, Trichogramma ostriniae Pang and Chen, Trichogramma chilonis Ishii, and T. sp. y, were identified based on morphology and the nucleotide sequence of the internal transcribed spacer 2 (ITS-2) region of rDNA. Although T. ostriniae and T. sp. y appear to be morphologically similar, ITS-2 identity between these two taxa is only 89%. Surprisingly, a commercially released Trichogramma colony thought to be T. chilonis possessed 99% identity (ITS-2) with the field T. sp. y individuals. This suggests past contamination leading to subsitution of the laboratory-reared T. chilonis colony by T. sp. y. Natural populations of all three Trichogramma species were found to be infected by a single Wolbachia strain which was identified using a wsp gene sequence. PMID:26896674

  15. B chromosome in the beetle Coprophanaeus cyanescens (Scarabaeidae): emphasis in the organization of repetitive DNA sequences

    PubMed Central


    Background To contribute to the knowledge of coleopteran cytogenetics, especially with respect to the genomic content of B chromosomes, we analyzed the composition and organization of repetitive DNA sequences in the Coprophanaeus cyanescens karyotype. We used conventional staining and the application of fluorescence in situ hybridization (FISH) mapping using as probes C0t-1 DNA fraction, the 18S and 5S rRNA genes, and the LOA-like non-LTR transposable element (TE). Results The conventional analysis detected 3 individuals (among 50 analyzed) carrying one small metacentric and mitotically unstable B chromosome. The FISH analysis revealed a pericentromeric block of C0t-1 DNA in the B chromosome but no 18S or 5S rDNA clusters in this extra element. Using the LOA-like TE probe, the FISH analysis revealed large pericentromeric blocks in eight autosomal bivalents and in the B chromosome, and a pericentromeric block extending to the short arm in one autosomal pair. No positive hybridization signal was observed for the LOA-like element in the sex chromosomes. Conclusions The results indicate that the origin of the B chromosome is associated with the autosomal elements, as demonstrated by the hybridization with C0t-1 DNA and the LOA-like TE. The present study is the first report on the cytogenetic mapping of a TE in coleopteran chromosomes. These TEs could have been involved in the origin and evolution of the B chromosome in C. cyanescens. PMID:23131070

  16. A Natural Polymorphism in rDNA Replication Origins Links Origin Activation with Calorie Restriction and Lifespan

    PubMed Central

    Kwan, Elizabeth X.; Foss, Eric J.; Tsuchiyama, Scott; Alvino, Gina M.; Kruglyak, Leonid; Kaeberlein, Matt; Raghuraman, M. K.; Brewer, Bonita J.; Kennedy, Brian K.; Bedalov, Antonio


    Aging and longevity are complex traits influenced by genetic and environmental factors. To identify quantitative trait loci (QTLs) that control replicative lifespan, we employed an outbred Saccharomyces cerevisiae model, generated by crossing a vineyard and a laboratory strain. The predominant QTL mapped to the rDNA, with the vineyard rDNA conferring a lifespan increase of 41%. The lifespan extension was independent of Sir2 and Fob1, but depended on a polymorphism in the rDNA origin of replication from the vineyard strain that reduced origin activation relative to the laboratory origin. Strains carrying vineyard rDNA origins have increased capacity for replication initiation at weak plasmid and genomic origins, suggesting that inability to complete genome replication presents a major impediment to replicative lifespan. Calorie restriction, a conserved mediator of lifespan extension that is also independent of Sir2 and Fob1, reduces rDNA origin firing in both laboratory and vineyard rDNA. Our results are consistent with the possibility that calorie restriction, similarly to the vineyard rDNA polymorphism, modulates replicative lifespan through control of rDNA origin activation, which in turn affects genome replication dynamics. PMID:23505383

  17. Differentiation of anaerobic polycentric fungi by rDNA PCR-RFLP.


    Fliegerová, K; Mrázek, J; Voigt, K


    The suitability of restriction fragment length polymorphism (RFLP) analysis of the ribosomal DNA cluster for discriminating two genera of anaerobic polycentric fungi, Orpinomyces and Anaeromyces, was determined. Three PCR-amplified DNA fragments--nuclear small subunit (SSU; 18S rDNA), the nuclear large subunit (LSU; 28S rDNA) and internal transcribed spacer (ITS)--were restricted with endonucleases AluI, DraI, HinfI and MboI. Although the SSU DNA fragment could be restricted successfully by all four enzymes, no differences were observed between restriction patterns of Orpinomyces and Anaeromyces. The most polymorphic restriction pattern between Orpinomyces and Anaeromyces resulted from cleavage of LSU rDNA fragments cut by AluI and HinfI and ITS fragment cut by DraI and HinfI. Genus-specific RFLP patterns were determined for Orpinomyces and Anaeromyces genera; the results showed that the PCR-RFLP analysis of rDNA offers an easy and rapid tool for differentiation of two polycentric genera of anaerobic fungi, which could be hardly separated on the basis of morphology. PMID:17007423

  18. Top2 and Sgs1-Top3 Act Redundantly to Ensure rDNA Replication Termination

    PubMed Central

    Fredsøe, Jacob; Nielsen, Ida; Pedersen, Jakob Madsen; Bentsen, Iben Bach; Lisby, Michael; Bjergbaek, Lotte; Andersen, Anni H


    Faithful DNA replication with correct termination is essential for genome stability and transmission of genetic information. Here we have investigated the potential roles of Topoisomerase II (Top2) and the RecQ helicase Sgs1 during late stages of replication. We find that cells lacking Top2 and Sgs1 (or Top3) display two different characteristics during late S/G2 phase, checkpoint activation and accumulation of asymmetric X-structures, which are both independent of homologous recombination. Our data demonstrate that checkpoint activation is caused by a DNA structure formed at the strongest rDNA replication fork barrier (RFB) during replication termination, and consistently, checkpoint activation is dependent on the RFB binding protein, Fob1. In contrast, asymmetric X-structures are formed independent of Fob1 at less strong rDNA replication fork barriers. However, both checkpoint activation and formation of asymmetric X-structures are sensitive to conditions, which facilitate fork merging and progression of replication forks through replication fork barriers. Our data are consistent with a redundant role of Top2 and Sgs1 together with Top3 (Sgs1-Top3) in replication fork merging at rDNA barriers. At RFB either Top2 or Sgs1-Top3 is essential to prevent formation of a checkpoint activating DNA structure during termination, but at less strong rDNA barriers absence of the enzymes merely delays replication fork merging, causing an accumulation of asymmetric termination structures, which are solved over time. PMID:26630413

  19. Clinorotation influences rDNA and NopA100 localization in nucleoli

    NASA Astrophysics Data System (ADS)

    Sobol, M. A.; González-Camacho, F.; Rodríguez-Vilariño, V.; Kordyum, E. L.; Medina, F. J.

    The nucleolus is the transcription site of rRNA genes as well as the site of processing and initial packaging of their transcripts. The plant nucleolin homologue NopA100 is involved in the regulation of r-chromatin condensation/expansion and rDNA transcription as well as in rRNA processing. We have investigated with immunogold electron microscopy the location of nucleolar DNA and NopA100 in cress root meristematic cells grown under slow horizontal clinorotation, reproducing an important feature of microgravity, namely the absence of an orienting action of a gravity vector, compared to control conditions. We demonstrate redistribution of both rDNA and NopA100 in nucleolar subcomponents induced by clinorotation. Ribosomal DNA concentrated predominantly in fibrillar centers in the form of condensed r-chromatin inclusions and internal non condensed fibrils, redistributing from the dense fibrillar component and the transition zone between fibrillar centers and the dense fibrillar component, recognized as the loci of rDNA transcription. The content of NopA100 was much higher in the inner space of fibrillar centers and reduced in the dense fibrillar component as compared to the control. Based on these data, an effect of slow horizontal clinorotation in lowering the level of rDNA transcription as well as rRNA processing is suggested.

  20. Relationships between rDNA, Nop1 and Sir complex in biotechnologically relevant distillery yeasts.


    Adamczyk, Jagoda; Deregowska, Anna; Potocki, Leszek; Kuna, Ewelina; Kaplan, Jakub; Pabian, Sylwia; Kwiatkowska, Aleksandra; Lewinska, Anna; Wnuk, Maciej


    Distillery yeasts are poorly characterized physiological group among the Saccharomyces sensu stricto complex. As industrial yeasts are under constant environmental stress during fermentation processes and the nucleolus is a stress sensor, in the present study, nucleolus-related parameters were evaluated in 22 commercially available distillery yeast strains. Distillery yeasts were found to be a heterogeneous group with a variable content and length of rDNA and degree of nucleolus fragmentation. The levels of rDNA were negatively correlated with Nop1 (r = -0.59, p = 0.0038). Moreover, the protein levels of Sir transcriptional silencing complex and longevity regulators, namely Sir1, Sir2, Sir3 and Fob1, were studied and negative correlations between Sir2 and Nop1 (r = -0.45, p = 0.0332), and between Sir2 and Fob1 (r = -0.49, p = 0.0211) were revealed. In general, S. paradoxus group of distillery yeasts with higher rDNA pools and Sir2 level than S. bayanus group was found to be more tolerant to fermentation-associated stress stimuli, namely mild cold/heat stresses and KCl treatment. We postulate that rDNA state may be considered as a novel factor that may modulate a biotechnological process. PMID:27329282

  1. Simple detection of the 5S ribosomal RNA of Pneumocystis carinii using in situ hybridisation.

    PubMed Central

    Kobayashi, M; Urata, T; Ikezoe, T; Hakoda, E; Uemura, Y; Sonobe, H; Ohtsuki, Y; Manabe, T; Miyagi, S; Miyoshi, I


    AIMS: To investigate the effectiveness of digoxigenin incorporated double stranded DNA probes produced by the polymerase chain reaction (PCR), for the detection of Pneumocystis carinii, using in situ hybridisation (ISH). METHODS: Formalin fixed, paraffin wax embedded sections of 26 human lung samples from 11 patients with P carinii pneumonia (PCP), and 15 with various types of fungal and viral pneumonia, were obtained during necropsy or transbronchial lung biopsy. Three additional PCP induced rat lung samples were also tested. PCR probes were prepared using the digoxigenin labelling mixture, and they were amplified from the DNA of a PCP induced rat lung after administration of dexamethasone, on the basis that 5S ribosomal RNA sequences are identical in human and rat P carinii. ISH was performed using this probe, and visualised using the digoxigenin nucleic acid detection kit. An immunohistochemical study using anti-human Pneumocystis monoclonal antibody was also carried out in parallel. RESULTS: ISH positively stained eight (of eight) lung necropsy specimens from patients with PCP, three (of three) transbronchial lung biopsy specimens from patients with PCP, and none of the three PCP induced rat lung specimens. In contrast, none of the specimens from patients with pneumonia caused by Aspergillus sp (n = 5), Candida sp (n = 4), Cryptococcus sp (n = 2), mucormycosis (n = 2), or cytomegalovirus (n = 2) were positive on ISH or immunohistochemistry. CONCLUSIONS: Using a digoxigenin labelled PCR probe for the entire 5S rRNA sequence in conjunction with conventional staining, ISH is highly reactive and specific for the diagnosis of PCP. Images PMID:9038753

  2. Aberrant DNA Methylation of rDNA and PRIMA1 in Borderline Personality Disorder.


    Teschler, Stefanie; Gotthardt, Julia; Dammann, Gerhard; Dammann, Reinhard H


    Borderline personality disorder (BPD) is a serious psychic disease with a high risk for suicide. DNA methylation is a hallmark for aberrant epigenetic regulation and could be involved in the etiology of BPD. Previously, it has been reported that increased DNA methylation of neuropsychiatric genes is found in the blood of patients with BPD compared to healthy controls. Here, we analyzed DNA methylation patterns of the ribosomal RNA gene (rDNA promoter region and 5'-external transcribed spacer/5'ETS) and the promoter of the proline rich membrane anchor 1 gene (PRIMA1) in peripheral blood samples of 24 female patients (mean age (33 ± 11) years) diagnosed with DSM-IV BPD and in 11 female controls (mean age (32 ± 7) years). A significant aberrant methylation of rDNA and PRIMA1 was revealed for BPD patients using pyrosequencing. For the promoter of PRIMA1, the average methylation of six CpG sites was 1.6-fold higher in BPD patients compared to controls. In contrast, the methylation levels of the rDNA promoter region and the 5'ETS were significantly lower (0.9-fold) in patients with BPD compared to controls. Thus, for nine CpGs located in the rDNA promoter region and for four CpGs at the 5'ETS decreased methylation was found in peripheral blood of patients compared to controls. Our results suggest that aberrant methylation of rDNA and PRIMA1 is associated with the pathogenesis of BPD. PMID:26742039

  3. Aberrant DNA Methylation of rDNA and PRIMA1 in Borderline Personality Disorder

    PubMed Central

    Teschler, Stefanie; Gotthardt, Julia; Dammann, Gerhard; Dammann, Reinhard H.


    Borderline personality disorder (BPD) is a serious psychic disease with a high risk for suicide. DNA methylation is a hallmark for aberrant epigenetic regulation and could be involved in the etiology of BPD. Previously, it has been reported that increased DNA methylation of neuropsychiatric genes is found in the blood of patients with BPD compared to healthy controls. Here, we analyzed DNA methylation patterns of the ribosomal RNA gene (rDNA promoter region and 5′-external transcribed spacer/5′ETS) and the promoter of the proline rich membrane anchor 1 gene (PRIMA1) in peripheral blood samples of 24 female patients (mean age (33 ± 11) years) diagnosed with DSM-IV BPD and in 11 female controls (mean age (32 ± 7) years). A significant aberrant methylation of rDNA and PRIMA1 was revealed for BPD patients using pyrosequencing. For the promoter of PRIMA1, the average methylation of six CpG sites was 1.6-fold higher in BPD patients compared to controls. In contrast, the methylation levels of the rDNA promoter region and the 5′ETS were significantly lower (0.9-fold) in patients with BPD compared to controls. Thus, for nine CpGs located in the rDNA promoter region and for four CpGs at the 5′ETS decreased methylation was found in peripheral blood of patients compared to controls. Our results suggest that aberrant methylation of rDNA and PRIMA1 is associated with the pathogenesis of BPD. PMID:26742039

  4. Domain rearrangement of SRP protein Ffh upon binding 4.5S RNA and the SRP receptor FtsY

    PubMed Central



    The signal recognition particle (SRP) mediates membrane targeting of translating ribosomes displaying a signal-anchor sequence. In Escherichia coli, SRP consists of 4.5S RNA and a protein, Ffh, that recognizes the signal peptide emerging from the ribosome and the SRP receptor at the membrane, FtsY. In the present work, we studied the interactions between the NG and M domains in Ffh and their rearrangements upon complex formation with 4.5S RNA and/or FtsY. In free Ffh, the NG and M domains are facing one another in an orientation that allows cross-linking between positions 231 in the G domain and 377 in the M domain. There are binding interactions between the two domains, as the isolated domains form a strong complex. The interdomain contacts are disrupted upon binding of Ffh to 4.5S RNA, consuming a part of the total binding energy of 4.5S RNA-Ffh association that is roughly equivalent to the free energy of domain binding to each other. In the SRP particle, the NG domain binds to 4.5S RNA in a region adjacent to the binding site of the M domain. Ffh binding to FtsY also requires a reorientation of NG and M domains. These results suggest that in free Ffh, the binding sites for 4.5S RNA and FtsY are occluded by strong domain–domain interactions which must be disrupted for the formation of SRP or the Ffh-FtsY complex. PMID:15923378

  5. Domain rearrangement of SRP protein Ffh upon binding 4.5S RNA and the SRP receptor FtsY.


    Buskiewicz, Iwona; Kubarenko, Andriy; Peske, Frank; Rodnina, Marina V; Wintermeyer, Wolfgang


    The signal recognition particle (SRP) mediates membrane targeting of translating ribosomes displaying a signal-anchor sequence. In Escherichia coli, SRP consists of 4.5S RNA and a protein, Ffh, that recognizes the signal peptide emerging from the ribosome and the SRP receptor at the membrane, FtsY. In the present work, we studied the interactions between the NG and M domains in Ffh and their rearrangements upon complex formation with 4.5S RNA and/or FtsY. In free Ffh, the NG and M domains are facing one another in an orientation that allows cross-linking between positions 231 in the G domain and 377 in the M domain. There are binding interactions between the two domains, as the isolated domains form a strong complex. The interdomain contacts are disrupted upon binding of Ffh to 4.5S RNA, consuming a part of the total binding energy of 4.5S RNA-Ffh association that is roughly equivalent to the free energy of domain binding to each other. In the SRP particle, the NG domain binds to 4.5S RNA in a region adjacent to the binding site of the M domain. Ffh binding to FtsY also requires a reorientation of NG and M domains. These results suggest that in free Ffh, the binding sites for 4.5S RNA and FtsY are occluded by strong domain-domain interactions which must be disrupted for the formation of SRP or the Ffh-FtsY complex. PMID:15923378

  6. rDNA genetic imbalance and nucleolar chromatin restructuring is induced by distant hybridization between Raphanus sativus and Brassica alboglabra.


    Long, Hong; Chen, Chunli; Wang, Bing; Feng, Yanni


    The expression of rDNA in hybrids inherited from only one progenitor refers to nucleolar dominance. The molecular basis for choosing which genes to silence remains unclear. We report genetic imbalance induced by distant hybridization correlates with formation of rDNA genes (NORs) in the hybrids between Raphanus sativus L. and Brassica alboglabra Bailey. Moreover, increased CCGG methylation of rDNA in F1 hybrids is concomitant with Raphanus-derived rDNA gene silencing and rDNA transcriptional inactivity revealed by nucleolar configuration restriction. Newly formed rDNA gene locus occurred through chromosomal in F1 hybrids via chromosomal imbalance. NORs are gained de novo, lost, and/or transposed in the new genome. Inhibition of methyltransferases leads to changes in nucleolar architecture, implicating a key role of methylation in control of nucleolar dominance and vital nucleolar configuration transition. Our findings suggest that gene imbalance and methylation-related chromatin restructuring is important for rDNA gene silencing that may be crucial for synthesis of specific proteins. PMID:25723542

  7. RNA Polymerase I and Fob1 contributions to transcriptional silencing at the yeast rDNA locus.


    Buck, Stephen W; Maqani, Nazif; Matecic, Mirela; Hontz, Robert D; Fine, Ryan D; Li, Mingguang; Smith, Jeffrey S


    RNA polymerase II (Pol II)-transcribed genes embedded within the yeast rDNA locus are repressed through a Sir2-dependent process called 'rDNA silencing'. Sir2 is recruited to the rDNA promoter through interactions with RNA polymerase I (Pol I), and to a pair of DNA replication fork block sites (Ter1 and Ter2) through interaction with Fob1. We utilized a reporter gene (mURA3) integrated adjacent to the leftmost rDNA gene to investigate localized Pol I and Fob1 functions in silencing. Silencing was attenuated by loss of Pol I subunits or insertion of an ectopic Pol I terminator within the adjacent rDNA gene. Silencing left of the rDNA array is naturally attenuated by the presence of only one intact Fob1 binding site (Ter2). Repair of the 2nd Fob1 binding site (Ter1) dramatically strengthens silencing such that it is no longer impacted by local Pol I transcription defects. Global loss of Pol I activity, however, negatively affects Fob1 association with the rDNA. Loss of Ter2 almost completely eliminates localized silencing, but is restored by artificially targeting Fob1 or Sir2 as Gal4 DNA binding domain fusions. We conclude that Fob1 and Pol I make independent contributions to establishment of silencing, though Pol I also reinforces Fob1-dependent silencing. PMID:27060141

  8. Homology-dependent repair is involved in 45S rDNA loss in plant CAF-1 mutants

    PubMed Central

    Muchová, Veronika; Amiard, Simon; Mozgová, Iva; Dvořáčková, Martina; Gallego, Maria E; White, Charles; Fajkus, Jiří


    Arabidopsis thaliana mutants in FAS1 and FAS2 subunits of chromatin assembly factor 1 (CAF1) show progressive loss of 45S rDNA copies and telomeres. We hypothesized that homology-dependent DNA damage repair (HDR) may contribute to the loss of these repeats in fas mutants. To test this, we generated double mutants by crossing fas mutants with knock-out mutants in RAD51B, one of the Rad51 paralogs of A. thaliana. Our results show that the absence of RAD51B decreases the rate of rDNA loss, confirming the implication of RAD51B-dependent recombination in rDNA loss in the CAF1 mutants. Interestingly, this effect is not observed for telomeric repeat loss, which thus differs from that acting in rDNA loss. Involvement of DNA damage repair in rDNA dynamics in fas mutants is further supported by accumulation of double-stranded breaks (measured as γ-H2AX foci) in 45S rDNA. Occurrence of the foci is not specific for S-phase, and is ATM-independent. While the foci in fas mutants occur both in the transcribed (intranucleolar) and non-transcribed (nucleoplasmic) fraction of rDNA, double fas rad51b mutants show a specific increase in the number of the intranucleolar foci. These results suggest that the repair of double-stranded breaks present in the transcribed rDNA region is RAD51B dependent and that this contributes to rDNA repeat loss in fas mutants, presumably via the single-stranded annealing recombination pathway. Our results also highlight the importance of proper chromatin assembly in the maintenance of genome stability. PMID:25359579

  9. The world in a river? A preliminary analysis of the 16S rDNA variability of Tubifex species (Clitellata: Tubificidae) from the Lambro River.


    Crottini, Angelica; Marotta, Roberto; Barbuto, Michela; Casiraghi, Maurizio; Ferraguti, Marco


    Tubifex tubifex Müller, 1774 is a cosmopolitan freshwater tubificid widely used as a model in ecotoxicology, population dynamics and developmental biology. It is traditionally recognized as a polytypic species and in Lambro River (Milano, Northern Italy) it occurs in two of the three recognized forms, named "tubifex" and "blanchardi", alternatively considered as ecological forms or distinct species. To investigate the genetic differentiation of the populations occurring in the Lambro River we sequenced a fragment of the 16S rDNA mitochondrial gene. T. blanchardi, characterized by a low genetic diversity, was genetically segregated from the other sympatric T. tubifex. The ancestral state reconstruction was used to define the morphological traits that support its distinctness. On the contrary, the other T. tubifex from the Lambro community, although morphologically indistinguishable, revealed an astonishing degree of genetic variability, both between and within the three identified clades that proved to be genetically isolated. Using samples from the mixed Lambro River community and from other countries around the world we present an overview of the species complex' 16S rDNA variability. Our results show that the genetic variability did not sensibly increase widening the data set, suggesting that the Lambro River populations meet the species' worldwide genetic variability. PMID:18625325

  10. Formal Revision of the Alexandrium tamarense Species Complex (Dinophyceae) Taxonomy: The Introduction of Five Species with Emphasis on Molecular-based (rDNA) Classification

    PubMed Central

    John, Uwe; Litaker, R. Wayne; Montresor, Marina; Murray, Shauna; Brosnahan, Michael L.; Anderson, Donald M.


    The Alexandrium tamarense species complex is one of the most studied marine dinoflagellate groups due to its ecological, toxicological and economic importance. Several members of this complex produce saxitoxin and its congeners – potent neurotoxins that cause paralytic shellfish poisoning. Isolates from this complex are assigned to A. tamarense, A. fundyense, or A. catenella based on two main morphological characters: the ability to form chains and the presence/absence of a ventral pore between Plates 1′ and 4′. However, studies have shown that these characters are not consistent and/or distinctive. Further, phylogenies based on multiple regions in the rDNA operon indicate that the sequences from morphologically indistinguishable isolates partition into five clades. These clades were initially named based on their presumed geographic distribution, but recently were renamed as Groups I–V following the discovery of sympatry among some groups. In this study we present data on morphology, ITS/5.8S genetic distances, ITS2 compensatory base changes, mating incompatibilities, toxicity, the sxtA toxin synthesis gene, and rDNA phylogenies. All results were consistent with each group representing a distinct cryptic species. Accordingly, the groups were assigned species names as follows: Group I, A. fundyense; Group II, A. mediterraneum; Group III, A. tamarense; Group IV, A. pacificum; Group V, A. australiense. PMID:25460230

  11. Morphology and Small Subunit rDNA Phylogeny of Two New Marine Urostylid Ciliates, Caudiholosticha marina sp. nov. and Nothoholosticha flava sp. nov. (Ciliophora, Hypotrichia).


    Li, Ju; Chen, Xumiao; Xu, Kuidong


    Two marine urostylid ciliates, Caudiholosticha marina sp. nov. and Nothoholosticha flava sp. nov., isolated from intertidal sediment in the Yellow Sea, are investigated using morphological and small subunit rDNA phylogenetic analyses. Caudiholosticha marina is 210-310 μm × 40-55 μm in vivo, and has 10-20 macronuclear nodules, 23-37 midventral cirral pairs extending to 5-8 transverse cirri, and two caudal cirri. It differs from congeners by its marine habitat, larger size, macronuclear arrangement pattern and high number of midventral pairs. Molecular phylogenetic analyses indicate a polyphyly of Caudiholosticha. Nothoholosticha flava is yellow to brownish and 240-320 μm × 40-60 μm sized, and has a bipartite adoral zone, six frontal cirri in atypical bicorona, usually four frontoterminal, one buccal and 5-7 transverse cirri and 28-54 midventral pairs. Phylogenetic analyses allocate N. flava as sister of N. fasciola, type of the genus. The two Nothoholosticha species differ distinctly by the presence/absence of frontoterminal cirri, a feature often used to define genera in the Hypotrichia. However, the SSU rDNA sequence similarity between these two species is 99.3%, which weakens the justification for separating the new isolate at genus level. The taxonomic significance of frontoterminal cirri is discussed based on morphological and molecular data. PMID:26663360

  12. The effective expression of xylanase gene in Candida utilis by 18S rDNA targeted homologous recombination in pGLR9K.


    Wei, Wang; Hong-Lan, Yang; HuiFang, Bao; Daoyuan, Zhang; Qi-mu-ge, Shan; Woof, Andrew J


    In order to test whether 18S rDNA can influence positively xylanase gene effective expression in the yeast of Candida utilis, a targeting vector pGLR9K-XA was constructed by adding an interested gene xynA from Streptomyces olivaceoviridis into the vector pGLR9K which is constructed by ourselves. pGLR9K contains the 18S rDNA, GAP promoter and CYH resistance gene sequence, all of which is from C. utilis. Then the vector pGLR9K-XA was transformed into C. utilis. To test the vector and transformed system, PCR, Southern blot and DNS methods were used. The results showed that xylanase gene can be detected in the chromosome DNA of recombinant C. utilis and the enzyme activity of xylanase is up to 60 IU ml(-1) in the study. It is suggested that this system can be used to express exogenous genes in C. utilis as a bioreactors. This is the first report that xylanase gene was expressed in C. utilis. PMID:19731075

  13. [Communities of Actynomicetes fungy in three vegetation types of the Colombian Amazon: abundance, morphotypes and the 16s rDNA gene].


    Cardona, Gladys Inés; Peña-Venegas, Clara Patricia; Ruiz-García, Manuel


    Among soil microorganisms, Actinomycetes play an important role in the sustainability of natural and agricultural systems: decomposition of organic matter; degradation of recalcitrant compounds like lignin; nitrogen fixation; degradation of agricultural chemicals and biological control in plants and animals. We evaluated their diversity in soils under three different vegetation covers (pasture, tropical primary forest and stubble) at two depths in the Southern Colombian Amazon border. We collected five replicates per vegetation type (in each, three samples at 0-20cm and three at 20-30cm; for a total of 30 samples). Abundance and phenotypic diversity were determined by plate counting. Genomic DNA was extracted from the isolates: the 16s rDNA gene was amplified with specific primers, and its genetic diversity was estimated by means of an amplified restriction analysis (ARDRA). Actynomicetes abundance varied with vegetation and depth, possibly reflecting presence of earthworms, macro-fauna and physico-chemical characteristics associated to fertility, as well as organic matter, total bases, and optimal capacity to cationic interchange. Primary forests had the highest diversity. Sixteen morpho-types (six genera) were identified; Streptomyces was the most abundant everywhere. The heterogeneity ofARDRA patterns prevented species identification because of the intra-species variability in sequences of 16s rDNA operons. This community is a biological indicator of landscape alteration and could include new bio-active compounds of pharmaceutical interest. PMID:20073339

  14. When molecules support morphology: Phylogenetic reconstruction of the family Onuphidae (Eunicida, Annelida) based on 16S rDNA and 18S rDNA.


    Budaeva, Nataliya; Schepetov, Dmitry; Zanol, Joana; Neretina, Tatiana; Willassen, Endre


    Onuphid polychaetes are tubicolous marine worms commonly reported worldwide from intertidal areas to hadal depths. They often dominate in benthic communities and have economic importance in aquaculture and recreational fishing. Here we report the phylogeny of the family Onuphidae based on the combined analyses of nuclear (18S rDNA) and mitochondrial (16S rDNA) genes. Results of Bayesian and Maximum Likelihood analyses supported the monophyly of Onuphidae and its traditional subdivision into two monophyletic subfamilies: Onuphinae and Hyalinoeciinae. Ten of 22 recognized genera were monophyletic with strong node support; four more genera included in this study were either monotypic or represented by a single species. None of the genera appeared para- or polyphyletic and this indicates a strong congruence between the traditional morphology-based systematics of the family and the newly obtained molecular-based phylogenetic reconstructions. Intergeneric relationships within Hyalinoeciinae were not resolved. Two strongly supported monophyletic groups of genera were recovered within Onuphinae: ((Onuphis, Aponuphis), Diopatra, Paradiopatra) and (Hirsutonuphis, (Paxtonia, (Kinbergonuphis, Mooreonuphis))). A previously accepted hypothesis on the subdivision of Onuphinae into the Onuphis group of genera and the Diopatra group of genera was largely rejected. PMID:26497420

  15. Radiative lifetime of the 3s3p exp 3(exp 5 S sub 2 exp 0) metastable level of P(+)

    NASA Technical Reports Server (NTRS)

    Calamai, Anthony G.; Han, Xiaofeng; Parkinson, William H.


    The present experimental and theoretical results for the radiative lifetime of the 3s3p exp 3(exp 5 S sub 2 exp 0) metastable level of P(+) encompass an experimental determination of the (exp 5 S sub 2 exp 0) lifetime which represents the first measured lifetime of a low charge-state ion in the Si I sequence. This constitutes a fundamental test of the theoretical methods used to determine transition possibilities for intercombination lines involving this level, and suggests that theoretical techniques used to determine such transition probabilities in low-Z species of the Si I isoelectronic sequence should be reevaluated.

  16. Structural polymorphism in the major groove of a 5S RNA gene complements the zinc finger domains of transcription factor IIIA.

    PubMed Central

    Huber, P W; Morii, T; Mei, H Y; Barton, J K


    Metal complexes that bind to DNA on the basis of shape-selection have been used to map the conformational features of the DNA binding site for transcription factor IIIA. Conformationally distinct segments are detected on the 5S rRNA gene that correspond closely to the binding sites identified for the individual zinc finger domains of the protein. The local conformations are characterized by a major groove opened because of a change in base pair inclination and/or displacement at a central 5'-pyrimidine-purine-3' step, flanked by a widened minor groove, as would arise at the junctions between alternating B- and A-like DNA segments. Docking experiments with a consensus structure of a zinc finger reveal that the mixed A-B binding site accommodates the peptide domain better than either canonical B- or A-DNA helices. The close structural matching of the conformational variations in the 5S rDNA both to the proposed sites of zinc finger binding and to the shape of an individual zinc finger domain points to DNA structural polymorphism as providing an important determinant in recognition. In particular, shape selection in the 5' half of the internal control region may orient the multiple finger domains. Images PMID:1961749

  17. Detection of novel organisms associated with salpingitis, by use of 16S rDNA polymerase chain reaction.


    Hebb, Jennifer K; Cohen, Craig R; Astete, Sabina G; Bukusi, Elizabeth A; Totten, Patricia A


    Although Chlamydia trachomatis and Neisseria gonorrhoeae are established causes of salpingitis, the majority of cases have no known etiology. We used broad-range 16S rDNA polymerase chain reaction to identify novel, possibly uncultivable, bacteria associated with salpingitis and identified bacterial 16S sequences in Fallopian-tube specimens from 11 (24%) of 45 consecutive women with laparoscopically confirmed acute salpingitis (the case patients) and from 0 of 44 women seeking tubal ligations (the control subjects) at Kenyatta National Hospital, Nairobi, Kenya. Bacterial phylotypes most closely related to Leptotrichia spp. were detected as the sole phylotypes in 1, and mixed with other bacterial phylotypes in 2, specimens. Novel bacterial phylotypes and those associated with bacterial vaginosis, including Atopobium vaginae, were identified in 3 specimens. N. gonorrhoeae and Streptococcus pyogenes were identified in 2 and 1 specimens, respectively. The finding of novel phylotypes associated with salpingitis has important implications for the etiology, pathogenesis, and treatment of this important reproductive-tract disease syndrome. PMID:15551209

  18. D5S351 and D5S1414 located at the spinal muscular atrophy critical region represent novel informative markers in the Iranian population

    PubMed Central

    Sedghi, Maryam; Vallian, Sadeq


    Spinal muscular atrophy (SMA) is a degenerative neuromuscular disease associated with progressive symmetric weakness and atrophy of the limb muscles. In view of the involvement of numerous point mutations and deletions associated with the disease, the application of polymorphic markers flanking the SMA critical region could be valuable in molecular diagnosis of the disease. In the present study, D5S351 and D5S1414 polymorphic markers located at the SMA critical region in the Iranian populations were characterized. Genotyping of the markers indicated the presence of six and nine different alleles for D5S351 and D5S1414, respectively. Haplotype frequency estimation in 25 trios families and 75 unrelated individuals indicated the presence of six informative haplotypes with frequency higher than 0.05 in the studied population. Furthermore, the D′ coefficient and the χ2 value for D5S351 and D5S1414 markers revealed the presence of linkage disequilibrium between the two markers in the Iranians. These data suggested that D5S351 and D5S1414 could be suggested as informative markers for linkage analysis and molecular diagnosis of SMA in the Iranian population. PMID:26693404

  19. Comparative chromosome mapping of repetitive sequences. Implications for genomic evolution in the fish, Hoplias malabaricus

    PubMed Central

    Cioffi, Marcelo B; Martins, Cesar; Bertollo, Luiz AC


    Background Seven karyomorphs of the fish, Hoplias malabaricus (A-G) were previously included in two major groups, Group I (A, B, C, D) and Group II (E, F, G), based on their similar karyotype structure. In this paper, karyomorphs from Group I were analyzed by means of distinct chromosomal markers, including silver-stained nucleolar organizer regions (Ag-NORs) and chromosomal location of repetitive sequences (18S and 5S rDNA, and satellite 5SHindIII-DNA), through fluorescence in situ hybridization (FISH), in order to evaluate the evolutionary relationships among them. Results The results showed that several chromosomal markers had conserved location in the four karyomorphs. In addition, some other markers were only conserved in corresponding chromosomes of karyomorphs A-B and C-D. These data therefore reinforced and confirmed the proposed grouping of karyomorphs A-D in Group I and highlight a closer relationship between karyomorphs A-B and C-D. Moreover, the mapping pattern of some markers on some autosomes and on the chromosomes of the XY and X1X2Y systems provided new evidence concerning the possible origin of the sex chromosomes. Conclusion The in situ investigation of repetitive DNA sequences adds new informative characters useful in comparative genomics at chromosomal level and provides insights into the evolutionary relationships among Hoplias malabaricus karyomorphs. PMID:19583858

  20. Molecular phylogeny and evolution of Scomber (Teleostei: Scombridae) based on mitochondrial and nuclear DNA sequences

    NASA Astrophysics Data System (ADS)

    Cheng, Jiao; Gao, Tianxiang; Miao, Zhenqing; Yanagimoto, Takashi


    A molecular phylogenetic analysis of the genus Scomber was conducted based on mitochondrial (COI, Cyt b and control region) and nuclear (5S rDNA) DNA sequence data in multigene perspective. A variety of phylogenetic analytic methods were used to clarify the current taxonomic Classification and to assess phylogenetic relationships and the evolutionary history of this genus. The present study produced a well-resolved phylogeny that strongly supported the monophyly of Scomber. We confirmed that S. japonicus and S. colias were genetically distinct. Although morphologically and ecologically similar to S. colias, the molecular data showed that S. japonicus has a greater molecular affinity with S. australasicus, which conflicts with the traditional taxonomy. This phylogenetic pattern was corroborated by the mtDNA data, but incompletely by the nuclear DNA data. Phylogenetic concordance between the mitochondrial and nuclear DNA regions for the basal nodes Supports an Atlantic origin for Scomber. The present-day geographic ranges of the species were compared with the resultant molecular phylogeny derived from partition Bayesian analyses of the combined data sets to evaluate possible dispersal routes of the genus. The present-day geographic distribution of Scomber species might be best ascribed to multiple dispersal events. In addition, our results suggest that phylogenies derived from multiple genes and long sequences exhibited improved phylogenetic resolution, from which we conclude that the phylogenetic reconstruction is a reliable representation of the evolutionary history of Scomber.

  1. 16S rDNA analysis of archaea indicates dominance of Methanobacterium and high abundance of Methanomassiliicoccaceae in rumen of Nili-Ravi buffalo.


    Paul, S S; Deb, S M; Dey, A; Somvanshi, S P S; Singh, D; Rathore, R; Stiverson, J


    The molecular diversity of rumen methanogens was investigated using 16S rDNA gene library prepared from the rumen contents of Nili-Ravi buffaloes. Microbial genomic DNA was isolated from four adult male fistulated buffaloes and PCR conditions were set up using specific primers. Amplified product was cloned into a suitable vector, and the inserts of positive clones were sequenced. A total of 142 clones were examined, and the analysis revealed 46 species level (0.01 distance) operational taxonomic units (OTUs). Twenty six OTUs comprising 89 clones (63% of the total clones) were taxonomically assigned to Methanobacterium genus and the majority of them had highest percent identity with Methanobacterium flexile among cultured methanogens. Five OTUs comprising 27 clones (19% of total clones) were taxonomically assigned to Methanomicrobium genus and these clones showed highest sequence identity with Methanomicrobium mobile. Only two OTUs comprising 6 clones (4% of total clones) were assigned to Methanobrevibacter genus. A total of 17 clones belonging to 10 species level OTUs showed highest percent identity (ranging from 85 to 95%) with Methanomassilicoccus luminyensis and were taxonomically classified as Methanomassiliicocaceae. Out of the 142 rDNA clones, 112 clones, which constitute 79% of the total clones representing 42 OTUs, had less than 98.5% sequence identity with any of the cultured strains of methanogens and represent novel species of methanogens. This study has revealed the largest assortment of hydrogenotrophic methanogen phylotypes ever identified from the rumen of Nili-Ravi buffaloes. The study indicates that Methanobacterium is the most dominant methanogen in the rumen of Nili-Ravi buffalo. This is also the first report on the presence of methanogens phylogenetically close to M. luminyensis, an H2 dependent methylotrophic methanogen, in the rumen of buffaloes at such a high level of abundance. PMID:26103451

  2. Multiple rDNA units distributed on all chromosomes of Nosema bombycis.


    Liu, Handeng; Pan, Guoqing; Song, Shihong; Xu, Jinshan; Li, Tian; Deng, Yanbo; Zhou, Zeyang


    Among Microsporidia, Nosema bombycis has a novel arrangement of LSUrRNA, SSUrRNA, ITS, IGS and 5SrRNA. To determine the distribution of rDNA among the chromosomes, we performed genome-wide screening and Southern blotting with three probes (SSU, ITS and IGS). Southern blotting revealed that ribosomal RNA genes are distributed on all chromosomes of N. bombycis, which is contrary to the previous result, which concluded that the N. bombycis rRNA genes were limited to a single chromosome. This wide distribution is similar to that of the rDNA unit of Encephalitozoon cuniculi. Screening of the N. bombycis genome detected 53 LSUrRNA elements, 43 SSUrRNA elements and 36 5SrRNA elements. However, it is still difficult to determine their loci on the chromosomes as the genomic map is unfinished. PMID:18640121

  3. Interpopulation hybridization generates meiotically stable rDNA epigenetic variants in allotetraploid Tragopogon mirus.


    Matyášek, Roman; Dobešová, Eva; Húska, Dalibor; Ježková, Ivana; Soltis, Pamela S; Soltis, Douglas E; Kovařík, Aleš


    Uniparental silencing of 35S rRNA genes (rDNA), known as nucleolar dominance (ND), is common in interspecific hybrids. Allotetraploid Tragopogon mirus composed of Tragopogon dubius (d) and Tragopogon porrifolius (p) genomes shows highly variable ND. To examine the molecular basis of such variation, we studied the genetic and epigenetic features of rDNA homeologs in several lines derived from recently and independently formed natural populations. Inbred lines derived from T. mirus with a dominant d-rDNA homeolog transmitted this expression pattern over generations, which may explain why it is prevalent among natural populations. In contrast, lines derived from the p-rDNA dominant progenitor were meiotically unstable, frequently switching to co-dominance. Interpopulation crosses between progenitors displaying reciprocal ND resulted in d-rDNA dominance, indicating immediate suppression of p-homeologs in F1 hybrids. Original p-rDNA dominance was not restored in later generations, even in those segregants that inherited the corresponding parental rDNA genotype, thus indicating the generation of additional p-rDNA and d-rDNA epigenetic variants. Despite preserved intergenic spacer (IGS) structure, they showed altered cytosine methylation and chromatin condensation patterns, and a correlation between expression, hypomethylation of RNA Pol I promoters and chromatin decondensation was apparent. Reversion of such epigenetic variants occurred rarely, resulting in co-dominance maintained in individuals with distinct genotypes. Generally, interpopulation crosses may generate epialleles that are not present in natural populations, underlying epigenetic dynamics in young allopolyploids. We hypothesize that highly expressed variants with distinct IGS features may induce heritable epigenetic reprogramming of the partner rDNA arrays, harmonizing the expression of thousands of genes in allopolyploids. PMID:26711705

  4. Quantum speciation in Aegilops: Molecular cytogenetic evidence from rDNA cluster variability in natural populations

    PubMed Central

    Raskina, Olga; Belyayev, Alexander; Nevo, Eviatar


    Data are presented on quantum speciation in the Sitopsis section of the genus Aegilops (Poaceae, Monocotyledones). Two small, peripheral, isolated, wild populations of annual cross-pollinated Ae. speltoides and annual self-pollinated Ae. sharonensis are located 30 m apart on different soil types. Despite the close proximity of the two species and their close relatedness, no mixed groups are known. Comparative molecular cytogenetic analysis based on the intrapopulation variability of rRNA-encoding DNA (rDNA) chromosomal patterns of individual Ae. speltoides geno-types revealed an ongoing dynamic process of permanent chromosomal rearrangements. Chromosomal mutations can arise de novo and can be eliminated. Analysis of the progeny of the investigated genotypes testifies that inheritance of de novo rDNA sites happens frequently. Heterologous recombination and/or transposable elements-mediated rDNA transfer seem to be the mechanisms for observed chromosomal repatterning. Consequently, several modified genomic forms, intermediate between Ae. speltoides and Ae. sharonensis, permanently arise in the studied wild population of Ae. speltoides, which make it possible to recognize Ae. sharonensis as a derivative species of Ae. speltoides, as well as to propose rapidness and canalization of quantum speciation in Sitopsis species. PMID:15466712

  5. Comparative application of direct sequencing, PCR-RFLP, and cytogenetic markers in the genetic characterization of Pimelodus (Siluriformes: Pimelodidae) species: possible implications for fish conservation.


    Ferreira, M; Bressane, K C O; Moresco, A R C; Moreira-Filho, O; Almeida-Toledo, L F; Garcia, C


    Pimelodus (Pimelodidae) is a genus comprising a group of South American species with complex taxonomic relationships. Cytogenetics, polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP), and sequencing data of mitochondrial genes were analyzed to characterize 4 Pimelodus species: P. fur, P. heraldoi, P. maculatus, and Pimelodus sp. All populations presented 2n=56 chromosomes and distinct karyotypic formulae. The heterochromatin distribution pattern and the number and location of 5S and 18S rDNA sites are discussed. The application of PCR-RFLP markers and sequencing of mitochondrial DNA genes provided species-specific haplotypes, which allowed us to differentiate the species studied. The mitochondrial gene sequences presented nucleotide mutations in the restriction sites and throughout the sequences, and they were mostly related to synonymous substitutions in the coded proteins; however, they did not affect the protein and its function. Comparing the data obtained using these 3 methodologies, the existence of a species complex in P. maculatus along the basins studied might be inferred, showing that cytogenetics is an important tool in studies focusing on the conservation or management of both natural and captive populations of these fishes. PMID:25036358

  6. Reconstitution of biologically active 50S ribosomal subunits with artificial 5S RNA molecules carrying disturbances in the base pairing within the molecular stalk.

    PubMed Central

    Raué, H A; Lorenz, S; Erdmann, V A; Planta, R J


    Bacillus stearothermophilus 50S ribosomal subunits were reconstituted in vitro using artificial 5S RNA molecules constructed by combining parts of major and minor type (Raué et al. (1976) Europ. J. Biochem. 68, 169-176) B. licheniformis 5S RNA. The artificial 5S RNA molecules carry defined disturbances (A.C juxtapositions and extra G.U pairs) in the base pairing between the 5'- and 3'-terminal sequences of the molecule (the molecular stalk region). The biological activity of the reconstituted subunits was determined in an E. coli cell-free system programmed with poly-U. The results show that conservation of the base pairing within the molecular stalk is not required for biological activity of 5S RNA. Disturbances of the base pairing within this region do reduce the rate of reconstitution, however. Normal base pairing in the molecular stalk is thus required to ensure efficient ribosome assembly. PMID:6164987

  7. BEND3 represses rDNA transcription by stabilizing a NoRC component via USP21 deubiquitinase

    PubMed Central

    Khan, Abid; Giri, Sumanprava; Wang, Yating; Chakraborty, Arindam; Ghosh, Archit K.; Anantharaman, Aparna; Aggarwal, Vasudha; Sathyan, Kizhakke M.; Ha, Taekjip; Prasanth, Kannanganattu V.; Prasanth, Supriya G.


    Ribosome biogenesis dictates the translational capacity of cells. Several mechanisms establish and maintain transcriptional output from eukaryotic ribosomal DNA (rDNA) loci. rDNA silencing is one such mechanism that ensures the inactivity and hence the maintenance of a silenced state of a subset of rRNA gene copies. Whereas oncogenic agents stimulate rRNA gene transcription, tumor suppressors decrease rRNA gene transcription. We demonstrate in mammalian cells that BANP, E5R, and Nac1 (BEN) domain 3 (BEND3), a quadruple BEN domain-containing protein, localizes in nucleoli and binds to ribosomal RNA gene promoters to help repress rRNA genes. Loss of BEND3 increases histone H3K4 trimethylation and, correspondingly, decreases rDNA promoter DNA methylation, consistent with a role for BEND3 in rDNA silencing. BEND3 associates with the nucleolar-remodeling complex (NoRC), and SUMOylated BEND3 stabilizes NoRC component TTF-1–interacting protein 5 via association with ubiquitin specific protease 21 (USP21) debiquitinase. Our results provide mechanistic insights into how the novel rDNA transcription repressor BEND3 acts together with NoRC to actively coordinate the establishment of rDNA silencing. PMID:26100909

  8. BEND3 represses rDNA transcription by stabilizing a NoRC component via USP21 deubiquitinase.


    Khan, Abid; Giri, Sumanprava; Wang, Yating; Chakraborty, Arindam; Ghosh, Archit K; Anantharaman, Aparna; Aggarwal, Vasudha; Sathyan, Kizhakke M; Ha, Taekjip; Prasanth, Kannanganattu V; Prasanth, Supriya G


    Ribosome biogenesis dictates the translational capacity of cells. Several mechanisms establish and maintain transcriptional output from eukaryotic ribosomal DNA (rDNA) loci. rDNA silencing is one such mechanism that ensures the inactivity and hence the maintenance of a silenced state of a subset of rRNA gene copies. Whereas oncogenic agents stimulate rRNA gene transcription, tumor suppressors decrease rRNA gene transcription. We demonstrate in mammalian cells that BANP, E5R, and Nac1 (BEN) domain 3 (BEND3), a quadruple BEN domain-containing protein, localizes in nucleoli and binds to ribosomal RNA gene promoters to help repress rRNA genes. Loss of BEND3 increases histone H3K4 trimethylation and, correspondingly, decreases rDNA promoter DNA methylation, consistent with a role for BEND3 in rDNA silencing. BEND3 associates with the nucleolar-remodeling complex (NoRC), and SUMOylated BEND3 stabilizes NoRC component TTF-1-interacting protein 5 via association with ubiquitin specific protease 21 (USP21) debiquitinase. Our results provide mechanistic insights into how the novel rDNA transcription repressor BEND3 acts together with NoRC to actively coordinate the establishment of rDNA silencing. PMID:26100909

  9. Molecular organization of the 25S-18S rDNA IGS of Fagus sylvatica and Quercus suber: a comparative analysis.


    Inácio, Vera; Rocheta, Margarida; Morais-Cecílio, Leonor


    The 35S ribosomal DNA (rDNA) units, repeated in tandem at one or more chromosomal loci, are separated by an intergenic spacer (IGS) containing functional elements involved in the regulation of transcription of downstream rRNA genes. In the present work, we have compared the IGS molecular organizations in two divergent species of Fagaceae, Fagus sylvatica and Quercus suber, aiming to comprehend the evolution of the IGS sequences within the family. Self- and cross-hybridization FISH was done on representative species of the Fagaceae. The IGS length variability and the methylation level of 18 and 25S rRNA genes were assessed in representatives of three genera of this family: Fagus, Quercus and Castanea. The intergenic spacers in Beech and Cork Oak showed similar overall organizations comprising putative functional elements needed for rRNA gene activity and containing a non-transcribed spacer (NTS), a promoter region, and a 5'-external transcribed spacer. In the NTS: the sub-repeats structure in Beech is more organized than in Cork Oak, sharing some short motifs which results in the lowest sequence similarity of the entire IGS; the AT-rich region differed in both spacers by a GC-rich block inserted in Cork Oak. The 5'-ETS is the region with the higher similarity, having nonetheless different lengths. FISH with the NTS-5'-ETS revealed fainter signals in cross-hybridization in agreement with the divergence between genera. The diversity of IGS lengths revealed variants from ∼ 2 kb in Fagus, and Quercus up to 5.3 kb in Castanea, and a lack of correlation between the number of variants and the number of rDNA loci in several species. Methylation of 25S Bam HI site was confirmed in all species and detected for the first time in the 18S of Q. suber and Q. faginea. These results provide important clues for the evolutionary trends of the rDNA 25S-18S IGS in the Fagaceae family. PMID:24893289

  10. Using Mitogenomic and Nuclear Ribosomal Sequence Data to Investigate the Phylogeny of the Xiphinema americanum Species Complex

    PubMed Central

    Zasada, Inga A.; Peetz, Amy; Howe, Dana K.; Wilhelm, Larry J.; Cheam, Daravuth; Denver, Dee R.; Smythe, Ashleigh B.


    Nematodes within the Xiphinema americanum species complex are economically important because they vector nepoviruses which cause considerable damage to a variety of agricultural crops. The taxonomy of X. americanum species complex is controversial, with the number of putative species being the subject of debate. Accurate phylogenetic knowledge of this group is highly desirable as it may ultimately reveal genetic differences between species. For this study, nematodes belonging to the X. americanum species complex, including potentially mixed species populations, were collected from 12 geographically disparate locations across the U.S. from different crops and in varying association with nepoviruses. At least four individuals from each population were analyzed. A portion of the 18S nuclear ribosomal DNA (rDNA) gene was sequenced for all individuals while the internal transcribed spacer region 1 (ITS1) of rDNA was cloned and 2 to 6 clones per individual were sequenced. Mitochondrial genomes for numerous individuals were sequenced in parallel using high-throughput DNA sequencing (HTS) technology. Phylogenetic analysis of the 18S rDNA revealed virtually identical sequences across all populations. Analysis of ITS1 rDNA sequences revealed several well-supported clades, with some degree of congruence with geographic location and viral transmission, but also numerous presumably paralogous sequences that failed to form clades with other sequences from the same population. Analysis of mitochondrial DNA (mtDNA) indicated the presence of three distinct monophyletic clades of X. americanum species complex nematodes. Two clades contained nematodes found in association with nepovirus and the third contained divergent mtDNA sequences from three nematode populations from the western U.S. where nepovirus was absent. The inherent heterogeneity in ITS1 rDNA sequence data and lack of informative sites in 18S rDNA analysis suggests that mtDNA may be more useful in sorting out the

  11. Wild Termitomyces Species Collected from Ondo and Ekiti States Are More Related to African Species as Revealed by ITS Region of rDNA

    PubMed Central

    Oyetayo, Victor Olusegun


    Molecular identification of eighteen Termitomyces species collected from two states, Ondo and Ekiti in Nigeria was carried out using the internal transcribed spacer (ITS) region. The amplicons obtained from rDNA of Termitomyces species were compared with existing sequences in the NCBI GenBank. The results of the ITS sequence analysis discriminated between all the Termitomyces species (obtained from Ondo and Ekiti States) and Termitomyces sp. sequences obtained from NCBI GenBank. The degree of similarity of T1 to T18 to gene of Termitomyces sp. obtained from NCBI ranges between 82 and 99 percent. Termitomyces species from Garbon with ascension number AF321374 was the closest relative of T1 to T18 except T12 that has T. eurhizus and T. striatus as the closet relative. Phylogenetic tree generated with ITS sequences obtained from NCBI GenBank data revealed that T1 to T18 are more related to Termitomyces species indigenous to African countries such as Senegal, Congo, and Gabon. PMID:22649309

  12. Distribution of a limited Sir2 protein pool regulates the strength of yeast rDNA silencing and is modulated by Sir4p.

    PubMed Central

    Smith, J S; Brachmann, C B; Pillus, L; Boeke, J D


    Transcriptional silencing in Saccharomyces cerevisiae occurs at the silent mating-type loci HML and HMR, at telomeres, and at the ribosomal DNA (rDNA) locus RDN1. Silencing in the rDNA occurs by a novel mechanism that depends on a single Silent Information Regulator (SIR) gene, SIR2. SIR4, essential for other silenced loci, paradoxically inhibits rDNA silencing. In this study, we elucidate a regulatory mechanism for rDNA silencing based on the finding that rDNA silencing strength directly correlates with cellular Sir2 protein levels. The endogenous level of Sir2p was shown to be limiting for rDNA silencing. Furthermore, small changes in Sir2p levels altered rDNA silencing strength. In rDNA silencing phenotypes, sir2 mutations were shown to be epistatic to sir4 mutations, indicating that SIR4 inhibition of rDNA silencing is mediated through SIR2. Furthermore, rDNA silencing is insensitive to SIR3 overexpression, but is severely reduced by overexpression of full-length Sir4p or a fragment of Sir4p that interacts with Sir2p. This negative effect of SIR4 overexpression was overridden by co-overexpression of SIR2, suggesting that SIR4 directly inhibits the rDNA silencing function of SIR2. Finally, genetic manipulations of SIR4 previously shown to promote extended life span also resulted in enhanced rDNA silencing. We propose a simple model in which telomeres act as regulators of rDNA silencing by competing for limiting amounts of Sir2 protein. PMID:9649515

  13. Secondary structure of Tetrahymena thermophilia 5S ribosomal RNA as revealed by enzymatic digestion and microdensitometric analysis.

    PubMed Central

    Sneath, B; Vary, C; Pavlakis, G; Vournakis, J


    The secondary structure of [32P] end-labeled 5S rRNA from Tetrahymena thermophilia (strain B) has been investigated using the enzymes S1 nuclease, cobra venom ribonuclease and T2 ribonuclease. The results, analyzed by scanning microdensitometry and illustrated by three-dimensional computer graphics, support the secondary structure model of Curtiss and Vournakis for 5S rRNA. Aberrent mobility of certain RNA fragments on sequencing gels was observed as regions of band compression. These regions are postulated to be caused by stable internal base-pairing. The molecule was probed with T2 RNase in neutral (pH 7.5) and acidic (pH 4.5) buffers and only minor structural differences were revealed. One of the helices was found to be susceptible to enzymatic attack by both the single-strand and double-strand specific enzymes. These observations are evidence for the existence of dynamic structural equilibria in 5S rRNA. Images PMID:3005972

  14. Structural and functional analysis of 5S rRNA in Saccharomyces cerevisiae

    PubMed Central

    Kiparisov, S.; Sergiev, P. V.; Dontsova, O. A.; Petrov, A.; Meskauskas, A.; Dinman, J. D.


    5S rRNA extends from the central protuberance of the large ribosomal subunit, through the A-site finger, and down to the GTPase-associated center. Here, we present a structure-function analysis of seven 5S rRNA alleles which are sufficient for viability in the yeast Saccharomyces cerevisiae when expressed in the absence of wild-type 5S rRNAs, and extend this analysis using a large bank of mutant alleles that show semidominant phenotypes in the presence of wild-type 5S rRNA. This analysis supports the hypothesis that 5S rRNA serves to link together several different functional centers of the ribosome. Data are also presented which suggest that in eukaryotic genomes selection has favored the maintenance of multiple alleles of 5S rRNA, and that these may provide cells with a mechanism to post-transcriptionally regulate gene expression. PMID:16047201

  15. Phylogeny of the eelpout genus Lycodes (Pisces, Zoarcidae) as inferred from mitochondrial cytochrome b and 12S rDNA.


    Møller, Peter R; Gravlund, Peter


    The bottom-dwelling and species-rich eelpout genus Lycodes Reinhardt has a great potential for the study of Arctic marine speciation. Subdivision of the genus has been based on single or few morphological characters (e.g., lateral line configuration) with contradicting results and phylogenetic approaches have not been attended. Here we present the first phylogenetic analysis of the genus employing DNA sequences of the mitochondrial genes cytochrome b and 12S rDNA (714 bp). The analysis with the two genes combined resulted in two equally parsimonious trees. In both cladograms most of the previously suggested subgroups are para- or polyphyletic, except for the so-called short-tailed Lycodes spp., with a short tail, a single mediolateral lateral line configuration and a shallow or filled otolith sulcus. The group of long-tailed Lycodes spp., with ventral or ventro-medio-lateral types of lateral line configuration and a deep otolith sulcus, appears to be paraphyletic, since Pacific and Atlantic species in this group are not each other's closest relatives. Thus, the short-tailed species are placed in a derived clade, indicating a secondary shortening of the tail, and a "slope to shore" type of evolution. This is not in accordance with earlier assumptions of the more elongate, deeper living species being the more derived. The basal position of long-tailed Pacific species supports earlier theories of Pacific origin of the genus/family. Small genetic differences between Arctic/Atlantic species indicate a rather recent radiation in these areas after the opening of the Bering Strait 3.0-3.5 million years ago. PMID:12644398

  16. Restriction fragment length polymorphism of the 5S-rRNA-NTS region: a rapid and precise method for plant identification.


    Bertea, Cinzia Margherita; Gnavi, Giorgio


    Molecular genetic methods have several advantages over classical morphological and chemical analyses. The genetic method requires genotype instead than phenotype, therefore PCR-based techniques have been widely used for a rapid identification of plant species, varieties and chemotypes. Recently, the molecular discrimination of some higher plant species has been evaluated using sequences of a 5S-rRNA gene spacer region. The variation in the nontranscribed sequence (NTS) region has been used in a number of plant species for studying intraspecific variation, genome evolution, and phylogenetic reconstruction. Here, we describe a rapid method based on the use of the 5S-rRNA-NTS region as a tool for plant DNA fingerprinting, which combines PCR, sequencing and restriction fragment length polymorphism analyses. PMID:22419491

  17. Phylogeny of Trypanosoma brucei and Trypanosoma evansi in naturally infected cattle in Nigeria by analysis of repetitive and ribosomal DNA sequences.


    Takeet, Michael I; Peters, Sunday O; Fagbemi, Benjamin O; De Donato, Marcos; Takeet, Vivian O; Wheto, Mathew; Imumorin, Ikhide G


    In continuing efforts to better understand the genetics of bovine trypanosomosis, we assessed genetic diversity of Trypanosoma brucei and Trypanosoma evansi in naturally infected Nigerian cattle using repetitive DNA and internal transcribed spacer 1 of rDNA sequences and compared these sequences to species from other countries. The length of repetitive DNA sequences in both species ranged from 161 to 244 bp and 239 to 240 bp for T. brucei and T. evansi, respectively, while the ITS1 rDNA sequences length range from 299 to 364 bp. The mean GC content of ITS1 rDNA sequences was 33.57 %, and that of repetitive sequences were 39.9 and 31.1 % for T. brucei and T. evansi, respectively. Result from sequence alignment revealed both T. brucei and T. evansi repetitive DNA sequences to be more polymorphic than ITS1 rDNA sequences, with moderate points of deletion and insertions. T. brucei separated into two clades when subjected to phylogenetic analysis. T. evansi repetitive DNA sequences clustered tightly within the T. brucei clade while the ITS1 rDNA sequences of T. brucei were clearly separated from T. theileri and T. vivax individually used as outgroups. This study suggest that ITS1 rDNA sequences may not be suitable for phylogenetic differentiation of the Trypanozoon group and also suggest that T. evansi may be a phenotypic variant of T. brucei which may have potential implications in designing prevention and therapeutic strategies. PMID:27174432

  18. Important role of the tetraloop region of 4.5S RNA in SRP binding to its receptor FtsY.

    PubMed Central

    Jagath, J R; Matassova, N B; de Leeuw, E; Warnecke, J M; Lentzen, G; Rodnina, M V; Luirink, J; Wintermeyer, W


    Binding of Escherichia coli signal recognition particle (SRP) to its receptor, FtsY, requires the presence of 4.5S RNA, although FtsY alone does not interact with 4.5S RNA. In this study, we report that the exchange of the GGAA tetraloop sequence in domain IV of 4.5S RNA for UUCG abolishes SRP-FtsY interaction, as determined by gel retardation and membrane targeting experiments, whereas replacements with other GNRA-type tetraloops have no effect. A number of other base exchanges in the tetraloop sequence have minor or intermediate inhibitory effects. Base pair disruptions in the stem adjacent to the tetraloop or replacement of the closing C-G base pair with G-C partially restored function of the otherwise inactive UUCG mutant. Chemical probing by hydroxyl radical cleavage of 4.5S RNA variants show that replacing GGAA with UUCG in the tetraloop sequence leads to structural changes both within the tetraloop and in the adjacent stem; the latter change is reversed upon reverting the C-G closing base pair to G-C. These results show that the SRP-FtsY interaction is strongly influenced by the structure of the tetraloop region of SRP RNA, in particular the tetraloop stem, and suggest that both SRP RNA and Ffh undergo mutual structural adaptation to form SRP that is functional in the interaction with the receptor, FtsY. PMID:11233986

  19. Accurate transcription of homologous 5S rRNA and tRNA genes and splicing of tRNA in vitro by soluble extracts of Neurospora.

    PubMed Central

    Tyler, B M; Giles, N H


    We have developed soluble extracts from Neurospora crassa capable of accurately and efficiently transcribing homologous 5S rRNA and tRNA genes. The extracts also appear to quantitatively end-process and splice the primary tRNA transcripts. Although the extracts could not transcribe a heterologous (yeast) 5S rRNA gene, they did transcribe a yeast tRNALeu gene and slowly process the transcripts. In addition, we have developed a novel strategy for rapidly sequencing uniformly labelled RNAs using base-specific ribonucleases. We have used this procedure to verify the identity of the in vitro transcripts and processing products. Images PMID:6235482

  20. Fragile Sites of 'Valencia' Sweet Orange (Citrus sinensis) Chromosomes Are Related with Active 45s rDNA.


    Lan, Hong; Chen, Chun-Li; Miao, Yin; Yu, Chang-Xiu; Guo, Wen-Wu; Xu, Qiang; Deng, Xiu-Xin


    Citrus sinensis chromosomes present a morphological differentiation of bands after staining by the fluorochromes CMA and DAPI, but there is still little information on its chromosomal characteristics. In this study, the chromosomes in 'Valencia' C. sinensis were analyzed by fluorescence in situ hybridization (FISH) using telomere DNA and the 45S rDNA gene as probes combining CMA/DAPI staining, which showed that there were two fragile sites in sweet orange chromosomes co-localizing at distended 45S rDNA regions, one proximally locating on B-type chromosome and the other subterminally locating on D-type chromosome. While the chromosomal CMA banding and 45S rDNA FISH mapping in the doubled haploid line of 'Valencia' C. sinensis indicated six 45S rDNA regions, four were identified as fragile sites as doubled comparing its parental line, which confirmed the cytological heterozygosity and chromosomal heteromorphisms in sweet orange. Furthermore, Ag-NOR identified two distended 45S rDNA regions to be active nucleolar organizing regions (NORs) in diploid 'Valencia' C. sinensis. The occurrence of quadrivalent in meiosis of pollen mother cells (PMCs) in 'Valencia' sweet orange further confirmed it was a chromosomal reciprocal translocation line. We speculated this chromosome translocation was probably related to fragile sites. Our data provide insights into the chromosomal characteristics of the fragile sites in 'Valencia' sweet orange and are expected to facilitate the further investigation of the possible functions of fragile sites. PMID:26977938

  1. Hot spots of DNA double-strand breaks in human rDNA units are produced in vivo.


    Tchurikov, Nickolai A; Yudkin, Dmitry V; Gorbacheva, Maria A; Kulemzina, Anastasia I; Grischenko, Irina V; Fedoseeva, Daria M; Sosin, Dmitri V; Kravatsky, Yuri V; Kretova, Olga V


    Endogenous hot spots of DNA double-strand breaks (DSBs) are tightly linked with transcription patterns and cancer genomics(1,2). There are nine hot spots of DSBs located in human rDNA units(3-6). Here we describe that the profiles of these hot spots coincide with the profiles of γ-H2AX or H2AX, strongly suggesting a high level of in vivo breakage inside rDNA genes. The data were confirmed by microscopic observation of the largest γ-H2AX foci inside nucleoli in interphase chromosomes. In metaphase chromosomes, we observed that only some portion of rDNA clusters possess γ-H2AX foci and that all γ-H2AX foci co-localize with UBF-1 binding sites, which strongly suggests that only active rDNA units possess the hot spots of DSBs. Both γ-H2AX and UBF-1 are epigenetically inherited and thus indicate the rDNA units that were active in the previous cell cycle. These results have implications for diverse fields, including epigenetics and cancer genomics. PMID:27160357

  2. More than 10% of yeast genes are related to genome stability and influence cellular senescence via rDNA maintenance.


    Saka, Kimiko; Takahashi, Akihiro; Sasaki, Mariko; Kobayashi, Takehiko


    Genome instability triggers cellular senescence and is a common cause of cancer. The ribosomal RNA genes (rDNA), due to their repetitive structure, form a fragile site with frequent rearrangements. To identify eukaryotic factors that connect reduced genome stability to senescence we screened 4,876 strains of a Saccharomyces cerevisiae deletion library for aberrant rDNA and found 708 genes that contribute to its upkeep. 28 mutants caused abnormalities in non-rDNA chromosomes and among them 12 mutants have abnormalities both in rDNA and in non-rDNA chromosomes. Many mutated genes have not previously been implicated with genome maintenance nor their homologues with tumorigenesis in mammals. The link between rDNA state and senescence was broken after deletion of factors related with DNA polymerase ϵ. These mutations also suppressed the short lifespan phenotype of a sir2 mutant, suggesting a model in which molecular events at the heart of the replication fork induce abnormal rDNA recombination and are responsible for the emergence of an aging signal. PMID:26912831

  3. Hot spots of DNA double-strand breaks in human rDNA units are produced in vivo

    PubMed Central

    Tchurikov, Nickolai A.; Yudkin, Dmitry V.; Gorbacheva, Maria A.; Kulemzina, Anastasia I.; Grischenko, Irina V.; Fedoseeva, Daria M.; Sosin, Dmitri V.; Kravatsky, Yuri V.; Kretova, Olga V.


    Endogenous hot spots of DNA double-strand breaks (DSBs) are tightly linked with transcription patterns and cancer genomics1,2. There are nine hot spots of DSBs located in human rDNA units3–6. Here we describe that the profiles of these hot spots coincide with the profiles of γ-H2AX or H2AX, strongly suggesting a high level of in vivo breakage inside rDNA genes. The data were confirmed by microscopic observation of the largest γ-H2AX foci inside nucleoli in interphase chromosomes. In metaphase chromosomes, we observed that only some portion of rDNA clusters possess γ-H2AX foci and that all γ-H2AX foci co-localize with UBF-1 binding sites, which strongly suggests that only active rDNA units possess the hot spots of DSBs. Both γ-H2AX and UBF-1 are epigenetically inherited and thus indicate the rDNA units that were active in the previous cell cycle. These results have implications for diverse fields, including epigenetics and cancer genomics. PMID:27160357

  4. Distribution of 18S rDNA sites and absence of the canonical TTAGG insect telomeric repeat in parasitoid Hymenoptera.


    Gokhman, Vladimir E; Anokhin, Boris A; Kuznetsova, Valentina G


    Karyotypes of six species belonging to three main clades of parasitoid Hymenoptera, the superfamilies Ichneumonoidea (Ichneumonidae: Ichneumon amphibolus), Cynipoidea (Cynipidae: Diplolepis rosae) and Chalcidoidea (Eurytomidae: Eurytoma robusta, Eu. serratulae and Eu. compressa, and Torymidae: Torymus bedeguaris) were studied using FISH with 18S rDNA and telomeric (TTAGG)n probes. Haploid karyotypes of D. rosae, Eu. robusta and Eu. serratulae carried the only 18S rDNA hybridization signal, whereas those of I. amphibolus and Eu. compressa carried three and two rDNA clusters respectively. In addition, three rDNA sites were visualized in the aneuploid female of T. bedeguaris. The number of rDNA clusters in parasitoid Hymenoptera generally correlates to the chromosome number. Apart from the overwhelming majority of the studied species of aculeate Hymenoptera, no hybridization signals were obtained from FISH with the telomeric (TTAGG)n probe in the examined parasitoid species. These data suggest absence of the canonical (TTAGG)n insect telomeric motif in the Ichneumonoidea, Cynipoidea and Chalcidoidea, and perhaps in parasitoid Hymenoptera in general. PMID:24992984

  5. A two-locus DNA sequence database for identifying host-specific pathogens and phylogenetic diversity within the Fusarium oxysporum species complex

    Technology Transfer Automated Retrieval System (TEKTRAN)

    An electronically portable two-locus DNA sequence database, comprising partial sequences of the translation elongation factor gene (EF-1a, 634 bp alignment) and nearly complete sequences of the nuclear ribosomal intergenic spacer region (IGS rDNA, 2220 bp alignment) for 850 isolates spanning the phy...

  6. Protein purification in multicompartment electrolyzers for crystal growth of r-DNA products in microgravity

    NASA Technical Reports Server (NTRS)

    Righetti, Pier Giorgio; Casale, Elena; Carter, Daniel; Snyder, Robert S.; Wenisch, Elisabeth; Faupel, Michel


    Recombinant-DNA (deoxyribonucleic acid) (r-DNA) proteins, produced in large quantities for human consumption, are now available in sufficient amounts for crystal growth. Crystallographic analysis is the only method now available for defining the atomic arrangements within complex biological molecules and decoding, e.g., the structure of the active site. Growing protein crystals in microgravity has become an important aspect of biology in space, since crystals that are large enough and of sufficient quality to permit complete structure determinations are usually obtained. However even small amounts of impurities in a protein preparation are anathema for the growth of a regular crystal lattice. A multicompartment electrolyzer with isoelectric, immobiline membranes, able to purify large quantities of r-DNA proteins is described. The electrolyzer consists of a stack of flow cells, delimited by membranes of very precise isoelectric point (pI, consisting of polyacrylamide supported by glass fiber filters containing Immobiline buffers and titrants to uniquely define a pI value) and very high buffering power, able to titrate all proteins tangent or crossing such membranes. By properly selecting the pI values of two membranes delimiting a flow chamber, a single protein can be kept isoelectric in a single flow chamber and thus, be purified to homogeneity (by the most stringent criterion, charge homogeneity).

  7. Altered gravity influences rDNA and NopA100 localization in nucleoli

    NASA Astrophysics Data System (ADS)

    Sobol, M. A.; Kordyum, E. L.

    Fundamental discovery of gravisensitivity of cells no specified to gravity perception focused increasing attention on an elucidation of the mechanisms involved in altered gravity effects at the cellular and subcellular levels. The nucleolus is the transcription site of rRNA genes as well as the site of processing and initial packaging of their transcripts with ribosomal and nonribosomal proteins. The mechanisms inducing the changes in the subcomponents of the nucleolus that is morphologically defined yet highly dynamic structure are still unknown in detail. To understand the functional organization of the nucleolus as in the control as under altered gravity conditions it is essential to determine both the precise location of rDNA and the proteins playing the key role in rRNA processing. Lepidium sativum seeds were germinated in 1% agar medium on the slow horizontal clinostat (2 rpm) and in the stationary conditions. We investigated the root meristematic cells dissected from the seedlings grown in darkness for two days. The investigations were carried out with anti-DNA and anti-NopA100 antibodies labeling as well as with TdT procedure, and immunogold electron microscopy. In the stationary growth conditions, the anti-DNA antibody as well TdT procedure were capable of detecting fibrillar centers (FCs) and the dense fibrillar component (DFC) in the nucleolus. In FCs, gold particles were revealed on the condensed chromatin inclusions, internal fibrils of decondensed rDNA and the transition zone FC-DFC. Quantitatively, FCs appeared 1,5 times more densely labeled than DFC. NopA100 was localized in FCs and in DFC. In FCs, the most of protein was revealed in the transition zone FC-DFC. After a quantitative study, FCs and the transition zone FC-DFC appeared to contain NopA100 1,7 times more than DFC. Under the conditions of altered gravity, quantitative data clearly showed a redistribution of nucleolar DNA and NopA100 between FCs and DFC in comparison with the control. In

  8. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2010 CFR


    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  9. 8 CFR 1236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR


    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... OF ALIENS ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition of classification. As a condition of classification and...

  10. A search for the Bs meson in Υ(5S) decays

    NASA Astrophysics Data System (ADS)

    Shipsey, Ian


    The CLEO III detector has recorded approximately 0.5 fb-1 of e^+ e^- annihilation data at the Υ(5S) resonance. Using this data sample, we have searched for fully reconstructed Bs mesons in the reaction Υ(5S) arrow B_s^(*) barB_s^(*)

  11. Phylogenetic differentiation between Atlantic Scomber colias and Pacific Scomber japonicus based on nuclear DNA sequences.


    Infante, Carlos; Blanco, Enrique; Zuasti, Eugenia; Crespo, Aniela; Manchado, Manuel


    In the classical taxonomy, three Scomber species are distinguished: S. scombrus, S. australasicus, and S. japonicus. Yet, some fish taxonomists have recently recognized Scomber colias, inhabiting the Atlantic Ocean, as a separate species from S. japonicus, distributed in the Pacific Ocean. Such proposal was based on significant mitochondrial DNA divergence as well as great phenotypic variation among individuals from these two ocean basins. However, in the absence of nuclear DNA data this issue remains still controversial. In this study, a phylogenetic analysis of nuclear 5S rDNA sequences was performed. A total of 30 individuals of S. colias collected in the Atlantic and 34 specimens of S. japonicus from the Pacific were characterized. Moreover, nine individuals of Pacific S. australasicus and eight of Atlantic S. scombrus were included. Maximum likelihood, maximum parsimony, and neighbor-joining analyses revealed the presence of two well-supported distinct clades corresponding to S. colias and S. japonicus, respectively. Altogether, morphologic and genetic data are in agreement with the recognition of two different species, S. colias in the Atlantic, and S. japonicus in the Pacific. PMID:16897460

  12. Evidence for the presence of 5S rRNA in mammalian mitochondria.


    Magalhães, P J; Andreu, A L; Schon, E A


    Mammalian mitochondrial ribosomes contain two prokaryotic-like rRNAs, 12S and 16S, both encoded by mitochondrial DNA. As opposed to cytosolic ribosomes, however, these ribosomes are not thought to contain 5S rRNA. For this reason, it has been unclear whether 5S rRNA, which can be detected in mitochondrial preparations, is an authentic organellar species imported from the cytosol or is merely a copurifying cytosol-derived contaminant. We now show that 5S rRNA is tightly associated with highly purified mitochondrial fractions of human and rat cells and that 5S rRNA transcripts derived from a synthetic gene transfected transiently into human cells are both expressed in vivo and present in highly purified mitochondria and mitoplasts. We conclude that 5S rRNA is imported into mammalian mitochondria, but its function there still remains to be clarified. PMID:9725900

  13. The 5S lean method as a tool of industrial management performances

    NASA Astrophysics Data System (ADS)

    Filip, F. C.; Marascu-Klein, V.


    Implementing the 5S (seiri, seiton, seiso, seiketsu, and shitsuke) method is carried out through a significant study whose purpose to analyse and deployment the management performance in order to emphasize the problems and working mistakes, reducing waste (stationary and waiting times), flow transparency, storage areas by properly marking and labelling, establishing standards work (everyone knows exactly where are the necessary things), safety and ergonomic working places (the health of all employees). The study describes the impact of the 5S lean method implemented to storing, cleaning, developing and sustaining a production working place from an industrial company. In order to check and sustain the 5S process, it is needed to use an internal audit, called “5S audit”. Implementing the 5S methodology requires organization and safety of the working process, properly marking and labelling of the working place, and audits to establish the work in progress and to maintain the improved activities.

  14. Mitochondrial Enzyme Rhodanese Is Essential for 5 S Ribosomal RNA Import into Human Mitochondria*

    PubMed Central

    Smirnov, Alexandre; Comte, Caroline; Mager-Heckel, Anne-Marie; Addis, Vanessa; Krasheninnikov, Igor A.; Martin, Robert P.; Entelis, Nina; Tarassov, Ivan


    5 S rRNA is an essential component of ribosomes. In eukaryotic cells, it is distinguished by particularly complex intracellular traffic, including nuclear export and re-import. The finding that in mammalian cells 5 S rRNA can eventually escape its usual circuit toward nascent ribosomes to get imported into mitochondria has made the scheme more complex, and it has raised questions about both the mechanism of 5 S rRNA mitochondrial targeting and its function inside the organelle. Previously, we showed that import of 5 S rRNA into mitochondria requires unknown cytosolic proteins. Here, one of them was identified as mitochondrial thiosulfate sulfurtransferase, rhodanese. Rhodanese in its misfolded form was found to possess a strong and specific 5 S rRNA binding activity, exploiting sites found earlier to function as signals of 5 S rRNA mitochondrial localization. The interaction with 5 S rRNA occurs cotranslationally and results in formation of a stable complex in which rhodanese is preserved in a compact enzymatically inactive conformation. Human 5 S rRNA in a branched Mg2+-free form, upon its interaction with misfolded rhodanese, demonstrates characteristic functional traits of Hsp40 cochaperones implicated in mitochondrial precursor protein targeting, suggesting that it may use this mechanism to ensure its own mitochondrial localization. Finally, silencing of the rhodanese gene caused not only a proportional decrease of 5 S rRNA import but also a general inhibition of mitochondrial translation, indicating the functional importance of the imported 5 S rRNA inside the organelle. PMID:20663881

  15. Early-life nutrition modulates the epigenetic state of specific rDNA genetic variants in mice.


    Holland, Michelle L; Lowe, Robert; Caton, Paul W; Gemma, Carolina; Carbajosa, Guillermo; Danson, Amy F; Carpenter, Asha A M; Loche, Elena; Ozanne, Susan E; Rakyan, Vardhman K


    A suboptimal early-life environment, due to poor nutrition or stress during pregnancy, can influence lifelong phenotypes in the progeny. Epigenetic factors are thought to be key mediators of these effects. We show that protein restriction in mice from conception until weaning induces a linear correlation between growth restriction and DNA methylation at ribosomal DNA (rDNA). This epigenetic response remains into adulthood and is restricted to rDNA copies associated with a specific genetic variant within the promoter. Related effects are also found in models of maternal high-fat or obesogenic diets. Our work identifies environmentally induced epigenetic dynamics that are dependent on underlying genetic variation and establishes rDNA as a genomic target of nutritional insults. PMID:27386920

  16. A Two-locus DNA Sequence Database for Typing Plant and Human Pathogens Within the Fusarium oxysporum Species Complex

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We constructed a two-locus database, comprising partial translation elongation factor (EF-1alpha) gene sequences and nearly full-length sequences of the nuclear ribosomal intergenic spacer region (IGS rDNA) for 850 isolates spanning the phylogenetic breadth of the Fusarium oxysporum species complex ...

  17. Detection of sequence variation in parasite ribosomal DNA by electrophoresis in agarose gels supplemented with a DNA-intercalating agent.


    Zhu, X Q; Chilton, N B; Gasser, R B


    This study evaluated the use of a commercially available DNA intercalating agent (Resolver Gold) in agarose gels for the direct detection of sequence variation in ribosomal DNA (rDNA). This agent binds preferentially to AT sequence motifs in DNA. Regions of nuclear rDNA, known to provide genetic markers for the identification of species of parasitic ascarid nematodes (order Ascaridida), were amplified by polymerase chain reaction (PCR) and subjected to electrophoresis in standard agarose gels versus gels supplemented with Resolver Gold. Individual taxa examined could not be distinguished reliably based on the size of their amplicons in standard agarose gels, whereas they could be readily delineated based on mobility using Resolver Gold-supplemented gels. The latter was achieved because of differences (approximately 0.1-8.2%) in the AT content of the fragments among different taxa, which were associated with significant interspecific differences (approximately 11-39%) in the rDNA sequences employed. There was a tendency for fragments with higher AT content to migrate slower in supplemented agarose gels compared with those of lower AT content. The results indicate the usefulness of this electrophoretic approach to rapidly screen for sequence variability within or among PCR-amplified rDNA fragments of similar sizes but differing AT contents. Although evaluated on rDNA of parasites, the approach has potential to be applied to a range of genes of different groups of infectious organisms. PMID:9629896

  18. Virtual RFLP analysis of 16S rDNA sequences identifies new subgroups in the clover proliferation phytoplasma group

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Phytoplasmas are insect-transmitted, phloem-inhabiting, cell wall-less bacteria that cause numerous diseases in several hundred plant species. In adaptation to diverse plant hosts and insect vectors, phytoplasmas have evolved to give rise to widely divergent lineages. As phytoplasmas are uncultura...

  19. Bacterial community dynamics in a swine wastewater anaerobic reactor revealed by 16S rDNA sequence analysis.


    Liu, An-Chi; Chou, Chu-Yang; Chen, Ling-Ling; Kuo, Chih-Horng


    Anaerobic digestion is a microbiological process of converting organic wastes into digestate and biogas in the absence of oxygen. In practice, disturbance to the system (e.g., organic shock loading) may cause imbalance of the microbial community and lead to digester failure. To examine the bacterial community dynamics after a disturbance, this study simulated an organic shock loading that doubled the chemical oxygen demand (COD) loading using a 4.5L swine wastewater anaerobic completely stirred tank reactor (CSTR). Before the shock (loading rate=0.65gCOD/L/day), biogas production rate was about 1-2L/L/day. After the shock, three periods representing increased biogas production rates were observed during days 1-7 (∼4.0L/L/day), 13 (3.3L/L/day), and 21-23 (∼6.1L/L/day). For culture-independent assessments of the bacterial community composition, the 454 pyrosequencing results indicated that the community contained >2500 operational taxonomic units (OTUs) and was dominated by three phyla: Bacteroidetes, Firmicutes, and Proteobacteria. The shock induced dynamic changes in the community composition, which was re-stabilized after approximately threefold hydraulic retention time (HRT). Intriguingly, upon restabilization, the community composition became similar to that observed before the shock, rather than reaching a new equilibrium. PMID:25500375


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Rice sheath blight, caused by Rhizoctonia solani Kühn (anastomosis group AG1-IA), is a serious disease worldwide. R. solani has a broad host range and no complete genetic resistance is available among cultivated rices. As first step to identify sheath blight resistance gene(s), molecular character...

  1. Phylogenetic relationships linking Duttaphrynus (Amphibia: Anura: Bufonidae) species based on 12S and 16S rDNA sequences.


    Pratihar, Suman; Bhattacharya, Manojit; Deuti, Kaushik


    Genus Duttaphrynus (Amphibia: Anura: Bufonidae) is endemic to southwestern and southern China and throughout southern Asia. Duttaphrynus phylogeny was also under debate for many years. 12S and 16S rDNAs help us to elucidate Duttaphrynus phylogeny. PMID:26155970

  2. Sequence variation of the rDNA internal transcribed spacer (ITS) region among isolates of Rhizoctonia solani

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Rhizoctonia solani is a common and highly heterogeneous fungal species. Sub-specific groups have been created based on hyphal anastomosis (AGs). One of the newer AGs described is AG-11 from soybean and rice seedlings or soil in Arkansas and lupine in Australia (Carling et al. Phytopathology 84:1378-...

  3. Phylogenetic analysis of the kenaf fiber microbial retting community by semiconductor sequencing of 16S rDNA amplicons

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Kenaf, hemp, and jute have been used for cordage and fiber production since prehistory. To obtain the fibers, harvested plants are soaked in ponds where indigenous microflora digests pectins and other heteropolysaccharides, releasing fibers in a process called retting. Renewed interest in “green” ...

  4. Gyr B versus 16s rDNA sequencing for the identification of Campylobacter jejuni, Campylobacter coli, and Campylobacter lari

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Species of the genus Campylobacter are the causative agents of a sizable number of the cases of food-borne illness in the developed world. The majority of this disease is caused by three of the thermotolerant Campylobacter species: Campylobacter jejuni, Campylobacter coli, and Campylobacter lari. ...

  5. Electron microscopic in situ hybridization and autoradiography: Localization and transcription of rDNA in human lymphocyte nucleoli

    SciTech Connect

    Wachtler, F.; Mosgoeller, W.S.; Schwarzacher, H.G. )


    The distribution of ribosomal DNA (rDNA) in the nucleoli of human lymphocytes was revealed by in situ hybridization with a nonautoradiographic procedure at the electron microscopic level. rDNA is located in the dense fibrillar component of the nucleolus but not in the fibrillar centers. In the same cells the incorporation of tritiated uridine takes place in the dense fibrillar component of the nucleolus as seen by autoradiography followed by gold latensification. From these findings it can be concluded that the transcription of ribosomal DNA takes place in the dense fibrillar component of the nucleolus.

  6. Analyses of the ribosomal DNA region in Nosema bombycis NIS 001.


    Iiyama, Kazuhiro; Chieda, Yuuka; Yasunaga-Aoki, Chisa; Hayasaka, Shoji; Shimizu, Susumu


    Ribosomal DNA (rDNA) containing small subunit (SSU) rDNA and both flanking regions in the entomopathogenic microsporidian Nosema bombycis NIS 001 was amplified from genomic DNA with a primer set based on the sequence of an inverse polymerase chain reaction (PCR)-derived fragment. In this fragment, SSU rDNA was divided by a 618-bp insert at nt 599, and 5S rDNA was located downstream of the SSU rDNA, fragmented by 284-bp intergenic spacer. In addition, the 48-bp 3'-end of large subunit (LSU) rDNA was located 118 bp upstream of the fragmented SSU rDNA. In the amplicon, the region upstream of the LSU rDNA was a homologue of the C-terminal CHARLIE8 transposon-like element of human GTF2IRD2. In this organism, another fragmented SSU rDNA, which was divided by a 231-bp insert at nt 50, was also detected. Both the intact (insertless) and fragmented SSU rDNAs clustered with LSU rDNA and 5S rDNA and the intergenic sequences between SSU rDNA and 5S rDNA were divergent in an organism. Reverse transcription (RT)-PCR assay indicated that not only the intact SSU rDNA but also the fragmened SSU rDNA were transcribed in N. bombycis. PMID:15666716

  7. Mouse nucleolin binds to 4.5S RNAH, a small noncoding RNA

    SciTech Connect

    Hirose, Yutaka Harada, Fumio


    4.5S RNAH is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAH is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAH-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAHin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAH-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAH recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAH was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus.

  8. Mouse nucleolin binds to 4.5S RNAh, a small noncoding RNA.


    Hirose, Yutaka; Harada, Fumio


    4.5S RNAh is a rodent-specific small noncoding RNA that exhibits extensive homology to the B1 short interspersed element. Although 4.5S RNAh is known to associate with cellular poly(A)-terminated RNAs and retroviral genomic RNAs, its function remains unclear. In this study, we analyzed 4.5S RNAh-binding proteins in mouse nuclear extracts using gel mobility shift and RNA-protein UV cross-linking assays. We found that at least nine distinct polypeptides (p170, p110, p93, p70, p48, p40, p34, p20, and p16.5) specifically interacted with 4.5S RNAhin vitro. Using anti-La antibody, p48 was identified as mouse La protein. To identify the other 4.5S RNAh-binding proteins, we performed expression cloning from a mouse cDNA library and obtained cDNA clones derived from nucleolin mRNA. We identified p110 as nucleolin using nucleolin-specific antibodies. UV cross-linking analysis using various deletion mutants of nucleolin indicated that the third of four tandem RNA recognition motifs is a major determinant for 4.5S RNAh recognition. Immunoprecipitation of nucleolin from the subcellular fractions of mouse cell extracts revealed that a portion of the endogenous 4.5S RNAh was associated with nucleolin and that this complex was located in both the nucleoplasm and nucleolus. PMID:17971306

  9. Repetitive DNA Sequences and Evolution of ZZ/ZW Sex Chromosomes in Characidium (Teleostei: Characiformes)

    PubMed Central

    Pansonato-Alves, José Carlos; da Costa Silva, Guilherme José; Vicari, Marcelo Ricardo; Artoni, Roberto Ferreira; Oliveira, Claudio; Foresti, Fausto


    Characidium constitutes an interesting model for cytogenetic studies, since a large degree of karyotype variation has been detected in this group, like the presence/absence of sex and supernumerary chromosomes and variable distribution of repetitive sequences in different species/populations. In this study, we performed a comparative cytogenetic analysis in 13 Characidium species collected at different South American river basins in order to investigate the karyotype diversification in this group. Chromosome analyses involved the karyotype characterization, cytogenetic mapping of repetitive DNA sequences and cross-species chromosome painting using a W-specific probe obtained in a previous study from Characidium gomesi. Our results evidenced a conserved diploid chromosome number of 2n = 50, and almost all the species exhibited homeologous ZZ/ZW sex chromosomes in different stages of differentiation, except C. cf. zebra, C. tenue, C. xavante and C. stigmosum. Notably, some ZZ/ZW sex chromosomes showed 5S and/or 18S rDNA clusters, while no U2 snDNA sites could be detected in the sex chromosomes, being restricted to a single chromosome pair in almost all the analyzed species. In addition, the species Characidium sp. aff. C. vidali showed B chromosomes with an inter-individual variation of 1 to 4 supernumerary chromosomes per cell. Notably, these B chromosomes share sequences with the W-specific probe, providing insights about their origin. Results presented here further confirm the extensive karyotype diversity within Characidium in contrast with a conserved diploid chromosome number. Such chromosome differences seem to constitute a significant reproductive barrier, since several sympatric Characidium species had been described during the last few years and no interespecific hybrids were found. PMID:26372604

  10. Comparative molecular cytogenetics of major repetitive sequence families of three Dendrobium species (Orchidaceae) from Bangladesh

    PubMed Central

    Begum, Rabeya; Alam, Sheikh Shamimul; Menzel, Gerhard; Schmidt, Thomas


    Background and Aims Dendrobium species show tremendous morphological diversity and have broad geographical distribution. As repetitive sequence analysis is a useful tool to investigate the evolution of chromosomes and genomes, the aim of the present study was the characterization of repetitive sequences from Dendrobium moschatum for comparative molecular and cytogenetic studies in the related species Dendrobium aphyllum, Dendrobium aggregatum and representatives from other orchid genera. Methods In order to isolate highly repetitive sequences, a c0t-1 DNA plasmid library was established. Repeats were sequenced and used as probes for Southern hybridization. Sequence divergence was analysed using bioinformatic tools. Repetitive sequences were localized along orchid chromosomes by fluorescence in situ hybridization (FISH). Key Results Characterization of the c0t-1 library resulted in the detection of repetitive sequences including the (GA)n dinucleotide DmoO11, numerous Arabidopsis-like telomeric repeats and the highly amplified dispersed repeat DmoF14. The DmoF14 repeat is conserved in six Dendrobium species but diversified in representative species of three other orchid genera. FISH analyses showed the genome-wide distribution of DmoF14 in D. moschatum, D. aphyllum and D. aggregatum. Hybridization with the telomeric repeats demonstrated Arabidopsis-like telomeres at the chromosome ends of Dendrobium species. However, FISH using the telomeric probe revealed two pairs of chromosomes with strong intercalary signals in D. aphyllum. FISH showed the terminal position of 5S and 18S–5·8S–25S rRNA genes and a characteristic number of rDNA sites in the three Dendrobium species. Conclusions The repeated sequences isolated from D. moschatum c0t-1 DNA constitute major DNA families of the D. moschatum, D. aphyllum and D. aggregatum genomes with DmoF14 representing an ancient component of orchid genomes. Large intercalary telomere-like arrays suggest chromosomal

  11. 16S Ribosomal DNA Sequence Analysis of a Large Collection of Environmental and Clinical Unidentifiable Bacterial Isolates

    PubMed Central

    Drancourt, Michel; Bollet, Claude; Carlioz, Antoine; Martelin, Rolland; Gayral, Jean-Pierre; Raoult, Didier


    Some bacteria are difficult to identify with phenotypic identification schemes commonly used outside reference laboratories. 16S ribosomal DNA (rDNA)-based identification of bacteria potentially offers a useful alternative when phenotypic characterization methods fail. However, as yet, the usefulness of 16S rDNA sequence analysis in the identification of conventionally unidentifiable isolates has not been evaluated with a large collection of isolates. In this study, we evaluated the utility of 16S rDNA sequencing as a means to identify a collection of 177 such isolates obtained from environmental, veterinary, and clinical sources. For 159 isolates (89.8%) there was at least one sequence in GenBank that yielded a similarity score of ≥97%, and for 139 isolates (78.5%) there was at least one sequence in GenBank that yielded a similarity score of ≥99%. These similarity score values were used to defined identification at the genus and species levels, respectively. For isolates identified to the species level, conventional identification failed to produce accurate results because of inappropriate biochemical profile determination in 76 isolates (58.7%), Gram staining in 16 isolates (11.6%), oxidase and catalase activity determination in 5 isolates (3.6%) and growth requirement determination in 2 isolates (1.5%). Eighteen isolates (10.2%) remained unidentifiable by 16S rDNA sequence analysis but were probably prototype isolates of new species. These isolates originated mainly from environmental sources (P = 0.07). The 16S rDNA approach failed to identify Enterobacter and Pantoea isolates to the species level (P = 0.04; odds ratio = 0.32 [95% confidence interval, 0.10 to 1.14]). Elsewhere, the usefulness of 16S rDNA sequencing was compromised by the presence of 16S rDNA sequences with >1% undetermined positions in the databases. Unlike phenotypic identification, which can be modified by the variability of expression of characters, 16S rDNA sequencing provides

  12. 104. JOB NO. 1347F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    104. JOB NO. 1347-F, SHEET 5S 1927, ASSEMBLY BUILDING; FORD MOTOR COMPANY; LONGITUDINAL SECTION AND TRUSS DETAILS - Ford Motor Company Long Beach Assembly Plant, Assembly Building, 700 Henry Ford Avenue, Long Beach, Los Angeles County, CA

  13. [Implementation of "5S" methodology in laboratory safety and its effect on employee satisfaction].


    Dogan, Yavuz; Ozkutuk, Aydan; Dogan, Ozlem


    Health institutions use the accreditation process to achieve improvement across the organization and management of the health care system. An ISO 15189 quality and efficiency standard is the recommended standard for medical laboratories qualification. The "safety and accommodation conditions" of this standard covers the requirement to improve working conditions and maintain the necessary safety precautions. The most inevitable precaution for ensuring a safe environment is the creation of a clean and orderly environment to maintain a potentially safe surroundings. In this context, the 5S application which is a superior improvement tool that has been used by the industry, includes some advantages such as encouraging employees to participate in and to help increase the productivity. The main target of this study was to implement 5S methods in a clinical laboratory of a university hospital for evaluating its effect on employees' satisfaction, and correction of non-compliance in terms of the working environment. To start with, first, 5S education was given to management and employees. Secondly, a 5S team was formed and then the main steps of 5S (Seiri: Sort, Seiton: Set in order, Seiso: Shine, Seiketsu: Standardize, and Shitsuke: Systematize) were implemented for a duration of 3 months. A five-point likert scale questionnaire was used in order to determine and assess the impact of 5S on employees' satisfaction considering the areas such as facilitating the job, the job satisfaction, setting up a safe environment, and the effect of participation in management. Questionnaire form was given to 114 employees who actively worked during the 5S implementation period, and the data obtained from 63 (52.3%) participants (16 male, 47 female) were evaluated. The reliability of the questionnaire's Cronbach's alpha value was determined as 0.858 (p< 0.001). After the implementation of 5S it was observed and determined that facilitating the job and setting up a safe environment created

  14. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2011 CFR


    ... 8 Aliens and Nationality 1 2011-01-01 2011-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  15. 8 CFR 236.4 - Removal of S-5, S-6, and S-7 nonimmigrants.

    Code of Federal Regulations, 2010 CFR


    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Removal of S-5, S-6, and S-7 nonimmigrants... of Aliens Prior to Order of Removal § 236.4 Removal of S-5, S-6, and S-7 nonimmigrants. (a) Condition... section 101(a)(15)(S) of the Act, nonimmigrants in S classification must have executed Form I-854, Part...

  16. One-stage surgery through posterior approach-for L5-S1 spondyloptosis

    PubMed Central

    Suslu, Hikmet Turan; Celikoglu, Erhan; Borekcı, Ali; Hıcdonmez, Tufan; Suslu, Hüsnü


    Grade 5 spondylolisthesis or spondyloptosis is a rare condition. Generally, the surgical management of spondyloptosis includes multi-staged procedures instead of one-staged procedures. One-stage treatment for spondyloptosis is very rare. A 15-year-old girl with L5-S1 spondyloptosis was admitted with severe low back pain. There was no history of trauma. The patient underwent L5 laminectomy, L5-S1 discectomy, resection of sacral dome, reduction, L3-L4-L5-S1 pedicular screw fixation, and interbody-posterolateral fusion through the posterior approach. The reduction was maintained with bilateral L5-S1 discectomy, resection of the sacral dome, and transpedicular instrumentation from L3 to S1. In this particular case, one-staged approach was adequate for the treatment of L5-S1 spondyloptosis. One-staged surgery using the posterior approach may be adequate for the treatment of L5-S1 spondyloptosis while avoiding the risks inherent in anterior approaches. PMID:23125496

  17. Direct 5S rRNA Assay for Monitoring Mixed-Culture Bioprocesses

    PubMed Central

    Stoner, D. L.; Browning, C. K.; Bulmer, D. K.; Ward, T. E.; MacDonell, M. T.


    This study demonstrates the efficacy of a direct 5S rRNA assay for the characterization of mixed microbial populations by using as an example the bacteria associated with acidic mining environments. The direct 5S rRNA assay described herein represents a nonselective, direct molecular method for monitoring and characterizing the predominant, metabolically active members of a microbial population. The foundation of the assay is high-resolution denaturing gradient gel electrophoresis (DGGE), which is used to separate 5S rRNA species extracted from collected biomass. Separation is based on the unique migration behavior of each 5S rRNA species during electrophoresis in denaturing gradient gels. With mixtures of RNA extracted from laboratory cultures, the upper practical limit for detection in the current experimental system has been estimated to be greater than 15 different species. With this method, the resolution was demonstrated to be effective at least to the species level. The strength of this approach was demonstrated by the ability to discriminate between Thiobacillus ferrooxidans ATCC 19859 and Thiobacillus thiooxidans ATCC 8085, two very closely related species. Migration patterns for the 5S rRNA from members of the genus Thiobacillus were readily distinguishable from those of the genera Acidiphilium and Leptospirillum. In conclusion, the 5S rRNA assay represents a powerful method by which the structure of a microbial population within acidic environments can be assessed. PMID:16535333

  18. Microbial rRNA: rDNA gene ratios may be unexpectedly low due to extracellular DNA preservation in soils

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We tested a method of estimating the activity of detectable individual bacterial and archaeal OTUs within a community by calculating ratios of absolute 16S rRNA to rDNA copy numbers. We investigated phylogenetically coherent patterns of activity among soil prokaryotes in non-growing soil communitie...


    EPA Science Inventory

    Recently, 16S rDNA Bacteroidetes-targeted PCR assays were developed to discriminate between ruminant and human fecal pollution. These assays are rapid and relatively inexpensive but have been used in a limited number of studies. In this study, we evaluated the efficacy o...


    EPA Science Inventory

    Traditional methods for assessing fecal pollution in environmental systems, such as monitoring for fecal coliforms are not capable of discriminating between different sources fecal pollution. Recently, 16S rDNA Bacteroidetes-targeted PCR assays were developed to discriminate betw...

  1. The complete mitochondrial genome sequence of Hepatozoon catesbianae (Apicomplexa: Coccidia: Adeleorina), a blood parasite of the green frog, Lithobates (formerly Rana) clamitans.


    Leveille, Alexandre N; Ogedengbe, Mosun E; Hafeez, Mian A; Tu, Hsiang-Hsien Abby; Barta, John R


    A complete mitochondrial genome for the blood parasite Hepatozoon catesbianae (Alveolata; Apicomplexa; Coccidia; Adeleorina; Hepatozoidae) was obtained through PCR amplification and direct sequencing of resulting PCR products. The mitochondrial genome of H. catesbianae is 6,397 bp in length and contains 3 protein-coding genes (cytochrome c oxidase subunit I [COI]; cytochrome c oxidase subunit III [COIII]; and cytochrome B [CytB]). Sequence similarities to previously published mitochondrial genomes of other apicomplexan parasites permitted annotation of 23 putative rDNA fragments in the mitochondrial genome of H. catesbianae, 14 large subunit rDNA fragments, and 9 small subunit rDNA fragments. Sequences corresponding to rDNA fragments RNA5, RNA8, RNA11, and RNA19 of Plasmodium falciparum were not identified in the mitrochondrial genome sequence of H. catesbianae. Although the presence of 3 protein-coding regions and numerous putative rDNA fragments is a feature typical for apicomplexan mitochondrial genomes, the mitochondrial genome of H. catesbianae possesses a structure and gene organization that is distinct among the Apicomplexa. This is the first complete mitochondrial genome sequence obtained from any apicomplexan parasite in the suborder Adeleorina. PMID:24820055

  2. Testing deep reticulate evolution in Amaryllidaceae Tribe Hippeastreae (Asparagales) with ITS and chloroplast sequence data

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The phylogeny of Amaryllidaceae tribe Hippeastreae was inferred using chloroplast (3’ycf1, ndhF, trnL-F) and nuclear (ITS rDNA) sequence data under maximum parsimony and maximum likelihood frameworks. Network analyses were applied to resolve conflicting signals among data sets and putative scenarios...

  3. Morphology and Small-Subunit Ribosomal DNA Sequence of Henneguya Adiposa (Myxosporea) From Ictalurus punctatus (Siluriformes)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The original description of Henneguya adiposa, a myxozoan parasitizing channel catfish Ictalurus punctatus, is supplemented with new data on spore morphology, including photomicrographs and line drawings, as well as 18S small-subunit (SSU) ribosomal DNA (rDNA) sequence. Elongate, translucent, linear...

  4. Macrolide Resistance in Treponema pallidum Correlates With 23S rDNA Mutations in Recently Isolated Clinical Strains

    PubMed Central

    Molini, Barbara J.; Tantalo, Lauren C.; Sahi, Sharon K.; Rodriguez, Veronica I.; Brandt, Stephanie L.; Fernandez, Mark C.; Godornes, Charmie B.; Marra, Christina M.; Lukehart, Sheila A.


    Background High rates of 23S rDNA mutations implicated in macrolide resistance have been identified in Treponema pallidum samples from syphilis patients in many countries. Nonetheless, some clinicians have been reluctant to abandon azithromycin as a treatment for syphilis, citing the lack of a causal association between these mutations and clinical evidence of drug resistance. Although azithromycin resistance has been demonstrated in vivo for the historical Street 14 strain, no recent T. pallidum isolates have been tested. We used the well-established rabbit model of syphilis to determine the in vivo efficacy of azithromycin against 23S rDNA mutant strains collected in 2004 to 2005 from patients with syphilis in Seattle, Wash. Methods Groups of 9 rabbits were each infected with a strain containing 23S rDNA mutation A2058G (strains UW074B, UW189B, UW391B) or A2059G (strains UW228B, UW254B, and UW330B), or with 1 wild type strain (Chicago, Bal 3, and Mexico A). After documentation of infection, 3 animals per strain were treated with azithromycin, 3 were treated with benzathine penicillin G, and 3 served as untreated control groups. Treatment efficacy was documented by darkfield microscopic evidence of T. pallidum, serological response, and rabbit infectivity test. Results Azithromycin uniformly failed to cure rabbits infected with strains harboring either 23S rDNA mutation, although benzathine penicillin G was effective. Infections caused by wild type strains were successfully treated by either azithromycin or benzathine penicillin G. Conclusions A macrolide resistant phenotype was demonstrated for all strains harboring a 23S rDNA mutation, demonstrating that either A2058G or A2059G mutation confers in vivo drug resistance. PMID:27513385

  5. Fragile Sites of ‘Valencia’ Sweet Orange (Citrus sinensis) Chromosomes Are Related with Active 45s rDNA

    PubMed Central

    Lan, Hong; Chen, Chun-Li; Miao, Yin; Yu, Chang-Xiu; Guo, Wen-Wu; Xu, Qiang; Deng, Xiu-Xin


    Citrus sinensis chromosomes present a morphological differentiation of bands after staining by the fluorochromes CMA and DAPI, but there is still little information on its chromosomal characteristics. In this study, the chromosomes in ‘Valencia’ C. sinensis were analyzed by fluorescence in situ hybridization (FISH) using telomere DNA and the 45S rDNA gene as probes combining CMA/DAPI staining, which showed that there were two fragile sites in sweet orange chromosomes co-localizing at distended 45S rDNA regions, one proximally locating on B-type chromosome and the other subterminally locating on D-type chromosome. While the chromosomal CMA banding and 45S rDNA FISH mapping in the doubled haploid line of ‘Valencia’ C. sinensis indicated six 45S rDNA regions, four were identified as fragile sites as doubled comparing its parental line, which confirmed the cytological heterozygosity and chromosomal heteromorphisms in sweet orange. Furthermore, Ag-NOR identified two distended 45S rDNA regions to be active nucleolar organizing regions (NORs) in diploid ‘Valencia’ C. sinensis. The occurrence of quadrivalent in meiosis of pollen mother cells (PMCs) in ‘Valencia’ sweet orange further confirmed it was a chromosomal reciprocal translocation line. We speculated this chromosome translocation was probably related to fragile sites. Our data provide insights into the chromosomal characteristics of the fragile sites in ‘Valencia’ sweet orange and are expected to facilitate the further investigation of the possible functions of fragile sites. PMID:26977938

  6. Next-generation sequencing reveals differentially amplified tandem repeats as a major genome component of Northern Europe's oldest Camellia japonica.


    Heitkam, Tony; Petrasch, Stefan; Zakrzewski, Falk; Kögler, Anja; Wenke, Torsten; Wanke, Stefan; Schmidt, Thomas


    Northern Europe's oldest and largest Camellia japonica growing at the Pillnitz Castle (Germany) for over 200 years is of botanical and cultural importance and is a reference for C. japonica molecular scale analysis. In order to provide a fundament for genome analysis of the genus Camellia, we characterize the C. japonica tandem repeat fraction, constituting 12.5 % of the Pillnitz camellia's genome. A genomic library of the Pillnitz C. japonica was produced and Illumina sequenced to generate 36 Gb of paired-end reads. We performed graph-based read clustering implemented in the RepeatExplorer pipeline to estimate the C. japonica repeat fraction of 73 %. This enabled us to identify and characterize the most prominent satellite DNAs, Camellia japonica satellite 1-4 (CajaSat1-CajaSat4), and the 5S ribosomal DNA (rDNA) by bioinformatics, fluorescent in situ and Southern hybridization. Within the Camellia genus, satellite spreading, array expansion and formation of higher-order structures highlight different modes of repeat evolution. The CajaSat satellites localize at prominent chromosomal sites, including (peri)centromeres and subtelomeres of all chromosomes, thus serving as chromosomal landmarks for their identification. This work provides an insight into the C. japonica chromosome organization and significantly expands the Camellia genomic knowledge, also with respect to the tea plant Camellia sinensis. PMID:26582634

  7. Affinity chromatography of Drosophila melanogaster ribosomal proteins to 5S rRNA.


    Stark, B C; Chooi, W Y


    The binding of Drosophila melanogaster ribosomal proteins to D. melanogaster 5S rRNA was studied using affinity chromatography of total ribosomal proteins (TP80) on 5S rRNA linked via adipic acid dihydrazide to Sepharose 4B. Ribosomal proteins which bound 5S rRNA at 0.3 M potassium chloride and were eluted at 1 M potassium chloride were identified as proteins 1, L4, 2/3, L14/L16, and S1, S2, S3, S4, S5, by two-dimensional polyacrylamide gel electrophoresis. Using poly A-Sepharose 4B columns as a model of non-specific binding, we found that a subset of TP80 proteins is also bound. This subset, while containing some of the proteins bound by 5S rRNA columns, was distinctly different from the latter subset, indicating that the binding to 5S rRNA was specific for that RNA species. PMID:3923010

  8. Photoionization study of Xe 5s: ionization cross sections and photoelectron angular distributions

    NASA Astrophysics Data System (ADS)

    Aarthi, G.; Jose, J.; Deshmukh, S.; Radojevic, V.; Deshmukh, P. C.; Manson, S. T.


    We report studies of photoelectron angular distribution and cross-section for photoionization of xenon 5s electrons using the relativistic multiconfiguration Tamm-Dancoff (MCTD) approximation. We find that MCTD provides a significantly improved agreement with experiment, compared to some of the other relativistic many body approximations such as the relativistic random phase approximation and the relativistic random phase approximation with relaxation, over the entire photon energy region bracketing the near-threshold 5s Cooper minimum, from the 5s threshold up to about 70 eV. The MCTD results in the length form are in much better agreement with the experiment than those in the velocity form, suggesting residual correlations that must be of importance.

  9. Diversity of 5S rRNA genes within individual prokaryotic genomes

    PubMed Central

    Pei, Anna; Li, Hongru; Oberdorf, William E; Alekseyenko, Alexander V.; Parsons, Tamasha; Yang, Liying; Gerz, Erika A.; Lee, Peng; Xiang, Charlie; Nossa, Carlos W.; Pei, Zhiheng


    We examined intragenomic variation of paralogous 5S rRNA genes to evaluate the concept of ribosomal constraints. In a dataset containing 1168 genomes from 779 unique species, 96 species exhibited >3% diversity. Twenty seven species with >10% diversity contained a total of 421 mismatches between all pairs of the most dissimilar copies of 5S rRNA genes. The large majority (401 of 421) the diversified positions were conserved at the secondary structure level. The high diversity was associated with partial rRNA operon, split operon, or spacer length-related divergence. In total, these findings indicated that there were tight ribosomal constraints on paralogous 5S rRNA genes in a genome despite of the high degree of diversity at the primary structure level. There is supplementary material. PMID:22765222

  10. Characterization of the L4-L5-S1 motion segment using the stepwise reduction method.


    Jaramillo, Héctor Enrique; Puttlitz, Christian M; McGilvray, Kirk; García, José J


    The two aims of this study were to generate data for a more accurate calibration of finite element models including the L5-S1 segment, and to find mechanical differences between the L4-L5 and L5-S1 segments. Then, the range of motion (ROM) and facet forces for the L4-S1 segment were measured using the stepwise reduction method. This consists of sequentially testing and reducing each segment in nine stages by cutting the ligaments, facet capsules, and removing the nucleus. Five L4-S1 human segments (median: 65 years, range: 53-84 years, SD=11.0 years) were loaded under a maximum pure moment of 8Nm. The ROM was measured using stereo-photogrammetry via tracking of three markers and the facet contact forces (CF) were measured using a Tekscan system. The ROM for the L4-L5 segment and all stages showed good agreement with published data. The major differences in ROM between the L4-L5 and L5-S1 segments were found for lateral bending and all stages, for which the L4-L5 ROM was about 1.5-3 times higher than that of the L5-S1 segment, consistent with L5-S1 facet CF about 1.3 to 4 times higher than those measured for the L4-L5 segment. For the other movements and few stages, the L4-L5 ROM was significantly lower that of the L5-S1 segment. ROM and CF provide important baseline data for more accurate calibration of FE models and to understand the role that their structures play in lower lumbar spine mechanics. PMID:27017302

  11. Phylogenetic analysis of LSU and SSU rDNA group I introns of lichen photobionts associated with the genera Xanthoria and Xanthomendoza (Teloschistaceae, lichenized Ascomycetes)

    PubMed Central

    Nyati, Shyam; Bhattacharya, Debashish; Werth, Silke; Honegger, Rosmarie


    We studied group I introns in sterile cultures of selected groups of lichen photobionts, focusing on Trebouxia species associated with Xanthoria s. lat. (including Xanthomendoza spp.; lichen-forming ascomycetes). Group I introns were found inserted after position 798 (Escherichia coli numbering) in the large subunit (LSU) rRNA in representatives of the green algal genera Trebouxia and Asterochloris. The 798 intron was found in about 25% of Xanthoria photobionts including several reference strains obtained from algal culture collections. An alignment of LSU-encoded rDNA intron sequences revealed high similarity of these sequences allowing their phylogenetic analysis. The 798 group I intron phylogeny was largely congruent with a phylogeny of the Internal Transcribed Spacer Region (ITS), indicating that the insertion of the intron most likely occurred in the common ancestor of the genera Trebouxia and Asterochloris. The intron was vertically inherited in some taxa, but lost in others. The high sequence similarity of this intron to one found in Chlorella angustoellipsoidea suggests that the 798 intron was either present in the common ancestor of Trebouxiophyceae, or that its present distribution results from more recent horizontal transfers, followed by vertical inheritance and loss. Analysis of another group I intron shared by these photobionts at small subunit (SSU) position 1512 supports the hypothesis of repeated lateral transfers of this intron among some taxa, but loss among others. Our data confirm that the history of group I introns is characterized by repeated horizontal transfers, and suggests that some of these introns have ancient origins within Chlorophyta. PMID:24415800

  12. Sequence variation within the rRNA gene loci of 12 Drosophila species

    PubMed Central

    Stage, Deborah E.; Eickbush, Thomas H.


    Concerted evolution maintains at near identity the hundreds of tandemly arrayed ribosomal RNA (rRNA) genes and their spacers present in any eukaryote. Few comprehensive attempts have been made to directly measure the identity between the rDNA units. We used the original sequencing reads (trace archives) available through the whole-genome shotgun sequencing projects of 12 Drosophila species to locate the sequence variants within the 7.8–8.2 kb transcribed portions of the rDNA units. Three to 18 variants were identified in >3% of the total rDNA units from 11 species. Species where the rDNA units are present on multiple chromosomes exhibited only minor increases in sequence variation. Variants were 10–20 times more abundant in the noncoding compared with the coding regions of the rDNA unit. Within the coding regions, variants were three to eight times more abundant in the expansion compared with the conserved core regions. The distribution of variants was largely consistent with models of concerted evolution in which there is uniform recombination across the transcribed portion of the unit with the frequency of standing variants dependent upon the selection pressure to preserve that sequence. However, the 28S gene was found to contain fewer variants than the 18S gene despite evolving 2.5-fold faster. We postulate that the fewer variants in the 28S gene is due to localized gene conversion or DNA repair triggered by the activity of retrotransposable elements that are specialized for insertion into the 28S genes of these species. PMID:17989256

  13. Origins of the plant chloroplasts and mitochondria based on comparisons of 5S ribosomal RNAs

    NASA Technical Reports Server (NTRS)

    Delihas, N.; Fox, G. E.


    In this paper, we provide macromolecular comparisons utilizing the 5S ribosomal RNA structure to suggest extant bacteria that are the likely descendants of chloroplast and mitochondria endosymbionts. The genetic stability and near universality of the 5S ribosomal gene allows for a useful means to study ancient evolutionary changes by macromolecular comparisons. The value in current and future ribosomal RNA comparisons is in fine tuning the assignment of ancestors to the organelles and in establishing extant species likely to be descendants of bacteria involved in presumed multiple endosymbiotic events.

  14. The Pattern of R2 Retrotransposon Activity in Natural Populations of Drosophila simulans Reflects the Dynamic Nature of the rDNA Locus

    PubMed Central

    Zhou, Jun; Eickbush, Thomas H.


    The pattern and frequency of insertions that enable transposable elements to remain active in a population are poorly understood. The retrotransposable element R2 exclusively inserts into the 28S rRNA genes where it establishes long-term, stable relationships with its animal hosts. Previous studies with laboratory stocks of Drosophila simulans have suggested that control over R2 retrotransposition resides within the rDNA loci. In this report, we sampled 180 rDNA loci of animals collected from two natural populations of D. simulans. The two populations were found to have similar patterns of R2 activity. About half of the rDNA loci supported no or very low levels of R2 transcripts with no evidence of R2 retrotransposition. The remaining half of the rDNA loci had levels of R2 transcripts that varied in a continuous manner over almost a 100-fold range and did support new retrotransposition events. Structural analysis of the rDNA loci in 18 lines that spanned the range of R2 transcript levels in these populations revealed that R2 number and rDNA locus size varied 2-fold; however, R2 activity was not readily correlated with either of these parameters. Instead R2 activity was best correlated with the distribution of elements within the rDNA locus. Loci with no activity had larger contiguous blocks of rDNA units free of R2-insertions. These data suggest a model in which frequent recombination within the rDNA locus continually redistributes R2-inserted units resulting in changing levels of R2 activity within individual loci and persistent R2 activity within the population. PMID:19229317

  15. The katablepharids are a distant sister group of the Cryptophyta: A proposal for Katablepharidophyta divisio nova/ Kathablepharida phylum novum based on SSU rDNA and beta-tubulin phylogeny.


    Okamoto, Noriko; Inouye, Isao


    The katablepharids are a morphologically well-defined group of heterotrophic flagellates. Since their original description in 1939, they have been classified in the Cryptophyceae (Cryptophyta) based on their similar cell shape, flagellar orientation, and the presence of ejectisomes visible by light microscopy. However, electron microscopy suggests that the katablepharids are distinct from cryptomonads. A possible affinity with the Alveolata has been proposed which is mainly based on the resemblance of their feeding apparatus to the apical complex of the Apicomplexa or to the tentacles of the Ciliophora. In this study, we provide the first SSU rDNA and beta-tubulin molecular sequence data for two katablepharids: Katablepharis japonica sp. nov. and Leucocryptos marina. We reveal that the katablepharids are not closely related to the Alveolata; rather, phylogenetic reconstruction analyses of SSU rDNA and beta-tubulin suggest that the katablepharids are a distant sister group of the Cryptophyta. We therefore conclude that the katablepharids should be a group equivalent to the Cryptophyta and propose Katablepharidophyta divisio nova (ICBN)/Kathablepharida phylum novum (ICZN). PMID:16171184

  16. Development of a real-time PCR method for the detection of fossil 16S rDNA fragments of phototrophic sulfur bacteria in the sediments of Lake Cadagno.


    Ravasi, D F; Peduzzi, S; Guidi, V; Peduzzi, R; Wirth, S B; Gilli, A; Tonolla, M


    Lake Cadagno is a crenogenic meromictic lake situated in the southern range of the Swiss Alps characterized by a compact chemocline that has been the object of many ecological studies. The population dynamics of phototrophic sulfur bacteria in the chemocline has been monitored since 1994 with molecular methods such as 16S rRNA gene clone library analysis. To reconstruct paleo-microbial community dynamics, we developed a quantitative real-time PCR methodology for specific detection of 16S rRNA gene sequences of purple and green sulfur bacteria populations from sediment samples. We detected fossil 16S rDNA of nine populations of phototrophic sulfur bacteria down to 9-m sediment depth, corresponding to about 9500 years of the lake's biogeological history. These results provide the first evidence for the presence of 16S rDNA of anoxygenic phototrophic bacteria in Holocene sediments of an alpine meromictic lake and indicate that the water column stratification and the bacterial plume were already present in Lake Cadagno thousands of years ago. The finding of Chlorobium clathratiforme remains in all the samples analyzed shows that this population, identified in the water column only in 2001, was already a part of the lake's biota in the past. PMID:22433067

  17. Tracking the evolution of sex chromosome systems in Melanoplinae grasshoppers through chromosomal mapping of repetitive DNA sequences

    PubMed Central


    Background The accumulation of repetitive DNA during sex chromosome differentiation is a common feature of many eukaryotes and becomes more evident after recombination has been restricted or abolished. The accumulated repetitive sequences include multigene families, microsatellites, satellite DNAs and mobile elements, all of which are important for the structural remodeling of heterochromatin. In grasshoppers, derived sex chromosome systems, such as neo-XY♂/XX♀ and neo-X1X2Y♂/X1X1X2X2♀, are frequently observed in the Melanoplinae subfamily. However, no studies concerning the evolution of sex chromosomes in Melanoplinae have addressed the role of the repetitive DNA sequences. To further investigate the evolution of sex chromosomes in grasshoppers, we used classical cytogenetic and FISH analyses to examine the repetitive DNA sequences in six phylogenetically related Melanoplinae species with X0♂/XX♀, neo-XY♂/XX♀ and neo-X1X2Y♂/X1X1X2X2♀ sex chromosome systems. Results Our data indicate a non-spreading of heterochromatic blocks and pool of repetitive DNAs (C0t-1 DNA) in the sex chromosomes; however, the spreading of multigene families among the neo-sex chromosomes of Eurotettix and Dichromatos was remarkable, particularly for 5S rDNA. In autosomes, FISH mapping of multigene families revealed distinct patterns of chromosomal organization at the intra- and intergenomic levels. Conclusions These results suggest a common origin and subsequent differential accumulation of repetitive DNAs in the sex chromosomes of Dichromatos and an independent origin of the sex chromosomes of the neo-XY and neo-X1X2Y systems. Our data indicate a possible role for repetitive DNAs in the diversification of sex chromosome systems in grasshoppers. PMID:23937327

  18. Imbalanced presence of Borrelia burgdorferi s.l. multilocus sequence types in clinical manifestations of Lyme borreliosis.


    Coipan, E Claudia; Jahfari, Setareh; Fonville, Manoj; Oei, G Anneke; Spanjaard, Lodewijk; Takumi, Katsuhisa; Hovius, Joppe W R; Sprong, Hein


    In this study we used typing based on the eight multilocus sequence typing scheme housekeeping genes (MLST) and 5S-23S rDNA intergenic spacer (IGS) to explore the population structure of Borrelia burgdorferi sensu lato isolates from patients with Lyme borreliosis (LB) and to test the association between the B. burgdorferi s.l. sequence types (ST) and the clinical manifestations they cause in humans. Isolates of B. burgdorferi from 183 LB cases across Europe, with distinct clinical manifestations, and 257 Ixodes ricinus lysates from The Netherlands, were analyzed for this study alone. For completeness, we incorporated in our analysis also 335 European B. burgdorferi s.l. MLST profiles retrieved from literature. Borrelia afzelii and Borrelia bavariensis were associated with human cases of LB while Borrelia garinii, Borrelia lusitaniae and Borrelia valaisiana were associated with questing I. ricinus ticks. B. afzelii was associated with acrodermatitis chronica atrophicans, while B. garinii and B. bavariensis were associated with neuroborreliosis. The samples in our study belonged to 251 different STs, of which 94 are newly described, adding to the overall picture of the genetic diversity of Borrelia genospecies. The fraction of STs that were isolated from human samples was significantly higher for the genospecies that are known to be maintained in enzootic cycles by mammals (B. afzelii, B. bavariensis, and Borrelia spielmanii) than for genospecies that are maintained by birds (B. garinii and B. valaisiana) or lizards (B. lusitaniae). We found six multilocus sequence types that were significantly associated to clinical manifestations in humans and five IGS haplotypes that were associated with the human LB cases. While IGS could perform just as well as the housekeeping genes in the MLST scheme for predicting the infectivity of B. burgdorferi s.l., the advantage of MLST is that it can also capture the differential invasiveness of the various STs. PMID:27125686

  19. A contribution to the taxonomy of the genus Rinodina (Physciaceae, lichenized Ascomycotina) using combined ITS and mtSSU rDNA data

    PubMed Central

    NADYEINA, Olga; GRUBE, Martin; MAYRHOFER, Helmut


    To test the phylogenetic position of phenotypically peculiar species in the Physciaceae we generated 47 new sequences (26 of nrITS region and 21 of mtSSU rDNA) from 19 crustose taxa of Physciaceae mainly from the genus Rinodina. Phylogenetic analysis confirmed the Buellia and Physcia groups. The analysis revealed a considerable variability of characters traditionally used for classification, especially in the delimitation of the genera Buellia and Rinodina. While ascus types agree well with the distinction of the Buellia and Physcia groups, none of the other traditional characters, including excipulum type and ascospore thickening, were consistent within subclades of the Physcia group. We suggest that both excipulum type and ascospore characters are rather dynamic in the evolution of Rinodina species and only appear consistent in morphologically more complex foliose and fruticose groups, which are characterized by thallus characters not present in the crustose groups. Two recent taxonomic changes are supported by molecular characters: Endohyalina insularis (syn. ‘Rinodina’ insularis) and Rinodina lindingeri (syn. ‘Buellia’ lindingeri). In addition Rinodina parvula (syn. ‘Buellia’ parvula) is reinstated. New records for Endohyalina brandii, E. diederichii, E. insularis and Rinodina albana are presented. PMID:22121298

  20. Molecular Identification and Differentiation of Fasciola Isolates Using PCR- RFLP Method Based on Internal Transcribed Spacer (ITS1, 5.8S rDNA, ITS2)

    PubMed Central

    Mahami-Oskouei, M; Dalimi, A; Forouzandeh-Moghadam, M; Rokni, MB


    Background In this study, we used both ITS1 and ITS2 for molecular identification of Fasciola species. Methods The region between 18S and 28S of ribosomal DNA was used in PCR-RFLP method for molecular identification of Fasciola species. Ninety trematodes of Fasciola were collected during abattoir inspection from livers of naturally infected sheep and cattle from Khorasan, East Azerbaijan, and Fars provinces in Iran. After DNA extraction, PCR was performed to amplify region ITS1, 5.8S rDNA, ITS2. To select a suitable restriction enzyme, we sequenced and analyzed the PCR products of F. hepatica and F. gigantica samples from sheep and cattle. Tsp509I fast digest restriction enzyme was selected for RFLP method that caused the separation specifically of Fasciola species. Results The fragment approximately 1000bp in all of the Fasciola samples was amplified and then digested with the Tsp509I restriction endonuclease. Seventy F. hepatica and 20 F. gigantica were identified of total 90 Fasciola isolates. Conclusion The new PCR-RFLP assay using Tsp509I restriction enzyme provides a simple, practical, fast, low cost, and reliable method for identification and differentiation of Fasciola isolates. PMID:22347295

  1. A molecular phylogeny of the Dactylogyridae sensu Kritsky & Boeger (1989) (Monogenea) based on the D1-D3 domains of large subunit rDNA.


    Simková, A; Matejusová, I; Cunningham, C O


    Phylogenetic analyses based on the partial large subunit rDNA (LSU) sequences of polyonchoinean monogeneans belonging to the Dactylogyridea and Monocotylidea were generated to investigate relationships among various subfamilies of the Dactylogyridae sensu Kritsky & Boeger, 1989. Monophyly of the Dactylogyridae was supported by all analyses performed. Status of the Ancyrocephalidae sensu Bychowsky & Nagibina, 1978 and Ancyrocephalinae sensu Kritsky & Boeger, 1989 was revised based on the present data. All phylogenetic analyses indicated polyphyletic origins of the Ancyrocephalidae and Ancyrocephalinae. Freshwater species of Ancyrocephalinae (Actinocleidus, Ancyrocephalus, Cleidodiscus and Urocleidus) and Ancylodiscoidinae (Thaparocleidus) collected from the fish in European waters were positioned at the base of the Dactylogyridae. The Dactylogyrinae formed a monophyletic group, sister to a clade including the Pseudodactylogyrinae and the tropical and subtropical Ancyrocephalinae. Analyses including only data set on Dactylogyridea were focused on relationships between representatives of the Asian and European Dactylogyrus species. Dactylogyrus species formed a monophyletic group, and the parasite colonization appeared to follow the dispersal history of the Cyprinidae from Asia to Europe. Three lineages of Dactylogyrus species were recognized: the first including species specific to hosts of Asian origin, the second by Dactylogyrus species from Chinese fish hosts, and the third included Dactylogyrus species from European cyprinids and one species from a percid host. The position of D. cryptomeres from Gobio gobio seems to be unresolved. PMID:16515727

  2. Ichthyophonus parasite phylogeny based on ITS rDNA structure prediction and alignment identifies six clades, with a single dominant marine type

    USGS Publications Warehouse

    Gregg, Jacob; Thompson, Rachel L.; Purcell, Maureen; Friedman, Carolyn S.; Hershberger, Paul


    Despite their widespread, global impact in both wild and cultured fishes, little is known of the diversity, transmission patterns, and phylogeography of parasites generally identified as Ichthyophonus. This study constructed a phylogeny based on the structural alignment of internal transcribed spacer (ITS) rDNA sequences to compare Ichthyophonus isolates from fish hosts in the Atlantic and Pacific oceans, and several rivers and aquaculture sites in North America, Europe, and Japan. Structure of the Ichthyophonus ITS1–5.8S–ITS2 transcript exhibited several homologies with other eukaryotes, and 6 distinct clades were identified within Ichthyophonus. A single clade contained a majority (71 of 98) of parasite isolations. This ubiquitous Ichthyophonus type occurred in 13 marine and anadromous hosts and was associated with epizootics in Atlantic herring, Chinook salmon, and American shad. A second clade contained all isolates from aquaculture, despite great geographic separation of the freshwater hosts. Each of the 4 remaining clades contained isolates from single host species. This study is the first to evaluate the genetic relationships among Ichthyophonus species across a significant portion of their host and geographic range. Additionally, parasite infection prevalence is reported in 16 fish species.

  3. Ichthyophonus parasite phylogeny based on ITS rDNA structure prediction and alignment identifies six clades, with a single dominant marine type.


    Gregg, Jacob L; Powers, Rachel L; Purcell, Maureen K; Friedman, Carolyn S; Hershberger, Paul K


    Despite their widespread, global impact in both wild and cultured fishes, little is known of the diversity, transmission patterns, and phylogeography of parasites generally identified as Ichthyophonus. This study constructed a phylogeny based on the structural alignment of internal transcribed spacer (ITS) rDNA sequences to compare Ichthyophonus isolates from fish hosts in the Atlantic and Pacific oceans, and several rivers and aquaculture sites in North America, Europe, and Japan. Structure of the Ichthyophonus ITS1-5.8S-ITS2 transcript exhibited several homologies with other eukaryotes, and 6 distinct clades were identified within Ichthyophonus. A single clade contained a majority (71 of 98) of parasite isolations. This ubiquitous Ichthyophonus type occurred in 13 marine and anadromous hosts and was associated with epizootics in Atlantic herring, Chinook salmon, and American shad. A second clade contained all isolates from aquaculture, despite great geographic separation of the freshwater hosts. Each of the 4 remaining clades contained isolates from single host species. This study is the first to evaluate the genetic relationships among Ichthyophonus species across a significant portion of their host and geographic range. Additionally, parasite infection prevalence is reported in 16 fish species. PMID:27409236

  4. TP53INP2/DOR, a mediator of cell autophagy, promotes rDNA transcription via facilitating the assembly of the POLR1/RNA polymerase I preinitiation complex at rDNA promoters.


    Xu, Yinfeng; Wan, Wei; Shou, Xin; Huang, Rui; You, Zhiyuan; Shou, Yanhong; Wang, Lingling; Zhou, Tianhua; Liu, Wei


    Cells control their metabolism through modulating the anabolic and catabolic pathways. TP53INP2/DOR (tumor protein p53 inducible nuclear protein 2), participates in cell catabolism by serving as a promoter of autophagy. Here we uncover a novel function of TP53INP2 in protein synthesis, a major biosynthetic and energy-consuming anabolic process. TP53INP2 localizes to the nucleolus through its nucleolar localization signal (NoLS) located at the C-terminal domain. Chromatin immunoprecipitation (ChIP) assays detected an association of TP53INP2 with the ribosomal DNA (rDNA), when exclusion of TP53INP2 from the nucleolus repressed rDNA promoter activity and the production of ribosomal RNA (rRNA) and proteins. The removal of TP53INP2 also impaired the association of the POLR1/RNA polymerase I preinitiation complex (PIC) with rDNA. Further, TP53INP2 interacts directly with POLR1 PIC, and is required for the assembly of the complex. These data indicate that TP53INP2 promotes ribosome biogenesis through facilitating rRNA synthesis at the nucleolus, suggesting a dual role of TP53INP2 in cell metabolism, assisting anabolism on the nucleolus, and stimulating catabolism off the nucleolus. PMID:27172002


    EPA Science Inventory

    Dyer, S.D., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to predict HC5's Based on QSARs (Abstract). To be presented at the SETAC Europe 14th Annual Meeting: Environmental Science Solution: A Pan-European Perspective, 18-...

  6. Sacrum fracture following L5-S1 stand-alone interbody fusion for isthmic spondylolisthesis.


    Phan, Kevin; Mobbs, Ralph J


    We report a 72-year-old man with a rare sacral fracture following stand-alone L5-S1 anterior lumbar interbody fusion for isthmic spondylolisthesis. The man underwent a minimally invasive management strategy using posterior percutaneous pedicle fixation and partial reduction of the deformity. We also discuss the current literature on fusion procedures for isthmic spondylolisthesis. PMID:26100158


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    5. S U.S. HIGHWAY 34 AND EAST (ILLINOIS) APPROACH TO BRIDGE WITH EAST BRIDGE HOUSE IN RIGHT FOREGROUND. VIEW TO WEST. - MacArthur Bridge, Spanning Mississippi River on Highway 34 between IA & IL, Burlington, Des Moines County, IA


    EPA Science Inventory

    Dyer, S., S. Belanger, J. Chaney, D. Versteeg and F. Mayer. In press. Use of Interspecies Correlation Estimations to Predict HC5's Based on Minimal Data (Abstract). To be presented at the SETAC Fourth World Congress, 14-18 November 2004, Portland, OR. 1 p. (ERL,GB R1013).

  9. Adaptation of the S-5-S pendulum seismometer for measurement of rotational ground motion

    NASA Astrophysics Data System (ADS)

    Knejzlík, Jaromír; Kaláb, Zdeněk; Rambouský, Zdeněk


    The Russian electrodynamic seismometer model S-5-S has been adapted for the measurement of rotational ground motion. The mechanical system of the original S-5-S seismometer consists of electrodynamic sensing and damping transducer coils mounted on an asymmetrical double-arm pendulum. This pendulum is suspended on a footing using two pairs of crossed flat springs, which operate as the axis of rotation. The pendulum is stabilised by an additional spring. The S-5-S can be used either as a vertical or as a horizontal sensor. The adaptation of the S-5-S seismometer described below involves removal of the additional spring and installation of an additional mass on the damping arm. Strain gauge angle sensors are installed on one pair of the crossed flat springs. The main dynamic parameters of the rotational seismometer created in this way, i.e. the natural period and damping, are controlled electronically by feedback currents proportional to the angular displacement and angular velocity, both fed to the damping transducer coil. This new seismometer, named the S-5-SR, enables measurement of the rotational component of ground motion around the horizontal or the vertical axes. The output signal from this S-5-SR seismometer can be proportional either to rotational displacement or rotational velocity.

  10. Molecular analysis of a NOR site polymorphism in brown trout (Salmo trutta): organization of rDNA intergenic spacers.


    Castro, J; Sánchez, L; Martínez, P; Lucchini, S D; Nardi, I


    Using restriction endonuclease mapping, we have analyzed the organization of rDNA (DNA coding for ribosomal RNA (rRNA)) units in the salmonid fish Salmo trutta, as an initial step toward understand the molecular basis of a nucleolar organizer region (NOR) site polymorphism detected in this species. The size of the rDNA units ranged between 15 and 23 kb, with remarkable variation both within individuals and between populations. Three regions of internal tandem repetitiveness responsible for this length polymorphism were located to the intergenic spacers. NOR site polymorphic individuals showed a higher number of length classes, in some cases forming a complete 1 kb fragment ladder. The amount of rRNA genes was as much as 8-fold higher in polymorphic individuals compared with standard individuals. All individuals from the most polymorphic population showed a 14-kb insertion of unknown nature in a small proportion (below 25%) of the 28S rRNA genes. PMID:18464877

  11. Analysis of 16S rDNA and Metagenomic Sequences Revealed Microbial Community and Host-Specific Sequences of Canadian Geese Feces

    EPA Science Inventory

    There is an increasing concern regarding the public health risks associated with waterfowl fecal pollution as a result of the increase in geese populations (Branta canadensis) in or near U.S. and Canadian recreational waters. Currently, there are no methods that can be used to de...

  12. Comparative analysis of the genes encoding 23S-5S rRNA intergenic spacer regions of Lactobacillus casei-related strains.


    Chen, H; Lim, C K; Lee, Y K; Chan, Y N


    In this study, investigations into the 23S-5S rRNA intergenic spacer regions (ISRs) of the Lactobacillus casei group were performed. A 1.6 kb fragment, from Lactobacillus paracasei strain ATCC 27092, containing part of the 5S rRNA gene (60 bp), the 5S-23S spacer region (198 bp) and part of the 23S rRNA gene (1295 bp) was cloned and sequenced (GenBank no. AF098107). This fragment was used as a probe to determine the rRNA restriction fragment length polymorphism (RFLP) patterns of nine strains belonging to the Lactobacillus casei group, along with four other non-Lactobacillus casei lactobacilli species. A pair of PCR primers, 23-Fl and 5-Ru, was designed and used for PCR amplification of the 23S-5S rRNA ISRs of these strains. The ISR length and sequence polymorphisms provided additional information for the taxonomic study of the Lactobacillus casei group. The spacer-length polymorphism of Lactobacillus rhamnosus was distinct from those of the other strains and this observation is consistent with the classification of Lactobacillus rhamnosus proposed by Mori et al. For all Lactobacillus casei and Lactobacillus paracasei strains, two major bands (approx. 250 and 170 bp in size) were obtained except in the case of Lactobacillus paracasei subsp. tolerans strain NCIMB 9709T, which yielded only one amplified product (250 bp). The sequencing data of the PCR products of seven well-characterized Lactobacillus casei and Lactobacillus paracasei strains revealed the presence of a 76/80 bp insertion/deletion with some random, single-base substitutions between the longer and shorter spacers for each respective strain. A few base variations were also detected within different strains in this group although the overall sequence similarity was very high (95.9-99.5%). The rRNA RFLP and the spacer sequence of Lactobacillus casei type strain ATCC 393T exhibited unique identities in this cluster. On the other hand, Lactobacillus casei strain ATCC 334 showed a high level of similarity

  13. DNaseI-hypersensitive sites at promoter-like sequences in the spacer of Xenopus laevis and Xenopus borealis ribosomal DNA.

    PubMed Central

    La Volpe, A; Taggart, M; McStay, B; Bird, A


    We have detected a DNAseI hypersensitive site in the ribosomal DNA spacer of Xenopus laevis and Xenopus borealis. The site is present in blood and embryonic nuclei of each species. In interspecies hybrids, however, the site is absent in unexpressed borealis rDNA, but is present normally in expressed laevis rDNA. Hypersensitive sites are located well upstream (over lkb) of the pre-ribosomal RNA promoter. Sequencing of the hypersensitive region in borealis rDNA, however, shows extensive homology with the promoter sequence, and with the hypersensitive region in X. laevis. Of two promoter-like duplications in each spacer, only the most upstream copy is associated with hypersensitivity to DNAaseI. Unlike DNAaseI, Endo R. MspI digests the rDNA of laevis blood nuclei at a domain extending downstream from the hypersensitive site to near the 40S promoter. Since the organisation of conserved sequence elements within this "proximal domain" is similar in three Xenopus species whose spacers have otherwise evolved rapidly, we conclude that this domain plays an important role in rDNA function. Images PMID:6310495

  14. 1s2s2p2 5p3 5S transition in B ii

    NASA Astrophysics Data System (ADS)

    Mannervik, S.; Cederquist, H.; Martinson, I.; Brage, T.; Froese Fischer, C.


    An experimental and theoretical study has been made of the 1s2s2p2 5P-1s2p3 5S transition in B ii. The experimental wavelength and lifetime (1323.92+/-0.07 Å and 0.65+/-0.01 ns), determined by beam-foil spectroscopy, are more than five times more accurate than previous experimental results. Our theoretical data, from multiconfiguration Hartree-Fock calculations, 1311.6 Å and 0.601 ns, are in excellent agreement with previous theoretical predictions of Beck and Nicolaides [Phys. Lett. 61A, 227 (1977)]. We have also observed the 1s2p3 5S-1s2p23s 5P transition, at 857.7+/-0.2 Å, in accord with the theoretical value 859.1 Å.

  15. Optical characterization of CuIn5S8 crystals by ellipsometry measurements

    NASA Astrophysics Data System (ADS)

    Isik, Mehmet; Gasanly, Nizami


    Optical properties of CuIn5S8 crystals grown by Bridgman method were investigated by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficients were obtained from the analysis of ellipsometry experiments performed in the 1.2-6.2 eV spectral region. Analysis of spectral dependence of the absorption coefficient revealed the existence of direct band gap transitions with energy 1.53 eV. Wemple-DiDomenico and Spitzer-Fan models were used to find the oscillator energy, dispersion energy, zero-frequency refractive index and high-frequency dielectric constant values. Structural properties of the CuIn5S8 crystals were investigated using X-ray diffraction and energy dispersive spectroscopy analysis.

  16. Ellipsometry study of optical parameters of AgIn5S8 crystals

    NASA Astrophysics Data System (ADS)

    Isik, Mehmet; Gasanly, Nizami


    AgIn5S8 crystals grown by Bridgman method were characterized for optical properties by ellipsometry measurements. Spectral dependence of optical parameters; real and imaginary parts of the pseudodielectric function, pseudorefractive index, pseudoextinction coefficient, reflectivity and absorption coefficient were obtained from ellipsometry experiments carried out in the 1.2-6.2 eV range. Direct band gap energy of 1.84 eV was found from the analysis of absorption coefficient vs. photon energy. The oscillator energy, dispersion energy and zero-frequency refractive index, high-frequency dielectric constant values were found from the analysis of the experimental data using Wemple-DiDomenico and Spitzer-Fan models. Crystal structure and atomic composition ratio of the constituent elements in the AgIn5S8 crystal were revealed from structural characterization techniques of X-ray diffraction and energy dispersive spectroscopy.

  17. Unexpected Diagnosis of Cerebral Toxoplasmosis by 16S and D2 Large-Subunit Ribosomal DNA PCR and Sequencing

    PubMed Central

    Kvich, Lasse; Eickhardt, Steffen; Omland, Lars H.; Bjarnsholt, Thomas; Moser, Claus


    The protozoan parasite Toxoplasma gondii causes severe opportunistic infections. Here, we report an unexpected diagnosis of cerebral toxoplasmosis. T. gondii was diagnosed by 16S and D2 large-subunit (LSU) ribosomal DNA (rDNA) sequencing of a cerebral biopsy specimen and confirmed by T. gondii-specific PCR and immunohistochemistry. The patient was later diagnosed with HIV/AIDS. PMID:25854484

  18. Biased amplification of non-target sequences prevents PCR-based detection of plant associated microbes observed with microscopy

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The process of amplifying rDNA from diverse microbial populations with universal primers is prone to biases that inaccurately represent population diversity. We have used a variety of fungal- and bacterial-specific primers to amplify endophyte sequences from Atriplex species and observed that 83% of...

  19. Three-step laser excitation of the odd-parity 5s5d 3D → 5s nf 3F states of cadmium

    NASA Astrophysics Data System (ADS)

    Nadeem, Ali; Shah, M.; Haq, S. U.; Shahzada, S.; Mumtaz, M.; Waheed, A.; Nawaz, M.; Ahmed, M.; Baig, M. A.


    We report new experimental data on the term energies and effective quantum numbers of the highly excited odd parity states of cadmium in the 71 773-72 500 cm-1 energy range. The experiment was performed using three dye lasers simultaneously pumped by the second harmonic (532 nm) of the Nd;YAG laser. The vapor containment and detection system was a thermionic diode ion detector working in a space charge limited mode. The new observations include the 5snf3F3 (12 ⩽ n ⩽ 52), 5snf3F4 (13 ⩽ n ⩽ 33) and 5snf3F2 (12 ⩽ n ⩽ 22) Rydberg series excited from the 5s5d3D multiplet. A two parameter fit to the transitions energies of the 5snf3F3 series yields the binding energy of the 5snd 2D2 level as 13 042.178 ± 0.02 cm-1 and consequently the first ionization of cadmium is determined as 72 540.05 ± 0.13 cm-1, which is in good agreement with the previously reported value.

  20. Global determinants of mortality in under 5s: 10 year worldwide longitudinal study

    PubMed Central

    Nacher, Mathieu; Guihenneuc, Chantal; Tubert-Bitter, Pascale; Chavance, Michel


    Objective To assess at country level the association of mortality in under 5s with a large set of determinants. Design Longitudinal study. Setting 193 United Nations member countries, 2000-09. Methods Yearly data between 2000 and 2009 based on 12 world development indicators were used in a multivariable general additive mixed model allowing for non-linear relations and lag effects. Main outcome measure National rate of deaths in under 5s per 1000 live births Results The model retained the variables: gross domestic product per capita; percentage of the population having access to improved water sources, having access to improved sanitation facilities, and living in urban areas; adolescent fertility rate; public health expenditure per capita; prevalence of HIV; perceived level of corruption and of violence; and mean number of years in school for women of reproductive age. Most of these variables exhibited non-linear behaviours and lag effects. Conclusions By providing a unified framework for mortality in under 5s, encompassing both high and low income countries this study showed non-linear behaviours and lag effects of known or suspected determinants of mortality in this age group. Although some of the determinants presented a linear action on log mortality indicating that whatever the context, acting on them would be a pertinent strategy to effectively reduce mortality, others had a threshold based relation potentially mediated by lag effects. These findings could help designing efficient strategies to achieve maximum progress towards millennium development goal 4, which aims to reduce mortality in under 5s by two thirds between 1990 and 2015. PMID:24212105

  1. A transfer RNAArg gene of Pelargonium chloroplasts, but not a 5S RNA gene, is efficiently transcribed after injection into Xenopus oocyte nuclei.

    PubMed Central

    Hellmund, D; Metzlaff, M; Serfling, E


    We present the primary structure of a chloroplast tRNAArgACG gene of the plant, Pelargonium zonale, and its faithful expression in Xenopus oocyte nuclei. This tRNAArg gene is located 250 bp downstream of a 5S RNA gene within a cloned 5kb long ribosomal DNA segment (Fig. 1). The Pelargonium tRNAArg gene shares 97% and 86% sequence homology with tRNAArgACG genes of Spirodela oligorhiza and Euglena gracilis chloroplasts, respectively, and also extensive homology (70%) with the corresponding gene of E. coli. It lacks an intervening sequence and, like eukaryotic tRNA genes, does not code for the 3' terminal CCA nucleotides. Moreover, the chloroplast tRNAArg gene carries all the sequence elements essential for transcription by vertebrate RNA polymerase III since it is efficiently expressed in Xenopus oocyte nuclei, even in the presence of 1 microgram/ml alpha-amanitin. In Xenopus oocyte nuclei, no transcripts of the chloroplast 5S RNA gene were detected. Images PMID:6209611

  2. Variation in the number of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng (Panax ginseng Meyer)

    PubMed Central

    Chelomina, Galina N.; Rozhkovan, Konstantin V.; Voronova, Anastasia N.; Burundukova, Olga L.; Muzarok, Tamara I.; Zhuravlev, Yuri N.


    Background Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. Methods The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. Results In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440–640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. Conclusion This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine. PMID:27158239

  3. Phylogeny of yeasts and related filamentous fungi within Pucciniomycotina determined from multigene sequence analyses

    PubMed Central

    Wang, Q.-M.; Groenewald, M.; Takashima, M.; Theelen, B.; Han, P.-J.; Liu, X.-Z.; Boekhout, T.; Bai, F.-Y.


    In addition to rusts, the subphylum Pucciniomycotina (Basidiomycota) includes a large number of unicellular or dimorphic fungi which are usually studied as yeasts. Ribosomal DNA sequence analyses have shown that the current taxonomic system of the pucciniomycetous yeasts which is based on phenotypic criteria is not concordant with the molecular phylogeny and many genera are polyphyletic. Here we inferred the molecular phylogeny of 184 pucciniomycetous yeast species and related filamentous fungi using maximum likelihood, maximum parsimony and Bayesian inference analyses based on the sequences of seven genes, including the small subunit ribosomal DNA (rDNA), the large subunit rDNA D1/D2 domains, the internal transcribed spacer regions (ITS 1 and 2) of rDNA including the 5.8S rDNA gene; the nuclear protein-coding genes of the two subunits of DNA polymerase II (RPB1 and RPB2) and the translation elongation factor 1-α (TEF1); and the mitochondrial gene cytochrome b (CYTB). A total of 33 monophyletic clades and 18 single species lineages were recognised among the pucciniomycetous yeasts employed, which belonged to four major lineages corresponding to Agaricostilbomycetes, Cystobasidiomycetes, Microbotryomycetes and Mixiomycetes. These lineages remained independent from the classes Atractiellomycetes, Classiculomycetes, Pucciniomycetes and Tritirachiomycetes formed by filamentous taxa in Pucciniomycotina. An updated taxonomic system of pucciniomycetous yeasts implementing the ‘One fungus = One name’ principle will be proposed based on the phylogenetic framework presented here. PMID:26955197

  4. What does the 5S rRNA multigene family tell us about the origin of the annual Triticeae (Poaceae)?


    Baum, B R; Edwards, T; Johnson, D A


    We have investigated the complex relationships among the annual genera within the tribe Triticeae through phylogenetic analyses of the 5S rRNA multigene family. Cloned sequences were assigned to groups of orthologous sequences, called unit classes, that were subjected to several analyses including BLAST (Basic Local Alignment Search Tool) searches to assess possible ancestral relationships with perennial genera; phylogenetic analyses using parsimony (Pars), maximum likelihood (ML), and Bayesian methods; and minimum reticulation networks from the Pars, ML, and Bayesian trees. In this study, we included genera with both annual and perennial species, such as Dasypyrum, Hordeum, and Secale. BLAST pointed to Pseudoroegneria (carrier of the St genome) and possibly Thinopyrum (carrier of the J genome) as the potential next of kin. However, Thinopyrum and Pseudoroegneria have never fallen together on the individual trees with the former generally associated with Crithopsis, Aegilops, Triticum, and Dasypyrum, while the latter is usually associated with the rest of the genera within Triticeae. The "long" unit classes placed Dasypyrum breviaristatum together with Dasypyrum villosum, whereas the "short" unit classes put them far apart on the trees. None of the gene trees alone was able to summarize the complex relationships among the genera, in line with previous results in the Triticeae. However, the application of tools designed to display phylogenetic networks was able to depict the complex links among the genera based on the short and the long gene trees, including the close link between Thinopyrum and Pseudoroegneria suggested by the phylogenetic analyses. In addition, our analyses provide support for the hypothesis that at least some annual Triticeae taxa are derived from their perennial relatives. PMID:23789993

  5. Molecular evolution of rDNA in early diverging Metazoa: First comparative analysis and phylogenetic application of complete SSU rRNA secondary structures in Porifera

    PubMed Central


    RNA secondary structures over the taxonomic range of Porifera in a database, along with some basic tools for relevant format-conversion. Conclusion We demonstrated that sophisticated secondary structure analyses can increase the potential phylogenetic information of already available rDNA sequences currently accessible in databases and conclude that the importance of SSU rRNA secondary structure information for phylogenetic reconstruction is still generally underestimated, at least among certain early branching metazoans. PMID:18304338

  6. Pseudanoplocephala crawfordi is a member of genus Hymenolepis based on phylogenetic analysis using ribosomal and mitochondrial DNA sequences.


    Jia, Yan-Qing; Yan, Wen-Chao; Du, Shuai-Zhi; Song, Jun-Ke; Zhao, Wen; Zhao, Yu-Xin; Cheng, Wen-Yu; Zhao, Guang-Hui


    Pseudanoplocephala crawfordi is one of the important zoonotic cestodes causing economic significance and public health concern. In the present study, the phylogenetic position of P. crawfordi isolated from pigs was re-inferred using molecular markers of internal transcribed spacer ribosomal DNA (ITS rDNA) and partial NADH dehydrogenase subunit 1 (pnad1) mitochondrial DNA. The lengths of ITS1, ITS2 rDNA and pnad1 were 757 bp, 628 bp and 458 bp, respectively. Sequence differences in the ITS1, ITS2 rDNA and pnad1 between P. crawfordi and Hymenolepis species were smaller than that between cestodes within genus Hymenolepis. Phylogenetic analyses based on three gene fragments showed that P. crawfordi was grouped into cluster of Hymenolepis species. These results suggested that P. crawfordi would be one member of genus Hymenolepis but not in a new genus Pseudanoplocephala. PMID:25211088

  7. Two spatially separated phases in semiconducting Rb0.8Fe1.5S2


    Wang, Meng; Tian, Wei; Valdivia, P.; Chi, Songxue; Bourret-Courchesne, E.; Dai, Pengcheng; Birgeneau, R. J.


    We report neutron scattering and transport measurements on semiconducting Rb0.8Fe1.5S2, a compound isostructural and isoelectronic to the well-studied A0.8FeySe2(A = K, Rb, Cs, Tl/K) superconducting systems. Both resistivity and DC susceptibility measurements reveal a magnetic phase transition at T = 275 K. Neutron diffraction studies show that the 275 K transition originates from a phase with rhombic iron vacancy order which exhibits an in-plane stripe antiferromagnetic ordering below 275 K. In addition, the stripe antiferromagnetic phase interdigitates mesoscopically with an ubiquitous phase with √5 x√5 iron vacancy order. This phase has a magnetic transition at TN = 425 K andmore » an iron vacancy order-disorder transition at TS = 600 K. These two different structural phases are closely similar to those observed in the isomorphous Se materials. Based on the close similarities of the in-plane antiferromagnetic structures, moments sizes, and ordering temperatures in semiconducting Rb0.8Fe1.5S2 and K0.81Fe1.58Se2, we argue that the in-plane antiferromagnetic order arises from strong coupling between local moments. Superconductivity, previously observed in the A0.8FeySe2₋ zSz system, is absent in A0.8Fe1.5S2, which has a semiconducting ground state. We discuss the implied relationship between stripe and block antiferromagnetism and superconductivity in these materials as well as a strategy for further investigation.« less

  8. SAXS investigation on the temperature dependence of the conformation of Carcinus aestuarii 5S hemocyanin subunit

    NASA Astrophysics Data System (ADS)

    Beltramini, M.; Di Muro, P.; Favilla, R.; La Monaca, A.; Mariani, P.; Sabatucci, A. L.; Salvato, B.; Solari, P. L.


    The small-angle X-ray scattering technique has been used to study the spatial distribution of a subunit isolated from Carcinus hemocyanin, in solution at pH 7.5 in the 20°C-40°C temperature range. From the obtained scattering profiles, two species with different gyration radius have been detected by Guinier approximation: one species with Rg1≈25 Å is assigned to the 75 kDa 5S subunit whereas a second species with Rg2≈48 Å, and accounting for ≈3% of the total protein, is attributed to the 450 kDa 16S hexamer. Whereas Rg2 decreases slightly (≈10%) and reversibly on increasing the temperature, Rg2 decreases more markedly (≈30%), but irreversibly. The scattering data have been analysed also on the basis of the impenetrable spheres model and by means of the distance distribution function: the temperature dependence of the geometrical dimensions of the particles is confirmed. In addition, for the 5S subunit also the cross-section gyration radius decreases appreciably (15%) and reversibly with temperature. These results are interpreted on the basis of temperature induced structural rearrangements among the three domains of 5S subunit leading to an increased compactness of the molecule and a more elongated form. In contrast, the effect on the hexamer is assigned to its irreversible dissociation to monomers. This interpretation agrees with the analysis of the distance distribution functions, calculated from the Fourier's transforms of the scattering curves at the different temperatures.

  9. Magic wavelengths for the 5 s -18 s transition in rubidium

    NASA Astrophysics Data System (ADS)

    Goldschmidt, E. A.; Norris, D. G.; Koller, S. B.; Wyllie, R.; Brown, R. C.; Porto, J. V.; Safronova, U. I.; Safronova, M. S.


    Magic wavelengths, for which there is no differential ac Stark shift for the ground and excited state of the atom, allow trapping of excited Rydberg atoms without broadening the optical transition. This is an important tool for implementing quantum gates and other quantum information protocols with Rydberg atoms, and reliable theoretical methods to find such magic wavelengths are thus extremely useful. We use a high-precision all-order method to calculate magic wavelengths for the 5 s -18 s transition of rubidium, and compare the calculation to experiment by measuring the light shift for atoms held in an optical dipole trap at a range of wavelengths near a calculated magic value.

  10. Minimally invasive L5-S1 oblique lumbar interbody fusion with anterior plate.


    Pham, Martin H; Jakoi, Andre M; Hsieh, Patrick C


    Lumbar interbody fusion is an important technique for the treatment of degenerative disc disease and degenerative scoliosis. The oblique lumbar interbody fusion (OLIF) establishes a minimally invasive retroperitoneal exposure anterior to the psoas and lumbar plexus. In this video case presentation, the authors demonstrate the techniques of the OLIF at L5-S1 performed on a 69-year-old female with degenerative scoliosis as one component of an overall strategy for her deformity correction. The video can be found here: . PMID:27364428

  11. Analysis of Sir2p domains required for rDNA and telomeric silencing in Saccharomyces cerevisiae.

    PubMed Central

    Cockell, M M; Perrod, S; Gasser, S M


    Silent information regulator (Sir) 2 is a limiting component of the Sir2/3/4 complex, which represses transcription at subtelomeric and HM loci. Sir2p also acts independently of Sir3p and Sir4p to influence chromatin organization in the rDNA locus. Deleted and mutated forms of Sir2p have been tested for their ability to complement and/or to disrupt silencing. The highly conserved C-terminal domain of Sir2p (aa 199-562) is insufficient to restore repression at either telomeric or rDNA reporters in a sir2Delta background and fails to nucleate silencing when targeted to an appropriate reporter gene. However, its expression in an otherwise wild-type strain disrupts telomeric repression. Similarly, a point mutation (P394L) within this conserved core inactivates the full-length protein but renders it dominant negative for all types of silencing. Deletion of aa 1-198 from Sir2(394L) eliminates its dominant negative effect. Thus we define two distinct functional domains in Sir2p, both essential for telomeric and rDNA repression: the conserved core domain found within aa 199-562 and a second domain that encompasses aa 94-198. Immunolocalization and two-hybrid studies show that aa 94-198 are required for the binding of Sir2p to Sir4p and for the targeting of Sir2p to the nucleolus through another ligand. The globular core domain provides an essential silencing function distinct from that of targeting or Sir complex formation that may reflect its reported mono-ADP-ribosyl transferase activity. PMID:10757754

  12. Male meiosis, heterochromatin characterization and chromosomal location of rDNA in Microtomus lunifer (Berg, 1900) (Hemiptera: Reduviidae: Hammacerinae)

    PubMed Central

    Poggio, María Georgina; Bressa, María José; Papeschi, Alba Graciela


    Abstract In the present work, we analysed the male meiosis, the content and distribution of heterochromatin and the number and location of nucleolus organizing regions in Microtomus lunifer (Berg, 1900) by means of standard technique, C- and fluorescent bandings, and fluorescent in situ hybridization with an 18S rDNA probe. This species is the second one cytogenetically analysed within the Hammacerinae. Its male diploid chromosome number is 31 (2n=28+X1X2Y), including a minute pair of m-chromosomes. The diploid autosomal number and the presence of m-chromosomes are similar to those reported in Microtomus conspicillaris (Drury, 1782) (2n=28+XY). However, Microtomus lunifer has a multiple sex chromosome system X1X2Y (male) that could have originated by fragmentation of the ancestral X chromosome. Taking into account that Microtomus conspicillaris and Microtomus lunifer are the only two species within Reduviidae that possess m-chromosomes, the presence of this pair could be a synapomorphy for the species of this genus. C- and fluorescent bandings showed that the amount of heterochromatin in Microtomus lunifer was small, and only a small CMA3 bright band was observed in the largest autosomal pair at one terminal region. FISH with the 18S rDNA probe demonstrated that ribosomal genes were terminally placed on the largest autosomal pair. Our present results led us to propose that the location of rDNA genes could be associated with variants of the sex chromosome systems in relation with a kind of the sex chromosome systems within this family. Furthermore, the terminal location of NOR in the largest autosomal pair allowed us to use it as a chromosome marker and, thus, to infer that the kinetic activity of both ends is not a random process, and there is an inversion of this activity. PMID:24260616

  13. New type of SSUrDNA sequence was detected from both Plasmodium ovale curtisi and Plasmodium ovale wallikeri samples

    PubMed Central


    Background Plasmodium ovale is relatively unfamiliar to Chinese staff engaged in malaria diagnosis. In 2013, dried blood spots of four unidentified but suspected ovale malaria samples were sent to the National Malaria Reference Laboratory (NMRL) for reconfirmation. Methods Partial and complete, small, subunit ribosomal DNA (SSU rDNA) sequences of four samples were obtained with PCR-cloning-sequencing method. Obtained sequences were analyzed by aligning with each other and with nine SSU rDNA sequences of six known Plasmodium parasites. A phylogenetic tree was constructed based on complete SSU rDNA sequences and 12 same gene sequences derived from six known Plasmodium parasites and three Babesia parasites. Primary structure of conservative and variable regions of variant sequences was determined also by comparing them with those of six known Plasmodium parasites. To confirm their existence in genome, they were redetected with primers matching their variable regions. PCR systems aimed to roughly detect any eukaryotes and prokaryotes respectively were also applied to search for other pathogens in one of four patients. Results Totally, 19 partial and 23 complete SSU rDNA sequences obtained from four samples. Except eight variant sequences, similarities among sequences from same DNA sample were in general high (more than 98%). The phylogenetic analysis revealed that three cases were infected by P. ovale wallikeri and one by P. ovale curtisi. Four of the variant sequences which obtained from four samples relatively showed high similarities with each other (98.5%-100%). Identical variant sequences actually could be re-obtained from each DNA sample. Their primary structure of conservative and variable regions showed quite fit with that of six known Plasmodium parasites. The test for prokaryote pathogens showed negative and the tests for eukaryotes only found DNA sequences of Human and P. ovale parasites. Conclusion Both P. ovale wallikeri and P. ovale curtisi infections are

  14. Refinement of the spinal muscular atrophy locus to the interval between D5S435 and MAP1B

    SciTech Connect

    Soares, V.M.; Brzustowicz, L.M.; Kleyn, P.W.; Knowles, J.A.; Palmer, D.A.; Asokan, S.; Penchaszadeh, G.K.; Gilliam, T.C. ); Munsat, T.L. )


    The childhood-onset SMA locus has been mapped to chromosome 5q13, in a region bounded by the proximal locus, D5S6, and the closely linked distal loci, D5S112 and MAP1B. We now describe a highly polymorphic, tightly linked microsatellite marker (D5S435) that is very likely the closet proximal marker to the SMA locus. Multipoint linkage analysis firmly establishes the following order of markers at 5q13; centromere-D5S76-D5S6-D5S435-MAP1B/D5S112-D5S39-telomere. The data indicate that SMA resides in an approximately 0.7-cM (range 01.-2.1) region between D5S435 and MAP1B. This finding reduces by approximately fourfold the genetic region that most likely harbors the SMA locus and will facilitate the physical mapping and cloning of the disease gene region. 24 refs., 3 figs., 1 tab.

  15. High resolution analysis of the timing of replication of specific DNA sequences during S phase of mammalian cells.

    PubMed Central

    D'Andrea, A D; Tantravahi, U; Lalande, M; Perle, M A; Latt, S A


    A new method, utilizing selective photodegradation of 5-bromo-deoxyuridine (BUdR)-substituted DNA and flow cytometry, has been developed for analyzing the timing of replication of specific DNA sequences. Chemically synchronized Chinese hamster ovary cells were given a pulse of the deoxythymidine analogue, BUdR, at different times during S phase, and flow sorted according to DNA content, before DNA isolation. Newly-replicated, unifilarly BUdR-substituted DNA was selectively degraded by treatment with 33258 Hoechst plus near UV light followed by S1 nuclease digestion; the resistant DNA was analyzed for its content of 18s and 28s rDNA or dihydrofolate reductase (DHFR) sequences via Southern blot analysis. Both the rDNA and DHFR sequences were found to replicate almost entirely during the first quarter of S phase. The approach described should have general utility for analyzing replication kinetics of specific DNA sequences in mammalian cells. Images PMID:6192392

  16. Comparative Phylogenetic Assignment of Environmental Sequences of Genes Encoding 16S rRNA and Numerically Abundant Culturable Bacteria from an Anoxic Rice Paddy Soil

    PubMed Central

    Hengstmann, Ulf; Chin, Kuk-Jeong; Janssen, Peter H.; Liesack, Werner


    We used both cultivation and direct recovery of bacterial 16S rRNA gene (rDNA) sequences to investigate the structure of the bacterial community in anoxic rice paddy soil. Isolation and phenotypic characterization of 19 saccharolytic and cellulolytic strains are described in the accompanying paper (K.-J. Chin, D. Hahn, U. Hengstmann, W. Liesack, and P. H. Janssen, Appl. Environ. Microbiol. 65:5042–5049, 1999). Here we describe the phylogenetic positions of these strains in relation to 57 environmental 16S rDNA clone sequences. Close matches between the two data sets were obtained for isolates from the culturable populations determined by the most-probable-number counting method to be large (3 × 107 to 2.5 × 108 cells per g [dry weight] of soil). This included matches with 16S rDNA similarity values greater than 98% within distinct lineages of the division Verrucomicrobia (strain PB90-1) and the Cytophaga-Flavobacterium-Bacteroides group (strains XB45 and PB90-2), as well as matches with similarity values greater than 95% within distinct lines of descent of clostridial cluster XIVa (strain XB90) and the family Bacillaceae (strain SB45). In addition, close matches with similarity values greater than 95% were obtained for cloned 16S rDNA sequences and bacteria (strains DR1/8 and RPec1) isolated from the same type of rice paddy soil during previous investigations. The correspondence between culture methods and direct recovery of environmental 16S rDNA suggests that the isolates obtained are representative geno- and phenotypes of predominant bacterial groups which account for 5 to 52% of the total cells in the anoxic rice paddy soil. Furthermore, our findings clearly indicate that a dual approach results in a more objective view of the structural and functional composition of a soil bacterial community than either cultivation or direct recovery of 16S rDNA sequences alone. PMID:10543822

  17. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    NASA Astrophysics Data System (ADS)

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi


    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system.

  18. Intraspecific and Interspecific Variation in 5s RNA Genes Are Decoupled in Diploid Wheat Relatives

    PubMed Central

    Kellogg, E. A.; Appels, R.


    5S RNAs form part of the ribosome in most organisms. In some, e.g., prokaryotes and some fungi, the genes are part of the ribosomal operon, but in most eukaryotes they are in tandem arrays of hundreds to thousands of copies separate from the main ribosomal array. 5S RNA genes can be aligned across kingdoms. We were therefore surprised to find that, for 28 diploid species of the wheat tribe (Triticeae), nucleotide diversity within an array is up to 6.2% in the genes, not significantly different from that of the nontranscribed spacers. Rates of concerted evolution must therefore be insufficient to homogenize the entire array. Between species, there are significantly fewer fixed differences in the gene than would be expected, given the high within-species variation. In contrast, the amount of variation between species in the spacer is the same as or greater than that within individuals. This leads to a paradox. High variation within an individual suggests that there is little selection on any particular gene within an array. But conservation of the gene across species implies that polymorphisms are periodically eliminated at a rate approximately equal to or greater than that of speciation. Levels of intraspecific polymorphism and interspecific divergence are thus decoupled. This implies that selective mechanisms exist to eliminate mutations in the gene without also affecting the spacer. PMID:7635297

  19. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure.


    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi


    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30-70 K in pressure range of 100-170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50-70 K in pressure range of 100-150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  20. Magnetization reversal phenomena in (Cr0.70Ti0.30)5S6

    NASA Astrophysics Data System (ADS)

    Hashimoto, Satoshi; Matsuda, Yuji; Sato, Tetsuya; Anzai, Shuichiro


    Magnetization reversal phenomena (MRP) along magnetic order-order transitions have recently been reported on impurity-doped magnetic systems. Because imperfect long-range magnetic order exists in these systems, it is expected that a systematic investigation of MRP will give physical information on thermomagnetic processes of magnetic systems in the range from the micro- to nanoscales. As a typical order-order transition (a state doubly modulated by helical and canting orders to a collinear ferrimagnetic state) has been known to occur on Cr5S6 at a transition temperature Tt, we investigate the magnetizations of (Cr0.70Ti0.30)5S6 on heating and cooling runs in various magnetic fields. At 20Oe, the field-cooled magnetization just below the Curie temperature has a positive sign; the sign turns negative below the compensation temperature TCM (first step) and finally returns to positive below Tt (second step). The first-step MRP observed in this system is explained by the potential barriers resulting from anisotropy energy when the preferred direction of collinear ferrimagnetic moment reverses. The proposed mechanism for second-step MRP is the pinning effect caused by the impurity atoms (Ti) in the helical long-range-order chains. Comparing other examples of MRPs, we discuss the roles of local impurity centers in the thermomagnetic process in magnetic order-order transitions.

  1. Superconducting H5S2 phase in sulfur-hydrogen system under high-pressure

    PubMed Central

    Ishikawa, Takahiro; Nakanishi, Akitaka; Shimizu, Katsuya; Katayama-Yoshida, Hiroshi; Oda, Tatsuki; Suzuki, Naoshi


    Recently, hydrogen sulfide was experimentally found to show the high superconducting critical temperature (Tc) under high-pressure. The superconducting Tc shows 30–70 K in pressure range of 100–170 GPa (low-Tc phase) and increases to 203 K, which sets a record for the highest Tc in all materials, for the samples annealed by heating it to room temperature at pressures above 150 GPa (high-Tc phase). Here we present a solid H5S2 phase predicted as the low-Tc phase by the application of the genetic algorithm technique for crystal structure searching and first-principles calculations to sulfur-hydrogen system under high-pressure. The H5S2 phase is thermodynamically stabilized at 110 GPa, in which asymmetric hydrogen bonds are formed between H2S and H3S molecules. Calculated Tc values show 50–70 K in pressure range of 100–150 GPa within the harmonic approximation, which can reproduce the experimentally observed low-Tc phase. These findings give a new aspect of the excellent superconductivity in compressed sulfur-hydrogen system. PMID:26983593

  2. A new genotype of Trypanosoma cruzi associated with bats evidenced by phylogenetic analyses using SSU rDNA, cytochrome b and Histone H2B genes and genotyping based on ITS1 rDNA.


    Marcili, A; Lima, L; Cavazzana, M; Junqueira, A C V; Veludo, H H; Maia Da Silva, F; Campaner, M; Paiva, F; Nunes, V L B; Teixeira, M M G


    We characterized 15 Trypanosoma cruzi isolates from bats captured in the Amazon, Central and Southeast Brazilian regions. Phylogenetic relationships among T. cruzi lineages using SSU rDNA, cytochrome b, and Histone H2B genes positioned all Amazonian isolates into T. cruzi I (TCI). However, bat isolates from the other regions, which had been genotyped as T. cruzi II (TC II) by the traditional genotyping method based on mini-exon gene employed in this study, were not nested within any of the previously defined TCII sublineages, constituting a new genotype designated as TCbat. Phylogenetic analyses demonstrated that TCbat indeed belongs to T. cruzi and not to other closely related bat trypanosomes of the subgenus Schizotrypanum, and that although separated by large genetic distances TCbat is closest to lineage TCI. A genotyping method targeting ITS1 rDNA distinguished TCbat from established T. cruzi lineages, and from other Schizotrypanum species. In experimentally infected mice, TCbat lacked virulence and yielded low parasitaemias. Isolates of TCbat presented distinctive morphological features and behaviour in triatomines. To date, TCbat genotype was found only in bats from anthropic environments of Central and Southeast Brazil. Our findings indicate that the complexity of T. cruzi is larger than currently known, and confirmed bats as important reservoirs and potential source of T. cruzi infections to humans. PMID:19368741

  3. Ampelomyces mycoparasites from apple powdery mildew identified as a distinct group based on single-stranded conformation polymorphism analysis of the rDNA ITS region.


    Szentiványi, Orsolya; Kiss, Levente; Russell, John C; Kovács, Gábor M; Varga, Krisztina; Jankovics, Tünde; Lesemann, Silke; Xu, Xiang-Ming; Jeffries, Peter


    Pycnidial fungi belonging to the genus Ampelomyces are the most common natural antagonists of powdery mildews worldwide. During a study of the interactions between apple powdery mildew (Podosphaera leucotricha) and Ampelomyces mycoparasites, 52 new Ampelomyces isolates were obtained from P. leucotricha and, in addition, 13 new isolates from other species of the Erysiphaceae in four European countries. Their genetic diversity was screened using single-stranded conformation polymorphism (SSCP) analysis of the internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA). For comparison, 24 isolates obtained from genetic resource collections or other sources were included in this study. Based on the ITS-SSCP patterns, the isolates were placed in eight groups. The isolates belonged to two types based on their growth in culture. The faster-growing and the slower-growing isolates were included in different SSCP groups. A phylogenetic analysis of the ITS sequences of representatives of these groups confirmed the results obtained with the SSCP method, and showed that the faster-growing isolates do not belong to Ampelomyces as suggested by earlier studies. All the isolates from P. leucotricha fell into a distinct SSCP group of genetically homogeneous isolates. This suggests that Ampelomyces mycoparasites which occur in apple powdery mildew are slightly different from the other Ampelomyces groups which contain mycoparasites from various powdery mildew species. This may be because the main growth period of Ampelomyces mycoparasites in apple powdery mildew is isolated in time from that of Ampelomyces isolates that occur in other species of the Erysiphaceae. P. leucotricha starts its life-cycle early in the season, usually in March-April, while most powdery mildews are active in the same environments only late in the year. PMID:15912930

  4. Variations of SSU rDNA group I introns in different isolates of Cordyceps militaris and the loss of an intron during cross-mating.


    Lian, Tiantian; Yang, Tao; Sun, Junde; Guo, Suping; Yang, Huaijun; Dong, Caihong


    Cordyceps militaris, the type species of genus Cordyceps, is one of the most popular mushrooms and a nutraceutical in eastern Asia. It is considered a model organism for the study of Cordyceps species because it can complete its life cycle when cultured in vitro. In the present study, the occurrence and sequence variation of SSU rDNA group I introns, Cmi.S943 and Cmi.S1199, among different isolates of C. militaris were analyzed. Based on the secondary structure predictions, the Cmi.S943 intron has been placed in subgroup IC1, and the Cmi.S1199 intron has been placed in subgroup IE. No significant similarity between Cmi.S943 and Cmi.S1199 suggested different origins. Three genotypes, based on the frequency and distribution of introns, were described to discriminate the 57 surveyed C. militaris strains. It was found that the genotype was related to the stroma characteristics. The stromata of all of the genotype II strains, which possessed only Cmi.S943, could produce perithecium. In contrast, the stromata of all genotype III strains, which had both Cmi.S943 and Cmi.S1199, could not produce perithecium. Cmi.S1199 showed the lowest level of intra-specific variation among the tested strains. Group I introns can be lost during strain cross-mating. Therefore, we presumed that during cross-mating and recombination, intron loss could be driven by positive Darwinian selection due to the energetic cost of transcribing long introns. PMID:24996897

  5. Repetitive Sequences

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Repetitive sequences, or repeats, account for a substantial portion of the eukaryotic genomes. These sequences include very different types of DNA with respect to mode of origin, function, structure, and genomic distribution. Two large families of repetitive sequences can be readily recognized, ta...

  6. Repair of rDNA in Saccharomyces cerevisiae: RAD4-independent strand-specific nucleotide excision repair of RNA polymerase I transcribed genes.

    PubMed Central

    Verhage, R A; Van de Putte, P; Brouwer, J


    Removal of UV-induced pyrimidine dimers from the individual strands of the rDNA locus in Saccharomyces cerevisiae was studied. Yeast rDNA, that is transcribed by RNA polymerase I(RNA pol I), is repaired efficiently, slightly strand-specific and independently of RAD26, which has been implicated in transcription-coupled repair of the RNA pol II transcribed RPB2 gene. No repair of rDNA is observed in rad1,2,3 and 14 mutants, demonstrating that dimer removal from this highly repetitive DNA is accomplished by nucleotide excision repair (NER). In rad7 and rad16 mutants, which are specifically deficient in repair of non-transcribed DNA, there is a clear preferential repair of the transcribed strand of rDNA, indicating that strand-specific and therefore probably transcription-coupled repair of RNA pol I transcribed genes does exist in yeast. Unexpectedly, the transcribed but not the non-transcribed strand of rDNA can be repaired in rad4 mutants, which seem otherwise completely NER-deficient. PMID:8604332

  7. R1 and R2 retrotransposition and deletion in the rDNA loci on the X and Y chromosomes of Drosophila melanogaster.

    PubMed Central

    Pérez-González, César E; Burke, William D; Eickbush, Thomas H


    The non-LTR retrotransposons R1 and R2 insert into the 28S rRNA genes of arthropods. Comparisons among Drosophila lineages have shown that these elements are vertically inherited, while studies within species have indicated a rapid turnover of individual copies (elimination of old copies and the insertion of new copies). To better understand the turnover of R1 and R2, 200 retrotranspositions and nearly 100 eliminations have been scored in the Harwich mutation-accumulation lines of Drosophila melanogaster. Because the rDNA arrays in D. melanogaster are present on the X and Y chromosomes and no exchanges were detected in these lines, it was possible to show that R1 retrotranspositions occur predominantly in the male germ line, while R2 retrotranspositions were more evenly divided between the germ lines of both sexes. The rate of elimination of elements from the Y rDNA array was twice that of the X rDNA array with both chromosomal loci containing regions where the rate of elimination was on average eight times higher. Most R1 and R2 eliminations appear to occur by large intrachromosomal events (i.e., loop-out events) that involve multiple rDNA units. These findings are interpreted in light of the known abundance of R1 and R2 elements in the X and Y rDNA loci of D. melanogaster. PMID:14573479

  8. Experimental investigation of an RNA sequence space

    NASA Technical Reports Server (NTRS)

    Lee, Youn-Hyung; Dsouza, Lisa; Fox, George E.


    Modern rRNAs are the historic consequence of an ongoing evolutionary exploration of a sequence space. These extant sequences belong to a special subset of the sequence space that is comprised only of those primary sequences that can validly perform the biological function(s) required of the particular RNA. If it were possible to readily identify all such valid sequences, stochastic predictions could be made about the relative likelihood of various evolutionary pathways available to an RNA. Herein an experimental system which can assess whether a particular sequence is likely to have validity as a eubacterial 5S rRNA is described. A total of ten naturally occurring, and hence known to be valid, sequences and two point mutants of unknown validity were used to test the usefulness of the approach. Nine of the ten valid sequences tested positive whereas both mutants tested as clearly defective. The tenth valid sequence gave results that would be interpreted as reflecting a borderline status were the answer not known. These results demonstrate that it is possible to experimentally determine which sequences in local regions of the sequence space are potentially valid 5S rRNAs.

  9. Genotyping of a miso and soy sauce fermentation yeast, Zygosaccharomyces rouxii, based on sequence analysis of the partial 26S ribosomal RNA gene and two internal transcribed spacers.


    Suezawa, Yasuhiko; Suzuki, Motofumi; Mori, Haruhiko


    We analyzed sequences of the D1D2 domain of the 26S ribosomal RNA gene (26S rDNA sequence), the internal transcribed spacer 1, the 5.8S ribosomal RNA gene, and the internal transcribed spacer 2 (the ITS sequence) from 46 strains of miso and soy sauce fermentation yeast, Zygosaccharomyces rouxii and a closely related species, Z. mellis, for typing. Based on the 26S rDNA sequence analysis, the Z. rouxii strains were of two types, and the extent of sequence divergence between them was 2.6%. Based on the ITS sequence analysis, they were divided into seven types (I-VII). Between the type strain (type I) and type VI, in particular, a 12% difference was detected. The occurrence of these nine genotypes with a divergence of more than 1% in these two sequences suggests that Z. rouxii is a species complex including novel species and hybrids. Z. mellis strains were of two types (type alpha and type beta) based on the ITS sequence. Z. rouxii could clearly be distinguished from Z. mellis by 26S rDNA and ITS sequence analyses, but not by the 16% NaCl tolerance, when used as the sole key characteristic for differentiation between the two species. PMID:18776675

  10. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site

    PubMed Central

    Calviño, Fabiola R.; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard


    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1–RpL5-N–RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1–RpL5–RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP. PMID:25849277

  11. Symportin 1 chaperones 5S RNP assembly during ribosome biogenesis by occupying an essential rRNA-binding site.


    Calviño, Fabiola R; Kharde, Satyavati; Ori, Alessandro; Hendricks, Astrid; Wild, Klemens; Kressler, Dieter; Bange, Gert; Hurt, Ed; Beck, Martin; Sinning, Irmgard


    During 60S biogenesis, mature 5S RNP consisting of 5S RNA, RpL5 and RpL11, assembles into a pre-60S particle, where docking relies on RpL11 interacting with helix 84 (H84) of the 25S RNA. How 5S RNP is assembled for recruitment into the pre-60S is not known. Here we report the crystal structure of a ternary symportin Syo1-RpL5-N-RpL11 complex and provide biochemical and structural insights into 5S RNP assembly. Syo1 guards the 25S RNA-binding surface on RpL11 and competes with H84 for binding. Pull-down experiments show that H84 releases RpL11 from the ternary complex, but not in the presence of 5S RNA. Crosslinking mass spectrometry visualizes structural rearrangements on incorporation of 5S RNA into the Syo1-RpL5-RpL11 complex supporting the formation of a pre-5S RNP. Our data underline the dual role of Syo1 in ribosomal protein transport and as an assembly platform for 5S RNP. PMID:25849277

  12. Differentiation of Phylogenetically Related Slowly Growing Mycobacteria Based on 16S-23S rRNA Gene Internal Transcribed Spacer Sequences

    PubMed Central

    Roth, Andreas; Fischer, Marga; Hamid, Mohamed E.; Michalke, Sabine; Ludwig, Wolfgang; Mauch, Harald


    Interspecific polymorphisms of the 16S rRNA gene (rDNA) are widely used for species identification of mycobacteria. 16S rDNA sequences, however, do not vary greatly within a species, and they are either indistinguishable in some species, for example, in Mycobacterium kansasii and M. gastri, or highly similar, for example, in M. malmoense and M. szulgai. We determined 16S-23S rDNA internal transcribed spacer (ITS) sequences of 60 strains in the genus Mycobacterium representing 13 species (M. avium, M. conspicuum, M. gastri, M. genavense, M. kansasii, M. malmoense, M. marinum, M. shimoidei, M. simiae, M. szulgai, M. triplex, M. ulcerans, and M. xenopi). An alignment of these sequences together with additional sequences available in the EMBL database (for M. intracellulare, M. phlei, M. smegmatis, and M. tuberculosis) was established according to primary- and secondary-structure similarities. Comparative sequence analysis applying different treeing methods grouped the strains into species-specific clusters with low sequence divergence between strains belonging to the same species (0 to 2%). The ITS-based tree topology only partially correlated to that based on 16S rDNA, but the main branching orders were preserved, notably, the division of fast-growing from slowly growing mycobacteria, separate branching for M. simiae, M. genavense, and M. triplex, and distinct branches for M. xenopi and M. shimoidei. Comparisons of M. gastri with M. kansasii and M. malmoense with M. szulgai revealed ITS sequence similarities of 93 and 88%, respectively. M. marinum and M. ulcerans possessed identical ITS sequences. Our results show that ITS sequencing represents a supplement to 16S rRNA gene sequences for the differentiation of closely related species. Slowly growing mycobacteria show a high sequence variation in the ITS; this variation has the potential to be used for the development of probes as a rapid approach to mycobacterial identification. PMID:9431937

  13. Electric-dipole 5s - 5p Transitions in Promethiumlike Ions

    SciTech Connect

    Vilkas, M J; Ishikawa, Y; Trabert, E


    The 5s-5p electric-dipole resonance transitions in highly ionized promethiumlike ions have been studied applying relativistic multi-reference Moeller-Plesset second-order perturbation theory. The transition wavelengths are determined to within 0.2 {angstrom} in the more highly charged ions, where the level degeneracies are small. For somewhat lighter ions a very large reference space was used in order to account for the many degeneracies. In order to calculate transition probabilities and lifetimes, correlation corrections have been added to the transition operator in the next order. The contributions from the higher orders of the theory, that is, frequency-dependent Breit correction, Lamb shift, and mass shifts, have been estimated. The results are used to re-assess spectroscopic data from beam-foil, electron beam ion trap, and tokamak observations.

  14. Solution-Based Processing of the Phase-Change Material KSb5S8

    SciTech Connect

    Mitzi,D.; Raoux, S.; Schrott, A.; Copel, M.; Kellock, A.; Jordan-Sweet, J.


    A hydrazine-based process for solution-depositing phase-change materials (PCMs) is demonstrated, using KSb{sub 5}S{sub 8} (KSS) as an example. The process involves dissolving the elemental metals and chalcogen in hydrazine at room temperature and spin-coating the solution onto a substrate, followed by a short low-temperature (T {<=} 250 C) anneal. The spin-coated KSS films, which range in thickness from 10 to 90 nm, are examined using variable temperature X-ray diffraction, medium energy ion scattering (MEIS), Rutherford backscattering spectroscopy (RBS), and scanning electron microscopy (SEM). The spin-coated KSS films exhibit a reversible amorphous-crystalline transition with a relatively high crystallization temperature ({approx}280 C). Selected other chalcogenide-based PCMs are also expected to be suitable for thin-film deposition using this approach.

  15. Minimally Invasive Approach For Extraforaminal Synovial Cyst L5-S1

    PubMed Central

    Torres Campa-Santamarina, Jose; Towne, Sara; Alimi, Marjan; Härtl, Roger


    Symptoms from synovial cysts are produced by neural compression in the spinal canal or the foramen. Few cases of extraforaminal synovial cyst have been published in the literature. This is a case report of a 65-year-old female who presented with a three-month history of sciatic pain and no relief with conservative treatment. MRI showed a left-sided extraforaminal synovial cyst at L5-S1 with compression of the L5 nerve root at the lateral portion of the foramen. Minimally invasive surgery for resection was performed using an extraforaminal tubular microscopic endoscopy-assisted approach. The patient improved clinically and remained symptom-free for the entire follow-up of 30 months. PMID:26623217

  16. Magic wavelengths for the 5 s - 18 s transition in rubidium

    NASA Astrophysics Data System (ADS)

    Goldschmidt, Elizabeth; Norris, David; Koller, Silvio; Wyllie, Robert; Brown, Roger; Porto, Trey; Safronova, Ulyana; Safronova, Marianna


    Magic wavelengths, for which there is no differential ac Stark shift for the ground and excited state of the atom, allow trapping of excited Rydberg atoms without broadening the optical transition. This is an important tool for implementing quantum gates and other quantum information protocols with Rydberg atoms, and reliable theoretical methods to find such magic wavelengths are thus extremely useful. We use a high-precision all-order method to calculate magic wavelengths for the 5 s - 18 s transition of rubidium near the 18 s - 6 p resonances. We compare the calculation to experiment by measuring the light shift for atoms held in a crossed optical dipole trap with wavelength tuned around the 18 s - 6p3 / 2 resonance at the experimentally convenient wavelength of 1064 nm.

  17. Classification of 5-S Epileptic EEG Recordings Using Distribution Entropy and Sample Entropy

    PubMed Central

    Li, Peng; Karmakar, Chandan; Yan, Chang; Palaniswami, Marimuthu; Liu, Changchun


    Epilepsy is an electrophysiological disorder of the brain, the hallmark of which is recurrent and unprovoked seizures. Electroencephalogram (EEG) measures electrical activity of the brain that is commonly applied as a non-invasive technique for seizure detection. Although a vast number of publications have been published on intelligent algorithms to classify interictal and ictal EEG, it remains an open question whether they can be detected using short-length EEG recordings. In this study, we proposed three protocols to select 5 s EEG segment for classifying interictal and ictal EEG from normal. We used the publicly-accessible Bonn database, which consists of normal, interical, and ictal EEG signals with a length of 4097 sampling points (23.6 s) per record. In this study, we selected three segments of 868 points (5 s) length from each recordings and evaluated results for each of them separately. The well-studied irregularity measure—sample entropy (SampEn)—and a more recently proposed complexity measure—distribution entropy (DistEn)—were used as classification features. A total of 20 combinations of input parameters m and τ for the calculation of SampEn and DistEn were selected for compatibility. Results showed that SampEn was undefined for half of the used combinations of input parameters and indicated a large intra-class variance. Moreover, DistEn performed robustly for short-length EEG data indicating relative independence from input parameters and small intra-class fluctuations. In addition, it showed acceptable performance for all three classification problems (interictal EEG from normal, ictal EEG from normal, and ictal EEG from interictal) compared to SampEn, which showed better results only for distinguishing normal EEG from interictal and ictal. Both SampEn and DistEn showed good reproducibility and consistency, as evidenced by the independence of results on analysing protocol. PMID:27148074

  18. Rho Kinase ROCK2 Mediates Acid-Induced NADPH Oxidase NOX5-S Expression in Human Esophageal Adenocarcinoma Cells

    PubMed Central

    Cao, Weibiao


    Mechanisms of the progression from Barrett’s esophagus (BE) to esophageal adenocarcinoma (EA) are not fully understood. We have shown that NOX5-S may be involved in this progression. However, how acid upregulates NOX5-S is not well known. We found that acid-induced increase in NOX5-S expression was significantly decreased by the Rho kinase (ROCK) inhibitor Y27632 in BE mucosal biopsies and FLO-1 EA cells. In addition, acid treatment significantly increased the Rho kinase activity in FLO-1 cells. The acid-induced increase in NOX5-S expression and H2O2 production was significantly decreased by knockdown of Rho kinase ROCK2, but not by knockdown of ROCK1. Conversely, the overexpression of the constitutively active ROCK2, but not the constitutively active ROCK1, significantly enhanced the NOX5-S expression and H2O2 production. Moreover, the acid-induced increase in Rho kinase activity and in NOX5-S mRNA expression was blocked by the removal of calcium in both FLO-1 and OE33 cells. The calcium ionophore A23187 significantly increased the Rho kinase activity and NOX5-S mRNA expression. We conclude that acid-induced increase in NOX5-S expression and H2O2 production may depend on the activation of ROCK2, but not ROCK1, in EA cells. The acid-induced activation of Rho kinase may be mediated by the intracellular calcium increase. It is possible that persistent acid reflux present in BE patients may increase the intracellular calcium, activate ROCK2 and thereby upregulate NOX5-S. High levels of reactive oxygen species derived from NOX5-S may cause DNA damage and thereby