Sample records for 5s rdna sequences

  1. Karyotype divergence and spreading of 5S rDNA sequences between genomes of two species: darter and emerald gobies ( Ctenogobius , Gobiidae).


    Lima-Filho, P A; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Molina, W F


    Karyotype analyses of the cryptobenthic marine species Ctenogobius boleosoma and C. smaragdus were performed by means of classical and molecular cytogenetics, including physical mapping of the multigene 18S and 5S rDNA families. C. boleosoma has 2n = 44 chromosomes (2 submetacentrics + 42 acrocentrics; FN = 46) with a single chromosome pair each carrying 18S and 5S ribosomal sites; whereas C. smaragdus has 2n = 48 chromosomes (2 submetacentrics + 46 acrocentrics; FN = 50), also with a single pair bearing 18S rDNA, but an extensive increase in the number of GC-rich 5S rDNA sites in 21 chromosome pairs. The highly divergent karyotypes among Ctenogobius species contrast with observations in several other marine fish groups, demonstrating an accelerated rate of chromosomal evolution mediated by both chromosomal rearrangements and the extensive dispersion of 5S rDNA sequences in the genome. PMID:24643007

  2. Karyotype divergence and spreading of 5S rDNA sequences between genomes of two species: darter and emerald gobies ( Ctenogobius , Gobiidae).


    Lima-Filho, P A; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Molina, W F


    Karyotype analyses of the cryptobenthic marine species Ctenogobius boleosoma and C. smaragdus were performed by means of classical and molecular cytogenetics, including physical mapping of the multigene 18S and 5S rDNA families. C. boleosoma has 2n = 44 chromosomes (2 submetacentrics + 42 acrocentrics; FN = 46) with a single chromosome pair each carrying 18S and 5S ribosomal sites; whereas C. smaragdus has 2n = 48 chromosomes (2 submetacentrics + 46 acrocentrics; FN = 50), also with a single pair bearing 18S rDNA, but an extensive increase in the number of GC-rich 5S rDNA sites in 21 chromosome pairs. The highly divergent karyotypes among Ctenogobius species contrast with observations in several other marine fish groups, demonstrating an accelerated rate of chromosomal evolution mediated by both chromosomal rearrangements and the extensive dispersion of 5S rDNA sequences in the genome.

  3. [An intriguing model for 5S rDNA sequences dispersion in the genome of freshwater stingray Potamotrygon motoro (Chondrichthyes: Potamotrygonidae)].


    Cruz, V P; Oliveira, C; Foresti, F


    5S rDNA genes of the stingray Potamotrygon motoro were PCR replicated, purified, cloned and sequenced. Two distinct classes of segments of different sizes were obtained. The smallest, with 342 bp units, was classified as class I, and the largest, with 1900 bp units, was designated as class II. Alignment with the consensus sequences for both classes showed changes in a few bases in the 5S rDNA genes. TATA-like sequences were detected in the nontranscribed spacer (NTS) regions of class I and a microsatellite (GCT) 10 sequence was detected in the NTS region of class II. The results obtained can help to understand the molecular organization of ribosomal genes and the mechanism of gene dispersion.

  4. [An intriguing model for 5S rDNA sequences dispersion in the genome of freshwater stingray Potamotrygon motoro (Chondrichthyes: Potamotrygonidae)].


    Cruz, V P; Oliveira, C; Foresti, F


    5S rDNA genes of the stingray Potamotrygon motoro were PCR replicated, purified, cloned and sequenced. Two distinct classes of segments of different sizes were obtained. The smallest, with 342 bp units, was classified as class I, and the largest, with 1900 bp units, was designated as class II. Alignment with the consensus sequences for both classes showed changes in a few bases in the 5S rDNA genes. TATA-like sequences were detected in the nontranscribed spacer (NTS) regions of class I and a microsatellite (GCT) 10 sequence was detected in the NTS region of class II. The results obtained can help to understand the molecular organization of ribosomal genes and the mechanism of gene dispersion. PMID:26107907

  5. Molecular confirmation of the genomic constitution of Douglasdeweya (Triticeae: Poaceae): demonstration of the utility of the 5S rDNA sequence as a tool for haplome identification.


    Baum, Bernard R; Johnson, Douglas A


    A new genus Douglasdeweya containing the two species, Douglasdeweya deweyi and D. wangii was published in 2005 by Yen et al. based upon the results of cytogenetical and morphological findings. The genome constitution of Douglasdeweya-PPStSt-allowed its segregation from the genus Pseudoroegneria which contains the StSt or StStStSt genomes. Our previous work had demonstrated the utility of using 5S rDNA units, especially the non-transcribed spacer sequence variation, for the resolution of genomes (haplomes) previously established by cytology. Here, we show that sequence analysis of the 5S DNA units from these species strongly supports the proposed species relationships of Yen et al. (Can J Bot 83:413-419, 2005), i.e., the PP genome from Agropyron and the StSt genome from Pseudoroegneria. Analysis of the 5S rDNA units constitutes a powerful tool for genomic research especially in the Triticeae. PMID:18421479

  6. 5S rDNA genome regions of Lens species.


    Fernández, M; Ruiz, M L; Linares, C; Fominaya, A; Pérez de la Vega, M


    The length variability of the nontranscribed spacer (NTS) of the 5S rDNA repeats was analyzed in species of the genus Lens by means of PCR amplification. The NTS ranged from approximately 227 to approximately 952 bp. The polymorphism detected was higher than previous NTS polymorphisms described in this genus. Three NTS length variants from Lens culinaris subsp. culinaris and 2 from Lens culinaris subsp. orientalis were sequenced. The culinaris NTS fragment lengths were 239, 371, and 838 bp, whereas the orientalis ones were 472 bp and 506 bp, respectively. As a result of sequence similarities, 2 families of sequences were distinguished, 1 including the sequences of 838 and 506 bp, and others with the sequences of 239, 371, and 472 bp. The 1st family was characterized by the presence of a repeated sequence designated A, whereas the 2nd family showed a single A sequence and other repeated sequences designated B, C, and D. The presence of an (AT)n microsatellite was also observed in the 2nd family of sequences. The fragments, which included the 239-bp and 838-bp NTS sequences, as well as the intergenic spacer (IGS) of the 18S-5.8S-26S ribosomal DNA also from L. culinaris subsp. culinaris, were used to localize the nucleolar organizer region (NOR) and the 5S rDNA loci in the chromosomes of several species of the genus Lens by means of fluorescence in situ hybridization (FISH). The selective hybridization of the 2 NTS probes allowed us to distinguish between different 5S rDNA chromosomal loci.

  7. Satellite DNA derived from 5S rDNA in Physalaemus cuvieri (Anura, Leiuperidae).


    Vittorazzi, S E; Lourenço, L B; Del-Grande, M L; Recco-Pimentel, S M


    In the present study, we describe for the first time a family of 190-bp satellite DNA related to 5S rDNA in anurans and the existence of 2 forms of 5S rDNA, type I (201 bp) and type II (690 bp). The sequences were obtained from genomic DNA of Physalaemus cuvieri from Palmeiras, State of Bahia, Brazil. Analysis of the nucleotide sequence revealed that the satellite DNA obtained by digestion with EcoRI, called PcP190EcoRI, is 70% similar to the coding region of type I 5S rDNA and 66% similar to the coding region of type II 5S rDNA. Membrane hybridization and PCR amplification of the sequence showed that PcP190EcoRI is tandemly repeated. The satellite DNA as well as type I and type II 5S rDNA were localized in P. cuvieri chromosomes by fluorescent in situ hybridization. The PcP190EcoRI sequence was found in the centromeres of chromosomes 1-5 and in the pericentromeric region of chromosome 3. Type I 5S rDNA was detected in chromosome 3, coincident with the site of PcP190EcoRI. Type II 5S rDNA was located interstitially in the long arm of chromosome 5. None of these sequences co-localized with nucleolar organizer regions. Our data suggests that this satellite DNA originates from the 5S ribosomal multigene family, probably by gene duplication, nucleotide divergence and sequence dispersion in the genome.

  8. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.


    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti


    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit. PMID:27106499

  9. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.


    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti


    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

  10. Chromosomal Mapping of Repetitive DNA Sequences in Five Species of Astyanax (Characiformes, Characidae) Reveals Independent Location of U1 and U2 snRNA Sites and Association of U1 snRNA and 5S rDNA.


    Silva, Duilio M Z A; Utsunomia, Ricardo; Pansonato-Alves, José C; Oliveira, Cláudio; Foresti, Fausto


    Astyanax is a genus of Characidae fishes currently composed of 155 valid species. Previous cytogenetic studies revealed high chromosomal diversification among them, and several studies have been performed using traditional cytogenetic techniques to investigate karyotypes and chromosomal locations of 18S and 5S rDNA genes. However, only a few studies are currently available about other repetitive sequences. Here, the chromosomal location of small nuclear RNA genes, identified as U1 and U2 snRNA clusters, was established and compared to the distribution of 5S rDNA and histone clusters in 5 Astyanax species (A. paranae, A. fasciatus, A. bockmanni, A. altiparanae, and A. jordani) using FISH. The cytogenetic mapping of U1 and U2 snRNA demonstrated a conserved pattern in the number of sites per genome independent of the location in Astyanax species. The location of the U1 snRNA gene was frequently associated with 5S rDNA sequences, indicating a possible interaction between the distinct repetitive DNA families. Finally, comparisons involving the location of U1 and U2 snRNA clusters in the chromosomes of Astyanax species revealed a very diverse pattern, suggesting that many rearrangements have occurred during the diversification process of this group. PMID:26329975

  11. Chromosomal Mapping of Repetitive DNA Sequences in Five Species of Astyanax (Characiformes, Characidae) Reveals Independent Location of U1 and U2 snRNA Sites and Association of U1 snRNA and 5S rDNA.


    Silva, Duilio M Z A; Utsunomia, Ricardo; Pansonato-Alves, José C; Oliveira, Cláudio; Foresti, Fausto


    Astyanax is a genus of Characidae fishes currently composed of 155 valid species. Previous cytogenetic studies revealed high chromosomal diversification among them, and several studies have been performed using traditional cytogenetic techniques to investigate karyotypes and chromosomal locations of 18S and 5S rDNA genes. However, only a few studies are currently available about other repetitive sequences. Here, the chromosomal location of small nuclear RNA genes, identified as U1 and U2 snRNA clusters, was established and compared to the distribution of 5S rDNA and histone clusters in 5 Astyanax species (A. paranae, A. fasciatus, A. bockmanni, A. altiparanae, and A. jordani) using FISH. The cytogenetic mapping of U1 and U2 snRNA demonstrated a conserved pattern in the number of sites per genome independent of the location in Astyanax species. The location of the U1 snRNA gene was frequently associated with 5S rDNA sequences, indicating a possible interaction between the distinct repetitive DNA families. Finally, comparisons involving the location of U1 and U2 snRNA clusters in the chromosomes of Astyanax species revealed a very diverse pattern, suggesting that many rearrangements have occurred during the diversification process of this group.

  12. Analysis of 5S rDNA organization and variation in polyploid hybrids from crosses of different fish subfamilies.


    Qin, Qinbo; He, Weiguo; Liu, Shaojun; Wang, Jing; Xiao, Jun; Liu, Yun


    In this article, sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) were conducted in red crucian carp (RCC), blunt snout bream (BSB), and their polyploid offspring. Three monomeric 5S rDNA classes (designated class I: 203 bp; class II: 340 bp; and class III: 477 bp) of RCC were characterized by distinct NTS types (designated NTS-I, II, and III for the 83, 220, and 357 bp monomers, respectively). In BSB, only one monomeric 5S rDNA was observed (designated class IV: 188 bp), which was characterized by one NTS type (designated NTS-IV: 68 bp). In the polyploid offspring, the tetraploid (4nRB) hybrids partially inherited 5S rDNA classes from their female parent (RCC); however, they also possessed a unique 5S rDNA sequence (designated class I-L: 203 bp) with a novel NTS sequence (designated NTS-I-L: 83 bp). The characteristic paternal 5S rDNA sequences (class IV) were not observed. The 5S rDNA of triploid (3nRB) hybrids was completely inherited from the parental species, and generally preserved the parental 5S rDNA structural organization. These results first revealed the influence of polyploidy on the organization and evolution of the multigene family of 5S rDNA of fish, and are also useful in clarifying aspects of vertebrate genome evolution.

  13. Physical mapping of 5S rDNA in two species of Knifefishes: Gymnotus pantanal and Gymnotus paraguensis (Gymnotiformes).


    da Silva, M; Matoso, D A; Vicari, M R; de Almeida, M C; Margarido, V P; Artoni, R F


    Physical mapping of 5S rDNA in 2 species of knifefishes, Gymnotuspantanal and G. paraguensis (Gymnotiformes), was performed using fluorescence in situ hybridization with a 5S rDNA probe. The 5S rDNA PCR product from the genomes of both species was also sequenced and aligned to determine non-transcribed spacer sequences (NTS). Both species under study had different patterns of 5S rDNA gene cluster distribution. While in the karyotype of G. pantanal two 5S rDNA-bearing pairs were observed, the karyotype of G. paraguensis possessed as many as 19 such pairs. Such multiplication of 5S rDNA gene clusters might be caused by the involvement of transposable elements because the NTS of G. paraguensis was 400 bp long with high identity (90%) with a mobile transposable element called Tc1-like transposon, described from the cyprinid fish Labeo rohita.

  14. Evolution in the block: common elements of 5S rDNA organization and evolutionary patterns in distant fish genera.


    Campo, Daniel; García-Vázquez, Eva


    The 5S rDNA is organized in the genome as tandemly repeated copies of a structural unit composed of a coding sequence plus a nontranscribed spacer (NTS). The coding region is highly conserved in the evolution, whereas the NTS vary in both length and sequence. It has been proposed that 5S rRNA genes are members of a gene family that have arisen through concerted evolution. In this study, we describe the molecular organization and evolution of the 5S rDNA in the genera Lepidorhombus and Scophthalmus (Scophthalmidae) and compared it with already known 5S rDNA of the very different genera Merluccius (Merluccidae) and Salmo (Salmoninae), to identify common structural elements or patterns for understanding 5S rDNA evolution in fish. High intra- and interspecific diversity within the 5S rDNA family in all the genera can be explained by a combination of duplications, deletions, and transposition events. Sequence blocks with high similarity in all the 5S rDNA members across species were identified for the four studied genera, with evidences of intense gene conversion within noncoding regions. We propose a model to explain the evolution of the 5S rDNA, in which the evolutionary units are blocks of nucleotides rather than the entire sequences or single nucleotides. This model implies a "two-speed" evolution: slow within blocks (homogenized by recombination) and fast within the gene family (diversified by duplications and deletions).

  15. Chromosomal localization of rDNA genes and genomic organization of 5S rDNA in Oreochromis mossambicus, O. urolepis hornorum and their hybrid.


    Zhu, Hua Ping; Lu, Mai Xin; Gao, Feng Ying; Huang, Zhang Han; Yang, Li Ping; Gui, Jian Fang


    In this study, classical and molecular cytogenetic analyses were performed in tilapia fishes, Oreochromis mossambicus (XX/XY sex determination system), O. urolepis hornorum (WZ/ZZ sex determination system) and their hybrid by crossing O. mossambicus female x O. u. hornorum male. An identical karyotype ((2n = 44, NF (total number of chromosomal arms) = 50) was obtained from three examined tilapia samples. Genomic organization analysis of 5S rDNA revealed two different types of 5S rDNA sequences, 5S type I and 5S type II. Moreover, fluorescence in situ hybridization (FISH) with 5S rDNA probes showed six positive fluorescence signals on six chromosomes of all the analysed metaphases from the three tilapia samples. Subsequently, 45S rDNA probes were also prepared, and six positive fluorescence signals were observed on three chromosome pairs in all analysed metaphases of the three tilapia samples. The correlation between 45 rDNA localization and nucleolar organizer regions (NORs) was confirmed by silver nitrate staining in tilapia fishes. Further, different chromosomal localizations of 5S rDNA and 45S rDNA were verified by two different colour FISH probes. Briefly, the current data provide an insights for hybridization projects and breeding improvement of tilapias.

  16. Nucleolar association and transcriptional inhibition through 5S rDNA in mammals.


    Fedoriw, Andrew M; Starmer, Joshua; Yee, Della; Magnuson, Terry


    Changes in the spatial positioning of genes within the mammalian nucleus have been associated with transcriptional differences and thus have been hypothesized as a mode of regulation. In particular, the localization of genes to the nuclear and nucleolar peripheries is associated with transcriptional repression. However, the mechanistic basis, including the pertinent cis- elements, for such associations remains largely unknown. Here, we provide evidence that demonstrates a 119 bp 5S rDNA can influence nucleolar association in mammals. We found that integration of transgenes with 5S rDNA significantly increases the association of the host region with the nucleolus, and their degree of association correlates strongly with repression of a linked reporter gene. We further show that this mechanism may be functional in endogenous contexts: pseudogenes derived from 5S rDNA show biased conservation of their internal transcription factor binding sites and, in some cases, are frequently associated with the nucleolus. These results demonstrate that 5S rDNA sequence can significantly contribute to the positioning of a locus and suggest a novel, endogenous mechanism for nuclear organization in mammals.

  17. Abridged 5S rDNA units in sea beet (Beta vulgaris subsp. maritima).


    Turner, Daniel J; Brown, Terence A


    Amplification by polymerase chain reaction of the 5S rDNA repeat units of Beta vulgaris subsp. maritima resulted in a 350-bp product corresponding to the full-length 5S unit, but also revealed 4 abridged unit classes, each with a deletion that removed most of the spacer and 12-76 bp of the coding sequence. Each abridged type lacks at least 1 of the conserved elements involved in transcription of the 5S gene, and so appear to be nonfunctional. Network analysis revealed that the abridged units are evolving in the same manner as the full-length versions.

  18. Molecular organization of the 5S rDNA gene type II in elasmobranchs

    PubMed Central

    Castro, Sergio I.; Hleap, Jose S.; Cárdenas, Heiber; Blouin, Christian


    ABSTRACT The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS. PMID:26488198

  19. Molecular organization of the 5S rDNA gene type II in elasmobranchs.


    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian


    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.

  20. Chromosomal localization of 18S and 5S rDNA using FISH in the genus Tor (Pisces, Cyprinidae).


    Singh, Mamta; Kumar, Ravindra; Nagpure, N S; Kushwaha, B; Gond, Indramani; Lakra, W S


    Dual color fluorescence in situ hybridization (FISH) was performed to study the simultaneous chromosomal localization of 18S and 5S ribosomal genes in the genus Tor for the first time. The 18S and 5S rDNAs in four Tor species were amplified, sequenced and mapped on the metaphase chromosomes. The number and distribution of 18S and 5S rDNA clusters were examined on metaphase chromosome spreads using FISH. The specimens of T. chelynoides, T. putitora and T. progeneius showed six bright fluorescent signals of 18S rDNA and T. tor exhibited ten such signals. The 5S rDNA signals were present only on one pair of chromosomes in all the four Tor species. Ag-NORs were observed on two pairs of chromosomes in T. chelynoides, T. putitora, T. progeneius and four pairs in T. tor. Comparison of the observed 18S rDNA FISH signals and Ag-NORs strongly suggested a possible inactivation of NORs localized at the telomeres of a subtelocentric and telocentric chromosome pairs in all four species. The 5S rDNA contained an identical 120 bp long coding region and 81 bp long highly divergent non-transcribed spacers in all species examined. 18S and 5S rDNA sequencing and chromosomal localization can be a useful genetic marker in species identification as well as phylogenetic and evolutionary studies.

  1. Contrasting patterns of the 5S and 45S rDNA evolutions in the Byblis liniflora complex (Byblidaceae).


    Fukushima, Kenji; Imamura, Kaori; Nagano, Katsuya; Hoshi, Yoshikazu


    To clarify the evolutionary dynamics of ribosomal RNA genes (rDNAs) in the Byblis liniflora complex (Byblidaceae), we investigated the 5S and 45S rDNA genes through (1) chromosomal physical mapping by fluorescence in situ hybridization (FISH) and (2) phylogenetic analyses using the nontranscribed spacer of 5S rDNA (5S-NTS) and the internal transcribed spacer of 45S rDNA (ITS). In addition, we performed phylogenetic analyses based on rbcL and trnK intron. The complex was divided into 2 clades: B. aquatica-B. filifolia and B. guehoi-B. liniflora-B. rorida. Although members of the complex had conservative symmetric karyotypes, they were clearly differentiated on chromosomal rDNA distribution patterns. The sequence data indicated that ITS was almost homogeneous in all taxa in which two or four 45S rDNA arrays were frequently found at distal regions of chromosomes in the somatic karyotype. ITS homogenization could have been prompted by relatively distal 45S rDNA positions. In contrast, 2-12 5S rDNA arrays were mapped onto proximal/interstitial regions of chromosomes, and some paralogous 5S-NTS were found in the genomes harboring 4 or more arrays. 5S-NTS sequence type-specific FISH analysis showed sequence heterogeneity within and between some 5S rDNA arrays. Interlocus homogenization may have been hampered by their proximal location on chromosomes. Chromosomal location may have affected the contrasting evolutionary dynamics of rDNAs in the B. liniflora complex.

  2. Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection

    PubMed Central


    Background The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. Results The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. Conclusions These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection. PMID:22004418

  3. Cytogenetic analysis in Polypterus ornatipinnis (Actinopterygii, Cladistia, Polypteridae) and 5S rDNA.


    Morescalchi, Maria Alessandra; Stingo, Vincenzo; Capriglione, Teresa


    Polypteridae is a family of archaic freshwater African fish that constitute an interesting subject for the study of the karyological evolution in vertebrates, on account of their primitive morphological characters and peculiar relationships with lower Osteichthyans. In this paper, a cytogenetic analysis on twenty specimens of both sexes of Polypterus ornatipinnis the ornate "bichir", coming from the Congo River basin, was performed by using both classical and molecular techniques. The karyotypic formula (2n=36; FN=72) was composed of 26 M+10 SM. The Alu I banding, performed to characterize heterochromatin in this species, was mainly centromeric. Both the chromosome location of the ribosomal 5S and 18S rRNA genes were examined by using Ag-NOR, classical C-banding, CMA(3) staining and FISH. CMA(3) marked all centromerical regions and showed the presence of two GC rich regions on the p arm of the chromosome pair n°1 and on the q arm of the pair n°14. Staining with Ag-NOR marked the only telomeric region of the chromosome n°1 p arm. After PCR, the 5S rDNA in this species was cloned, sequenced and analyzed. In the 665bp 5S rDNA sequence of P.ornatipinnis, a conserved 120bp gene region for the 5S rDNA was identified, followed by a non-transcribed variable spacer (NTS) which included simple repeats, microsatellites and a fragment of a non-LTR retrotransposon R-TEX. FISH with 5S rDNA marked the subtelomeric region of the q arm of the chromosome pair n°14, previously marked by CMA(3). FISH with 18S rDNA marked the telomeric region of the p arm of the pair n°1, previously marked both by Ag-NOR and CMA(3). The (GATA)(7) repeats marked the telomeric regions of all chromosome pairs, with the exclusion of the n°1, n°3 and n°14; hybridization with telomeric probes (TTAGGG)(n) showed signals at the end of all chromosomes. Karyotype evolution in Polypterus genus was finally discussed, including the new data obtained.

  4. Cytogenetic analysis in Polypterus ornatipinnis (Actinopterygii, Cladistia, Polypteridae) and 5S rDNA.


    Morescalchi, Maria Alessandra; Stingo, Vincenzo; Capriglione, Teresa


    Polypteridae is a family of archaic freshwater African fish that constitute an interesting subject for the study of the karyological evolution in vertebrates, on account of their primitive morphological characters and peculiar relationships with lower Osteichthyans. In this paper, a cytogenetic analysis on twenty specimens of both sexes of Polypterus ornatipinnis the ornate "bichir", coming from the Congo River basin, was performed by using both classical and molecular techniques. The karyotypic formula (2n=36; FN=72) was composed of 26 M+10 SM. The Alu I banding, performed to characterize heterochromatin in this species, was mainly centromeric. Both the chromosome location of the ribosomal 5S and 18S rRNA genes were examined by using Ag-NOR, classical C-banding, CMA(3) staining and FISH. CMA(3) marked all centromerical regions and showed the presence of two GC rich regions on the p arm of the chromosome pair n°1 and on the q arm of the pair n°14. Staining with Ag-NOR marked the only telomeric region of the chromosome n°1 p arm. After PCR, the 5S rDNA in this species was cloned, sequenced and analyzed. In the 665bp 5S rDNA sequence of P.ornatipinnis, a conserved 120bp gene region for the 5S rDNA was identified, followed by a non-transcribed variable spacer (NTS) which included simple repeats, microsatellites and a fragment of a non-LTR retrotransposon R-TEX. FISH with 5S rDNA marked the subtelomeric region of the q arm of the chromosome pair n°14, previously marked by CMA(3). FISH with 18S rDNA marked the telomeric region of the p arm of the pair n°1, previously marked both by Ag-NOR and CMA(3). The (GATA)(7) repeats marked the telomeric regions of all chromosome pairs, with the exclusion of the n°1, n°3 and n°14; hybridization with telomeric probes (TTAGGG)(n) showed signals at the end of all chromosomes. Karyotype evolution in Polypterus genus was finally discussed, including the new data obtained. PMID:21429462

  5. Molecular dissection of the rDNA array and of the 5S rDNA gene in Meloidogyne artiellia: phylogenetic and diagnostic implications.


    Veronico, Pasqua; De Luca, Francesca; De Giorgi, Carla


    The sequence of a 13.423 nucleotide genomic fragment has been determined for the plant parasitic nematode Meloidogyne artiellia. It contains an entire rDNA cluster, the bordering intergenic regions and portions of the flanking coding regions. The sequence analysis of the rDNA repeats suggests homogeneity in M. artiellia, thus providing a further indication of the usefulness of these genes for the diagnostic identification of this species. The comparison of the secondary structures of the internal transcribed spacer 2 region in several Meloidogyne species indicates that RNA folding predictions can be used as a tool of potential diagnostic relevance. The other ribosomal gene, 5S rDNA, has been demonstrated to be functional and located near the trans-spliced leader sequences, in the same arrangement found in the distantly related nematode Caenorhabditis elegans but never in other Meloidogyne thus providing species-specific markers for the identification of several Thylenchida parasitic nematodes. PMID:15135452

  6. Phylogenetic relationships among diploid Aegilops species inferred from 5S rDNA units.


    Baum, B R; Edwards, T; Johnson, D A


    Relationships among the currently recognized 11 diploid species within the genus Aegilops have been investigated. Sequence similarity analysis, based upon 363 sequenced 5S rDNA clones from 44 accessions plus 15 sequences retrieved from GenBank, depicted two unit classes labeled the long AE1 and short AE1. Several different analytical methods were applied to infer relationships within haplomes, between haplomes and among the species, including maximum parsimony and maximum likelihood analyses of consensus sequences, "total evidence" phylogeny analysis and "matrix representation with parsimony" analysis. None were able to depict suites of markers or unit classes that could discern among the seven haplomes as is observed among established haplomes in other genera within the tribe Triticeae; however, most species could be separated when displayed on gene trees. These results suggest that the haplomes currently recognized are so refined that they may be relegated as sub-haplomes or haplome variants. Amblyopyrum shares the same 5S rDNA unit classes with the diploid Aegilops species suggesting that it belongs within the latter. Comparisons of the Aegilops sequences with those of Triticum showed that the long AE1 unit class of Ae. tauschii shared the clade with the equivalent long D1 unit class, i.e., the putative D haplome donor, but the short AE1 unit class did not. The long AE1 unit class but not the short, of Ae. speltoides and Ae. searsii both share the clade with the previously identified long {S1 and long G1 unit classes meaning that both Aegilops species can be equally considered putative B haplome donors to tetraploid Triticum species. The semiconserved nature of the nontranscribed spacer in Aegilops and in Triticeae in general is discussed in view that it may have originated by processes of incomplete gene conversion or biased gene conversion or birth-and-death evolution.

  7. Evolutionary dynamics of the 5S rDNA gene family in the mussel Mytilus: mixed effects of birth-and-death and concerted evolution.


    Freire, Ruth; Arias, Alberto; Insua, Ana M; Méndez, Josefina; Eirín-López, José M


    In higher eukaryotes, the gene family encoding the 5S ribosomal RNA (5S rRNA) has been used (together with histones) to showcase the archetypal example of a gene family subject to concerted evolution. However, recent studies have revealed conspicuous features challenging the predictions of this model, including heterogeneity of repeat units, the presence of functional 5S gene variants as well as the existence of 5S rDNA divergent pseudogenes lacking traces of homogenization. In the present work, we have broadened the scope in the evolutionary study of ribosomal gene families by studying the 5S rRNA family in mussels, a model organism which stands out among other animals due to the heterogeneity it displays regarding sequence and organization. To this end, 48 previously unknown 5S rDNA units (coding and spacer regions) were sequenced in five mussel species, leading to the characterization of two new types of units (referred to here as small-beta 5S rDNA and gamma-5S rDNA) coexisting in the genome with alpha and beta rDNA units. The intense genetic dynamics of this family is further supported by the first description of an association between gamma-5S rDNA units and tRNA genes. Molecular evolutionary and phylogenetic analyses revealed an extensive lack of homology among spacer sequences belonging to different rDNA types, suggesting the presence of independent evolutionary pathways leading to their differentiation. Overall, our results suggest that the long-term evolution of the 5S rRNA gene family in mussels is most likely mediated by a mixed mechanism involving the generation of genetic diversity through birth-and-death, followed by a process of local homogenization resulting from concerted evolution in order to maintain the genetic identities of the different 5S units, probably after their transposition to independent chromosomal locations.

  8. Organization and variation analysis of 5S rDNA in different ploidy-level hybrids of red crucian carp × topmouth culter.


    He, Weiguo; Qin, Qinbo; Liu, Shaojun; Li, Tangluo; Wang, Jing; Xiao, Jun; Xie, Lihua; Zhang, Chun; Liu, Yun


    Through distant crossing, diploid, triploid and tetraploid hybrids of red crucian carp (Carassius auratus red var., RCC♀, Cyprininae, 2n = 100) × topmouth culter (Erythroculter ilishaeformis Bleeker, TC♂, Cultrinae, 2n = 48) were successfully produced. Diploid hybrids possessed 74 chromosomes with one set from RCC and one set from TC; triploid hybrids harbored 124 chromosomes with two sets from RCC and one set from TC; tetraploid hybrids had 148 chromosomes with two sets from RCC and two sets from TC. The 5S rDNA of the three different ploidy-level hybrids and their parents were sequenced and analyzed. There were three monomeric 5S rDNA classes (designated class I: 203 bp; class II: 340 bp; and class III: 477 bp) in RCC and two monomeric 5S rDNA classes (designated class IV: 188 bp, and class V: 286 bp) in TC. In the hybrid offspring, diploid hybrids inherited three 5S rDNA classes from their female parent (RCC) and only class IV from their male parent (TC). Triploid hybrids inherited class II and class III from their female parent (RCC) and class IV from their male parent (TC). Tetraploid hybrids gained class II and class III from their female parent (RCC), and generated a new 5S rDNA sequence (designated class I-N). The specific paternal 5S rDNA sequence of class V was not found in the hybrid offspring. Sequence analysis of 5S rDNA revealed the influence of hybridization and polyploidization on the organization and variation of 5S rDNA in fish. This is the first report on the coexistence in vertebrates of viable diploid, triploid and tetraploid hybrids produced by crossing parents with different chromosome numbers, and these new hybrids are novel specimens for studying the genomic variation in the first generation of interspecific hybrids, which has significance for evolution and fish genetics.

  9. Chromosome mapping of 18S rDNA and 5S rDNA by dual-color fluorescence in situ hybridization in the half-smooth tongue sole (Cynoglossus semilaevis).


    Jiang, L; Jiang, J; Liu, J; Yuan, J; Chen, Y; Zhang, Q; Wang, X


    Half-smooth tongue sole (Cynoglossus semilaevis) is an important aquaculture flatfish in China. Cytogenetic analysis has revealed that its sex determination system is female heterogametic (ZZ/ZW). The W chromosome is morphologically larger and has been considered evolutionarily younger than any other chromosome in the set. However, the genetic origin and evolution process of this neo-chromosome remains unclear. In this study, 2 tandem arrays of rRNA genes were chosen to address this question. Both the major rDNA (18S rDNA) and the minor rDNA (5S rDNA) were located on the C. semilaevis chromosomes by fluorescence in situ hybridization (FISH). Six 18S rDNA signals were observed on the centromeric regions of 3 pairs of autosomes in both males and females. In females, there was an additional 18S rDNA signal mapping to the telomeric region of the W chromosome long arm. With respect to the 5S rDNA, 12 signals were mapped to the centromeric regions of six pairs of autosomes. Two-color FISH further confirmed that the two pairs of the 5S rDNA signals were correspondingly located at the same positions of the same autosomes as those of the 18S rDNA signals. These results allowed us to speculate about the evolution process of the W chromosome. Chromosome fusions and repetitive sequence accumulations might have occurred in C. semilaevis. The synteny and non-synteny of C. semilaevis 18S rDNA and 5S rDNA might imply the original and evolutionary characteristics of this species. These findings will facilitate studies on karyotype evolution of the order Pleuronectiformes.

  10. Chromosomal Locations of 5S and 45S rDNA in Gossypium Genus and Its Phylogenetic Implications Revealed by FISH.


    Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo


    We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G. incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G. raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution.

  11. Evolutionary dynamics of 5S rDNA location in acridid grasshoppers and its relationship with H3 histone gene and 45S rDNA location.


    Cabral-de-Mello, Diogo C; Cabrero, Josefa; López-León, María Dolores; Camacho, Juan Pedro M


    We analyze the chromosomal location of 5S rDNA clusters in 29 species of grasshoppers belonging to the family Acrididae. There was extensive variation among species for the number and location of 5S rDNA sites. Out of 148 sites detected, 75% were proximally located, 21.6% were interstitial, and only 3.4% were distal. The number of 5S rDNA sites per species varied from a single chromosome pair (in six species) to all chromosome pairs (in five species), with a range of intermediate situations. Thirteen chromosomes from eight species carried two 5S rDNA clusters. At intraspecific level, differences among populations were detected in Eyprepocnemis plorans, and some heteromorphisms have also been observed in some species. Double FISH for 5S rDNA and H3 histone gene DNA, performed on 17 of these 29 species, revealed that both markers are sometimes placed in a same chromosome but at different location, whereas they appeared to co-localize in five species (Calliptamus barbarus, Heteracris adpersa, Aiolopus strepens, Oedipoda charpentieri and O. coerulescens). Double fiber-FISH in A. strepens and O. coerulescens showed that the two DNAs are closely interspersed with variable relative amounts of both classes of DNA. Finally, no correlation was observed between the number of 5S and 45S rDNA clusters in 23 species where this information was available. These results are discussed in the light of possible mechanisms of spread that led to the extensive variation in the number of clusters observed for both rDNA types in acridid grasshoppers.

  12. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae)

    PubMed Central

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M


    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at −25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant. PMID:21364693

  13. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).


    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M


    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant.

  14. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).


    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M


    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant. PMID:21364693

  15. Non-Random Distribution of 5S rDNA Sites and Its Association with 45S rDNA in Plant Chromosomes.


    Roa, Fernando; Guerra, Marcelo


    5S and 45S rDNA sites are the best mapped chromosome regions in eukaryotic chromosomes. In this work, a database was built gathering information about the position and number of 5S rDNA sites in 784 plant species, aiming to identify patterns of distribution along the chromosomes and its correlation with the position of 45S rDNA sites. Data revealed that in most karyotypes (54.5%, including polyploids) two 5S rDNA sites (a single pair) are present, with 58.7% of all sites occurring in the short arm, mainly in the proximal region. In karyotypes of angiosperms with only 1 pair of sites (single sites) they are mostly found in the proximal region (52.0%), whereas in karyotypes with multiple sites the location varies according to the average chromosome size. Karyotypes with multiple sites and small chromosomes (<3 µm) often display proximal sites, while medium-sized (between 3 and 6 µm) and large chromosomes (>6 µm) more commonly show terminal or interstitial sites. In species with holokinetic chromosomes, the modal value of sites per karyotype was also 2, but they were found mainly in a terminal position. Adjacent 5S and 45S rDNA sites were often found in the short arm, reflecting the preferential distribution of both sites in this arm. The high frequency of genera with at least 1 species with adjacent 5S and 45S sites reveals that this association appeared several times during angiosperm evolution, but it has been maintained only rarely as the dominant array in plant genera.

  16. Physical mapping of 18S and 5S rDNA loci and histone H3 gene in grasshopper species of the subfamily Gomphocerinae (Acrididae).


    Silva-Neto, L C; Bernardino, A C S; Loreto, V; Moura, R C


    In this study, fluorescence in situ hybridization (FISH) analysis was used to determine and compare the numbers and chromosomal locations of two multigene families (rDNA and histone H3) in four Neotropical species of gomphocerine grasshoppers. FISH using the 18S rDNA probe identified a single site on the S9 chromosome of Amblytropidia sp and Cauratettix borelli, a single site on chromosome M6 of Compsacris pulcher, and two sites (chromosomes L1 and L2) in Orphulella punctata. By contrast, FISH with a 5S rDNA probe identified dispersion of this sequence in the genomes of the four species, with evidence of intraspecific variations. Amblytropidia sp had six to eight FISH signals on autosomal chromosomes, while C. pulcher exhibited a signal only on the M5 bivalent. The histone H3 gene was less variable and was restricted to a single pair in all species. The conservation of the numbers and locations of 18S rDNA and H3 genes in conjunction with data from the literature was useful for evaluating karyotype evolution in this subfamily. The variation in the number and sizes of 5S rDNA sites indicates a process of recent dispersion that might have been mediated by transposition. PMID:26634462

  17. Physical mapping of 18S and 5S rDNA loci and histone H3 gene in grasshopper species of the subfamily Gomphocerinae (Acrididae).


    Silva-Neto, L C; Bernardino, A C S; Loreto, V; Moura, R C


    In this study, fluorescence in situ hybridization (FISH) analysis was used to determine and compare the numbers and chromosomal locations of two multigene families (rDNA and histone H3) in four Neotropical species of gomphocerine grasshoppers. FISH using the 18S rDNA probe identified a single site on the S9 chromosome of Amblytropidia sp and Cauratettix borelli, a single site on chromosome M6 of Compsacris pulcher, and two sites (chromosomes L1 and L2) in Orphulella punctata. By contrast, FISH with a 5S rDNA probe identified dispersion of this sequence in the genomes of the four species, with evidence of intraspecific variations. Amblytropidia sp had six to eight FISH signals on autosomal chromosomes, while C. pulcher exhibited a signal only on the M5 bivalent. The histone H3 gene was less variable and was restricted to a single pair in all species. The conservation of the numbers and locations of 18S rDNA and H3 genes in conjunction with data from the literature was useful for evaluating karyotype evolution in this subfamily. The variation in the number and sizes of 5S rDNA sites indicates a process of recent dispersion that might have been mediated by transposition.

  18. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation

    PubMed Central

    Garcia, S; Kovařík, A


    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S–5.8S–26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S–18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S–5.8S–26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants. PMID:23512008

  19. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.


    Garcia, S; Kovařík, A


    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

  20. Chromosomal location of 18S and 5S rDNA sites in Triportheus fish species (Characiformes, Characidae)

    PubMed Central


    The location of 18S and 5S rDNA sites was determined in eight species and populations of the fish genus Triportheus by using fluorescent in situ hybridization (FISH). The males and females of all species had 2n = 52 chromosomes and a ZZ/ZW sex chromosome system. A single 18S rDNA site that was roughly equivalent to an Ag-NOR was detected on the short arms of a submetacentric pair in nearly all species, and up to two additional sites were also observed in some species. In addition, another 18S rDNA cluster was identified in a distal region on the long arms of the W chromosome; this finding corroborated previous evidence that this cluster would be a shared feature amongst Triportheus species. In T. angulatus, a heterozygotic paracentric inversion involving the short arms of one homolog of a metacentric pair was associated with NORs. The 5S rDNA sites were located on the short arms of a single submetacentric chromosomal pair, close to the centromeres, except in T. auritus, which had up to ten 5S rDNA sites. The 18S and 5S rDNA sites were co-localized and adjacent on the short arms of a chromosomal pair in two populations of T. nematurus. Although all Triportheus species have a similar karyotypic macrostructure, the results of this work show that in some species ribosomal genes may serve as species-specific markers when used in conjunction with other putatively synapomorphic features. PMID:21637644

  1. Molecular characterization and physical mapping of two classes of 5S rDNA in the genomes of Gymnotus sylvius and G. inaequilabiatus (Gymnotiformes, Gymnotidae).


    Scacchetti, P C; Alves, J C P; Utsunomia, R; Claro, F L; de Almeida Toledo, L F; Oliveira, C; Foresti, F


    The nucleotide sequences of the 5S rRNA multigene family and their distribution across the karyotypes in 2 species of Gymnotiformes, genus Gymnotus (G. sylvius and G. inaequilabiatus) were investigated by means of fluorescence in situ hybridization (FISH). The results showed the existence of 2 distinct classes of 5S rDNA sequences in both species: class I and class II. A high conservative pattern of the codifying region of the 5S rRNA gene was identified, contrasting with significant alterations detected in the nontranscribed spacer (NTS). The presence of TATA-like sequences along the NTS of both species was an expected occurrence, since such sequences have been associated with the regulation of the gene expression. FISH using 5S rDNA class I and class II probes revealed that both gene classes were collocated in the same chromosome pair in the genome of G. sylvius, while in that of G. inaequilabiatus, class II appeared more disperse than class I.

  2. The 5S rDNA gene family in mollusks: characterization of transcriptional regulatory regions, prediction of secondary structures, and long-term evolution, with special attention to Mytilidae mussels.


    Vizoso, Miguel; Vierna, Joaquín; González-Tizón, Ana M; Martínez-Lage, Andrés


    Several reports on the characterization of 5S ribosomal DNA (5S rDNA) in various animal groups have been published to date, but there is a lack of studies analyzing this gene family in a much broader context. Here, we have studied 5S rDNA variation in several molluskan species, including bivalves, gastropods, and cephalopods. The degree of conservation of transcriptional regulatory regions was analyzed in these lineages, revealing a conserved TATA-like box in the upstream region. The evolution of the 120 bp coding region (5S) was also studied, suggesting the occurrence of paralogue groups in razor clams, clams, and cockles. In addition, 5S rDNA sequences from 11 species and 7 genus of Mytilidae Rafinesque, 1815 mussels were sampled and studied in detail. Four different 5S rDNA types, based on the nontranscribed spacer region were identified. The phylogenetic analyses performed within each type showed a between-species gene clustering pattern, suggesting ancestral polymorphism. Moreover, some putative pseudogenized 5S copies were also identified. Our report, together with previous studies that found high degree of intragenomic divergence in bivalve species, suggests that birth-and-death evolution may be the main force driving the evolution of 5S rDNA in these animals, even at the genus level.

  3. Contrasting patterns of evolution of 45S and 5S rDNA families uncover new aspects in the genome constitution of the agronomically important grass Thinopyrum intermedium (Triticeae).


    Mahelka, Václav; Kopecky, David; Baum, Bernard R


    We employed sequencing of clones and in situ hybridization (genomic and fluorescent in situ hybridization [GISH and rDNA-FISH]) to characterize both the sequence variation and genomic organization of 45S (herein ITS1-5.8S-ITS2 region) and 5S (5S gene + nontranscribed spacer) ribosomal DNA (rDNA) families in the allohexaploid grass Thinopyrum intermedium. Both rDNA families are organized within several rDNA loci within all three subgenomes of the allohexaploid species. Both families have undergone different patterns of evolution. The 45S rDNA family has evolved in a concerted manner: internal transcribed spacer (ITS) sequences residing within the arrays of two subgenomes out of three got homogenized toward one major ribotype, whereas the third subgenome contained a minor proportion of distinct unhomogenized copies. Homogenization mechanisms such as unequal crossover and/or gene conversion were coupled with the loss of certain 45S rDNA loci. Unlike in the 45S family, the data suggest that neither interlocus homogenization among homeologous chromosomes nor locus loss occurred in 5S rDNA. Consistently with other Triticeae, the 5S rDNA family in intermediate wheatgrass comprised two distinct array types-the long- and short-spacer unit classes. Within the long and short units, we distinguished five and three different types, respectively, likely representing homeologous unit classes donated by putative parental species. Although the major ITS ribotype corresponds in our phylogenetic analysis to the E-genome species, the minor ribotype corresponds to Dasypyrum. 5S sequences suggested the contributions from Pseudoroegneria, Dasypyrum, and Aegilops. The contribution from Aegilops to the intermediate wheatgrass' genome is a new finding with implications in wheat improvement. We discuss rDNA evolution and potential origin of intermediate wheatgrass.

  4. Contrasting patterns of evolution of 45S and 5S rDNA families uncover new aspects in the genome constitution of the agronomically important grass Thinopyrum intermedium (Triticeae).


    Mahelka, Václav; Kopecky, David; Baum, Bernard R


    We employed sequencing of clones and in situ hybridization (genomic and fluorescent in situ hybridization [GISH and rDNA-FISH]) to characterize both the sequence variation and genomic organization of 45S (herein ITS1-5.8S-ITS2 region) and 5S (5S gene + nontranscribed spacer) ribosomal DNA (rDNA) families in the allohexaploid grass Thinopyrum intermedium. Both rDNA families are organized within several rDNA loci within all three subgenomes of the allohexaploid species. Both families have undergone different patterns of evolution. The 45S rDNA family has evolved in a concerted manner: internal transcribed spacer (ITS) sequences residing within the arrays of two subgenomes out of three got homogenized toward one major ribotype, whereas the third subgenome contained a minor proportion of distinct unhomogenized copies. Homogenization mechanisms such as unequal crossover and/or gene conversion were coupled with the loss of certain 45S rDNA loci. Unlike in the 45S family, the data suggest that neither interlocus homogenization among homeologous chromosomes nor locus loss occurred in 5S rDNA. Consistently with other Triticeae, the 5S rDNA family in intermediate wheatgrass comprised two distinct array types-the long- and short-spacer unit classes. Within the long and short units, we distinguished five and three different types, respectively, likely representing homeologous unit classes donated by putative parental species. Although the major ITS ribotype corresponds in our phylogenetic analysis to the E-genome species, the minor ribotype corresponds to Dasypyrum. 5S sequences suggested the contributions from Pseudoroegneria, Dasypyrum, and Aegilops. The contribution from Aegilops to the intermediate wheatgrass' genome is a new finding with implications in wheat improvement. We discuss rDNA evolution and potential origin of intermediate wheatgrass. PMID:23741054

  5. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family

    PubMed Central


    Background In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in ~200 species representing the family diversity and other closely related groups. Results Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Conclusions Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units

  6. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).


    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro


    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus. PMID:26959315

  7. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).


    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro


    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus.

  8. Variability of the 5S and 45S rDNA Sites in Passiflora L. Species with Distinct Base Chromosome Numbers

    PubMed Central



    Cytologically, the species of Passiflora with known chromosome number can be divided into four groups: (1) 2n = 12, 24, 36; (2) 2n = 24; (3) 2n = 18, 72; and (4) 2n = 20. The base chromosome number proposed for the genus is x = 6, with x = 9, x = 10 and x = 12 being considered secondary base numbers. In the present study, variability of 5S and 45S rDNA sites was investigated in 20 species of these four groups to check the reliability of this hypothesis. In the group with x = 6, five diploid species (2n = 12) exhibit two 5S rDNA sites and two (P. capsularis, P. morifolia and P. rubra) or four (P. misera 2x and P. tricuspis) 45S rDNA sites. The hexaploid cytotype of P. misera had 12 45S rDNA sites and six 5S rDNA. A tetraploid species, P. suberosa, had ten 45S rDNA sites and four 5S rDNA sites, both in the same chromosomes as the 45S rDNA sites. In the group with x = 9, P. actinia, P. amethystina, P. edmundoi, P. elegans, P. galbana, P. glandulosa and P. mucronata displayed six 45S rDNA sites, whereas P. alata, P. cincinnata, P. edulis f. flavicarpa, P. edulis var. roxo and P. laurifolia had four sites. In this group, all species were diploid (2n = 18) and had only two 5S rDNA sites. Passiflora foetida, the only species with 2n = 20, had six 45S rDNA sites and four 5S rDNA sites. The species with x = 12 (2n = 24), P. haematostigma and P. pentagona, showed four 45S rDNA sites and two 5S rDNA. In general, the number and location of 5S and 45S rDNA sites were consistent with the hypothesis of x = 6 as the probable ancestral genome for the genus, while the groups of species with x = 9, x = 10 and x = 12 were considered to be of tetraploid origin with descending dysploidy and gene silencing of some redundant gene sites, mainly those of 5S rDNA. PMID:12876193

  9. Variability of the 5S and 45S rDNA sites in Passiflora L. species with distinct base chromosome numbers.


    de Melo, Natoniel Franklin; Guerra, Marcelo


    Cytologically, the species of Passiflora with known chromosome number can be divided into four groups: (1) 2n = 12, 24, 36; (2) 2n = 24; (3) 2n = 18, 72; and (4) 2n = 20. The base chromosome number proposed for the genus is x = 6, with x = 9, x = 10 and x = 12 being considered secondary base numbers. In the present study, variability of 5S and 45S rDNA sites was investigated in 20 species of these four groups to check the reliability of this hypothesis. In the group with x = 6, five diploid species (2n = 12) exhibit two 5S rDNA sites and two (P. capsularis, P. morifolia and P. rubra) or four (P. misera 2x and P. tricuspis) 45S rDNA sites. The hexaploid cytotype of P. misera had 12 45S rDNA sites and six 5S rDNA. A tetraploid species, P. suberosa, had ten 45S rDNA sites and four 5S rDNA sites, both in the same chromosomes as the 45S rDNA sites. In the group with x = 9, P. actinia, P. amethystina, P. edmundoi, P. elegans, P. galbana, P. glandulosa and P. mucronata displayed six 45S rDNA sites, whereas P. alata, P. cincinnata, P. edulis f. flavicarpa, P. edulis var. roxo and P. laurifolia had four sites. In this group, all species were diploid (2n = 18) and had only two 5S rDNA sites. Passiflora foetida, the only species with 2n = 20, had six 45S rDNA sites and four 5S rDNA sites. The species with x = 12 (2n = 24), P. haematostigma and P. pentagona, showed four 45S rDNA sites and two 5S rDNA. In general, the number and location of 5S and 45S rDNA sites were consistent with the hypothesis of x = 6 as the probable ancestral genome for the genus, while the groups of species with x = 9, x = 10 and x = 12 were considered to be of tetraploid origin with descending dysploidy and gene silencing of some redundant gene sites, mainly those of 5S rDNA. PMID:12876193

  10. Compilation of 5S rRNA and 5S rRNA gene sequences

    PubMed Central

    Specht, Thomas; Wolters, Jörn; Erdmann, Volker A.


    The BERLIN RNA DATABANK as of Dezember 31, 1989, contains a total of 667 sequences of 5S rRNAs or their genes, which is an increase of 114 new sequence entries over the last compilation (1). It covers sequences from 44 archaebacteria, 267 eubacteria, 20 plastids, 6 mitochondria, 319 eukaryotes and 11 eukaryotic pseudogenes. The hardcopy shows only the list (Table 1) of those organisms whose sequences have been determined. The BERLIN RNA DATABANK uses the format of the EMBL Nucleotide Sequence Data Library complemented by a Sequence Alignment (SA) field including secondary structure information. PMID:1692116

  11. Partial sequence homogenization in the 5S multigene families may generate sequence chimeras and spurious results in phylogenetic reconstructions.


    Galián, José A; Rosato, Marcela; Rosselló, Josep A


    Multigene families have provided opportunities for evolutionary biologists to assess molecular evolution processes and phylogenetic reconstructions at deep and shallow systematic levels. However, the use of these markers is not free of technical and analytical challenges. Many evolutionary studies that used the nuclear 5S rDNA gene family rarely used contiguous 5S coding sequences due to the routine use of head-to-tail polymerase chain reaction primers that are anchored to the coding region. Moreover, the 5S coding sequences have been concatenated with independent, adjacent gene units in many studies, creating simulated chimeric genes as the raw data for evolutionary analysis. This practice is based on the tacitly assumed, but rarely tested, hypothesis that strict intra-locus concerted evolution processes are operating in 5S rDNA genes, without any empirical evidence as to whether it holds for the recovered data. The potential pitfalls of analysing the patterns of molecular evolution and reconstructing phylogenies based on these chimeric genes have not been assessed to date. Here, we compared the sequence integrity and phylogenetic behavior of entire versus concatenated 5S coding regions from a real data set obtained from closely related plant species (Medicago, Fabaceae). Our results suggest that within arrays sequence homogenization is partially operating in the 5S coding region, which is traditionally assumed to be highly conserved. Consequently, concatenating 5S genes increases haplotype diversity, generating novel chimeric genotypes that most likely do not exist within the genome. In addition, the patterns of gene evolution are distorted, leading to incorrect haplotype relationships in some evolutionary reconstructions.

  12. Identification of goose (Anser anser) and mule duck (Anasplatyrhynchos x Cairina moschata) foie gras by multiplex polymerase chain reaction amplification of the 5S RDNA gene.


    Rodríguez, M A; García, T; González, I; Asensio, L; Fernández, A; Lobo, E; Hernández, P E; Martín, R


    Polymerase chain reaction (PCR) amplification of the nuclear 5S rDNA gene has been used for the identification of goose and mule duck foie gras. Two species-specific reverse primers were designed and used in a multiplex reaction, together with a forward universal primer, to amplify specific fragments of the 5S rDNA in each species. The different sizes of the species-specific amplicons, separated by agarose gel electrophoresis, allowed clear identification of goose and mule duck foie gras samples. This genetic marker can be useful for detecting fraudulent substitution of the duck liver for the more expensive goose liver.

  13. Chromosomal localization of 5S rDNA in Chinese shrimp ( Fenneropenaeus chinensis): a chromosome-specific marker for chromosome identification

    NASA Astrophysics Data System (ADS)

    Huan, Pin; Zhang, Xiaojun; Li, Fuhua; Zhao, Cui; Zhang, Chengsong; Xiang, Jianhai


    Chinese shrimp ( Fenneropenaeus chinensis) is an economically important aquaculture species in China. However, cytogenetic and genomic data is limited in the organism partly because the chromosomes are difficult to isolate and analyze. In this study, fluorescence in-situ hybridization (FISH) was used to identify the chromosomes of F. chinensis. The 5S ribosomal RNA gene (rDNA) of F. chinensis was isolated, cloned and then used as a hybridization probe. The results show that the 5S rDNA was located on one pair of homologous chromosomes in F. chinensis. In addition, triploid shrimp were used to evaluate the feasibility of chromosome identification using FISH and to validate the method. It was confirmed that 5S rDNA can be used as a chromosome-specific probe for chromosome identification in F. chinensis. The successful application of FISH in F. chinensis shows that chromosome-specific probes can be developed and this finding will facilitate further research on the chromosomes of penaeid shrimps.

  14. Physical mapping of the 5S and 18S rDNA in ten species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae): evolutionary tendencies in the genus.


    Bueno, Vanessa; Venere, Paulo César; Thums Konerat, Jocicléia; Zawadzki, Cláudio Henrique; Vicari, Marcelo Ricardo; Margarido, Vladimir Pavan


    Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH) with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus.

  15. Physical Mapping of the 5S and 18S rDNA in Ten Species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae): Evolutionary Tendencies in the Genus

    PubMed Central

    César Venere, Paulo; Thums Konerat, Jocicléia; Henrique Zawadzki, Cláudio; Ricardo Vicari, Marcelo; Margarido, Vladimir Pavan


    Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH) with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus. PMID:25405240

  16. Chromosomal characteristics and distribution of rDNA sequences in the brook trout Salvelinus fontinalis (Mitchill, 1814).


    Śliwińska-Jewsiewicka, A; Kuciński, M; Kirtiklis, L; Dobosz, S; Ocalewicz, K; Jankun, Malgorzata


    Brook trout Salvelinus fontinalis (Mitchill, 1814) chromosomes have been analyzed using conventional and molecular cytogenetic techniques enabling characteristics and chromosomal location of heterochromatin, nucleolus organizer regions (NORs), ribosomal RNA-encoding genes and telomeric DNA sequences. The C-banding and chromosome digestion with the restriction endonucleases demonstrated distribution and heterogeneity of the heterochromatin in the brook trout genome. DNA sequences of the ribosomal RNA genes, namely the nucleolus-forming 28S (major) and non-nucleolus-forming 5S (minor) rDNAs, were physically mapped using fluorescence in situ hybridization (FISH) and primed in situ labelling. The minor rDNA locus was located on the subtelo-acrocentric chromosome pair No. 9, whereas the major rDNA loci were dispersed on 14 chromosome pairs, showing a considerable inter-individual variation in the number and location. The major and minor rDNA loci were located at different chromosomes. Multichromosomal location (3-6 sites) of the NORs was demonstrated by silver nitrate (AgNO3) impregnation. All Ag-positive i.e. active NORs corresponded to the GC-rich blocks of heterochromatin. FISH with telomeric probe showed the presence of the interstitial telomeric site (ITS) adjacent to the NOR/28S rDNA site on the chromosome 11. This ITS was presumably remnant of the chromosome rearrangement(s) leading to the genomic redistribution of the rDNA sequences. Comparative analysis of the cytogenetic data among several related salmonid species confirmed huge variation in the number and the chromosomal location of rRNA gene clusters in the Salvelinus genome.

  17. Phylogenetic study on Shiraia bambusicola by rDNA sequence analyses.


    Cheng, Tian-Fan; Jia, Xiao-Ming; Ma, Xiao-Hang; Lin, Hai-Ping; Zhao, Yu-Hua


    In this study, 18S rDNA and ITS-5.8S rDNA regions of four Shiraia bambusicola isolates collected from different species of bamboos were amplified by PCR with universal primer pairs NS1/NS8 and ITS5/ITS4, respectively, and sequenced. Phylogenetic analyses were conducted on three selected datasets of rDNA sequences. Maximum parsimony, distance and maximum likelihood criteria were used to infer trees. Morphological characteristics were also observed. The positioning of Shiraia in the order Pleosporales was well supported by bootstrap, which agreed with the placement by Amano (1980) according to their morphology. We did not find significant inter-hostal differences among these four isolates from different species of bamboos. From the results of analyses and comparison of their rDNA sequences, we conclude that Shiraia should be classified into Pleosporales as Amano (1980) proposed and suggest that it might be positioned in the family Phaeosphaeriaceae.

  18. Cloning and sequencing of the rDNA gene family of the water buffalo (Bubalus bubalis).


    Pang, C Y; Deng, T X; Tang, D S; Yang, C Y; Jiang, H; Yang, B Z; Liang, X W


    The rDNA genes coding for ribosomal RNA in animals are complicated repeat sequences with high GC content. We amplified water buffalo rDNA gene sequences with the long and accurate (LA) PCR method, using LA Taq DNA polymerase and GC buffer, based on bioinformatic analysis of related organisms. The rDNA genes were found to consist of 9016 nucleotides, including three rRNA genes and two internal transcribed spacers (ITS), which we named 18S rRNA, ITS1, 5.8S rRNA, ITS2 and 28S rRNA. We tested and optimized conditions for cloning these complicated rDNA sequences, including specific rules of primer design, improvements in the reaction system, and selection of the DNA polymerase.

  19. Heterochromatin and rDNA 5S and 45S sites as reliable cytogenetic markers for castor bean (Ricinus communis, Euphorbiaceae).


    Vasconcelos, Santelmo; Souza, Analice Araújo de; Gusmão, Cássia Lima Silva; Milani, Máira; Benko-Iseppon, Ana M; Brasileiro-Vidal, Ana Christina


    The increasing need for renewable energy resources has led to higher demands for biofuel, a scenario where the castor bean (Ricinus communis L.) seed oil represents a promising source of raw material. Despite that, information regarding the genome organization of R. communis is still scarce, impairing the application of modern biotechnological and breeding procedures. The present work brings the first evaluation of the mitotic chromosomes of this species, including 10 potentially interesting accessions for cultivation in semi-arid environments aiming at the biofuel production. The approach included standard staining, fluorochrome staining (CMA/DAPI), fluorescent in situ hybridization (FISH) with rDNA 5S and 45S, as well as silver impregnation. All accessions were diploid with 2n=2x=20, displaying mainly metacentric chromosomes, with CMA-positive bands (GC-rich) in all pairs of the complement. After silver impregnation, one to 14 nucleoli were observed, while the FISH with rDNA 45S revealed two large sites and a variety of minor dots, and the DNAr 5S hybridized in a single pair. The observed features were discussed and compared with literature data regarding pachytene bivalents.

  20. Chromosomal mapping of repetitive DNAs in Gobionellus oceanicus and G. stomatus (Gobiidae; Perciformes): A shared XX/XY system and an unusual distribution of 5S rDNA sites on the Y chromosome.


    Lima-Filho, Paulo A; Amorim, Karlla D J; Cioffi, Marcelo B; Bertollo, Luiz A C; Molina, Wagner F


    With nearly 2,000 species, Gobiidae is the most specious family of the vertebrates. This high level of speciation is accompanied by conspicuous karyotypic modifications, where the role of repetitive sequences remains largely unknown. This study analyzed the karyotype of 2 species of the genus Gobionellus and mapped 18S and 5S ribosomal RNA genes and (CA)15 microsatellite sequences onto their chromosomes. G. oceanicus (2n = 56; ♂ 12 metacentrics (m) + 4 submetacentrics (sm) + 1 subtelocentric (st) + 39 acrocentrics (a); ♀ 12m + 4sm + 2st + 38a) and G. stomatus (2n = 56; ♂ 20m + 14sm + 1st + 21a; ♀ 20m + 14sm + 2st + 20a) possess the highest diploid chromosome number among the Gobiidae and have different karyotypes. Both species share an XX/XY sex chromosome system with a large subtelocentric X and a small acrocentric Y chromosome which is rich in (CA)15 sequences and bears 5S rRNA sites. Although coding and noncoding repetitive DNA sequences may be involved in the genesis or differentiation of the sex chromosomes, the exclusive presence of 5S rDNA sites on the Y, but not on the X chromosome of both species, represents a novelty in fishes. In summary, the karyotypic differences, as well as new data on the sex chromosome systems in these 2 Gobiidae species, confirm the high chromosomal dynamism observed in this family.

  1. Cytogenetic Diversity and the Evolutionary Dynamics of rDNA Genes and Telomeric Sequences in the Ancistrus Genus (Loricariidae: Ancistrini).


    Favarato, Ramon Marin; Silva, Maelin da; Oliveira, Renildo Ribeiro de; Artoni, Roberto Ferreira; Feldberg, Eliana; Matoso, Daniele Aparecida


    The Ancistrus genus differs from other Ancistrini due to its wide karyotypic diversity, varied diploid numbers, differences in sex chromosomes, and large number of species, as well as its tendency to form small populations with low vagility. This study investigated the role of 5S and 18S rDNA and telomeric repetitive sequences in the evolution of the karyotypic macrostructure of seven species of the genus Ancistrus from the Central Amazon. The results indicate a strong correlation between the location of ribosomal sites and fragile sites in the genome, particularly of 5S rDNA sequences, which are associated, in some species, with telomeric sequences at the sites of chromosomal healing. Moreover, the occurrence of two lineages was observed with regard to the synteny of ribosomal genes. The species of the genus Ancistrus showed high chromosomal lability associated with breakpoints, which was characterized by the presence of repetitive DNA sequences and this process is suggested to be an evolutionary model for the rapid fixation of structural rearrangements. PMID:26829587

  2. Cytogenetic Diversity and the Evolutionary Dynamics of rDNA Genes and Telomeric Sequences in the Ancistrus Genus (Loricariidae: Ancistrini).


    Favarato, Ramon Marin; Silva, Maelin da; Oliveira, Renildo Ribeiro de; Artoni, Roberto Ferreira; Feldberg, Eliana; Matoso, Daniele Aparecida


    The Ancistrus genus differs from other Ancistrini due to its wide karyotypic diversity, varied diploid numbers, differences in sex chromosomes, and large number of species, as well as its tendency to form small populations with low vagility. This study investigated the role of 5S and 18S rDNA and telomeric repetitive sequences in the evolution of the karyotypic macrostructure of seven species of the genus Ancistrus from the Central Amazon. The results indicate a strong correlation between the location of ribosomal sites and fragile sites in the genome, particularly of 5S rDNA sequences, which are associated, in some species, with telomeric sequences at the sites of chromosomal healing. Moreover, the occurrence of two lineages was observed with regard to the synteny of ribosomal genes. The species of the genus Ancistrus showed high chromosomal lability associated with breakpoints, which was characterized by the presence of repetitive DNA sequences and this process is suggested to be an evolutionary model for the rapid fixation of structural rearrangements.

  3. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    PubMed Central


    Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement) or, less commonly, linked to 35 S rDNA units (L-type). The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6) but not all species. Two species contained major L-type and minor S-type units (termed Ls-type). The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’) is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs. PMID:22716941

  4. Phylogeny and genetic diversity of Bridgeoporus nobilissimus inferred using mitochondrial and nuclear rDNA sequences

    USGS Publications Warehouse

    Redberg, G.L.; Hibbett, D.S.; Ammirati, J.F.; Rodriguez, R.J.


    The genetic diversity and phylogeny of Bridgeoporus nobilissimus have been analyzed. DNA was extracted from spores collected from individual fruiting bodies representing six geographically distinct populations in Oregon and Washington. Spore samples collected contained low levels of bacteria, yeast and a filamentous fungal species. Using taxon-specific PCR primers, it was possible to discriminate among rDNA from bacteria, yeast, a filamentous associate and B. nobilissimus. Nuclear rDNA internal transcribed spacer (ITS) region sequences of B. nobilissimus were compared among individuals representing six populations and were found to have less than 2% variation. These sequences also were used to design dual and nested PCR primers for B. nobilissimus-specific amplification. Mitochondrial small-subunit rDNA sequences were used in a phylogenetic analysis that placed B. nobilissimus in the hymenochaetoid clade, where it was associated with Oxyporus and Schizopora.

  5. Patterns of rDNA and telomeric sequences diversification: contribution to repetitive DNA organization in Phyllostomidae bats.


    Calixto, Merilane da Silva; de Andrade, Izaquiel Santos; Cabral-de-Mello, Diogo Cavalcanti; Santos, Neide; Martins, Cesar; Loreto, Vilma; de Souza, Maria José


    Chromosomal organization and the evolution of genome architecture can be investigated by physical mapping of the genes for 45S and 5S ribosomal DNAs (rDNAs) and by the analysis of telomeric sequences. We studied 12 species of bats belonging to four subfamilies of the family Phyllostomidae in order to correlate patterns of distribution of heterochromatin and the multigene families for rDNA. The number of clusters for 45S gene ranged from one to three pairs, with exclusively location in autosomes, except for Carollia perspicillata that had in X chromosome. The 5S gene all the species studied had only one site located on an autosomal pair. In no species the 45S and 5S genes collocated. The fluorescence in situ hybridization (FISH) probe for telomeric sequences revealed fluorescence on all telomeres in all species, except in Carollia perspicillata. Non-telomeric sites in the pericentromeric region of the chromosomes were observed in most species, ranged from one to 12 pairs. Most interstitial telomeric sequences were coincident with heterochromatic regions. The results obtained in the present work indicate that different evolutionary mechanisms are acting in Phyllostomidae genome architecture, as well as the occurrence of Robertsonian fusion during the chromosomal evolution of bats without a loss of telomeric sequences. These data contribute to understanding the organization of multigene families and telomeric sequences on bat genome as well as the chromosomal evolutionary history of Phyllostomidae bats.

  6. How well do ITS rDNA sequences differentiate species of true morels (Morchella)?


    Du, Xi-Hui; Zhao, Qi; Yang, Zhu L; Hansen, Karen; Taskin, Hatira; Büyükalaca, Saadet; Dewsbury, Damon; Moncalvo, Jean-Marc; Douhan, Greg W; Robert, Vincent A R G; Crous, Pedro W; Rehner, Stephen A; Rooney, Alejandro P; Sink, Stacy; O'Donnell, Kerry


    Arguably more mycophiles hunt true morels (Morchella) during their brief fruiting season each spring in the northern hemisphere than any other wild edible fungus. Concerns about overharvesting by individual collectors and commercial enterprises make it essential that science-based management practices and conservation policies are developed to ensure the sustainability of commercial harvests and to protect and preserve morel species diversity. Therefore, the primary objectives of the present study were to: (i) investigate the utility of the ITS rDNA locus for identifying Morchella species, using phylogenetic species previously inferred from multilocus DNA sequence data as a reference; and (ii) clarify insufficiently identified sequences and determine whether the named sequences in GenBank were identified correctly. To this end, we generated 553 Morchella ITS rDNA sequences and downloaded 312 additional ones generated by other researchers from GenBank using emerencia and analyzed them phylogenetically. Three major findings emerged: (i) ITS rDNA sequences were useful in identifying 48/62 (77.4%) of the known phylospecies; however, they failed to identify 12 of the 22 species within the species-rich Elata Subclade and two closely related species in the Esculenta Clade; (ii) at least 66% of the named Morchella sequences in GenBank are misidentified; and (iii) ITS rDNA sequences of up to six putatively novel Morchella species were represented in GenBank. Recognizing the need for a dedicated Web-accessible reference database to facilitate the rapid identification of known and novel species, we constructed Morchella MLST (, which can be queried with ITS rDNA sequences and those of the four other genes used in our prior multilocus molecular systematic studies of this charismatic genus.

  7. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.


    Hori, H; Osawa, S; Iwabuchi, M


    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).

  8. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.


    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio


    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product.

  9. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.


    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio


    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. PMID:26789074

  10. Phylogenetic relationships within Cornus (Cornaceae) based on 26S rDNA sequences.


    Fan, C


    Phylogenetic relationships within the dogwood genus Cornus have been highly controversial due to the great morphological heterogeneity. Earlier phylogenetic analyses of Cornus using chloroplast DNA (cpDNA) data (including rbcL and matK sequences, as well as restriction sites) and morphological characters suggested incongruent relationships within the genus. The present study generated sequence data from the nuclear gene 26S rDNA for Cornus to test the phylogenetic hypotheses based on cpDNA and morphological data. The 26S rDNA sequence data obtained represent 16 species, 13 from Cornus and three from outgroups, having an aligned length of 3380 bp. Both parsimony and maximum likelihood analyses of these sequences were conducted. Trees resulting from these analyses suggest relationships among subgroups of Cornus consistent with those inferred from cpDNA data. That is, the dwarf dogwood (subg. Arctocrania) and the big-bracted dogwood (subg. Cynoxylon and subg. Syncarpea) clades are sisters, which are, in turn, sister to the cornelian cherries (subg. Cornus and subg. Afrocrania). This red-fruited clade is sister to the blue- or white-fruited dogwoods (subg. Mesomora, subg. Kraniopsis, and subg. Yinquania). Within the blue- or white-fruited clade, C. oblonga (subg. Yinquania) is sister to the remainder, and subg. Mesomora is sister to subg. Kraniopsis. These relationships were also suggested by the combined 26S rDNA and cpDNA data, but with higher bootstrap and Bremer support in the combined analysis. The 26S rDNA sequence data of Cornus consist of 12 expansion segments spanning 1034 bp. These expansion segments evolve approximately four times as fast as the conserved core regions. The study provides an example of phylogenetic utility of 26S rDNA sequences below the genus level. PMID:11410478

  11. Conservation patterns in angiosperm rDNA ITS2 sequences.

    PubMed Central

    Hershkovitz, M A; Zimmer, E A


    The two internal transcribed spacers (ITS1 and ITS2) of nuclear ribosomal DNA have become commonly exploited sources of informative variation for interspecific-/intergeneric-level phylogenetic analyses among angiosperms and other eukaryotes. We present an alignment in which one-third to one-half of the ITS2 sequence is alignable above the family level in angiosperms and a phenetic analysis showing that ITS2 contains information sufficient to diagnose lineages at several hierarchical levels. Base compositional analysis shows that angiosperm ITS2 is inherently GC-rich, and that the proportion of T is much more variable than that for other bases. We propose a general model of angiosperm ITS2 secondary structure that shows common pairing relationships for most of the conserved sequence tracts. Variations in our secondary structure predictions for sequences from different taxa indicate that compensatory mutation is not limited to paired positions. PMID:8760866

  12. Heterothallic species of neurospora are distinguishable by restriction analysis of their nuclear rDNA sequences

    SciTech Connect

    Chambers, C.; Dutta, S.K.


    Restriction analysis of rDNAs was used to distinguish nuclear rDNA's of three different reference strains of heterothallic species of the genus Neurospora: N. crassa 74A (FGSC number987), N. intermedia P420 (FGSC number2316), and N. sitophila 10B (FGSC number580). Two approaches were adopted: (1) Nuclear DNA's of these three Neurospora species were treated with various restriction enzymes. Against the streaks of nuclear DNAs on the 0.7% agarose gels background bands were visible. These background bands are visible because rDNA sequences of Neurospora species exist in multiple copies within the nuclear DNA's. (2) The second approach was comparison of auto-radiographs of hybrid molecules of Southern blot transfers of restricted nuclear DNAs and /sup 32/P-labelled nick translated rDNA's (referred to as rDNA probe) isolated from N. crassa slime mutant (FGSC number1118), rDNA cloned into pBR322. A summary of restricted fragment sizes as seen in the gels and in autoradiographs of Southern blots of the respective gels is presented.

  13. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.


    MacKay, R M; Gray, M W; Doolittle, W F


    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.

  14. [Structural organization of 5S ribosomal DNA of Rosa rugosa].


    Tynkevych, Iu O; Volkov, R A


    In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

  15. Evolutionary relationships among Magnetospirillum strains inferred from phylogenetic analysis of 16S rDNA sequences.

    PubMed Central

    Burgess, J G; Kawaguchi, R; Sakaguchi, T; Thornhill, R H; Matsunaga, T


    We have investigated the evolutionary relationships between two facultatively anaerobic Magnetospirillum strains (AMB-1 and MGT-1) and fastidious, obligately microaerophilic species, such as Magnetospirillum magnetotacticum, using a molecular phylogenetic approach. Genomic DNA from strains MGT-1 and AMB-1 was used as a template for amplification of the genes coding for 16S rRNA (16S rDNA) by the polymerase chain reaction. Amplified DNA fragments were sequenced (1,424 bp) and compared with sequences for M. magnetotacticum MS-1 and Magnetospirillum gryphiswaldense MSR-1. Phylogenetic analysis of the aligned 16S rDNA sequences indicated that the two new magnetic spirilla, AMB-1 and MGT-1, lie within the alpha subdivision (alpha-1) of the eubacterial group Proteobacteria and are closely related to Rhodospirillum fulvum and to several endosymbiotic bacteria. Strains AMB-1, MGT-1, and MS-1 formed a cluster, termed group I, in which they were more closely related to each other than to group II, which contained M. gryphiswaldense MSR-1. Group I strains were also physiologically distinct from strain MSR-1. Sequence alignment studies allowed elucidation of genus-specific regions of the 16S rDNA, and oligonucleotide primers complementary to two of these regions were used to develop a specific polymerase chain reaction assay for detection of magnetic spirilla in natural samples. Images PMID:7691800

  16. Primary structure of the 5 S subunit of transcarboxylase as deduced from the genomic DNA sequence.


    Thornton, C G; Kumar, G K; Shenoy, B C; Haase, F C; Phillips, N F; Park, V M; Magner, W J; Hejlik, D P; Wood, H G; Samols, D


    Transcarboxylase from Propionibacterium shermanii is a complex biotin-containing enzyme composed of 30 polypeptides of three different types. It is composed of six dimeric outer subunits associated with a central cylindrical hexameric subunit through 12 biotinyl subunits; three outer subunits on each face of the central hexamer. Each outer dimer is termed a 5 S subunit which associates with two biotinyl subunits. The enzyme catalyzes a two-step reaction in which methylmalonyl-CoA and pyruvate form propionyl-CoA and oxalacetate, the 5 S subunit specifically catalyzing one of these reactions. We report here the cloning, sequencing and expression of the monomer of the 5 S subunit. The gene was identified by matching amino acid sequences derived from isolated authentic 5 S peptides with the deduced sequence of an open reading frame present on a cloned P. shermanii genomic fragment known to contain the gene encoding the 1.3 S biotinyl subunit. The cloned 5 S gene encodes a protein of 519 amino acids, M(r) 57,793. The deduced sequence shows regions of extensive homology with that of pyruvate carboxylase and oxalacetate decarboxylase, two enzymes which catalyze the same or reverse reaction. A fragment was subcloned into pUC19 in an orientation such that the 5 S open reading frame could be expressed from the lac promoter of the vector. Crude extracts prepared from these cells contained an immunoreactive band on Western blots which co-migrated with authentic 5 S and were fully active in catalyzing the 5 S partial reaction. We conclude that we have cloned, sequenced and expressed the monomer of the 5 S subunit and that the expressed product is catalytically active. PMID:8365490

  17. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    NASA Technical Reports Server (NTRS)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.


    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  18. Common 5S rRNA variants are likely to be accepted in many sequence contexts

    NASA Technical Reports Server (NTRS)

    Zhang, Zhengdong; D'Souza, Lisa M.; Lee, Youn-Hyung; Fox, George E.


    Over evolutionary time RNA sequences which are successfully fixed in a population are selected from among those that satisfy the structural and chemical requirements imposed by the function of the RNA. These sequences together comprise the structure space of the RNA. In principle, a comprehensive understanding of RNA structure and function would make it possible to enumerate which specific RNA sequences belong to a particular structure space and which do not. We are using bacterial 5S rRNA as a model system to attempt to identify principles that can be used to predict which sequences do or do not belong to the 5S rRNA structure space. One promising idea is the very intuitive notion that frequently seen sequence changes in an aligned data set of naturally occurring 5S rRNAs would be widely accepted in many other 5S rRNA sequence contexts. To test this hypothesis, we first developed well-defined operational definitions for a Vibrio region of the 5S rRNA structure space and what is meant by a highly variable position. Fourteen sequence variants (10 point changes and 4 base-pair changes) were identified in this way, which, by the hypothesis, would be expected to incorporate successfully in any of the known sequences in the Vibrio region. All 14 of these changes were constructed and separately introduced into the Vibrio proteolyticus 5S rRNA sequence where they are not normally found. Each variant was evaluated for its ability to function as a valid 5S rRNA in an E. coli cellular context. It was found that 93% (13/14) of the variants tested are likely valid 5S rRNAs in this context. In addition, seven variants were constructed that, although present in the Vibrio region, did not meet the stringent criteria for a highly variable position. In this case, 86% (6/7) are likely valid. As a control we also examined seven variants that are seldom or never seen in the Vibrio region of 5S rRNA sequence space. In this case only two of seven were found to be potentially valid. The

  19. Next generation sequencing analysis reveals a relationship between rDNA unit diversity and locus number in Nicotiana diploids

    PubMed Central


    Background Tandemly arranged nuclear ribosomal DNA (rDNA), encoding 18S, 5.8S and 26S ribosomal RNA (rRNA), exhibit concerted evolution, a pattern thought to result from the homogenisation of rDNA arrays. However rDNA homogeneity at the single nucleotide polymorphism (SNP) level has not been detailed in organisms with more than a few hundred copies of the rDNA unit. Here we study rDNA complexity in species with arrays consisting of thousands of units. Methods We examined homogeneity of genic (18S) and non-coding internally transcribed spacer (ITS1) regions of rDNA using Roche 454 and/or Illumina platforms in four angiosperm species, Nicotiana sylvestris, N. tomentosiformis, N. otophora and N. kawakamii. We compared the data with Southern blot hybridisation revealing the structure of intergenic spacer (IGS) sequences and with the number and distribution of rDNA loci. Results and Conclusions In all four species the intragenomic homogeneity of the 18S gene was high; a single ribotype makes up over 90% of the genes. However greater variation was observed in the ITS1 region, particularly in species with two or more rDNA loci, where >55% of rDNA units were a single ribotype, with the second most abundant variant accounted for >18% of units. IGS heterogeneity was high in all species. The increased number of ribotypes in ITS1 compared with 18S sequences may reflect rounds of incomplete homogenisation with strong selection for functional genic regions and relaxed selection on ITS1 variants. The relationship between the number of ITS1 ribotypes and the number of rDNA loci leads us to propose that rDNA evolution and complexity is influenced by locus number and/or amplification of orphaned rDNA units at new chromosomal locations. PMID:23259460

  20. Phylogenetic Analysis of Geographically Diverse Radopholus similis via rDNA Sequence Reveals a Monomorphic Motif

    PubMed Central

    Kaplan, D. T.; Thomas, W. K.; Frisse, L. M.; Sarah, J. L.; Stanton, J. M.; Speijer, P. R.; Marin, D. H.; Opperman, C. H.


    The nucleic acid sequences of rDNA ITS1 and the rDNA D2/D3 expansion segment were compared for 57 burrowing nematode isolates collected from Australia, Cameroon, Central America, Cuba, Dominican Republic, Florida, Guadeloupe, Hawaii, Nigeria, Honduras, Indonesia, Ivory Coast, Puerto Rico, South Africa, and Uganda. Of the 57 isolates, 55 were morphologically similar to Radopholus similis and seven were citrus-parasitic. The nucleic acid sequences for PCR-amplified ITS1 and for the D2/D3 expansion segment of the 28S rDNA gene were each identical for all putative R. similis. Sequence divergence for both the ITS1 and the D2/D3 was concordant with morphological differences that distinguish R. similis from other burrowing nematode species. This result substantiates previous observations that the R. similis genome is highly conserved across geographic regions. Autapomorphies that would delimit phylogenetic lineages of non-citrus-parasitic R. similis from those that parasitize citrus were not observed. The data presented herein support the concept that R. similis is comprised of two pathotypes-one that parasitizes citrus and one that does not. PMID:19270959

  1. 5 S and 5.8 S ribosomal RNA sequences and protist phylogenetics.


    Walker, W F


    More than 100 5 S 5.8 S rRNA sequences from protists, including fungi, are known. Through a combination of quantitative treeing and special consideration of "signature' nucleotide combinations, the most significant phylogenetic implications of these data are emphasized. Also, limitations of the data for phylogenetic inferences are discussed and other significant data are brought to bear on the inferences obtained. 5 S sequences from red algae are seen as the most isolated among eukaryotics. A 5 S sequence lineage consisting of oomycetes, euglenoids, most protozoa, most slime molds and perhaps dinoflagellates and mesozoa is defined. Such a lineage is not evident from 5.8 S rRNA or cytochrome c sequence data. 5 S sequences from Ascomycota and Basidiomycota are consistent with the proposal that each is derived from a mycelial form with a haploid yeast phase and simple septal pores, probably most resembling present Taphrinales. 5 S sequences from Chytridiomycota and Zygomycota are not clearly distinct from each other and suggest that a major lineage radiation occurred in the early history of each. Qualitative biochemical data clearly supports a dichotomy between an Ascomycota-Basidiomycota lineage and a Zygomycota-Chytridiomycota lineage.

  2. Nucleotide sequences of 5S rRNAs from four jellyfishes.


    Hori, H; Ohama, T; Kumazaki, T; Osawa, S


    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica.

  3. Nucleotide sequences of 5S rRNAs from four jellyfishes.


    Hori, H; Ohama, T; Kumazaki, T; Osawa, S


    The nucleotide sequences of 5S rRNAs from four jellyfishes, Spirocodon saltatrix, Nemopsis dofleini, Aurelia aurita and Chrysaora quinquecirrha have been determined. The sequences are highly similar to each other. A fairly high similarity was also found between these jellyfishes and a sea anemone, Anthopleura japonica. PMID:6130512

  4. The nucleotide sequences of 5S rRNAs from three ciliated protozoa.

    PubMed Central

    Kumazaki, T; Hori, H; Osawa, S; Mita, T; Higashinakagawa, T


    The nucleotide sequences of 5S rRNAs from three ciliated protozoa, Paramecium tetraurelia, Tetrahymena thermophila and Blepharisma japonicum have been determined. All of them are 120 nucleotides long and the sequence of probable tRNA binding site of position 41-44 is GAAC which is characteristic of the plant 5S rRNAs. The sequence similarity percents are 87% (Paramecium/Tetrahymena), 86% (Paramecium/Blepharisma) and 79% (Tetrahymena/Blepharisma), suggesting a close relationship of these three ciliates. PMID:7122243

  5. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    NASA Technical Reports Server (NTRS)

    Luehrsen, K. R.; Fox, G. E.


    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  6. Analysis of the 5S RNA pool in Arabidopsis thaliana: RNAs are heterogeneous and only two of the genomic 5S loci produce mature 5S RNA.


    Cloix, Catherine; Tutois, Sylvie; Yukawa, Yasushi; Mathieu, Olivier; Cuvillier, Claudine; Espagnol, Marie-Claude; Picard, Georges; Tourmente, Sylvette


    One major 5S RNA, 120 bases long, was revealed by an analysis of mature 5S RNA from tissues, developmental stages, and polysomes in Arabidopsis thaliana. Minor 5S RNA were also found, varying from the major one by one or two base substitutions; 5S rDNA units from each 5S array of the Arabidopsis genome were isolated by PCR using CIC yeast artificial chromosomes (YACs) mapped on the different loci. By using a comparison of the 5S DNA and RNA sequences, we could show that both major and minor 5S transcripts come from only two of the genomic 5S loci: chromosome 4 and chromosome 5 major block. Other 5S loci are either not transcribed or produce rapidly degraded 5S transcripts. Analysis of the 5'- and 3'-DNA flanking sequence has permitted the definition of specific signatures for each 5S rDNA array.

  7. Molecular analysis of complete ssu to lsu rdna sequence in the harmful dinoflagellate alexandrium tamarense (korean isolate, HY970328M)

    NASA Astrophysics Data System (ADS)

    Ki, Jang-Seu; Han, Myung-Soo


    New PCR primers (N=18) were designed for the isolation of complete SSU to LSU rDNA sequences from the dinoflagellate Alexandrium tamarense. Standard PCR, employing each primer set selected for amplifications of less than 1.5 kb, successfully amplified the expected rDNA regions of A. tamarense (Korean isolate, HY970328M). Complete SSU, LSU rDNAs and ITS sequences, including 5.8S rDNA, were recorded at 1,800 bp, 520 bp and 3,393 bp, respectively. The LSU rDNA sequence was the first report in Alexandrium genus. No intron was found in the LSU rRNA coding region. Twelve D-domains within the LSU rDNA were put together into 1,879 bp (44.4% G+C), and cores into 1514 bp (42.8% G+C). The core sequence was significantly different (0.0867 of genetic distance, 91% sequence similarity) in comparison with Prorocentrum micans (GenBank access. no. X16108). The D2 region was the longest in length (300 bp) and highly variable among the 12 D-domains. In a phylogenetic analysis using complete LSU rDNA sequences of a variety of phytoplankton, A tamarense was clearly separated with high resolution against other species. The result suggests that the sequence may resolve the taxonomic ambiguities of Alexandrium genus, particularly of the tamarensis complex.

  8. Sequence variation of the rDNA ITS regions within and between anastomosis groups in Rhizoctonia solani.


    Kuninaga, S; Natsuaki, T; Takeuchi, T; Yokosawa, R


    Sequence analysis of the rDNA region containing the internal transcribed spacer (ITS) regions and the 5.8s rDNA coding sequence was used to evaluate the genetic diversity of 45 isolates within and between anastomosis groups (AGs) in Rhizoctonia solani. The 5.8s rDNA sequence was completely conserved across all the AGs examined, whereas the ITS rDNA sequence was found to be highly variable among isolates. The sequence homology in the ITS regions was above 96% for isolates of the same subgroup, 66-100% for isolates of different subgroups within an AG, and 55-96% for isolates of different AGs. In neighbor-joining trees based on distances derived from ITS-5.8s rDNA sequences, subgroups IA, IB and IC within AG-1 and subgroups HG-I and HG-II within AG-4 were placed on statistically significant branches as assessed by bootstrap analysis. These results suggest that sequence analysis of ITS rDNA regions of R. solani may be a valuable tool for identifying AG subgroups of biological significance.

  9. Diversity within the genus Elymus (Poaceae: Triticeae) as investigated by the analysis of the nr5S rDNA variation in species with St and H haplomes.


    Baum, B R; Edwards, T; Johnson, D A


    The genus Elymus ("Ryegrass") is a repository for a range of species with a variety of haplome contents; hence the pejorative name "dustbin" genus. We have analyzed 1,059 sequences from 128 accessions representing 24 species to investigate the relationships among the StH haplomes-containing species described by Yen and Yang (Genus Elymus Beijing 5:58-362, 2013). Sequences were assigned to "unit classes" of orthologous sequences and subjected to a suite of analyses including BLAST (Basic Local Alignment Search Tool) searches, phylogenetic analysis and population genetic analysis to estimate species diversity. Our results support the genome analyses in Yen and Yang (Genus Elymus Beijing 5:58-362, 2013), i.e., genomic constitution StStHH including variants restricted to Elymus. Population genetic analysis of the 5S nrDNA sequence data revealed that the within-species variance component is roughly ±89 %; thus, we were unable to identify molecular markers capable to separate the 24 species analyzed. Separate phylogenetic analyses of the two unit classes and of all the data exhibit a trend only of the species to cluster on the phylograms. Finally, the analysis provides evidence for the multiple origins of American and Eurasian species. PMID:25248636

  10. Phylogenetic relationships among higher Nemertean (Nemertea) Taxa inferred from 18S rDNA sequences.


    Sundberg, P; Turbeville, J M; Lindh, S


    We estimated the phylogenetic relationships of 15 nemertean (phylum Nemertea) species from the four subclasses Hoplo-, Hetero-, Palaeo-, and Bdellonemertea with 18S rDNA sequence data. Three outgroup taxa were used for rooting: Annelida, Platyhelminthes, and Mollusca. Parsimony and maximum-likelihood analyses supported the monophyletic status of the Heteronemertea and a taxon consisting of hoplonemerteans and Bdellonemertea, while indicating that Palaeonemertea is paraphyletic. The monophyletic status of the two nemertean classes Anopla and Enopla is not supported by the data. The unambiguous clades are well supported, as assessed by a randomization test (bootstrapping) and branch support values.

  11. Chromosomal localization of 18S rDNA and telomere sequence in the aye-aye, Daubentonia madagascariensis.


    Rakotoarisoa, G; Hirai, Y; Go, Y; Kawamoto, Y; Shima, T; Koyama, N; Randrianjafy, A; Mora, R; Hirai, H


    Chromosomal localization of 18S rDNA and telomere sequence was attempted on the chromosomes of the aye-aye (2n = 30) using fluorescence in situ hybridization (FISH) and primed in situ labeling (PRINS), respectively. The rDNA was localized at the tip or whole of the short arm of acrocentric chromosomes 13 and 14 in all spreads observed. However, post-FISH silver-nitrate (Ag) staining showed that transcriptional activity of the rRNA genes was variable, particularly in chromosome 14, which was most frequently negative in one homologue carrying the smaller copy number of rDNA. This observation supports, at the molecular cytogenetic level, previous data concerning the relationship between the copy number of rDNA and its trancriptional activity. On the other hand, telomere sequence was localized only at the telomeric region of all chromosomes, the so-called telomere-only pattern, a characteristic similar to that of the greater bushbaby. These data may provide information on the chromosomal evolution of the lemur, because locations of rDNA and telomere sequences frequently offer important clues in reconstruction of karyotype differentiation. PMID:11245223

  12. Molecular Analysis of Methanogen Richness in Landfill and Marshland Targeting 16S rDNA Sequences.


    Yadav, Shailendra; Kundu, Sharbadeb; Ghosh, Sankar K; Maitra, S S


    Methanogens, a key contributor in global carbon cycling, methane emission, and alternative energy production, generate methane gas via anaerobic digestion of organic matter. The methane emission potential depends upon methanogenic diversity and activity. Since they are anaerobes and difficult to isolate and culture, their diversity present in the landfill sites of Delhi and marshlands of Southern Assam, India, was analyzed using molecular techniques like 16S rDNA sequencing, DGGE, and qPCR. The sequencing results indicated the presence of methanogens belonging to the seventh order and also the order Methanomicrobiales in the Ghazipur and Bhalsawa landfill sites of Delhi. Sequences, related to the phyla Crenarchaeota (thermophilic) and Thaumarchaeota (mesophilic), were detected from marshland sites of Southern Assam, India. Jaccard analysis of DGGE gel using Gel2K showed three main clusters depending on the number and similarity of band patterns. The copy number analysis of hydrogenotrophic methanogens using qPCR indicates higher abundance in landfill sites of Delhi as compared to the marshlands of Southern Assam. The knowledge about "methanogenic archaea composition" and "abundance" in the contrasting ecosystems like "landfill" and "marshland" may reorient our understanding of the Archaea inhabitants. This study could shed light on the relationship between methane-dynamics and the global warming process. PMID:26568700

  13. Molecular Analysis of Methanogen Richness in Landfill and Marshland Targeting 16S rDNA Sequences.


    Yadav, Shailendra; Kundu, Sharbadeb; Ghosh, Sankar K; Maitra, S S


    Methanogens, a key contributor in global carbon cycling, methane emission, and alternative energy production, generate methane gas via anaerobic digestion of organic matter. The methane emission potential depends upon methanogenic diversity and activity. Since they are anaerobes and difficult to isolate and culture, their diversity present in the landfill sites of Delhi and marshlands of Southern Assam, India, was analyzed using molecular techniques like 16S rDNA sequencing, DGGE, and qPCR. The sequencing results indicated the presence of methanogens belonging to the seventh order and also the order Methanomicrobiales in the Ghazipur and Bhalsawa landfill sites of Delhi. Sequences, related to the phyla Crenarchaeota (thermophilic) and Thaumarchaeota (mesophilic), were detected from marshland sites of Southern Assam, India. Jaccard analysis of DGGE gel using Gel2K showed three main clusters depending on the number and similarity of band patterns. The copy number analysis of hydrogenotrophic methanogens using qPCR indicates higher abundance in landfill sites of Delhi as compared to the marshlands of Southern Assam. The knowledge about "methanogenic archaea composition" and "abundance" in the contrasting ecosystems like "landfill" and "marshland" may reorient our understanding of the Archaea inhabitants. This study could shed light on the relationship between methane-dynamics and the global warming process.

  14. Molecular Analysis of Methanogen Richness in Landfill and Marshland Targeting 16S rDNA Sequences

    PubMed Central

    Yadav, Shailendra; Kundu, Sharbadeb; Ghosh, Sankar K.; Maitra, S. S.


    Methanogens, a key contributor in global carbon cycling, methane emission, and alternative energy production, generate methane gas via anaerobic digestion of organic matter. The methane emission potential depends upon methanogenic diversity and activity. Since they are anaerobes and difficult to isolate and culture, their diversity present in the landfill sites of Delhi and marshlands of Southern Assam, India, was analyzed using molecular techniques like 16S rDNA sequencing, DGGE, and qPCR. The sequencing results indicated the presence of methanogens belonging to the seventh order and also the order Methanomicrobiales in the Ghazipur and Bhalsawa landfill sites of Delhi. Sequences, related to the phyla Crenarchaeota (thermophilic) and Thaumarchaeota (mesophilic), were detected from marshland sites of Southern Assam, India. Jaccard analysis of DGGE gel using Gel2K showed three main clusters depending on the number and similarity of band patterns. The copy number analysis of hydrogenotrophic methanogens using qPCR indicates higher abundance in landfill sites of Delhi as compared to the marshlands of Southern Assam. The knowledge about “methanogenic archaea composition” and “abundance” in the contrasting ecosystems like “landfill” and “marshland” may reorient our understanding of the Archaea inhabitants. This study could shed light on the relationship between methane-dynamics and the global warming process. PMID:26568700

  15. Taxonomy of 5 S ribosomal RNA by the linguistic technique: probing with mitochondrial and mammalian sequences.


    Guimarães, R C; Trifonov, E N; Lagunez-Otero, J


    Linguistic similarities and dissimilarities between 5 S rRNA sequences allowed taxonomical separation of species and classes. Comparisons with the molecule from mammals distinguished fungi and plants from protists and animals. Similarities to mammalians progressively increased from protists to invertebrates and to somatic-type molecules of the vertebrates lineage. In this, deviations were detected in avian, oocyte type, and pseudogene sequences. Among bacteria, actinobacteria were most similar to the mammalians, which could be related to the high frequency of associations among members of these groups. Some archaebacterial species most similar to the mammalians belonged to the Thermoproteales and Halobacteria groups. Comparisons with the soybean mitochondrial molecule revealed high internal homogeneity among plant mitochondria. The eubacterial groups most similar to it were Thermus and Rhodobacteria gamma-1 and alpha-2. Other procedures have already indicated similarities of Rhodobacteria alpha to mitochondria but the linguistic similarities were on the average higher with the first two groups.

  16. Cytogenetic comparison between two allopatric populations of Astyanax altiparanae Garutti et Britski, 2000 (Teleostei, Characidae), with emphasis on the localization of 18S and 5S rDNA

    PubMed Central

    Pacheco, Rosiley Berton; da Rosa, Renata; Giuliano-Caetano, Lucia; Júlio Jr., Horácio Ferreira; Dias, Ana Lúcia


    Abstract Two populations of Astyanax altiparanae (Garutti & Britski, 2000) of the Água dos Patos stream/SP and lake Igapó/PR were analyzed. All individuals showed 2n = 50, however, different karyotypic formulae were observed. The population of the Água dos Patos stream showed 8m +24sm+6st+12a (NF=88) and the population of lake Igapó, 8m+28sm+4st+10a (NF=90). Nucleolus organizing regions (AgNORs) were observed in the terminal position on the short and long arm of different chromosomes of both populations, showing a variation from 3 to 4 chromosomes. Fluorescent in situ hybridization (FISH) using 18S rDNA probes revealed only one pair of chromosomes with fluorescent signals in the terminal site on the short arm in the Igapó lake population, while the population of Água dos Patos stream showed 4 fluorescence terminal signals, characterizing a system of simple and multiple NORs, respectively. 5S rDNA fluorescent signals were detected in the interstitial position of a pair of chromosomes in the two studied populations. Some AgNOR sites revealed to be GC-rich when stained with Chromomycin A3 (CMA3), however, AT positive regions were not observed. The data obtained show that, despite the conservation of the diploid number and location of 5S DNAr, differences in both the distribution of 18S rDNA and karyotypic formula among the populations were found, thus corroborating the existing data on chromosome variability in Astyanax altiparanae that can be significant for cytotaxonomy in this group. PMID:24260632

  17. Cytogenetic comparison between two allopatric populations of Astyanax altiparanae Garutti et Britski, 2000 (Teleostei, Characidae), with emphasis on the localization of 18S and 5S rDNA.


    Pacheco, Rosiley Berton; da Rosa, Renata; Giuliano-Caetano, Lucia; Júlio, Horácio Ferreira; Dias, Ana Lúcia


    Two populations of Astyanax altiparanae (Garutti & Britski, 2000) of the Água dos Patos stream/SP and lake Igapó/PR were analyzed. All individuals showed 2n = 50, however, different karyotypic formulae were observed. The population of the Água dos Patos stream showed 8m +24sm+6st+12a (NF=88) and the population of lake Igapó, 8m+28sm+4st+10a (NF=90). Nucleolus organizing regions (AgNORs) were observed in the terminal position on the short and long arm of different chromosomes of both populations, showing a variation from 3 to 4 chromosomes. Fluorescent in situ hybridization (FISH) using 18S rDNA probes revealed only one pair of chromosomes with fluorescent signals in the terminal site on the short arm in the Igapó lake population, while the population of Água dos Patos stream showed 4 fluorescence terminal signals, characterizing a system of simple and multiple NORs, respectively. 5S rDNA fluorescent signals were detected in the interstitial position of a pair of chromosomes in the two studied populations. Some AgNOR sites revealed to be GC-rich when stained with Chromomycin A3 (CMA3), however, AT positive regions were not observed. The data obtained show that, despite the conservation of the diploid number and location of 5S DNAr, differences in both the distribution of 18S rDNA and karyotypic formula among the populations were found, thus corroborating the existing data on chromosome variability in Astyanax altiparanae that can be significant for cytotaxonomy in this group.

  18. Phylogenetic analysis of Leymus (Poaceae: Triticeae) inferred from nuclear rDNA ITS sequences.


    Sha, Li-Na; Yang, Rui-Wu; Fan, Xing; Wang, Xiao-Li; Zhou, Yong-Hong


    To investigate the phylogenetic relationships of polyploid Leymus (Poaceae: Triticeae), sequences of the nuclear rDNA internal transcribed spacer region (ITS) were analyzed for 34 Leymus accessions representing 25 species, together with three Psathyrostachys species (Ns genome), two Pseudoroegneria (St genome) species, Lophopyrum elongatum (E(e) genome), and Thinopyrum bessarabicum (E(b) genome). The phylogenetic analyses (maximum likelihood and Bayesian inference) supported two major clades, one including 21 Leymus species and three Psathyrostachys species, the other with nine Leymus species and four diploid species. The ITS RNA secondary structure of the Leymus species was compared with that of their putative diploid donor. It is suggested that (1) the species from the same areas or neighboring geographic regions are closely related to each other; (2) L. coreanus, L. duthiei, L. duthiei var. longearistatus, and L. komarovii are closely related to other Leymus species, and it is reasonable to transfer these species from the genus Hystrix to Leymus; (3) the ITS sequences of Leymus are evolutionarily distinct; (4) the different Leymus species and different distribution of a species derived their Ns genome from different Psathyrostachys species; and (5) there is a close relationship among Leymus, Pseudoroegneria, Lophopyrum, and Thinopyrum, but it is difficult to presume that the St, E(e), and E(b) genome may be the Xm genome donor of the Leymus species.

  19. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    NASA Technical Reports Server (NTRS)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.


    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  20. Eukaryotic origins: string analysis of 5S ribosomal RNA sequences from some relevant organisms.


    Nanney, D L; Mobley, D O; Preparata, R M; Meyer, E B; Simon, E M


    Using the PHYLOGEN tree-forming programs, we evaluate the published 5S rRNA sequences in certain of the files in the Berlin DataBank in an attempt to identify the connection between archaebacteria and the eukaryotic protists. These programs are based on methods of string analysis developed by Sankoff and others. Their discriminatory power is derived from their continuous realignment of sequences through repeated assessment of insertions and deletions as well as substitutions. The programs demonstrate that even these small molecules (ca. 120 bases) retain substantial records of evolutionary events that occurred over a billion years ago. The eukaryotes seem to have been derived from ancestors near the common origins of the halobacterial and Methanococcales groups. Identifying what might have been a primordial eukaryote is more difficult because several of the species considered as early derivatives from the common root are isolated species with large genetic differences from each other and from all other extant forms that have been sequenced. The ameboid, flagellated, and ciliated protists seem to have emerged nearly simultaneously from an ancient cluster, but the sarcodinid protozoa have preference as the group of most ancient origin. The euglenozoa and the ciliates are of later derivation. Our ability to tease plausible trees from such small molecules suggests that the mode of analysis rather than the size of the molecule is often a major limitation in the reconstruction of acceptable ancient phylogenics.(ABSTRACT TRUNCATED AT 250 WORDS)

  1. Characterization of viable bacteria from Siberian permafrost by 16S rDNA sequencing

    NASA Technical Reports Server (NTRS)

    Shi, T.; Reeves, R. H.; Gilichinsky, D. A.; Friedmann, E. I.


    Viable bacteria were found in permafrost core samples from the Kolyma-Indigirka lowland of northeast Siberia. The samples were obtained at different depths; the deepest was about 3 million years old. The average temperature of the permafrost is -10 degrees C. Twenty-nine bacterial isolates were characterized by 16S rDNA sequencing and phylogenetic analysis, cell morphology, Gram staining, endospore formation, and growth at 30 degrees C. The majority of the bacterial isolates were rod shaped and grew well at 30 degrees C; but two of them did not grow at or above 28 degrees C, and had optimum growth temperatures around 20 degrees C. Thirty percent of the isolates could form endospores. Phylogenetic analysis revealed that the isolates fell into four categories: high-GC Gram-positive bacteria, beta-proteobacteria, gamma-proteobacteria, and low-GC Gram-positive bacteria. Most high-GC Gram-positive bacteria and beta-proteobacteria, and all gamma-proteobacteria, came from samples with an estimated age of 1.8-3.0 million years (Olyor suite). Most low-GC Gram-positive bacteria came from samples with an estimated age of 5,000-8,000 years (Alas suite).

  2. [Organization of 5S ribosomal DNA of Melitaea trivia].


    Cherevatov, O V; Volkov, R A


    Two length variants of 5S rDNA repeated units were detected in the genome of East European butterfly Melitaea trivia. Both repeat variants contain the 5S rRNA coding region of the same length of 120 bp, but possess the intergenic spacer region (IGS) of different size, 78 and 125 bp, respectively. The level of sequence similarity between the two 5S rDNA variants amounts to 43.9-45.5% in the IGS, whereas the coding region appears to be more conservative. In the IGS, microsatellite sequence motives were found; amplification of these motives could be involved in the evolution of the 5S rDNA.

  3. Systematic analysis and evolution of 5S ribosomal DNA in metazoans.


    Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M


    Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

  4. rDNA ITS sequences among morphotypes of Keratell cochlearis, Keratell quadrata and Brachionus forficula (Rotifera).


    Ge, Y L; Xi, Y L; Ma, J; Xu, D D


    Morphological variation in rotifers is affected by environmental conditions, making it hard to identify some rotifer taxa. We examined the rDNA ITS sequences of 10 unspined (KCU1-KCU10) and 17 spined (KCS1-KCS17) Keratell cochlearis clones, 26 two-spined (KQT1-KQT26), 18 single-spined (KQS1-KQS18) and 9 unspined (KQU1-KQU9) K. quadrata clones, and 17 long-spined (BL1-BL17) and 11 short-spined (BS1-BS11) Brachionus forficula clones collected from Lake Tingtang in Wuhu city, China. Molecular phylogenetic trees were constructed by neighbor-joining, maximum-likelihood, maximum parsimony, and Bayesian inference methods using B. calyciflorus as an outgroup. The K. cochlearis clones included 20 haplotypes, the K. quadrata clones included 37 haplotypes, and the B. forficula clones included 25 haplotypes. Different morphotypes of each rotifer species had shared haplotypes. Sequence divergences were 0.1-8.9% among different K. cochlearis haplotypes, and 8.1-8.9% between KCHAP1 (KCU1 and KCU10), KCU3, KCU4 and KCU6, and the other haplotypes. Sequence divergences were 0.1-14.5% among different K. quadrata haplotypes, and 11.9-14.5% between KQS17 and the other haplotypes. Sequence divergences were 0.1-11.7% among different B. forficula haplotypes, 11.0-11.7% between BL15 and the other haplotypes, 9.3-10.1% between BS3 and the other haplotypes, and 11.7% between BL15 and BS3. The four phylogenetic trees all supported that KCHAP1, KCU3, KCU4, KCU6 and the other 16 haplotypes among the 20 K. cochlearis haplotypes, KQS17 and the other 36 haplotypes among the 37 K. quadrata haplotypes, and BL15, BS3 and the other 23 haplotypes among the 25 B. forficula haplotypes all belonged to their own isolated clades. The morphological variation of the three rotifer species was attributed mainly to phenotypic plasticity.

  5. 18S rDNA Sequences from Microeukaryotes Reveal Oil Indicators in Mangrove Sediment

    PubMed Central

    Santos, Henrique F.; Cury, Juliano C.; Carmo, Flavia L.; Rosado, Alexandre S.; Peixoto, Raquel S.


    Background Microeukaryotes are an effective indicator of the presence of environmental contaminants. However, the characterisation of these organisms by conventional tools is often inefficient, and recent molecular studies have revealed a great diversity of microeukaryotes. The full extent of this diversity is unknown, and therefore, the distribution, ecological role and responses to anthropogenic effects of microeukaryotes are rather obscure. The majority of oil from oceanic oil spills (e.g., the May 2010 accident in the Gulf of Mexico) converges on coastal ecosystems such as mangroves, which are threatened with worldwide disappearance, highlighting the need for efficient tools to indicate the presence of oil in these environments. However, no studies have used molecular methods to assess the effects of oil contamination in mangrove sediment on microeukaryotes as a group. Methodology/Principal Findings We evaluated the population dynamics and the prevailing 18S rDNA phylotypes of microeukaryotes in mangrove sediment microcosms with and without oil contamination, using PCR/DGGE and clone libraries. We found that microeukaryotes are useful for monitoring oil contamination in mangroves. Our clone library analysis revealed a decrease in both diversity and species richness after contamination. The phylogenetic group that showed the greatest sensitivity to oil was the Nematoda. After contamination, a large increase in the abundance of the groups Bacillariophyta (diatoms) and Biosoecida was detected. The oil-contaminated samples were almost entirely dominated by organisms related to Bacillariophyta sp. and Cafeteria minima, which indicates that these groups are possible targets for biomonitoring oil in mangroves. The DGGE fingerprints also indicated shifts in microeukaryote profiles; specific band sequencing indicated the appearance of Bacillariophyta sp. only in contaminated samples and Nematoda only in non-contaminated sediment. Conclusions/Significance We believe that

  6. Evolution of green plants as deduced from 5S rRNA sequences.


    Hori, H; Lim, B L; Osawa, S


    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other.

  7. Evolution of green plants as deduced from 5S rRNA sequences

    PubMed Central

    Hori, Hiroshi; Lim, Byung-Lak; Osawa, Syozo


    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  8. Evolution of green plants as deduced from 5S rRNA sequences.


    Hori, H; Lim, B L; Osawa, S


    We have constructed a phylogenic tree for green plants by comparing 5S rRNA sequences. The tree suggests that the emergence of most of the uni- and multicellular green algae such as Chlamydomonas, Spirogyra, Ulva, and Chlorella occurred in the early stage of green plant evolution. The branching point of Nitella is a little earlier than that of land plants and much later than that of the above green algae, supporting the view that Nitella-like green algae may be the direct precursor to land plants. The Bryophyta and the Pteridophyta separated from each other after emergence of the Spermatophyta. The result is consistent with the view that the Bryophyta evolved from ferns by degeneration. In the Pteridophyta, Psilotum (whisk fern) separated first, and a little later Lycopodium (club moss) separated from the ancestor common to Equisetum (horsetail) and Dryopteris (fern). This order is in accordance with the classical view. During the Spermatophyta evolution, the gymnosperms (Cycas, Ginkgo, and Metasequoia have been studied here) and the angiosperms (flowering plants) separated, and this was followed by the separation of Metasequoia and Cycas (cycad)/Ginkgo (maidenhair tree) on one branch and various flowering plants on the other. PMID:16593540

  9. Secondray structure and sequence of ITS2-rDNA of the Egyptian malaria vector Anopheles pharoensis (Theobald).


    Wassim, Nahla M


    Out of the twelve Anophelines present in Egypt, only five species known to be malaria vectors. Anopheles (An.) pharoensis proved to be the important vector all over Egypt, especially in the Delta. Anopheles sergenti proved to be the primary vector in the Oases of the Western Desert, An. multicolor in Faiyoum, An. stephensi in the Red Sea Coast, and An. superpictus in Sinai. Genomic DNA was isolated from single adult mosquito of An. pharoensis (Sahel Sudanese form), PCR was performed to amplify ITS2 region of rDNA using specific primers for 5.8S and 28S rDNA genes. The amplicons were purified, directly sequenced and aligned to the sequence of the same region of An. gambiae, using clustalw2. The length of ITS2-rDNA of An. pharoensis was 411bp. The GC content of the ITS2 reported 53% is consistent with spacer base composition in Anopheles species. The similarity between the two species was 52% and genetic distance was 0.46.Variable simple sequence repeats (SSRs) are found at low frequency. The secondary structure of rDNA-ITS2was predicted by MFOLD and was -192; 60 to-195.32 kilocalories/mole.

  10. Secondray structure and sequence of ITS2-rDNA of the Egyptian malaria vector Anopheles pharoensis (Theobald).


    Wassim, Nahla M


    Out of the twelve Anophelines present in Egypt, only five species known to be malaria vectors. Anopheles (An.) pharoensis proved to be the important vector all over Egypt, especially in the Delta. Anopheles sergenti proved to be the primary vector in the Oases of the Western Desert, An. multicolor in Faiyoum, An. stephensi in the Red Sea Coast, and An. superpictus in Sinai. Genomic DNA was isolated from single adult mosquito of An. pharoensis (Sahel Sudanese form), PCR was performed to amplify ITS2 region of rDNA using specific primers for 5.8S and 28S rDNA genes. The amplicons were purified, directly sequenced and aligned to the sequence of the same region of An. gambiae, using clustalw2. The length of ITS2-rDNA of An. pharoensis was 411bp. The GC content of the ITS2 reported 53% is consistent with spacer base composition in Anopheles species. The similarity between the two species was 52% and genetic distance was 0.46.Variable simple sequence repeats (SSRs) are found at low frequency. The secondary structure of rDNA-ITS2was predicted by MFOLD and was -192; 60 to-195.32 kilocalories/mole. PMID:24961025

  11. Characterization and Sequence Variation in the rDNA Region of Six Nematode Species of the Genus Longidorus (Nematoda)

    PubMed Central

    De Luca, F.; Reyes, A.; Grunder, J.; Kunz, P.; Agostinelli, A.; De Giorgi, C.; Lamberti, F.


    Total DNA was isolated from individual nematodes of the species Longidorus helveticus, L. macrosoma, L. arthensis, L. profundorum, L. elongatus, and L. raskii collected in Switzerland. The ITS region and D1-D2 expansion segments of the 26S rDNA were amplified and cloned. The sequences obtained were aligned in order to investigate sequence diversity and to infer the phylogenetic relationships among the six Longidorus species. D1-D2 sequences were more conserved than the ITS sequences that varied widely in primary structure and length, and no consensus was observed. Phylogenetic analyses using the neighbor-joining, maximum parsimony and maximum likelihood methods were performed with three different sequence data sets: ITS1-ITS2, 5.8S-D1-D2, and combining ITS1-ITS2+5.8S-D1-D2 sequences. All multiple alignments yielded similar basic trees supporting the existence of the six species established using morphological characters. These sequence data also provided evidence that the different regions of the rDNA are characterized by different evolution rates and by different factors associated with the generation of extreme size variation. PMID:19262800

  12. Authentication of Curcuma species (Zingiberaceae) based on nuclear 18S rDNA and plastid trnK sequences.


    Cao, Hui; Sasaki, Yohei; Fushimi, Hirotoshi; Komatsu, Katsuko


    Curcuma drugs have been used discriminatingly for invigorating blood circulation, promoting digestion, and as a cholagogic in China. However, there is confusion about the drug's botanical origins and clinical uses because of morphological similarity of Curcuma plants and drugs. Comparative sequencing of the 18S rRNA gene in nuclear ribosomal DNA (rDNA) and trnK gene in chloroplast DNA (cpDNA) was carried out in order to examine interspecies phylogeny and to identify ultimately Curcuma species. A total of a hundred of accessions of eighteen species were analyzed. This resulted in an aligned matrix of 1810 bp for 18S rDNA and 2 800 bp for trnK. 18S rDNA sequence divergence within the ingroup ranged from 0-0.05%, trnK ranged from 0-0.19%. One base transversion-substituted site (from cytosine to thymine) was observed from the upstream of 18S rDNA at nucleotide position 234 in C. kwangsiensis and Japanese population of C. zedoaria which have separated genetic distance to other Curcuma taxa. Two noncoding regions embedded in trnK intron showed higher variability, including nucleotide substitutions, repeat insertion and deletions. Based on consensus of relationship, eighteen major lineages within Curcuma are recognized at the species level. The results suggest that Curcuma is monophyletic with 100% bootstrap support and sister to the genera Hedychium and Zingiber. The trnK sequences showed considerable variations between Curcuma species and thus were revealed as a promising candidate for barcoding of Curcuma species, which provide valuable characters for inferring relationship within species but are insufficient to resolve relationships among closely related taxa.

  13. Phylogenetic origins of the plant mitochondrion based on a comparative analysis of 5S ribosomal RNA sequences

    NASA Technical Reports Server (NTRS)

    Villanueva, E.; Delihas, N.; Luehrsen, K. R.; Fox, G. E.; Gibson, J.


    The complete nucleotide sequences of 5S ribosomal RNAs from Rhodocyclus gelatinosa, Rhodobacter sphaeroides, and Pseudomonas cepacia were determined. Comparisons of these 5S RNA sequences show that rather than being phylogenetically related to one another, the two photosynthetic bacterial 5S RNAs share more sequence and signature homology with the RNAs of two nonphotosynthetic strains. Rhodobacter sphaeroides is specifically related to Paracoccus denitrificans and Rc. gelatinosa is related to Ps. cepacia. These results support earlier 16S ribosomal RNA studies and add two important groups to the 5S RNA data base. Unique 5S RNA structural features previously found in P. denitrificans are present also in the 5S RNA of Rb. sphaeroides; these provide the basis for subdivisional signatures. The immediate consequence of obtaining these new sequences is that it is possible to clarify the phylogenetic origins of the plant mitochondrion. In particular, a close phylogenetic relationship is found between the plant mitochondria and members of the alpha subdivision of the purple photosynthetic bacteria, namely, Rb. sphaeroides, P. denitrificans, and Rhodospirillum rubrum.

  14. Assessing diversity of the female urine microbiota by high throughput sequencing of 16S rDNA amplicons

    PubMed Central


    Background Urine within the urinary tract is commonly regarded as "sterile" in cultivation terms. Here, we present a comprehensive in-depth study of bacterial 16S rDNA sequences associated with urine from healthy females by means of culture-independent high-throughput sequencing techniques. Results Sequencing of the V1V2 and V6 regions of the 16S ribosomal RNA gene using the 454 GS FLX system was performed to characterize the possible bacterial composition in 8 culture-negative (<100,000 CFU/ml) healthy female urine specimens. Sequences were compared to 16S rRNA databases and showed significant diversity, with the predominant genera detected being Lactobacillus, Prevotella and Gardnerella. The bacterial profiles in the female urine samples studied were complex; considerable variation between individuals was observed and a common microbial signature was not evident. Notably, a significant amount of sequences belonging to bacteria with a known pathogenic potential was observed. The number of operational taxonomic units (OTUs) for individual samples varied substantially and was in the range of 20 - 500. Conclusions Normal female urine displays a noticeable and variable bacterial 16S rDNA sequence richness, which includes fastidious and anaerobic bacteria previously shown to be associated with female urogenital pathology. PMID:22047020

  15. Two sequence classes of kinetoplastid 5S ribosomal RNA gene revealed among bodonid spliced leader RNA gene arrays.


    Santana, D M; Lukes, J; Sturm, N R; Campbell, D A


    The spliced leader RNA genes of Bodo saltans, Cryptobia helicis and Dimastigella trypaniformis were analyzed as molecular markers for additional taxa within the suborder Bodonina. The non-transcribed spacer regions were distinctive for each organism, and 5S rRNA genes were present in Bodo and Dimastigella but not in C. helicis. Two sequence classes of 5S rRNA were evident from analysis of the bodonid genes. The two classes of 5S rRNA genes were found in other Kinetoplastids independent of co-localization with the spliced leader RNA gene.

  16. Transcription of the Drosophila melanogaster 5S RNA gene requires an upstream promoter and four intragenic sequence elements

    SciTech Connect

    Sharp, S.J.; Garcia, A.D.


    Linker-scanning (LS) mutations were constructed spanning the length of the Drosophila melanogaster 5S RNA gene. In vitro transcription analysis of the LS 5S DNAs revealed five transcription control regions. One control region essential for the transcription initiation was identified in the 5'-flanking sequence. The major sequence determinants of this upstream promoter region were located between coordinates -39 and -26 (-30 region), but important sequences extended to the transcription start site at position 1. Since mutations in the upstream promoter did not alter the ability of 5S DNA to sequester transcription factors into a stable transcription complex, it appears that this control region involved the interaction of RNA polymerase III. Active 5S DNA transcription additionally required the four intragenic control regions (ICRs) located between coordinates 3 and 18 (ICR I), 37 and 44 (ICR II), 48 and 61 (ICR III), and 78 and 98 (ICR IV). LS mutations in each ICR decreased the ability of 5S DNA to sequester transcription factors. ICR III, ICR IV, and the spacer sequence between were similar in sequence and position to the determinant elements of the multipartite ICR of Xenopus 5S DNA. The importance of ICR III and ICR IV in transcription initiation and in sequestering transcription factors suggests the presence of an activity in D. melanogaster similar to transcription factor TFIIIA of Xenopus laevis and HeLa cells. Transcription initiation of Drosophila 5S DNA was not eliminated by LS mutations in the spacer region even though these mutations reduced the ability of the TFIIIA-like activity to bind.

  17. Sequence analysis of the rDNA internal transcribed spacer 2 of five species of South American human malaria mosquitoes.


    Fritz, G N


    The rDNA internal transcribed spacer 2 (ITS2) was sequenced for 5 species of mosquitoes that may be important vectors of human malaria in certain regions of South America and are difficult to distinguish by morphology: Anopheles evansae, An. nuneztovari, An. rangeli, An. strodei and An. trinkae. ITS2 sequences from samples collected in Ecuador, Bolivia, Venezuela and Brazil were aligned and compared in order to determine the usefulness of this spacer for the elaboration of species specific primers and DNA probes. The ITS2 was found to be different in size (ranging from 333 to 397 bp) and sequence between all pairs of species. Highly variable regions were found primarily at the 3' end of the spacer and were interspersed with relatively conserved sites. Instraspecific sequence variation was limited to a single transversion between specimens of An. rangeli from distant geographic locations suggesting concerted evolution and homogenization of the ITS2. PMID:10520449

  18. Employment of 16 S rDNA gene sequencing techniques to identify culturable environmental eubacteria in a tertiary referral hospital.


    Xu, J; Smyth, C L; Buchanan, J A; Dolan, A; Rooney, P J; Millar, B C; Goldsmith, C E; Elborn, J S; Moore, J E


    Universal or 'broad-range' eubacterial polymerase chain reaction (PCR) was performed on 53 isolates from environmental water-associated sites in a haematology unit (N = 22) and the outer surfaces of cleaning lotion containers sited throughout a tertiary referral hospital (N = 31) 16 S rDNA PCR was performed using two sets of universal primers, including the novel reverse primer, XB4, to generate a composite amplicon of 1068 bp, which was sequenced to obtain each isolate's identity. Sequence analysis was able to identify 51 isolates. Most (75% from the haematology unit and 81% from cleaner containers) were Gram-positive. Nine different genera were identified from the haematology unit and 13 from the cleaning lotion containers. This study provides the first reports of Terrabacter spp. and Brachybacterium paraconglomeratum isolated from a hospital environment. As unusual and difficult-to-identify environmental organisms are unlikely to be clinically significant, and molecular identification is costly and labour-intensive, we recommend that molecular methods are only used as an adjunct to first-line phenotypic identification schemes where a definitive identification is required. Where molecular identification methods are justified, partial 16 S rDNA PCR and sequencing employing the novel universal primer XB4, is a valuable and reliable technique.

  19. Phylogeny and rates of molecular evolution of planktonic foraminifera: SSU rDNA sequences compared to the fossil record.


    de Vargas, C; Zaninetti, L; Hilbrecht, H; Pawlowski, J


    Planktonic foraminifera are marine protists, whose calcareous shells form oceanic sediments and are widely used for stratigraphic and paleoenvironmental analyses. The fossil record of planktonic foraminifera is compared here to their molecular phylogeny inferred from ribosomal DNA sequences. Eighteen partial SSU rDNA sequences from species representing all modern planktonic families (Globigerinidae, Hastigerinidae, Globorotaliidae, Candeinidae) were obtained and compared to seven sequences representing the major groups of benthic foraminifera. The phylogenetic analyses indicate a polyphyletic origin for the planktonic foraminifera. The Candeinidae, the Globorotaliidae, and the clade Globigerinidae + Hastigerinidae seem to have originated independently, at different epochs in the evolution of foraminifera. Inference of their relationships, however, is limited by substitution rates of heterogeneity. Rates of SSU rDNA evolution vary from 4.0 x 10(-9) substitutions/site/year in the Globigerinidae to less than 1.0 x 10(-9) substitutions/site/year in the Globorotaliidae. These variations may be related to different levels of adaptation to the planktonic mode of life. A clock-like evolution is observed among the Globigerinidae, for which molecular and paleontological data are congruent. Phylogeny of the Globorotaliidae is clearly biased by rapid rates of substitution in two species (G. truncatulinoides and G. menardii). Our study reveals differences in absolute rates of evolution at all taxonomic levels in planktonic foraminifera and demonstrates their effect on phylogenetic reconstructions.

  20. Molecular characterization of dichloromethane-degrading Hyphomicrobium strains using 16S rDNA and DCM dehalogenase gene sequences.


    Nikolausz, Marcell; Kappelmeyer, Uwe; Nijenhuis, Ivonne; Ziller, Katja; Kästner, Matthias


    A phylogenetic analysis of 6 strains of dichloromethane (DCM) utilizing bacteria was performed. Based on the almost complete 16S rDNA sequence determination, all strains clustered together and showed high sequence similarity to Hyphomicrobium denitrificans, except for the strain MC8b, which is only moderately related to them and probably represents a distinct species. The 16S rDNA-based phylogenetic tree was compared to the one obtained from the DNA sequence data of the dcmA gene coding DCM dehalogenase, the key enzyme of DCM utilization. The topology of the two trees is in good agreement and may suggest an ancient origin of DCM dehalogenase, but also raises questions about the original role of the enzyme. PMID:16156115

  1. Cytological characterization of sunflower by in situ hybridization using homologous rDNA sequences and a BAC clone containing highly represented repetitive retrotransposon-like sequences.


    Talia, P; Greizerstein, E; Quijano, C Díaz; Peluffo, L; Fernández, L; Fernández, P; Hopp, H E; Paniego, N; Heinz, R A; Poggio, L


    In the present work we report new tools for the characterization of the complete chromosome complement of sunflower (Helianthus annuus L.), using a bacterial artificial chromosome (BAC) clone containing repetitive sequences with similarity to retrotransposons and a homologous rDNA sequence isolated from the sunflower genome as probes for FISH. The rDNA signal was found in 3 pairs of chromosomes, coinciding with the location of satellites. The BAC clone containing highly represented retroelements hybridized with all the chromosome complement in FISH, and used together with the rDNA probe allowed the discrimination of all chromosome pairs of sunflower. Their distinctive distribution pattern suggests that these probes could be useful for karyotype characterization and for chromosome identification. The karyotype could be subdivided into 3 clear-cut groups of 12 metacentric pairs, 1 submetacentric pair, and 4 subtelocentric pairs, thus resolving previously described karyotype controversies. The use of BAC clones containing single sequences of specific markers and (or) genes associated with important agricultural traits represents an important tool for future locus-specific identification and physical mapping.

  2. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.

    PubMed Central

    Ohama, T; Kumazaki, T; Hori, H; Osawa, S


    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  3. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.


    Ohama, T; Kumazaki, T; Hori, H; Osawa, S


    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period.

  4. Evolution of multicellular animals as deduced from 5S rRNA sequences: a possible early emergence of the Mesozoa.


    Ohama, T; Kumazaki, T; Hori, H; Osawa, S


    The nucleotide sequences of 5S rRNA from a mesozoan Dicyema misakiense and three metazoan species, i.e., an acorn-worm Saccoglossus kowalevskii, a moss-animal Bugula neritina, and an octopus Octopus vulgaris have been determined. A phylogenic tree of multicellular animals has been constructed from 73 5S rRNA sequences available at present including those from the above four sequences. The tree suggests that the mesozoan is the most ancient multicellular animal identified so far, its emergence time being almost the same as that of flagellated or ciliated protozoans. The branching points of planarians and nematodes are a little later than that of the mesozoan but are clearly earlier than other metazoan groups including sponges and jellyfishes. Many metazoan groups seem to have diverged within a relatively short period. PMID:6539911

  5. Characterisation of the microbial diversity in a pig manure storage pit using small subunit rDNA sequence analysis.


    Snell-Castro, Raúl; Godon, Jean-Jacques; Delgenès, Jean-Philippe; Dabert, Patrick


    The microbial community structure of pig manure slurry (PMS) was determined with comparative analysis of 202 bacterial, 44 archaeal and 33 eukaryotic small subunit (SSU) rDNA partial sequences. Based on a criterion of 97% of sequence similarity, the phylogenetic analyses revealed a total of 108, eight and five phylotypes for the Bacteria, Archaea and Eukarya lineages, respectively. Only 36% of the bacterial phylotypes were closely related (>or=97% similarity) to any previously known sequence in databases. The bacterial groups most often represented in terms of phylotype and clone abundance were the Eubacterium (22% of total sequences), the Clostridium (15% of sequences), the Bacillus-Lactobacillus-Streptococcus subdivision (20% of sequences), theMycoplasma and relatives (10% of sequences) and the Flexibacter-Cytophaga-Bacteroides (20% of sequences). The global microbial community structure and phylotype diversity show a close relationship to the pig gastrointestinal tract ecosystem whereas phylotypes from the Acholeplasma-Anaeroplasma and the Clostridium purinolyticum groups appear to be better represented in manure. Archaeal diversity was dominated by three phylotypes clustering with a group of uncultured microorganisms of unknown activity and only distantly related to the Thermoplasmales and relatives. Other Archaea were methanogenic H2/CO2 utilisers. No known acetoclastic Archaea methanogen was found. Eukaryotic diversity was represented by a pluricellular nematode, two Alveolata, a Blastocystis and an Entamoebidae. Manure slurry physico-chemical characteristics were analysed. Possible inhibitory effects of acetate, sulphide and ammonia concentrations on the microbial anaerobic ecosystem are discussed. PMID:16329909

  6. Phylogenetic Relationships Among Xiphinema and Xiphidorus Nematode Species from Brazil Inferred from 18S rDNA Sequences.


    Oliveira, Claudio M G; Hübschen, Judith; Brown, Derek J F; Ferraz, Luiz C C B; Wright, Frank; Neilson, Roy


    Maximum likelihood trees produced from 18S rDNA sequences separated 14 Xiphinema and five Xiphidorus nematode species from Brazil into distinct groups that concurred with their current morphological taxonomic status. Species belonging to the X. americanum group (X. brevicolle, X. diffusum, X. oxycaudatum, and X. peruvianum) formed a single group that was clearly separated from the other Xiphinema species. As with previous taxonomic studies that noted only minor morphological differences between putative X. americanum group species, separation of these species based upon 18S rDNA sequences was inconclusive. Thus it is probable that instead of comprising distinct species, the X. americanum group may in fact represent numerous morphotypes with large inter- and intra- population morphological variability that may be environmentally driven. Within the cluster representing non X. americanum group species, there was little statistical support to clearly separate species. However, three subgroups, comprising (i) the X. setariae/vulgare complex, (ii) X. ifacolum and X. paritaliae, and (iii) X. brasiliense and X. ensiculiferum were well resolved.

  7. Phylogenetic Relationships Among Xiphinema and Xiphidorus Nematode Species from Brazil Inferred from 18S rDNA Sequences

    PubMed Central

    Oliveira, Claudio M. G.; Hübschen, Judith; Brown, Derek J. F.; Ferraz, Luiz C. C. B.; Wright, Frank; Neilson, Roy


    Maximum likelihood trees produced from 18S rDNA sequences separated 14 Xiphinema and five Xiphidorus nematode species from Brazil into distinct groups that concurred with their current morphological taxonomic status. Species belonging to the X. americanum group (X. brevicolle, X. diffusum, X. oxycaudatum, and X. peruvianum) formed a single group that was clearly separated from the other Xiphinema species. As with previous taxonomic studies that noted only minor morphological differences between putative X. americanum group species, separation of these species based upon 18S rDNA sequences was inconclusive. Thus it is probable that instead of comprising distinct species, the X. americanum group may in fact represent numerous morphotypes with large inter- and intra- population morphological variability that may be environmentally driven. Within the cluster representing non X. americanum group species, there was little statistical support to clearly separate species. However, three subgroups, comprising (i) the X. setariae/vulgare complex, (ii) X. ifacolum and X. paritaliae, and (iii) X. brasiliense and X. ensiculiferum were well resolved. PMID:19262801

  8. Molecular organization of 5S rDNAs in Rajidae (Chondrichthyes): Structural features and evolution of piscine 5S rRNA genes and nontranscribed intergenic spacers.


    Pasolini, Paola; Costagliola, Domenico; Rocco, Lucia; Tinti, Fausto


    The genomic and gene organisation of 5S rDNA clusters have been extensively characterized in bony fish and eukaryotes, providing general issues for understanding the molecular evolution of this multigene DNA family. By contrast, the 5S rDNA features have been rarely investigated in cartilaginous fish (only three species). Here, we provide evidence for a dual 5S rDNA gene system in the Rajidae by sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (NTS) in five Mediterranean species of rays (Rajidae), and in a large number of piscine taxa including lampreys and bony fish. As documented in several bony fish, two functional 5S rDNA types were found here also in the rajid genome: a short one (I) and a long one (II), distinguished by distinct 5S and NTS sequences. That the ancestral piscine genome had these two 5S rDNA loci might be argued from the occurrence of homologous dual gene systems that exist in several fish taxa and from 5S phylogenetic relationships. An extensive analysis of NTS-II sequences of Rajidae and Dasyatidae revealed the occurrence of large simple sequence repeat (SSR) regions that are formed by microsatellite arrays. The localization and organization of SSR within the NTS-II are conserved in Rajiformes since the Upper Cretaceous. The direct correlation between the SSRs extension and the NTS length indicated that they might play a role in the maintenance of the larger 5S rDNA clusters in rays. The phylogenetic analysis indicated that NTS-II is a valuable systematic tool limited to distantly related taxa of Rajiformes. PMID:16612546

  9. Molecular Taxonomy of Ganoderma cupreum from Southern India Inferred from ITS rDNA Sequences Analysis

    PubMed Central


    Ganoderma is a cosmopolitan wood-rot basidiomycete that has been extensively studied for its pathogencity and medicinal properties. Identification of Ganoderma based on macro-microscopic features led to large number of synonyms which resulted in 250 taxonomic names. A Ganoderma species collected from Courtallam, Tamil Nadu was identified as G. cupreum. Phylogenetic analysis inferred from internal transcribed spacer rDNA region resolved the Indian isolate MYC1 as Ganoderma cupreum which clustered with Australian and Asian "cupreum" clade with 85% bootstrap support BS and shared 99% and 98% nucleotide similarity with Malaysian and Australian 'cupreum' respectively. This study represents the first molecular evidence of G. cupreum from Asian origin. PMID:24493948

  10. Phylogeny of Populus (Salicaceae) based on nucleotide sequences of chloroplast TRNT-TRNF region and nuclear rDNA.


    Hamzeh, Mona; Dayanandan, Selvadurai


    The species of the genus Populus, collectively known as poplars, are widely distributed over the northern hemisphere and well known for their ecological, economical, and evolutionary importance. The extensive interspecific hybridization and high morphological diversity in this group pose difficulties in identifying taxonomic units for comparative evolutionary studies and systematics. To understand the evolutionary relationships among poplars and to provide a framework for biosystematic classification, we reconstructed a phylogeny of the genus Populus based on nucleotide sequences of three noncoding regions of the chloroplast DNA (intron of trnL and intergenic regions of trnT-trnL and trnL-trnF) and ITS1 and ITS2 of the nuclear rDNA. The resulting phylogenetic trees showed polyphyletic relationships among species in the sections Tacamahaca and Aigeiros. Based on chloroplast DNA sequence data, P. nigra had a close affinity to species of section Populus, whereas nuclear DNA sequence data suggested a close relationship between P. nigra and species of the section Aigeiros, suggesting a possible hybrid origin for P. nigra. Similarly, the chloroplast DNA sequences of P. tristis and P. szechuanica were similar to that of the species of section Aigeiros, while the nuclear sequences revealed a close affinity to species of the section Tacamahaca, suggesting a hybrid origin for these two Asiatic balsam poplars. The incongruence between phylogenetic trees based on nuclear- and chloroplast-DNA sequence data suggests a reticulate evolution in the genus Populus.

  11. Distribution and 16S rDNA sequences of Argas monachus (Acari: Argasidae), a soft tick parasite of Myiopsitta monachus (Aves: Psittacidae).


    Mastropaolo, Mariano; Turienzo, Paola; Di Iorio, Osvaldo; Nava, Santiago; Venzal, José M; Guglielmone, Alberto A; Mangold, Atilio J


    Specimens of Argas monachus Keirans et al. were collected from Myiopsitta monachus nests in 42 localities in Argentina and Paraguay from 2006 to 2010. A list of localities where this tick has been found is presented. 16S rDNA sequences of specimens of A. monachus from different localities were compared to confirm whether they belong to the same specific taxon. Argas monachus is present in the phytogeographic provinces of Chaco, Espinal, and Monte, but not in the Pampa (all from de Chaco Domain) where the host is well distributed. No differences were found among 16S rDNA sequences of geographically distant specimens.

  12. Description of the male, redescription of the female and 16S rDNA sequence of Ixodes aulacodi (Ixodidae).


    Chiţimia-Dobler, Lidia; D'Amico, Gianluca; Yao, Patrick Kouassi; Kalmár, Zsuzsa; Gherman, Călin Mircea; Mihalca, Andrei Daniel; Estrada-Peña, Agustin


    Ixodes (Afrixodes) aulacodiArthur, 1956 is a poorly known species that has been recorded predominantly in the wet countries of western and central Africa, mainly associated to the greater cane rat Thryonomys swinderianus (Temmink). We herein redescribe the female, describe the male (ascribed to the species from specimens found in copula) and provide the 16S rDNA sequence. We also provide complete illustrations of the adults based on specimens found on greater cane rats in Ivory Coast. Ixodes aulacodi is included in the group of species of the subgenus Afrixodes that have horseshoe shaped anal groove, and which lack auriculae and cornua. The female is easily separated when compared with other species because of a unique combination of characters: All the coxae have internal spurs, coxa II has two external spurs, syncoxae are absent, and trochanters I-III have one spur each. The male has a notched hypostome and lacks syncoxae, auriculae and cornua. PMID:26803353

  13. Surface water-borne multidrug and heavy metal-resistant Staphylococcus isolates characterized by 16S rDNA sequencing.


    Yilmaz, Fadime; Orman, Nazlı; Serim, Gamze; Kochan, Ceren; Ergene, Aysun; Icgen, Bulent


    Four Staphylococcus isolates having both multidrug- and multimetal-resistant ability were isolated from surface water. Further identification of the isolates was obtained through biochemical tests and 16S rDNA gene sequencing. One methicillin-resistant and two methicillin-sensitive isolates were determined as Staphylococcus aureus. The other isolate was identified as Staphylococcus warneri. The antibiotic and heavy metal resistance profiles of the Staphylococcus isolates were determined by using 26 antibiotics and 17 heavy metals. S. aureus isolates displayed resistance to most of the β-lactam antibiotics tested. All Staphylococcus isolates were resistant to heavy metals including silver, lithium, and barium. Due to a possible health risk of these pathogenic bacteria, a need exists for an accurate assessment of their acquired resistance to multiple drugs and metals.

  14. Phylogenetic analyses of four species of Ulva and Monostroma grevillei using ITS, rbc L and 18S rDNA sequence data

    NASA Astrophysics Data System (ADS)

    Lin, Zhongheng; Shen, Songdong; Chen, Weizhou; Li, Huihui


    Chlorophyta species are common in the southern and northern coastal areas of China. In recent years, frequent green tide incidents in Chinese coastal waters have raised concerns and attracted the attention of scientists. In this paper, we sequenced the 18S rDNA genes, the internal transcribed spacer (ITS) regions and the rbc L genes in seven organisms and obtained 536-566 bp long ITS sequences, 1 377-1 407 bp long rbc L sequences and 1 718-1 761 bp long partial 18S rDNA sequences. The GC base pair content was highest in the ITS regions and lowest in the rbc L genes. The sequencing results showed that the three Ulva prolifera (or U. pertusa) gene sequences from Qingdao and Nan'ao Island were identical. The ITS, 18S rDNA and rbc L genes in U. prolifera and U. pertusa from different sea areas in China were unchanged by geographic distance. U. flexuosa had the least evolutionary distance from U. californica in both the ITS regions (0.009) and the 18S rDNA (0.002). These data verified that Ulva and Enteromorpha are not separate genera.

  15. Molecular authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii by ITS and 5S rRNA spacer sequencing.


    Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui


    In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii. PMID:17202681

  16. Quantitative analysis of dinoflagellates and diatoms community via Miseq sequencing of actin gene and v9 region of 18S rDNA

    PubMed Central

    Guo, Liliang; Sui, Zhenghong; Liu, Yuan


    Miseq sequencing and data analysis for the actin gene and v9 region of 18S rDNA of 7 simulated samples consisting of different mixture of dinoflagellates and diatoms were carried out. Not all the species were detectable in all the 18S v9 samples, and sequence percent in all the v9 samples were not consistent with the corresponding cell percent which may suggest that 18S rDNA copy number in different cells of these species differed greatly which result in the large deviation of the amplification. And 18S rDNA amplification of the microalgae was prone to be contaminated by fungus. The amplification of actin gene all was from the dinoflagellates because of its targeted degenerate primers. All the actin sequences of dinoflagellates were detected in the act samples except act4, and sequence percentage of the dinoflagellates in the act samples was not completely consistent with the dinoflagellates percentage of cell samples, but with certain amplification deviations. Indexes of alpha diversity of actin gene sequencing may be better reflection of community structure, and beta diversity analysis could cluster the dinoflagellates samples with identical or similar composition together and was distinguishable with blooming simulating samples at the generic level. Hence, actin gene was more proper than rDNA as the molecular marker for the community analysis of the dinoflagellates. PMID:27721499

  17. Then and now: use of 16S rDNA gene sequencing for bacterial identification and discovery of novel bacteria in clinical microbiology laboratories.


    Woo, P C Y; Lau, S K P; Teng, J L L; Tse, H; Yuen, K-Y


    In the last decade, as a result of the widespread use of PCR and DNA sequencing, 16S rDNA sequencing has played a pivotal role in the accurate identification of bacterial isolates and the discovery of novel bacteria in clinical microbiology laboratories. For bacterial identification, 16S rDNA sequencing is particularly important in the case of bacteria with unusual phenotypic profiles, rare bacteria, slow-growing bacteria, uncultivable bacteria and culture-negative infections. Not only has it provided insights into aetiologies of infectious disease, but it also helps clinicians in choosing antibiotics and in determining the duration of treatment and infection control procedures. With the use of 16S rDNA sequencing, 215 novel bacterial species, 29 of which belong to novel genera, have been discovered from human specimens in the past 7 years of the 21st century (2001-2007). One hundred of the 215 novel species, 15 belonging to novel genera, have been found in four or more subjects. The largest number of novel species discovered were of the genera Mycobacterium (n = 12) and Nocardia (n = 6). The oral cavity/dental-related specimens (n = 19) and the gastrointestinal tract (n = 26) were the most important sites for discovery and/or reservoirs of novel species. Among the 100 novel species, Streptococcus sinensis, Laribacter hongkongensis, Clostridium hathewayi and Borrelia spielmanii have been most thoroughly characterized, with the reservoirs and routes of transmission documented, and S. sinensis, L. hongkongensis and C. hathewayi have been found globally. One of the greatest hurdles in putting 16S rDNA sequencing into routine use in clinical microbiology laboratories is automation of the technology. The only step that can be automated at the moment is input of the 16S rDNA sequence of the bacterial isolate for identification into one of the software packages that will generate the result of the identity of the isolate on the basis of its sequence database. However

  18. Identification of cephalopod species from the North and Baltic Seas using morphology, COI and 18S rDNA sequences

    NASA Astrophysics Data System (ADS)

    Gebhardt, Katharina; Knebelsberger, Thomas


    We morphologically analyzed 79 cephalopod specimens from the North and Baltic Seas belonging to 13 separate species. Another 29 specimens showed morphological features of either Alloteuthis mediaor Alloteuthis subulata or were found to be in between. Reliable identification features to distinguish between A. media and A. subulata are currently not available. The analysis of the DNA barcoding region of the COI gene revealed intraspecific distances (uncorrected p) ranging from 0 to 2.13 % (average 0.1 %) and interspecific distances between 3.31 and 22 % (average 15.52 %). All species formed monophyletic clusters in a neighbor-joining analysis and were supported by bootstrap values of ≥99 %. All COI haplotypes belonging to the 29 Alloteuthis specimens were grouped in one cluster. Neither COI nor 18S rDNA sequences helped to distinguish between the different Alloteuthis morphotypes. For species identification purposes, we recommend the use of COI, as it showed higher bootstrap support of species clusters and less amplification and sequencing failure compared to 18S. Our data strongly support the assumption that the genus Alloteuthis is only represented by a single species, at least in the North Sea. It remained unclear whether this species is A. subulata or A. media. All COI sequences including important metadata were uploaded to the Barcode of Life Data Systems and can be used as reference library for the molecular identification of more than 50 % of the cephalopod fauna known from the North and Baltic Seas.

  19. Morphology and 18S rDNA gene sequence of Blepharisma sinuosum Sawaya, 1940 (Ciliophora: Heterotrichea) from Brazil.


    Fernandes, Noemi Mendes; Dias, Roberto Júnio Pedroso; Senra, Marcus Vinicius Xavier; Soares, Carlos Augusto Gomes; da Silva Neto, Inácio Domingos


    The morphology and morphometric data of seven populations of Blepharisma sinuosum from southeastern Brazil were investigated. The description is based on live observations, protargol impregnation, and scanning electron microscopy. Blepharisma sinuosum measures 75-255μm in length and 25-93μm in width and has a spindle-shaped body, pink color, a single contractile vacuole located at the posterior end, 50 adoral membranelles, a conspicuous paroral, 17-35 somatic kineties, a moniliform macronucleus with 2-7 connected nodules, and 3-20 micronuclei. Morphological comparisons with similar species were performed and suggest that B. americanum is the junior synonym of B. sinuosum. The 18S rDNA gene sequence of B. sinuosum was obtained and compared with that of other Blepharisma species. The length and GC content of the obtained sequence is 1652bp and 47.03%, respectively, and has a very high structural similarity (99.9%) with the B. undulans sequence. The validity of the classification of Blepharisma species in morphonuclear subgenera is also discussed.

  20. Molecular phylogenetics at the Felsenstein zone: approaching the Strepsiptera problem using 5.8S and 28S rDNA sequences.


    Hwang, U W; Kim, W; Tautz, D; Friedrich, M


    Recent efforts to reconstruct the phylogenetic position of the insect order Strepsiptera have elicited a major controversy in molecular phylogenetics. We sequenced the 5.8S rDNA and major parts of the 28S rDNA 5' region of the strepsipteran species Stylops melittae. Their evolutionary dynamics were analyzed together with previously published insect rDNA sequences to identify tree estimation bias risks and to explore additional sources of phylogenetic information. Several major secondary structure changes were found as being autapomorphic for the Diptera, the Strepsiptera, or the Archaeognatha. Besides elevated substitution rates a significant AT bias was present in dipteran and strepsipteran 28S rDNA which, however, was restricted to stem sites in the Diptera while also affecting single-stranded sites in the Strepsiptera. When dipteran taxa were excluded from tree estimation all methods consistently supported the placement of Strepsiptera to within the Holometabola. When dipteran taxa were included maximum likelihood continued to favor a sister-group relationship of Strepsiptera with Mecoptera while remaining methods strongly supported a sister-group relationship with Diptera. Parametric bootstrap analysis revealed maximum likelihood as a consistent estimator if rate heterogeneity across sites was taken into account. Though the position of Strepsiptera within Holometabola remains elusive, we conclude that the evolution of dipteran and strepsipteran rDNA involved similar yet independent changes of substitution parameters. PMID:9667995

  1. Polymorphism of Paramecium pentaurelia (Ciliophora, Oligohymenophorea) strains revealed by rDNA and mtDNA sequences.


    Przyboś, Ewa; Tarcz, Sebastian; Greczek-Stachura, Magdalena; Surmacz, Marta


    Paramecium pentaurelia is one of 15 known sibling species of the Paramecium aurelia complex. It is recognized as a species showing no intra-specific differentiation on the basis of molecular fingerprint analyses, whereas the majority of other species are polymorphic. This study aimed at assessing genetic polymorphism within P. pentaurelia including new strains recently found in Poland (originating from two water bodies, different years, seasons, and clones of one strain) as well as strains collected from distant habitats (USA, Europe, Asia), and strains representing other species of the complex. We compared two DNA fragments: partial sequences (349 bp) of the LSU rDNA and partial sequences (618 bp) of cytochrome B gene. A correlation between the geographical origin of the strains and the genetic characteristics of their genotypes was not observed. Different genotypes were found in Kraków in two types of water bodies (Opatkowice-natural pond; Jordan's Park-artificial pond). Haplotype diversity within a single water body was not recorded. Likewise, seasonal haplotype differences between the strains within the artificial water body, as well as differences between clones originating from one strain, were not detected. The clustering of some strains belonging to different species was observed in the phylogenies.

  2. Molecular characterization and phylogeny of whipworm nematodes inferred from DNA sequences of cox1 mtDNA and 18S rDNA.


    Callejón, Rocío; Nadler, Steven; De Rojas, Manuel; Zurita, Antonio; Petrášová, Jana; Cutillas, Cristina


    A molecular phylogenetic hypothesis is presented for the genus Trichuris based on sequence data from the mitochondrial cytochrome c oxidase 1 (cox1) and ribosomal 18S genes. The taxa consisted of different described species and several host-associated isolates (undescribed taxa) of Trichuris collected from hosts from Spain. Sequence data from mitochondrial cox1 (partial gene) and nuclear 18S near-complete gene were analyzed by maximum likelihood and Bayesian inference methods, as separate and combined datasets, to evaluate phylogenetic relationships among taxa. Phylogenetic results based on 18S ribosomal DNA (rDNA) were robust for relationships among species; cox1 sequences delimited species and revealed phylogeographic variation, but most relationships among Trichuris species were poorly resolved by mitochondrial sequences. The phylogenetic hypotheses for both genes strongly supported monophyly of Trichuris, and distinct genetic lineages corresponding to described species or nematodes associated with certain hosts were recognized based on cox1 sequences. Phylogenetic reconstructions based on concatenated sequences of the two loci, cox1 (mitochondrial DNA (mtDNA)) and 18S rDNA, were congruent with the overall topology inferred from 18S and previously published results based on internal transcribed spacer sequences. Our results demonstrate that the 18S rDNA and cox1 mtDNA genes provide resolution at different levels, but together resolve relationships among geographic populations and species in the genus Trichuris.

  3. Photobiont diversity in lichens from metal-rich substrata based on ITS rDNA sequences.


    Backor, Martin; Peksa, Ondrej; Skaloud, Pavel; Backorová, Miriam


    The photobiont is considered as the more sensitive partner of lichen symbiosis in metal pollution. For this reason the presence of a metal tolerant photobiont in lichens may be a key factor of ecological success of lichens growing on metal polluted substrata. The photobiont inventory was examined for terricolous lichen community growing in Cu mine-spoil heaps derived by historical mining. Sequences of internal transcribed spacer (ITS) were phylogenetically analyzed using maximum likelihood analyses. A total of 50 ITS algal sequences were obtained from 22 selected lichen taxa collected at three Cu mine-spoil heaps and two control localities. Algae associated with Cladonia and Stereocaulon were identified as members of several Asterochloris lineages, photobionts of cetrarioid lichens clustered with Trebouxia hypogymniae ined. We did not find close relationship between heavy metal content (in localities as well as lichen thalli) and photobiont diversity. Presence of multiple algal genotypes in single lichen thallus has been confirmed. PMID:20031214

  4. The phylogeny of the genus Yersinia based on 16S rDNA sequences.


    Ibrahim, A; Goebel, B M; Liesack, W; Griffiths, M; Stackebrandt, E


    The inter- and intrageneric relationships of the genus Yersinia were investigated by sequence analysis of the 16S rRNA gene. A stretch of approximately 1450 nucleotides was sequenced from representatives of ten of the eleven validly described species. Phylogenetic analysis revealed that yersinae form a coherent cluster within the gamma subgroup of Proteobacteria. The intrageneric relationship was characterized by five sublines with Y. enterocolitica, Y. rohdei, and Y. ruckeri forming separate sublines each represented by a single species. A separate subline was formed by Y. pestis, Y pseudotuberculosis and Y. kristensenii, while Y. mollaretii, Y. intermedia, Y. bercovieri, Y. aldovae, and Y. kristensenii formed a fifth subline. The phylogenetic distinctness of the yersiniae sublines is compared to published phenotypic properties and results of DNA-DNA similarity studies.

  5. The spatial and temporal distribution of microalgae in the South China Sea: evidence from GIS-based analysis of 18S rDNA sequences.


    Li, LüYan; Huang, QiaoJuan; Wu, ShuHui; Lin, Duan; Chen, JiaHui; Chen, YueQin


    The purpose of this study was to estimate the spatial and temporal variation of microalgae in the South China Sea and to demonstrate the environmental factors controlling the diversity of microalgae by GIS (geographic information system)-based analysis of 18S rDNA sequences. Six 18S rDNA libraries were constructed from environmental samples collected at different sites in the study area, and more than 600 18S rDNA sequences were determined. The rDNA sequence data were then analyzed by DIVA-GIS software to display the spatial and temporal variation of phytoplankton's composition. It was shown that the autotrophic eukaryotic plankton dominated over the heterotrophic cells in most of our clone libraries, and the dominating phytoplankton was Dinophyceae except for Bacillariophyta at the Xiamen harbor. The percentages of these two groups were controlled by water temperature and salinity. Our results also revealed that the species composition of Chlorophyta showed a close relationship with latitude, changing from Prasinophyceae at the high latitude to Trebouxiophyceae at the low latitude. Several newly classified picoplankton lineages were first uncovered in the South China Sea, including the pico-sized green alga Ostreococcus sp. and Picochlorum eukaryotum, and picobiliphytes, which was just discovered in 2007 with unknown affinities to other eukaryotes. Their spatial and temporal variation were also analyzed and discussed.

  6. The phylogenetic position of the pelobiont Mastigamoeba balamuthi based on sequences of rDNA and translation elongation factors EF-1alpha and EF-2.


    Arisue, Nobuko; Hashimot, Tetsuo; Lee, Jennifer A; Moore, Dorothy V; Gordon, Paul; Sensen, Christoph W; Gaasterland, Terry; Hasegawa, Masami; Müller, Miklós


    The taxonomic position and phylogenetic relationships of the Pelobionta, an amitochondriate amoeboflagellate group, are not yet completely settled. To provide more information, we obtained sequences for the large subunit rDNA gene, the gene for translation elongation factor 1alpha, and for a large part of the gene encoding translation elongation factor 2 from a representative of this group, Mastigamoeba balamuthi (formerly Phreatamoeba balamuthi). The gene for the large subunit rDNA was unusually large compared to those of other protists, a phenomenon that had previously been observed for the gene encoding the small subunit rDNA. Phylogenetic reconstruction using a maximum likelihood method was performed with these sequences, as well as the gene encoding the small subunit rDNA. When evaluated individually, the M. balamuthi genes for the small and large subunit rDNAs and elongation factor 1alpha had a most recent common ancestor with either the Mycetozoa (slime molds) or with Entamoeba histolytica. A clade formed by M. balamuthi, E. histolytica, and Mycetozoa was not rejected statistically for any of the sequences. A combined maximum likelihood analysis using 3,935 positions from all molecules suggested that these three taxonomic units form a robust clade. We were unable to resolve the closest group to this clade using the combined analysis. These findings support the notion, which had previously been proposed primarily on cytological evidence, that both M. balamuthi and E. histolytica are closely related to the Mycetozoa and that these three together represent a major eukaryotic lineage.

  7. The nucleotide sequences of 5S rRNAs from a sea-cucumber, a starfish and a sea-urchin.

    PubMed Central

    Ohama, T; Hori, H; Osawa, S


    The nucleotide sequences of 5S rRNA from three echinoderms, a sea-cucumber Stichopus oshimae, a starfish Asterina pectinifera and a sea-urchin Hemicentrotus pulcherrimus have been determined. These 5S rRNAs are all 120 nucleotides long. The echinoderm sequences are more related to the sequences of proterostomes animals such as mollusc, annelids and some others (87% identity on average) than to those of vertebrates (82% identity on average). PMID:6878041

  8. Oceanic 18S rDNA sequences from picoplankton reveal unsuspected eukaryotic diversity.


    Moon-van der Staay, S Y; De Wachter, R; Vaulot, D


    Picoplankton--cells with a diameter of less than 3 microm--are the dominant contributors to both primary production and biomass in open oceanic regions. However, compared with the prokaryotes, the eukaryotic component of picoplankton is still poorly known. Recent discoveries of new eukaryotic algal taxa based on picoplankton cultures suggest the existence of many undiscovered taxa. Conventional approaches based on phenotypic criteria have limitations in depicting picoplankton composition due to their tiny size and lack of distinctive taxonomic characters. Here we analyse, using an approach that has been very successful for prokaryotes but has so far seldom been applied to eukaryotes, 35 full sequences of the small-subunit (18S) ribosomal RNA gene derived from a picoplanktonic assemblage collected at a depth of 75 m in the equatorial Pacific Ocean, and show that there is a high diversity of picoeukaryotes. Most of the sequences were previously unknown but could still be assigned to important marine phyla including prasinophytes, haptophytes, dinoflagellates, stramenopiles, choanoflagellates and acantharians. We also found a novel lineage, closely related to dinoflagellates and not previously described.

  9. Oceanic 18S rDNA sequences from picoplankton reveal unsuspected eukaryotic diversity

    NASA Astrophysics Data System (ADS)

    Moon-van der Staay, Seung Yeo; De WachterRDanielVaulot, RupertDe WachterR.Daniel


    Picoplankton-cells with a diameter of less than 3µm-are the dominant contributors to both primary production and biomass in open oceanic regions. However, compared with the prokaryotes, the eukaryotic component of picoplankton is still poorly known. Recent discoveries of new eukaryotic algal taxa based on picoplankton cultures suggest the existence of many undiscovered taxa. Conventional approaches based on phenotypic criteria have limitations in depicting picoplankton composition due to their tiny size and lack of distinctive taxonomic characters. Here we analyse, using an approach that has been very successful for prokaryotes but has so far seldom been applied to eukaryotes, 35 full sequences of the small-subunit (18S) ribosomal RNA gene derived from a picoplanktonic assemblage collected at a depth of 75m in the equatorial Pacific Ocean, and show that there is a high diversity of picoeukaryotes. Most of the sequences were previously unknown but could still be assigned to important marine phyla including prasinophytes, haptophytes, dinoflagellates, stramenopiles, choanoflagellates and acantharians. We also found a novel lineage, closely related to dinoflagellates and not previously described.

  10. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    PubMed Central

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich


    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  11. Phylogeny of hard- and soft-tick taxa (Acari: Ixodida) based on mitochondrial 16S rDNA sequences.

    PubMed Central

    Black, W C; Piesman, J


    Ticks are parasitiform mites that are obligate hematophagous ectoparasites of amphibians, reptiles, birds, and mammals. A phylogeny for tick families, subfamilies, and genera has been described based on morphological characters, life histories, and host associations. To test the existing phylogeny, we sequenced approximately 460 bp from the 3' end of the mitochondrial 16S rRNA gene (rDNA) in 36 hard- and soft-tick species; a mesostigmatid mite, Dermanyssus gallinae, was used as an outgroup. Phylogenies derived using distance, maximum-parsimony, or maximum-likelihood methods were congruent. The existing phylogeny was largely supported with four exceptions. In hard ticks (Ixodidae), members of Haemaphysalinae were monophyletic with the primitive Amblyomminae and members of Hyalomminae grouped within the Rhipicephalinae. In soft ticks (Argasidae), the derived phylogeny failed to support a monophyletic relationship among members of Ornithodorinae and supported placement of Argasinae as basal to the Ixodidae, suggesting that hard ticks may have originated from an Argas-like ancestor. Because most Argas species are obligate bird octoparasites, this result supports earlier suggestions that hard ticks did not evolve until the late Cretaceous. PMID:7937832

  12. Molecular systematics of the Amphisphaeriaceae based on cladistic analyses of partial LSU rDNA gene sequences.


    Jeewon, Rajesh; Liew, Edward C Y; Hyde, Kevin D


    The Amphisphaeriaceae is an important family of ascomycetes within the Xylariales. There has been, however, disagreement regarding the taxonomic placement of many genera within this family and whether it should be confined to ascomycetes producing Pestalotiopsis-like anamorphs. In this study, phylogenetic relationships among members of the Amphisphaeriaceae are investigated using partial sequences of the 28S rDNA. Molecular data provided further evidence to support the association of several coelomycetous genera with the ascomycetous Amphisphaeriaceae. Phylogenetic analyses also show that all ascomycetous genera possessing Pestalotiopsis-like anamorphs are monophyletic and confirm the anamorphic-teleomorphic connections of some. There is, however, insufficient evidence to support the restriction of Amphisphaeriaceae to genera, which produce Pestalotiopsis-like anamorphs, because the phylogenetic placement of Amphisphaeria umbrina is not fully resolved and its affinities with other members received low bootstrap support. The results also indicate that Iodosphaeria and Arecophila should be excluded from the Amphisphaeriaceae. The placement of Lanceispora in the Amphisphaeriaceae is doubtful. A broad concept of the family Amphisphaeriaceae is advocated until further data are available.

  13. The phylogeny of native and exotic scallops cultured in China based on 16S rDNA sequences

    NASA Astrophysics Data System (ADS)

    Liu, Baozhong; Dong, Bo; Xiang, Jianhai; Wang, Zaizhao


    Scallops of the Family Pectinidae are a valuable resource in marine industry of the world. Understanding the phylogeny of the family is important for the development of the industry. In this study, partial 16S mitochondrial rDNA genes were obtained from 8 scallop species that are commonly cultured indigenous and transplanted species in China. Phylogenetic relationships of Pectinidae were analyzed based on the 8 sequences and other 5 published ones in GenBank, representing 9 genera of the family. The molecular phylogeny trees were constructed using 3 methods with software PHYLIP. The results showe that total 13 species of scallops clustered in 4 clades. Pecten maximus joins P. jacobaeus then Amusium pleuronectes in cluster, indicating close relationship of genus Amusium with Pecten in evolution. P. yessoensis is close to Chlamys farreri and C. islandica. No enough material was available to single out genus Patinopecten as an independent monophyletic subfamily. The position of Adamussium colbecki indicates that it is far from genus Pecten but near to genus Chlamys in evolution.

  14. Phylogenetic relationships of the enigmatic angiosperm family Podostemaceae inferred from 18S rDNA and rbcL sequence data.


    Soltis, D E; Mort, M E; Soltis, P S; Hibsch-Jetter, C; Zimmer, E A; Morgan, D


    The phylogenetic relationships of some angiosperm families have remained enigmatic despite broad phylogenetic analyses of rbcL sequences. One example is the aquatic family Podostemaceae, the relationships of which have long been controversial because of major morphological modifications associated with their aquatic habit. Podostemaceae have variously been associated with Piperaceae, Nepenthaceae, Polygonaceae, Caryophyllaceae, Scrophulariaceae, Rosaceae, Crassulaceae, and Saxifragaceae. Two recent analyses of rbcL sequences suggest a possible sister-group relationship of Podostemaceae to Crassulaceae (Saxifragales). However, the branch leading to Podostemaceae was long, and use of different outgroups resulted in alternative placements. We explored the phylogenetic relationships of Podostemaceae using 18S rDNA sequences and a combined rbcL + 18S rDNA matrix representing over 250 angiosperms. In analyses based on 18S rDNA data, Podostemaceae are not characterized by a long branch; the family consistently appears as part of a Malpighiales clade that also includes Malpighiaceae, Turneraceae, Passifloraceae, Salicaceae, Euphorbiaceae, Violaceae, Linaceae, Chrysobalanaceae, Trigoniaceae, Humiriaceae, and Ochnaceae. Phylogenetic analyses based on a combined 18S rDNA + rbcL data set (223 ingroup taxa) with basal angiosperms as the outgroup also suggest that Podostemaceae are part of a Malpighiales clade. These searches swapped to completion, and the shortest trees showed enhanced resolution and increased internal support compared to those based on 18S rDNA or rbcL alone. However, when Gnetales are used as the outgroup, Podostemaceae appear with members of the nitrogen fixing clade (e.g., Elaeagnaceae, Ulmaceae, Rhamnaceae, Cannabaceae, Moraceae, and Urticaceae). None of the relationships suggested here for Podostemaceae receives strong bootstrap support. Our analyses indicate that Podostemaceae are not closely allied with Crassulaceae or with other members of the

  15. Phylogenetic relationships of Brazilian isolates of Pythium insidiosum based on ITS rDNA and cytochrome oxidase II gene sequences.


    Azevedo, M I; Botton, S A; Pereira, D I B; Robe, L J; Jesus, F P K; Mahl, C D; Costa, M M; Alves, S H; Santurio, J M


    Pythium insidiosum is an aquatic oomycete that is the causative agent of pythiosis. Advances in molecular methods have enabled increased accuracy in the diagnosis of pythiosis, and in studies of the phylogenetic relationships of this oomycete. To evaluate the phylogenetic relationships among isolates of P. insidiosum from different regions of Brazil, and also regarding to other American and Thai isolates, in this study a total of thirty isolates of P. insidiosum from different regions of Brazil was used and had their ITS1, 5.8S rRNA and ITS2 rDNA (ITS) region and the partial sequence of cytochrome oxidase II (COX II) gene sequenced and analyzed. The outgroup consisted of six isolates of other Pythium species and one of Lagenidium giganteum. Phylogenetic analyses of ITS and COX II genes were conducted, both individually and in combination, using four different methods: Maximum parsimony (MP); Neighbor-joining (NJ); Maximum likelihood (ML); and Bayesian analysis (BA). Our data supported P. insidiosum as monophyletic in relation to the other Pythium species, and COX II showed that P. insidiosum appears to be subdivided into three major polytomous groups, whose arrangement provides the Thai isolates as paraphyletic in relation to the Brazilian ones. The molecular analyses performed in this study suggest an evolutionary proximity among all American isolates, including the Brazilian and the Central and North America isolates, which were grouped together in a single entirely polytomous clade. The COX II network results presented signals of a recent expansion for the American isolates, probably originated from an Asian invasion source. Here, COX II showed higher levels bias, although it was the source of higher levels of phylogenetic information when compared to ITS. Nevertheless, the two markers chosen for this study proved to be entirely congruent, at least with respect to phylogenetic relationships between different isolates of P. insidiosum. PMID:22483240

  16. Rapid identification of bovine mastitis pathogens by high-resolution melt analysis of 16S rDNA sequences.


    Ajitkumar, Praseeda; Barkema, Herman W; De Buck, Jeroen


    Accurate identification of mastitis pathogens is often compromised when using conventional culture-based methods. Here, we report a novel, rapid assay tested for speciation of bacterial mastitis pathogens using high-resolution melt analysis (HRMA) of 16S rDNA sequences. Real-time PCR amplification of 16S rRNA gene fragment, spanning the variable region V5 and V6 was performed with a resulting amplicon of 290bp. First, a library was generated of melt curves of 9 common pathogens that are implicated in bovine mastitis. Six of the isolates, Escherichia coli, Streptococcus agalactiae, Klebsiella pneumoniae, Streptococcus uberis, Staphylococcus aureus and Mycoplasma bovis, were type strains while the other 3, Arcanobacterium pyogenes, Corynebacterium bovis and Streptococcus dysgalactiae, were bovine mastitis field isolates. Four of the type strains, E. coli, S. agalactiae, K. pneumoniae and S. aureus, were found to be of human origin, while the other 3 type strains were isolated from bovine infections. Secondly, the melt curves and corresponding amplicon sequences of A. pyogenes, E. coli, S. agalactiae, S. dysgalactiae, K. pneumoniae, S. uberis and S. aureus were compared with 10 bovine mastitis field isolates of each pathogen. Based on the distinct differences in melt curves and sequences between human and bovine isolates of E. coli and K. pneumoniae, it was deemed necessary to select a set of bovine strains for these pathogens to be used as reference strains in the HRMA. Next, the HRMA was validated by three interpreters analyzing the differential clustering pattern of melt curves of 60 bacterial cultures obtained from mastitis milk samples. The three test interpreters were blinded to the culture and sequencing results of the isolates. Overall accuracy of the validation assay was 95% as there was difficulty in identifying the streptococci due to heterogeneity observed in the PCR amplicons of S. uberis. The present study revealed that broad-range real-time PCR with

  17. Distribution of Mosquitoes in the South East of Argentina and First Report on the Analysis Based on 18S rDNA and COI Sequences

    PubMed Central

    Díaz-Nieto, Leonardo M.; Maciá, Arnaldo; Parisi, Gustavo; Farina, Juan L.; Vidal-Domínguez, María E.; Perotti, M. Alejandra; Berón, Corina M.


    Although Mar del Plata is the most important city on the Atlantic coast of Argentina, mosquitoes inhabiting such area are almost uncharacterized. To increase our knowledge in their distribution, we sampled specimens of natural populations. After the morphological identification based on taxonomic keys, sequences of DNA from small ribosomal subunit (18S rDNA) and cytochrome c oxidase I (COI) genes were obtained from native species and the phylogenetic analysis of these sequences were done. Fourteen species from the genera Uranotaenia, Culex, Ochlerotatus and Psorophora were found and identified. Our 18S rDNA and COI-based analysis indicates the relationships among groups at the supra-species level in concordance with mosquito taxonomy. The introduction and spread of vectors and diseases carried by them are not known in Mar del Plata, but some of the species found in this study were reported as pathogen vectors. PMID:24098700

  18. Intraspecific Genetic Variation and Phylogenetic Analysis of Dirofilaria immitis Samples from Western China Using Complete ND1 and 16S rDNA Gene Sequences

    PubMed Central

    Liu, Tianyu; Liang, Yinan; Zhong, Xiuqin; Wang, Ning; Hu, Dandan; Zhou, Xuan; Gu, Xiaobin; Peng, Xuerong; Yang, Guangyou


    Dirofilaria immitis (heartworm) is the causative agent of an important zoonotic disease that is spread by mosquitoes. In this study, molecular and phylogenetic characterization of D. immitis were performed based on complete ND1 and 16S rDNA gene sequences, which provided the foundation for more advanced molecular diagnosis, prevention, and control of heartworm diseases. The mutation rate and evolutionary divergence in adult heartworm samples from seven dogs in western China were analyzed to obtain information on genetic diversity and variability. Phylogenetic relationships were inferred using both maximum parsimony (MP) and Bayes methods based on the complete gene sequences. The results suggest that D. immitis formed an independent monophyletic group in which the 16S rDNA gene has mutated more rapidly than has ND1. PMID:24639299

  19. A tandem array of 5S ribosomal RNA genes in Pythium irregulare.


    Belkhiri, A; Intengan, H; Klassen, G R


    The 5S ribosomal RNA genes of the oomycete Pythium irregulare exist in tandem arrays unlinked to the rDNA repeat unit. A clone with a 9.2-kb insert containing an array of 5S genes was identified in a lambda genomic library and was characterized by restriction mapping and partial sequencing. The array consisted of 9 apparently identical 5S genes and their spacers in tandem, followed by a diverged 5S-like sequence that is likely to be a pseudogene. This gene arrangement, although almost universal in plants and animals, is rare in fungi and protists.

  20. [Analysis of DNA homology and 16S rDNA sequence of rhizobia, a new phenotypic subgroup, isolated from Xizang Autonomous Region of China].


    Wang, Su-ying; Yang, Xiao-li; Li, Hai-feng; Liu, Jie


    Based on the studies of numerical taxonomy, the seven rhizobial strains isolated from the root nodules of leguminous plants Trigonella spp. and Astragalus spp. growing in the Xizang Autonomous Region of China constituted a new phenotypic subgroup, where wide phenotypic and genotypic diversity among legume crops had been reported due to complex terrain and various climate. The new phenotypic subgroup were further identified to clarify its taxonomic position by DNA homology analysis and 16S rDNA gene sequencing. The mol% G + C ratio of the DNA among members of the new subgroup ranged from 59.5 to 63.3 mol% as determined by T (m) assay. The levels of DNA relatedness, determined by using the DNA liquid hybridization method, among the members of the new subgroup were between 74.3% and 92.3%, while level of DNA relatedness between the central strains XZ2-3 of the new subgroup and the type strains of known species of Rhizobium was less than 47.4%. These results indicated that the new phenotypic subgroup is a DNA homological group different from described species of Rhizobium. Therefore, this new phenotypic subgroup was supposed to be a new species in the genus of Rhizobium since the strains in the same species generally exhibit levels of DNA homology ranging from 70 to 100%. A systematic identification method-16S rDNA gene sequence comparison was carried out to determine the phylogenetic relationships of the new subgroup with the described species of Rhizobium. The GenBank accession number for the 16S rDNA sequence of the central strain XZ2-3 of the new subgroup is DQ099745. The full-length 16S rDNA gene sequence were sequenced by chain terminator techniques and analyzed with PHYLIP. The phylogenetic trees were constructed by using the programs DRAWTREE. The phylogenetic analysis indicated that new subgroup occupy a independent sub-branch in phylogenetic tree. The sequence similarities between the center strain XZ2-3 and the closest relatives, strain R. leguminosarum USDA

  1. Nuclear rDNA ITS-2 sequences reveal polyphyly of Panstrongylus species (Hemiptera: Reduviidae: Triatominae), vectors of Trypanosoma cruzi.


    Marcilla, A; Bargues, M D; Abad-Franch, F; Panzera, F; Carcavallo, R U; Noireau, F; Galvão, C; Jurberg, J; Miles, M A; Dujardin, J P; Mas-Coma, S


    Panstrongylus species are widely distributed throughout the Americas, where they act as vectors of Trypanosoma cruzi, agent of Chagas disease. Their intraspecific relationships, taxonomic position and phylogeny in relation to other Triatomini were explored using ribosomal DNA (rDNA) internal transcribed spacer 2 (ITS-2) sequence polymorphisms and maximum parsimony, distance and maximum likelihood analyses of 10 populations representing six species of the genus (P. megistus, P. geniculatus, P. rufotuberculatus, P. lignarius, P. herreri and P. chinai). At the subspecific level, P. megistus appeared more homogeneous than P. rufotuberculatus and P. geniculatus (both with broader distribution). Several dinucleotide microsatellites were detected in the sequences of given species. Many of these microsatellites (GC, TA, GT and AT) showed different number of repeats in different populations and thus, may be very useful for population differentiation and dynamics analyses in future studies. The sequences of P. lignarius (considered sylvatic) and P. herreri (a major disease vector in Peru) were identical, suggesting that these species should be synonymised. Intrageneric analysis showed a clear separation of P. rufotuberculatus, with closest relationships between P. geniculatus and P. chinai, and P. megistus occupying a separate branch. Genetic distances between Panstrongylus species (0.11585-0.22131) were higher than those between Panstrongylus and other Triatomini (16 species from central and North America and South America) (0.08617-0.11039). The distance between P. megistus and P. lignarius/herreri (0.22131) was the largest so far recorded in the tribe. The pronounced differences in length and nucleotide composition suggest a relatively old divergence of Panstrongylus species. P. rufotuberculatus was closer to Mesoamerican Triatoma, Meccus and Dipetalogaster species than to other Panstrongylus. All Panstrongylus clustered with the Mesoamerican clade; P. rufotuberculatus

  2. Identification of the Bacterial Community of Maple Sap by Using Amplified Ribosomal DNA (rDNA) Restriction Analysis and rDNA Sequencing

    PubMed Central

    Lagacé, L.; Pitre, M.; Jacques, M.; Roy, D.


    The bacterial community of maple sap was characterized by analysis of samples obtained at the taphole of maple trees for the 2001 and 2002 seasons. Among the 190 bacterial isolates, 32 groups were formed according to the similarity of the banding patterns obtained by amplified ribosomal DNA restriction analysis (ARDRA). A subset of representative isolates for each ARDRA group was identified by 16S rRNA gene fragment sequencing. Results showed a wide variety of organisms, with 22 different genera encountered. Pseudomonas and Ralstonia, of the γ- and β-Proteobacteria, respectively, were the most frequently encountered genera. Gram-positive bacteria were also observed, and Staphylococcus, Plantibacter, and Bacillus were the most highly represented genera. The sampling period corresponding to 50% of the cumulative sap flow percentage presented the greatest bacterial diversity according to its Shannon diversity index value (1.1). γ-Proteobacteria were found to be dominant almost from the beginning of the season to the end. These results are providing interesting insights on maple sap microflora that will be useful for further investigation related to microbial contamination and quality of maple products and also for guiding new strategies on taphole contamination control. PMID:15066796

  3. Comet-FISH with rDNA probes for the analysis of mutagen-induced DNA damage in plant cells.


    Kwasniewska, Jolanta; Grabowska, Marta; Kwasniewski, Miroslaw; Kolano, Bozena


    We used comet-fluorescence in situ hybridization (FISH) in the model plant species Crepis capillaris following exposure of seedlings to maleic hydrazide (MH). FISH with 5S and 25S rDNA probes was applied to comets obtained under alkaline conditions to establish whether these DNA regions were preferentially involved in comet tail formation. MH treatment induced significant fragmentation of nuclear DNA and of rDNA loci. A 24-h post-treatment recovery period allowed a partial reversibility of MH-induced damage on nuclear and rDNA regions. Analyses of FISH signals demonstrated that rDNA sequences were always involved in tail formation and that 5S rDNA was more frequently present in the tail than 25S rDNA, regardless of treatment. The involvement of 25S rDNA in nucleolus formation and differences in chromatin structure between the two loci may explain the different susceptibility of the 25S and 5S rDNA regions to migrate into the tail. This work is the first report on the application of FISH to comet preparations from plants to analyze the distribution and repair of DNA damage within specific genomic regions after mutagenic treatment. Moreover, our work suggests that comet-FISH in plants may be a useful tool for environmental monitoring assessment. PMID:22556029

  4. Reconstructing the Phylogeny of Capsosiphon fulvescens (Ulotrichales, Chlorophyta) from Korea Based on rbcL and 18S rDNA Sequences

    PubMed Central

    Sun, Sang-Mi; Yang, Seung Hwan


    Capsosiphon fulvescens is a filamentous green algae in the class Ulvophyceae. It has been consumed as food with unique flavor and soft texture to treat stomach disorders and hangovers, and its economic value justifies studying its nutritional and potential therapeutic effects. In contrast to these applications, only a few taxonomic studies have been conducted on C. fulvescens. In particular, classification and phylogenetic relationships of the C. fulvescens below the order level are controversial. To determine its phylogenetic position in the class, we used rbcL and 18S rDNA sequences as molecular markers to construct phylogenetic trees. The amplified rbcL and 18S rDNA sequences from 4 C. fulvescens isolates (Jindo, Jangheung, Wando, and Koheung, Korea) were used for phylogenetic analysis by employing three different phylogenetic methods: neighbor joining (NJ), maximum parsimony (MP), and maximum likelihood (ML). The rbcL phylogenetic tree showed that all taxa in the order Ulvales were clustered as a monophyletic group and resolved the phylogenetic position of C. fulvescens in the order Ulotrichales. The significance of our study is that the 18S rDNA phylogenetic tree shows the detailed taxonomic position of C. fulvescens. In our result, C. fulvescens is inferred as a member of Ulotrichaceae, along with Urospora and Acrosiphonia. PMID:27190985

  5. Molecular approaches to differentiate three species of Nematodirus in sheep and goats from China based on internal transcribed spacer rDNA sequences.


    Zhao, G H; Jia, Y Q; Bian, Q Q; Nisbet, A J; Cheng, W Y; Liu, Y; Fang, Y Q; Ma, X T; Yu, S K


    Internal transcribed spacer (ITS) rDNA sequences of three Nematodirus species from naturally infected goats or sheep in two endemic provinces of China were analysed to establish an effective molecular approach to differentiate Nematodirus species in small ruminants. The respective intra-specific genetic variations in ITS1 and ITS2 rDNA regions were 0.3-1.8% and 0-0.4% in N. spathiger, 0-6.5% and 0-5.4% in N. helvetianus, and 0-4.4% and 0-6.1% in N. oiratianus from China. The respective intra-specific variations of ITS1 and ITS2 were 1.8-4.4% and 1.6-6.1% between N. oiratianus isolates from China and Iran, 5.7-7.1% and 6.3-8.3% between N. helvetianus samples from China and America. For N. spathiger, compared with samples from China, sequence differences in ITS1 rDNA were 0.3-2.4% in isolates from America, 0.3-2.9% in New Zealand and 2.1-2.4% in Australia. Genetic variations in ITS2 rDNA of N. spathiger were 0-0.4% between samples from China and America, and 0-0.8% between samples from China and New Zealand. Using mutation sites, polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and specific PCR techniques were developed to differentiate these three Nematodirus species. The specific PCR assay allowed the accurate identification of N. oiratianus from other common nematodes with a sensitivity of 0.69 pg and further examination of Nematodirus samples demonstrated the reliability of these two molecular methods.

  6. Fresh-water planarias and a marine planaria are relatively dissimilar in the 5S rRNA sequences.


    Ohama, T; Kumazaki, T; Hori, H; Osawa, S; Takai, M


    The nucleotide sequences from fresh-water Dugesia japonica and marine Planocera reticulata have been determined. The similarity between these two species is only 69%. The Planocera sequence reveals nearly 80% similarity (72-81%) to the sequences of multicellular animals, while the Dugesia sequences are considerably different from them (66-73%).

  7. Sequence-Based Identification of Mycobacterium Species Using the MicroSeq 500 16S rDNA Bacterial Identification System

    PubMed Central

    Patel, Jean Baldus; Leonard, Debra G. B.; Pan, Xai; Musser, James M.; Berman, Richard E.; Nachamkin, Irving


    We evaluated the MicroSeq 500 16S rDNA Bacterial Sequencing Kit (PE Applied Biosystems), a 500-bp sequence-based identification system, for its ability to identify clinical Mycobacterium isolates. The organism identity was determined by comparing the 16S rDNA sequence to the MicroSeq database, which consists primarily of type strain sequences. A total of 113 isolates (18 different species), previously recovered and identified by routine methods from two clinical laboratories, were analyzed by the MicroSeq method. Isolates with discordant results were analyzed by hsp65 gene sequence analysis and in some cases repeat phenotypic identification, AccuProbe rRNA hybridization (Gen-Probe, Inc., San Diego, Calif.), or high-performance liquid chromatography of mycolic acids. For 93 (82%) isolates, the MicroSeq identity was concordant with the previously reported identity. For 18 (16%) isolates, the original identification was discordant with the MicroSeq identification. Of the 18 discrepant isolates, 7 (six unique sequences) were originally misidentified by phenotypic analysis or the AccuProbe assay but were correctly identified by the MicroSeq assay. Of the 18 discrepant isolates, 11 (seven unique sequences) were unusual species that were difficult to identify by phenotypic methods and, in all but one case, by molecular methods. The remaining two isolates (2%) failed definitive phenotypic identification, but the MicroSeq assay was able to definitively identify one of these isolates. The MicroSeq identification system is an accurate and rapid method for the identification of Mycobacterium spp. PMID:10618095

  8. Genetic diversity of Histoplasma capsulatum strains isolated from Argentina based on nucleotide sequence variations in the internal transcribed spacer regions of rDNA.


    Landaburu, Fernanda; Cuestas, María Luján; Rubio, Andrea; Elías, Nahuel Alejandro; Daneri, Gabriela Lopez; Veciño, Cecilia; Iovannitti, Cristina A; Mujica, María Teresa


    The internal transcribed spacer (ITS) regions of rDNA genes of 49 Histoplasma capsulatum (48 from clinical samples and one from soil) isolates were examined. Nucleotide sequence heterogeneity within this region was useful for phylogenetic classification of H. capsulatum and species identification. Thus, in 45 of 49 isolates we observed higher percentages of identity in the nucleotide sequences of ITS regions when the isolates studied herein were compared with those reported in our country in the South America B clade. Phylogenetic analyses of rDNA sequences corresponding to the 537 bp of the ITS region obtained from H. capsulatum isolates assigned South America type B clade (45 isolates), North America type 1 and Asia clade (2 isolates each one). H. capsulatum strains isolated from soil and from patients living in Argentina (45 of 49) clustered together with the H. capsulatum isolates of the South America B clade. The high level of genetic similarity among our isolates suggests that almost one genetic population is present in the microenvironment. Isolates described as H. capsulatum var. capsulatum or var. farciminosum (2 isolates) did not form a monophyletic group and were found in the Asia clade. Subsequent studies are needed to properly identify these isolates.

  9. Genetic diversity of Histoplasma capsulatum strains isolated from Argentina based on nucleotide sequence variations in the internal transcribed spacer regions of rDNA.


    Landaburu, Fernanda; Cuestas, María Luján; Rubio, Andrea; Elías, Nahuel Alejandro; Daneri, Gabriela Lopez; Veciño, Cecilia; Iovannitti, Cristina A; Mujica, María Teresa


    The internal transcribed spacer (ITS) regions of rDNA genes of 49 Histoplasma capsulatum (48 from clinical samples and one from soil) isolates were examined. Nucleotide sequence heterogeneity within this region was useful for phylogenetic classification of H. capsulatum and species identification. Thus, in 45 of 49 isolates we observed higher percentages of identity in the nucleotide sequences of ITS regions when the isolates studied herein were compared with those reported in our country in the South America B clade. Phylogenetic analyses of rDNA sequences corresponding to the 537 bp of the ITS region obtained from H. capsulatum isolates assigned South America type B clade (45 isolates), North America type 1 and Asia clade (2 isolates each one). H. capsulatum strains isolated from soil and from patients living in Argentina (45 of 49) clustered together with the H. capsulatum isolates of the South America B clade. The high level of genetic similarity among our isolates suggests that almost one genetic population is present in the microenvironment. Isolates described as H. capsulatum var. capsulatum or var. farciminosum (2 isolates) did not form a monophyletic group and were found in the Asia clade. Subsequent studies are needed to properly identify these isolates. PMID:24299459

  10. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    NASA Technical Reports Server (NTRS)

    Fox, G. E.


    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  11. Haplotype Detection from Next-Generation Sequencing in High-Ploidy-Level Species: 45S rDNA Gene Copies in the Hexaploid Spartina maritima

    PubMed Central

    Boutte, Julien; Aliaga, Benoît; Lima, Oscar; Ferreira de Carvalho, Julie; Ainouche, Abdelkader; Macas, Jiri; Rousseau-Gueutin, Mathieu; Coriton, Olivier; Ainouche, Malika; Salmon, Armel


    Gene and whole-genome duplications are widespread in plant nuclear genomes, resulting in sequence heterogeneity. Identification of duplicated genes may be particularly challenging in highly redundant genomes, especially when there are no diploid parents as a reference. Here, we developed a pipeline to detect the different copies in the ribosomal RNA gene family in the hexaploid grass Spartina maritima from next-generation sequencing (Roche-454) reads. The heterogeneity of the different domains of the highly repeated 45S unit was explored by identifying single nucleotide polymorphisms (SNPs) and assembling reads based on shared polymorphisms. SNPs were validated using comparisons with Illumina sequence data sets and by cloning and Sanger (re)sequencing. Using this approach, 29 validated polymorphisms and 11 validated haplotypes were reported (out of 34 and 20, respectively, that were initially predicted by our program). The rDNA domains of S. maritima have similar lengths as those found in other Poaceae, apart from the 5′-ETS, which is approximately two-times longer in S. maritima. Sequence homogeneity was encountered in coding regions and both internal transcribed spacers (ITS), whereas high intragenomic variability was detected in the intergenic spacer (IGS) and the external transcribed spacer (ETS). Molecular cytogenetic analysis by fluorescent in situ hybridization (FISH) revealed the presence of one pair of 45S rDNA signals on the chromosomes of S. maritima instead of three expected pairs for a hexaploid genome, indicating loss of duplicated homeologous loci through the diploidization process. The procedure developed here may be used at any ploidy level and using different sequencing technologies. PMID:26530424

  12. Culturable bacteria present in the fluid of the hooded-pitcher plant Sarracenia minor based on 16S rDNA gene sequence data.


    Siragusa, Alex J; Swenson, Janice E; Casamatta, Dale A


    The culturable microbial community within the pitcher fluid of 93 Sarracenia minor carnivorous plants was examined over a 2-year study. Many aspects of the plant/bacterial/insect interaction within the pitcher fluid are minimally understood because the bacterial taxa present in these pitchers have not been identified. Thirteen isolates were characterized by 16S rDNA sequencing and subsequent phylogenetic analysis. The Proteobacteria were the most abundant taxa and included representatives from Serratia, Achromobacter, and Pantoea. The Actinobacteria Micrococcus was also abundant while Bacillus, Lactococcus, Chryseobacterium, and Rhodococcus were infrequently encountered. Several isolates conformed to species identifiers (>98% rDNA gene sequence similarity) including Serratia marcescens (isolates found in 27.5% of pitchers), Achromobacter xylosoxidans (37.6%), Micrococcus luteus (40.9%), Bacillus cereus (isolates found in 10.2%), Bacillus thuringiensis (5.4%), Lactococcus lactis (17.2%), and Rhodococcus equi (2.2%). Species-area curves suggest that sampling efforts were sufficient to recover a representative culturable bacterial community. The bacteria present represent a diverse community probably as a result of introduction by insect vectors, but the ecological significance remains under explored. PMID:17380356

  13. Cellular identity of a novel small subunit rDNA sequence clade of apicomplexans: description of the marine parasite Rhytidocystis polygordiae n. sp. (host: Polygordius sp., Polychaeta).


    Leander, Brian S; Ramey, Patricia A


    A new species of Rhytidocystis (Apicomplexa) is characterized from North American waters of the Atlantic Ocean using electron microscopy and phylogenetic analyses of small subunit (SSU) rDNA sequences. Rhytidocystis polygordiae n. sp. is a parasite of the polychaete Polygordius sp. and becomes the fourth described species within this genus. The trophozoites of R. polygordiae were relatively small oblong cells (L=35-55 microm; W=20-25 microm) and distinctive in possessing subterminal indentations at both ends of the cell. The surface of the trophozoites had six to eight longitudinal series of small transverse folds and several micropores arranged in short linear rows. The trophozoites of R. polygordiae were positioned beneath the brush border of the intestinal epithelium but appeared to reside between the epithelial cells within the extracellular matrix rather than within the cells. The trophozoites possessed a uniform distribution of paraglycogen granules, putative apicoplasts, mitochondria with tubular cristae, and a centrally positioned nucleus. The trophozoites were non-motile and lacked a mucron and an apical complex. Intracellular sporozoites of R. polygordiae had a conoid, a few rhoptries, micronemes, dense granules, and a posteriorly positioned nucleus. Phylogenies inferred from SSU rDNA sequences demonstrated a close relationship between R. polygordiae and the poorly known parasite reported from the hemolymph of the giant clam Tridacna crocea. The rhytidocystid clade diverged early in the apicomplexan radiation and showed a weak affinity to a clade consisting of cryptosporidian parasites, monocystids, and neogregarines.

  14. Culturable bacteria present in the fluid of the hooded-pitcher plant Sarracenia minor based on 16S rDNA gene sequence data.


    Siragusa, Alex J; Swenson, Janice E; Casamatta, Dale A


    The culturable microbial community within the pitcher fluid of 93 Sarracenia minor carnivorous plants was examined over a 2-year study. Many aspects of the plant/bacterial/insect interaction within the pitcher fluid are minimally understood because the bacterial taxa present in these pitchers have not been identified. Thirteen isolates were characterized by 16S rDNA sequencing and subsequent phylogenetic analysis. The Proteobacteria were the most abundant taxa and included representatives from Serratia, Achromobacter, and Pantoea. The Actinobacteria Micrococcus was also abundant while Bacillus, Lactococcus, Chryseobacterium, and Rhodococcus were infrequently encountered. Several isolates conformed to species identifiers (>98% rDNA gene sequence similarity) including Serratia marcescens (isolates found in 27.5% of pitchers), Achromobacter xylosoxidans (37.6%), Micrococcus luteus (40.9%), Bacillus cereus (isolates found in 10.2%), Bacillus thuringiensis (5.4%), Lactococcus lactis (17.2%), and Rhodococcus equi (2.2%). Species-area curves suggest that sampling efforts were sufficient to recover a representative culturable bacterial community. The bacteria present represent a diverse community probably as a result of introduction by insect vectors, but the ecological significance remains under explored.

  15. Isolation and identification of spoilage microorganisms using food-based media combined with rDNA sequencing: ranch dressing as a model food.


    Waite, Joy G; Jones, Joseph M; Yousef, Ahmed E


    Investigating microbial spoilage of food is hampered by the lack of suitable growth media and protocols to characterize the causative agents. Microbial spoilage of salad dressing is sporadic and relatively unpredictable, thus processors struggle to develop strategies to minimize or prevent spoilage of this product. The objectives of this study were to (i) induce and characterize spoilage events in ranch-style dressing as a model food, and (ii) isolate and identify the causative microorganisms using traditional and food-based media, coupled with rDNA sequence analysis. Ranch dressing (pH 4.4) was prepared and stored at 25 degrees C for 14 d and microbial populations were recovered on MRS agar and ranch dressing agar (RDA), a newly formulated food-based medium. When isolates suspected as the spoilage agents were inoculated into ranch dressing and held at 25 degrees C for 9-10 d, three unique spoilage events were characterized. Using rDNA sequence comparisons, spoilage organisms were identified as Lactobacillus brevis, Pediococcus acidilactici, and Torulaspora delbrueckii. P. acidilactici produced flat-sour spoilage, whereas Lb. brevis resulted in product acidification and moderate gas production. The RDA medium allowed for optimum recovery of the excessive gas-producing spoilage yeast, T. delbrueckii. The isolation and identification strategy utilized in this work should assist in the characterization of spoilage organisms in other food systems.

  16. Identification of Hortaea werneckii Isolated from mangrove plant Aegiceras comiculatum based on morphology and rDNA sequences.


    Chen, Juan; Xing, Xiao-Ke; Zhang, Li-Chun; Xing, Yong-Mei; Guo, Shun-Xing


    Hortaea werneckii is a black yeast-like ascomycetous fungi associated with the human superficial infection tinea nigra, which commonly occurs in tropical and subtropical countries. Now, this fungus has been found in the halophilic environment all over the world and recognized as a new model organism in exploring the mechanisms of salt tolerance in eukaryotes. During a survey of endophytic fungi of mangrove forest at South China Sea, two isolates of H. werneckii were recovered from medicinal plant of Aegiceras comiculatum. The isolates were identified by morphological characters and phylogenetic analyses (e.g., ITS rDNA, LSU rDNA and translation elongation factor EF1α). Some physiological tests such as thermotolerance, acid tolerance (pH) and NaCl tolerance as well as pathogenicity test in vitro for the strains of Hortaea were performed. It is the first report that H. werneckii was isolated from medicinal plant of A. comiculatum in south sea of China as the endophytic fungi.

  17. Sequence Analysis of the Second Internal Transcribed Spacer (ITS2) Region of rDNA for Species Identification of Trichostrongylus Nematodes Isolated From Domestic Livestock in Iran

    PubMed Central

    Ghasemikhah, R; Sharbatkhori, M; Mobedi, I; Kia, EB; Harandi, M Fasihi; Mirhendi, H


    Background Infectivity of herbivores with Trichostrongylus nematodes is widespread in many countries, having a major economic impact on breeding, survivability, and productivity of domestic livestock. This study was carried out on Trichostrongylus species isolated from domestic livestock in order to develop an easy-to-perform method for species identification. Methods Trichostrongylus isolates were collected from sheep, goat, cattle, and buffaloes in Khuzestan Province, southwest Iran. Primary species identification was carried out based on morphological characterization of male worms. PCR amplification of ITS2-rDNA region was performed on genomic DNA and the products were sequenced. Phylogenetic analysis of the nucleotide sequence data was conducted employing Bayesian Inference approach. Consequently, a restriction fragment length polymorphism (RFLP) profile was designed to differentiate Trichostrongylus species. Results A consensus sequence of 238 nucleotides was deposited in the GenBank for Iranian isolates of Trichostrongylus species including T. colubriformis, T. capricola, T. probolurus and T. vitrinus. The designated RFLP using restriction enzyme TasI could readily differentiate among species having different ITS2 sequence. The molecular analysis was in concordance with morphological findings. Conclusion Phylogenetic analysis indicated a close relationship among the sequences obtained in this study and reference sequence of relevant species. ITS2-RFLP with TasI is recommended for molecular differentiation of common Trichostrongylus species. PMID:23109944

  18. The origin of the 5S ribosomal RNA molecule could have been caused by a single inverse duplication: strong evidence from its sequences.


    Branciamore, Sergio; Di Giulio, Massimo


    The secondary structure of the 5S ribosomal RNA (5S rRNA) molecule shows a high degree of symmetry. In order to explain the origin of this symmetry, it has been conjectured that one half of the 5S rRNA molecule was its precursor and that an indirect duplication of this precursor created the other half and thus the current symmetry of the molecule. Here, we have subjected to an empirical test both the indirect duplication model, analysing a total of 684 5S rRNA sequences for complementarity between the two halves of the 5S rRNA, and the direct duplication model analysing in this case the similarity between the two halves of this molecule. In intra- and inter-molecule and intra- and inter-domain comparisons, we find a high statistical support to the hypothesis of a complementarity relationship between the two halves of the 5S rRNA molecule, denying vice versa the hypothesis of similarity between these halves. Therefore, these observations corroborate the indirect duplication model at the expense of the direct duplication model, as reason of the origin of the 5S rRNA molecule. More generally, we discuss and favour the hypothesis that all RNAs and proteins, which present symmetry, did so through gene duplication and not by gradualistic accumulation of few monomers or segments of molecule into a gradualistic growth process. This would be the consequence of the very high propensity that nucleic acids have to be subjected to duplications.

  19. Ultrastructure and 18S rDNA sequence analysis of Wobblia lunata gen. et sp. nov., a new heterotrophic flagellate (Stramenopiles, Incertae sedis).


    Moriya, M; Nakayama, T; Inouye, I


    A new heterotrophic flagellate Wobblia lunata gen. et sp. nov. is described. This organism usually attaches to the substratum showing a wobbling motion, and sometimes glides on the substratum or swims freely in the medium. W. lunata has various features characteristic of the stramenopiles. These include a hairy flagellum with tripartite tubular hairs, a mitochondrion with tubular cristae, arrangement of flagellar apparatus components and a double helix in the flagellar transition zone. W. lunata shares a double helix with heterotrophic stramenopiles, including Developayella elegans, oomycetes, hyphochytrids, opalinids and proteromonads, and could be placed in the phylum Bigyra Cavalier-Smith. However, from 18S rDNA tree analysis, these organisms form two distantly-related clades in the stramenopiles, and Wobblia appears at the base of the stramenopiles. Evaluation of morphological features and comparison of 18S rDNA sequences indicate that W. lunata is a member of the stramenopiles, but it is distinct from any other stramenopiles so far described. Its phylogenetic position within the stramenopiles is uncertain and therefore W. lunata is described as a stramenopile incertae sedis. PMID:10896132

  20. Species-genomic relationships among the tribasic diploid and polyploid Carthamus taxa based on physical mapping of active and inactive 18S-5.8S-26S and 5S ribosomal RNA gene families, and the two tandemly repeated DNA sequences.


    Agrawal, Renuka; Tsujimoto, Hisashi; Tandon, Rajesh; Rao, Satyawada Rama; Raina, Soom Nath


    In the genus Carthamus (2n=20, 22, 24, 44, 64; x=10, 11, 12), most of the homologues within and between the chromosome complements are difficult to be identified. In the present work, we used fluorescent in situ hybridisation (FISH) to determine the chromosome distribution of the two rRNA gene families, and the two isolated repeated DNA sequences in the 14 Carthamus taxa. The distinctive variability in the distribution, number and signal intensity of hybridisation sites for 18S-26S and 5S rDNA loci could generally distinguish the 14 Carthamus taxa. Active 18S-26S rDNA sites were generally associated with NOR loci on the nucleolar chromosomes. The two A genome taxa, C. glaucus ssp. anatolicus and C. boissieri with 2n=20, and the two botanical varieties of B genome C. tinctorius (2n=24) had diagnostic FISH patterns. The present results support the origin of C. tinctorius from C. palaestinus. FISH patterns of C. arborescens vis-à-vis the other taxa indicate a clear division of Carthamus taxa into two distinct lineages. Comparative distribution and intensity pattern of 18S-26S rDNA sites could distinguish each of the tetraploid and hexaploid taxa. The present results indicate that C. boissieri (2n=20) is one of the genome donors for C. lanatus and C. lanatus ssp. lanatus (2n=44), and C. lanatus is one of the progenitors for the hexaploid (2n=64) taxa. The association of pCtKpnI-2 repeated sequence with rRNA gene cluster (orphon) in 2-10 nucleolar and non-nucleolar chromosomes and the consistent occurrence of pCtKpnI-1 repeated sequence at the subtelomeric region in all the taxa analysed indicate some functional role of these sequences.

  1. Morphology and small subunit rDNA gene sequence of Pseudoamphisiella quadrinucleata n. sp. (Ciliophora, Urostylida) from the South China Sea.


    Shen, Zhuo; Lin, Xiaofeng; Long, Hongan; Miao, Miao; Liu, Hongbin; Al-Rasheid, Khaled A S; Song, Weibo


    The urosylid genus Pseudoamphisiella was established by Song (1996) with hitherto only two known congeners. In the present work, the morphology and infraciliature of a new member, Pseudoamphisiella quadrinucleata n. sp., a form with conspicuous alveolar layer and four macronuclear nodules isolated from the coastal waters both near Hong Kong and near Guangzhou, South China were investigated using living observation and protargol silver impregnation methods. Pseudoamphisiella quadrinucleata differs from other two known forms mainly by the number of macronuclear nodules: constantly four vs. two in Pseudoamphisiella alveolata and 24-57 in Pseudoamphisiella lacazei. To support this, the sequence of the small subunit rDNA of P. quadrinucleata n. sp. showed 14 and 74 nucleotides in comparison with that of the two known congeners, respectively, which hence firmly supports the validity of the new species.

  2. Mutation scanning analysis of sequence heterogeneity in the second internal transcribed spacer (rDNA) within some members of the Hypodontus macropi (Nematoda: Strongyloidea) complex.


    Gasser, R B; Zhu, X; Beveridge, I; Chilton, N


    Single-strand conformation polymorphism analysis was employed to investigate sequence variation in the second internal transcribed spacer (ITS-2) of nuclear ribosomal DNA within and among individuals representing three operational taxonomic units (OTUs) of Hypodontus macropi from different species of Australian macropodid marsupials. Of the 96 nematodes analysed, totals of 3 (OTU1 from Petrogale persephone), 10 (OTU2 from Macropus robustus) and 7 (OTU9 from Macropus rufus) representative individuals were selected for DNA sequencing to characterise and estimate the magnitude of nucleotide variation in the ITS-2. While no unequivocal nucleotide difference in the ITS-2 was detectable within OTU1, most sequence variation (3/44.7%) detected within OTU2 and OTU9 was related chiefly to dinucleotide (CA, TA, or a combination of both) differences. This microsatellite variability in some H. macropi OTUs suggests that the ITS-2 rDNA may be subjected to slippage events during DNA replication, resulting in short dinucleotide repeat tracts being dispersed throughout the ITS-2 lineages, or possibly transposition and/or crossing-over events. Nucleotide variation in the ITS-2 of individual OTUs was related to the proposed secondary structure for the precursor ribosomal RNAs. Most of the sequence heterogeneity or polymorphism within OTU2 and OTU9 occurred in loops or bulges of the predicted secondary structure, which appear not to be under functional constraint. The findings of this study have implications for investigating speciation events and population differentiation in nematodes at the molecular level.

  3. Molecular Profiling of Microbial Communities from Contaminated Sources: Use of Subtractive Cloning Methods and rDNA Spacer Sequences

    SciTech Connect

    Robb, Frank T.


    The major objective of this research was to provide appropriate sequences and assemble a DNA array of oligonucleotides to be used for rapid profiling of microbial populations from polluted areas and other areas of interest. The sequences to be assigned to the DNA array were chosen from cloned genomic DNA taken from groundwater sites having well characterized pollutant histories at Hanford Nuclear Plant and Lawrence Livermore Site 300. Glass-slide arrays were made and tested; and a new multiplexed, bead-based method was developed that uses nucleic acid hybridization on the surface of microscopic polystyrene spheres to identify specific sequences in heterogeneous mixtures of DNA sequences. The test data revealed considerable strain variation between sample sites showing a striking distribution of sequences. It also suggests that diversity varies greatly with bioremediation, and that there are many bacterial intergenic spacer region sequences that can indicate its effects. The bead method exhibited superior sequence discrimination and has features for easier and more accurate measurement.

  4. The 18S rDNA sequence of Synchytrium endobioticum and its utility in microarrays for the simultaneous detection of fungal and viral pathogens of potato.


    Abdullahi, Ismail; Koerbler, Marianne; Stachewicz, Hans; Winter, Stephan


    Resting spores extracted from wart (Synchytrium endobioticum)-infected potato tubers were used for DNA extraction and amplification of 18S rDNA. Analysis of the cloned, sequenced fragment revealed high similarity to members of the Chytridiomycota. Using this information, specific oligonucleotide probes were designed and arrayed onto glass slides for detection of the pathogen. Viral sequence information available in the databank was retrieved, or new viral sequences were generated, and used to design probes for specific detection of important quarantine viruses of potato. To determine the sensitivity and specificity of the oligonucleotide probes, total RNA from infected plants was reverse transcribed, labelled with Cyanine 5, and hybridised with the microarray. A significant number of the oligonucleotide probes exhibited high specificity to S. endobioticum, Andean potato latent virus, Andean potato mottle virus, Potato black ringspot virus, and Potato spindle tuber viroid. Hybridisation signals of sub-arrays within slides were reproducible (r = 0.79) with a high correlation coefficient of hybridisation repetitions (0.73). Our results demonstrate the potential of microarray-based hybridisation for identification of multiple pathogen targets, which will find application in quarantine laboratories, where parallel testing for diverse pathogens is essential. PMID:15800764

  5. Epitheliocystis hyperinfection in captive spotted eagle rays Aetobatus narinari associated with a novel Chlamydiales 16S rDNA signature sequence.


    Camus, Alvin; Soto, Esteban; Berliner, Aimee; Clauss, Tonya; Sanchez, Susan


    This report details 2 cases of epitheliocystis in spotted eagle rays Aetobatus narinari associated with a novel Chlamydiales 16S rDNA signature sequence. Epitheliocystis is a common disease of variable severity affecting >50 species of wild and cultured freshwater and marine teleosts. Disease in elasmobranchs is rarely reported and descriptions are limited. Occurring in gill and skin epithelium, lesions are characterized by large hypertrophied cells with basophilic inclusions containing Gram-negative, chlamydia-like bacteria. Acute lethargy, labored respiration, and abnormal swimming developed in a captive spotted eagle ray following an uneventful quarantine period, and mild epitheliocystis lesions were found microscopically. Three months later, a second animal exhibited similar signs. A gill clip revealed myriad spherical bodies identical to the previous case, and treatment with chloramphenicol and oxytetracycline was initiated. Despite therapy, respiration became irregular and euthanasia was elected. Histologically, epitheliocystis inclusions up to 200 µm filled approximately 80% of lamellar troughs. Multifocal mild hypertrophy and hyperplasia of lamellar tips was accompanied by mild to moderate infiltrates of granulocytes and lymphocytes. Electron microscopy revealed a homogeneous population of elongate chlamydia-like bacterial forms similar in size and morphology to the primary long cells described in teleosts. Immunohistochemical staining with a polyclonal anti-chlamydial lipopolysaccharide antibody was positive. Sequence analysis of a unique 296 bp Chlamydiales signature sequence amplicon isolated from the rays showed greatest homology (85 to 87%) to 'Candidatus Piscichlamydia salmonis'. PMID:23670076

  6. Evaluation of direct 16S rDNA sequencing as a metagenomics-based approach to screening bacteria in bottled water.


    Hansen, Trine; Skånseng, Beate; Hoorfar, Jeffrey; Löfström, Charlotta


    Deliberate or accidental contamination of food, feed, and water supplies poses a threat to human health worldwide. A rapid and sensitive detection technique that could replace the current labor-intensive and time-consuming culture-based methods is highly desirable. In addition to species-specific assays, such as PCR, there is a need for generic methods to screen for unknown pathogenic microorganisms in samples. This work presents a metagenomics-based direct-sequencing approach for detecting unknown microorganisms, using Bacillus cereus (as a model organism for B. anthracis) in bottled water as an example. Total DNA extraction and 16S rDNA gene sequencing were used in combination with principle component analysis and multicurve resolution to study detection level and possibility for identification. Results showed a detection level of 10(5) to 10(6) CFU/L. Using this method, it was possible to separate 2 B. cereus strains by the principal component plot, despite the close sequence resemblance. A linear correlation between the artificial contamination level and the relative amount of the Bacillus artificial contaminant in the metagenome was observed, and a relative amount value above 0.5 confirmed the presence of Bacillus. The analysis also revealed that background flora in the bottled water varied between the different water types that were included in the study. This method has the potential to be adapted to other biological matrices and bacterial pathogens for fast screening of unknown bacterial threats in outbreak situations.

  7. Evaluation of direct 16S rDNA sequencing as a metagenomics-based approach to screening bacteria in bottled water.


    Hansen, Trine; Skånseng, Beate; Hoorfar, Jeffrey; Löfström, Charlotta


    Deliberate or accidental contamination of food, feed, and water supplies poses a threat to human health worldwide. A rapid and sensitive detection technique that could replace the current labor-intensive and time-consuming culture-based methods is highly desirable. In addition to species-specific assays, such as PCR, there is a need for generic methods to screen for unknown pathogenic microorganisms in samples. This work presents a metagenomics-based direct-sequencing approach for detecting unknown microorganisms, using Bacillus cereus (as a model organism for B. anthracis) in bottled water as an example. Total DNA extraction and 16S rDNA gene sequencing were used in combination with principle component analysis and multicurve resolution to study detection level and possibility for identification. Results showed a detection level of 10(5) to 10(6) CFU/L. Using this method, it was possible to separate 2 B. cereus strains by the principal component plot, despite the close sequence resemblance. A linear correlation between the artificial contamination level and the relative amount of the Bacillus artificial contaminant in the metagenome was observed, and a relative amount value above 0.5 confirmed the presence of Bacillus. The analysis also revealed that background flora in the bottled water varied between the different water types that were included in the study. This method has the potential to be adapted to other biological matrices and bacterial pathogens for fast screening of unknown bacterial threats in outbreak situations. PMID:23971801

  8. Monitoring of Fasciola Species Contamination in Water Dropwort by cox1 Mitochondrial and ITS-2 rDNA Sequencing Analysis.


    Choi, In-Wook; Kim, Hwang-Yong; Quan, Juan-Hua; Ryu, Jae-Gee; Sun, Rubing; Lee, Young-Ha


    Fascioliasis, a food-borne trematode zoonosis, is a disease primarily in cattle and sheep and occasionally in humans. Water dropwort (Oenanthe javanica), an aquatic perennial herb, is a common second intermediate host of Fasciola, and the fresh stems and leaves are widely used as a seasoning in the Korean diet. However, no information regarding Fasciola species contamination in water dropwort is available. Here, we collected 500 samples of water dropwort in 3 areas in Korea during February and March 2015, and the water dropwort contamination of Fasciola species was monitored by DNA sequencing analysis of the Fasciola hepatica and Fasciola gigantica specific mitochondrial cytochrome c oxidase subunit 1 (cox1) and nuclear ribosomal internal transcribed spacer 2 (ITS-2). Among the 500 samples assessed, the presence of F. hepatica cox1 and 1TS-2 markers were detected in 2 samples, and F. hepatica contamination was confirmed by sequencing analysis. The nucleotide sequences of cox1 PCR products from the 2 F. hepatica-contaminated samples were 96.5% identical to the F. hepatica cox1 sequences in GenBank, whereas F. gigantica cox1 sequences were 46.8% similar with the sequence detected from the cox1 positive samples. However, F. gigantica cox1 and ITS-2 markers were not detected by PCR in the 500 samples of water dropwort. Collectively, in this survey of the water dropwort contamination with Fasciola species, very low prevalence of F. hepatica contamination was detected in the samples.

  9. Monitoring of Fasciola Species Contamination in Water Dropwort by cox1 Mitochondrial and ITS-2 rDNA Sequencing Analysis

    PubMed Central

    Choi, In-Wook; Kim, Hwang-Yong; Quan, Juan-Hua; Ryu, Jae-Gee; Sun, Rubing; Lee, Young-Ha


    Fascioliasis, a food-borne trematode zoonosis, is a disease primarily in cattle and sheep and occasionally in humans. Water dropwort (Oenanthe javanica), an aquatic perennial herb, is a common second intermediate host of Fasciola, and the fresh stems and leaves are widely used as a seasoning in the Korean diet. However, no information regarding Fasciola species contamination in water dropwort is available. Here, we collected 500 samples of water dropwort in 3 areas in Korea during February and March 2015, and the water dropwort contamination of Fasciola species was monitored by DNA sequencing analysis of the Fasciola hepatica and Fasciola gigantica specific mitochondrial cytochrome c oxidase subunit 1 (cox1) and nuclear ribosomal internal transcribed spacer 2 (ITS-2). Among the 500 samples assessed, the presence of F. hepatica cox1 and 1TS-2 markers were detected in 2 samples, and F. hepatica contamination was confirmed by sequencing analysis. The nucleotide sequences of cox1 PCR products from the 2 F. hepatica-contaminated samples were 96.5% identical to the F. hepatica cox1 sequences in GenBank, whereas F. gigantica cox1 sequences were 46.8% similar with the sequence detected from the cox1 positive samples. However, F. gigantica cox1 and ITS-2 markers were not detected by PCR in the 500 samples of water dropwort. Collectively, in this survey of the water dropwort contamination with Fasciola species, very low prevalence of F. hepatica contamination was detected in the samples. PMID:26537044

  10. Triploblastic relationships with emphasis on the acoelomates and the position of Gnathostomulida, Cycliophora, Plathelminthes, and Chaetognatha: a combined approach of 18S rDNA sequences and morphology.


    Giribet, G; Distel, D L; Polz, M; Sterrer, W; Wheeler, W C


    Triploblastic relationships were examined in the light of molecular and morphological evidence. Representatives for all triploblastic "phyla" (except Loricifera) were represented by both sources of phylogenetic data. The 18S ribosomal (rDNA) sequence data for 145 terminal taxa and 276 morphological characters coded for 36 supraspecific taxa were combined in a total evidence regime to determine the most consistent picture of triploblastic relationships for these data. Only triploblastic taxa are used to avoid rooting with distant outgroups, which seems to happen because of the extreme distance that separates diploblastic from triploblastic taxa according to the 18S rDNA data. Multiple phylogenetic analyses performed with variable analysis parameters yield largely inconsistent results for certain groups such as Chaetognatha, Acoela, and Nemertodermatida. A normalized incongruence length metric is used to assay the relative merit of the multiple analyses. The combined analysis having the least character incongruence yields the following scheme of relationships of four main clades: (1) Deuterostomia [((Echinodermata + Enteropneusta) (Cephalochordata (Urochordata + Vertebrata)))]; (2) Ecdysozoa [(((Priapulida + Kinorhyncha) (Nematoda + Nematomorpha)) ((Onychophora + Tardigrada) Arthropoda))]; (3) Trochozoa [((Phoronida + Brachiopoda) (Entoprocta (Nemertea (Sipuncula (Mollusca (Pogonophora (Echiura + Annelida)))))))]; and (4) Platyzoa [((Gnathostomulida (Cycliophora + Syndermata)) (Gastrotricha + Plathelminthes))]. Chaetognatha, Nemertodermatida, and Bryozoa cannot be assigned to any one of these four groups. For the first time, a data analysis recognizes a clade of acoelomates, the Platyzoa (sensu Cavalier-Smith, Biol. Rev. 73:203-266, 1998). Other relationships that corroborate some morphological analyses are the existence of a clade that groups Gnathostomulida + Syndermata (= Gnathifera), which is expanded to include the enigmatic phylum Cycliophora, as sister group

  11. Detecting a complex of cryptic species within Neoechinorhynchus golvani (Acanthocephala: Neoechinorhynchidae) inferred from ITSs and LSU rDNA gene sequences.


    Martínez-Aquino, Andrés; Reyna-Fabián, Miriam E; Rosas-Valdez, Rogelio; Razo-Mendivil, Ulises; de León, Gerardo Pérez-Ponce; García-Varela, Martín


    Neoechinorhynchus golvani is an intestinal parasite of freshwater and brackish water fishes distributed in Mexico. The genetic variability of 40 samples representing 12 populations from north, south, and central Mexico, and 1 from Costa Rica, was estimated by sequencing 2 nuclear genes (ITS1, 5.8S, ITS2, and LSU rDNA, including the domain D2 + D3). The length of both genes ranged from 700 to 779 base pairs (bp) and from 813 to 821 bp, for ITSs and LSU, respectively. The genetic divergence among populations ranged from 19.5 to 35.3% with ITSs and from 9.28 to 19.58% with LSU. Maximum likelihood and maximum parsimony analyses were performed for each data set and also for 2 combined data sets (ITSs + LSU rDNA with and without outgroups), showing strong similarities among trees, with high bootstrap support in all cases. Genetic divergence, in combination with phylogenetic analyses, suggested that the acanthocephalan N. golvani represents a complex of cryptic species, which is composed of at least 3 lineages. The first lineage, corresponding with N. golvani, shows a wide distribution, including localities from northeastern Mexico, southwards through central and southeastern Mexico, and further down to Costa Rica. This lineage is associated with cichlid fishes in strictly freshwater environments. Lineages 2 and 3 are distributed in brackish water systems along the Gulf of Mexico and Pacific slopes, respectively; both are associated with eleotrid fishes, and apparently represent 2 cryptic species. The diversification of the eleotrid and cichlid lineages seems to be the result of independent host-switching events from the ancestral population.

  12. Triploblastic relationships with emphasis on the acoelomates and the position of Gnathostomulida, Cycliophora, Plathelminthes, and Chaetognatha: a combined approach of 18S rDNA sequences and morphology.


    Giribet, G; Distel, D L; Polz, M; Sterrer, W; Wheeler, W C


    Triploblastic relationships were examined in the light of molecular and morphological evidence. Representatives for all triploblastic "phyla" (except Loricifera) were represented by both sources of phylogenetic data. The 18S ribosomal (rDNA) sequence data for 145 terminal taxa and 276 morphological characters coded for 36 supraspecific taxa were combined in a total evidence regime to determine the most consistent picture of triploblastic relationships for these data. Only triploblastic taxa are used to avoid rooting with distant outgroups, which seems to happen because of the extreme distance that separates diploblastic from triploblastic taxa according to the 18S rDNA data. Multiple phylogenetic analyses performed with variable analysis parameters yield largely inconsistent results for certain groups such as Chaetognatha, Acoela, and Nemertodermatida. A normalized incongruence length metric is used to assay the relative merit of the multiple analyses. The combined analysis having the least character incongruence yields the following scheme of relationships of four main clades: (1) Deuterostomia [((Echinodermata + Enteropneusta) (Cephalochordata (Urochordata + Vertebrata)))]; (2) Ecdysozoa [(((Priapulida + Kinorhyncha) (Nematoda + Nematomorpha)) ((Onychophora + Tardigrada) Arthropoda))]; (3) Trochozoa [((Phoronida + Brachiopoda) (Entoprocta (Nemertea (Sipuncula (Mollusca (Pogonophora (Echiura + Annelida)))))))]; and (4) Platyzoa [((Gnathostomulida (Cycliophora + Syndermata)) (Gastrotricha + Plathelminthes))]. Chaetognatha, Nemertodermatida, and Bryozoa cannot be assigned to any one of these four groups. For the first time, a data analysis recognizes a clade of acoelomates, the Platyzoa (sensu Cavalier-Smith, Biol. Rev. 73:203-266, 1998). Other relationships that corroborate some morphological analyses are the existence of a clade that groups Gnathostomulida + Syndermata (= Gnathifera), which is expanded to include the enigmatic phylum Cycliophora, as sister group

  13. Optimized sequence retrieval from single bands of temperature gradient gel electrophoresis profiles of the amplified 16S rDNA fragments from an activated sludge system.


    Zhang, Xueli; Yan, Xing; Gao, Pingping; Wang, Linghua; Zhou, Zhihua; Zhao, Liping


    Sequence retrieval from single bands of polymerase chain reaction (PCR)-denaturing gel electrophoresis (DGE) profiles is an important but often difficult step for molecular diversity analysis of complex microbial communities such as activated sludge systems. We analyzed the temperature gradient gel electrophoresis (TGGE) profiles of PCR-amplified 16S rDNA fragments from an activated sludge sample of a coking wastewater treatment plant. Single bands were excised, and a clone library was constructed for each. Sequence heterogeneity in each single band was found to be significantly overestimated due to single-stranded DNA (ssDNA) contamination formed during the PCR amplification, since only 10-60% of library clones of each single TGGE band had identical migration behavior compared with the parent band. Three methods, digestion with mung bean nuclease, optimization of PCR amplification, and purification via denatured polyacrylamide gel electrophoresis (d-PAGE), were compared for their ability to minimize ssDNA contamination, with the last one being the most efficient. After using d-PAGE to minimize ssDNA to a nearly nondetectable level, 70-100% of library clones for each single TGGE band had identical migration compared with the parent band. Several sequences were found in each of six single bands, and this co-migration could be predicted with the Poland software. The predominant bacteria of the activated sludge were assessed via a combination of sequence retrieval from each single TGGE band and band intensity analysis. Only beta and alpha subclasses of the Proteobacteria were detected, 93.8% and 6.2%, respectively. Our work suggests that prior to constructing a clone library to retrieve the actual sequence diversity of a single DGE band, it is advisable to minimize ssDNA contamination to a nondetectable level.

  14. Phylogenetic relationships of Paradiclybothrium pacificum and Diclybothrium armatum (Monogenoidea: Diclybothriidae) inferred from 18S rDNA sequence data.


    Rozhkovan, Konstantin V; Shedko, Marina B


    The Diclybothriidae (Monogenoidea: Oligonchoinea) includes specific parasites of fishes assigned to the ancient order Acipenseriformes. Phylogeny of the Diclybothriidae is still unclear despite several systematic studies based on morphological characters. Together with the closely related Hexabothriidae represented by parasites of sharks and ray-fishes, the position of Diclybothriidae in different taxonomical systems has been matter of discussion. Here, we present the first molecular data on Diclybothriidae. The SSU rRNA gene was used to investigate the phylogenetic position of Paradiclybothrium pacificum and Diclybothrium armatum among the other Oligonchoinea. Complete nucleotide sequences of P. pacificum and D. armatum demonstrated high identity (98.53%) with no intraspecific sequence variability. Specimens of D. armatum were obtained from different hosts (Acipenser schrenckii and Huso dauricus); however, variation by host was not detected. The sequence divergence and phylogenetic trees data show that Diclybothriidae and Hexabothriidae are more closely related to each other than with other representatives of Oligonchoinea.

  15. Eukaryotic diversity in premise drinking water using 18S rDNA sequencing: implications for health risks

    EPA Science Inventory

    The goal of this study was to characterize microbial eukaryotes over a 12 month period, so as to provide insight into the occurrence of potentially important predators and bacterial hosts in hot and cold premise plumbing. Nearly 6,300 partial (600 bp) 18S rRNA gene sequences from...

  16. Morphology and morphogenesis of a novel mangrove ciliate, Sterkiella subtropica sp. nov. (Protozoa, Ciliophora, Hypotrichia), with phylogenetic analyses based on small-subunit rDNA sequence data.


    Chen, Xumiao; Gao, Feng; Al-Farraj, Saleh A; Al-Rasheid, Khaled A S; Xu, Kuidong; Song, Weibo; Song, Weibo


    A novel marine hypotrichous ciliate, Sterkiella subtropica sp. nov., was recently isolated from a mangrove wetland in Hong Kong. Its morphology, morphogenesis and systematic position have been investigated. The novel species is diagnosed by combined features of morphology, ciliature and nuclear apparatus, while its ontogenetic events present a stable pattern: (i) the six streaks of the undulating membrane (UM) and cirral anlagen are segmented in a 1 : 3 : 3 : 3 : 4 : 4 pattern from left to right, and form three frontal, four frontoventral, one buccal, five ventral and five transverse cirri; (ii) the dorsal structure is similar to most other oxytrichids; that is, in a '4+2' pattern with three caudal cirri being formed. Based on the small-subunit rDNA sequence, the novel species is different from its congeners by between 21 and 35 bp, with sequence identities from 0.978 to 0.987. All molecular trees exhibited a similar topology: the monophyly of species of the genus Sterkiella is not completely supported in our analyses, and approximately unbiased tests (both including and excluding the novel species) also reject the possibility that Sterkiella is a monophyletic lineage, as indicated by the morphology-based classification. PMID:25872955

  17. Molecular phylogenetic studies based on rDNA ITS, cpDNA trnL intron sequence and cladode characteristics in nine Protasparagus taxa.


    Saha, Partha Sarathi; Ray, Sudipta; Sengupta, Mainak; Jha, Sumita


    The genus Asparagus comprises three subgenera of cladode bearing plants: Protasparagus, Asparagus, and Myrsiphyllum. The interspecific delimitation of the subgenus Protasparagus is ill-defined till date. In the present study, interspecific phylogenetic relationships among nine taxa of Protasparagus based on ribosomal DNA internal transcribed spacer region (ITS1-5.8S-ITS2) sequence and the chloroplast DNA trnL intron sequence conservation with their cladode morphology, anatomy, and stomatal characteristics have been analyzed for the first time. The monophyletic subgenus Protasparagus could be resolved into four strongly supported distinct subclades (I, II, III and IV) suggesting that the rDNA and cpDNA molecular phylogenies are explicitly congruent with the cladode characteristics of the subgenus Protasparagus. The present study also confirms the existing subgeneric classification of the genus Asparagus with the monophyletic origin of the dioecious subgenus Asparagus. The present work brings out phylogenetic and taxonomic relationships within the studied taxa of the subgenus Protasparagus therefore providing important background information for further studies on biogeography of a wide range of species. PMID:25534258

  18. Morphology and SSU rDNA sequence analysis of two hypotrichous ciliates (Protozoa, Ciliophora, Hypotrichia) including the new species Metaurostylopsis parastruederkypkeae n. sp.

    NASA Astrophysics Data System (ADS)

    Lu, Borong; Wang, Chundi; Huang, Jie; Shi, Yuhong; Chen, Xiangrui


    The morphology and phylogeny of two hypotrichous ciliates, Metaurostylopsis parastruederkypkeae n. sp. and Neourostylopsis flavicana (Wang et al., 2011) Chen et al., 2013 were investigated based on morphology, infraciliature and the small subunit (SSU) ribosomal RNA gene (rRNA) sequence. The new species, M. parastruederkypkeae n. sp. was identified according to its characteristics: body shape ellipsoidal, size about (165-200) × (45-60) μm in vivo, cell color reddish; two types of cortical granules including wheat grain-like and yellow-greenish larger ones along the marginal cirri rows and dorsal kineties and dot-like and reddish smaller ones, grouped around marginal cirri on ventral side and arranged in short lines on dorsal side; 26-41 adoral membranelles; three frontal and one parabuccal, five to seven frontoterminal, one buccal, and three to six transverse cirri; seven to thirteen midventral pairs; five to nine unpaired ventral cirri, five to seven left and three to five right marginal rows; and three complete dorsal kineties. Phylogenetic analysis based on SSU rDNA sequences showed that both Metaurostylopsis and Neourostylopsis are monophyletic. As the internal relationship between and within both genera are not clear, further studies on the species in these two genera are necessary. The key characteristics of all known twelve Metaurostylopsis-Apourostylopsis-Neourostylopsis species complex were updated.

  19. Morphology and SSU rDNA sequence analysis of two hypotrichous ciliates (Protozoa, Ciliophora, Hypotrichia) including the new species Metaurostylopsis parastruederkypkeae n. sp.

    NASA Astrophysics Data System (ADS)

    Lu, Borong; Wang, Chundi; Huang, Jie; Shi, Yuhong; Chen, Xiangrui


    The morphology and phylogeny of two hypotrichous ciliates, Metaurostylopsis parastruederkypkeae n. sp. and Neourostylopsis flavicana (Wang et al., 2011) Chen et al., 2013 were investigated based on morphology, infraciliature and the small subunit (SSU) ribosomal RNA gene (rRNA) sequence. The new species, M. parastruederkypkeae n. sp. was identified according to its characteristics: body shape ellipsoidal, size about (165-200) × (45-60) μm in vivo, cell color reddish; two types of cortical granules including wheat grain-like and yellow-greenish larger ones along the marginal cirri rows and dorsal kineties and dot-like and reddish smaller ones, grouped around marginal cirri on ventral side and arranged in short lines on dorsal side; 26-41 adoral membranelles; three frontal and one parabuccal, five to seven frontoterminal, one buccal, and three to six transverse cirri; seven to thirteen midventral pairs; five to nine unpaired ventral cirri, five to seven left and three to five right marginal rows; and three complete dorsal kineties. Phylogenetic analysis based on SSU rDNA sequences showed that both Metaurostylopsis and Neourostylopsis are monophyletic. As the internal relationship between and within both genera are not clear, further studies on the species in these two genera are necessary. The key characteristics of all known twelve Metaurostylopsis-Apourostylopsis-Neourostylopsis species complex were updated.

  20. Phylogenetic relationships of the soybean sudden death syndrome pathogen Fusarium solani f. sp. phaseoli inferred from rDNA sequence data and PCR primers for its identification.


    O'Donnell, K; Gray, L E


    Phylogenetic relationships of several species within the Fusarium solani-complex were investigated using characters from the nuclear ribosomal DNA. Genetic variation within 24 isolates, including 5 soybean sudden death syndrome (SDS) strains, was assessed using rDNA sequence data and restriction fragment length polymorphic markers. By these techniques, the causal agent of soybean SDS was identified as F. solani f. sp. phaseoli. In separate cladistic analyses, Plectosphaerella cucumerina and Nectria cinnabarina or F. ventricosum were used for rooting purposes. Monophyly of the F. solani-complex was strongly supported by bootstrap and decay analyses. Parsimony analysis indicates that this complex is composed of a number of phylogenetically distinct species, including Neocosmospora vasinfecta, F. solani f. sp. phaseoli, and biological species designated as MPI, MPV, and MPVI of N. haematococca. The results demonstrate complete congruence between biological and phylogenetic species within the N. haematococca-complex. In addition, DNA sequence data were used to design a PCR primer pair which could specifically amplify DNA from isolates of the SDS pathogen from infected plants. PMID:7579615

  1. Microheterogeneity and coevolution: an examination of rDNA sequence characteristics in Neoparamoeba pemaquidensis and its prokinetoplastid endosymbiont.


    Caraguel, Charles G B; O'Kelly, Charles J; Legendre, Pierre; Frasca, Salvatore; Gast, Rebecca J; Després, Béatrice M; Cawthorn, Richard J; Greenwood, Spencer J


    Neoparamoeba pemaquidensis, the etiological agent of amoebic gill disease, has shown surprising sequence variability among different copies of the 18S ribosomal RNA gene within an isolate. This intra-genomic microheterogeneity was confirmed and extended to an analysis of the internal transcribed spacer (ITS) region. High levels of intra-genomic nucleotide diversity (Pi=0.0201-0.0313) were found among sequenced ITS regions from individual host amoeba isolates. In contrast, the ITS region of its endosymbiont revealed significantly lower levels of intra-genomic nucleotide diversity (Pi=0.0028-0.0056) compared with the host N. pemaquidensis. Phylogenetic and ParaFit coevolution analyses involving N. pemaquidensis isolates and their respective endosymbionts confirmed a significant coevolutionary relationship between the two protists. The observation of non-shared microheterogeneity and coevolution emphasizes the complexity of the interactions between N. pemaquidensis and its obligate endosymbiont.

  2. Eukaryotic diversity in premise drinking water using 18S rDNA sequencing: implications for health risks.


    Buse, Helen Y; Lu, Jingrang; Struewing, Ian T; Ashbolt, Nicholas J


    The goal of this study was to characterize microbial eukaryotes over a 12-month period to provide insight into the occurrence of potential bacterial predators and hosts in premise plumbing. Nearly 6,300 partial 18S rRNA gene sequences from 24 hot (36.9-39.0 °C) and cold (6.8-29.1 °C) drinking water samples were analyzed and classified into major eukaryotic groups. Each major group, consisting of free-living amoebae (FLA)/protozoa, algae, copepods, dinoflagellates, fungi, nematodes, and unique uncultured eukaryotic sequences, showed limited diversity dominated by a few distinct populations, which may be characteristic of oligotrophic environments. Changes in the relative abundance of predators such as nematodes, copepods, and FLA appear to be related to temperature and seasonal changes in water quality. Sequences nearly identical to FLA such as Hartmannella vermiformis, Echinamoeba thermarmum, Pseudoparamoeba pagei, Protacanthamoeba bohemica, Platyamoeba sp., and Vannella sp. were obtained. In addition to FLA, various copepods, rotifers, and nematodes have been reported to internalize viral and bacterial pathogens within drinking water systems thus potentially serving as transport hosts; implications of which are discussed further. Increasing the knowledge of eukaryotic occurrence and their relationship with potential pathogens should aid in assessing microbial risk associated with various eukaryotic organisms in drinking water.

  3. A universal DNA extraction and PCR amplification method for fungal rDNA sequence-based identification.


    Romanelli, A M; Fu, J; Herrera, M L; Wickes, B L


    Accurate identification of fungal pathogens using a sequence-based approach requires an extraction method that yields template DNA pure enough for polymerase chain reaction (PCR) or other types of amplification. Therefore, the objective of this study was to develop and standardise a rapid, inexpensive DNA extraction protocol applicable to the major fungal phyla, which would yield sufficient template DNA pure enough for PCR and sequencing. A total of 519 clinical and culture collection strains, comprised of both yeast and filamentous fungi, were prepared using our extraction method to determine its applicability for PCR, which targeted the ITS and D1/D2 regions in a single PCR amplicon. All templates were successfully amplified and found to yield the correct strain identification when sequenced. This protocol could be completed in approximately 30 min and utilised a combination of physical and chemical extraction methods but did not require organic solvents nor ethanol precipitation. The method reduces the number of tube manipulations and yielded suitable template DNA for PCR amplification from all phyla that were tested.



    Handy, Sara M; Bachvaroff, Tsvetan R; Timme, Ruth E; Wayne Coats, D; Kim, Sunju; Delwiche, Charles F


    Dinoflagellates are a highly diverse and environmentally important group of protists with relatively poor resolution of phylogenetic relationships, particularly among heterotrophic species. We examined the phylogeny of several dinophysiacean dinoflagellates using samples collected from four Atlantic sites. As a rule, 3.5 kb of sequence including the nuclear ribosomal genes SSU, 5.8S, LSU, plus their internal transcribed spacer (ITS) 1 and 2 regions were determined for 26 individuals, including representatives of two genera for which molecular data were previously unavailable, Ornithocercus F. Stein and Histioneis F. Stein. In addition, a clone library targeting the dinophysiacean ITS2 and LSU sequences was constructed from bulk environmental DNA from three sites. Three phylogenetic trees were inferred from the data, one using data from this study for cells identified to genus or species (3.5 kb, 28 taxa); another containing dinoflagellate SSU submissions from GenBank and the 12 new dinophysiacean sequences (1.9 kb, 56 taxa) from this study; and the third tree combing data from identified taxa, dinophysiacean GenBank submissions, and the clone libraries from this study (2.1 kb, 136 taxa). All trees were congruent and indicated a distinct division between the genera Phalacroma F. Stein and Dinophysis Ehrenb. The cyanobionts containing genera Histioneis and Ornithocercus were also monophyletic. This was the largest molecular phylogeny of dinophysoid taxa performed to date and was consistent with the view that the genus Phalacroma may not be synonymous with Dinophysis.

  5. Characterization and physical mapping of 18S and 5S ribosomal genes in Indian major carps (Pisces, Cyprinidae).


    Ravindra Kumar; Kushwaha, Basdeo; Nagpure, Naresh S


    Characterization of the major (18S) and minor (5S) ribosomal RNA genes were carried out in three commercially important Indian major carp (IMC) species, viz. Catla catla, Labeo rohita and Cirrhinus mrigala along with their physical localizations using dual colour fluorescence in situ hybridization. The diploid chromosome number in the above carps was confirmed to be 50 with inter-species karyo-morphological variations. The 18S rDNA signals were observed on 3 pair of chromosomes in C. catla and L. rohita, and two pairs in C. mrigala. The 5S rDNA signal was found on single pair of chromosome in all the species with variation in their position on chromosomes. The sequencing of 18S rDNA generated 1804, 1805 and 1805 bp long fragments, respectively, in C. catla, L. rohita and C. mrigala with more than 98% sequence identity among them. Similarly, sequencing of 5S rDNA generated 191 bp long fragments in the three species with 100% identity in coding region and 23.2% overall variability in non-transcribed spacer region. Thus, these molecular markers could be used as species-specific markers for taxonomic identification and might help in understanding the genetic diversity, genome organization and karyotype evolution of these species.

  6. Molecular Phylogeny of Cypridoid Freshwater Ostracods (Crustacea: Ostracoda), Inferred from 18S and 28S rDNA Sequences.


    Hiruta, Shimpei F; Kobayashi, Norio; Katoh, Toru; Kajihara, Hiroshi


    With the aim of exploring phylogenetic relationships within Cypridoidea, the most species-rich superfamily among the podocopidan ostracods, we sequenced nearly the entire 18S rRNA gene (18S) and part of the 28S rRNA gene (28S) for 22 species in the order Podocopida, with representatives from all the major cypridoid families. We conducted phylogenetic analyses using the methods of maximum likelihood, minimum evolution, and Bayesian analysis. Our analyses showed monophyly for Cyprididae, one of the four families currently recognized in Cypridoidea. Candonidae turned out to be paraphyletic, and included three clades corresponding to the subfamilies Candoninae, Paracypridinae, and Cyclocypridinae. We propose restricting the name Candonidae s. str. to comprise what is now Candoninae, and raising Paracypridinae and Cyclocyprininae to family rank within the superfamily Cypridoidea.

  7. Cryptic diversity of free-living parabasalids, Pseudotrichomonas keilini and Lacusteria cypriaca n. g., n. sp., as inferred from small subunit rDNA sequences.


    Yubuki, Naoji; Céza, Vít; Cepicka, Ivan; Yabuki, Akinori; Inagaki, Yuji; Nakayama, Takeshi; Inouye, Isao; Leander, Brian S


    Ultrastructural and molecular phylogenetic evidence indicate that the Parabasalia consists of seven main subgroups: the Trichomonadida, Honigbergiellida, Hypotrichomonadida, Tritrichomonadida, Cristamonadida, Spirotrichonymphida, and Trichonymphida. Only five species of free-living parabasalids are known: Monotrichomonas carabina, Ditrichomonas honigbergii, Honigbergiella sp., Tetratrichomonas undula, and Pseudotrichomonas keilini. Phylogenetic analyses show that free-living species do not form a clade and instead branch in several different positions within the context of their parasitic relatives. Because the diversity of free-living parabasalids is poorly understood, the systematics of these lineages is in a significant state of disarray. In order to better understand the phylogenetic distribution of free-living parabasalids, we sequenced the small subunit rDNA from three different strains reminiscent of P. keilini; the strains were isolated from different geographical locations: (1) mangrove sediments in Japan and (2) sediments in Cyprus. These data demonstrated that the free-living parabasalids P. keilini and Lacusteria cypriaca n. g., n. sp., form a paraphyletic assemblage near the origin of a clade consisting mostly of parasitic trichomonadids (e.g. Trichomonas vaginalis). This paraphyletic distribution of similar morphotypes indicates that free-living trichomonadids represent a compelling example of morphostasis that provides insight into the suite of features present in the most recent free-living ancestor of their parasitic relatives. PMID:20880033

  8. [Phylogenetic relations of Salix L. subg. Salix species (Salicaceae) according to sequencing data of intergenic spacers of chloroplasic genomes and ITS rDNA].


    Barkalov, V Iu; Kozyrenko, M M


    A phylogenetic analysis based on a comparison of nucleotide sequences of six regions from cpDNA and ITS rDNA (petN-psbM, trnD-trnT, trnC-petN, psaA-ycf3, petG-trnP, and rpoB-trnC) allowed for elucidating the relationship among species and sections belonging to the Salix subgenus and, more generally, to the Salix genus, as well as revealing the relations of the Chosenia genus. The definition of the subgenera of Pleuradenia (including the Urbanianea genus and the Chosenia genus), Salix (without the Triandrae section), Triandrae, and Longifoliae is essentially consistent with current classification schemes of the Salix genus. The previously defined genera of Chosenia and Toisusu (Urbanianea) are not only joined with the Salix genus but are also closely related between themselves. The Protitea subgenus only corresponds to the American species of the Humboldtianae section (S. humboldtiana, S. amygdaloides, S. gooddingii). The relationship of S. chaenomeloides, which is a nomenclatural type of this subgenus, as well as the relationship of the Wilsonia section, remains unresolved. The Humboldtianae section should be interpreted more narrowly, apparently, separating the Acmophillae and Tetraspermae sections from it. The monotypic American Floridanae section is related to the Salix, Salicaster, Tetraspermae, and Wilsonia.

  9. Molecular phylogenetics of Floridosentis ward, 1953 (Acanthocephala: Neoechinorhynchidae) parasites of mullets (Osteichthyes) from Mexico, using 28S rDNA sequences.


    Rosas-Valdez, Rogelio; Morrone, Juan J; García-Varela, Martín


    Species of Floridosentis (Acanthocephala) are common parasites of mullets (Mugil spp., Mugilidae) found in tropical marine and brackish water in the Americas. Floridosentis includes 2 species distributed in Mexico, i.e., Floridosentis pacifica, restricted to the Pacific Ocean near Salina Cruz, Oaxaca, and Floridosentis mugilis, distributed along the coast of the Pacific Ocean and the Gulf of Mexico. We sampled 18 populations of F. mugilis and F. pacifica (12 from the Pacific and 6 from the Gulf of Mexico) and sequenced a fragment of the rDNA large subunit to evaluate phylogenetic relationships of populations of Floridosentis spp. from Mexico. Species identification of museum specimens of F. mugilis from the Pacific Ocean was confirmed by examination of morphology traits. Phylogenetic trees inferred with maximum parsimony, maximum likelihood, and Bayesian inference indicate that Floridosentis is monophyletic comprising of 2 major well-supported clades, the first clade corresponding to F. mugilis from the Gulf of Mexico, and the second to F. pacifica from the Pacific Ocean. Genetic divergence between species ranged from 7.68 to 8.60%. Intraspecific divergence ranged from 0.14 to 0.86% for F. mugilis and from 1.72 to 4.49% for F. pacifica. Data obtained from diagnostic characters indicate that specimens from the Pacific Ocean in Mexico have differences in some traits among locations. These results are consistent with the phylogenetic hypothesis, indicating that F. pacifica is distributed in the Pacific Ocean in Mexico with 3 major lineages.

  10. Interstitial Telomeric Sequences (ITS) and major rDNA mapping reveal insights into the karyotypical evolution of Neotropical leaf frogs species (Phyllomedusa, Hylidae, Anura)

    PubMed Central


    Background The combination of classical cytogenetics with molecular techniques represents a powerful approach for the comparative analysis of the genome, providing data for the systematic identification of chromosomal homologies among species and insights into patterns of chromosomal evolution within phylogenetically related groups. Here, we present cytogenetic data on four species of Neotropical treefrogs of the genus Phyllomedusa (P. vaillantii, P. tarsius, P. distincta, and P. bahiana), collected in Brazil and Ecuador, with the aim of contributing to the understanding of the chromosomal diversification of this genus. Results With the exception of P. tarsius, which presented three telocentric pairs, all the species analyzed had conservative karyotypic features. Heterochromatic patterns in the genomes of these species revealed by C-banding and fluorochrome staining indicated the presence of a large number of non-centromeric blocks. Using the Ag-NOR method and FISH with an rDNA 28S probe, we detected NOR in the pericentromeric region of the short arm of pair 7 in P. vaillantii, pair 1 in P. tarsius, chromosomes 1 and 9 in P. distincta, and in chromosome 9 in P. bahiana, in addition to the presence of NOR in one homologue of chromosome pair 10 in some individuals of this species. As expected, the telomeric probe detected the terminal regions of the chromosomes of these four species, although it also detected Interstitial Telomeric Sequences (ITS) in some chromosomes of the P. vaillantii, P. distincta and P. bahiana karyotypes. Conclusion A number of conservative chromosomal structures permitted the recognition of karyotypic homologies. The data indicate that the presence of a NOR-bearing chromosome in pair 9 is the plesiomorphic condition in the P. burmeisteri group. The interspecific and intraspecific variation in the number and location of rDNA sites reflects the rapid rate of evolution of this character in Phyllomedusa. The ITS detected in this study does not

  11. Phylogeny of giant clams (Cardiidae: Tridacninae) based on partial mitochondrial 16S rDNA gene sequences.


    Schneider, J A; Foighil, D O


    We have performed the first DNA molecular phylogenetic analysis of giant clams. An approximately 462-nucleotide fragment of the mitochondrial large ribosomal subunit (16S) was sequenced for all eight species of giant clams and two species of an outgroup taxon, the edible cockle Cerastoderma. The data were analyzed using a maximum parsimony approach and a single most parsimonious tree was found. The resulting phylogenetic hypothesis indicates that the genera Hippopus and Tridacna are monophyletic sister taxa. Tridacna (Chametrachea) is the sister taxon to (T. tevoroa (T. derasa + T. gigas)), with these latter three taxa all being placed in a single subgenus, Tridacna (Tridacna). The number of recognized giant clam species has increased by one-third over the last two decades with the discovery of two rare new species having restricted geographic ranges: H. porcellanus (Palau and the Sulu Archipelago) and T. tevoroa (Tonga and Fiji). These two species lack a known fossil record but exhibit greater genetic distances from sister taxa than do extant giant clam species pairs which are recognizable in Neogene strata, e.g., T. gigas/T. derasa and T. maxima/T. squamosa. We propose that the two new species represent ancient relict lineages of Miocene origin.

  12. Deodorization of pig slurry and characterization of bacterial diversity using 16S rDNA sequence analysis.


    Hwang, Ok-Hwa; Raveendar, Sebastian; Kim, Young-Ju; Kim, Ji-Hun; Choi, Jung-Woo; Kim, Tae-Hun; Choi, Dong-Yoon; Jeon, Che Ok; Cho, Sung-Back; Lee, Kyung-Tai


    The concentration of major odor-causing compounds including phenols, indoles, short-chain fatty acids (SCFAs) and branched chain fatty acids (BCFAs) in response to the addition of powdered horse radish (PHR) and spent mushroom compost (SMC) was compared with control non-treated slurry (CNS) samples. A total of 97,465 rDNAs sequence reads were generated from three different samples (CNS, n = 2; PHR, n = 3; SMC, n = 3) using bar-coded pyrosequencing. The number of operational taxonomic units (OTUs) was lower in the PHR slurry compared with the other samples. A total of 11 phyla were observed in the slurry samples, while the phylogenetic analysis revealed that the slurry microbiome predominantly comprised members of the Bacteroidetes, Firmicutes, and Proteobacteria phyla. The rarefaction analysis showed the bacterial species richness varied among the treated samples. Overall, at the OTU level, 2,558 individual genera were classified, 276 genera were found among the three samples, and 1,832 additional genera were identified in the individual samples. A principal component analysis revealed the differences in microbial communities among the CNS, PHR, and SMC pig slurries. Correlation of the bacterial community structure with the Kyoto Encyclopedia of Genes and Genomes (KEGG) predicted pathways showed that the treatments altered the metabolic capabilities of the slurry microbiota. Overall, these results demonstrated that the PHR and S MC treatments significantly reduced the malodor compounds in pig slurry (P < 0.05). PMID:25359269

  13. Phylogeny of the major lineages of Membracoidea (Insecta: Hemiptera: Cicadomorpha) based on 28S rDNA sequences.


    Dietrich, C H; Rakitov, R A; Holmes, J L; Black, W C


    Analysis of sequences from a 3.5-kb region of the nuclear ribosomal 28S DNA gene spanning divergent domains D2-D10 supports the hypothesis, based on fossil, biogeographic, and behavioral evidence, that treehoppers (Aetalionidae and Membracidae) are derived from leafhoppers (Cicadellidae). Maximum-parsimony analysis indicated that treehoppers are the sister group of a lineage comprising the currently recognized cicadellid subfamilies Agalliinae, Megophthalminae, Adelungiinae, and Ulopinae. Based on this phylogenetic estimate, the derivation of treehoppers approximately coincided with shifts in physiology and behavior, including loss of brochosome production and a reversal from active, jumping nymphs to sessile, nonjumping nymphs. Myerslopiidae, traditionally placed as a tribe of the cicadellid subfamily Ulopinae, represented a basal lineage distinct from other extant membracoids. The analysis recovered a large leafhopper lineage comprising a polyphyletic Deltocephalinae (sensu stricto) and its apparent derivatives Koebeliinae, Eupelicinae (polyphyletic), Selenocephalinae, and Penthimiinae. Clades comprising Macropsinae, Neocoelidiinae, Scarinae, Iassinae, Coelidiinae, Eurymelinae + Idiocerinae, Evacanthini + Pagaroniini, Aphrodinae + Ledrinae (in part), Stenocotini + Tartessinae, and Cicadellini + Proconiini were also recovered with moderate to high branch support. Cicadellinae (sensu lato), Ledrinae, Typhlocybinae, and Xestocephalinae were consistently polyphyletic on the most-parsimonious topologies, but constraining these groups to be monophyletic did not significantly increase the length of the cladograms. Relationships among the major lineages received low branch support, suggesting that more data are needed to provide a robust phylogenetic estimate.

  14. Deodorization of pig slurry and characterization of bacterial diversity using 16S rDNA sequence analysis.


    Hwang, Ok-Hwa; Raveendar, Sebastian; Kim, Young-Ju; Kim, Ji-Hun; Choi, Jung-Woo; Kim, Tae-Hun; Choi, Dong-Yoon; Jeon, Che Ok; Cho, Sung-Back; Lee, Kyung-Tai


    The concentration of major odor-causing compounds including phenols, indoles, short-chain fatty acids (SCFAs) and branched chain fatty acids (BCFAs) in response to the addition of powdered horse radish (PHR) and spent mushroom compost (SMC) was compared with control non-treated slurry (CNS) samples. A total of 97,465 rDNAs sequence reads were generated from three different samples (CNS, n = 2; PHR, n = 3; SMC, n = 3) using bar-coded pyrosequencing. The number of operational taxonomic units (OTUs) was lower in the PHR slurry compared with the other samples. A total of 11 phyla were observed in the slurry samples, while the phylogenetic analysis revealed that the slurry microbiome predominantly comprised members of the Bacteroidetes, Firmicutes, and Proteobacteria phyla. The rarefaction analysis showed the bacterial species richness varied among the treated samples. Overall, at the OTU level, 2,558 individual genera were classified, 276 genera were found among the three samples, and 1,832 additional genera were identified in the individual samples. A principal component analysis revealed the differences in microbial communities among the CNS, PHR, and SMC pig slurries. Correlation of the bacterial community structure with the Kyoto Encyclopedia of Genes and Genomes (KEGG) predicted pathways showed that the treatments altered the metabolic capabilities of the slurry microbiota. Overall, these results demonstrated that the PHR and S MC treatments significantly reduced the malodor compounds in pig slurry (P < 0.05).

  15. DNA sequence heterogeneity in the three copies of the long 16S-23S rDNA spacer of Enterococcus faecalis isolates.


    Gürtler, V; Rao, Y; Pearson, S R; Bates, S M; Mayall, B C


    The possibility of intragenic heterogeneity between copies of the long intergenic (16S-23S rDNA) spacer region (LISR) was investigated by specific amplification of this region from 21 Enterococcus faecalis isolates. Three copies of the LISR (rrnA, B and C) were demonstrated by hybridization of the LISR to genomic DNA cleaved with I-Ceul and SmaI. When the LISR amplicon was digested with Tsp509I, two known nucleotide substitutions were detected, one 4 nt upstream from the 5' end of the tRNA(ala) gene (allele rrnB has the Tsp509I site and rrnA and C do not) and the other 22 nt downstream from the 3' end of the tRNA(ala) gene (rrnC has the Tsp509I site). Sequence differences at these sites were detected at the allelic level (alleles rrnA, B and C) and different combinations of these alleles were designated Tsp Types. Using densitometry to analyse bands from electrophoresis gels, the intra-isolate ratios of the separate alleles (rrnA:rrnB:rrnC) were determined in each Tsp Type: I (0:3:0), II (1:2:0), III (2:0:1), IV (3:0:0), V (2:1:0) and VI (1:1:1). Sequence variation between the three copies of the LISR was confirmed by the detection of at least five other intra-isolate nucleotide substitutions using heteroduplex analysis by conformation-sensitive gel electrophoresis (CSGE) that were not detected by Tsp509I cleavage. Perpendicular denaturing gradient gel electrophoresis was capable of resolving homoduplexes; six to seven out of a possible nine curves were obtained in some isolates. In the isolate where seven curves were obtained one or more further nucleotide substitutions, not detected by Tsp509I cleavage or CSGE, were detected. On the basis of LISR sequence heterogeneity, isolates were categorized into homogeneous (only one allele sequence present) and heterogeneous (two or three allele sequences present). The transition between homogeneous and heterogeneous LISRs may be useful in studying evolutionary mechanisms between E. faecalis isolates.

  16. Evaluation of the effects of intrapartum antibiotic prophylaxis on newborn intestinal microbiota using a sequencing approach targeted to multi hypervariable 16S rDNA regions.


    Aloisio, Irene; Quagliariello, Andrea; De Fanti, Sara; Luiselli, Donata; De Filippo, Carlotta; Albanese, Davide; Corvaglia, Luigi Tommaso; Faldella, Giacomo; Di Gioia, Diana


    Different factors are known to influence the early gut colonization in newborns, among them the perinatal use of antibiotics. On the other hand, the effect on the baby of the administration of antibiotics to the mother during labor, referred to as intrapartum antibiotic prophylaxis (IAP), has received less attention, although routinely used in group B Streptococcus positive women to prevent the infection in newborns. In this work, the fecal microbiota of neonates born to mothers receiving IAP and of control subjects were compared taking advantage for the first time of high-throughput DNA sequencing technology. Seven different 16S rDNA hypervariable regions (V2, V3, V4, V6 + V7, V8, and V9) were amplified and sequenced using the Ion Torrent Personal Genome Machine. The results obtained showed significant differences in the microbial composition of newborns born to mothers who had received IAP, with a lower abundance of Actinobacteria and Bacteroidetes as well as an overrepresentation of Proteobacteria. Considering that the seven hypervariable regions showed different discriminant ability in the taxonomic identification, further analyses were performed on the V4 region evidencing in IAP infants a reduced microbial richness and biodiversity, as well as a lower number of bacterial families with a predominance of Enterobacteriaceae members. In addition, this analysis pointed out a significant reduction in Bifidobacterium spp. strains. The reduced abundance of these beneficial microorganisms, together with the increased amount of potentially pathogenic bacteria, may suggest that IAP infants are more exposed to gastrointestinal or generally health disorders later in age. PMID:26971496

  17. Phylogenetic position of the genus Cyrtostrombidium, with a description of Cyrtostrombidium paralongisomum nov. spec. and a redescription of Cyrtostrombidium longisomum Lynn & Gilron, 1993 (Protozoa, Ciliophora) based on live observation, protargol impregnation, and 18S rDNA sequences.


    Tsai, Sheng-Fang; Chen, Wei-Ting; Chiang, Kuo-Ping


    We redescribe Cyrtostrombidium longisomum Lynn & Gilron, 1993, the type species of the genus Cyrtostrombidium, and describe the new species Cyrtostrombidium paralongisomum n. sp. using live observation, protargol staining and molecular data. The morphological characters of these two species are clearly distinct, i.e., dikinetid numbers in the girdle and ventral kineties; however, it is difficult to separate them by 18S rDNA sequences because they differ by only 8 bp, indicating that 18S rDNA sequences are insufficient for separating different species in the genus Cyrtostrombidium. We not only observed the position of the oral primordium in the genus Cyrtostrombidium but also observed a possibly homoplasious trait, a dorsal split in the girdle kinety, in (1) Apostrombidium, (2) Varistrombidium, and (3) Cyrtostrombidium/Williophrya. This partially supports the hypothesis of somatic ciliary pattern evolution recently put forth by Agatha and Strüder-Kypke.

  18. Isolation and molecular identification of Vibrio spp. by sequencing of 16S rDNA from seafood, meat and meat products in Libya

    PubMed Central

    Azwai, S.M.; Alfallani, E.A.; Abolghait, S.K.; Garbaj, A.M.; Naas, H.T.; Moawad, A.A.; Gammoudi, F.T.; Rayes, H.M.; Barbieri, I.; Eldaghayes, I.M.


    The genus Vibrio includes several food-borne pathogens that cause a spectrum of clinical conditions including septicemia, cholera and milder forms of gastroenteritis. Several Vibrio spp. are commonly associated with food-borne transmission including Vibrio cholerae, Vibrio parahemolyticus, and Vibrio vulnificus. Microbiological analysis for enumeration and isolation of Vibrio spp. were carried out for a total of 93 samples of seafood, meat and meat products from different geographic localities in Libya (Tripoli, Regdalin, Janzour and Tobruk). Vibrio spp. were detected by conventional cultural and molecular method using PCR and sequencing of 16S rDNA. Out of the 93 cultured samples only 48 (51.6%) yielded colonies on Thiosulfate Citrate Bile Salt agar (TCBS) with culture characteristics of Vibrio spp. More than half (n=27) of processed seafood samples (n=46) yielded colonies on TCBS, while only 44.6 % of samples of meat and meat products showed colonies on TCBS. Among cultured seafood samples, the highest bacterial count was recorded in clam with a count of 3.8 ×104 CFU\\g. Chicken burger samples showed the highest bacterial count with 6.5 ×104 CFU\\g. Molecular analysis of the isolates obtained in this study, showed that 11 samples out of 48 (22.9%) were Vibrio spp. Vibrio parahemolyticus was isolated from camel meat for the first time. This study is an initial step to provide a baseline for future molecular research targeting Vibrio spp. foodborne illnesses. This data will be used to provide information on the magnitude of such pathogens in Libyan seafood, meat and meat products. PMID:27004169

  19. Dracula ant phylogeny as inferred by nuclear 28S rDNA sequences and implications for ant systematics (Hymenoptera: Formicidae: Amblyoponinae).


    Saux, Corrie; Fisher, Brian L; Spicer, Greg S


    Ants are one of the most ecologically and numerically dominant families of organisms in almost every terrestrial habitat throughout the world, though they include only about 1% of all described insect species. The development of eusociality is thought to have been a driving force in the striking diversification and dominance of this group, yet we know little about the evolution of the major lineages of ants and have been unable to clearly determine their primitive characteristics. Ants within the subfamily Amblyoponinae are specialized arthropod predators, possess many anatomically and behaviorally primitive characters and have been proposed as a possible basal lineage within the ants. We investigate the phylogenetic relationships among the members of the subfamily, using nuclear 28S rDNA sequence data. Outgroups for the analysis include members of the poneromorph and leptanillomorph (Apomyrma, Leptanilla) ant subfamilies, as well as three wasp families. Parsimony, maximum likelihood, and Bayesian analyses provide strong support for the monophyly of a clade containing the two genera Apomyrma+Mystrium (100% bpp; 97% ML bs; and 97% MP bs), and moderate support for the monophyly of the Amblyoponinae as long as Apomyrma (Apomyrminae) is included (87% bpp; 57% ML bs; and 76% MP bs). Analyses did not recover evidence of monophyly of the Amblyopone genus, while the monophyly of the other genera in the subfamily is supported. Based on these results we provide a morphological diagnosis of the Amblyoponinae that includes Apomyrma. Among the outgroup taxa, Typhlomyrmex grouped consistently with Ectatomma, supporting the recent placement of Typhlomyrmex in the Ectatomminae. The results of this present study place the included ant subfamilies into roughly two clades with the basal placement of Leptanilla unclear. One clade contains all the Amblyoponinae (including Apomyrma), Ponerinae, and Proceratiinae (Poneroid clade). The other clade contains members from subfamilies

  20. Isolation and molecular identification of Vibrio spp. by sequencing of 16S rDNA from seafood, meat and meat products in Libya.


    Azwai, S M; Alfallani, E A; Abolghait, S K; Garbaj, A M; Naas, H T; Moawad, A A; Gammoudi, F T; Rayes, H M; Barbieri, I; Eldaghayes, I M


    The genus Vibrio includes several food-borne pathogens that cause a spectrum of clinical conditions including septicemia, cholera and milder forms of gastroenteritis. Several Vibrio spp. are commonly associated with food-borne transmission including Vibrio cholerae, Vibrio parahemolyticus, and Vibrio vulnificus. Microbiological analysis for enumeration and isolation of Vibrio spp. were carried out for a total of 93 samples of seafood, meat and meat products from different geographic localities in Libya (Tripoli, Regdalin, Janzour and Tobruk). Vibrio spp. were detected by conventional cultural and molecular method using PCR and sequencing of 16S rDNA. Out of the 93 cultured samples only 48 (51.6%) yielded colonies on Thiosulfate Citrate Bile Salt agar (TCBS) with culture characteristics of Vibrio spp. More than half (n=27) of processed seafood samples (n=46) yielded colonies on TCBS, while only 44.6 % of samples of meat and meat products showed colonies on TCBS. Among cultured seafood samples, the highest bacterial count was recorded in clam with a count of 3.8 ×10(4) CFU\\g. Chicken burger samples showed the highest bacterial count with 6.5 ×10(4) CFU\\g. Molecular analysis of the isolates obtained in this study, showed that 11 samples out of 48 (22.9%) were Vibrio spp. Vibrio parahemolyticus was isolated from camel meat for the first time. This study is an initial step to provide a baseline for future molecular research targeting Vibrio spp. foodborne illnesses. This data will be used to provide information on the magnitude of such pathogens in Libyan seafood, meat and meat products.

  1. Isolation and molecular identification of Vibrio spp. by sequencing of 16S rDNA from seafood, meat and meat products in Libya.


    Azwai, S M; Alfallani, E A; Abolghait, S K; Garbaj, A M; Naas, H T; Moawad, A A; Gammoudi, F T; Rayes, H M; Barbieri, I; Eldaghayes, I M


    The genus Vibrio includes several food-borne pathogens that cause a spectrum of clinical conditions including septicemia, cholera and milder forms of gastroenteritis. Several Vibrio spp. are commonly associated with food-borne transmission including Vibrio cholerae, Vibrio parahemolyticus, and Vibrio vulnificus. Microbiological analysis for enumeration and isolation of Vibrio spp. were carried out for a total of 93 samples of seafood, meat and meat products from different geographic localities in Libya (Tripoli, Regdalin, Janzour and Tobruk). Vibrio spp. were detected by conventional cultural and molecular method using PCR and sequencing of 16S rDNA. Out of the 93 cultured samples only 48 (51.6%) yielded colonies on Thiosulfate Citrate Bile Salt agar (TCBS) with culture characteristics of Vibrio spp. More than half (n=27) of processed seafood samples (n=46) yielded colonies on TCBS, while only 44.6 % of samples of meat and meat products showed colonies on TCBS. Among cultured seafood samples, the highest bacterial count was recorded in clam with a count of 3.8 ×10(4) CFU\\g. Chicken burger samples showed the highest bacterial count with 6.5 ×10(4) CFU\\g. Molecular analysis of the isolates obtained in this study, showed that 11 samples out of 48 (22.9%) were Vibrio spp. Vibrio parahemolyticus was isolated from camel meat for the first time. This study is an initial step to provide a baseline for future molecular research targeting Vibrio spp. foodborne illnesses. This data will be used to provide information on the magnitude of such pathogens in Libyan seafood, meat and meat products. PMID:27004169

  2. [Comparative analysis of rDNA distribution in metaphase chromosomes of Cucurbitaceae species].


    Xu, Yan-Hao; Yang, Fei; Cheng, You-Lin; Ma, Lu; Wang, Jian-Bo; Li, Li-Jia


    Fluorescence in situ hybridization (FISH) and double FISH experiments were carried out to ascertain the chromosomal distribution patterns of the 45S and 5S ribosomal DNAs in the three species of Cucurbitaceae. Five pairs of 45S rDNA loci and two pairs of 5S rDNA signals were detected on chromosomes of Cucurbita moschata Duch. Luffa cylindrical Roem. contained five pairs of 45S rDNA loci and one pair of 5S rDNA loci. In Benincasa hispida Cogn., two pairs of 45S rDNA sites and one pair of 5S rDNA site were detected. In this species, 5S rDNA and one pair of the 45S loci were collocated closely in chromosome 7S. 45S rDNA chromosomal distribution patterns were highly conserved among the three species, althoufh their number varied markedly. The 5S rDNA sites on chromosomes among the three species were highly polymorphic. We further discussed differentially evolutionary processes of 45S and 5S rDNA in plant genomes.

  3. Evolutionary Dynamics of rDNA Clusters in Chromosomes of Five Clam Species Belonging to the Family Veneridae (Mollusca, Bivalvia)

    PubMed Central

    Pérez-García, Concepción; Hurtado, Ninoska S.; Morán, Paloma; Pasantes, Juan J.


    The chromosomal changes accompanying bivalve evolution are an area about which few reports have been published. To improve our understanding on chromosome evolution in Veneridae, ribosomal RNA gene clusters were mapped by fluorescent in situ hybridization (FISH) to chromosomes of five species of venerid clams (Venerupis corrugata, Ruditapes philippinarum, Ruditapes decussatus, Dosinia exoleta, and Venus verrucosa). The results were anchored to the most comprehensive molecular phylogenetic tree currently available for Veneridae. While a single major rDNA cluster was found in each of the five species, the number of 5S rDNA clusters showed high interspecies variation. Major rDNA was either subterminal to the short arms or intercalary to the long arms of metacentric or submetacentric chromosomes, whereas minor rDNA signals showed higher variability. Major and minor rDNAs map to different chromosome pairs in all species, but in R. decussatus one of the minor rDNA gene clusters and the major rDNA cluster were located in the same position on a single chromosome pair. This interspersion of both sequences was confirmed by fiber FISH. Telomeric signals appeared at both ends of every chromosome in all species. FISH mapping data are discussed in relation to the molecular phylogenetic trees currently available for Veneridae. PMID:24967400

  4. Identifying the bacterial community on the surface of Intralox belting in a meat boning room by culture-dependent and culture-independent 16S rDNA sequence analysis.


    Brightwell, Gale; Boerema, Jackie; Mills, John; Mowat, Eilidh; Pulford, David


    We examined the bacterial community present on an Intralox conveyor belt system in an operating lamb boning room by sequencing the 16S ribosomal DNA (rDNA) of bacteria extracted in the presence or absence of cultivation. RFLP patterns for 16S rDNA clone library and cultures were generated using HaeIII and MspI restriction endonucleases. 16S rDNA amplicons produced 8 distinct RFLP pattern groups. RFLP groups I-IV were represented in the clone library and RFLP groups I and V-VIII were represented amongst the cultured isolates. Partial DNA sequences from each RFLP group revealed that all group I, II and VIII representatives were Pseudomonas spp., group III were Sphingomonas spp., group IV clones were most similar to an uncultured alpha proteobacterium, group V was similar to a Serratia spp., group VI with an Alcaligenes spp., and group VII with Microbacterium spp. Sphingomonads were numerically dominant in the culture-independent clone library and along with the group IV alpha proteobacterium were not represented amongst the cultured isolates. Serratia, Alcaligenes and Microbacterium spp. were only represented with cultured isolates. Pseudomonads were detected by both culture-dependent (84% of isolates) and culture-independent (12.5% of clones) methods and their presence at high frequency does pose the risk of product spoilage if transferred onto meat stored under aerobic conditions. The detection of sphingomonads in large numbers by the culture-independent method demands further analysis because sphingomonads may represent a new source of meat spoilage that has not been previously recognised in the meat processing environment. The 16S rDNA collections generated by both methods were important at representing the diversity of the bacterial population associated with an Intralox conveyor belt system.

  5. Ultraviolet damage and nucleosome folding of the 5S ribosomal RNA gene.

    SciTech Connect

    Liu, X; Mann, David B.; Suquet, C; Springer, David L. ); Smerdon, Michael J.


    The Xenopus borealis somatic 5S ribosomal RNA gene was used as a model system to determine the mutual effects of nucleosome folding and formation of ultraviolet (UV) photoproducts (primarily cis-syn cyclobutane pyrimidine dimers, or CPDs) in chromatin. We analyzed the preferred rotational and translational settings of 5S rDNA on the histone octamer surface after induction of up to 0.8 CPD/nucleosome core (2.5 kJ/m(2) UV dose). DNase I and hydroxyl radical footprints indicate that UV damage at these levels does not affect the average rotational setting of the 5S rDNA molecules. Moreover, a combination of nuclease trimming and restriction enzyme digestion indicates the preferred translational positions of the histone octamer are not affected by this level of UV damage. We also did not observe differences in the UV damage patterns of irradiated 5S rDNA before or after nucleosome formation, indicating there is little difference in the inhibition of nucleosome folding by specific CPD sites in the 5S rRNA gene. Conversely, nucleosome folding significantly restricts CPD formation at all sites in the three helical turns of the nontranscribed strand located in the dyad axis region of the nucleosome, where DNA is bound exclusively by the histone H3-H4 tetramer. Finally, modulation of the CPD distribution in a 14 nt long pyrimidine tract correlates with its rotational setting on the histone surface, when the strong sequence bias for CPD formation in this tract is minimized by normalization. These results help establish the mutual roles of histone binding and UV photoproducts on their formation in chromatin.

  6. Cytogenetic Analysis of Populus trichocarpa - Ribosomal DNA, Telomere Repeat Sequence, and Marker-selected BACs

    SciTech Connect

    Tuskan, Gerald A; Gunter, Lee E; DiFazio, Stephen P


    The 18S-28S rDNA and 5S rDNA loci in Populus trichocarpa were localized using fluorescent in situ hybridization (FISH). Two 18S-28S rDNA sites and one 5S rDNA site were identified and located at the ends of 3 different chromosomes. FISH signals from the Arabidopsis -type telomere repeat sequence were observed at the distal ends of each chromosome. Six BAC clones selected from 2 linkage groups based on genome sequence assembly (LG-I and LG-VI) were localized on 2 chromosomes, as expected. BACs from LG-I hybridized to the longest chromosome in the complement. All BAC positions were found to be concordant with sequence assembly positions. BAC-FISH will be useful for delineating each of the Populus trichocarpa chromosomes and improving the sequence assembly of this model angiosperm tree species.

  7. Evolution of rDNA in Nicotiana Allopolyploids: A Potential Link between rDNA Homogenization and Epigenetics

    PubMed Central

    Kovarik, Ales; Dadejova, Martina; Lim, Yoong K.; Chase, Mark W.; Clarkson, James J.; Knapp, Sandra; Leitch, Andrew R.


    Background The evolution and biology of rDNA have interested biologists for many years, in part, because of two intriguing processes: (1) nucleolar dominance and (2) sequence homogenization. We review patterns of evolution in rDNA in the angiosperm genus Nicotiana to determine consequences of allopolyploidy on these processes. Scope Allopolyploid species of Nicotiana are ideal for studying rDNA evolution because phylogenetic reconstruction of DNA sequences has revealed patterns of species divergence and their parents. From these studies we also know that polyploids formed over widely different timeframes (thousands to millions of years), enabling comparative and temporal studies of rDNA structure, activity and chromosomal distribution. In addition studies on synthetic polyploids enable the consequences of de novo polyploidy on rDNA activity to be determined. Conclusions We propose that rDNA epigenetic expression patterns established even in F1 hybrids have a material influence on the likely patterns of divergence of rDNA. It is the active rDNA units that are vulnerable to homogenization, which probably acts to reduce mutational load across the active array. Those rDNA units that are epigenetically silenced may be less vulnerable to sequence homogenization. Selection cannot act on these silenced genes, and they are likely to accumulate mutations and eventually be eliminated from the genome. It is likely that whole silenced arrays will be deleted in polyploids of 1 million years of age and older. PMID:18310159

  8. Nuclear rDNA pseudogenes in Chagas disease vectors: evolutionary implications of a new 5.8S+ITS-2 paralogous sequence marker in triatomines of North, Central and northern South America.


    Bargues, M Dolores; Zuriaga, M Angeles; Mas-Coma, Santiago


    A pseudogene, paralogous to rDNA 5.8S and ITS-2, is described in Meccus dimidiata dimidiata, M. d. capitata, M. d. maculippenis, M. d. hegneri, M. sp. aff. dimidiata, M. p. phyllosoma, M. p. longipennis, M. p. pallidipennis, M. p. picturata, M. p. mazzottii, Triatoma mexicana, Triatoma nitida and Triatoma sanguisuga, covering North America, Central America and northern South America. Such a nuclear rDNA pseudogene is very rare. In the 5.8S gene, criteria for pseudogene identification included length variability, lower GC content, mutations regarding the functional uniform sequence, and relatively high base substitutions in evolutionary conserved sites. At ITS-2 level, criteria were the shorter sequence and large proportion of insertions and deletions (indels). Pseudogenic 5.8S and ITS-2 secondary structures were different from the functional foldings, different one another, showing less negative values for minimum free energy (mfe) and centroid predictions, and lower fit between mfe, partition function, and centroid structures. A complete characterization indicated a processed pseudogenic unit of the ghost type, escaping from rDNA concerted evolution and with functionality subject to constraints instead of evolving free by neutral drift. Despite a high indel number, low mutation number and an evolutionary rate similar to the functional ITS-2, that pseudogene distinguishes different taxa and furnishes coherent phylogenetic topologies with resolution similar to the functional ITS-2. The discovery of a pseudogene in many phylogenetically related species is unique in animals and allowed for an estimation of its palaeobiogeographical origin based on molecular clock data, inheritance pathways, evolutionary rate and pattern, and geographical spread. Additional to the technical risk to be considered henceforth, this relict pseudogene, designated as "ps(5.8S+ITS-2)", proves to be a valuable marker for specimen classification, phylogenetic analyses, and systematic

  9. Distribution of 5-methylcytosine residues in 5S rRNA genes in Arabidopsis thaliana and Secale cereale.


    Fulnecek, J; Matyásek, R; Kovarík, A


    Bisulfite genomic sequencing was used to localise 5-methylcytosine residues (mC) in 5S rRNA genes of Arabidopsis thaliana and Secale cereale. The maps of mC distribution were compared with the previously published map of the corresponding region in Nicotiana tabacum. In all three species, the level of methylation of 5S rRNA genes was generally higher than the average for the entire genome. The ratio of 5S rDNA methylation to average overall methylation was 44%/30-33% for N. tabacum, 27%/4-6% for A. thaliana and 24%/20-22% for S. cereale. With the exception of one clone from S. cereale, no methylation-free 5S rDNA was detected. The level of methylation at different sequence motifs in 5S rDNA was calculated for N. tabacum/A. thaliana/ S. cereale, and this analysis yielded the following values (expressed as a percentage of total C): mCG 90%/78%/85%, mCWG 89%/41%/53%, mCmCG 72%/32%/16%, mCCG 4%/2%/0%, mCHH 15%/6%/1%, where W=A or T, and H=A or C or T. Non-symmetrical methylation was almost negligible in the large genome of S. cereale but relatively frequent in N. tabacum and A. thaliana, suggesting that the strict correlation between genome size and cytosine methylation might be violated for this type of methylation. Among non-symmetrical motifs the mCWA triplets were significantly over-represented in Arabidopsis, while in tobacco this preference was not as pronounced. The differences in methylation levels in different sequence contexts might be of phylogenetic significance, but further species in related and different taxa need to be studied before firm conclusions can be drawn. PMID:12471448

  10. Nuclear rDNA and chloroplast rbcL, rbcS and IGS sequence data, and their implications from the Japanese, Korean, and North American harmful algae, Heterosigma akashiwo (Raphidophyceae)

    SciTech Connect

    Ki, Jang-Seu . E-mail:; Han, Myung-Soo


    The toxic Heterosigma akashiwo has been found in coastal environments and its algal blooms have been associated with mass mortality in marine organisms and farmed fish. Over the last two decades, H. akashiwo has expanded its geographical range on a worldwide scale, though all populations are suspected to be a single species. To find strong molecular evidence, supporting this hypothesis we determined nuclear 18S , ITS and LSU rDNA, and chloroplast rbcL, rbcS and flanking IGS sequences from six isolates located in North America, Japan and Korea. We compared individual loci from molecular regions (e.g., 26.7 kbp of DNA sequence) and found all the isolates to have an identical genotype. Further, the long sequences allow us to compare all the partial sequences that have been reported from samples obtained in ten countries. All these sequence are nearly identical. This suggests that they have dispersed recently from one location. The sequences revealed here can be used as an additional option for making molecular comparisons of sequences from the same isolate.

  11. Nuclear rDNA and chloroplast rbcL, rbcS and IGS sequence data, and their implications from the Japanese, Korean, and North American harmful algae, Heterosigma akashiwo (Raphidophyceae).


    Ki, Jang-Seu; Han, Myung-Soo


    The toxic Heterosigma akashiwo has been found in coastal environments and its algal blooms have been associated with mass mortality in marine organisms and farmed fish. Over the last two decades, H. akashiwo has expanded its geographical range on a worldwide scale, though all populations are suspected to be a single species. To find strong molecular evidence, supporting this hypothesis we determined nuclear 18S, ITS and LSU rDNA, and chloroplast rbcL, rbcS and flanking IGS sequences from six isolates located in North America, Japan and Korea. We compared individual loci from molecular regions (e.g., 26.7kbp of DNA sequence) and found all the isolates to have an identical genotype. Further, the long sequences allow us to compare all the partial sequences that have been reported from samples obtained in ten countries. All these sequence are nearly identical. This suggests that they have dispersed recently from one location. The sequences revealed here can be used as an additional option for making molecular comparisons of sequences from the same isolate. PMID:17049343

  12. Molecular Cytogenetics in Digenean Parasites: Linked and Unlinked Major and 5S rDNAs, B Chromosomes and Karyotype Diversification.


    García-Souto, Daniel; Pasantes, Juan J


    Digenetic trematodes are the largest group of internal metazoan parasites, but their chromosomes are poorly studied. Although chromosome numbers and/or karyotypes are known for about 300 of the 18,000 described species, molecular cytogenetic knowledge is mostly limited to the mapping of telomeric sequences and/or of major rDNA clusters in 9 species. In this work we mapped major and 5S rDNA clusters and telomeric sequences in chromosomes of Bucephalus minimus, B. australis, Prosorhynchoides carvajali (Bucephaloidea), Monascus filiformis (Gymnophalloidea), Parorchis acanthus (Echinostomatoidea), Cryptocotyle lingua (Opisthorchioidea), Cercaria longicaudata, Monorchis parvus (Monorchioidea), Diphterostomum brusinae, and Bacciger bacciger (Microphalloidea). Whilst single major and minor rDNA clusters were mapped to different chromosome pairs in B. minimus and P. acanthus, overlapping signals were detected on a single chromosome pair in the remaining taxa. FISH experiments using major rDNA and telomeric probes clearly demonstrated the presence of highly stretched NORs in most of the digenean taxa analyzed. B chromosomes were detected in the B. bacciger samples hosted by Ruditapes decussatus. Although the cercariae specimens obtained from Donax trunculus, Tellina tenuis, and R. decussatus were in agreement with B. bacciger, their karyotypes showed striking morphological differences in agreement with the proposed assignation of these cercariae to different species of the genus Bacciger. Results are discussed in comparison with previous data on digenean chromosomes. PMID:26680763

  13. Checklist of the species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) in fishes and turtles in Middle-America, and their delimitation based on sequences of the 28S rDNA.


    Pinacho-Pinacho, Carlos Daniel; Sereno-Uribe, Ana L; De León, Gerardo Pérez-Ponce; García-Varela, Martín


    Among the acanthocephalans, Neoechinorhynchus is one of the most speciose genera, with 116 described species distributed worldwide. The adults of Neoechinorhynchus are found in the intestine of freshwater and brackish water fish, as well as in freshwater turtles. In this study, a checklist of the congeneric species of Neoechinorhynchus occurring in Middle-American fish and turtles is presented. The checklist contains the records established in all published accounts, as well as novel data from survey work conducted in the region comprising Neotropical areas of Mexico, as well as some localities in Central America. The species delimitation criteria used to discriminate among species is based on molecular data. In the last years, a large database derived from sequences of the D2 + D3 domains of the large subunit of rDNA (28S) was generated for 262 specimens corresponding to nine species of Neoechinorhynchus. This molecular marker has shown to be useful in establishing species limits within Neoechinorhynchus and in resolving phylogenetic relationships at species level. Based on our results, the domains D2 + D3 of the 28S rDNA could be considered as potential DNA barcodes to complement mitochondrial DNA to discriminate among acanthocephalan species.

  14. Checklist of the species of Neoechinorhynchus (Acanthocephala: Neoechinorhynchidae) in fishes and turtles in Middle-America, and their delimitation based on sequences of the 28S rDNA.


    Pinacho-Pinacho, Carlos Daniel; Sereno-Uribe, Ana L; De León, Gerardo Pérez-Ponce; García-Varela, Martín


    Among the acanthocephalans, Neoechinorhynchus is one of the most speciose genera, with 116 described species distributed worldwide. The adults of Neoechinorhynchus are found in the intestine of freshwater and brackish water fish, as well as in freshwater turtles. In this study, a checklist of the congeneric species of Neoechinorhynchus occurring in Middle-American fish and turtles is presented. The checklist contains the records established in all published accounts, as well as novel data from survey work conducted in the region comprising Neotropical areas of Mexico, as well as some localities in Central America. The species delimitation criteria used to discriminate among species is based on molecular data. In the last years, a large database derived from sequences of the D2 + D3 domains of the large subunit of rDNA (28S) was generated for 262 specimens corresponding to nine species of Neoechinorhynchus. This molecular marker has shown to be useful in establishing species limits within Neoechinorhynchus and in resolving phylogenetic relationships at species level. Based on our results, the domains D2 + D3 of the 28S rDNA could be considered as potential DNA barcodes to complement mitochondrial DNA to discriminate among acanthocephalan species. PMID:26250025

  15. Molecular characterization and chromosomal mapping of the 5S rRNA gene in Solea senegalensis: a new linkage to the U1, U2, and U5 small nuclear RNA genes.


    Manchado, Manuel; Zuasti, Eugenia; Cross, Ismael; Merlo, Alejandro; Infante, Carlos; Rebordinos, Laureana


    Some units of the 5S rDNA of Solea senegalensis were amplified by PCR and sequenced. Three main PCR products (227, 441, and 2166 bp) were identified. The 227- and 441-bp fragments were characterized by highly divergent nontranscribed spacer sequences (referred to as NTS-I and NTS-II) that were 109 and 324 bp long, respectively, yet their coding sequences were nearly identical. The 2166-bp 5S rDNA unit was composed of two 5S rRNA genes separated by NTS-I and followed by a 1721-bp spacer containing the U2, U5, and U1 small nuclear RNA genes (snRNAs). They were inverted and arranged in the transcriptional direction opposite that of the 5S rRNA gene. This simultaneous linkage of 3 different snRNAs had never been observed before. The PCR products were used as probes in fluorescence in situ hybridization experiments to locate the corresponding loci on the chromosomes of S. senegalensis. A major 5S rDNA chromosomal site was located along most of the short arm of a submetacentric pair, while a minor site was detected near the centromeric region of an acrocentric pair.

  16. Chromosomal localization of the 18S-28S and 5S rRNA genes and (TTAGGG)n sequences of butterfly lizards (Leiolepis belliana belliana and Leiolepis boehmei, Agamidae, Squamata).


    Srikulnath, Kornsorn; Uno, Yoshinobu; Matsubara, Kazumi; Thongpan, Amara; Suputtitada, Saowanee; Apisitwanich, Somsak; Nishida, Chizuko; Matsuda, Yoichi


    Chromosomal mapping of the butterfly lizards Leiolepis belliana belliana and L. boehmei was done using the 18S-28S and 5S rRNA genes and telomeric (TTAGGG)n sequences. The karyotype of L. b. belliana was 2n = 36, whereas that of L. boehmei was 2n = 34. The 18S-28S rRNA genes were located at the secondary constriction of the long arm of chromosome 1, while the 5S rRNA genes were found in the pericentromeric region of chromosome 6 in both species. Hybridization signals for the (TTAGGG)n sequence were observed at the telomeric ends of all chromosomes, as well as interstitially at the same position as the 18S-28S rRNA genes in L. boehmei. This finding suggests that in L. boehmei telomere-to-telomere fusion probably occurred between chromosome 1 and a microchromosome where the 18S-28S rRNA genes were located or, alternatively, at the secondary constriction of chromosome 1. The absence of telomeric sequence signals in chromosome 1 of L. b. belliana suggested that its chromosomes may have only a few copies of the (TTAGGG)n sequence or that there may have been a gradual loss of the repeat sequences during chromosomal evolution.

  17. Plantago lagopus B Chromosome Is Enriched in 5S rDNA-Derived Satellite DNA.


    Kumke, Katrin; Macas, Jiří; Fuchs, Jörg; Altschmied, Lothar; Kour, Jasmeet; Dhar, Manoj K; Houben, Andreas


    B chromosomes are supernumerary dispensable parts of the karyotype which appear in some individuals of some populations in some species. Using advanced sequencing technology, we in silico characterized the high-copy DNA composition of Plantago lagopus with and without B chromosomes. The nuclear genome (2.46 pg/2C) was found to be relatively rich in repetitive sequences, with highly and moderately repeated elements making up 68% of the genome. Besides a centromere-specific marker, we identified a B-specific satellite and a repeat enriched in polymorphic A chromosome segments. The B-specific tandem repeat PLsatB originated from sequence amplification including 5S rDNA fragments. PMID:27173804

  18. Identification of airborne bacterial and fungal species in the clinical microbiology laboratory of a university teaching hospital employing ribosomal DNA (rDNA) PCR and gene sequencing techniques.


    Nagano, Yuriko; Walker, Jim; Loughrey, Anne; Millar, Cherie; Goldsmith, Colin; Rooney, Paul; Elborn, Stuart; Moore, John


    Universal or "broad-range" PCR-based ribosomal DNA (rDNA) was performed on a collection of 58 isolates (n = 30 bacteria + 28 fungi), originating from environmental air from several locations within a busy clinical microbiology laboratory, supporting a university teaching hospital. A total of 10 bacterial genera were identified including both Gram-positive and Gram-negative genera. Gram-positive organisms accounted for 27/30 (90%) of total bacterial species, consisting of seven genera and included (in descending order of frequency) Staphylococcus, Micrococcus, Corynebacterium, Paenibacillus, Arthrobacter, Janibacter and Rothia. Gram-negative organisms were less frequently isolated 3/30 (10%) and comprised three genera, including Moraxella, Psychrobacter and Haloanella. Eight fungal genera were identified among the 28 fungal organisms isolated, including (in descending order of frequency) Cladosporium, Penicillium, Aspergillus, Thanatephorus, Absidia, Eurotium, Paraphaeosphaeria and Tritirachium, with Cladosporium accounting for 10/28 (35.7%) of the total fungal isolates. In conclusion, this study identified the presence of 10 bacterial and eight fungal genera in the air within the laboratory sampled. Although this reflected diversity of the microorganisms present, none of these organisms have been described previously as having an inhalational route of laboratory-acquired infection. Therefore, we believe that the species of organisms identified and the concentration levels of these airborne contaminants determined, do not pose a significant health and safety threat for immunocompotent laboratory personnel and visitors. PMID:20183192

  19. Molecular identification of Hysterothylacium aduncum specimens isolated from commercially important fish species of Eastern Mediterranean Sea using mtDNA cox1 and ITS rDNA gene sequences.


    Keskin, Emre; Koyuncu, Cafer Erkin; Genc, Ercument


    The presence of a Raphidascarid parasitic nematode Hysterothylacium aduncum (Rudolphi, 1802) in two sparid fish (Sparus aurata and Diplodus vulgaris) and one soleid fish (Solea solea) was investigated in this study. A total of 868 individuals; 385 S. aurata, 437 D. vulgaris and 46 S. solea were collected from the Mersin Bay between February 2013 and January 2014 and examined. Variations in the prevalence, mean intensity, and mean abundance of the parasite were 14.55%, 2.05, and 0.30 for S. aurata, 4.12%, 2.44, and 0.10 for D. vulgaris, and 15.22%, 3.29, and 0.50 for S. sole respectively. Nucleotide sequences of 1398 base pair long fragment of 18S rRNA-ITS1-5.8S rRNA-ITS2-28S rRNA region and 641 base pair long fragment of mtDNA cytochrome c oxidase I (cox1) gene were used in molecular identification of isolated parasites at species level. All the parasite samples were identified as H. aduncum based on nucleotide sequence comparisons. Both ITS rDNA and mtDNA cox1 sequences revealed a genetic variation among H. aduncum specimens isolated from different fish species, while only mtDNA cox1 sequences were indicating a mean genetic distance of 0.010 among H. aduncum specimens of the same host species. PMID:25543079

  20. Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats.


    Warmerdam, Daniël O; van den Berg, Jeroen; Medema, René H


    rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded breaks in rDNA. Using selective endonucleases, we show that human cells are highly sensitive to breaks in 45S but not the 5S rDNA repeats. We find that homologous recombination inhibits repair of breaks in 45S rDNA, and this results in repeat loss. We identify the structural maintenance of chromosomes protein 5 (SMC5) as contributing to recombination-mediated repair of rDNA breaks. Together, our data demonstrate that SMC5-mediated recombination can lead to error-prone repair of 45S rDNA repeats, resulting in their loss and thereby reducing cellular viability.

  1. Variation in rDNA locus number and position among legume species and detection of 2 linked rDNA loci in the model Medicago truncatula by FISH.


    Abirached-Darmency, Mona; Prado-Vivant, Emilce; Chelysheva, Liudmila; Pouthier, Thomas


    Within Fabaceae, legume species have a variable genome size, chromosome number, and ploidy level. The genome distribution of ribosomal genes, easily detectable by fluorescent in situ hybridization (FISH), is a good tool for anchoring physical and genetic comparative maps. The organisation of 45S rDNA and 5S loci was analysed by FISH in the 4 closely related species: Pisum sativum, Medicago truncatula, Medicago sativa (2 diploid taxa), and Lathyrus sativus. The 2 types of rDNA arrays displayed interspecific variation in locus number and location, but little intraspecific variation was detected. In the model legume, M. truncatula, the presence of 2 adjacent 45S rDNA loci was demonstrated, and the location of the rDNA loci was independent of the general evolution of the genome DNA. The different parameters relative to clustering of the rDNA loci in specific chromosome regions and the possible basis of rDNA instability are discussed. PMID:16121252

  2. Comparative sequence analyses on the 16S rRNA (rDNA) of Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus and proposal for creation of a new genus, Alicyclobacillus gen. nov

    NASA Technical Reports Server (NTRS)

    Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.; Deinhard, G.; Poralla, K.


    Comparative 16S rRNA (rDNA) sequence analyses performed on the thermophilic Bacillus species Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus revealed that these organisms are sufficiently different from the traditional Bacillus species to warrant reclassification in a new genus, Alicyclobacillus gen. nov. An analysis of 16S rRNA sequences established that these three thermoacidophiles cluster in a group that differs markedly from both the obligately thermophilic organisms Bacillus stearothermophilus and the facultatively thermophilic organism Bacillus coagulans, as well as many other common mesophilic and thermophilic Bacillus species. The thermoacidophilic Bacillus species B. acidocaldarius, B. acidoterrestris, and B. cycloheptanicus also are unique in that they possess omega-alicylic fatty acid as the major natural membranous lipid component, which is a rare phenotype that has not been found in any other Bacillus species characterized to date. This phenotype, along with the 16S rRNA sequence data, suggests that these thermoacidophiles are biochemically and genetically unique and supports the proposal that they should be reclassified in the new genus Alicyclobacillus.

  3. Pedological and mineralogical investigations on a soil-paleosoil sequence within Andosols in the Western Cordillera of the Peruvian Andes (region Laramate, 14.5S)

    NASA Astrophysics Data System (ADS)

    Leceta Gobitz, Fernando; Mächtle, Bertil; Schukraft, Gerd; Meyer, Hans-Peter; Eitel, Bernhard


    An integrated research project of environmental sciences focuses on a group of four Andosol profiles in Western flank of the Peruvian southern Andes. Aim of this study is to contribute to the reconstruction of the paleo environmental conditions in the Western Cordillera of the Peruvian Andes. Standard pedological and sedimentological analysis has been conducted in order to identify morphological and geochemical features generated by climatic variations during the middle and late Holocene. Though a provenance analysis of sediments, all potential lithological sources around the town of Laramate are being examined under the scanning electron microscope, in order to find significant mineralogical associations downward the soil-profile. Preliminary results reveal two edaphic cycles within a soil-paleo soil-sequence: a relative poor developed "Ah" topsoil, mostly composed by fine grain sediments, is underlain by a well preserved "2Ah" paleo soil; a "2Bwt" subsoil exhibits signs of alteration and clay translocation; parent material in slight weathered statement at "2C" culminates the sequence. Mineralogical analytical data supports the premise, that materials in the uppermost horizons are relatable to distal geological units of the Western and Eastern Cordillera, therefore also related to other described aeolian archives from the region: "Desert Margin Loess" at the Andean foot-zone and "Mixed Loess" in the Puna grassland. The amphibole varieties Actinolite, Mg-Hornblende and Edenite could be only distinguished within the soil sediments. The fluvial transport to its current position is excluded, insofar mentioned varieties stem from the granodiorites of Coastal Batholite (downstream the study area), and the vulcanites of the Anta und Andahuaylas Formation (eastward the continental divide). References: Eitel, B., et al. (2005). "Geoarchaeological evidence from desert loess in the Nazca-Palpa region, southern Peru : Palaeoenvironmental changes and their impact on Pre

  4. The 5S genes of Drosophila melanogaster.


    Artavanis-Tsakonas, S; Schedl, P; Tschudi, C; Pirrotta, V; Steward, R; Gehring, W J


    We have cloned embryonic Drosophila DNA using the poly (dA-DT) connector method (Lobban and Kaiser, 1973) and the ampicillin-resistant plasmid pSF2124 (So, Gill and Falkow, 1975) as a cloning vehicle. Two clones, containing hybrid plasmids with sequences complementary to a 5S RNA probe isolated from Drosophila tissue culture cells, were identified by the Grunstein and Hogness (1975) colony hybridization procedure. One hybrid plasmid has a Drosophila insert which is comprised solely of tandem repeats of the 5S gene plus spacer sequences. The other plasmid contains an insert which has about 20 tandem 5S repeat units plus an additional 4 kilobases of adjacent sequences. The size of the 5S repeat unit was determined by gel electrophoresis and was found to be approximately 375 base pairs. We present a restriction map of both plasmids, and a detailed map of of the5S repeat unit. The 5S repat unit shows slight length and sequence heterogeneity. We present evidence suggesting that the 5S genes in Drosophila melanogaster may be arranged in a single continuous cluster. PMID:413625

  5. Studies on Lethrinitrema Lim & Justine, 2011 (Monogenea: Dactylogyridae), with the description of two new species, a key to the genus and a phylogenetic analysis based on rDNA sequences.


    Sun, Yuan; Li, Min; Yang, Tingbao


    Six species of Lethrinitrema Lim & Justine, 2011, including two new taxa, are described from the gills of Lethrinus nebulosus (Forsskål) from the South China Sea. Lethrinitrema nebulosum n. sp. differs from all other members of the genus in possessing a copulatory organ with a short, distally recurved tube, a cup-shaped base and a thin accessory piece, arising from distal end of tube, junction inconspicuous. Lethrinitrema zhanjiangense n. sp. can be distinguished from its congeners by possessing a copulatory organ with a C-shaped tube, a cup-shaped base and without accessory piece. Lethrinitrema grossecurvitubum (Li & Chen, 2005) n. comb. and Lethrinitrema austrosinense (Li & Chen, 2005) n. comb., previously included in Haliotrema Johnston & Tiegs, 1922, are transferred to Lethrinitrema and redescribed with additional details, including the intestinal caeca that unite posterior to gonads and continue posteriorly as two diverticula, and the elongate tubular distal end of each haptoral reservoir bifurcating prior to entering a superficial lateral groove on each side of the ventral anchor. The sclerotised parts of two unidentified species of Lethrinitrema are also described. Lethrinitrema sp. 1 differs from the other Lethrinitrema spp. in possessing a male copulatory organ consisting of a short tapered tube with a robust cup-shaped base and in lacking accessory piece. Lethrinitrema sp. 2 differs from its congeners in possessing a copulatory organ comprised of a short slender tube and without accessory piece, delicate ventral and dorsal bars, and poorly developed outer roots of the anchors. Sequences of partial 28S rDNA (domains D1-D2) and complete 18S rDNA for 27 dactylogyrids including five species of Lethrinitrema, i.e. Lethrinitrema fleti (Young, 1968) Lim & Justine, 2011, L. nebulosum, L. zhanjiangense, L. grossecurvitubum and Lethrinitrema sp. 1 were used to assess the monophyly of Lethrinitrema which was supported by high bootstrap values.

  6. Molecular profiling of microbial communities from contaminated sources: Use of subtractive cloning methods and rDNA spacer sequences. 1998 annual progress report

    SciTech Connect

    Robb, F.T.


    'The major objective of the research is to provide appropriate sequences and to assemble a high-density DNA array of oligonucleotides that can be used for rapid profiling of microbial populations from polluted areas. The sequences to be assigned to the DNA array are chosen from from cloned genomic DNA sequences (the ribosomal operon, described below) from groundwater at DOE sites containing organic solvents. The sites, Hanford Nuclear Plant and Lawrence Livermore Site 300, have well characterized pollutant histories, which have been provided by the collaborators. At this mid-point of the project, over 60 unique sequence classes of intergenic spacer region have been idedntified from the first sample site. The use of these sequences as hybridization probes, and their frequency of occurrence, allow a clear distinction between bacterial communities before and after remediation by acetate/nitrate pumping. The authors have developed the hybridization conditions for identifying PCR products in a 96 well format, a versatile alignment and visualization program (acronym: MALIGN) developed by Dr. Dennis Maeder, has been used to align the ISRs, which are variable in length and sometimes in position of the tRNAs. Finally, in collaboration with Dr. W. Chen and Dr. J. Zhou at ORNL, they have significant evidence that mass spectrometer analysis can be used to determine the lengths of PCR amplified intergenic spacer DNA.'

  7. Phylogenetic relationships among microsporidia based on rDNA sequence data, with particular reference to fish-infecting Microsporidium balbiani 1884 species.


    Bell, A S; Aoki, T; Yokoyama, H


    Recently, large discrepancies have been identified between microsporidian systematics based on molecular and traditional characteristics. In the current study the 530f-580r region of the rRNA gene of eight microsporidian species was cloned and sequenced. Included were two unclassified species of Microsporidium Balbiani, 1884 and an unidentified microsporidian that infects the musculature of different sea bream species. Sequence identities in excess of 98% indicated that these three species almost certainly are members of the same genus. Phylogenetic analyses of all microsporidian sequence data available for this region of the gene (20 species) and for partial small subunit sequences (51 species of 21 genera) revealed these species to be distinct from the family Pleistophoridae Doflein, 1901 and closely related them to the genus Sproguea Weissenberg, 1976. This clade was found to comprise a sister taxon to that containing the vast majority of fish-infecting species. Broad cladistic divisions were found between terrestrial insect-infecting and fish-infecting species, which together are distant from the aquatic insect-infecting microsporidia. The rRNA gene of certain fish-infecting genera was found to be more highly conserved than previously reported. This has implications for its utility in diagnostic assays and phylogenetic studies at, or close to, the species level.

  8. Phylogenetic reconstruction using secondary structures and sequence motifs of ITS2 rDNA of Paragonimus westermani (Kerbert, 1878) Braun, 1899 (Digenea: Paragonimidae) and related species

    PubMed Central


    Background Most phylogenetic studies using current methods have focused on primary DNA sequence information. However, RNA secondary structures are particularly useful in systematics because they include characteristics that give "morphological" information, not found in the primary sequence. In several mountainous regions of Northeastern India, foci of Paragonimus (lung fluke) infection reportedly involve species that are known to prevail in neighbouring countries. The present study was undertaken to demonstrate the sequence analysis of the ribosomal DNA (ITS2) of the infective (metacercarial) stage of the lung fluke collected from the edible crab hosts that are abundant in a mountain stream of the area (Miao, Changlang District in Arunachal Pradesh) and to construct its phylogeny. Using the approach of molecular morphometrics that is based on ITS2 secondary structure homologies, phylogenetic relationships of the various isolates of Paragonimus species that are prevalent in the neighbouring Near-eastern countries have been discussed. Results Initially, ten predicted RNA secondary structures were reconstructed and the topology based only on the predicted RNA secondary structure of the ITS2 region resolved most relationships among the species studied. We obtained three similar topologies for seven species of the genus Paragonimus on the basis of traditional primary sequence analysis using MEGA and a Bayesian analysis of the combined data. The latter approach allowed us to include both primary sequence and RNA molecular morphometrics; each data partition was allowed to have a different evolution rate. Paragonimus westermani was found to group with P. siamensis of Thailand; this was best supported by both the molecular morphometrics and combined analyses. P. heterotremus, P. proliferus, P. skrjabini, P. bangkokensis and P. harinasutai formed a separate clade in the molecular phylogenies, and were reciprocally monophyletic with respect to other species. ITS2 sequence

  9. PAGE analysis of the heteroduplexes formed between PCR-amplified 16S rRNA genes: estimation of sequence similarity and rDNA complexity.


    Espejo, R T; Feijóo, C G; Romero, J; Vásquez, M


    Analysis of the 16S rRNA genes retrieved directly from different environments has proven to be a powerful tool that has greatly expanded our knowledge of microbial diversity and phylogeny. It is shown here that sequence similarity between 80 and 100% among 16S rDNAs can be estimated by the electrophoretic migration of their heteroduplexes. This was measured by hybridization and electrophoresis in polyacrylamide gels of the product obtained after PCR amplification of almost the entire 16S rRNA gene from different bacterial species. These heteroduplexes were also observed after amplification of samples containing DNA from two or more bacterial species and a procedure was applied to identify reliably heteroduplexes among the amplification products. The electrophoretic migration of the heteroduplexes observed after PCR was used to detect the presence of 16S rDNAs with different sequences in DNA extracted from both a mixture of two bacterial species and samples containing a natural bacterial community.

  10. Analysis of the 16S-23S rDNA intergenic spacers (IGSs) of marine vibrios for species-specific signature DNA sequences.


    Lee, Simon K Y; Wang, H Z; Law, Sheran H W; Wu, Rudolf S S; Kong, Richard Y C


    Vibrios are widespread in the marine environment and a few pathogenic species are known to be commonly associated with outbreaks of diarrheal diseases in humans due to the consumption of raw or improperly cooked seafood. However, there are also many Vibrio species which are potentially pathogenic to vertebrate and invertebrate aquatic animals, and of which little is known. In an attempt to develop rapid PCR detection methods for these latter class of vibrios, we have examined the 16S-23S intergenic spacers (IGSs) of 10 lesser-known Vibrio species and successfully developed species-specific primers for eight of them--Vibrio costicola, V. diazotrophicus, V. fluvialis, V. nigripulchritudo, V. proteolyticus, V. salmonicida, V. splendidus and V. tubiashii. The IGS amplicons were amplified using primers complementary to conserved regions of the 16S and 23S rRNA genes, and cloned into plasmid vectors and sequenced. Analysis of the IGS sequences showed that 37 ribosomal RNA (rrn) operons representing seven different IGS types have been cloned from the 10 vibrios. The three IGS types--IGS(0), IGS(IA) and IGS(Glu)--were the most prevalent forms detected. Multiple alignment of representative sequences of these three IGS types from different Vibrio species revealed several domains of high sequence variability, which were used to design species-specific primers for PCR. The specificity of the primers were evaluated using total DNA prepared from different Vibrio species and bacterial genera. The results showed that the PCR method can be used to reliably detect eight of the 10 Vibrio species in marine waters in this study.

  11. Assessing Symbiodinium diversity in scleractinian corals via next-generation sequencing-based genotyping of the ITS2 rDNA region

    PubMed Central

    Arif, Chatchanit; Daniels, Camille; Bayer, Till; Banguera-Hinestroza, Eulalia; Barbrook, Adrian; Howe, Christopher J; LaJeunesse, Todd C; Voolstra, Christian R


    The persistence of coral reef ecosystems relies on the symbiotic relationship between scleractinian corals and intracellular, photosynthetic dinoflagellates in the genus Symbiodinium. Genetic evidence indicates that these symbionts are biologically diverse and exhibit discrete patterns of environmental and host distribution. This makes the assessment of Symbiodinium diversity critical to understanding the symbiosis ecology of corals. Here, we applied pyrosequencing to the elucidation of Symbiodinium diversity via analysis of the internal transcribed spacer 2 (ITS2) region, a multicopy genetic marker commonly used to analyse Symbiodinium diversity. Replicated data generated from isoclonal Symbiodinium cultures showed that all genomes contained numerous, yet mostly rare, ITS2 sequence variants. Pyrosequencing data were consistent with more traditional denaturing gradient gel electrophoresis (DGGE) approaches to the screening of ITS2 PCR amplifications, where the most common sequences appeared as the most intense bands. Further, we developed an operational taxonomic unit (OTU)-based pipeline for Symbiodinium ITS2 diversity typing to provisionally resolve ecologically discrete entities from intragenomic variation. A genetic distance cut-off of 0.03 collapsed intragenomic ITS2 variants of isoclonal cultures into single OTUs. When applied to the analysis of field-collected coral samples, our analyses confirm that much of the commonly observed SymbiodiniumITS2 diversity can be attributed to intragenomic variation. We conclude that by analysing Symbiodinium populations in an OTU-based framework, we can improve objectivity, comparability and simplicity when assessing ITS2 diversity in field-based studies. PMID:25052021

  12. Chromosomal mapping of H3 histone and 5S rRNA genes in eight species of Astyanax (Pisces, Characiformes) with different diploid numbers: syntenic conservation of repetitive genes.


    Piscor, Diovani; Parise-Maltempi, Patricia Pasquali


    The genus Astyanax is widely distributed from the southern United States to northern Patagonia, Argentina. While cytogenetic studies have been performed for this genus, little is known about the histone gene families. The aim of this study was to examine the chromosomal relationships among the different species of Astyanax. The chromosomal locations of the 5S rRNA and H3 histone genes were determined in A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, A. mexicanus (all 2n = 50), A. fasciatus (2n = 46), and A. schubarti (2n = 36). All eight species exhibited H3 histone clusters on two chromosome pairs. In six species (A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, and A. fasciatus), syntenic clusters of H3 histone and 5S rDNA were observed on metacentric (m) or submetacentric (sm) chromosomes. In seven species, clusters of 5S rDNA sequences were located on one or two chromosome pairs. In A. mexicanus, 5S rDNA clusters were located on four chromosome pairs. This study demonstrates that H3 histone clusters are conserved on two chromosome pairs in the genus Astyanax, and specific chromosomal features may contribute to the genomic organization of the H3 histone and 5S rRNA genes.

  13. Chromosomal mapping of H3 histone and 5S rRNA genes in eight species of Astyanax (Pisces, Characiformes) with different diploid numbers: syntenic conservation of repetitive genes.


    Piscor, Diovani; Parise-Maltempi, Patricia Pasquali


    The genus Astyanax is widely distributed from the southern United States to northern Patagonia, Argentina. While cytogenetic studies have been performed for this genus, little is known about the histone gene families. The aim of this study was to examine the chromosomal relationships among the different species of Astyanax. The chromosomal locations of the 5S rRNA and H3 histone genes were determined in A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, A. mexicanus (all 2n = 50), A. fasciatus (2n = 46), and A. schubarti (2n = 36). All eight species exhibited H3 histone clusters on two chromosome pairs. In six species (A. abramis, A. asuncionensis, A. altiparanae, A. bockmanni, A. eigenmanniorum, and A. fasciatus), syntenic clusters of H3 histone and 5S rDNA were observed on metacentric (m) or submetacentric (sm) chromosomes. In seven species, clusters of 5S rDNA sequences were located on one or two chromosome pairs. In A. mexicanus, 5S rDNA clusters were located on four chromosome pairs. This study demonstrates that H3 histone clusters are conserved on two chromosome pairs in the genus Astyanax, and specific chromosomal features may contribute to the genomic organization of the H3 histone and 5S rRNA genes. PMID:26835745

  14. Morphology and morphogenesis of a soil ciliate, Rigidohymena candens (Kahl, 1932) Berger, 2011 (Ciliophora, Hypotricha, Oxytrichidae), with notes on its molecular phylogeny based on small-subunit rDNA sequence data.


    Chen, Xumiao; Yan, Ying; Hu, Xiaozhong; Zhu, Mingzhuang; Ma, Honggang; Warren, Alan


    The morphology and morphogenesis of the stylonychine hypotrich Rigidohymena candens (Kahl, 1932) Berger, 2011, isolated from garden soil in Qingdao, China, were investigated using live observation and protargol impregnation methods. The Qingdao isolate possesses all diagnostic morphological characters of R. candens. The main events during binary fission are as follows: (i) the proter retains the parental adoral zone of membranelles entirely, whereas the old undulating membranes dedifferentiate into an anlage that gives rise to the leftmost frontal cirrus and the new undulating membranes of the proter; (ii) five streaks of fronto-ventral-transverse cirral anlagen are segmented in the pattern 3 : 3 : 3 : 4 : 4 from left to right, which form two frontal, four frontoventral, one buccal, five ventral and five transverse cirri, respectively; (iii) dorsal morphogenesis is in the typical Oxytricha pattern; (iv) three caudal cirri are formed, one at the posterior end of each of dorsal kineties 1, 2 and 4; and (v) the postoral ventral cirrus V/3 is not involved in primordia formation. The morphological and morphogenetic observations and phylogenetic analyses based on the small-subunit rDNA sequence data support the validity of Rigidohymena Berger, 2011 and its systematic position in the subfamily Stylonychinae. PMID:23456808

  15. Detection and phylogenetic relationships of Puccinia emaculata and Uromyces graminicola (Pucciniales) on switchgrass in New York State using rDNA sequence information.


    Kenaley, Shawn C; Hudler, George W; Bergstrom, Gary C


    The species of rust fungi (Pucciniales) inciting disease on switchgrass (Panicum virgatum) grown in bioenergy feedstock systems across the north-central and eastern United States remain unclear. In the present study, the species number and phylogenetic relationships of rust species affecting switchgrass were examined in 2011-2013 at two sites in New York State as well as selected sites in Alabama, Iowa, Nebraska, Pennsylvania, South Dakota, and West Virginia using ribosomal RNA gene data (partial internal transcribed spacer [ITS] 1, complete 5.8 subunit [S] and ITS2, and partial 28S). Uredinial group and teliospore morphology were also utilized to delimit taxa in collection years 2012 and 2013. Maximum likelihood, maximum parsimony, and Bayesian analyses demonstrated two monophyletic clades. Clade I consisted of Puccinia emaculata and included the majority of single-sorus samples across sites, whereas, Clade II included multiple samples from Iowa, Nebraska, and South Dakota. Single-telial samples for Clade I possessed only two-celled teliospores while Clade II samples possessed only one-celled teliospores, and hence, were readily diagnosed morphologically to P. emaculata and Uromyces graminicola, respectively. No U. graminicola sequences exist in GenBank to compare with our Clade II samples; however, based on teliospore morphology, the identity of Clade II taxa is U. graminicola. PMID:27109375

  16. Phylogenetic relationships of Plasmopara, Bremia and other genera of downy mildew pathogens with pyriform haustoria based on Bayesian analysis of partial LSU rDNA sequence data.


    Voglmayr, Hermann; Riethmüller, Alexandra; Göker, Markus; Weiss, Michael; Oberwinkler, Franz


    Bayesian and maximum parsimony phylogenetic analyses of 92 collections of the genera Basidiophora, Bremia, Paraperonospora, Phytophthora and Plasmopara were performed using nuclear large subunit ribosomal DNA sequences containing the D1 and D2 regions. In the Bayesian tree, two main clades were apparent: one clade containing Plasmopara pygmaea s. lat., Pl. sphaerosperma, Basidiophora, Bremia and Paraperonospora, and a clade containing all other Plasmopara species. Plasmopara is shown to be polyphyletic, and Pl. sphaerosperma is transferred to a new genus, Protobremia, for which also the oospore characteristics are described. Within the core Plasmopara clade, all collections originating from the same host family except from Asteraceae and Geraniaceae formed monophyletic clades; however, higher-level phylogenetic relationships lack significant branch support. A sister group relationship of Pl. sphaerosperma with Bremia lactucae is highly supported. Within Bremia lactucae s. l., three distinct clades are evident, which only partly conform to the published host specificity groups. All species of the genera Basidiophora, Bremia, Paraperonospora and Plasmopara included in the present study were investigated for haustorial morphology, and all had ellipsoid to pyriform haustoria, which are regarded as a diagnostic synapomorphy of the whole clade. Aspects of coevolution and cospeciation within the downy mildew pathogens with ellipsoid to pyriform haustoria are briefly discussed.

  17. Phylogeny and Biogeography of the Genus Ainsliaea (Asteraceae) in the Sino-Japanese Region based on Nuclear rDNA and Plastid DNA Sequence Data

    PubMed Central

    Mitsui, Yuki; Chen, Shao-Tien; Zhou, Zhe-Kun; Peng, Ching-I.; Deng, Yun-Fei; Setoguchi, Hiroaki


    Background and Aims The flora of the Sino-Japanese plant region of eastern Asia is distinctively rich compared with other floristic regions in the world. However, knowledge of its floristic evolution is fairly limited. The genus Ainsliaea is endemic to and distributed throughout the Sino-Japanese region. Its interspecific phylogenetic relationships have not been resolved. The aim is to provide insight into floristic evolution in eastern Asia on the basis of a molecular phylogenetic analysis of Ainsliaea species. Methods Cladistic analyses of the sequences of two nuclear (ITS, ETS) and one plastid (ndhF) regions were carried out individually and using the combined data from the three markers. Key Results Phylogenetic analyses of three DNA regions confirmed that Ainsliaea is composed of three major clades that correspond to species distributions. Evolution of the three lineages was estimated to have occurred around 1·1 MYA during the early Pleistocene. Conclusions The results suggest that Ainsliaea species evolved allopatrically and that the descendants were isolated in the eastern (between SE China and Japan, through Taiwan and the Ryukyu Islands) and western (Yunnan Province and its surrounding areas, including the Himalayas, the temperate region of Southeast Asia, and Sichuan Province) sides of the Sino-Japanese region. The results suggest that two distinct lineages of Ainsliaea have independently evolved in environmentally heterogeneous regions within the Sino-Japanese region. These regions have maintained rich and original floras due to their diverse climates and topographies. PMID:17981878

  18. Molecular profiling of microbial communities from contaminated sources: Use of substractive cloning methods and rDNA spacer sequences. 1997 annual progress report

    SciTech Connect


    'This project is to develop molecular methods for rapid characterization of microbial communities in contaminated ecosystems. The authors are exploring the use of {sup 16}s ribosomal DNA intergenic spacer regions (ISRs) to profile community composition. The choice proves to be a good one: there are 200--550 bases of 1 to 3 variable regions from which to choose species-specific probes, as well as 2--4 stretches of conserved sequence from which to develop universal PCR (polymerase chain reaction) primers. Preliminary community characterization is complete, and several types of arrays are under development to determine the types of bacteria present and the status of the ground water. Profiling the community composition of polluted groundwater will impact the broad field of microbial ecology as well as mixed-waste bioremediation. Results The samples the authors have been analysing were provided by Dr. Fred Brockman from Pacific Northwest Laboratory, and were collected at the US DOE Hanford site, Washington state. The samples were microbial filtrates from ground water polluted with 2 mg/L carbon tetrachloride and 250 mg/L nitrate and subjected to enrichment (acetate + nitrate) and recirculation. This project is described in some detail in PNNL-11113, Accelerated In Situ Bioremediation of Groundwater, by M.J. Truex, B.S. Hooker, and D.B. Anderson, July 1996.'

  19. Discovery of Pseudozyma rugulosa NBRC 10877 as a novel producer of the glycolipid biosurfactants, mannosylerythritol lipids, based on rDNA sequence.


    Morita, Tomotake; Konishi, Masaaki; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai


    The search for a novel producer of glycolipid biosurfactants, mannosylerythritol lipids (MEL) was undertaken based on the analysis of ribosomal DNA sequences on the yeast strains of the genus Pseudozyma. Pseudozyma rugulosa NBRC 10877 was found to produce a large amount of glycolipids from soybean oil. Fluorescence microscopic observation also demonstrated that the strain significantly accumulates polar lipids in the cells. The structure of the glycolipids produced by the strain was analyzed by (1)H and (13)C nuclear magnetic resonance and gas chromatography-mass spectrometry methods, and was determined to be the same as MEL produced by Pseudozyma antarctica, a well-known MEL producer. The major fatty acids of the present MEL consisted of C8 and C10 acids. Based on high performance liquid chromatography, the composition of the produced MEL was as follows: MEL-A (68%), MEL-B (12%), and MEL-C (20%). To enhance the production of MEL by the novel strain, factors affecting the production, such as carbon and nitrogen sources, were further examined. Soybean oil and sodium nitrate were the best carbon and nitrogen sources, respectively. The supplementation of a MEL precursor, such as erythritol, drastically enhanced the production yield from soybean oil at a rate of 70 to 90%. Under the optimal conditions in a shake culture, a maximum yield, productivity, and yield coefficient (on a weight basis to soybean oil supplied) of 142 g l(-1), 5.0 g l(-1) day(-1), and 0.5 g g(-1) were achieved by intermittent feeding of soybean oil and erythritol using the yeast.

  20. Discovery of Pseudozyma rugulosa NBRC 10877 as a novel producer of the glycolipid biosurfactants, mannosylerythritol lipids, based on rDNA sequence.


    Morita, Tomotake; Konishi, Masaaki; Fukuoka, Tokuma; Imura, Tomohiro; Kitamoto, Dai


    The search for a novel producer of glycolipid biosurfactants, mannosylerythritol lipids (MEL) was undertaken based on the analysis of ribosomal DNA sequences on the yeast strains of the genus Pseudozyma. Pseudozyma rugulosa NBRC 10877 was found to produce a large amount of glycolipids from soybean oil. Fluorescence microscopic observation also demonstrated that the strain significantly accumulates polar lipids in the cells. The structure of the glycolipids produced by the strain was analyzed by (1)H and (13)C nuclear magnetic resonance and gas chromatography-mass spectrometry methods, and was determined to be the same as MEL produced by Pseudozyma antarctica, a well-known MEL producer. The major fatty acids of the present MEL consisted of C8 and C10 acids. Based on high performance liquid chromatography, the composition of the produced MEL was as follows: MEL-A (68%), MEL-B (12%), and MEL-C (20%). To enhance the production of MEL by the novel strain, factors affecting the production, such as carbon and nitrogen sources, were further examined. Soybean oil and sodium nitrate were the best carbon and nitrogen sources, respectively. The supplementation of a MEL precursor, such as erythritol, drastically enhanced the production yield from soybean oil at a rate of 70 to 90%. Under the optimal conditions in a shake culture, a maximum yield, productivity, and yield coefficient (on a weight basis to soybean oil supplied) of 142 g l(-1), 5.0 g l(-1) day(-1), and 0.5 g g(-1) were achieved by intermittent feeding of soybean oil and erythritol using the yeast. PMID:16733733

  1. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.


    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng


    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location. PMID:27334092

  2. Comparative chromosomal localization of 45S and 5S rDNAs and implications for genome evolution in Cucumis.


    Zhang, Zhen-Tao; Yang, Shu-Qiong; Li, Zi-Ang; Zhang, Yun-Xia; Wang, Yun-Zhu; Cheng, Chun-Yan; Li, Ji; Chen, Jin-Feng; Lou, Qun-Feng


    Ribosomal DNAs are useful cytogenetic markers for chromosome analysis. Studies investigating site numbers and distributions of rDNAs have provided important information for elucidating genome organization and chromosomal relationships of many species by fluorescence in situ hybridization. But relevant studies are scarce for species of the genus Cucumis, especially in wild species. In the present study, FISH was conducted to investigate the organization of 45S and 5S rDNA among 20 Cucumis accessions, including cultivars and wild accessions. Our results showed that the number of 45S rDNA sites varied from one to five pairs in different accessions, and most of these sites are located at the terminal regions of chromosomes. Interestingly, up to five pairs of 45S rDNA sites were observed in C. sativus var. sativus, the species which has the lowest chromosome number, i.e., 2n = 14. Only one pair of 5S rDNA sites was detected in all accessions, except for C. heptadactylus, C. sp, and C. spp that had two pairs of 5S rDNA sites. The distributions of 5S rDNA sites showed more variation than 45S rDNA sites. The phylogenetic analysis in this study showed that 45S and 5S rDNA have contrasting evolutionary patterns. We find that 5S rDNA has a polyploidization-related tendency towards the terminal location from an interstitial location but maintains a conserved site number, whereas the 45S rDNA showed a trend of increasing site number but a relatively conserved location.

  3. Chromosomal localization and molecular characterization of three different 5S ribosomal DNA clusters in the sea urchin Paracentrotus lividus.


    Caradonna, Fabio; Bellavia, Daniele; Clemente, Ann Maria; Sisino, Giorgia; Barbieri, Rainer


    In this paper the chromosomal localization and molecular cloning and characterization of three 5S rDNA clusters of 700 bp (base pairs), 900 bp, and 950 bp in the sea urchin Paracentrotus lividus are reported. Southern blot hybridization demonstrated the existence of three 5S rDNA repeats of differing length in the P. lividus genome. Fluorescence in situ hybridization analysis, performed in parallel on both haploid and diploid metaphases and interphase nuclei using different 5S rDNA units as probes, localized these 5S rDNA clusters in 3 different pairs of P. lividus chromosomes. This is the first complete gene mapping not only in a sea urchin but also in the phylum of echinoderms as a whole. PMID:17893727

  4. Cytogenetic characterization by in situ hybridization techniques and molecular analysis of 5S rRNA genes of the European hazelnut (Corylus avellana).


    Falistocco, E; Marconi, G


    The European hazelnut (Corylus avellana L.) is widespread in Europe, where it has been cultivated for centuries. Despite progress in genetics, most of the cytogenetic aspects of this species have been overlooked. The aim of this study was to fill in this gap and obtain basic information on the chromosome structure of this species. Karyomorphological analysis confirmed the chromosome number 2n = 22 and showed that, despite their apparent uniformity, the chromosomes could be separated into three groups of different size: large (L), medium (M), and small (S). As a first step towards the physical mapping of the hazelnut chromosomes, we applied FISH to localize the position of rRNA genes (rDNA). The sites of 45S and 5S rDNA enabled us to identify two chromosome pairs belonging, respectively, to the L and S groups. The self-GISH procedure revealed that repetitive DNA is concentrated in the pericentromeric regions of the chromosomes, as with other species with rather small genomes. The analysis of 5S rDNA repeats offered additional information on the hazelnut genome by obtaining the whole sequence of the transcribed region so far unpublished. The overall results constitute a substantial advance in hazelnut cytogenetics. Further investigation of other species of Corylus could be an effective approach to understanding the phylogenesis of the genus and resolving taxonomic problems.

  5. Chaperoning 5S RNA assembly.


    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas


    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2-Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2-Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2-Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit.

  6. Chaperoning 5S RNA assembly

    PubMed Central

    Madru, Clément; Lebaron, Simon; Blaud, Magali; Delbos, Lila; Pipoli, Juliana; Pasmant, Eric; Réty, Stéphane; Leulliot, Nicolas


    In eukaryotes, three of the four ribosomal RNAs (rRNAs)—the 5.8S, 18S, and 25S/28S rRNAs—are processed from a single pre-rRNA transcript and assembled into ribosomes. The fourth rRNA, the 5S rRNA, is transcribed by RNA polymerase III and is assembled into the 5S ribonucleoprotein particle (RNP), containing ribosomal proteins Rpl5/uL18 and Rpl11/uL5, prior to its incorporation into preribosomes. In mammals, the 5S RNP is also a central regulator of the homeostasis of the tumor suppressor p53. The nucleolar localization of the 5S RNP and its assembly into preribosomes are performed by a specialized complex composed of Rpf2 and Rrs1 in yeast or Bxdc1 and hRrs1 in humans. Here we report the structural and functional characterization of the Rpf2–Rrs1 complex alone, in complex with the 5S RNA, and within pre-60S ribosomes. We show that the Rpf2–Rrs1 complex contains a specialized 5S RNA E-loop-binding module, contacts the Rpl5 protein, and also contacts the ribosome assembly factor Rsa4 and the 25S RNA. We propose that the Rpf2–Rrs1 complex establishes a network of interactions that guide the incorporation of the 5S RNP in preribosomes in the initial conformation prior to its rotation to form the central protuberance found in the mature large ribosomal subunit. PMID:26159998

  7. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron

    NASA Technical Reports Server (NTRS)

    Mackay, R. M.; Salgado, D.; Bonen, L.; Doolittle, W. F.; Stackebrandt, E.


    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are presented, along with the demonstrated phylogenetic relationships of P. denitrificans with purple nonsulfur bacteria, and of Prochloron with cyanobacteria. Structural findings include the following: (1) helix II in both models is much shorter than in other eubacteria, (2) a base-pair has been deleted from helix IV of P. denitrificans 5S, and (3) Prochloron 5S has the potential to form four base-pairs between residues. Also covered are the differences between pairs of sequences in P. denitrificans, Prochloron, wheat mitochondion, spinach chloroplast, and nine diverse eubacteria. Findings include the observation that Prochloron 5S rRNA is much more similar to the 5S of the cyanobacterium Anacystis nidulans (25 percent difference) than either are to any of the other nine eubacterial 5S rRNAs.

  8. Early evolutionary colocalization of the nuclear ribosomal 5S and 45S gene families in seed plants: evidence from the living fossil gymnosperm Ginkgo biloba.


    Galián, J A; Rosato, M; Rosselló, J A


    In seed plants, the colocalization of the 5S loci within the intergenic spacer (IGS) of the nuclear 45S tandem units is restricted to the phylogenetically derived Asteraceae family. However, fluorescent in situ hybridization (FISH) colocalization of both multigene families has also been observed in other unrelated seed plant lineages. Previous work has identified colocalization of 45S and 5S loci in Ginkgo biloba using FISH, but these observations have not been confirmed recently by sequencing a 1.8 kb IGS. In this work, we report the presence of the 45S-5S linkage in G. biloba, suggesting that in seed plants the molecular events leading to the restructuring of the ribosomal loci are much older than estimated previously. We obtained a 6.0 kb IGS fragment showing structural features of functional sequences, and a single copy of the 5S gene was inserted in the same direction of transcription as the ribosomal RNA genes. We also obtained a 1.8 kb IGS that was a truncate variant of the 6.0 kb IGS lacking the 5S gene. Several lines of evidence strongly suggest that the 1.8 kb variants are pseudogenes that are present exclusively on the satellite chromosomes bearing the 45S-5S genes. The presence of ribosomal IGS pseudogenes best reconciles contradictory results concerning the presence or absence of the 45S-5S linkage in Ginkgo. Our finding that both ribosomal gene families have been unified to a single 45S-5S unit in Ginkgo indicates that an accurate reassessment of the organization of rDNA genes in basal seed plants is necessary.

  9. Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.


    Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar


    Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

  10. Species identification of Crassostrea and Ostrea oysters by polymerase chain reaction amplification of the 5S rRNA gene.


    Cross, Ismael; Rebordinos, Laureana; Diaz, Edgardo


    A specific multiplex polymerase chain reaction (PCR) was developed for the identification of Crassostrea angulata, C. gigas, Ostrea edulis, and O. stentina oyster species. Universal primers were used for the amplification of complete repetition units of 5S rDNA in each of the 4 species. The alignment of the obtained sequences was the basis for the specific design of species-specific primers (ED1, ED2, ST1, ST2, CR1, and CR2) located in the nontranscribed spacer regions. The different sizes of the species-specific amplicons, separated by agarose gel electrophoresis, allowed identification of Crassostrea and Ostrea species. A multiplex PCR with a set of the 6 designed primers showed that they did not interfere with each other and bound specifically to the DNA target. This genetic marker can be very useful for traceability of the species, application in the management of oyster cultures, and conservation of the genetic resources of the species. PMID:16512239

  11. Extremely high copy numbers and polymorphisms of the rDNA operon estimated from single cell analysis of oligotrich and peritrich ciliates.


    Gong, Jun; Dong, Jun; Liu, Xihan; Massana, Ramon


    The copy number and sequence variation of the ribosomal DNA (rDNA) operon are of functional significance in evolution and ecology of organisms. However, the relationship between copy number and sequence variation of rDNA in protists has been rarely studied. Here we quantified rDNA copy numbers of oligotrich and peritrich ciliate species using single-cell quantitative PCR. We also examined the rDNA sequence variation by using single-cell PCR, cloning, and sequencing of multiple clones. We found that the rDNA copy numbers per cell were extremely high and different among even congeners, with the highest record of about 310,000. There was substantial intraindividual haplotype diversity and nucleotide diversity for the rDNA markers, with sequence differences primarily characterized by single nucleotide polymorphisms. Haplotype and nucleotide diversity was positively correlated to the rDNA copy number. Our findings provide evidence that: (1) ciliates generally have much higher rDNA copy numbers than other protists and fungi, which could lead to overestimation of the relative abundance of ciliates in environmental samples when rDNA sequence-based methodologies are used; and that (2) the rDNA might not always evolve in a strictly concerted manner in ciliates, which may raise problems in rDNA-based inference of species richness and phylogeny.

  12. A yeast transcription system for the 5S rRNA gene.

    PubMed Central

    van Keulen, H; Thomas, D Y


    A cell-free extract of yeast nuclei that can specifically transcribe cloned yeast 5S rRNA genes has been developed. Optima for transcription of 5S rDNA were determined and conditions of extract preparation leading to reproducible activities and specificities established. The major in vitro product has the same size and oligonucleotide composition as in vivo 5S rRNA. The in vitro transcription extract does not transcribe yeast tRNA genes. The extract does increase the transcription of tRNA genes packaged in chromatin. Images PMID:7145700

  13. Isolation, characterization and chromosome localization of repetitive DNA sequences in bananas (Musa spp.).


    Valárik, M; Simková, H; Hribová, E; Safár, J; Dolezelová, M; Dolezel, J


    Partial genomic DNA libraries were constructed in Musa acuminata and M. balbisiana and screened for clones carrying repeated sequences, and sequences carrying rDNA. Isolated clones were characterized in terms of copy number, genomic distribution in M. acuminata and M. balbisiana, and sequence similarity to known DNA sequences. Ribosomal RNA genes have been the most abundant sequences recovered. FISH with probes for DNA clones Radkal and Radka7, which carry different fragments of Musa 26S rDNA, and Radka14, for which no homology with known DNA sequences has been found, resulted in clear signals at secondary constrictions. Only one clone carrying 5S rDNA, named Radka2, has been recovered. All remaining DNA clones exhibited more or less pronounced clustering at centromeric regions. The study revealed small differences in genomic distribution of repetitive DNA sequences between M. acuminata and M. balbisiana, the only exception being the 5S rDNA where the two Musa clones under study differed in the number of sites. All repetitive sequences were more abundant in M. acuminata whose genome is about 12% larger than that of M. balbisiana. While, for some sequences, the differences in copy number between the species were relatively small, for some of them, e.g. Radka5, the difference was almost thirty-fold. These observations suggest that repetitive DNA sequences contribute to the difference in genome size between both species, albeit to different extents. Isolation and characterization of new repetitive DNA sequences improves the knowledge of long-range organization of chromosomes in

  14. Astonishing 35S rDNA diversity in the gymnosperm species Cycas revoluta Thunb.


    Wang, Wencai; Ma, Lu; Becher, Hannes; Garcia, Sònia; Kovarikova, Alena; Leitch, Ilia J; Leitch, Andrew R; Kovarik, Ales


    In all eukaryotes, the highly repeated 35S ribosomal DNA (rDNA) sequences encoding 18S-5.8S-26S ribosomal RNA (rRNA) typically show high levels of intragenomic uniformity due to homogenisation processes, leading to concerted evolution of 35S rDNA repeats. Here, we compared 35S rDNA divergence in several seed plants using next generation sequencing and a range of molecular and cytogenetic approaches. Most species showed similar 35S rDNA homogeneity indicating concerted evolution. However, Cycas revoluta exhibits an extraordinary diversity of rDNA repeats (nucleotide sequence divergence of different copies averaging 12 %), influencing both the coding and non-coding rDNA regions nearly equally. In contrast, its rRNA transcriptome was highly homogeneous suggesting that only a minority of genes (<20 %) encode functional rRNA. The most common SNPs were C > T substitutions located in symmetrical CG and CHG contexts which were also highly methylated. Both functional genes and pseudogenes appear to cluster on chromosomes. The extraordinary high levels of 35S rDNA diversity in C. revoluta, and probably other species of cycads, indicate that the frequency of repeat homogenisation has been much lower in this lineage, compared with all other land plant lineages studied. This has led to the accumulation of methylation-driven mutations and pseudogenisation. Potentially, the reduced homology between paralogs prevented their elimination by homologous recombination, resulting in long-term retention of rDNA pseudogenes in the genome.

  15. Astonishing 35S rDNA diversity in the gymnosperm species Cycas revoluta Thunb.


    Wang, Wencai; Ma, Lu; Becher, Hannes; Garcia, Sònia; Kovarikova, Alena; Leitch, Ilia J; Leitch, Andrew R; Kovarik, Ales


    In all eukaryotes, the highly repeated 35S ribosomal DNA (rDNA) sequences encoding 18S-5.8S-26S ribosomal RNA (rRNA) typically show high levels of intragenomic uniformity due to homogenisation processes, leading to concerted evolution of 35S rDNA repeats. Here, we compared 35S rDNA divergence in several seed plants using next generation sequencing and a range of molecular and cytogenetic approaches. Most species showed similar 35S rDNA homogeneity indicating concerted evolution. However, Cycas revoluta exhibits an extraordinary diversity of rDNA repeats (nucleotide sequence divergence of different copies averaging 12 %), influencing both the coding and non-coding rDNA regions nearly equally. In contrast, its rRNA transcriptome was highly homogeneous suggesting that only a minority of genes (<20 %) encode functional rRNA. The most common SNPs were C > T substitutions located in symmetrical CG and CHG contexts which were also highly methylated. Both functional genes and pseudogenes appear to cluster on chromosomes. The extraordinary high levels of 35S rDNA diversity in C. revoluta, and probably other species of cycads, indicate that the frequency of repeat homogenisation has been much lower in this lineage, compared with all other land plant lineages studied. This has led to the accumulation of methylation-driven mutations and pseudogenisation. Potentially, the reduced homology between paralogs prevented their elimination by homologous recombination, resulting in long-term retention of rDNA pseudogenes in the genome. PMID:26637996

  16. Enterococcus faecium PBP5-S/R, the missing link between PBP5-S and PBP5-R.


    Pietta, Ester; Montealegre, Maria Camila; Roh, Jung Hyeob; Cocconcelli, Pier Sandro; Murray, Barbara E


    During a study to investigate the evolution of ampicillin resistance in Enterococcus faecium, we observed that a number of E. faecium strains, mainly from the recently described subclade A2, showed PBP5 sequences in between PBP5-S and PBP5-R. These hybrid PBP5-S/R patterns reveal a progression of amino acid changes from the S form to the R form of this protein; however, these changes do not strictly correlate with changes in ampicillin MICs.

  17. Assessing Fungal Population in Soil Planted with Cry1Ac and CPTI Transgenic Cotton and Its Conventional Parental Line Using 18S and ITS rDNA Sequences over Four Seasons

    PubMed Central

    Qi, Xiemin; Liu, Biao; Song, Qinxin; Zou, Bingjie; Bu, Ying; Wu, Haiping; Ding, Li; Zhou, Guohua


    Long-term growth of genetically modified plants (GMPs) has raised concerns regarding their ecological effects. Here, FLX-pyrosequencing of region I (18S) and region II (ITS1, 5.8S, and ITS2) rDNA was used to characterize fungal communities in soil samples after 10-year monoculture of one representative transgenic cotton line (TC-10) and 15-year plantation of various transgenic cotton cultivars (TC-15mix) over four seasons. Soil fungal communities in the rhizosphere of non-transgenic control (CC) were also compared. No notable differences were observed in soil fertility variables among CC, TC-10, and TC-15mix. Within seasons, the different estimations were statistically indistinguishable. There were 411 and 2 067 fungal operational taxonomic units in the two regions, respectively. More than 75% of fungal taxa were stable in both CC and TC except for individual taxa with significantly different abundance between TC and CC. Statistical analysis revealed no significant differences between CC and TC-10, while discrimination of separating TC-15mix from CC and TC-10 with 37.86% explained variance in PCoA and a significant difference of Shannon indexes between TC-10 and TC-15mix were observed in region II. As TC-15mix planted with a mixture of transgenic cottons (Zhongmian-29, 30, and 33B) for over 5 years, different genetic modifications may introduce variations in fungal diversity. Further clarification is necessary by detecting the fungal dynamic changes in sites planted in monoculture of various transgenic cottons. Overall, we conclude that monoculture of one representative transgenic cotton cultivar may have no effect on fungal diversity compared with conventional cotton. Furthermore, the choice of amplified region and methodology has potential to affect the outcome of the comparison between GM-crop and its parental line. PMID:27462344

  18. Assessing Fungal Population in Soil Planted with Cry1Ac and CPTI Transgenic Cotton and Its Conventional Parental Line Using 18S and ITS rDNA Sequences over Four Seasons.


    Qi, Xiemin; Liu, Biao; Song, Qinxin; Zou, Bingjie; Bu, Ying; Wu, Haiping; Ding, Li; Zhou, Guohua


    Long-term growth of genetically modified plants (GMPs) has raised concerns regarding their ecological effects. Here, FLX-pyrosequencing of region I (18S) and region II (ITS1, 5.8S, and ITS2) rDNA was used to characterize fungal communities in soil samples after 10-year monoculture of one representative transgenic cotton line (TC-10) and 15-year plantation of various transgenic cotton cultivars (TC-15mix) over four seasons. Soil fungal communities in the rhizosphere of non-transgenic control (CC) were also compared. No notable differences were observed in soil fertility variables among CC, TC-10, and TC-15mix. Within seasons, the different estimations were statistically indistinguishable. There were 411 and 2 067 fungal operational taxonomic units in the two regions, respectively. More than 75% of fungal taxa were stable in both CC and TC except for individual taxa with significantly different abundance between TC and CC. Statistical analysis revealed no significant differences between CC and TC-10, while discrimination of separating TC-15mix from CC and TC-10 with 37.86% explained variance in PCoA and a significant difference of Shannon indexes between TC-10 and TC-15mix were observed in region II. As TC-15mix planted with a mixture of transgenic cottons (Zhongmian-29, 30, and 33B) for over 5 years, different genetic modifications may introduce variations in fungal diversity. Further clarification is necessary by detecting the fungal dynamic changes in sites planted in monoculture of various transgenic cottons. Overall, we conclude that monoculture of one representative transgenic cotton cultivar may have no effect on fungal diversity compared with conventional cotton. Furthermore, the choice of amplified region and methodology has potential to affect the outcome of the comparison between GM-crop and its parental line. PMID:27462344

  19. Physical mapping of 18S and 5S genes in pelagic species of the genera Caranx and Carangoides (Carangidae).


    Jacobina, U P; Bertollo, L A C; Bello Cioffi, M; Molina, W F


    In Carangidae, Caranx is taxonomically controversial because of slight morphological differences among species, as well as because of its relationship with the genus Carangoides. Cytogenetic data has contributed to taxonomic and phylogenetic classification for some groups of fish. In this study, we examined the chromosomes of Caranx latus, Caranx lugubris, and Carangoides bartholomaei using classical methods, including conventional staining, C-banding, silver staining for nuclear organizer regions, base-specific fluorochrome, and 18S and 5S ribosomal sequence mapping using in situ hybridization. These 3 species showed chromosome numbers of 2n = 48, simple nuclear organizer regions (pair 1), and mainly centromeric heterochomatin. However, C. latus (NF = 50) and C. bartholomaei (NF = 50) showed a structurally conserved karyotype compared with C. lugubris (NF = 54), with a larger number of 2-armed chromosomes. The richness of GC-positive heterochromatic segments and sites in 5S rDNA in specific locations compared to the other 2 species reinforce the higher evolutionary dynamism in C. lugubris. Cytogenetic aspects shared between C. latus and C. bartholomaei confirm the remarkable phylogenetic proximity between these genera.

  20. Contrasting Patterns of rDNA Homogenization within the Zygosaccharomyces rouxii Species Complex

    PubMed Central

    Chand Dakal, Tikam; Giudici, Paolo; Solieri, Lisa


    Arrays of repetitive ribosomal DNA (rDNA) sequences are generally expected to evolve as a coherent family, where repeats within such a family are more similar to each other than to orthologs in related species. The continuous homogenization of repeats within individual genomes is a recombination process termed concerted evolution. Here, we investigated the extent and the direction of concerted evolution in 43 yeast strains of the Zygosaccharomyces rouxii species complex (Z. rouxii, Z. sapae, Z. mellis), by analyzing two portions of the 35S rDNA cistron, namely the D1/D2 domains at the 5’ end of the 26S rRNA gene and the segment including the internal transcribed spacers (ITS) 1 and 2 (ITS regions). We demonstrate that intra-genomic rDNA sequence variation is unusually frequent in this clade and that rDNA arrays in single genomes consist of an intermixing of Z. rouxii, Z. sapae and Z. mellis-like sequences, putatively evolved by reticulate evolutionary events that involved repeated hybridization between lineages. The levels and distribution of sequence polymorphisms vary across rDNA repeats in different individuals, reflecting four patterns of rDNA evolution: I) rDNA repeats that are homogeneous within a genome but are chimeras derived from two parental lineages via recombination: Z. rouxii in the ITS region and Z. sapae in the D1/D2 region; II) intra-genomic rDNA repeats that retain polymorphisms only in ITS regions; III) rDNA repeats that vary only in their D1/D2 domains; IV) heterogeneous rDNA arrays that have both polymorphic ITS and D1/D2 regions. We argue that an ongoing process of homogenization following allodiplodization or incomplete lineage sorting gave rise to divergent evolutionary trajectories in different strains, depending upon temporal, structural and functional constraints. We discuss the consequences of these findings for Zygosaccharomyces species delineation and, more in general, for yeast barcoding. PMID:27501051

  1. Comparative physical mapping of the 18S-5.8S-26S rDNA in three sorghum species.


    Sang, Y; Liang, G H


    The physical locations of the 18S-5.8S-26S rDNA sequences were examined in three sorghum species by fluorescence in situ hybridization (FISH) using biotin-labeled heterologous 18S-5.8S-26S rDNA probe (pTa71). Each 18S-5.8S-26S rDNA locus occurred at two sites on the chromosomes in Sorghum bicolor (2n = 20) and S. versicolor (2n = 10), but at four sites on the chromosomes of S. halepense (2n = 40) and the tetraploid S. versicolor (2n = 20). Positions of the rDNA loci varied from the interstitial to terminal position among the four accessions of the three sorghum species. The rDNA data are useful for investigation of chromosome evolution and phylogeny. This study excluded S. versicolor as the possible progenitor of S. bicolor.

  2. Characterization of the rDNA unit and sequence analysis of the small subunit rRNA and 5.8S rRNA genes from Tritrichomonas foetus.


    Chakrabarti, D; Dame, J B; Gutell, R R; Yowell, C A


    The ribosomal RNA gene unit of the protozoan parasite Tritrichomonas foetus has been cloned and analyzed. Southern blot analysis of the genomic DNA showed that the ribosomal RNA gene unit is organized as a tandem head to tail repeat with a unit length of 6 kb. By Northern analysis a primary transcript of 5.8 kb was detected. Copy number analysis showed the presence of 12 copies of the ribosomal RNA gene unit. The lengths of the small subunit ribosomal RNA and 5.8S ribosomal RNA are 1571 bp and 159 bp, respectively, as determined by sequence analysis. The T. foetus small subunit ribosomal RNA sequence is one of the shortest eukaryotic small subunit rRNA sequences, similar in length to those from 2 other amitochondrial protists. Although shorter than the majority of the eukaryotic small subunit ribosomal RNAs, this sequence maintains the primary and secondary structure common to all eukaryotic small subunit ribosomal RNA structures, while truncating sequences found within the eukaryotic variable regions. The length of the large subunit ribosomal RNA was measured at 2.5 kb.

  3. Molecular cytogenetic analysis of the Appenine endemic cyprinid fish Squalius lucumonis and three other Italian leuciscines using chromosome banding and FISH with rDNA probes.


    Rossi, Anna Rita; Milana, Valentina; Hett, Anne Kathrin; Tancioni, Lorenzo


    Karyotype and other chromosomal characteristics of the Appenine endemic cyprinid fish, Toscana stream chub Squalius lucumonis, were analysed using conventional banding and FISH with 45S and 5S rDNA probes. The diploid chromosome number (2n = 50) and karyotype characteristics including pericentromeric heterochromatic blocks and GC-rich CMA(3)-positive sites corresponding to both positive Ag-NORs and 45S rDNA loci on the short arms of a single medium-sized submetacentric chromosome pair were consistent with those found in most European leuciscine cyprinids. On other hand, 5S rDNA FISH in the Toscana stream chub and three other Italian leuciscines, S. squalus, Rutilus rubilio and Telestes muticellus, revealed a species-specific hybridization pattern, i.e. signals on four (S. lucumonis), three (S. squalus and R. rubilio) and two (T. muticellus) chromosome pairs. Whereas all the species shared the 5S rDNA loci on the largest subtelocentric chromosome pair, a "leuciscine" cytotaxonomic marker, S. lucumonis showed both classes of rDNA loci tandem aligned on the short arms of chromosome pair No. 12. The present findings suggest that the observed high variability of 5S rDNA loci provides a powerful tool for investigation of karyotype differentiation in karyologically conservative leuciscine fishes.

  4. Molecular cytogenetic analysis of the Appenine endemic cyprinid fish Squalius lucumonis and three other Italian leuciscines using chromosome banding and FISH with rDNA probes.


    Rossi, Anna Rita; Milana, Valentina; Hett, Anne Kathrin; Tancioni, Lorenzo


    Karyotype and other chromosomal characteristics of the Appenine endemic cyprinid fish, Toscana stream chub Squalius lucumonis, were analysed using conventional banding and FISH with 45S and 5S rDNA probes. The diploid chromosome number (2n = 50) and karyotype characteristics including pericentromeric heterochromatic blocks and GC-rich CMA(3)-positive sites corresponding to both positive Ag-NORs and 45S rDNA loci on the short arms of a single medium-sized submetacentric chromosome pair were consistent with those found in most European leuciscine cyprinids. On other hand, 5S rDNA FISH in the Toscana stream chub and three other Italian leuciscines, S. squalus, Rutilus rubilio and Telestes muticellus, revealed a species-specific hybridization pattern, i.e. signals on four (S. lucumonis), three (S. squalus and R. rubilio) and two (T. muticellus) chromosome pairs. Whereas all the species shared the 5S rDNA loci on the largest subtelocentric chromosome pair, a "leuciscine" cytotaxonomic marker, S. lucumonis showed both classes of rDNA loci tandem aligned on the short arms of chromosome pair No. 12. The present findings suggest that the observed high variability of 5S rDNA loci provides a powerful tool for investigation of karyotype differentiation in karyologically conservative leuciscine fishes. PMID:23238894

  5. Utility of internally transcribed spacer region of rDNA (ITS) and β-tubulin gene sequences to infer genetic diversity and migration patterns of Colletotrichum truncatum infecting Capsicum spp.


    Rampersad, Kandyce; Ramdial, Hema; Rampersad, Sephra N


    Anthracnose is among the most economically important diseases affecting pepper (Capsicum spp.) production in the tropics and subtropics. Of the three species of Colletotrichum implicated as causal agents of pepper anthracnose, C. truncatum is considered to be the most destructive in agro-ecosystems worldwide. However, the genetic variation and the migration potential of C. truncatum infecting pepper are not known. Five populations were selected for study and a two-locus (internally transcribed spacer region, ITS1-5.8S-ITS2, and β-tubulin, β-TUB) sequence data set was generated and used in the analyses. Sequences of the ITS region were less informative than β -tubulin gene sequences based on comparisons of DNA polymorphism indices. Trinidad had the highest genetic diversity and also had the largest effective population size in pairwise comparisons with the other populations. The Trinidad population also demonstrated significant genetic differentiation from the other populations. AMOVA and STRUCTURE analyses both suggested significant genetic variation within populations more so than among populations. A consensus Maximum Likelihood tree based on β-TUB gene sequences revealed very little intraspecific diversity for all isolates except for Trinidad. Two clades consisting solely of Trinidad isolates may have diverged earlier than the other isolates. There was also evidence of directional migration among the five populations. These findings may have a direct impact on the development of integrated disease management strategies to control C. truncatum infection in pepper. PMID:26843942

  6. The 5S ribosomal RNAs of Paracoccus denitrificans and Prochloron.

    PubMed Central

    MacKay, R M; Salgado, D; Bonen, L; Stackebrandt, E; Doolittle, W F


    The nucleotide sequences of the 5S rRNAs of Paracoccus denitrificans and Prochloron sp. are (formula: see text), respectively. Specific phylogenetic relationships of P. denitrificans with purple non-sulphur bacteria, and of Prochloron with cyanobacteria are demonstrated, and unique features of potential secondary structure are described. PMID:7099971

  7. Effects of 16S rDNA sampling on estimates of the number of endosymbiont lineages in sucking lice

    PubMed Central

    Burleigh, J. Gordon; Light, Jessica E.; Reed, David L.


    Phylogenetic trees can reveal the origins of endosymbiotic lineages of bacteria and detect patterns of co-evolution with their hosts. Although taxon sampling can greatly affect phylogenetic and co-evolutionary inference, most hypotheses of endosymbiont relationships are based on few available bacterial sequences. Here we examined how different sampling strategies of Gammaproteobacteria sequences affect estimates of the number of endosymbiont lineages in parasitic sucking lice (Insecta: Phthirapatera: Anoplura). We estimated the number of louse endosymbiont lineages using both newly obtained and previously sequenced 16S rDNA bacterial sequences and more than 42,000 16S rDNA sequences from other Gammaproteobacteria. We also performed parametric and nonparametric bootstrapping experiments to examine the effects of phylogenetic error and uncertainty on these estimates. Sampling of 16S rDNA sequences affects the estimates of endosymbiont diversity in sucking lice until we reach a threshold of genetic diversity, the size of which depends on the sampling strategy. Sampling by maximizing the diversity of 16S rDNA sequences is more efficient than randomly sampling available 16S rDNA sequences. Although simulation results validate estimates of multiple endosymbiont lineages in sucking lice, the bootstrap results suggest that the precise number of endosymbiont origins is still uncertain. PMID:27547523

  8. Effects of 16S rDNA sampling on estimates of the number of endosymbiont lineages in sucking lice.


    Allen, Julie M; Burleigh, J Gordon; Light, Jessica E; Reed, David L


    Phylogenetic trees can reveal the origins of endosymbiotic lineages of bacteria and detect patterns of co-evolution with their hosts. Although taxon sampling can greatly affect phylogenetic and co-evolutionary inference, most hypotheses of endosymbiont relationships are based on few available bacterial sequences. Here we examined how different sampling strategies of Gammaproteobacteria sequences affect estimates of the number of endosymbiont lineages in parasitic sucking lice (Insecta: Phthirapatera: Anoplura). We estimated the number of louse endosymbiont lineages using both newly obtained and previously sequenced 16S rDNA bacterial sequences and more than 42,000 16S rDNA sequences from other Gammaproteobacteria. We also performed parametric and nonparametric bootstrapping experiments to examine the effects of phylogenetic error and uncertainty on these estimates. Sampling of 16S rDNA sequences affects the estimates of endosymbiont diversity in sucking lice until we reach a threshold of genetic diversity, the size of which depends on the sampling strategy. Sampling by maximizing the diversity of 16S rDNA sequences is more efficient than randomly sampling available 16S rDNA sequences. Although simulation results validate estimates of multiple endosymbiont lineages in sucking lice, the bootstrap results suggest that the precise number of endosymbiont origins is still uncertain. PMID:27547523

  9. [Chromosomal localization of 5S and 45S ribosomal DNA in species of Linum L. section Linum (syn=Protolinum and Adenolinum)].


    Muravenko, O V; Amosova, A V; Samatadze, T E; Semenova, O Iu; Nosova, I V; Popov, K V; Shostak, N G; Zoshchuk, S A; Zelenin, A V


    Fluorescence in situ hybridization (FISH) was for the first time used to study the chromosomal location of the 45S (18-2.5S-26S) and 5S ribosomal genes in the genomes of five flax species of the section Linum (syn. Protolinum and Adenolinum). In L. usitatissimum L. (2n = 30), L. angustifolium Huds. (2n = 30), and L. bienne Mill. (2n = 30), a major hybridization site of 45S rDNA was observed in the pericentric region of a large metacentric chromosome. A polymorphic minor locus of 45S rDNA was found on one of the small chromosomes. Sites of 5S rDNA colocalized with those of 45S rDNA, but direct correlation between signal intensities from the 45S and 5S rDNA sites was observed only in some cases. Other 5S rDNA sites mapped to two chromosomes in these flax species. In L. grandiflorum Desf. (2n = 16) and L. austriacum L. (2n = 18), large regions of 45S and 5S rDNA were similarly located on a pair of homologous satellite-bearing chromosomes. An additional large polymorphic site of 45S and 5S rDNA was found in the proximal region of one arm of a small chromosome in the L. usitatissimum. L. angustifolium, and L. bienne karyotypes. The other arm of this chromosome contained a large 5S rDNA cluster. A similar location of the ribosomal genes in the pericentric region of the pair of satellite-bearing metacentrics confirmed the close relationships of the species examined. The difference in chromosomal location of the ribosomal genes between flax species with 2n = 30 and those with 2n = 16 or 18 testified to their assignment to different sections. The use of ribosomal genes as chromosome markers was assumed to be of importance for comparative genomic studies in cultivated flax, a valuable crop species of Russia, and in its wild relatives. PMID:15065434

  10. Phylogenetic position of Magnivitellinum Kloss, 1966 and Perezitrema Baruš & Moravec, 1967 (Trematoda: Plagiorchioidea: Macroderoididae) inferred from partial 28S rDNA sequences, with the establishment of Alloglossidiidae n. fam.


    Hernández-Mena, David Iván; Mendoza-Garfias, Berenit; Ornelas-García, Claudia Patricia; Pérez-Ponce de León, Gerardo


    The systematic position of two genera of Macroderoididae McMullen, 1937, Perezitrema Baruš & Moravec, 1967 and Magnivitellinum Kloss, 1966 is reviewed based on a phylogenetic analysis of the interrelationships of 15 species of the family allocated into six genera, along with 44 species of plagiorchioid trematodes, using partial sequences of the 28S rRNA gene. Sequences were analysed through parsimony, maximum likelihood and Bayesian inference. The obtained topologies show Perezitrema as the sister taxon of three species of Macroderoides Pearse, 1924; the latter genus appears to be paraphyletic since another three species are not included in this group. Instead, Magnivitellinum was placed as the sister taxon of Alloglossidium Simer, 1929. These relationships are well supported by high bootstrap and posterior probability values. The resulting trees demonstrate that the family Macroderoididae, as currently conceived in taxonomic treatments, is not monophyletic. Magnivitellinum simplex Kloss, 1966 and Alloglossidium spp. were nested as sister taxa of members of the family Leptophallidae Dayal, 1938, whereas Perezitrema bychowskii Baruš & Moravec, 1967 and species of Macroderoides and Paramacroderoides Venard, 1941 were grouped with Auridistomum chelydrae (Stafford, 1900), a monotypic member of Auridistomidae Stunkard, 1924. Based on our results, a new family, Alloglossidiidae n. fam. was established to accommodate the genera Magnivitellinum and Alloglossidium. PMID:27307166

  11. 5S rRNA and ribosome.


    Gongadze, G M


    5S rRNA is an integral component of the ribosome of all living organisms. It is known that the ribosome without 5S rRNA is functionally inactive. However, the question about the specific role of this RNA in functioning of the translation apparatus is still open. This review presents a brief history of the discovery of 5S rRNA and studies of its origin and localization in the ribosome. The previously expressed hypotheses about the role of this RNA in the functioning of the ribosome are discussed considering the unique location of 5S rRNA in the ribosome and its intermolecular contacts. Based on analysis of the current data on ribosome structure and its functional complexes, the role of 5S rRNA as an intermediary between ribosome functional domains is discussed.

  12. Real-time PCR and sequencing assays for rapid detection and identification of avian schistosomes in environmental samples.


    Jothikumar, Narayanan; Mull, Bonnie J; Brant, Sara V; Loker, Eric S; Collinson, Jeremy; Secor, W Evan; Hill, Vincent R


    Cercarial dermatitis, also known as swimmer's itch, is an allergenic skin reaction followed by intense itching caused by schistosome cercariae penetrating human skin. Cercarial dermatitis outbreaks occur globally and are frequently associated with freshwater lakes and are occasionally associated with marine or estuarine waters where birds reside year-round or where migratory birds reside. In this study, a broadly reactive TaqMan assay targeting 18S rRNA gene (ribosomal DNA [rDNA]) sequences that was based on a genetically diverse panel of schistosome isolates representing 13 genera and 20 species (the 18S rDNA TaqMan assay) was developed. A PCR assay was also developed to amplify a 28S rDNA region for subsequent sequencing to identify schistosomes. When applied to surface water samples seeded with Schistosoma mansoni cercariae, the 18S rDNA TaqMan assay enabled detection at a level of 5 S. mansoni cercariae in 100 liters of lake water. The 18S rDNA TaqMan and 28S rDNA PCR sequencing assays were also applied to 100-liter water samples collected from lakes in Nebraska and Wisconsin where there were reported dermatitis outbreaks. Avian schistosome DNA was detected in 11 of 34 lake water samples using the TaqMan assay. Further 28S rDNA sequence analysis of positive samples confirmed the presence of avian schistosome DNA and provided a preliminary identification of the avian schistosomes in 10 of the 11 samples. These data indicate that the broadly schistosome-reactive TaqMan assay can be effective for rapid screening of large-volume water samples for detection of avian schistosomes, thereby facilitating timely response actions to mitigate or prevent dermatitis outbreaks. Additionally, samples positive by the 18S rDNA TaqMan assay can be further assayed using the 28S rDNA sequencing assay to both confirm the presence of schistosomes and contribute to their identification.

  13. Real-Time PCR and Sequencing Assays for Rapid Detection and Identification of Avian Schistosomes in Environmental Samples

    PubMed Central

    Mull, Bonnie J.; Brant, Sara V.; Loker, Eric S.; Collinson, Jeremy; Secor, W. Evan; Hill, Vincent R.


    Cercarial dermatitis, also known as swimmer's itch, is an allergenic skin reaction followed by intense itching caused by schistosome cercariae penetrating human skin. Cercarial dermatitis outbreaks occur globally and are frequently associated with freshwater lakes and are occasionally associated with marine or estuarine waters where birds reside year-round or where migratory birds reside. In this study, a broadly reactive TaqMan assay targeting 18S rRNA gene (ribosomal DNA [rDNA]) sequences that was based on a genetically diverse panel of schistosome isolates representing 13 genera and 20 species (the 18S rDNA TaqMan assay) was developed. A PCR assay was also developed to amplify a 28S rDNA region for subsequent sequencing to identify schistosomes. When applied to surface water samples seeded with Schistosoma mansoni cercariae, the 18S rDNA TaqMan assay enabled detection at a level of 5 S. mansoni cercariae in 100 liters of lake water. The 18S rDNA TaqMan and 28S rDNA PCR sequencing assays were also applied to 100-liter water samples collected from lakes in Nebraska and Wisconsin where there were reported dermatitis outbreaks. Avian schistosome DNA was detected in 11 of 34 lake water samples using the TaqMan assay. Further 28S rDNA sequence analysis of positive samples confirmed the presence of avian schistosome DNA and provided a preliminary identification of the avian schistosomes in 10 of the 11 samples. These data indicate that the broadly schistosome-reactive TaqMan assay can be effective for rapid screening of large-volume water samples for detection of avian schistosomes, thereby facilitating timely response actions to mitigate or prevent dermatitis outbreaks. Additionally, samples positive by the 18S rDNA TaqMan assay can be further assayed using the 28S rDNA sequencing assay to both confirm the presence of schistosomes and contribute to their identification. PMID:25862226

  14. Characteristics of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) rRNA genes of Apis mellifera (Insecta: Hymenoptera): structure, organization, and retrotransposable elements

    PubMed Central

    Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R


    As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome

  15. Shifts in rDNA levels act as a genome buffer promoting chromosome homeostasis.


    Deregowska, Anna; Adamczyk, Jagoda; Kwiatkowska, Aleksandra; Gurgul, Artur; Skoneczny, Marek; Skoneczna, Adrianna; Szmatola, Tomasz; Jasielczuk, Igor; Magda, Michal; Rawska, Ewa; Pabian, Sylwia; Panek, Anita; Kaplan, Jakub; Lewinska, Anna; Wnuk, Maciej


    The nucleolus is considered to be a stress sensor and rDNA-based regulation of cellular senescence and longevity has been proposed. However, the role of rDNA in the maintenance of genome integrity has not been investigated in detail. Using genomically diverse industrial yeasts as a model and array-based comparative genomic hybridization (aCGH), we show that chromosome level may be balanced during passages and as a response to alcohol stress that may be associated with changes in rDNA pools. Generation- and ethanol-mediated changes in genes responsible for protein and DNA/RNA metabolism were revealed using next-generation sequencing. Links between redox homeostasis, DNA stability, and telomere and nucleolus states were also established. These results suggest that yeast genome is dynamic and chromosome homeostasis may be controlled by rDNA. PMID:26566866

  16. Phylogeny of the Eustigmatophyceae Based upon 18S rDNA, with Emphasis on Nannochloropsis.


    Andersen, R A; Brett, R W; Potter, D; Sexton, J P


    Complete 18S rDNA sequences were determined for 25 strains representing five genera of the Eustigmatophyceae, including re-examination of three strains with previously published sequences. Parsimony analysis of these and 44 published sequences for other heterokont chromophytes (unalignable sites removed) revealed that the Eustigmatophyceae were a monophyletic group. Analysis of eustigmatophyte taxa only (complete gene analyzed) supported the current familial classification scheme. Twenty one strains of Nannochloropsis were also examined using light microscopy. Gross morphology of cells was variable and overlapped among the strains; cell size was consistent within strains but sometimes varied considerably among strains of a species. The 18S rDNA of N. gaditana, N. oculata and N. salina was re-sequenced for strains used in previous publications and one or more nucleotide differences were found. Nucleotide sequences for Nannochloropsis species varied by up to 32 nucleotides. Identical sequences were found for six strains of N. salina, five strains of N. gadifana, four strains of N. granulata, and two strains of N. oculata, respectively. Four strains could not be assigned to described species and may represent two new species. The unique 18S rDNA sequences for each sibling species of Nannochloropsis demonstrates the presence of considerable genetic diversity despite the extremely simple morphology in this genus. PMID:23196114

  17. Unequal exchanges and the coevolution of X and Y rDNA arrays in Drosophila melanogaster.


    Coen, E S; Dover, G A


    We have examined the molecular basis of the response of individuals of D. melanogaster to artificial selection for high and low abdominal bristles. By monitoring the fate of particular rDNA spacer length variants associated with individually isolated X and Y chromosomes, we show that flies from the low bristle number selection lines have undergone an unequal exchange between the X and Y rDNA arrays. Such exchanges result in translocations between X and Y chromosomes, visualised as X.Y compound chromosomes at mitosis. Transfer of few copies of a length variant between X and Y indicates a clustering of variants. Flies that have reverted back to wild-type seemingly have undergone a second unequal exchange, giving rise to a compound X.Y chromosome containing Y rDNA of normal amounts. Unequal exchanges between X and Y rDNA arrays could contribute to the observed coevolution of rDNA sequences on these chromosomes. The biological significance of this outcome is discussed.

  18. Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization.


    Dingman, Douglas W


    Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions.

  19. High diversity of bacterial pathogens and antibiotic resistance in salmonid fish farm pond water as determined by molecular identification employing 16S rDNA PCR, gene sequencing and total antibiotic susceptibility techniques.


    Moore, John E; Huang, Junhua; Yu, Pengbo; Ma, Chaofeng; Moore, Peter Ja; Millar, Beverley C; Goldsmith, Colin E; Xu, Jiru


    The aim of this study was to examine the microbiological and related parameters (antibiotic resistance and pathogen identification) of water at two salmonid fish farms in Northern Ireland. Total Bacterial Counts at the Movanagher Fish Farm was 1730 colony forming units (cfu)/ml water (log10 3.24cfu/ml) and 3260cfu/ml (log10 3.51cfu/ml) at the Bushmills Salmon Station. Examination of resulting organisms revealed 10 morphological phenotypes, which were subsequently sequenced to determine their identification. All these organisms were Gram-negative and no Gram-positive organisms were isolated from any water sample. From these phenotypes, eight different genera were identified including Acinetobacter, Aeromonas, Chryseobacterium, Erwinia, Flavobacterium, Pseudomonas and Rheinheimera. One unnamed novel taxon was identified from water at the Movanagher Fish Farm, belonging to the genus Acinetobacter and has been tentatively named Acinetobacter movanagherensis. No other novel taxa were observed. All but one of these environmental organisms (Erwinia) are potential pathogens of fish disease. Total antibiotic resistance was observed to varying degrees in water specimens. The most resistant populations were observed in water taken from the Bushmills Salmon Station inlet, followed by water from the Movanagher Fish Farm. No resistance was observed against tetracycline and there was only one occurrence of resistance against ciprofloxacin. Overall, this study indicates that potential fish pathogens made up the majority of environmental organisms identified, even in the absence of recorded fish disease. There was also relatively high levels of total antibiotic resistance in the bacterial water populations examined, where tetracycline was the only antibiotic with zero resistance. These data indicate that the threat of bacterial disease is relatively close due to the indigenous colonization of farm water and that husbandry standards should be maintained at a high standard to avert

  20. High diversity of bacterial pathogens and antibiotic resistance in salmonid fish farm pond water as determined by molecular identification employing 16S rDNA PCR, gene sequencing and total antibiotic susceptibility techniques.


    Moore, John E; Huang, Junhua; Yu, Pengbo; Ma, Chaofeng; Moore, Peter Ja; Millar, Beverley C; Goldsmith, Colin E; Xu, Jiru


    The aim of this study was to examine the microbiological and related parameters (antibiotic resistance and pathogen identification) of water at two salmonid fish farms in Northern Ireland. Total Bacterial Counts at the Movanagher Fish Farm was 1730 colony forming units (cfu)/ml water (log10 3.24cfu/ml) and 3260cfu/ml (log10 3.51cfu/ml) at the Bushmills Salmon Station. Examination of resulting organisms revealed 10 morphological phenotypes, which were subsequently sequenced to determine their identification. All these organisms were Gram-negative and no Gram-positive organisms were isolated from any water sample. From these phenotypes, eight different genera were identified including Acinetobacter, Aeromonas, Chryseobacterium, Erwinia, Flavobacterium, Pseudomonas and Rheinheimera. One unnamed novel taxon was identified from water at the Movanagher Fish Farm, belonging to the genus Acinetobacter and has been tentatively named Acinetobacter movanagherensis. No other novel taxa were observed. All but one of these environmental organisms (Erwinia) are potential pathogens of fish disease. Total antibiotic resistance was observed to varying degrees in water specimens. The most resistant populations were observed in water taken from the Bushmills Salmon Station inlet, followed by water from the Movanagher Fish Farm. No resistance was observed against tetracycline and there was only one occurrence of resistance against ciprofloxacin. Overall, this study indicates that potential fish pathogens made up the majority of environmental organisms identified, even in the absence of recorded fish disease. There was also relatively high levels of total antibiotic resistance in the bacterial water populations examined, where tetracycline was the only antibiotic with zero resistance. These data indicate that the threat of bacterial disease is relatively close due to the indigenous colonization of farm water and that husbandry standards should be maintained at a high standard to avert

  1. Assessment of helminth biodiversity in wild rats using 18S rDNA based metagenomics.


    Tanaka, Ryusei; Hino, Akina; Tsai, Isheng J; Palomares-Rius, Juan Emilio; Yoshida, Ayako; Ogura, Yoshitoshi; Hayashi, Tetsuya; Maruyama, Haruhiko; Kikuchi, Taisei


    Parasite diversity has important implications in several research fields including ecology, evolutionary biology and epidemiology. Wide-ranging analysis has been restricted because of the difficult, highly specialised and time-consuming processes involved in parasite identification. In this study, we assessed parasite diversity in wild rats using 18S rDNA-based metagenomics. 18S rDNA PCR products were sequenced using an Illumina MiSeq sequencer and the analysis of the sequences using the QIIME software successfully classified them into several parasite groups. The comparison of the results with those obtained using standard methods including microscopic observation of helminth parasites in the rat intestines and PCR amplification/sequencing of 18S rDNA from isolated single worms suggests that this new technique is reliable and useful to investigate parasite diversity.

  2. Functional domains of the Xenopus laevis 5S gene promoter.

    PubMed Central

    Pieler, T; Oei, S L; Hamm, J; Engelke, U; Erdmann, V A


    To study the fine structure of the Xenopus laevis somatic 5S gene internal control region, we have created 15 different transversions using mutagenic oligonucleotide primers. The effects of these mutations on 5S DNA transcription in vitro as well as on stable complex formation with transcription factor TF III A and TF III C in crude nuclear extracts were analyzed. Mutations in the common class III 5' promoter element (nucleotides 50-61 in the 5S gene) interfere with transcription activity and stable complex formation whenever they contradict the tDNA box A consensus sequence. The second promoter element is defined by a major sequence block (nucleotides 80-89, box C) and two additional internal residues (70 and 71) at a distance of roughly one helical turn from both the major 3' and 5' control sequences; these two 3' elements contain the primary TF III A binding domain. The remaining nucleotides (62-69 and 71-79) when mutated do not interfere with transcription activity or factor binding and thus they constitute two spacer elements within a symmetrically structured 5S gene promoter. An increase in the relative spacing of box A and box C by insertion of 3 bp between nucleotides 66 and 67 leads to a drastic reduction in transcription activity and the ability to form a stable complex with TF III A and/or TF III C. Thus, accurate spacing is essential for the proper orientation of TF III A on 5S DNA and/or TF III C binding. Images Fig. 1. Fig. 3. Fig. 4. PMID:3004969

  3. Chromosome mapping of repetitive sequences in four Serrasalmidae species (Characiformes).


    Ribeiro, Leila Braga; Matoso, Daniele Aparecida; Feldberg, Eliana


    The Serrasalmidae family is composed of a number of commercially interesting species, mainly in the Amazon region where most of these fishes occur. In the present study, we investigated the genomic organization of the 18S and 5S rDNA and telomeric sequences in mitotic chromosomes of four species from the basal clade of the Serrasalmidae family: Colossoma macropomum, Mylossoma aureum, M. duriventre, and Piaractus mesopotamicus, in order to understand the chromosomal evolution in the family. All the species studied had diploid numbers 2n = 54 and exclusively biarmed chromosomes, but variations of the karyotypic formulas were observed. C-banding resulted in similar patterns among the analyzed species, with heterochromatic blocks mainly present in centromeric regions. The 18S rDNA mapping of C. macropomum and P. mesopotamicus revealed multiple sites of this gene; 5S rDNA sites were detected in two chromosome pairs in all species, although not all of them were homeologs. Hybridization with a telomeric probe revealed signals in the terminal portions of chromosomes in all the species and an interstitial signal was observed in one pair of C. macropomum. PMID:24688290

  4. Chromosome mapping of repetitive sequences in four Serrasalmidae species (Characiformes)

    PubMed Central

    Ribeiro, Leila Braga; Matoso, Daniele Aparecida; Feldberg, Eliana


    The Serrasalmidae family is composed of a number of commercially interesting species, mainly in the Amazon region where most of these fishes occur. In the present study, we investigated the genomic organization of the 18S and 5S rDNA and telomeric sequences in mitotic chromosomes of four species from the basal clade of the Serrasalmidae family: Colossoma macropomum, Mylossoma aureum, M. duriventre, and Piaractus mesopotamicus, in order to understand the chromosomal evolution in the family. All the species studied had diploid numbers 2n = 54 and exclusively biarmed chromosomes, but variations of the karyotypic formulas were observed. C-banding resulted in similar patterns among the analyzed species, with heterochromatic blocks mainly present in centromeric regions. The 18S rDNA mapping of C. macropomum and P. mesopotamicus revealed multiple sites of this gene; 5S rDNA sites were detected in two chromosome pairs in all species, although not all of them were homeologs. Hybridization with a telomeric probe revealed signals in the terminal portions of chromosomes in all the species and an interstitial signal was observed in one pair of C. macropomum. PMID:24688290

  5. Bacterial diversity in the rumen of Indian Surti buffalo (Bubalus bubalis), assessed by 16S rDNA analysis.


    Pandya, P R; Singh, K M; Parnerkar, S; Tripathi, A K; Mehta, H H; Rank, D N; Kothari, R K; Joshi, C G


    Bacterial communities in buffalo rumen were characterized using a culture-independent approach for a pooled sample of rumen fluid from 3 adult Surti buffaloes. Buffalo rumen is likely to include species of various bacterial phyla, so 16S rDNA sequences were amplified and cloned from the sample. A total of 191 clones were sequenced and similarities to known 16S rDNA sequences were examined. About 62.82% sequences (120 clones) had >90% similarity to the 16S rDNA database sequences. Furthermore, about 34.03% of the sequences (65 clones) were 85-89% similar to 16S rDNA database sequences. For the remaining 3.14%; the similarity was lower than 85% Phylogenetic analyses were also used to infer the makeup of bacterial communities in the rumen of Surti buffalo. As a result, we distinguished 42 operational taxonomic units (OTUs) based on unique 16S r DNA sequences: 19 OTUs affiliated to an unidentified group (45.23% of total OTUs), 11 OTUs of the phylum Firmicutes, also known as the low G+C group (26.19%), 7 OTUs of the Cytophaga-Flexibacter-Bacteroides phylum (16.66%), 4 OTUs of Spirochaetes (9.52%), and 1 OTU of Actinobacteria (2.38%). These include 10 single-clone OTUs, so Good's coverage (94.76%) of 16S rRNA libraries indicated that sequences identified in the libraries represent the majority of bacterial diversity present in rumen. PMID:20720314

  6. Analysis of Mammalian rDNA Internal Transcribed Spacers

    PubMed Central

    Coleman, Annette W.


    Nuclear rDNA Internal Transcribed Spacers, ITS1 and ITS2, are widely used for eukaryote phylogenetic studies from the ordinal level to the species level, and there is even a database for ITS2 sequences. However, ITS regions have been ignored in mammalian phylogenetic studies, and only a few rodent and ape sequences are represented in GenBank. The reasons for this dearth, and the remedies, are described here. We have recovered these sequences, mostly >1 kb in length, for 36 mammalian species. Sequence alignment and transcript folding comparisons reveal the rRNA transcript secondary structure. Mammalian ITS regions, though quite long, still fold into the recognizable secondary structure of other eukaryotes. The ITS2 in particular bears the four standard helix loops, and loops II and III have the hallmark characters universal to eukaryotes. Both sequence and insertions/deletions of transcript secondary structure helices observed here support the four superorder taxonomy of Placentalia. On the family level, major unique indels, neatly excising entire helices, will be useful when additional species are represented, resulting in significant further understanding of the details of mammalian evolutionary history. Furthermore, the identification of a highly conserved element of ITS1 common to warm-blooded vertebrates may aid in deciphering the complex mechanism of RNA transcript processing. This is the last major group of terrestrial vertebrates for which rRNA ITS secondary structure has been resolved. PMID:24260162

  7. Nucleotide excision repair of the 5 S ribosomal RNA gene assembled into a nucleosome.


    Liu, X; Smerdon, M J


    A-175-base pair fragment containing the Xenopus borealis somatic 5 S ribosomal RNA gene was used as a model system to determine the effect of nucleosome assembly on nucleotide excision repair (NER) of the major UV photoproduct (cyclobutane pyrimidine dimer (CPD)) in DNA. Xenopus oocyte nuclear extracts were used to carry out repair in vitro on reconstituted, positioned 5 S rDNA nucleosomes. Nucleosome structure strongly inhibits NER at many CPD sites in the 5 S rDNA fragment while having little effect at a few sites. The time course of CPD removal at 35 different sites indicates that >85% of the CPDs in the naked DNA fragment have t(12) values <2 h, whereas <26% of the t(12) values in nucleosomes are <2 h, and 15% are >8 h. Moreover, removal of histone tails from these mononucleosomes has little effect on the repair rates. Finally, nucleosome inhibition of repair shows no correlation with the rotational setting of a 14-nucleotide-long pyrimidine tract located 30 base pairs from the nucleosome dyad. These results suggest that inhibition of NER by mononucleosomes is not significantly influenced by the rotational orientation of CPDs on the histone surface, and histone tails play little (or no) role in this inhibition. PMID:10821833

  8. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae).


    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo


    Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country's economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 'Azul', Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700

  9. Physical mapping of 5S and 18S ribosomal DNA in three species of Agave (Asparagales, Asparagaceae)

    PubMed Central

    Gomez-Rodriguez, Victor Manuel; Rodriguez-Garay, Benjamin; Palomino, Guadalupe; Martínez, Javier; Barba-Gonzalez, Rodrigo


    Abstract Agave Linnaeus, 1753 is endemic of America and is considered one of the most important crops in Mexico due to its key role in the country’s economy. Cytogenetic analysis was carried out in Agave tequilana Weber, 1902 ‘Azul’, Agave cupreata Trelease et Berger, 1915 and Agave angustifolia Haworth, 1812. The analysis showed that in all species the diploid chromosome number was 2n = 60, with bimodal karyotypes composed of five pairs of large chromosomes and 25 pairs of small chromosomes. Furthermore, different karyotypical formulae as well as a secondary constriction in a large chromosome pair were found in all species. Fluorescent in situ hybridization (FISH) was used for physical mapping of 5S and 18S ribosomal DNA (rDNA). All species analyzed showed that 5S rDNA was located in both arms of a small chromosome pair, while 18S rDNA was associated with the secondary constriction of a large chromosome pair. Data of FISH analysis provides new information about the position and number of rDNA loci and helps for detection of hybrids in breeding programs as well as evolutionary studies. PMID:24260700

  10. Methanogen diversity in the rumen of Indian Surti buffalo (Bubalus bubalis), assessed by 16S rDNA analysis.


    Singh, K M; Tripathi, A K; Pandya, P R; Parnerkar, S; Rank, D N; Kothari, R K; Joshi, C G


    The methanogenic communities in buffalo rumen were characterized using a culture-independent approach of a pooled sample of rumen fluid from three adult Surti buffaloes. Buffalo rumen is likely to include species of various methanogens, so 16S rDNA sequences were amplified and cloned from the sample. A total of 171 clones were sequenced to examine 16S rDNA sequence similarity. About 52.63% sequences (90 clones) had ≥ 90% similarity, whereas, 46.78% of the sequences (81 clones) were 75-89% similar to 16S rDNA database sequences, respectively. Phylogenetic analyses were also used to infer the makeup of methanogenic communities in the rumen of Surti buffalo. As a result, we distinguished 23 operational taxonomic units (OTUs) based on unique 16S rDNA sequences: 12 OTUs (52.17%) affiliated to Methanomicrobiales order, 10 OTUs (43.47%) of the order Methanobacteriales and one OTU (4.34%) of Methanosarcina barkeri like clone, respectively. In addition, the population of Methanomicrobiales and Methabacteriales orders were also observed, accounting 4% and 2.17% of total archea. This study has revealed the largest assortment of hydrogenotrophic methanogens phylotypes ever identified from rumen of Surti buffaloes. PMID:21507441

  11. Generalized oscillator strengths for 5s, 5s{sup '}, and 5p excitations of krypton

    SciTech Connect

    Li Wenbin; Zhu Linfan; Yuan Zhensheng; Sun Jianmin; Cheng Huadong; Xu Kezun; Zhong Zhiping; Liu Xiaojing


    The absolute generalized oscillator strengths (GOSs) for 5s, 5s{sup '}, 5p [5/2]{sub 3,2}, 5p [3/2]{sub 1,2}, and 5p [1/2]{sub 0} transitions of krypton have been determined in a large K{sup 2} region at a high electron-impact energy of 2500 eV. The positions of the minima and maxima of these GOSs have been determined. The present results show that the angular resolution and pressure effect have great influence on the position and the amplitude of the minimum for the GOS of 5s+5s{sup '} transitions. When these effects are considered, the measured minimum position for the GOS of 5s+5s{sup '} transitions is in excellent agreement with the calculation of Chen and Msezane [J. Phys. B 33, 5397 (2000)].

  12. Overexpression of Ribosomal RNA in the Development of Human Cervical Cancer Is Associated with rDNA Promoter Hypomethylation

    PubMed Central

    Zhou, Hong; Wang, Yapei; Lv, Qiongying; Zhang, Juan; Wang, Qing; Gao, Fei; Hou, Haoli; Zhang, Hao; Zhang, Wei; Li, Lijia


    The ribosomal RNA (rRNA) gene encodes rRNA for protein synthesis. Aberrant expression of the rRNA gene has been generally observed in tumor cells and levels of its promoter methylation as an epigenetic regulator affect rRNA gene transcription. The possible relationship between expression and promoter methylation of rDNA has not been examined in human clinical cervical cancer. Here we investigate rRNA gene expression by quantitative real time PCR, and promoter methylation levels by HpaII/MspI digestion and sodium bisulfite sequencing in the development of human cervical cancer. We find that indeed rRNA levels are elevated in most of cervical intraepithelial neoplasia (CIN) specimens as compared with non-cancer tissues. The rDNA promoter region in cervical intraepithelial neoplasia (CIN) tissues reveals significant hypomethylation at cytosines in the context of CpG dinucleotides, accompanied with rDNA chromatin decondensation. Furthermore treatment of HeLa cells with the methylation inhibitor drug 5-aza-2’-deoxycytidine (DAC) demonstrates the negative correlation between the expression of 45S rDNA and the methylation level in the rDNA promoter region. These data suggest that a decrease in rDNA promoter methylation levels can result in an increase of rRNA synthesis in the development of human cervical cancer. PMID:27695092

  13. Direct identification of slowly growing Mycobacterium species by analysis of the intergenic 16S-23S rDNA spacer region (ISR) using a GelCompar II database containing sequence based optimization for restriction fragment site polymorphisms (RFLPs) for 12 enzymes.


    Gürtler, Volker; Harford, Cate; Bywater, Judy; Mayall, Barrie C


    To obtain Mycobacterium species identification directly from clinical specimens and cultures, the 16S-23S rDNA spacer (ISR) was amplified using previously published primers that detect all Mycobacterium species. The restriction enzyme that could potentially produce the most restriction fragment length polymorphisms (RFLPs) was determined from all available ISR DNA sequences in GenBank to produce a novel data set of RFLPs for 31 slowly growing Mycobacterium species. Subsequently a GelCompar II database was constructed from RFLPs for 10 enzymes that have been used in the literature to differentiate slowly growing Mycobacterium species. The combination of Sau96I and HaeIII were the best choice of enzymes for differentiating clinically relevant slowly growing Mycobacterium species. A total of 392 specimens were studied by PCR with 195 negative and 197 positive specimens. The ISR-PCR product was digested with HaeIII (previously reported) and Sau96I (new to this study) to obtain a Mycobacterium species identification based on the ISR-RFLPs. The species identification obtained by ISR-RFLP was confirmed by DNA sequencing (isolate numbers are shown in parentheses) for M. avium (3), M. intracellulare (4), M. avium complex (1), M. gordonae (2) and M. tuberculosis (1). The total number of specimens (99) identified were from culture (67), Bactectrade mark 12B culture bottles (11), EDTA blood (3), directly from smear positive specimens (13), tissue (4) and urine (1). Direct species identification was obtained from all 13/13 smear positive specimens. The total number of specimens (99) were identified as M. tuberculosis (41), M. avium (7), M. avium complex (11), M. intracellulare MIN-A (20), M. flavescens (2), M. fortuitum (10), M. gordonae (4), M. shimoidei (1), M. ulcerans (1) and M. chelonae (2). This method reduces the time taken for Mycobacterium species identification from 8-10 weeks for culture and biochemical identification; to 4-6 weeks for culture and ISR-RFLP; to 2 days

  14. Complete Sequence Construction of the Highly Repetitive Ribosomal RNA Gene Repeats in Eukaryotes Using Whole Genome Sequence Data.


    Agrawal, Saumya; Ganley, Austen R D


    The ribosomal RNA genes (rDNA) encode the major rRNA species of the ribosome, and thus are essential across life. These genes are highly repetitive in most eukaryotes, forming blocks of tandem repeats that form the core of nucleoli. The primary role of the rDNA in encoding rRNA has been long understood, but more recently the rDNA has been implicated in a number of other important biological phenomena, including genome stability, cell cycle, and epigenetic silencing. Noncoding elements, primarily located in the intergenic spacer region, appear to mediate many of these phenomena. Although sequence information is available for the genomes of many organisms, in almost all cases rDNA repeat sequences are lacking, primarily due to problems in assembling these intriguing regions during whole genome assemblies. Here, we present a method to obtain complete rDNA repeat unit sequences from whole genome assemblies. Limitations of next generation sequencing (NGS) data make them unsuitable for assembling complete rDNA unit sequences; therefore, the method we present relies on the use of Sanger whole genome sequence data. Our method makes use of the Arachne assembler, which can assemble highly repetitive regions such as the rDNA in a memory-efficient way. We provide a detailed step-by-step protocol for generating rDNA sequences from whole genome Sanger sequence data using Arachne, for refining complete rDNA unit sequences, and for validating the sequences obtained. In principle, our method will work for any species where the rDNA is organized into tandem repeats. This will help researchers working on species without a complete rDNA sequence, those working on evolutionary aspects of the rDNA, and those interested in conducting phylogenetic footprinting studies with the rDNA. PMID:27576718

  15. Eukaryotic 5S rRNA biogenesis

    PubMed Central

    Ciganda, Martin; Williams, Noreen


    The ribosome is a large complex containing both protein and RNA which must be assembled in a precise manner to allow proper functioning in the critical role of protein synthesis. 5S rRNA is the smallest of the RNA components of the ribosome, and although it has been studied for decades, we still do not have a clear understanding of its function within the complex ribosome machine. It is the only RNA species that binds ribosomal proteins prior to its assembly into the ribosome. Its transport into the nucleolus requires this interaction. Here we present an overview of some of the key findings concerning the structure and function of 5S rRNA and how its association with specific proteins impacts its localization and function. PMID:21957041

  16. Phylogeny of gregarines (Apicomplexa) as inferred from small-subunit rDNA and beta-tubulin.


    Leander, Brian S; Clopton, Richard E; Keeling, Patrick J


    Gregarines are thought to be deep-branching apicomplexans. Accordingly, a robust inference of gregarine phylogeny is crucial to any interpretation of apicomplexan evolution, but molecular sequences from gregarines are restricted to a small number of small-subunit (SSU) rDNA sequences from derived taxa. This work examines the usefulness of SSU rDNA and beta-tubulin sequences for inferring gregarine phylogeny. SSU rRNA genes from Lecudina (Mingazzini) sp., Monocystis agilis Stein, Leidyana migrator Clopton and Gregarina polymorpha Dufour, as well as the beta-tubulin gene from Leidyana migrator, were sequenced. The results of phylogenetic analyses of alveolate taxa using both genes were consistent with an early origin of gregarines and the putative 'sister' relationship between gregarines and Cryptosporidium, but neither phylogeny was strongly supported. In addition, two SSU rDNA sequences from unidentified marine eukaryotes were found to branch among the gregarines: one was a sequence derived from the haemolymph parasite of the giant clam, Tridacna crocea, and the other was a sequence misattributed to the foraminiferan Ammonium beccarii. In all of our analyses, the SSU rDNA sequence from Colpodella sp. clustered weakly with the apicomplexans, which is consistent with ultrastructural data. Altogether, the exact position of gregarines with respect to Cryptosporidium and other apicomplexans remains to be confirmed, but the congruence of SSU rDNA and beta-tubulin trees with one another and with morphological data does suggest that further sampling of molecular data will eventually put gregarine diversity into a phylogenetic context.

  17. Evolutionary pattern of rDNA following polyploidy in Leymus (Triticeae: Poaceae).


    Fan, Xing; Liu, Jing; Sha, Li-Na; Sun, Gen-Lou; Hu, Zhi-Qin; Zeng, Jian; Kang, Hou-Yang; Zhang, Hai-Qin; Wang, Yi; Wang, Xiao-Li; Zhang, Li; Ding, Chun-Bang; Yang, Rui-Wu; Zheng, You-Liang; Zhou, Yong-Hong


    Ribosomal ITS polymorphism and its ancestral genome origin of polyploid Leymus were examined to infer the evolutionary outcome of rDNA gene following allopolyploid speciation and to elucidate the geographic pattern of ITS variation. The results demonstrated that different polyploids have experienced varying fates, including maintenance or homogenization of divergent arrays, occurrence of chimeric repeats and potential pseudogenes. Our data suggested that (1) the Ns, P/F, and St genomic types in Leymus were originated from Psathyrostachys, Agropyron/Eremopyrum, and Pseudoroegneria, respectively; (2) the occurrence of a higher proportion of Leymus species with predominant uniparental rDNA type might associate with the segmental allopolyploid origin, nucleolar dominance of alloploids, and rapid radiation of Leymus; (3) maintenance of multiple parental ITS types in allopolyploid might result from long generation times associated to vegetative multiplication, number and chromosomal location of ribosomal loci and/or recurrent hybridization; (4) the rDNA genealogical structure of Leymus species might associate with the geographic origins; and (5) ITS sequence clade shared by Leymus species from Central Asia, North America, and Nordic might be an outcome of ancestral ITS homogenization. Our results shed new light on understanding evolutionary outcomes of rDNA following allopolyploid speciation and geographic isolation. PMID:24780748

  18. Polymorphism and recombination for rDNA in the putatively asexual microsporidian Nosema ceranae, a pathogen of honeybees.


    Sagastume, Soledad; del Aguila, Carmen; Martín-Hernández, Raquel; Higes, Mariano; Henriques-Gil, Nuno


    Nosema ceranae is currently one of the major pathogens of honeybees, related to the worldwide colony losses phenomenon. The genotyping of strains based on ribosomal DNA (rDNA) can be misleading if the repeated units are not identical. The analysis of cloned rDNA fragments containing the intergenic spacer (IGS) and part of the rDNA small-subunit (SSU) gene, from N. ceranae isolates from different European and Central Asia populations, revealed a high diversity of sequences. The variability involved single-nucleotide polymorphisms and insertion/deletions, resulting in 79 different haplotypes. Two sequences from the same isolate could be as different as any pair of sequences from different samples; in contrast, identical haplotypes were also found in very different geographical origins. Consequently, haplotypes cannot be organized in a consistent phylogenetic tree, clearly indicating that rDNA is not a reliable marker for the differentiation of N. ceranae strains. The results indicate that recombination between different sequences may produce new variants, which is quite surprising in microsporidia, usually considered to have an asexual mode of reproduction. The diversity of sequences and their geographical distribution indicate that haplotypes of different lineages may occasionally be present in a same cell and undergo homologue recombination, therefore suggesting a sexual haplo-diploid cycle.

  19. {upsilon}(5S) Results from CLEO

    SciTech Connect

    Pavlunin, Victor


    Using the CLEO detector at the Cornell Electron Storage Ring, we have observed the Bs meson in e+e- annihilation at the {upsilon}(5S) resonance. We have fully reconstructed 14 candidates consistent with Bs decays into final states with a J/{psi} or a D{sub s}{sup (*)-}. The probability that this is a background fluctuation is less than 8 x 10-10. We have established that Bs production proceeds predominantly through the creation of B{sub s}*B-bar{sub s}* pairs with {sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s}*) =0[ .11{sub -0.03}{sup +0.04}(stat) {+-} 0.02(syst)] nb. The following limits are set: {sigma}(e{sup +}e{sup -} {yields} B{sub s}B-bar{sub s})/{sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s}*) < 0.16 and [{sigma}(e{sup +}e{sup -} {yields} B{sub s}B-bar{sub s}*) + {sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s})]/{sigma}(e{sup +}e{sup -} {yields} B{sub s}*B-bar{sub s}*) < 0.16 (90% CL). In a separate analysis, by comparing production rates of D{sub s}{sup +} mesons in {upsilon}(5S) and {upsilon}(4S) decays, an estimate of the ratio of B{sub s}{sup (*)} B-bar{sub s}{sup (*)} to the total bb-bar quark pair production at the {upsilon}(5S) energy of (16 {+-} 3 {+-} 6)% is obtained.

  20. Deletion of the Tetrahymena thermophila rDNA replication fork barrier region disrupts macronuclear rDNA excision and creates a fragile site in the micronuclear genome.


    Yakisich, J S; Kapler, G M


    During macronuclear development the Tetrahymena thermophila ribosomal RNA gene is excised from micronuclear chromosome 1 by site-specific cleavage at chromosome breakage sequence (Cbs) elements, rearranged into a 'palindromic' 21 kb minichromosome and extensively amplified. Gene amplification initiates from origins in the 5' non-transcribed spacer, and forks moving toward the center of the palindrome arrest at a developmentally regulated replication fork barrier (RFB). The RFB is inactive during vegetative cell divisions, suggesting a role in the formation or amplification of macronuclear rDNA. Using micronuclear (germline) transformation, we show that the RFB region facilitates Cbs-mediated excision. Deletion of the RFB inhibits chromosome breakage in a sub-population of developing macronuclei and promotes alternative processing by a Cbs-independent mechanism. Remarkably, the RFB region prevents spontaneous breakage of chromosome 1 in the diploid micronucleus. Strains heterozygous for DeltaRFB and wild-type rDNA lose the DeltaRFB allele and distal left arm of chromosome 1 during vegetative propagation. The wild-type chromosome is subsequently fragmented near the rDNA locus, and both homologs are progressively eroded, suggesting that broken micronuclear chromosomes are not 'healed' by telomerase. Deletion of this 363 bp segment effectively creates a fragile site in the micronuclear genome, providing the first evidence for a non-telomere cis-acting determinant that functions to maintain the structural integrity of a mitotic eukaryotic chromosome.

  1. Distribution of 45S rDNA sites in chromosomes of plants: Structural and evolutionary implications

    PubMed Central


    Background 45S rDNA sites are the most widely documented chromosomal regions in eukaryotes. The analysis of the distribution of these sites along the chromosome in several genera has suggested some bias in their distribution. In order to evaluate if these loci are in fact non-randomly distributed and what is the influence of some chromosomal and karyotypic features on the distribution of these sites, a database was built with the position and number of 45S rDNA sites obtained by FISH together with other karyotypic data from 846 plant species. Results In angiosperms the most frequent numbers of sites per diploid karyotype were two and four, suggesting that in spite of the wide dispersion capacity of these sequences the number of rDNA sites tends to be restricted. The sites showed a preferential distribution on the short arms, mainly in the terminal regions. Curiously, these sites were frequently found on the short arms of acrocentric chromosomes where they usually occupy the whole arm. The trend to occupy the terminal region is especially evident in holokinetic chromosomes, where all of them were terminally located. In polyploids there is a trend towards reduction in the number of sites per monoploid complement. In gymnosperms, however, the distribution of rDNA sites varied strongly among the sampled families. Conclusions The location of 45S rDNA sites do not vary randomly, occurring preferentially on the short arm and in the terminal region of chromosomes in angiosperms. The meaning of this preferential location is not known, but some hypotheses are considered and the observed trends are discussed. PMID:23181612

  2. Evaluation of amplified rDNA restriction analysis (ARDRA) for the identification of Mycoplasma species

    PubMed Central

    Stakenborg, Tim; Vicca, Jo; Butaye, Patrick; Maes, Dominiek; De Baere, Thierry; Verhelst, Rita; Peeters, Johan; de Kruif, Aart; Haesebrouck, Freddy; Vaneechoutte, Mario


    Background Mycoplasmas are present worldwide in a large number of animal hosts. Due to their small genome and parasitic lifestyle, Mycoplasma spp. require complex isolation media. Nevertheless, already over 100 different species have been identified and characterized and their number increases as more hosts are sampled. We studied the applicability of amplified rDNA restriction analysis (ARDRA) for the identification of all 116 acknowledged Mycoplasma species and subspecies. Methods Based upon available 16S rDNA sequences, we calculated and compared theoretical ARDRA profiles. To check the validity of these theoretically calculated profiles, we performed ARDRA on 60 strains of 27 different species and subspecies of the genus Mycoplasma. Results In silico digestion with the restriction endonuclease AluI (AG^CT) was found to be most discriminative and generated from 3 to 13 fragments depending on the Mycoplasma species. Although 73 Mycoplasma species could be differentiated using AluI, other species gave undistinguishable patterns. For these, an additional restriction digestion, typically with BfaI (C^TAG) or HpyF10VI (GCNNNNN^NNGC), was needed for a final identification. All in vitro obtained restriction profiles were in accordance with the calculated fragments based on only one 16S rDNA sequence, except for two isolates of M. columbinum and two isolates of the M. mycoides cluster, for which correct ARDRA profiles were only obtained if the sequences of both rrn operons were taken into account. Conclusion Theoretically, restriction digestion of the amplified rDNA was found to enable differentiation of all described Mycoplasma species and this could be confirmed by application of ARDRA on a total of 27 species and subspecies. PMID:15955250

  3. Chromosomal localization of two novel repetitive sequences isolated from the Chenopodium quinoa Willd. genome.


    Kolano, B; Gardunia, B W; Michalska, M; Bonifacio, A; Fairbanks, D; Maughan, P J; Coleman, C E; Stevens, M R; Jellen, E N; Maluszynska, J


    The chromosomal organization of two novel repetitive DNA sequences isolated from the Chenopodium quinoa Willd. genome was analyzed across the genomes of selected Chenopodium species. Fluorescence in situ hybridization (FISH) analysis with the repetitive DNA clone 18-24J in the closely related allotetraploids C. quinoa and Chenopodium berlandieri Moq. (2n = 4x = 36) evidenced hybridization signals that were mainly present on 18 chromosomes; however, in the allohexaploid Chenopodium album L. (2n = 6x = 54), cross-hybridization was observed on all of the chromosomes. In situ hybridization with rRNA gene probes indicated that during the evolution of polyploidy, the chenopods lost some of their rDNA loci. Reprobing with rDNA indicated that in the subgenome labeled with 18-24J, one 35S rRNA locus and at least half of the 5S rDNA loci were present. A second analyzed sequence, 12-13P, localized exclusively in pericentromeric regions of each chromosome of C. quinoa and related species. The intensity of the FISH signals differed considerably among chromosomes. The pattern observed on C. quinoa chromosomes after FISH with 12-13P was very similar to GISH results, suggesting that the 12-13P sequence constitutes a major part of the repetitive DNA of C. quinoa.

  4. Molecular cytogenetic analysis of the crucian carp, Carassius carassius (Linnaeus, 1758) (Teleostei, Cyprinidae), using chromosome staining and fluorescence in situ hybridisation with rDNA probes

    PubMed Central

    Spoz, Aneta; Boron, Alicja; Porycka, Katarzyna; Karolewska, Monika; Ito, Daisuke; Abe, Syuiti; Kirtiklis, Lech; Juchno, Dorota


    Abstract The crucian carp Carassius carassius (Linnaeus, 1758) is a species with restricted and decreasing distribution in Europe. Six males and six females of the species from the Baltic Sea basin in Poland were examined to show sequentially CMA3/AgNO3 staining pattern, DAPI staining, and, for the first time in literature, molecular cytogenetic analysis using double-colour fluorescence in situ hybridisation (FISH) with 28S and 5S rDNA probes. The karyotype consisted of 20 m, 36 sm and 44 sta chromosomes, NF=156. The AgNO3 stained NORs were most frequently located terminally in the short arms of two sm and two sta elements, and CMA3-positive sites were also observed suggesting abundant GC-rich repetitive DNA in the regions. Other CMA3-positive sites in the short arms of six to ten sm and sta chromosomes were detected. The results based on 28S rDNA FISH confirmed the location of rDNA sites. DAPI-negative staining of NORs suggested the scarcity of AT-rich DNA in the regions. FISH with 5S rDNA probe revealed 8–14 loci (ten and 12 in respectively 49 and 29% of metaphases). They were located in two sm and eight to ten sta chromosomes and six of them were larger than others. Simultaneously, mapping of the two rDNA families on the chromosomes of C. carassius revealed that both 28S and 5S rDNA probes were located in different chromosomes. Molecular cytogenetic data of C. carassius presented here for the first time give an important insight into the structure of chromosomes of this polyploid and declining species and may be useful in its systematics. PMID:25349674

  5. Functional variants of 5S rRNA in the ribosomes of common sea urchin Paracentrotus lividus.


    Dimarco, Eufrosina; Cascone, Eleonora; Bellavia, Daniele; Caradonna, Fabio


    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus; this study, performed at DNA level only, lends itself as starting point to verify that these clusters could contain transcribed genes, then, to demonstrate the presence of heterogeneity at functional RNA level, also. In the present work we report in P. lividus ribosomes the existence of several transcribed variants of the 5S rRNA and we associate all transcribed variants to the cluster to which belong. Our finding is the first demonstration of the presence of high heterogeneity in functional 5S rRNA molecules in animal ribosomes, a feature that had been considered a peculiarity of some plants. PMID:22967708

  6. The conservation of number and location of 18S sites indicates the relative stability of rDNA in species of Pentatomomorpha (Heteroptera).


    Bardella, Vanessa Bellini; Fernandes, Thiago; Vanzela, André Luís Laforga


    Fluorescent in situ hybridization (FISH) with rDNA probes has been used for comparative cytogenetics studies in different groups of organisms. Although heteropterans are a large suborder within Hemiptera, studies using rDNA are limited to the infraorder Cimicomorpha, in which rDNA sites are present in the autosomes or sex chromosomes. We isolated and sequenced a conserved 18S rDNA region of Antiteuchus tripterus (Pentatomidae) and used it as a probe against chromosomes of 25 species belonging to five different families of Pentatomomorpha. The clone pAt05, with a length of 736 bp, exhibited a conserved stretch of 590 bp. FISH analysis with the probe pAt05 always demonstrated hybridization signals in sub-terminal positions, except for Euschistus heros. Apparently, there is a tendency for 18S rDNA sites to locate in autosomes, except for Leptoglossus gonagra and Euryophthalmus rufipennis, which showed signals in the m- and sex chromosomes, respectively. Although FISH has produced evidence that rearrangements are involved in rDNA repositioning, whether in different autosomes or between sex and m-chromosomes, we have no conclusive evidence of what were the pathways of these rearrangements based on the evolutionary history of the species studied here. Nevertheless, the diversity in the number of species analyzed here showed a tendency of 18S rDNA to remain among the autosomes.

  7. Discovery and characterization of Acanthamoeba castellanii mitochondrial 5S rRNA.


    Bullerwell, Charles E; Schnare, Murray N; Gray, Michael W


    Although 5S rRNA is a highly conserved and universal component of eubacterial, archaeal, chloroplast, and eukaryotic cytoplasmic ribosomes, a mitochondrial DNA-encoded 5S rRNA has so far been identified only in land plants and certain protists. This raises the question of whether 5S rRNA is actually required for and used in mitochondrial translation. In the protist Acanthamoeba castellanii, BLAST searches fail to reveal a 5S rRNA gene in the complete mitochondrial genome sequence, nor is a 5S-sized RNA species detectable in ethidium bromide-stained gels of highly purified mitochondrial RNA preparations. Here we show that an alternative visualization technique, UV shadowing, readily detects a novel, mitochondrion-specific small RNA in A. castellanii mitochondrial RNA preparations, and that this RNA species is, in fact, a 5S rRNA encoded by the A. castellanii mitochondrial genome. These results emphasize the need for caution when interpreting negative results that suggest the absence of 5S rRNA and/or a mitochondrial DNA-encoded 5S rRNA sequence in other (particularly protist) mitochondrial systems.

  8. Chromosomal mapping of rRNA genes, core histone genes and telomeric sequences in Brachidontes puniceus and Brachidontes rodriguezi (Bivalvia, Mytilidae)

    PubMed Central


    Background Chromosome rearrangements are an important part of the speciation process in many taxa. The study of chromosome evolution in bivalves is hampered by the absence of clear chromosomal banding patterns and the similarity in both chromosome size and morphology. For this reason, obtaining good chromosome markers is essential for reliable karyotypic comparisons. To begin this task, the chromosomes of the mussels Brachidontes puniceus and B. rodriguezi were studied by means of fluorochrome staining and fluorescent in situ hybridization (FISH). Results Brachidontes puniceus and B. rodriguezi both have 2n = 32 chromosomes but differing karyotype composition. Vertebrate-type telomeric sequences appear at both ends of every single chromosome. B. puniceus presents a single terminal major rRNA gene cluster on a chromosome pair while B. rodriguezi shows two. Both mussels present two 5S rDNA and two core histone gene clusters intercalary located on the long arms of two chromosome pairs. Double and triple-FISH experiments demonstrated that one of the 5S rDNA and one of the major rDNA clusters appear on the same chromosome pair in B. rodriguezi but not in B. puniceus. On the other hand, the second 5S rDNA cluster is located in one of the chromosome pairs also bearing one of the core histone gene clusters in the two mussel species. Conclusion Knowledge of the chromosomal distribution of these sequences in the two species of Brachidontes is a first step in the understanding of the role of chromosome changes on bivalve evolution. PMID:21143946

  9. When fathers are instant losers: homogenization of rDNA loci in recently formed Cardamine × schulzii trigenomic allopolyploid.


    Zozomová-Lihová, Judita; Mandáková, Terezie; Kovaříková, Alena; Mühlhausen, Andreas; Mummenhoff, Klaus; Lysak, Martin A; Kovařík, Aleš


    Recently formed allopolyploids represent an excellent system to study the impacts of hybridization and genomic duplication on genome structure and evolution. Here we explored the 35SrRNA genes (rDNA) in the Cardamine × schulzii allohexaploid that was formed by two subsequent hybridization events within the past c. 150 yr. The rDNA loci were analyzed by cloning, next generation sequencing (NGS), RT-PCR and FISH methods. The primary C. × insueta triploid hybrid derived from C. rivularis (♀) and C. amara (♂) had gene ratios highly skewed towards maternal sequences. Similarly, C. × schulzii, originating from the secondary hybridization event involving C. × insueta (♀) and C. pratensis (♂), showed a reduction in paternal rDNA homeologs despite an excess of chromosomes inherited from C. pratensis. We also identified novel rDNA loci in C. × schulzii, suggesting that lost loci might be slowly reinstalled by translocation (but not recombination) of genes from partner genomes. Prevalent clonal propagation of allopolyploids, C. × insueta and C. × schulzii, indicates that concerted evolution of rDNA may occur in the absence of extensive meiotic cycles. Adoption of NGS in rDNA variant analysis is highly informative for deciphering the evolutionary histories of allopolyploid species with ongoing homogenization processes. PMID:24916080

  10. Radiolaria Divided into Polycystina and Spasmaria in Combined 18S and 28S rDNA Phylogeny

    PubMed Central

    Dolven, Jane K.; Ose, Randi F.; Klaveness, Dag; Kristensen, Tom; Bjørklund, Kjell R.; Shalchian-Tabrizi, Kamran


    Radiolarians are marine planktonic protists that belong to the eukaryote supergroup Rhizaria together with Foraminifera and Cercozoa. Radiolaria has traditionally been divided into four main groups based on morphological characters; i.e. Polycystina, Acantharia, Nassellaria and Phaeodaria. But recent 18S rDNA phylogenies have shown that Phaeodaria belongs within Cerocozoa, and that the previously heliozoan group Taxopodida should be included in Radiolaria. 18S rDNA phylogenies have not yet resolved the sister relationship between the main Radiolaria groups, but nevertheless suggests that Spumellaria, and thereby also Polycystina, are polyphyletic. Very few sequences other than 18S rDNA have so far been generated from radiolarian cells, mostly due to the fact that Radiolaria has been impossible to cultivate and single cell PCR has been hampered by low success rate. Here we have therefore investigated the mutual evolutionary relationship of the main radiolarian groups by using the novel approach of combining single cell whole genome amplification with targeted PCR amplification of the 18S and 28S rDNA genes. Combined 18S and 28S phylogeny of sequences obtained from single cells shows that Radiolaria is divided into two main lineages: Polycystina (Spumellaria+Nassellaria) and Spasmaria (Acantharia+Taxopodida). Further we show with high support that Foraminifera groups within Radiolaria supporting the Retaria hypothesis. PMID:21853146

  11. Radiolaria divided into Polycystina and Spasmaria in combined 18S and 28S rDNA phylogeny.


    Krabberød, Anders K; Bråte, Jon; Dolven, Jane K; Ose, Randi F; Klaveness, Dag; Kristensen, Tom; Bjørklund, Kjell R; Shalchian-Tabrizi, Kamran


    Radiolarians are marine planktonic protists that belong to the eukaryote supergroup Rhizaria together with Foraminifera and Cercozoa. Radiolaria has traditionally been divided into four main groups based on morphological characters; i.e. Polycystina, Acantharia, Nassellaria and Phaeodaria. But recent 18S rDNA phylogenies have shown that Phaeodaria belongs within Cerocozoa, and that the previously heliozoan group Taxopodida should be included in Radiolaria. 18S rDNA phylogenies have not yet resolved the sister relationship between the main Radiolaria groups, but nevertheless suggests that Spumellaria, and thereby also Polycystina, are polyphyletic. Very few sequences other than 18S rDNA have so far been generated from radiolarian cells, mostly due to the fact that Radiolaria has been impossible to cultivate and single cell PCR has been hampered by low success rate. Here we have therefore investigated the mutual evolutionary relationship of the main radiolarian groups by using the novel approach of combining single cell whole genome amplification with targeted PCR amplification of the 18S and 28S rDNA genes. Combined 18S and 28S phylogeny of sequences obtained from single cells shows that Radiolaria is divided into two main lineages: Polycystina (Spumellaria+Nassellaria) and Spasmaria (Acantharia+Taxopodida). Further we show with high support that Foraminifera groups within Radiolaria supporting the Retaria hypothesis.

  12. Transcript levels, alternative splicing and proteolytic cleavage of TFIIIA control 5S rRNA accumulation during Arabidopsis thaliana development.


    Layat, Elodie; Cotterell, Sylviane; Vaillant, Isabelle; Yukawa, Yasushi; Tutois, Sylvie; Tourmente, Sylvette


    Ribosome biogenesis is critical for eukaryotic cells and requires coordinated synthesis of the protein and rRNA moieties of the ribosome, which are therefore highly regulated. 5S ribosomal RNA, an essential component of the large ribosomal subunit, is transcribed by RNA polymerase III and specifically requires transcription factor IIIA (TFIIIA). To obtain insight into the regulation of 5S rRNA transcription, we have investigated the expression of 5S rRNA and the exon-skipped (ES) and exon-including (EI) TFIIIA transcripts, two transcript isoforms that result from alternative splicing of the TFIIIA gene, and TFIIIA protein amounts with respect to requirements for 5S rRNA during development. We show that 5S rRNA quantities are regulated through distinct but complementary mechanisms operating through transcriptional and post-transcriptional control of TFIIIA transcripts as well as at the post-translational level through proteolytic cleavage of the TFIIIA protein. During the reproductive phase, high expression of the TFIIIA gene together with low proteolytic cleavage contributes to accumulation of functional, full-length TFIIIA protein, and results in 5S rRNA accumulation in the seed. In contrast, just after germination, the levels of TFIIIA-encoding transcripts are low and stable. Full-length TFIIIA protein is undetectable, and the level of 5S rRNA stored in the embryo progressively decreases. After day 4, in correlation with the reorganization of 5S rDNA chromatin to a mature state, full-length TFIIIA protein with transcriptional activity accumulates and permits de novo transcription of 5S rRNA.

  13. PCR amplification of 16S rDNA from lyophilized cell cultures facilitates studies in molecular systematics

    NASA Technical Reports Server (NTRS)

    Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.


    The sequence of the major portion of a Bacillus cycloheptanicus strain SCH(T) 16S rRNA gene is reported. This sequence suggests that B. cycloheptanicus is genetically quite distinct from traditional Bacillus strains (e.g., B. subtilis) and may be properly regarded as belonging to a different genus. The sequence was determined from DNA that was produced by direct amplification of ribosomal DNA from a lyophilized cell pellet with straightforward polymerase chain reaction (PCR) procedures. By obviating the need to revive cell cultures from the lyophile pellet, this approach facilitates rapid 16S rDNA sequencing and thereby advances studies in molecular systematics.

  14. Molecular evolution of homologous gene sequences in germline-limited and somatic chromosomes of Acricotopus.


    Staiber, Wolfgang


    The origin of germline-limited chromosomes (Ks) as descendants of somatic chromosomes (Ss) and their structural evolution was recently elucidated in the chironomid Acricotopus. The Ks consist of large S-homologous sections and of heterochromatic segments containing germline-specific, highly repetitive DNA sequences. Less is known about the molecular evolution and features of the sequences in the S-homologous K sections. More information about this was received by comparing homologous gene sequences of Ks and Ss. Genes for 5.8S, 18S, 28S, and 5S ribosomal RNA were choosen for the comparison and therefore isolated first by PCR from somatic DNA of Acricotopus and sequenced. Specific K DNA was collected by microdissection of monopolar moving K complements from differential gonial mitoses and was then amplified by degenerate oligonucleotide primer (DOP)-PCR. With the sequence data of the somatic rDNAs, the homologous 5.8S and 5S rDNA sequences were isolated by PCR from the DOP-PCR sequence pool of the Ks. In addition, a number of K DOP-PCR sequences were directly cloned and analysed. One K clone contained a section of a putative N-acetyltransferase gene. Compared with its homolog from the Ss, the sequence exhibited few nucleotide substitutions (99.2% sequence identity). The same was true for the 5.8S and 5S sequences from Ss and Ks (97.5%-100% identity). This supports the idea that the S-homologous K sequences may be conserved and do not evolve independently from their somatic homologs. Possible mechanisms effecting such conservation of S-derived sequences in the Ks are discussed.

  15. Karyotype Diversification and Evolution in Diploid and Polyploid South American Hypochaeris (Asteraceae) Inferred from rDNA Localization and Genetic Fingerprint Data

    PubMed Central

    Weiss-Schneeweiss, Hanna; Tremetsberger, Karin; Schneeweiss, Gerald M.; Parker, John S.; Stuessy, Tod F.


    Background and Aims Changes in chromosome structure and number play an important role in plant evolution. A system well-suited to studying different modes of chromosome evolution is the genus Hypochaeris (Asteraceae) with its centre of species' diversity in South America. All South American species uniformly have a chromosome base number of x = 4 combined with variation in rDNA number and distribution, and a high frequency of polyploidy. The aim of this paper is to assess directions and mechanisms of karyotype evolution in South American species by interpreting both newly obtained and previous data concerning rDNA localization in a phylogenetic context. Methods Eleven Hypochaeris species from 18 populations were studied using fluorescence in situ hybridization (FISH) with 35S and 5S rDNA probes. A phylogenetic framework was established from neighbour-net analysis of amplified fragment length polymorphism (AFLP) fingerprint data. Key Results A single 5S rDNA locus is invariably found on the short arm of chromosome 2. Using 35S rDNA loci, based on number (one or two) and localization (interstitial on the long arm of chromosome 2, but sometimes lacking, and terminal or interstitial on the short arm of chromosome 3, only very rarely lacking), seven karyotype groups can be distinguished; five of these include polyploids. Karyotype groups with more than one species do not form monophyletic groups. Conclusions Early evolution of Hypochaeris in South America was characterized by considerable karyotype differentiation resulting from independent derivations from an ancestral karyotype. There was marked diversification with respect to the position and evolution of the 35S rDNA locus on chromosome 3, probably involving inversions and/or transpositions, and on chromosome 2 (rarely 3) concerning inactivation and loss. Among these different karyotype assemblages, the apargioides group and its derivatives constitute by far the majority of species. PMID:18285356

  16. Measuring rDNA diversity in eukaryotic microbial systems: how intragenomic variation, pseudogenes, and PCR artifacts confound biodiversity estimates.


    Thornhill, Daniel J; Lajeunesse, Todd C; Santos, Scott R


    Molecular approaches have revolutionized our ability to study the ecology and evolution of micro-organisms. Among the most widely used genetic markers for these studies are genes and spacers of the rDNA operon. However, the presence of intragenomic rDNA variation, especially among eukaryotes, can potentially confound estimates of microbial diversity. To test this hypothesis, bacterially cloned PCR products of the internal transcribed spacer (ITS) region from clonal isolates of Symbiodinium, a large genus of dinoflagellates that live in symbiosis with many marine protists and invertebrate metazoa, were sequenced and analysed. We found widely differing levels of intragenomic sequence variation and divergence in representatives of Symbiodinium clades A to E, with only a small number of variants attributed to Taq polymerase/bacterial cloning error or PCR chimeras. Analyses of 5.8S-rDNA and ITS2 secondary structure revealed that some variants possessed base substitutions and/or indels that destabilized the folded form of these molecules; given the vital nature of secondary structure to the function of these molecules, these likely represent pseudogenes. When similar controls were applied to bacterially cloned ITS sequences from a recent survey of Symbiodinium diversity in Hawaiian Porites spp., most variants (approximately 87.5%) possessed unstable secondary structures, had unprecedented mutations, and/or were PCR chimeras. Thus, data obtained from sequencing of bacterially cloned rDNA genes can substantially exaggerate the level of eukaryotic microbial diversity inferred from natural samples if appropriate controls are not applied. These considerations must be taken into account when interpreting sequence data generated by bacterial cloning of multicopy genes such as rDNA.

  17. Primary and secondary structure analyses of the rDNA group-I introns of the Zygnematales (Charophyta).


    Bhattacharya, D; Damberger, S; Surek, B; Melkonian, M


    The Zygnematales (Charophyta) contain a group-I intron (subgroupIC1) within their nuclear-encoded small subunit ribosomal DNA (SSU rDNA) coding region. This intron, which is inserted after position 1506 (relative to the SSU rDNA of Escherichia coli), is proposed to have been vertically inherited since the origin of the Zygnematales approximately 350-400 million years ago. Primary and secondary structure analyses were carried out to model group-I intron evolution in the Zygnematales. Secondary structure analyses support genetic data regarding sequence conservation within regions known to be functionally important for in vitro self-splicing of group-I introns. Comparisons of zygnematalean group-I intron secondary structures also provided some new insights into sequences that may have important roles in in vivo RNA splicing. Sequence analyses showed that sequence divergence rates and the nucleotide compositions of introns and coding regions within any one taxon varied widely, suggesting that the "1506" group-I introns and rDNA coding regions in the Zygnematales evolve independently.

  18. Complete structure of nuclear rDNA of the obligate plant parasite Plasmodiophora brassicae: intraspecific polymorphisms in the exon and group I intron of the large subunit rDNA.


    Niwa, Rieko; Kawahara, Ai; Murakami, Hiroharu; Tanaka, Shuhei; Ezawa, Tatsuhiro


    Plasmodiophora brassicae is a soil-borne obligate intracellular parasite in the phylum Cercozoa of the Rhizaria that causes clubroot disease of crucifer crops. To control the disease, understanding the distribution and infection routes of the pathogen is essential, and thus development of reliable molecular markers to discriminate geographic populations is required. In this study, the nuclear ribosomal RNA gene (rDNA) repeat unit of P. brassicae was determined, with particular emphasis on the structure of large subunit (LSU) rDNA, in which polymorphic regions were expected to be present. The complete rDNA complex was 9513bp long, which included the small subunit, 5.8S and LSU rDNAs as well as the internal transcribed spacer and intergenic spacer regions. Among eight field populations collected from throughout Honshu Island, Japan, a 1.1 kbp region of the LSU rDNA, including the divergent 8 domain, exhibited intraspecific polymorphisms that reflected geographic isolation of the populations. Two new group I introns were found in this region in six out of the eight populations, and the sequences also reflected their geographic isolation. The polymorphic region found in this study may have potential for the development of molecular markers for discrimination of field populations/isolates of this organism.

  19. Complete structure of nuclear rDNA of the obligate plant parasite Plasmodiophora brassicae: intraspecific polymorphisms in the exon and group I intron of the large subunit rDNA.


    Niwa, Rieko; Kawahara, Ai; Murakami, Hiroharu; Tanaka, Shuhei; Ezawa, Tatsuhiro


    Plasmodiophora brassicae is a soil-borne obligate intracellular parasite in the phylum Cercozoa of the Rhizaria that causes clubroot disease of crucifer crops. To control the disease, understanding the distribution and infection routes of the pathogen is essential, and thus development of reliable molecular markers to discriminate geographic populations is required. In this study, the nuclear ribosomal RNA gene (rDNA) repeat unit of P. brassicae was determined, with particular emphasis on the structure of large subunit (LSU) rDNA, in which polymorphic regions were expected to be present. The complete rDNA complex was 9513bp long, which included the small subunit, 5.8S and LSU rDNAs as well as the internal transcribed spacer and intergenic spacer regions. Among eight field populations collected from throughout Honshu Island, Japan, a 1.1 kbp region of the LSU rDNA, including the divergent 8 domain, exhibited intraspecific polymorphisms that reflected geographic isolation of the populations. Two new group I introns were found in this region in six out of the eight populations, and the sequences also reflected their geographic isolation. The polymorphic region found in this study may have potential for the development of molecular markers for discrimination of field populations/isolates of this organism. PMID:21497131

  20. 18S rDNA dataset profiling microeukaryotic populations within Chicago area nearshore waters.


    Searle, Daniel; Sible, Emily; Cooper, Alexandria; Putonti, Catherine


    Despite their critical role in the aquatic food web and nutrient cycling, microeukaryotes within freshwater environments are under-studied. Herein we present the first high-throughput molecular survey of microeukaryotes within Lake Michigan. Every two weeks from May 13 to August 5, 2014, we collected surface water samples from the nearshore waters of four Chicago area beaches: Gillson Park, Montrose Beach, 57th Street Beach, and Calumet Beach. Four biological replicates were collected for each sampling date and location, resulting in 112 samples. Eighty-nine of these samples were surveyed through targeted sequencing of the V7 and V8 regions of the 18S rDNA gene. Both technical and biological replicates were sequenced and are included in this dataset. Raw sequence data is available via NCBI's SRA database (BioProject PRJNA294919). PMID:26904716

  1. 18S rDNA dataset profiling microeukaryotic populations within Chicago area nearshore waters.


    Searle, Daniel; Sible, Emily; Cooper, Alexandria; Putonti, Catherine


    Despite their critical role in the aquatic food web and nutrient cycling, microeukaryotes within freshwater environments are under-studied. Herein we present the first high-throughput molecular survey of microeukaryotes within Lake Michigan. Every two weeks from May 13 to August 5, 2014, we collected surface water samples from the nearshore waters of four Chicago area beaches: Gillson Park, Montrose Beach, 57th Street Beach, and Calumet Beach. Four biological replicates were collected for each sampling date and location, resulting in 112 samples. Eighty-nine of these samples were surveyed through targeted sequencing of the V7 and V8 regions of the 18S rDNA gene. Both technical and biological replicates were sequenced and are included in this dataset. Raw sequence data is available via NCBI's SRA database (BioProject PRJNA294919).

  2. Chemical accessibility of the 4.5S RNA in spinach chloroplast ribosomes.

    PubMed Central

    Kumagai, I; Bartsch, M; Subramanian, A R; Erdmann, V A


    We have examined the accessibility to diethylpyrocarbonate of spinach chloroplast 4.5S ribosomal RNA when free and when it is part of the ribosomal structure. The modifications in free 4.5S RNA were found mostly in single-stranded regions of the secondary structure model proposed in our previous paper (Kumagai, I. et al. (1982) J.B.C. 257, 12924-28): adenines at positions 17, 19, 33, 36, 54, 55, 60, 64, 68, 72, 77, 86 and 87 were identified as the reactive residues. On the other hand, in 4.5S RNA in 70S ribosomes or 50S subunits, adenine 33 was exclusively modified, and its reactivity was much higher than in free 4.5S RNA. This highly accessible A33 of spinach 4.5S RNA is located within a characteristic seven nucleotide sequence, which is found in the 4.5S rRNAs from spinach, tobacco and a fern but deleted in 4.5S RNAs from maize and wheat. Images PMID:6828382

  3. Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

    PubMed Central

    Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B


    A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

  4. An Archaea 5S rRNA analog is stably expressed in Escherichia coli

    NASA Technical Reports Server (NTRS)

    Yang, Y.; Fox, G. E.


    Mini-genes for 5S-like rRNA were constructed. These genes had a sequence which largely resembles that of the naturally occurring 5S rRNA of a bacterium, Halococcus morrhuae, which phylogenetically belongs to the Archaea. Plasmids carrying the mini-genes were transformed into Escherichia coli (Ec). Ribosomal incorporation was not a prerequisite for stable accumulation of the RNA product. However, only those constructs with a well-base-paired helix I accumulated RNA product. This result strongly implies that this aspect of the structure is likely to be an important condition for stabilizing 5S rRNA-like products. The results are consistent with our current understanding of 5S rRNA processing in Ec. When used in conjunction with rRNA probe technology, the resulting chimeric RNA may be useful as a monitoring tool for genetically engineered microorganisms or naturally occurring organisms that are released into the environment.

  5. In situ chromosomal localization of rDNA sites in "Safed Musli" Chlorophytum ker-gawl and their physical measurement by fiber FISH.


    Lavania, U C; Basu, S; Srivastava, S; Mukai, Y; Lavania, S


    Fluorescence In Situ Hybridization (FISH) technique has been applied on somatic chromosomes and extended DNA fibers in the medicinally important species of Chlorophytum to elucidate physical localization and measurement of the rDNA sites using two rRNA multigene families homologous to 45S and 5S rDNA. The two species of Chlorophytum, namely C. borivillianum and C. comosum, both with 2n = 28, reveal diversity for copy number and localization of rDNA sites. C. borivillianum is comprised of five 45S-rDNA sites:one each in the secondary constriction region of chromosomes 7, 8, 9; one in the subtelomeric region of the short arm of chromosome 2 and the telomeric region of the short arm of chromosome 12; and one 5S-rDNA site in the subtelomeric region of the long arm of chromosome 1. In C. comosum, there are three 45S-rDNA sites (one each in the short arm of chromosomes 12, 13, and 14) and two 5S-rDNA sites (in the secondary constriction regions of chromosomes 2 and 13). Fiber FISH analysis conducted on extended DNA fibers revealed variation in the size of continuous tandem strings for the two r-DNA families. Taking the standard value of native B DNA equivalent to 3.27 kb for 1 mum, it was estimated that the physical size of continuous DNA strings is of the order of approximately 90 kb, 180 kb, and 300 kb for 45S-rDNA and of the order of 60 kb, 150 kb for 5S-rDNA in C. comosum, grossly in correspondence to their respective physical sizes at metaphase.

  6. Karyotype characterization and evolution in South American species of Lathyrus (Notolathyrus, Leguminosae) evidenced by heterochromatin and rDNA mapping.


    Chalup, Laura; Samoluk, Sergio Sebastián; Neffa, Viviana Solís; Seijo, Guillermo


    Notolathyrus is a section of South American endemic species of the genus Lathyrus. The origin, phylogenetic relationship and delimitation of some species are still controversial. The present study provides an exhaustive analysis of the karyotypes of approximately half (10) of the species recognized for section Notolathyrus and four outgroups (sections Lathyrus and Orobus) by cytogenetic mapping of heterochromatic bands and 45S and 5S rDNA loci. The bulk of the parameters analyzed here generated markers to identify most of the chromosomes in the complements of the analyzed species. Chromosome banding showed interspecific variation in the amount and distribution of heterochromatin, and together with the distribution of rDNA loci, allowed the characterization of all the species studied here. Additionally, some of the chromosome parameters described (st chromosomes and the 45S rDNA loci) constitute the first diagnostic characters for the Notolathyrus section. Evolutionary, chromosome data revealed that the South American species are a homogeneous group supporting the monophyly of the section. Variation in the amount of heterochromatin was not directly related to the variation in DNA content of the Notolathyrus species. However, the correlation observed between the amount of heterochromatin and some geographical and bioclimatic variables suggest that the variation in the heterochromatic fraction should have an adaptive value.

  7. Molecular characterization of Stictodora tridactyla (Trematoda: Heterophyidae) from Kuwait Bay using rDNA ITS and mtCO1.


    Al-Kandari, Wafa Y; Alnaqeeb, Majed A; Isaac, Asha M; Al-Bustan, Suzanne A


    Stictodora tridactyla is an intestinal fluke in the family Heterophyidae that parasitizes shorebirds and mammals, including humans. Its metacercarial cyst stage was reported in the Arabian killifish, Aphanius dispar, at Kuwait Bay. In the present study, Cerithidea cingulata was found to serve as the first intermediate host of S. tridactyla. In order to establish the snail-fish link in the life cycle of S. tridactyla, complete sequences of ribosomal DNA internal transcribed spacer region 1 and 2 (rDNA ITS1 and ITS2) and partial sequence of cytochrome oxidase subunit 1 were obtained for metacercarial cysts isolated from the fish A. dispar and rediae isolated from the snail C. cingulata. Sequence alignment demonstrated that these larval stages belong to the same heterophyid species, S. tridactyla. Phylogenetic analysis based on rDNA ITS1, ITS2, and mtCO1 confirmed the position of S. tridactyla within the Heterophyidae and found it to cluster with Haplorchis spp. The present study represents the first molecular study correlating the larval stages of S. tridactyla using rDNA ITS1, ITS2, and mtCO1 and examining the phylogenetic relationships of S. tridactyla with different heterophyid species. PMID:26268569

  8. Abundant 5S rRNA-like transcripts encoded by the mitochondrial genome in amoebozoa.


    Bullerwell, Charles E; Burger, Gertraud; Gott, Jonatha M; Kourennaia, Olga; Schnare, Murray N; Gray, Michael W


    5S rRNAs are ubiquitous components of prokaryotic, chloroplast, and eukaryotic cytosolic ribosomes but are apparently absent from mitochondrial ribosomes (mitoribosomes) of many eukaryotic groups including animals and fungi. Nevertheless, a clearly identifiable, mitochondrion-encoded 5S rRNA is present in Acanthamoeba castellanii, a member of Amoebozoa. During a search for additional mitochondrial 5S rRNAs, we detected small abundant RNAs in other members of Amoebozoa, namely, in the lobose amoeba Hartmannella vermiformis and in the myxomycete slime mold Physarum polycephalum. These RNAs are encoded by mitochondrial DNA (mtDNA), cosediment with mitoribosomes in glycerol gradients, and can be folded into a secondary structure similar to that of bona fide 5S rRNAs. Further, in the mtDNA of another slime mold, Didymium nigripes, we identified a region that in sequence, potential secondary structure, and genomic location is similar to the corresponding region encoding the Physarum small RNA. A mtDNA-encoded small RNA previously identified in Dictyostelium discoideum is here shown to share several characteristics with known 5S rRNAs. Again, we detected genes encoding potential homologs of this RNA in the mtDNA of three other species of the genus Dictyostelium as well as in a related genus, Polysphondylium. Taken together, our results indicate a widespread occurrence of small, abundant, mtDNA-encoded RNAs with 5S rRNA-like structures that are associated with the mitoribosome in various amoebozoan taxa. Our working hypothesis is that these novel small abundant RNAs represent radically divergent mitochondrial 5S rRNA homologs. We posit that currently unrecognized 5S-like RNAs may exist in other mitochondrial systems in which a conventional 5S rRNA cannot be identified.

  9. Chromosomal organization of the 18S and 5S rRNAs and histone H3 genes in Scarabaeinae coleopterans: insights into the evolutionary dynamics of multigene families and heterochromatin

    PubMed Central


    Background Scarabaeinae beetles show a high level of macro-chromosomal variability, although the karyotypic organization of heterochromatin and multigene families (rDNAs and histone genes) is poorly understood in this group. To better understand the chromosomal organization and evolution in this group, we analyzed the karyotypes, heterochromatin distribution and chromosomal locations of the rRNAs and histone H3 genes in beetles belonging to eight tribes from the Scarabaeinae subfamily (Coleoptera, Scarabaeidae). Results The number of 18S rRNA gene (a member of the 45S rDNA unit) sites varied from one to 16 and were located on the autosomes, sex chromosomes or both, although two clusters were most common. Comparison of the 45S rDNA cluster number and the diploid numbers revealed a low correlation value. However, a comparison between the number of 45S rDNA sites per genome and the quantity of heterochromatin revealed (i) species presenting heterochromatin restricted to the centromeric/pericentromeric region that contained few rDNA sites and (ii) species with a high quantity of heterochromatin and a higher number of rDNA sites. In contrast to the high variability for heterochromatin and 45S rDNA cluster, the presence of two clusters (one bivalent cluster) co-located on autosomal chromosomes with the 5S rRNA and histone H3 genes was highly conserved. Conclusions Our results indicate that the variability of the 45S rDNA chromosomal clusters is not associated with macro-chromosomal rearrangements but are instead related to the spread of heterochromatin. The data obtained also indicate that both heterochromatin and the 45S rDNA loci could be constrained by similar evolutionary forces regulating spreading in the distinct Scarabaeinae subfamily lineages. For the 5S rRNA and the histone H3 genes, a similar chromosomal organization could be attributed to their association/co-localization in the Scarabaeinae karyotypes. These data provide evidence that different evolutionary

  10. Increased 5S rRNA oxidation in Alzheimer's disease.


    Ding, Qunxing; Zhu, Haiyan; Zhang, Bing; Soriano, Augusto; Burns, Roxanne; Markesbery, William R


    It is widely accepted that oxidative stress is involved in neurodegenerative disorders such as Alzheimer's disease (AD). Ribosomal RNA (rRNA) is one of the most abundant molecules in most cells and is affected by oxidative stress in the human brain. Previous data have indicated that total rRNA levels were decreased in the brains of subjects with AD and mild cognitive impairment concomitant with an increase in rRNA oxidation. In addition, level of 5S rRNA, one of the essential components of the ribosome complex, was significantly lower in the inferior parietal lobule (IP) brain area of subjects with AD compared with control subjects. To further evaluate the alteration of 5S rRNA in neurodegenerative human brains, multiple brain regions from both AD and age-matched control subjects were used in this study, including IP, superior and middle temporal gyro, temporal pole, and cerebellum. Different molecular pools including 5S rRNA integrated into ribosome complexes, free 5S rRNA, cytoplasmic 5S rRNA, and nuclear 5S rRNA were studied. Free 5S rRNA levels were significantly decreased in the temporal pole region of AD subjects and the oxidation of ribosome-integrated and free 5S rRNA was significantly increased in multiple brain regions in AD subjects compared with controls. Moreover, a greater amount of oxidized 5S rRNA was detected in the cytoplasm and nucleus of AD subjects compared with controls. These results suggest that the increased oxidation of 5S rRNA, especially the oxidation of free 5S rRNA, may be involved in the neurodegeneration observed in AD.

  11. 5SRNAdb: an information resource for 5S ribosomal RNAs.


    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M


    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb ( is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces. PMID:26490961

  12. 5SRNAdb: an information resource for 5S ribosomal RNAs.


    Szymanski, Maciej; Zielezinski, Andrzej; Barciszewski, Jan; Erdmann, Volker A; Karlowski, Wojciech M


    Ribosomal 5S RNA (5S rRNA) is the ubiquitous RNA component found in the large subunit of ribosomes in all known organisms. Due to its small size, abundance and evolutionary conservation 5S rRNA for many years now is used as a model molecule in studies on RNA structure, RNA-protein interactions and molecular phylogeny. 5SRNAdb ( is the first database that provides a high quality reference set of ribosomal 5S RNAs (5S rRNA) across three domains of life. Here, we give an overview of new developments in the database and associated web tools since 2002, including updates to database content, curation processes and user web interfaces.

  13. New parachlamydial 16S rDNA phylotypes detected in human clinical samples.


    Corsaro, Daniele; Venditti, Danielle; Valassina, Marcello


    Chlamydiales are important intracellular bacterial pathogens, causing a wide variety of diseases in vertebrates, including humans. Besides the well-known species in the family Chlamydiaceae, new chlamydial organisms have recently been discovered, forming three new families: Parachlamydiaceae, Simkaniaceae and Waddliaceae. Parachlamydia acanthamoebae and Simkania negevensis are currently investigated as emerging human respiratory pathogens. Additional chlamydial lineages have been discovered by 16S rDNA-based molecular studies, and their implication in human infections is poorly known. By using a pan-chlamydia 16S rDNA PCR, we have searched for the presence of chlamydiae in 228 clinical samples that all previously had been shown to be PCR-negative for Chlamydophila pneumoniae: 170 respiratory samples, 45 atheromatic plaques and 13 peripheral blood mononuclear cell samples. Nine respiratory samples tested positive. Sequence analysis has allowed us to assign four sequences to Chlamydophila psittaci, three sequences to Chlamydophila felis, and two sequences to two novel phylotypes belonging to the Parachlamydiaceae. These latter sequences showed similarity values of more than 93% with each other and with the P. acanthamoebae sequence, thus belonging to novel, unrecognized species. In conclusion, this report showed that a variety of non-C. pneumoniae chlamydial respiratory infection is present in humans, and that new parachlamydiae distinct from P. acanthamoebae may be detected in human clinical samples. Future studies will be of interest in order to estimate the diversity of these novel chlamydiae in both clinical and environmental samples, as well as their possible clinical implication in human and animal infections.

  14. Variability of 18rDNA loci in four lace bug species (Hemiptera, Tingidae) with the same chromosome number

    PubMed Central

    Golub, Natalia V.; Golub, Viktor B.; Kuznetsova, Valentina G.


    Abstract Male karyotypes of Elasmotropis testacea (Herrich-Schaeffer, 1835), Tingis cardui (Linnaeus, 1758), Tingis crispata (Herrich-Schaeffer, 1838), and Agramma femorale Thomson, 1871 (Heteroptera, Cimicomorpha, Tingidae) were analyzed using conventional chromosome staining and FISH with 18S rDNA and (TTAGG)n telomeric probes. The FISH technique was applied for the first time in the Tingidae. In spite of the fact that all species showed the same chromosome number (2n = 12 + XY), they have significant differences in the number and position of rDNA loci. FISH with the classical insect (TTAGG)n probe produced no signals on chromosomes suggesting telomeres in lace bugs to be of some other molecular composition. Tingidae share absence of the (TTAGG)n telomeric sequence with all so far studied taxa of the advanced true bug infraorders Cimicomorpha and Pentatomomorpha. PMID:26753071

  15. Randomly detected genetically modified (GM) maize (Zea mays L.) near a transport route revealed a fragile 45S rDNA phenotype.


    Waminal, Nomar Espinosa; Ryu, Ki Hyun; Choi, Sun-Hee; Kim, Hyun Hee


    Monitoring of genetically modified (GM) crops has been emphasized to prevent their potential effects on the environment and human health. Monitoring of the inadvertent dispersal of transgenic maize in several fields and transport routes in Korea was carried out by qualitative multiplex PCR, and molecular analyses were conducted to identify the events of the collected GM maize. Cytogenetic investigations through fluorescence in situ hybridization (FISH) of the GM maize were performed to check for possible changes in the 45S rDNA cluster because this cluster was reported to be sensitive to replication and transcription stress. Three GM maize kernels were collected from a transport route near Incheon port, Korea, and each was found to contain NK603, stacked MON863 x NK603, and stacked NK603 x MON810 inserts, respectively. Cytogenetic analysis of the GM maize containing the stacked NK603 x MON810 insert revealed two normal compact 5S rDNA signals, but the 45S rDNA showed a fragile phenotype, demonstrating a "beads-on-a-string" fragmentation pattern, which seems to be a consequence of genetic modification. Implications of the 45S rDNA cluster fragility in GM maize are also discussed.

  16. Randomly Detected Genetically Modified (GM) Maize (Zea mays L.) near a Transport Route Revealed a Fragile 45S rDNA Phenotype

    PubMed Central

    Waminal, Nomar Espinosa; Ryu, Ki Hyun; Choi, Sun-Hee; Kim, Hyun Hee


    Monitoring of genetically modified (GM) crops has been emphasized to prevent their potential effects on the environment and human health. Monitoring of the inadvertent dispersal of transgenic maize in several fields and transport routes in Korea was carried out by qualitative multiplex PCR, and molecular analyses were conducted to identify the events of the collected GM maize. Cytogenetic investigations through fluorescence in situ hybridization (FISH) of the GM maize were performed to check for possible changes in the 45S rDNA cluster because this cluster was reported to be sensitive to replication and transcription stress. Three GM maize kernels were collected from a transport route near Incheon port, Korea, and each was found to contain NK603, stacked MON863 x NK603, and stacked NK603 x MON810 inserts, respectively. Cytogenetic analysis of the GM maize containing the stacked NK603 x MON810 insert revealed two normal compact 5S rDNA signals, but the 45S rDNA showed a fragile phenotype, demonstrating a “beads-on-a-string” fragmentation pattern, which seems to be a consequence of genetic modification. Implications of the 45S rDNA cluster fragility in GM maize are also discussed. PMID:24040165

  17. Introduction of a novel 18S rDNA gene arrangement along with distinct ITS region in the saline water microalga Dunaliella

    PubMed Central


    Comparison of 18S rDNA gene sequences is a very promising method for identification and classification of living organisms. Molecular identification and discrimination of different Dunaliella species were carried out based on the size of 18S rDNA gene and, number and position of introns in the gene. Three types of 18S rDNA structure have already been reported: the gene with a size of ~1770 bp lacking any intron, with a size of ~2170 bp consisting one intron near 5' terminus, and with a size of ~2570 bp harbouring two introns near 5' and 3' termini. Hereby, we report a new 18S rDNA gene arrangement in terms of intron localization and nucleotide sequence in a Dunaliella isolated from Iranian salt lakes (ABRIINW-M1/2). PCR amplification with genus-specific primers resulted in production of a ~2170 bp DNA band, which is similar to that of D. salina 18S rDNA gene containing only one intron near 5' terminus. Whilst, sequence composition of the gene revealed the lack of any intron near 5' terminus in our isolate. Furthermore, another alteration was observed due to the presence of a 440 bp DNA fragment near 3' terminus. Accordingly, 18S rDNA gene of the isolate is clearly different from those of D. salina and any other Dunaliella species reported so far. Moreover, analysis of ITS region sequence showed the diversity of this region compared to the previously reported species. 18S rDNA and ITS sequences of our isolate were submitted with accesion numbers of EU678868 and EU927373 in NCBI database, respectively. The optimum growth rate of this isolate occured at the salinity level of 1 M NaCl. The maximum carotenoid content under stress condition of intense light (400 μmol photon m-2 s-1), high salinity (4 M NaCl) and deficiency of nitrate and phosphate nutritions reached to 240 ng/cell after 15 days. PMID:20377865

  18. 5S rRNA gene arrangements in protists: a case of nonadaptive evolution.


    Drouin, Guy; Tsang, Corey


    Given their high copy number and high level of expression, one might expect that both the sequence and organization of eukaryotic ribosomal RNA genes would be conserved during evolution. Although the organization of 18S, 5.8S and 28S ribosomal RNA genes is indeed relatively well conserved, that of 5S rRNA genes is much more variable. Here, we review the different types of 5S rRNA gene arrangements which have been observed in protists. This includes linkages to the other ribosomal RNA genes as well as linkages to ubiquitin, splice-leader, snRNA and tRNA genes. Mapping these linkages to independently derived phylogenies shows that these diverse linkages have repeatedly been gained and lost during evolution. This argues against such linkages being the primitive condition not only in protists but also in other eukaryote species. Because the only characteristic the diverse genes with which 5S rRNA genes are found linked with is that they are tandemly repeated, these arrangements are unlikely to provide any selective advantage. Rather, the observed high variability in 5S rRNA genes arrangements is likely the result of the fact that 5S rRNA genes contain internal promoters, that these genes are often transposed by diverse recombination mechanisms and that these new gene arrangements are rapidly homogenized by unequal crossingovers and/or by gene conversions events in species with short generation times and frequent founder events.

  19. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules

    PubMed Central

    Valach, Matus; Burger, Gertraud; Gray, Michael W.; Lang, B. Franz


    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator. PMID:25429974

  20. Widespread occurrence of organelle genome-encoded 5S rRNAs including permuted molecules.


    Valach, Matus; Burger, Gertraud; Gray, Michael W; Lang, B Franz


    5S Ribosomal RNA (5S rRNA) is a universal component of ribosomes, and the corresponding gene is easily identified in archaeal, bacterial and nuclear genome sequences. However, organelle gene homologs (rrn5) appear to be absent from most mitochondrial and several chloroplast genomes. Here, we re-examine the distribution of organelle rrn5 by building mitochondrion- and plastid-specific covariance models (CMs) with which we screened organelle genome sequences. We not only recover all organelle rrn5 genes annotated in GenBank records, but also identify more than 50 previously unrecognized homologs in mitochondrial genomes of various stramenopiles, red algae, cryptomonads, malawimonads and apusozoans, and surprisingly, in the apicoplast (highly derived plastid) genomes of the coccidian pathogens Toxoplasma gondii and Eimeria tenella. Comparative modeling of RNA secondary structure reveals that mitochondrial 5S rRNAs from brown algae adopt a permuted triskelion shape that has not been seen elsewhere. Expression of the newly predicted rrn5 genes is confirmed experimentally in 10 instances, based on our own and published RNA-Seq data. This study establishes that particularly mitochondrial 5S rRNA has a much broader taxonomic distribution and a much larger structural variability than previously thought. The newly developed CMs will be made available via the Rfam database and the MFannot organelle genome annotator.

  1. Conserved Organisation of 45S rDNA Sites and rDNA Gene Copy Number among Major Clades of Early Land Plants.


    Rosato, Marcela; Kovařík, Aleš; Garilleti, Ricardo; Rosselló, Josep A


    Genes encoding ribosomal RNA (rDNA) are universal key constituents of eukaryotic genomes, and the nuclear genome harbours hundreds to several thousand copies of each species. Knowledge about the number of rDNA loci and gene copy number provides information for comparative studies of organismal and molecular evolution at various phylogenetic levels. With the exception of seed plants, the range of 45S rDNA locus (encoding 18S, 5.8S and 26S rRNA) and gene copy number variation within key evolutionary plant groups is largely unknown. This is especially true for the three earliest land plant lineages Marchantiophyta (liverworts), Bryophyta (mosses), and Anthocerotophyta (hornworts). In this work, we report the extent of rDNA variation in early land plants, assessing the number of 45S rDNA loci and gene copy number in 106 species and 25 species, respectively, of mosses, liverworts and hornworts. Unexpectedly, the results show a narrow range of ribosomal locus variation (one or two 45S rDNA loci) and gene copies not present in vascular plant lineages, where a wide spectrum is recorded. Mutation analysis of whole genomic reads showed higher (3-fold) intragenomic heterogeneity of Marchantia polymorpha (Marchantiophyta) rDNA compared to Physcomitrella patens (Bryophyta) and two angiosperms (Arabidopsis thaliana and Nicotiana tomentosifomis) suggesting the presence of rDNA pseudogenes in its genome. No association between phylogenetic position, taxonomic adscription and the number of rDNA loci and gene copy number was found. Our results suggest a likely evolutionary rDNA stasis during land colonisation and diversification across 480 myr of bryophyte evolution. We hypothesise that strong selection forces may be acting against ribosomal gene locus amplification. Despite showing a predominant haploid phase and infrequent meiosis, overall rDNA homogeneity is not severely compromised in bryophytes.

  2. Conserved Organisation of 45S rDNA Sites and rDNA Gene Copy Number among Major Clades of Early Land Plants

    PubMed Central

    Rosato, Marcela; Kovařík, Aleš; Garilleti, Ricardo; Rosselló, Josep A.


    Genes encoding ribosomal RNA (rDNA) are universal key constituents of eukaryotic genomes, and the nuclear genome harbours hundreds to several thousand copies of each species. Knowledge about the number of rDNA loci and gene copy number provides information for comparative studies of organismal and molecular evolution at various phylogenetic levels. With the exception of seed plants, the range of 45S rDNA locus (encoding 18S, 5.8S and 26S rRNA) and gene copy number variation within key evolutionary plant groups is largely unknown. This is especially true for the three earliest land plant lineages Marchantiophyta (liverworts), Bryophyta (mosses), and Anthocerotophyta (hornworts). In this work, we report the extent of rDNA variation in early land plants, assessing the number of 45S rDNA loci and gene copy number in 106 species and 25 species, respectively, of mosses, liverworts and hornworts. Unexpectedly, the results show a narrow range of ribosomal locus variation (one or two 45S rDNA loci) and gene copies not present in vascular plant lineages, where a wide spectrum is recorded. Mutation analysis of whole genomic reads showed higher (3-fold) intragenomic heterogeneity of Marchantia polymorpha (Marchantiophyta) rDNA compared to Physcomitrella patens (Bryophyta) and two angiosperms (Arabidopsis thaliana and Nicotiana tomentosifomis) suggesting the presence of rDNA pseudogenes in its genome. No association between phylogenetic position, taxonomic adscription and the number of rDNA loci and gene copy number was found. Our results suggest a likely evolutionary rDNA stasis during land colonisation and diversification across 480 myr of bryophyte evolution. We hypothesise that strong selection forces may be acting against ribosomal gene locus amplification. Despite showing a predominant haploid phase and infrequent meiosis, overall rDNA homogeneity is not severely compromised in bryophytes. PMID:27622766

  3. Conserved Organisation of 45S rDNA Sites and rDNA Gene Copy Number among Major Clades of Early Land Plants.


    Rosato, Marcela; Kovařík, Aleš; Garilleti, Ricardo; Rosselló, Josep A


    Genes encoding ribosomal RNA (rDNA) are universal key constituents of eukaryotic genomes, and the nuclear genome harbours hundreds to several thousand copies of each species. Knowledge about the number of rDNA loci and gene copy number provides information for comparative studies of organismal and molecular evolution at various phylogenetic levels. With the exception of seed plants, the range of 45S rDNA locus (encoding 18S, 5.8S and 26S rRNA) and gene copy number variation within key evolutionary plant groups is largely unknown. This is especially true for the three earliest land plant lineages Marchantiophyta (liverworts), Bryophyta (mosses), and Anthocerotophyta (hornworts). In this work, we report the extent of rDNA variation in early land plants, assessing the number of 45S rDNA loci and gene copy number in 106 species and 25 species, respectively, of mosses, liverworts and hornworts. Unexpectedly, the results show a narrow range of ribosomal locus variation (one or two 45S rDNA loci) and gene copies not present in vascular plant lineages, where a wide spectrum is recorded. Mutation analysis of whole genomic reads showed higher (3-fold) intragenomic heterogeneity of Marchantia polymorpha (Marchantiophyta) rDNA compared to Physcomitrella patens (Bryophyta) and two angiosperms (Arabidopsis thaliana and Nicotiana tomentosifomis) suggesting the presence of rDNA pseudogenes in its genome. No association between phylogenetic position, taxonomic adscription and the number of rDNA loci and gene copy number was found. Our results suggest a likely evolutionary rDNA stasis during land colonisation and diversification across 480 myr of bryophyte evolution. We hypothesise that strong selection forces may be acting against ribosomal gene locus amplification. Despite showing a predominant haploid phase and infrequent meiosis, overall rDNA homogeneity is not severely compromised in bryophytes. PMID:27622766

  4. High-Resolution Infrared Spectroscopy of Carbon-Sulfur Chains: II. C_5S and SC_5S

    NASA Astrophysics Data System (ADS)

    Thorwirth, Sven; Salomon, Thomas; Dudek, John B.


    Unbiased high-resolution infrared survey scans of the ablation products from carbon-sulfur targets in the 2100 to 2150 cm-1 regime reveal two bands previously not observed in the gas phase. On the basis of comparison against laboratory matrix-isolation work and new high-level quantum-chemical calculations these bands are attributed to the linear C_5S and SC_5S clusters. While polar C_5S was studied earlier using Fourier-transform microwave techniques, the present work marks the first gas-phase spectroscopic detection of SC_5S. H. Wang, J. Szczepanski, P. Brucat, and M. Vala 2005, Int. J. Quant. Chem. 102, 795 Y. Kasai, K. Obi, Y. Ohshima, Y. Hirahara, Y. Endo, K. Kawaguchi, and A. Murakami 1993, ApJ 410, L45 V. D. Gordon, M. C. McCarthy, A. J. Apponi, and P. Thaddeus 2001, ApJS 134, 311

  5. Genealogical relationships of southern Ontario polyploid unisexual salamanders (genus Ambystoma) inferred from intergenomic exchanges and major rDNA cytotypes.


    Bi, Ke; Bogart, James P; Fu, Jinzhong


    North American unisexual salamanders in the genus Ambystoma are common around the Great Lakes region of North America. They contain an almost identical mitochondrial genome across their distribution that is unlike that of any of the four species whose genomes may be included in their nuclei. Thus, sequence-based phylogenies of unisexual populations are confusing. We used chromosomal intergenomic exchanges and major rDNA cytotypes as combined cytogenetic markers to tentatively construct a genealogy of unisexual Ambystoma in southern Ontario. We employed GISH and sequential/simultaneous GISH/FISH-rDNA to reveal intergenomic exchanges and rDNA cytotypes in unisexual A. laterale--2 jeffersonianum (LJJ) triploids and their tetraploid derivative A. laterale--3 jeffersonianum (LJJJ). We identified 10 different patterns of intergenomic exchanges from 18 isolated populations and used them as primary cytogenetic markers. Major rDNA cytotypes served as independent and supplementary markers. Our results suggest that current LJJ and LJJJ populations in southern Ontario are likely derived from a few unisexual individuals. Intergenomic exchanges are common phenomena and widely distributed in the salamanders of the A. laterale--A. jeffersonianum unisexual complex. Integration of GISH and FISH can exhibit multiple unrelated chromosomal markers on the same chromosome spread and demonstrate lineage relationships in unisexual populations. Similar methods may be applied for studying the molecular cytogenetics of other unisexuals to improve our understanding of their genealogical relationships and historical dispersal. PMID:18175200

  6. Characterization of novel human oral isolates and cloned 16S rDNA sequences that fall in the family Coriobacteriaceae: description of olsenella gen. nov., reclassification of Lactobacillus uli as Olsenella uli comb. nov. and description of Olsenella profusa sp. nov.


    Dewhirst, F E; Paster, B J; Tzellas, N; Coleman, B; Downes, J; Spratt, D A; Wade, W G


    The diversity of organisms present in the subgingival pockets of patients with periodontitis and acute necrotizing ulcerative gingivitis (ANUG) were examined previously. The 16S rRNA genes of subgingival plaque bacteria were amplified using PCR with a universal forward primer and a spirochaete-selective reverse primer. The amplified DNA was cloned into Escherichia coli. In one subject with ANUG, 70 clones were sequenced. Seventy-five per cent of the clones were spirochaetal, as expected. Twelve of the remaining clones fell into two clusters that represent novel phylotypes in the family Coriobacteriaceae. The first novel phylotype was most closely related to Atopobium rimae (98% similarity). The phylotype probably represents a novel Atopobium species, but will not be named until cultivable strains are obtained. The second novel phylotype was only 91% similar to described Atopobium species and 84% similar to Coriobacterium glomerans. The 16S rRNA sequences of the type strain of Lactobacillus uli and a strain representing the Moores' Eubacterium group D52 were determined as part of on ongoing sequence analysis of oral bacteria. The sequence for L. uli was more than 99.8% similar to sequences for the second clone phylotype. It therefore appears that the second clone phylotype and L. uli represent the same species. The sequence for the Eubacterium D52 strain was 95.6% similar to that of L. uli. The G+C content of the DNA of L. uli and Eubacterium D52 is 63-64 mol %. These organisms are thus distinct from the neighbouring genus Atopobium, which has a DNA G+C content of 35-46 mol%. A new genus, Olsenella gen. nov., is proposed for these two species on the basis of phenotypic characteristics and 16S rRNA sequence analysis to include Olsenella uli comb. nov. and Olsenella profusa sp. nov.

  7. Comparison of the ITS1 and ITS2 rDNA in Emeria callospermophili (Apicomplexa: Eimeriidae) from Sciurid Rodents

    PubMed Central

    Motriuk-Smith, Dagmara; Seville, R Scott; Quealy, Leah; Oliver, Clinton E.


    The taxonomy of the coccidia has historically been morphologically based. The purpose of this study was to establish if conspecificity of isolates of Eimeria callospermophili from 4 ground-dwelling squirrel hosts (Rodentia: Sciuridae) is supported by comparison of rDNA sequence data and to examine how this species relates to eimerian species from other sciurid hosts. Eimeria callospermophili was isolated from 4 wild caught hosts, i.e., Urocitellus elegans, Cynomys leucurus, Marmota flaviventris, and Cynomys ludovicianus. The ITS1 and ITS2 genomic rDNA sequences were PCR generated, sequenced, and analyzed. The highest intraspecific pairwise distance values of 6.0% in ITS1 and 7.1% in ITS2 were observed in C. leucurus. Interspecific pairwise distance values greater than 5% do not support E. callospermophili conspecificity. Generated E. callospermophili sequences were compared to Eimeria lancasterensis from Sciuris niger and Sciurus niger cinereus, and Eimeria ontarioensis from S. niger. A single well-supported clade was formed by E. callospermophili amplicons in Neighbor Joining and Maximum Parsimony analyses. However, within the clade there was little evidence of host or geographic structuring of the species. PMID:21506777

  8. TFIIIA binds to different domains of 5S RNA and the Xenopus borealis 5S RNA gene.

    PubMed Central

    Sands, M S; Bogenhagen, D F


    We have established the conditions for the reassociation of 5S RNA and TFIIIA to form 7S particles. We tested the ability of altered 5S RNAs to bind TFIIIA, taking advantage of the slower mobility of 7S particles compared with free 5S RNA in native polyacrylamide gels. Linker substitution mutants were constructed encompassing the entire gene, including the intragenic control region. In vitro transcripts of the linker substitution mutants were tested for their ability to bind TFIIIA to form 7S ribonucleoprotein particles. Altered 5S RNAs with base changes in or around helices IV and V, which would interfere with the normal base pairing of that region, showed decreased ability to bind TFIIIA. The transcripts of some mutant genes that were efficiently transcribed (greater than 50% of wild-type efficiency) failed to bind TFIIIA in this gel assay. In contrast, the RNA synthesized from a poorly transcribed mutant, LS 86/97, in which residues 87 to 96 of the RNA were replaced in the single-stranded loop at the base of helix V, bound TFIIIA well. The data indicate that TFIIIA binds to different domains in the 5S RNA gene and 5S RNA. Images PMID:3431548

  9. Detection of rDNA ITS polymorphism in Rhizoctonia solani AG 2-1 isolates.


    Pannecoucque, Joke; Höfte, Monica


    The sequence variability of the ribosomal internal transcribed spacer regions ITS1 and ITS2, including the 5.8S gene, was investigated for Rhizoctonia solani isolates of anastomosis group (AG) 2-1. During PCR RFLP analysis of eight isolates, the restriction patterns of four isolates showed an excess of bands after restriction with the enzymes AvaII and/or HincII, which suggested the presence of more than one ITS region. By cloning the ITS region of six isolates sequence heterogeneity was detected in the isolates that showed an excess of bands in the PCR RFLP analysis; up to nine different ITS regions were identified within one isolate. The same level of diversity was found within the same isolate as among isolates. In the phylogenetic tree based on the rDNA ITS sequences of several AG 2-1 isolates, sequences derived from the same isolate did not form distinct clusters, questioning the relevance of further subdivision of heterogeneous AG 2-1 isolates based on the ITS region.

  10. Characterization of bacterial diversity in pulque, a traditional Mexican alcoholic fermented beverage, as determined by 16S rDNA analysis.


    Escalante, Adelfo; Rodríguez, María Elena; Martínez, Alfredo; López-Munguía, Agustín; Bolívar, Francisco; Gosset, Guillermo


    The bacterial diversity in pulque, a traditional Mexican alcoholic fermented beverage, was studied in 16S rDNA clone libraries from three pulque samples. Sequenced clones identified as Lactobacillus acidophilus, Lactobacillus strain ASF360, L. kefir, L. acetotolerans, L. hilgardii, L. plantarum, Leuconostoc pseudomesenteroides, Microbacterium arborescens, Flavobacterium johnsoniae, Acetobacter pomorium, Gluconobacter oxydans, and Hafnia alvei, were detected for the first time in pulque. Identity of 16S rDNA sequenced clones showed that bacterial diversity present among pulque samples is dominated by Lactobacillus species (80.97%). Seventy-eight clones exhibited less than 95% of relatedness to NCBI database sequences, which may indicate the presence of new species in pulque samples.

  11. Two distinct structural elements of 5S rRNA are needed for its import into human mitochondria.


    Smirnov, Alexandre; Tarassov, Ivan; Mager-Heckel, Anne-Marie; Letzelter, Michel; Martin, Robert P; Krasheninnikov, Igor A; Entelis, Nina


    RNA import into mitochondria is a widespread phenomenon. Studied in details for yeast, protists, and plants, it still awaits thorough investigation for human cells, in which the nuclear DNA-encoded 5S rRNA is imported. Only the general requirements for this pathway have been described, whereas specific protein factors needed for 5S rRNA delivery into mitochondria and its structural determinants of import remain unknown. In this study, a systematic analysis of the possible role of human 5S rRNA structural elements in import was performed. Our experiments in vitro and in vivo show that two distinct regions of the human 5S rRNA molecule are needed for its mitochondrial targeting. One of them is located in the proximal part of the helix I and contains a conserved uncompensated G:U pair. The second and most important one is associated with the loop E-helix IV region with several noncanonical structural features. Destruction or even destabilization of these sites leads to a significant decrease of the 5S rRNA import efficiency. On the contrary, the beta-domain of the 5S rRNA was proven to be dispensable for import, and thus it can be deleted or substituted without affecting the 5S rRNA importability. This finding was used to demonstrate that the 5S rRNA can function as a vector for delivering heterologous RNA sequences into human mitochondria. 5S rRNA-based vectors containing a substitution of a part of the beta-domain by a foreign RNA sequence were shown to be much more efficiently imported in vivo than the wild-type 5S rRNA.

  12. Soil clone library analyses to evaluate specificity and selectivity of PCR primers targeting fungal 18S rDNA for denaturing-gradient gel electrophoresis (DGGE).


    Takada Hoshino, Yuko; Morimoto, Sho


    We evaluated the fungal specificity and detection bias of four fungal 18S rRNA gene (18S rDNA) primer sets for denaturing-gradient gel electrophoresis (DGGE). We constructed and compared clone libraries amplified from upland and paddy field soils with each primer set (1, NS1/GCFung; 2, FF390/FR1-GC; 3, NS1/FR1-GC; and 4, NS1/EF3 for the first PCR and NS1/FR1-GC for the second PCR). Primer set 4 (for nested PCR) showed the highest specificity for fungi but biased specific sequences. Sets 1, 2, and 3 (for single PCR) amplified non-fungal eukaryotic sequences (from 7 to 16% for upland soil and from 20 to 31% for paddy field soil) and produced libraries with similar distributions of fungal 18S rDNA sequences at both the phylum and the class level. Set 2 tended to amplify more diverse fungal sequences, maintaining higher specificity for fungi. In addition, clone analyses revealed differences among primer sets in the frequency of chimeras. In upland field soil, the libraries amplified with primer sets 3 and 4, which targeted long fragments, contained many chimeric 18S rDNA sequences (18% and 48%, respectively), while the libraries obtained with sets 1 and 2, which targeted short fragments, contained fewer chimeras (5% and 10%, respectively).

  13. Karyotypic diversity in four species of the genus Gymnotus Linnaeus, 1758 (Teleostei, Gymnotiformes, Gymnotidae): physical mapping of ribosomal genes and telomeric sequences.


    Scacchetti, Priscilla Cardim; Pansonato-Alves, José Carlos; Utsunomia, Ricardo; Oliveira, Claudio; Foresti, Fausto


    Conventional (Giemsa, C-Banding, Ag-NORs, CMA3) and molecular (5S rDNA, 18S rDNA, telomeric sequences) cytogenetic studies were carried out in specimens of ten distinct fish populations of the genus Gymnotus (Gymnotus sylvius Albert and Fernandes-Matioli, 1999, Gymnotus inaequilabiatus Valenciennes, 1839, Gymnotus pantherinus Steindachner, 1908, and G. cf. carapo Linnaeus, 1758) from different Brazilian hydrographic basins. Gymnotus sylvius presented a diploid number of 40 chromosomes (22m+12sm+6st), Gymnotus pantherinus presented 52 chromosomes (32m+18sm+2st), while Gymnotus inaequilabiatus (42m+10sm+2a)and Gymnotus cf. carapo (38m+12sm+4st) presented 54 chromosomes. The C-banding technique revealed centromeric marks in all chromosomes of all species. Besides that, conspicuous blocks of heterochromatin were found interstitially on the chromosomes of Gymnotus inaequilabiatus, Gymnotus cf. carapo,and Gymnotus pantherinus. All four species showed single nucleolus organizing regions confirmed by results obtained through Ag-NORs and FISH experiments using 18S rDNA probes, which showed the NORs localized on the first chromosome pair in Gymnotus inaequilabiatus, Gymnotus cf. carapo,and Gymnotus pantherinus, and on pair 2 in Gymnotus sylvius. CMA3 staining revealed additional unrelated NORs marks in Gymnotus sylvius and Gymnotus pantherinus. The 5S rDNA probes revealed signals on one pair in Gymnotus sylvius and two pairs in Gymnotus pantherinus; Gymnotus inaequilabiatus had about seventeen pairs marked, and Gymnotus cf. carapo had about fifteen pairs marked. It is considered that the high amount of heterochromatin identified in the chromosomes of Gymnotus inaequilabiatus and Gymnotus cf. carapo could have facilitated the dispersion of 5S rDNA in these species. Interstitial signals were detected on the first metacentric pair of Gymnotus sylvius by telomeric probes (TTAGGG)n indicating the possible occurrence of chromosomal fusions in this species. The present study

  14. Karyotypic diversity in four species of the genus Gymnotus Linnaeus, 1758 (Teleostei, Gymnotiformes, Gymnotidae): physical mapping of ribosomal genes and telomeric sequences

    PubMed Central

    Scacchetti, Priscilla Cardim; Pansonato-Alves, José Carlos; Utsunomia, Ricardo; Oliveira, Claudio; Foresti, Fausto


    Abstract Conventional (Giemsa, C-Banding, Ag-NORs, CMA3) and molecular (5S rDNA, 18S rDNA, telomeric sequences) cytogenetic studies were carried out in specimens of ten distinct fish populations of the genus Gymnotus (Gymnotus sylvius Albert and Fernandes-Matioli, 1999, Gymnotus inaequilabiatus Valenciennes, 1839, Gymnotus pantherinus Steindachner, 1908, and G. cf. carapo Linnaeus, 1758) from different Brazilian hydrographic basins. Gymnotus sylvius presented a diploid number of 40 chromosomes (22m+12sm+6st), Gymnotus pantherinus presented 52 chromosomes (32m+18sm+2st), while Gymnotus inaequilabiatus (42m+10sm+2a)and Gymnotus cf. carapo (38m+12sm+4st) presented 54 chromosomes. The C-banding technique revealed centromeric marks in all chromosomes of all species. Besides that, conspicuous blocks of heterochromatin were found interstitially on the chromosomes of Gymnotus inaequilabiatus, Gymnotus cf. carapo,and Gymnotus pantherinus. All four species showed single nucleolus organizing regions confirmed by results obtained through Ag-NORs and FISH experiments using 18S rDNA probes, which showed the NORs localized on the first chromosome pair in Gymnotus inaequilabiatus, Gymnotus cf. carapo,and Gymnotus pantherinus, and on pair 2 in Gymnotus sylvius. CMA3 staining revealed additional unrelated NORs marks in Gymnotus sylvius and Gymnotus pantherinus. The 5S rDNA probes revealed signals on one pair in Gymnotus sylvius and two pairs in Gymnotus pantherinus; Gymnotus inaequilabiatus had about seventeen pairs marked, and Gymnotus cf. carapo had about fifteen pairs marked. It is considered that the high amount of heterochromatin identified in the chromosomes of Gymnotus inaequilabiatus and Gymnotus cf. carapo could have facilitated the dispersion of 5S rDNA in these species. Interstitial signals were detected on the first metacentric pair of Gymnotus sylvius by telomeric probes (TTAGGG)n indicating the possible occurrence of chromosomal fusions in this species. The present

  15. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2010 CFR


    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  16. 17 CFR 259.5s - Form U5S, for annual reports filed under section 5(c) of the Act.

    Code of Federal Regulations, 2011 CFR


    ... holding company. Editorial Note: For Federal Register citations affecting Form U5S, see the List of CFR... filed under section 5(c) of the Act. 259.5s Section 259.5s Commodity and Securities Exchanges SECURITIES... 1935 Forms for Registration and Annual Supplements § 259.5s Form U5S, for annual reports filed...

  17. 16S and 23S plastid rDNA phylogenies of Prototheca species and their auxanographic phenotypes.


    Ewing, Aren; Brubaker, Shane; Somanchi, Aravind; Yu, Esther; Rudenko, George; Reyes, Nina; Espina, Karen; Grossman, Arthur; Franklin, Scott


    Because algae have become more accepted as sources of human nutrition, phylogenetic analysis can help resolve the taxonomy of taxa that have not been well studied. This can help establish algal evolutionary relationships. Here, we compare Auxenochlorella protothecoides and 23 strains of Prototheca based on their complete 16S and partial 23S plastid rDNA sequences along with nutrient utilization (auxanographic) profiles. These data demonstrate that some of the species groupings are not in agreement with the molecular phylogenetic analyses and that auxanographic profiles are poor predictors of phylogenetic relationships. PMID:25937672

  18. 16S and 23S plastid rDNA phylogenies of Prototheca species and their auxanographic phenotypes1

    PubMed Central

    Ewing, Aren; Brubaker, Shane; Somanchi, Aravind; Yu, Esther; Rudenko, George; Reyes, Nina; Espina, Karen; Grossman, Arthur; Franklin, Scott


    Because algae have become more accepted as sources of human nutrition, phylogenetic analysis can help resolve the taxonomy of taxa that have not been well studied. This can help establish algal evolutionary relationships. Here, we compare Auxenochlorella protothecoides and 23 strains of Prototheca based on their complete 16S and partial 23S plastid rDNA sequences along with nutrient utilization (auxanographic) profiles. These data demonstrate that some of the species groupings are not in agreement with the molecular phylogenetic analyses and that auxanographic profiles are poor predictors of phylogenetic relationships. PMID:25937672

  19. The 5-S RNA . protein complex from an extreme halophile, Halobacterium cutirubrum. Purification and characterization.


    Smith, N; Matheson, A T; Yaguchi, M; Willick, G E; Nazar, R N


    A 5-S RNA . protein complex has been isolated from the 50-S ribosomal subunit of an extreme halophile, Halobacterium cutirubrum. The 50-S ribosomal subunit from the extreme halophile requires 3.4 M K+ and 100 mM Mg2+ for stability. However, if the high K+ concentration is maintained but the Mg2+ concentration lowered to 0.3 mM, the 5-S RNA . protein complex is selectively extracted from the subunit. After being purified on an Agarose 0.5-m column the complex had a molecular weight of about 80000 and contained 5-S RNA and two proteins, HL13 and HL19, with molecular weights (by sedimentation equilibrium) of 18700 and 18000, respectively. No ATPase or GTPase activity could be detected in the 5-S RNA . protein complex. The amino acid composition and electrophoretic mobility on polyacrylamide gels indicated both proteins were much more acidic than the equivalent from Escherichia coli or Bacillus stearothermophilus. Partial amino acid sequence data suggest HL13 is homologous to EL18 and HL19 to EL5.

  20. Characterization of Ffh of Mycobacterium tuberculosis and its interaction with 4.5S RNA.


    Palaniyandi, Kannan; Veerasamy, Malini; Narayanan, Sujatha


    Signal recognition particle (SRP) mediates targeting of proteins to appropriate cellular compartments, which is an important process in all living organisms. In prokaryotes, SRP consists of Ffh, a protein, and 4.5S RNA that recognizes signal peptide emerging from ribosomes. The SRP (Ffh) of one the most successful intracellular pathogen, Mycobacterium tuberculosis, has been investigated with respect to biochemical properties. In the present study, Ffh of M. tuberculosis was overexpressed and was confirmed to be a GTPase using thin layer chromatography and malachite green assay. The GTP binding ability was confirmed by GTP overlay assay. The 4.5S RNA sequence of M. tuberculosis was synthesized by in vitro transcription assay. The interaction between Ffh and 4.5S RNA was confirmed by overlay assay and RNA gel shift assay. The results show that the biochemical properties of M. tuberculosis Ffh have been conserved, and this is the first report that shows the interaction of components of SRP in M. tuberculosis, namely Ffh protein and 4.5S RNA.

  1. L5-S1 Laparoscopic Anterior Interbody Fusion

    PubMed Central

    Zeni, Tallal M.; Phillips, Frank M.; Mathur, Sameer; Zografakis, John G.; Moore, Ronald M.; Laguna, Luis E.


    Objective: We evaluated our experience with laparoscopic L5-S1 anterior lumbar interbody fusion (ALIF). Methods: This represents a retrospective analysis of consecutive patients who underwent L5-S1 laparoscopic ALIF between February 1998 and August 2003. Results: Twenty-eight patients underwent L5-S1 LAIF (15 males and 13 females). The mean age was 43 years (range, 26 to 67). Mean operative time was 225 minutes (range, 137 to 309 minutes). No conversions to an open procedure were necessary. Twenty-four (85.7%) patients underwent successful bilateral cage placement. Four patients (14.3%) in whom only a single cage could be placed underwent supplementary posterior pedicle screw placement. Mean length of stay (LOS) was 4.1 days (range, 2 to 15). Two patients underwent reoperation subacutely secondary to symptomatic lateral displacement of the cage. One patient developed radiculopathy 6 months postoperatively and required reoperation. One patient developed a small bowel obstruction secondary to adhesions to the cage requiring laparoscopic reoperation. Fusion was achieved in all patients. Visual analogue scale scores for back pain were significantly improved from 8.6±0.8 to 2.8±0.8 (P<0.0001) at 1 year. Conclusion: L5-S1 LAIF is feasible and safe with all the advantages of minimally invasive surgery. Fusion rates and pain improvement were comparable to those with an open repair. PMID:17575763

  2. Analyzing Digital Library Initiatives: 5S Theory Perspective

    ERIC Educational Resources Information Center

    Isah, Abdulmumin; Mutshewa, Athulang; Serema, Batlang; Kenosi, Lekoko


    This article traces the historical development of Digital Libraries (DLs), examines some DL initiatives in developed and developing countries and uses 5S Theory as a lens for analyzing the focused DLs. The analysis shows that present-day systems, in both developed and developing nations, are essentially content and user centric, with low level…

  3. Wide occurrence of SSU rDNA intragenomic polymorphism in foraminifera and its implications for molecular species identification.


    Weber, Alexandra Anh-Thu; Pawlowski, Jan


    Ribosomal DNA is commonly used as a marker for protist phylogeny and taxonomy because of its ubiquity and its expected species specificity thanks to the mechanism of concerted evolution. However, numerous studies reported the occurrence of intragenomic (intra-individual) polymorphism in various protists and particularly in Foraminifera. To infer to what extent the SSU rDNA intragenomic variability occurs in Foraminifera, we studied 16 foraminiferal species belonging to single-chambered monothalamids and multi-chambered Globothalamea, with one to six individuals per species. We performed single-cell DNA extractions and PCRs of a 600bp fragment of SSU rDNA, and sequenced 9 to 23 clones per individual for a total of 818 sequences. We found intragenomic variability in almost all species, even after excluding singleton mutations. Intra-individual sequence divergence ranged from 0 to 5.15% and was higher than 1% in 11 species. Variability was usually located at the end of stem-loop structures and included compensatory single nucleotide polymorphisms and expansion segments polymorphisms. However, the polymorphisms did not change the secondary structure of the rRNA. Our results suggest a non-concerted evolution of rRNA genes in Foraminifera. The origin of this variability and its implications for species identification in environmental DNA studies are discussed.

  4. Detection and characterization of fungal infections of Ammophila arenaria (marram grass) roots by denaturing gradient gel electrophoresis of specifically amplified 18s rDNA.

    PubMed Central

    Kowalchuk, G A; Gerards, S; Woldendorp, J W


    Marram grass (Ammophila arenaria L.), a sand-stabilizing plant species in coastal dune areas, is affected by a specific pathosystem thought to include both plant-pathogenic fungi and nematodes. To study the fungal component of this pathosystem, we developed a method for the cultivation-independent detection and characterization of fungi infecting plant roots based on denaturing gradient gel electrophoresis (DGGE) of specifically amplified DNA fragments coding for 18S rRNA (rDNA). A nested PCR strategy was employed to amplify a 569-bp region of the 18S rRNA gene, with the addition of a 36-bp GC clamp, from fungal isolates, from roots of test plants infected in the laboratory, and from field samples of marram grass roots from both healthy and degenerating stands from coastal dunes in The Netherlands. PCR products from fungal isolates were subjected to DGGE to examine the variation seen both between different fungal taxa and within a single species. DGGE of the 18S rDNA fragments could resolve species differences from fungi used in this study yet was unable to discriminate between strains of a single species. The 18S rRNA genes from 20 isolates of fungal species previously recovered from A. arenaria roots were cloned and partially sequenced to aid in the interpretation of DGGE data. DGGE patterns recovered from laboratory plants showed that this technique could reliably identify known plant-infecting fungi. Amplification products from field A. arenaria roots also were analyzed by DGGE, and the major bands were excised, reamplified, sequenced, and subjected to phylogenetic analysis. Some recovered 18S rDNA sequences allowed for phylogenetic placement to the genus level, whereas other sequences were not closely related to known fungal 18S rDNA sequences. The molecular data presented here reveal fungal diversity not detected in previous culture-based surveys. PMID:9327549


    EPA Science Inventory

    The phylogenetic relationship of Alexandrium monilatum to other Alexandrium spp. was explored using 18S rDNA sequences. Maximum likelilhood phylogenetic analysis of the combined rDNA sequences established that A. monilatum paired with Alexandrium taylori and that the pair was the...


    EPA Science Inventory

    The phylogenetic relationship of Alexandrium monilatum to other Alexandrium spp. was explored using 18S rDNA sequences. Maximum likelihood phylogenetic analysis of the combined rDNA sequences established that A. monilatum paired with Alexandrium taylori and that the pair was the ...

  7. Overaccumulation of the chloroplast antisense RNA AS5 is correlated with decreased abundance of 5S rRNA in vivo and inefficient 5S rRNA maturation in vitro.


    Sharwood, Robert E; Hotto, Amber M; Bollenbach, Thomas J; Stern, David B


    Post-transcriptional regulation in the chloroplast is exerted by nucleus-encoded ribonucleases and RNA-binding proteins. One of these ribonucleases is RNR1, a 3'-to-5' exoribonuclease of the RNase II family. We have previously shown that Arabidopsis rnr1-null mutants exhibit specific abnormalities in the expression of the rRNA operon, including the accumulation of precursor 23S, 16S, and 4.5S species and a concomitant decrease in the mature species. 5S rRNA transcripts, however, accumulate to a very low level in both precursor and mature forms, suggesting that they are unstable in the rnr1 background. Here we demonstrate that rnr1 plants overaccumulate an antisense RNA, AS5, that is complementary to the 5S rRNA, its intergenic spacer, and the downstream trnR gene, which encodes tRNA(Arg), raising the possibility that AS5 destabilizes 5S rRNA or its precursor and/or blocks rRNA maturation. To investigate this, we used an in vitro system that supports 5S rRNA and trnR processing. We show that AS5 inhibits 5S rRNA maturation from a 5S-trnR precursor, and shorter versions of AS5 demonstrate that inhibition requires intergenic sequences. To test whether the sense and antisense RNAs form double-stranded regions in vitro, treatment with the single-strand-specific mung bean nuclease was used. These results suggest that 5S-AS5 duplexes interfere with a sense-strand secondary structure near the endonucleolytic cleavage site downstream from the 5S rRNA coding region. We hypothesize that these duplexes are degraded by a dsRNA-specific ribonuclease in vivo, contributing to the 5S rRNA deficiency observed in rnr1.

  8. Analysis of a 5S rRNA gene cloned from Euplotes eurstomus

    SciTech Connect

    Roberson, A.E.; Wolffe, A.; Olins, D.E.


    The macronucleus of the hypotrichous ciliated protozoan Euplotes eurystomus lends itself to the study of eukaryotic gene and chromatin structure because native macronuclear DNA exists as linear, gene-sized fragments between 400 and 20,000 bp in length. The macronuclear chromatin, while arranged in a typical nucleosomal structure, is freely soluble in low ionic strength buffers without treatment by nucleases. Thus, specific genes may be enriched as native, intact chromatin molecules. The 5S rRNA gene from Euplotes has been cloned to facilitate investigation of 5S gene-chromatin following characterization of the gene at the DNA level. It has been demonstrated that the gene, while in circular or linear form, can be transcribed in vitro by a Xenopus oocyte nuclear extract. The transcript generated in vitro is 120 nucleotides in length and is synthesized by RNA polymerase III. Anti-Xenopus TFIIIA antibodies recognize a Euplotes macronuclear chromatin-associated protein which is approx. 80 KD in size. It has been established that the sequence of the telomere flanking the 5S gene in Euplotes eurystomus is the same telomeric sequence published for Euplotes aediculatus.

  9. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.


    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon


    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment. PMID:22724546

  10. 5S rRNA and accompanying proteins in gonads: powerful markers to identify sex and reproductive endocrine disruption in fish.


    Diaz de Cerio, Oihane; Rojo-Bartolomé, Iratxe; Bizarro, Cristina; Ortiz-Zarragoitia, Maren; Cancio, Ibon


    In anuran ovaries, 5S rDNA is regulated transcriptionally by transcription factor IIIA (TFIIIA), which upon transcription, binds 5S rRNA, forming 7S RNP. 5S rRNA can be stockpiled also in the form of 42S RNP bound to 42sp43. The aim of the present study was to assess the differential transcriptional regulation of 5S rRNA and associated proteins in thicklip gray mullet (Chelon labrosus) gonads. Up to 75% of the total RNA from mullet ovaries was 5S rRNA. qPCR quantification of 5S rRNA expression, in gonads of histologically sexed individuals from different geographical areas, successfully sexed animals. All males had expression levels that were orders of magnitude below expression levels in females, throughout an annual reproductive cycle, with the exception of two individuals: one in November and one in December. Moreover, intersex mullets from a polluted harbor had expression levels between both sexes. TFIIIA and 42sp43 were also very active transcriptionally in gonads of female and intersex mullets, in comparison to males. Nucleocytoplasmatic transport is important in this context and we also analyzed transcriptional levels of importins-α1, -α2, and -β2 and different exportins. Importin-αs behaved similarly to 5S rRNA. Thus, 5S rRNA and associated proteins constitute very powerful molecular markers of sex and effects of xenosterogens in fish gonads, with potential technological applications in the analysis of fish stock dynamics and reproduction as well as in environmental health assessment.

  11. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.


    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio


    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status.

  12. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.


    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio


    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status. PMID:23933480

  13. A methylated Neurospora 5S rRNA pseudogene contains a transposable element inactivated by repeat-induced point mutation.

    PubMed Central

    Margolin, B S; Garrett-Engele, P W; Stevens, J N; Fritz, D Y; Garrett-Engele, C; Metzenberg, R L; Selker, E U


    In an analysis of 22 of the roughly 100 dispersed 5S rRNA genes in Neurospora crassa, a methylated 5S rRNA pseudogene, Psi63, was identified. We characterized the Psi63 region to better understand the control and function of DNA methylation. The 120-bp 5S rRNA-like region of Psi63 is interrupted by a 1.9-kb insertion that has characteristics of sequences that have been modified by repeat-induced point mutation (RIP). We found sequences related to this insertion in wild-type strains of N. crassa and other Neurospora species. Most showed evidence of RIP; but one, isolated from the N. crassa host of Psi63, showed no evidence of RIP. A deletion from near the center of this sequence apparently rendered it incapable of participating in RIP with the related full-length copies. The Psi63 insertion and the related sequences have features of transposons and are related to the Fot1 class of fungal transposable elements. Apparently Psi63 was generated by insertion of a previously unrecognized Neurospora transposable element into a 5S rRNA gene, followed by RIP. We name the resulting inactivated Neurospora transposon PuntRIP1 and the related sequence showing no evidence of RIP, but harboring a deletion that presumably rendered it defective for transposition, dPunt. PMID:9691037

  14. [Investigation of bacterial diversity in the biological desulfurization reactor for treating high salinity wastewater by the 16S rDNA cloning method].


    Liu, Wei-Guo; Liang, Cun-Zhen; Yang, Jin-Sheng; Wang, Gui-Ping; Liu, Miao-Miao


    The bacterial diversity in the biological desulfurization reactor operated continuously for 1 year was studied by the 16S rDNA cloning and sequencing method. Forty clones were randomly selected and their partial 16S rDNA genes (ca. 1,400 bp) were sequenced and blasted. The results indicated that there were dominant bacterias in the biological desulfurization reactor, where 33 clones belonged to 3 different published phyla, while 1 clone belonged to unknown phylum. The dominant bacterial community in the system was Proteobacteria, which accounted for 85.3%. The bacterial community succession was as follows: the gamma-Proteobacteria(55.9%), beta-Proteobacteria(17.6%), Actinobacteridae (8.8%), delta-Proteobacteria (5.9%) , alpha-Proteobacteria(5.9%), and Sphingobacteria (2.9%). Halothiobacillus sp. ST15 and Thiobacillus sp. UAM-I were the major desulfurization strains.

  15. Differentiation of Acidithiobacillus ferrooxidans and A. thiooxidans strains based on 16S-23S rDNA spacer polymorphism analysis.


    Bergamo, Rogério F; Novo, Maria Teresa M; Veríssimo, Ricardo V; Paulino, Luciana C; Stoppe, Nancy C; Sato, Maria Inês Z; Manfio, Gilson P; Prado, Paulo Inácio; Garcia, Oswaldo; Ottoboni, Laura M M


    Restriction fragment length polymorphism (RFLP) and sequence analyses of the PCR-amplified 16S-23S rDNA intergenic spacer (ITS) were used for differentiating Acidithiobacillus thiooxidans strains from other related acidithiobacilli, including A. ferrooxidans and A. caldus. RFLP fingerprints obtained with AluI, DdeI, HaeIII, HinfI and MspI enabled the differentiation of all Acidithiobacillus reference strains into species groups. The A. thiooxidans strains investigated (metal mine isolates) yielded identical RFLP patterns to the A. thiooxidans type strain (ATCC 19377(T)), except for strain DAMS, which had a distinct pattern for all enzymes tested. Fourteen A. ferrooxidans mine strains were assigned to 3 RFLP groups, the majority of which were grouped with A. ferrooxidans ATCC 23270(T). The spacer region of one representative strain from each of the RFLP groups obtained was subjected to sequence analysis, in addition to eleven additional A. thiooxidans strains isolated from sediment and water samples, and A. caldus DSM 8584(T). The tRNA(IIe) and tRNA(Ala) genes, present in all strains analyzed, showed high sequence similarity. Phylogenetic analysis of the ITS sequences differentiated all three Acidithiobacillus species. Inter- and infraspecific genetic variations detected were mainly due to the size and sequence polymorphism of the ITS3 region. Mantel tests showed no significant correlation between ITS sequence similarity and the geographical origin of strains. The results showed that the 16S-23S rDNA spacer region is a useful target for the development of molecular-based methods aimed at the detection, rapid differentiation and identification of acidithiobacilli.

  16. Bacterial diversity in water samples from uranium wastes as demonstrated by 16S rDNA and ribosomal intergenic spacer amplification retrievals.


    Radeva, Galina; Selenska-Pobell, Sonja


    Bacterial diversity was assessed in water samples collected from several uranium mining wastes in Ger many and in the United States by using 16S rDNA and ribosomal intergenic spacer amplification retrievals. The results obtained using the 16S rDNA retrieval showed that the samples collected from the uranium mill tailings of Schlema/Alberoda, Germany, were predominated by Nitrospina-like bacteria, whereas those from the mill tailings of Shiprock, New Mexico, USA, were predominated by gamma-Pseudomonas and Frauteria spp. Additional smaller populations of the Cytophaga-Flavobacterium-Bacteroides group and alpha- and delta-Proteobacteria were identified in the Shiprock samples as well. Proteobacteria and Cytophaga-Flavobacterium-Bacteroides were also found in the third uranium mill tailings studied, Gittersee/Coschütz, Germany, but the groups of the predominant clones were rather small. Most of the clones of the Gittersee/Coschütz samples represented individual sequences, which indicates a high level of bacterial diversity. The samples from the fourth uranium waste studied, Steinsee Deponie B1, Germany, were predominantly occupied by Acinetobacter spp. The ribosomal intergenic spacer amplification retrieval provided results complementary to those obtained by the 16S rDNA analyses. For instance, in the Shiprock samples, an additional predominant bacterial group was identified and affiliated with Nitrosomonas sp., whereas in the Gittersee/Coschütz samples, anammox populations were identified that were not retrieved by the applied 16S rDNA approach.

  17. Transcription factor IIIA induced bending of the Xenopus somatic 5S gene promoter.


    Schroth, G P; Cook, G R; Bradbury, E M; Gottesfeld, J M


    Transcription factor IIIA (TFIIIA), the canonical zinc-finger protein, is a protein of relative molecular mass 39,000 (39K) that is required for transcription of 5S-ribosomal subunit genes in Xenopus. It binds in a sequence-specific manner to the internal control region of the 5S gene (see Fig. 1) and facilitates transcription of the gene by RNA polymerase III. It also binds to the 5S gene product to form a 7S ribonucleoprotein particle. In oocytes the 7S particle acts as a storage form of the RNA to be utilized later in development. TFIIIA binds to DNA through its 30 K N-terminal domain, which contains nine zinc-fingers. TFIIIA was the first protein described to have this type of DNA binding motif, but numerous other proteins have now been shown to have zinc-finger domains. A structure for a single zinc-finger from the yeast protein ADR1, was recently proposed based on two-dimensional NMR data (ref. 8), and a similar structure was proposed based on comparison with crystal structures of other metalloproteins. Although models for the interaction of TFIIIA with the 5S-ribosomal gene DNA have been proposed, based on nuclease digestion and methylation interference data, little precise structural information is available for TFIIIA and the physical basis for the interaction of zinc-fingers with DNA is not understood. Using both circular permutation and circularization assays we provide convincing biochemical evidence that TFIIIA bends the DNA at the internal promoter of the 5S gene.

  18. Physical studies of 5S RNA variants at position 66.

    PubMed Central

    Zhang, P; Popieniek, P; Moore, P B


    Two variants of the 5S RNA of E. coli have been examined by imino proton NMR spectroscopy, one of them a deletion of A66 (Christiansen, J., Douthwaite, S.R., Christensen, A. and Garrett, R.A. (1985) EMBO J. 4, 1019-1024) and the other a replacement of A66 with a C (Goringer, H.U. and Wagner, R. (1986) Biol. Chem. Hoppe-Seyler 367, 769-780). Both are of interest because the role the bulged A in helix II of 5S RNA is supposed to play in interactions with ribosomal protein L18. The data show that the structural perturbations that result from these mutations are minimal, and assign the resonances of some of the imino protons around position 66. Some mutations at or near position 66 greatly reduce the L18-dependent increase in the circular dichroism of 5S RNA at 267 nm first observed by Bear and coworkers (Bear, D.G., Schleich, T., Noller, H.F. and Garrett, R.A. (1977) Nucl. Acids Res. 4, 2511-2526). PMID:2479908

  19. Triphosphate residues at the 5' ends of rRNA precursor and 5S RNA from Dictyostelium discoideum.

    PubMed Central

    Batts-Young, B; Lodish, H F


    We present here direct evidence for the preservation of a transcriptional initiation sequence in a eukaryotic rRNA precursor: the 5'-end group for precursor to 17S rRNA (p17S RNA) from Dictyostelium discoideum is identified as the triphosphate residue pppA-. We also show that mature 5S RNA form Dictyostelium bears a different triphosphate residue, pppG-. In contrast, we find no evidence for more than one phosphate at the 5' end of the 25S rRNA precursor (p25S RNA). These observations indicate that synthesis of the large ribosomal RNAs of Dictyostelium begins with the 5'-terminal sequence of the p17S RNA, and that 5S RNA transcription must be initiated independently, despite the close association of the 5S and rRNA coding segments. Images PMID:204930

  20. Rapid identification and classification of bacteria by 16S rDNA restriction fragment melting curve analyses (RFMCA).


    Rudi, Knut; Kleiberg, Gro H; Heiberg, Ragnhild; Rosnes, Jan T


    The aim of this work was to evaluate restriction fragment melting curve analyses (RFMCA) as a novel approach for rapid classification of bacteria during food production. RFMCA was evaluated for bacteria isolated from sous vide food products, and raw materials used for sous vide production. We identified four major bacterial groups in the material analysed (cluster I-Streptococcus, cluster II-Carnobacterium/Bacillus, cluster III-Staphylococcus and cluster IV-Actinomycetales). The accuracy of RFMCA was evaluated by comparison with 16S rDNA sequencing. The strains satisfying the RFMCA quality filtering criteria (73%, n=57), with both 16S rDNA sequence information and RFMCA data (n=45) gave identical group assignments with the two methods. RFMCA enabled rapid and accurate classification of bacteria that is database compatible. Potential application of RFMCA in the food or pharmaceutical industry will include development of classification models for the bacteria expected in a given product, and then to build an RFMCA database as a part of the product quality control. PMID:17367680

  1. A Tale of Two Lines: Searching for the 5s - 5p Resonance Lines in Pm-like Ion Spectra

    SciTech Connect

    Trabert, E; Vilkas, M J; Ishikawa, Y


    Highly charged ions in the promethium sequence have been suggested to show spectral features resembling the alkali sequence ions. Guided by calculations, the 5s-5p resonance lines have been sought in a variety of experiments. In the light of the most extensive calculations of Pm-like ions yet, applying relativistic multi-reference Moeller-Plesset second-order perturbation theory, the experimental evidence is reviewed and the line identification problem assessed.

  2. D5S2500 is an ambiguously characterized STR: Identification and description of forensic microsatellites in the genomics age.


    Phillips, C; Parson, W; Amigo, J; King, J L; Coble, M D; Steffen, C R; Vallone, P M; Gettings, K B; Butler, J M; Budowle, B


    In the process of establishing short tandem repeat (STR) sequence variant nomenclature guidelines in anticipation of expanded forensic multiplexes for massively parallel sequencing (MPS), it was discovered that the STR D5S2500 has multiple positions and genomic characteristics reported. This ambiguity is because the marker named D5S2500 consists of two different microsatellites forming separate components in the capillary electrophoresis multiplexes of Qiagen's HDplex (Hilden, Germany) and AGCU ScienTech's non-CODIS STR 21plex (Wuxi, Jiangsu, China). This study outlines the genomic details used to identify each microsatellite and reveals the D5S2500 marker in HDplex has the correctly assigned STR name, while the D5S2500 marker in the AGCU 21plex, closely positioned a further 1643 nucleotides in the human reference sequence, is an unnamed microsatellite. The fact that the D5S2500 marker has existed as two distinct STR loci undetected for almost ten years, even with reported discordant genotypes for the standard control DNA, underlines the need for careful scrutiny of the genomic properties of forensic STRs, as they become adapted for sequence analysis with MPS systems. We make the recommendation that precise chromosome location data must be reported for any forensic marker under development but not in common use, so that the genomic characteristics of the locus are validated to the same level of accuracy as its allelic variation and forensic performance. To clearly differentiate each microsatellite, we propose the name D5S2800 be used to identify the Chromosome-5 STR in the AGCU 21plex.

  3. D5S2500 is an ambiguously characterized STR: Identification and description of forensic microsatellites in the genomics age.


    Phillips, C; Parson, W; Amigo, J; King, J L; Coble, M D; Steffen, C R; Vallone, P M; Gettings, K B; Butler, J M; Budowle, B


    In the process of establishing short tandem repeat (STR) sequence variant nomenclature guidelines in anticipation of expanded forensic multiplexes for massively parallel sequencing (MPS), it was discovered that the STR D5S2500 has multiple positions and genomic characteristics reported. This ambiguity is because the marker named D5S2500 consists of two different microsatellites forming separate components in the capillary electrophoresis multiplexes of Qiagen's HDplex (Hilden, Germany) and AGCU ScienTech's non-CODIS STR 21plex (Wuxi, Jiangsu, China). This study outlines the genomic details used to identify each microsatellite and reveals the D5S2500 marker in HDplex has the correctly assigned STR name, while the D5S2500 marker in the AGCU 21plex, closely positioned a further 1643 nucleotides in the human reference sequence, is an unnamed microsatellite. The fact that the D5S2500 marker has existed as two distinct STR loci undetected for almost ten years, even with reported discordant genotypes for the standard control DNA, underlines the need for careful scrutiny of the genomic properties of forensic STRs, as they become adapted for sequence analysis with MPS systems. We make the recommendation that precise chromosome location data must be reported for any forensic marker under development but not in common use, so that the genomic characteristics of the locus are validated to the same level of accuracy as its allelic variation and forensic performance. To clearly differentiate each microsatellite, we propose the name D5S2800 be used to identify the Chromosome-5 STR in the AGCU 21plex. PMID:26974236

  4. Analysis of the unexplored features of rrs (16S rDNA) of the Genus Clostridium

    PubMed Central


    Background Bacterial taxonomy and phylogeny based on rrs (16S rDNA) sequencing is being vigorously pursued. In fact, it has been stated that novel biological findings are driven by comparison and integration of massive data sets. In spite of a large reservoir of rrs sequencing data of 1,237,963 entries, this analysis invariably needs supplementation with other genes. The need is to divide the genetic variability within a taxa or genus at their rrs phylogenetic boundaries and to discover those fundamental features, which will enable the bacteria to naturally fall within them. Within the large bacterial community, Clostridium represents a large genus of around 110 species of significant biotechnological and medical importance. Certain Clostridium strains produce some of the deadliest toxins, which cause heavy economic losses. We have targeted this genus because of its high genetic diversity, which does not allow accurate typing with the available molecular methods. Results Seven hundred sixty five rrs sequences (> 1200 nucleotides, nts) belonging to 110 Clostridium species were analyzed. On the basis of 404 rrs sequences belonging to 15 Clostridium species, we have developed species specific: (i) phylogenetic framework, (ii) signatures (30 nts) and (iii) in silico restriction enzyme (14 Type II REs) digestion patterns. These tools allowed: (i) species level identification of 95 Clostridium sp. which are presently classified up to genus level, (ii) identification of 84 novel Clostridium spp. and (iii) potential reduction in the number of Clostridium species represented by small populations. Conclusions This integrated approach is quite sensitive and can be easily extended as a molecular tool for diagnostic and taxonomic identification of any microbe of importance to food industries and health services. Since rapid and correct identification allows quicker diagnosis and consequently treatment as well, it is likely to lead to reduction in economic losses and mortality

  5. rDNA Copy Number Variants Are Frequent Passenger Mutations in Saccharomyces cerevisiae Deletion Collections and de Novo Transformants

    PubMed Central

    Kwan, Elizabeth X.; Wang, Xiaobin S.; Amemiya, Haley M.; Brewer, Bonita J.; Raghuraman, M. K.


    The Saccharomyces cerevisiae ribosomal DNA (rDNA) locus is known to exhibit greater instability relative to the rest of the genome. However, wild-type cells preferentially maintain a stable number of rDNA copies, suggesting underlying genetic control of the size of this locus. We performed a screen of a subset of the Yeast Knock-Out (YKO) single gene deletion collection to identify genetic regulators of this locus and to determine if rDNA copy number correlates with yeast replicative lifespan. While we found no correlation between replicative lifespan and rDNA size, we identified 64 candidate strains with significant rDNA copy number differences. However, in the process of validating candidate rDNA variants, we observed that independent isolates of our de novo gene deletion strains had unsolicited but significant changes in rDNA copy number. Moreover, we were not able to recapitulate rDNA phenotypes from the YKO yeast deletion collection. Instead, we found that the standard lithium acetate transformation protocol is a significant source of rDNA copy number variation, with lithium acetate exposure being the treatment causing variable rDNA copy number events after transformation. As the effects of variable rDNA copy number are being increasingly reported, our finding that rDNA is affected by lithium acetate exposure suggested that rDNA copy number variants may be influential passenger mutations in standard strain construction in S. cerevisiae. PMID:27449518

  6. Comparative cytogenetics of giant trahiras Hoplias aimara and H. intermedius (Characiformes, Erythrinidae): chromosomal characteristics of minor and major ribosomal DNA and cross-species repetitive centromeric sequences mapping differ among morphologically identical karyotypes.


    Blanco, D R; Lui, R L; Vicari, M R; Bertollo, L A C; Moreira-Filho, O


    Karyotype and cytogenetic characteristics of 2 species of giant trahiras, Hopliasintermedius, São Francisco river basin, and Hopliasaimara, Arinos river (Amazon basin), were examined by conventional (C-banding, Ag-NOR, DAPI/CMA(3) double-staining) and fluorescent in situ hybridization (FISH) with 5S, 18S rDNA probes and cross-species Cot-1 DNA probing. Both species invariably had diploid chromosome number 2n = 50 and identical karyotypes composed of 10 pairs of metacentric and 15 pairs of submetacentric chromosomes. On the other hand, staining with base-specific fluorochromes (CMA(3), DAPI) and FISH mapping of repetitive DNA sequences showed extensive interspecific differences: while the genome of H. aimara had one submetacentric pair bearing CMA(3)-positive (DAPI-negative) sites, that of H. intermedius had 4 such pairs; while FISH with a 5S rDNA probe showed one (likely homologous) signal-bearing pair, that with 18S rDNA displayed one signal-bearing pair in H. intermedius and 2 such pairs in H. aimara. Cross-species FISH probing with Cot-1 DNA prepared from total DNA of both species showed no signals of Cot-1 DNA from H. aimara on chromosomes of H. intermedius but reciprocally (Cot-1 DNA from H. intermedius on chromosomes of H. aimara) displayed signals on at least 4 chromosome pairs. Present findings indicate (i) different composition of repetitive sequences around centromeres, (ii) different NOR phenotypes and (iii) distinct taxonomic status of both giant trahira species. PMID:20924165

  7. Cytogenetic analysis and chromosomal characteristics of the polymorphic 18S rDNA of Haliotis discus hannai from Fujian, China.


    Wang, Haishan; Luo, Xuan; You, Weiwei; Dong, Yunwei; Ke, Caihuan


    We report on novel chromosomal characteristics of Haliotis discus hannai from a breeding population at Fujian, China. The karyotypes of H. discus hannai we obtained from an abalone farm include a common type 2n = 36 = 10M + 8SM (82%) and two rare types 2n = 36 = 11M + 7SM (14%) and 2n = 36 = 10M + 7SM + 1ST (4%). The results of silver staining showed that the NORs of H. discus hannai were usually located terminally on the long arms of chromosome pairs 14 and 17, NORs were also sometimes located terminally on the short arms of other chromosomes, either metacentric or submetacentric pairs. The number of Ag-nucleoli ranged from 2 to 8, and the mean number was 3.61 ± 0.93. Among the scored interphase cells, 41% had 3 detectable nucleoli and 37% had 4 nucleoli. The 18S rDNA FISH result is the first report of the location of 18S rDNA genes in H. discus hannai. The 18S rDNA locations were highly polymorphic in this species. Copies of the gene were observed in the terminal of long or/and short arms of submetacentric or/and metacentric chromosomes. Using FISH with probe for vertebrate-like telomeric sequences (CCCTAA)3 displayed positive green FITC signals at telomere regions of all analyzed chromosome types. We found about 7% of chromosomes had breaks in prophase. A special form of nucleolus not previously described from H. discus hannai was observed in some interphase cells. It consists of many small silver-stained nucleoli gathered together to form a larger nucleolus and may correspond to prenucleolar bodies. PMID:25699679

  8. Cytogenetic analysis and chromosomal characteristics of the polymorphic 18S rDNA of Haliotis discus hannai from Fujian, China.


    Wang, Haishan; Luo, Xuan; You, Weiwei; Dong, Yunwei; Ke, Caihuan


    We report on novel chromosomal characteristics of Haliotis discus hannai from a breeding population at Fujian, China. The karyotypes of H. discus hannai we obtained from an abalone farm include a common type 2n = 36 = 10M + 8SM (82%) and two rare types 2n = 36 = 11M + 7SM (14%) and 2n = 36 = 10M + 7SM + 1ST (4%). The results of silver staining showed that the NORs of H. discus hannai were usually located terminally on the long arms of chromosome pairs 14 and 17, NORs were also sometimes located terminally on the short arms of other chromosomes, either metacentric or submetacentric pairs. The number of Ag-nucleoli ranged from 2 to 8, and the mean number was 3.61 ± 0.93. Among the scored interphase cells, 41% had 3 detectable nucleoli and 37% had 4 nucleoli. The 18S rDNA FISH result is the first report of the location of 18S rDNA genes in H. discus hannai. The 18S rDNA locations were highly polymorphic in this species. Copies of the gene were observed in the terminal of long or/and short arms of submetacentric or/and metacentric chromosomes. Using FISH with probe for vertebrate-like telomeric sequences (CCCTAA)3 displayed positive green FITC signals at telomere regions of all analyzed chromosome types. We found about 7% of chromosomes had breaks in prophase. A special form of nucleolus not previously described from H. discus hannai was observed in some interphase cells. It consists of many small silver-stained nucleoli gathered together to form a larger nucleolus and may correspond to prenucleolar bodies.

  9. The evolution pattern of rDNA ITS in Avena and phylogenetic relationship of the Avena species (Poaceae: Aveneae).


    Peng, Yuan-Ying; Baum, Bernard R; Ren, Chang-Zhong; Jiang, Qian-Tao; Chen, Guo-Yue; Zheng, You-Liang; Wei, Yu-Ming


    Ribosomal ITS sequences are commonly used for phylogenetic reconstruction because they are included in rDNA repeats, and these repeats often undergo rapid concerted evolution within and between arrays. Therefore, the rDNA ITS copies appear to be virtually identical and can sometimes be treated as a single gene. In this paper we examined ITS polymorphism within and among 13 diploid (A and C genomes), seven tetraploid (AB, AC and CC genomes) and four hexaploid (ACD genome) to infer the extent and direction of concerted evolution, and to reveal the phylogenetic and genome relationship among species of Avena. A total of 170 clones of the ITS1-5.8S-ITS2 fragment were sequenced to carry out haplotype and phylogenetic analysis. In addition, 111 Avena ITS sequences retrieved from GenBank were combined with 170 clones to construct a phylogeny and a network. We demonstrate the major divergence between the A and C genomes whereas the distinction among the A and B/D genomes was generally not possible. High affinity among the A(d) genome species A. damascena and the ACD genome species A. fatua was found, whereas the rest of the ACD genome hexaploids and the AACC tetraploids were highly affiliated with the A(l) genome diploid A. longiglumis. One of the AACC species A. murphyi showed the closest relationship with most of the hexaploid species. Both C(v) and C(p) genome species have been proposed as paternal donors of the C-genome carrying polyploids. Incomplete concerted evolution is responsible for the observed differences among different clones of a single Avena individual. The elimination of C-genome rRNA sequences and the resulting evolutionary inference of hexaploid species are discussed.

  10. Seasonal dynamics of bacterioplankton community structure in a eutrophic lake as determined by 5S rRNA analysis.


    Höfle, M G; Haas, H; Dominik, K


    Community structure of bacterioplankton was studied during the major growth season for phytoplankton (April to October) in the epilimnion of a temperate eutrophic lake (Lake Plusssee, northern Germany) by using comparative 5S rRNA analysis. Estimates of the relative abundances of single taxonomic groups were made on the basis of the amounts of single 5S rRNA bands obtained after high-resolution electrophoresis of RNA directly from the bacterioplankton. Full-sequence analysis of single environmental 5S rRNAs enabled the identification of single taxonomic groups of bacteria. Comparison of partial 5S rRNA sequences allowed the detection of changes of single taxa over time. Overall, the whole bacterioplankton community showed two to eight abundant (>4% of the total 5S rRNA) taxa. A distinctive seasonal succession was observed in the taxonomic structure of this pelagic community. A rather-stable community structure, with seven to eight different taxonomic units, was observed beginning in April during the spring phytoplankton bloom. A strong reduction in this diversity occurred at the beginning of the clear-water phase (early May), when only two to four abundant taxa were observed, with one taxon dominating (up to 72% of the total 5S rRNA). The community structure during summer stagnation (June and July) was characterized by frequent changes of different dominating taxa. During late summer, a dinoflagellate bloom (Ceratium hirudinella) occurred, with Comamonas acidovorans (beta-subclass of the class Proteobacteria) becoming the dominant bacterial species (average abundance of 43% of the total 5S rRNA). Finally, the seasonal dynamics of the community structure of bacterioplankton were compared with the abundances of other major groups of the aquatic food web, such as phyto- and zooplankton, revealing that strong grazing pressure by zooplankton can reduce microbial diversity substantially in pelagic environments.

  11. Molecular Systematic of Three Species of Oithona (Copepoda, Cyclopoida) from the Atlantic Ocean: Comparative Analysis Using 28S rDNA

    PubMed Central

    Cepeda, Georgina D.; Blanco-Bercial, Leocadio; Bucklin, Ann; Berón, Corina M.; Viñas, María D.


    Species of Oithona (Copepoda, Cyclopoida) are highly abundant, ecologically important, and widely distributed throughout the world oceans. Although there are valid and detailed descriptions of the species, routine species identifications remain challenging due to their small size, subtle morphological diagnostic traits, and the description of geographic forms or varieties. This study examined three species of Oithona (O. similis, O. atlantica and O. nana) occurring in the Argentine sector of the South Atlantic Ocean based on DNA sequence variation of a 575 base-pair region of 28S rDNA, with comparative analysis of these species from other North and South Atlantic regions. DNA sequence variation clearly resolved and discriminated the species, and revealed low levels of intraspecific variation among North and South Atlantic populations of each species. The 28S rDNA region was thus shown to provide an accurate and reliable means of identifying the species throughout the sampled domain. Analysis of 28S rDNA variation for additional species collected throughout the global ocean will be useful to accurately characterize biogeographical distributions of the species and to examine phylogenetic relationships among them. PMID:22558245

  12. Molecular systematic of three species of Oithona (Copepoda, Cyclopoida) from the Atlantic Ocean: comparative analysis using 28S rDNA.


    Cepeda, Georgina D; Blanco-Bercial, Leocadio; Bucklin, Ann; Berón, Corina M; Viñas, María D


    Species of Oithona (Copepoda, Cyclopoida) are highly abundant, ecologically important, and widely distributed throughout the world oceans. Although there are valid and detailed descriptions of the species, routine species identifications remain challenging due to their small size, subtle morphological diagnostic traits, and the description of geographic forms or varieties. This study examined three species of Oithona (O. similis, O. atlantica and O. nana) occurring in the Argentine sector of the South Atlantic Ocean based on DNA sequence variation of a 575 base-pair region of 28S rDNA, with comparative analysis of these species from other North and South Atlantic regions. DNA sequence variation clearly resolved and discriminated the species, and revealed low levels of intraspecific variation among North and South Atlantic populations of each species. The 28S rDNA region was thus shown to provide an accurate and reliable means of identifying the species throughout the sampled domain. Analysis of 28S rDNA variation for additional species collected throughout the global ocean will be useful to accurately characterize biogeographical distributions of the species and to examine phylogenetic relationships among them. PMID:22558245

  13. SSU rDNA Divergence in Planktonic Foraminifera: Molecular Taxonomy and Biogeographic Implications

    PubMed Central

    André, Aurore; Quillévéré, Frédéric; Morard, Raphaël; Ujiié, Yurika; Escarguel, Gilles; de Vargas, Colomban; de Garidel-Thoron, Thibault; Douady, Christophe J.


    The use of planktonic foraminifera in paleoceanography requires taxonomic consistency and precise assessment of the species biogeography. Yet, ribosomal small subunit (SSUr) DNA analyses have revealed that most of the modern morpho-species of planktonic foraminifera are composed of a complex of several distinct genetic types that may correspond to cryptic or pseudo-cryptic species. These genetic types are usually delimitated using partial sequences located at the 3′end of the SSUrDNA, but typically based on empirical delimitation. Here, we first use patristic genetic distances calculated within and among genetic types of the most common morpho-species to show that intra-type and inter-type genetic distances within morpho-species may significantly overlap, suggesting that genetic types have been sometimes inconsistently defined. We further apply two quantitative and independent methods, ABGD (Automatic Barcode Gap Detection) and GMYC (General Mixed Yule Coalescent) to a dataset of published and newly obtained partial SSU rDNA for a more objective assessment of the species status of these genetic types. Results of these complementary approaches are highly congruent and lead to a molecular taxonomy that ranks 49 genetic types of planktonic foraminifera as genuine (pseudo)cryptic species. Our results advocate for a standardized sequencing procedure allowing homogenous delimitations of (pseudo)cryptic species. On the ground of this revised taxonomic framework, we finally provide an integrative taxonomy synthesizing geographic, ecological and morphological differentiations that can occur among the genuine (pseudo)cryptic species. Due to molecular, environmental or morphological data scarcities, many aspects of our proposed integrative taxonomy are not yet fully resolved. On the other hand, our study opens up the potential for a correct interpretation of environmental sequence datasets. PMID:25119900

  14. [Variability of nuclear 18S-25S rDNA of Gentiana lutea L. in nature and in tissue culture in vitro].


    Mel'nyk, V M; Spiridonova, K V; Andrieiev, I O; Strashniuk, N M; Kunakh, V A


    18S-25S rDNA sequence in genomes of G. lutea plants from different natural populations and from tissue culture has been studied with blot-hybridization method. It was shown that ribosomal repeats are represented by the variants which differ for their size and for the presence of additional HindIII restriction site. Genome of individual plant usually possesses several variants of DNA repeats. Interpopulation variability according to their quantitative ratio and to the presence of some of them has been shown. Modifications of the range of rDNA repeats not exceeding intraspecific variability were observed in callus tissues in comparison with the plants of initial population. Non-randomness of genome modifications in the course of cell adaptation to in vitro conditions makes it possible to some extent to forecast these modifications in tissue culture.

  15. [18S-25S rDNA variation in tissue culture of some Gentiana L. species].


    Mel'nyk, V M; Andrieiev, I O; Spiridonova, K V; Strashniuk, N M; Kunakh, V A


    18S-25S rDNA of intact plants and tissue cultures of G. acaulis, G. punctata and G. lutea have been investigated by using blot-hybridization. The decrease of rDNA amount was found in the callus cultures as compared with the plants. In contrast to other species, G. lutea showed intragenome heterogeneity of rRNA genes as well as qualitative rDNA changes in tissue culture, in particular appearance of altered repeats. The relationship between the peculiarities of rRNA gene structure and their rearrangements in in vitro culture was suggested.

  16. High dynamics of rDNA cluster location in kissing bug holocentric chromosomes (Triatominae, Heteroptera).


    Panzera, Y; Pita, S; Ferreiro, M J; Ferrandis, I; Lages, C; Pérez, R; Silva, A E; Guerra, M; Panzera, F


    In this paper, we determine by fluorescent in situ hybridization the variability in the chromosomal location of 45S rDNA clusters in 38 species belonging to 7 genera of the Triatominae subfamily, using a triatomine-specific 18S rDNA probe. Our results show a striking variability at the inter- and intraspecific level, never reported so far in holocentric chromosomes, revealing the extraordinary genomic dynamics that occurred during the evolution in this group of insects. Our results also demonstrate that the chromosomal position of rDNA clusters is an important marker to disclose chromosomal differentiation in species karyotypically homogenous in their chromosome number.

  17. Characterization of the Complete Nuclear Ribosomal DNA Sequences of Paramphistomum cervi

    PubMed Central

    Zheng, Xu; Chang, Qiao-Cheng; Zhang, Yan; Tian, Si-Qin; Lou, Yan; Duan, Hong; Guo, Dong-Hui; Wang, Chun-Ren; Zhu, Xing-Quan


    Sequences of the complete nuclear ribosomal DNA (rDNA) gene from five individual Paramphistomum cervi were determined for the first time. The five complete rDNA sequences, which included the 18S rDNA, the internal transcribed spacer 1 (ITS1), the 5.8S rDNA, the internal transcribed spacer 2 (ITS2), the 28S rDNA, and the intergenic spacer (IGS) regions, had a length range of 8,493–10,221 bp. The lengths of the investigated 18S, ITS1, 5.8S, ITS2, and 28S rDNA sequences, which were 1,994 bp, 1,293 bp, 157 bp, 286 bp, and 4,186 bp, respectively, did not vary. However, the IGS rDNA sequences had a length range of 577–2,305 bp. The 5.8S and ITS-2 rDNA sequences had 100% identity among the five investigated samples, while the identities among the IGS had a range of 53.7–99.8%. A comparative analysis revealed that different types and numbers of repeats were found within each ITS1 and IGS region, which may be related to the length polymorphism of IGS. The phylogenetic position of P. cervi in Paramphistomatidae was analyzed based on the 18S rDNA sequences. These results will aid in studying the intra- and interspecific variation of the Paramphistomatidae and the systematics and phylogenetics of Digenea. PMID:25140347

  18. Release of ribosome-bound 5S rRNA upon cleavage of the phosphodiester bond between nucleotides A54 and A55 in 5S rRNA.


    Holmberg, L; Nygård, O


    Reticulocyte lysates contain ribosome-bound and free populations of 5S RNA. The free population is sensitive to nuclease cleavage in the internal loop B, at the phosphodiester bond connecting nucleotides A54 and A55. Similar cleavage sites were detected in 5S rRNA in 60S subunits and 80S ribosomes. However, 5S rRNA in reticulocyte polysomes is insensitive to cleavage unless ribosomes are salt-washed. This suggests that a translational factor protects the backbone surrounding A54 from cleavage in polysomes. Upon nuclease treatment of mouse 60S subunits or reticulocyte lysates a small population of ribosomes released its 5S rRNA together with ribosomal protein L5. Furthermore, rRNA sequences from 5.8S, 28S and 18S rRNA were released. In 18S rRNA the sequences mainly originate from the 630 loop and stem (helix 18) in the 5' domain, whereas in 28S rRNA a majority of fragments is derived from helices 47 and 81 in domains III and V, respectively. We speculate that this type of rRNA-fragmentation may mimic a ribosome degradation pathway.


    EPA Science Inventory

    In a previously described study, only 15% of the bacterial strains isolated from a water distribution system (WDS) grown on R2A agar were identifiable using fatty acid methyl esthers (FAME) profiling. The lack of success was attributed to the use of fatty acid databases of bacter...

  20. How well do ITS rDNA sequences differentiate species of true morels (Morchella)?

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Arguably more mycophiles hunt true morels (Morchella) during their brief fruiting season each spring in the Northern Hemisphere than any other wild edible fungus. Concerns about overharvesting by individual collectors and commercial enterprises make it essential that science-based management practic...


    EPA Science Inventory

    Turkey feces are an important source of fecal waste in the United States. With the exception of isolated studies on bacterial pathogens, little is known about the type of bacteria inhabiting the turkey gut. In order to understand the microbial diversity and functional genes assoc...

  2. Chromosomal localization and characterization of rDNA loci in the Brassica A and C genomes.


    Snowdon, R J; Köhler, W; Köhler, A


    Using fluorescence in situ hybridization, we located ribosomal DNA loci on prometaphase chromosomes of the diploid species Brassica rapa and Brassica oleracea and their amphidiploid Brassica napus. Based on comparisons of chromosome morphology and hybridization patterns, we characterized the individual B. napus rDNA loci according to their presumed origins in the Brassica A and C genomes. As reported in other studies, the sum of rDNA loci observed on B. rapa (AA genome) and B. oleracea (CC genome) chromosomes was one greater than the total number of loci seen in their amphidiploid B. napus (AACC). Evidence is presented that this reduction in B. napus rDNA locus number results from the loss of the smallest A genome rDNA site in the amphidiploid.

  3. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).


    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A


    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA. PMID:26853884

  4. FISH and AgNor mapping of the 45S and 5S rRNA genes in wild and cultivated species of Capsicum (Solananceae).


    Scaldaferro, Marisel A; da Cruz, M Victoria Romero; Cecchini, Nicolás M; Moscone, Eduardo A


    Chromosome number and position of rDNA were studied in 12 wild and cultivated species of the genus Capsicum with chromosome numbers x = 12 and x = 13 (22 samples). For the first time in these species, the 5S and 45S rRNA loci were localized and physically mapped using two-color fluorescence in situ hybridization and AgNOR banding. We focused on the comparison of the results obtained with both methods with the aim of accurately revealing the real functional rRNA genes. The analyzes were based on a previous work that reported that the 18S-5.8S-25S loci mostly coincide with GC-rich heterochromatic regions and likely have given rise to satellite DNAs, which are not active genes. These data show the variability of rDNA within karyotypes of the genus Capsicum, providing anchor points for (comparative) genetic maps. In addition, the obtained information might be useful for studies on evolution of repetitive DNA.

  5. Contrasting evolution of a satellite DNA and its ancestral IGS rDNA in Phaseolus (Fabaceae).


    Almeida, Cícero; Fonsêca, Artur; dos Santos, Karla Galvão Bezerra; Mosiolek, Magdalena; Pedrosa-Harand, Andrea


    CC4 is a satellite DNA from common bean (Phaseolus vulgaris L.) that is similar to its intergenic spacer (IGS) rDNA. CC4 was originally hypothesized to be an old, fast evolving satellite family that has invaded common bean rDNA. To test this hypothesis and contribute to the understanding of IGS-like satellite DNA evolution, we have investigated its distribution in the genus Phaseolus and related species. CC4 was cloned and used as probe for Southern blot and FISH experiments. CC4 was observed as an independent satellite in common bean, forming two to three major and a few minor pericentromeric clusters. In Phaseolus coccineus, CC4 was present in four major clusters, also not co-localized with the 45S rDNA sites. Remarkably, in the less related species of the genus, signals were detected co-localized with the 45S rDNA sites, but co-localization was not observed in the species where CC4 is present as an independent satellite. No signal was detected in species from related genera. Altogether, the data suggest that CC4 has originated from the IGS rDNA in the P. vulgaris-P. coccineus lineage and has evolved slower than the IGS rDNA from this lineage.

  6. Contrasting evolution of a satellite DNA and its ancestral IGS rDNA in Phaseolus (Fabaceae).


    Almeida, Cícero; Fonsêca, Artur; dos Santos, Karla Galvão Bezerra; Mosiolek, Magdalena; Pedrosa-Harand, Andrea


    CC4 is a satellite DNA from common bean (Phaseolus vulgaris L.) that is similar to its intergenic spacer (IGS) rDNA. CC4 was originally hypothesized to be an old, fast evolving satellite family that has invaded common bean rDNA. To test this hypothesis and contribute to the understanding of IGS-like satellite DNA evolution, we have investigated its distribution in the genus Phaseolus and related species. CC4 was cloned and used as probe for Southern blot and FISH experiments. CC4 was observed as an independent satellite in common bean, forming two to three major and a few minor pericentromeric clusters. In Phaseolus coccineus, CC4 was present in four major clusters, also not co-localized with the 45S rDNA sites. Remarkably, in the less related species of the genus, signals were detected co-localized with the 45S rDNA sites, but co-localization was not observed in the species where CC4 is present as an independent satellite. No signal was detected in species from related genera. Altogether, the data suggest that CC4 has originated from the IGS rDNA in the P. vulgaris-P. coccineus lineage and has evolved slower than the IGS rDNA from this lineage. PMID:23050694

  7. Performance of 16s rDNA Primer Pairs in the Study of Rhizosphere and Endosphere Bacterial Microbiomes in Metabarcoding Studies

    PubMed Central

    Beckers, Bram; Op De Beeck, Michiel; Thijs, Sofie; Truyens, Sascha; Weyens, Nele; Boerjan, Wout; Vangronsveld, Jaco


    Next-generation sequencing technologies have revolutionized the methods for studying microbial ecology by enabling high-resolution community profiling. However, the use of these technologies in unraveling the plant microbiome remains challenging. Many bacterial 16S rDNA primer pairs also exhibit high affinity for non-target DNA such as plastid (mostly chloroplast) DNA and mitochondrial DNA. Therefore, we experimentally tested a series of commonly used primers for the analysis of plant-associated bacterial communities using 454 pyrosequencing. We evaluated the performance of all selected primer pairs in the study of the bacterial microbiomes present in the rhizosphere soil, root, stem and leaf endosphere of field-grown poplar trees (Populus tremula × Populus alba) based on (a) co-amplification of non-target DNA, (b) low amplification efficiency for pure chloroplast DNA (real-time PCR), (c) high retrieval of bacterial 16S rDNA, (d) high operational taxonomic unit (OTU) richness and Inverse Simpson diversity and (e) taxonomic assignment of reads. Results indicate that experimental evaluation of primers provide valuable information that could contribute in the selection of suitable primer pairs for 16S rDNA metabarcoding studies in plant-microbiota research. Furthermore, we show that primer pair 799F-1391R outperforms all other primer pairs in our study in the elimination of non-target DNA and retrieval of bacterial OTUs. PMID:27242686

  8. Phylogeny of coral-inhabiting barnacles (Cirripedia; Thoracica; Pyrgomatidae) based on 12S, 16S and 18S rDNA analysis.


    Simon-Blecher, N; Huchon, D; Achituv, Y


    The traditional phylogeny of the coral-inhabiting barnacles, the Pyrgomatidae, is based on morphological characteristics, mainly of the hard parts. It has been difficult to establish the phylogenetic relationships among Pyrgomatidae because of the apparent convergence of morphological characteristics, and due to the use of non-cladistic systematics, which emphasize ancestor-descendant relationships rather than sister-clade relationships. We used partial sequences of two mithochondrial genes, 12S rDNA and 16S rDNA, and a nuclear gene, 18S rDNA, to infer the molecular phylogeny of the pyrgomatids. Our phylogenetic results allowed us to reject previous classifications of Pyrgomatidae based on morphological characteristics. Our results also suggested the possibility of paraphyly of the Pyrgomatidae. The hydrocoral barnacle Wanella is not found on the same clade as the other pyrgomatids, but rather, with the free-living balanids. The basal position of Megatrema and Ceratoconcha is supported. The archeaobalanid Armatobalanus is grouped with Cantellius at the base of the Indo-Pacific pyrgomatines. Fusion of the shell plate and modification of the opercular valves are homoplasious features that occurred more than three times on different clades. The monophyly of the "Savignium" group, comprising four nominal genera, is also not supported, and the different taxa are placed on different clades.

  9. The establishment of species-specific primers for the molecular identification of ten stored-product psocids based on ITS2 rDNA

    PubMed Central

    Zhao, Zi-Hua; Cui, Bing-Yi; Li, Zhi-Hong; Jiang, Fan; Yang, Qian-Qian; Kučerová, Zuzana; Stejskal, Václav; Opit, George; Cao, Yang; Li, Fu-Jun


    Psocids are important stored product pests found worldwide that can be spread through grain trade. Most stored-product psocids, including eggs, nymphs, and adults, are very small (~1 mm) and difficult to identify morphologically. Here, we collected 10 economically important stored-product Liposcelis spp. psocids (L. bostrychophila, L. entomophila, L. decolor, L. paeta, L. brunnea, L. corrodens, L. mendax, L. rufa, L. pearmani, and L. tricolor) from 35 geographical locations in 5 countries (China, Czech Republic, Denmark, Germany, and the United States). The ITS2 rDNA gene was extracted and sequenced. The interspecific genetic distance of the stored-product psocids was significantly higher than the intraspecific genetic distance according to the barcoding gap analysis. Ten pairs of species-specific primers based on the ITS2 rDNA were developed for psocid identification. The sensitivity estimation indicated that the species-specific primers could correctly amplify the target ITS2 gene and successfully identify psocids at 1.0 ng/mL. Additionally, these species-specific primers could quantify specificity and identify 10 stored-product psocids; this approach could also be used to accurately identify other stored-product psocids. This work provides a practical approach for the precise examination of 10 stored-product psocid species and also contributes to the development of an identification method using ITS2 rDNA. PMID:26880378

  10. Performance of 16s rDNA Primer Pairs in the Study of Rhizosphere and Endosphere Bacterial Microbiomes in Metabarcoding Studies.


    Beckers, Bram; Op De Beeck, Michiel; Thijs, Sofie; Truyens, Sascha; Weyens, Nele; Boerjan, Wout; Vangronsveld, Jaco


    Next-generation sequencing technologies have revolutionized the methods for studying microbial ecology by enabling high-resolution community profiling. However, the use of these technologies in unraveling the plant microbiome remains challenging. Many bacterial 16S rDNA primer pairs also exhibit high affinity for non-target DNA such as plastid (mostly chloroplast) DNA and mitochondrial DNA. Therefore, we experimentally tested a series of commonly used primers for the analysis of plant-associated bacterial communities using 454 pyrosequencing. We evaluated the performance of all selected primer pairs in the study of the bacterial microbiomes present in the rhizosphere soil, root, stem and leaf endosphere of field-grown poplar trees (Populus tremula × Populus alba) based on (a) co-amplification of non-target DNA, (b) low amplification efficiency for pure chloroplast DNA (real-time PCR), (c) high retrieval of bacterial 16S rDNA, (d) high operational taxonomic unit (OTU) richness and Inverse Simpson diversity and (e) taxonomic assignment of reads. Results indicate that experimental evaluation of primers provide valuable information that could contribute in the selection of suitable primer pairs for 16S rDNA metabarcoding studies in plant-microbiota research. Furthermore, we show that primer pair 799F-1391R outperforms all other primer pairs in our study in the elimination of non-target DNA and retrieval of bacterial OTUs. PMID:27242686

  11. Genetic diversity of microbial eukaryotes in anoxic sediment around fumaroles on a submarine caldera floor based on the small-subunit rDNA phylogeny.


    Takishita, Kiyotaka; Miyake, Hiroshi; Kawato, Masaru; Maruyama, Tadashi


    Recent culture-independent molecular analyses have shown the diversity and ecological importance of microbial eukaryotes (protists) in various marine environments. In the present study we directly extracted DNA from anoxic sediment near active fumaroles on a submarine caldera floor at a depth of 200 m and constructed genetic libraries of PCR-amplified eukaryotic small-subunit (SSU) rDNA. By sequencing cloned SSU rDNA of the libraries and their phylogenetic analyses, it was shown that most sequences have affiliations with known major lineages of eukaryotes (Cercozoa, Alveolata, stramenopiles and Opisthokonta). In particular, some sequences were closely related to those of representatives of eukaryotic parasites, such as Phagomyxa and Cryothecomonas of Cercozoa, Pirsonia of stramenopiles and Ichthyosporea of Opisthokonta, although it is not clear whether the organisms occur in free-living or parasitic forms. In addition, other sequences did not seem to be related to any described eukaryotic lineages suggesting the existence of novel eukaryotes at a high-taxonomic level in the sediment. The community composition of microbial eukaryotes in the sediment we surveyed was different overall from those of other anoxic marine environments previously investigated. PMID:15744454

  12. Genetic diversity of microbial eukaryotes in anoxic sediment around fumaroles on a submarine caldera floor based on the small-subunit rDNA phylogeny.


    Takishita, Kiyotaka; Miyake, Hiroshi; Kawato, Masaru; Maruyama, Tadashi


    Recent culture-independent molecular analyses have shown the diversity and ecological importance of microbial eukaryotes (protists) in various marine environments. In the present study we directly extracted DNA from anoxic sediment near active fumaroles on a submarine caldera floor at a depth of 200 m and constructed genetic libraries of PCR-amplified eukaryotic small-subunit (SSU) rDNA. By sequencing cloned SSU rDNA of the libraries and their phylogenetic analyses, it was shown that most sequences have affiliations with known major lineages of eukaryotes (Cercozoa, Alveolata, stramenopiles and Opisthokonta). In particular, some sequences were closely related to those of representatives of eukaryotic parasites, such as Phagomyxa and Cryothecomonas of Cercozoa, Pirsonia of stramenopiles and Ichthyosporea of Opisthokonta, although it is not clear whether the organisms occur in free-living or parasitic forms. In addition, other sequences did not seem to be related to any described eukaryotic lineages suggesting the existence of novel eukaryotes at a high-taxonomic level in the sediment. The community composition of microbial eukaryotes in the sediment we surveyed was different overall from those of other anoxic marine environments previously investigated.

  13. Morphology and 18S rDNA of Henneguya gurlei (Myxosporea) from Ameiurus nebulosus (Siluriformes) in North Carolina

    USGS Publications Warehouse

    Iwanowicz, L.R.; Iwanowicz, D.D.; Pote, L.M.; Blazer, V.S.; Schill, W.B.


    Henneguya gurlei was isolated from Ameiurus nebulosus captured in North Carolina and redescribed using critical morphological features and 18S small-subunit ribosomal RNA (SSU rDNA) gene sequence. Plasmodia are white, spherical, or subspherical, occur in clusters, measure up to 1.8 mm in length, and are located on the dorsal, pectoral, and anal fins. Histologically, plasmodia are located in the dermis and subdermally, and the larger cysts disrupt the melanocyte pigment layer. The spore body is lanceolate, 18.2 ?? 0.3 ??m (range 15.7-20.3) in length, and 5.4 ?? 0.1 ??m (range 3.8-6.1) in width in valvular view. The caudal appendages are 41.1 ?? 1.1 ??m (range 34.0-49.7) in length. Polar capsules are pyriform and of unequal size. The longer polar capsule measures 6.2 ?? 0.1 ??m (range 5.48-7.06), while the shorter is 5.7 ?? 0.1 ??m (range 4.8-6.4) in length. Polar capsule width is 1.2 ?? 0.03 ??m (range 1.0-1.54). The total length of the spore is 60.9 ?? 1.2 ??m (range 48.7-68.5). Morphologically, this species is similar to other species of Henneguya that are known to infect ictalurids. Based on SSU rDNA sequences, this species is most closely related to H. exilis and H. ictaluri, which infect Ictalurus punctatus. ?? American Society of Parasitologists 2008.

  14. Specific PCR for Myxobolus arcticus SSU rDNA in juvenile sockeye salmon Oncorhynchus nerka from British Columbia, Canada.


    Mahony, Amelia; Fraser, Sarah; Groman, David B; Jones, Simon R M


    A PCR for the specific detection of the salmon brain parasite Myxobolus arcticus (Pugachev and Khokhlov, 1979) was developed using primers designed to amplify a 1363 base pair fragment of the small subunit rDNA. The assay did not amplify DNA from 5 other Myxobolus species or from 7 other myxozoan species belonging to 5 other genera. For juvenile sockeye salmon Oncorhynchus nerka (Walbaum) collected from Chilko Lake, British Columbia (BC), Canada, in 2011, the prevalence by PCR was 96%, in contrast to 71% by histological examination of brain tissue. In 2010, the histological prevalence was 52.5%. Sequence identity between M. arcticus from Chilko Lake and other sites in BC ranged from 99.7 to 99.8% and was 99.6% for a Japanese sequence. In contrast, an M. arcticus sequence from Norway shared 95.3% identity with the Chilko Lake sequence, suggesting misidentification of the parasite. Chilko Lake sockeye salmon were previously reported free of infection with M. arcticus, and more research is required to understand the processes involved in the local and global dispersion of this parasite. PMID:26119303

  15. Cytogenetic mapping of 5S and 18S rRNAs and H3 histone genes in 4 ancient Proscopiidae grasshopper species: contribution to understanding the evolutionary dynamics of multigene families.


    Cabral-de-Mello, D C; Martins, C; Souza, M J; Moura, R C


    This paper reports on the chromosomal location of 18S rRNA, 5S rRNA and H3 histone multigene families in 4 species of a relatively ancient and diversified group of grasshoppers belonging to the family Proscopiidae. The 5S rRNA and H3 histone genes were highly conserved in the number of sites and chromosomal position in the 4th chromosome pair in all species analyzed, whereas the 18S rRNA genes showed slightly more variation because they were present on one or 2 chromosome pairs, depending on the species. The 5S and 18S rRNA gene families occurred in different chromosomes; in contrast, H3 histone and 5S rRNA genes co-localized in the same chromosomal position, with an apparently interspersed organization. Considering that the Proscopiidae family is a relatively ancient group compared with the Acrididae family, the association of the H3 histone and 5S rRNA multigene families can represent a basal condition for grasshoppers, although more research is needed on other representatives of this insect group to confirm this statement. The presence of such an association of 5S rDNA and H3 histone in mussels and arthropods (beetles, grasshoppers and crustaceans) suggests that this linked configuration could represent an ancestral pattern for invertebrates. These results provide new insights into the understanding of the genome organization and the evolution of multigene families in grasshoppers and in insects as a whole.

  16. Repumping and spectroscopy of laser-cooled Sr atoms using the (5s5p)3P2-(5s4d)3D2 transition

    NASA Astrophysics Data System (ADS)

    Mickelson, P. G.; Martinez de Escobar, Y. N.; Anzel, P.; De Salvo, B. J.; Nagel, S. B.; Traverso, A. J.; Yan, M.; Killian, T. C.


    We describe repumping and spectroscopy of laser-cooled strontium (Sr) atoms using the (5s5p)3P2-(5s4d)3D2 transition. Atom number in a magneto-optical trap is enhanced by driving this transition because Sr atoms that have decayed into the (5s5p)3P2 dark state are repumped back into the (5s2)1S0 ground state. Spectroscopy of 84Sr, 86Sr, 87Sr and 88Sr improves the value of the (5s5p)3P2-(5s4d)3D2 transition frequency and determines the isotope shifts for the transition accurately enough to guide laser-cooling experiments with less abundant isotopes.

  17. 18S rDNA analysis of alkenone-producing haptophyte(s) preserved in surface sediments of Lake Toyoni, Japan

    NASA Astrophysics Data System (ADS)

    McColl, J. L.; Couto, J.; Bendle, J. A.; Henderson, A. C.; Seki, O.; Phoenix, V. R.; Toney, J. L.


    Alkenones (long chain ketones) are readily preserved in sedimentary archives and have the potential to provide quantitative reconstructions of past water temperature. Alkenones are produced by a limited number of haptophyte algae in the marine and also some lacustrine systems. However, lakes are heterogeneous: an individual lake will have a unique combination of ecological conditions, haptophyte species and seasonal alkenone production that contributes to the sedimentary record. Haptophyte algae species have different sensitivities to temperature; therefore identifying the alkenone producer(s) prior to down-core temperature reconstructions is critical before selecting the most appropriate temperature calibration. We present a study from Lake Toyoni, a freshwater lake in Hokkaido, Japan that has alkenones preserved in surface sediments. The aim of this study is to identify the alkenone producer(s) within the lake using 18S rDNA analyses. Preserved rDNA of planktonic phototrophic algae was extracted from surface sediments of Lake Toyoni and phylogenetic analyses of the rDNA sequences suggest alkenones are produced by a single haptophyte within the class Prymnesiophyceae (order Isochrysidales). The Lake Toyoni alkenone-producer shares a distinct phylotype with a haptophyte reported from water filter samples collected in Lake BrayaSø, Greenland (D'Andrea et al., 2006). Similarity between the 18S rDNA sequences from Lake Toyoni and Lake BrayaSø provides a basis for applying (and updating) the Greenland lake temperature calibration. Applying this temperature calibration (T°C = 40.8 [UK37] + 31.8, R2=0.96; n=34) to the surface sediment alkenone unsaturation index from Lake Toyoni gives an estimated lake surface temperature (LST) of 8°C. This is in line with observed LST at Lake Toyoni, which ranges between 7 - 22°C (Apr 2011 to Nov 2011). The occurrence and identification of a single alkenone producer in Lake Toyoni means problems posed by a mixture of haptophytes in

  18. Sequence and structure of the extrachromosomal palindrome encoding the ribosomal RNA genes in Dictyostelium.


    Sucgang, Richard; Chen, Guokai; Liu, Wen; Lindsay, Ryan; Lu, Jing; Muzny, Donna; Shaulsky, Gad; Loomis, William; Gibbs, Richard; Kuspa, Adam


    Ribosomal RNAs (rRNAs) are encoded by multicopy families of identical genes. In Dictyostelium and other protists, the rDNA is carried on extrachromosomal palindromic elements that comprise up to 20% of the nuclear DNA. We present the sequence of the 88 kb Dictyostelium rDNA element, noting that the rRNA genes are likely to be the only transcribed regions. By interrogating a library of ordered YAC clones, we provide evidence for a chromosomal copy of the rDNA on chromosome 4. This locus may provide master copies for the stable transmission of the extrachromosomal elements. The extrachromosomal elements were also found to form chromosome-sized clusters of DNA within nuclei of nocodazole-treated cells arrested in mitosis. These clusters resemble true chromosomes and may allow the efficient segregation of the rDNA during mitosis. These rDNA clusters may also explain the cytological observations of a seventh chromosome in this organism.

  19. Investigating bacterial populations in styrene-degrading biofilters by 16S rDNA tag pyrosequencing.


    Portune, Kevin J; Pérez, M Carmen; Álvarez-Hornos, F Javier; Gabaldón, Carmen


    Microbial biofilms are essential components in the elimination of pollutants within biofilters, yet still little is known regarding the complex relationships between microbial community structure and biodegradation function within these engineered ecosystems. To further explore this relationship, 16S rDNA tag pyrosequencing was applied to samples taken at four time points from a styrene-degrading biofilter undergoing variable operating conditions. Changes in microbial structure were observed between different stages of biofilter operation, and the level of styrene concentration was revealed to be a critical factor affecting these changes. Bacterial genera Azoarcus and Pseudomonas were among the dominant classified genera in the biofilter. Canonical correspondence analysis (CCA) and correlation analysis revealed that the genera Brevundimonas, Hydrogenophaga, and Achromobacter may play important roles in styrene degradation under increasing styrene concentrations. No significant correlations (P > 0.05) could be detected between biofilter operational/functional parameters and biodiversity measurements, although biological heterogeneity within biofilms and/or technical variability within pyrosequencing may have considerably affected these results. Percentages of selected bacterial taxonomic groups detected by fluorescence in situ hybridization (FISH) were compared to results from pyrosequencing in order to assess the effectiveness and limitations of each method for identifying each microbial taxon. Comparison of results revealed discrepancies between the two methods in the detected percentages of numerous taxonomic groups. Biases and technical limitations of both FISH and pyrosequencing, such as the binding of FISH probes to non-target microbial groups and lack of classification of sequences for defined taxonomic groups from pyrosequencing, may partially explain some differences between the two methods.

  20. Development of a PCR assay based on the 16S-23S rDNA internal transcribed spacer for identification of strictly anaerobic bacterium Zymophilus.


    Felsberg, Jurgen; Jelínková, Markéta; Kubizniaková, Petra; Matoulková, Dagmar


    PCR-primers were designed for identification of strictly anaerobic bacteria of the genus Zymophilus based on genus-specific sequences of the 16S-23S rDNA internal transcribed spacer region. The specificity of the primers was tested against 37 brewery-related non-target microorganisms that could potentially occur in the same brewery specimens. None DNA was amplified from any of the non-Zymophilus strains tested including genera from the same family (Pectinatus, Megasphaera, Selenomonas), showing thus 100% specificity. PCR assay developed in this study allows an extension of the spectra of detected beer spoilage microorganisms in brewery laboratories. PMID:25725268

  1. Basic cytogenetics and physical mapping of 5S and 18S ribosomal genes in Hoplias malabaricus (Osteichthyes, Characiformes, Erythrinidae) from isolated natural lagoons: a conserved karyomorph along the Iguaçu river basin.


    Gemi, Gisele; Lui, Roberto Laridondo; Treco, Fernando Rodrigo; Paiz, Leonardo Marcel; Moresco, Rafaela Maria; Margarido, Vladimir Pavan


    Erythrinidae include Neotropical teleost fish that are widely distributed in South America. Hoplias Gill, 1903 include two large groups: H. malabaricus Bloch, 1794 and H. lacerdae Miranda Ribeiro, 1908. Hoplias malabaricus is characterized by remarkable karyotype diversity, with some karyomorphs widely distributed geographically while others are more restricted to certain river basins. Cytogenetic analyzes were performed in a population of Hoplias malabaricus from the Wildlife Refuge of Campos de Palmas, the Iguaçu River basin. The specimens showed diploid number of 42 chromosomes (24m+18sm) without differentiated sex chromosomes system. The impregnation by silver nitrate showed multiple AgNORs. Seven pairs (4, 7, 10, 13, 16, 20 and 21) carrying 18S rDNA were detected by FISH. Heterochromatin was verified in the centromeric and pericentromeric region of most chromosomes and the terminal region of some pairs. FISH with 5S rDNA probes showed two chromosome pairs carrying these sites in the interstitial region (8 and 14). The data obtained in this study are similar to those found for two other populations of H. malabaricus already studied in the basin of the Iguaçu River, confirming the hypothesis that this species is natural, not having been introduced, as well as having an intrinsic characteristic, such as the largest number of sites of 18S rDNA.

  2. Evolutionary relationships between 15 Plasmodium species from new and old world primates (including humans): an 18S rDNA cladistic analysis.


    Leclerc, M C; Hugot, J P; Durand, P; Renaud, F


    We present a new phylogenetic analysis of 15 primate Plasmodium species based on 18S rDNA sequences including new sequences of Plasmodium coatneyi, P. fieldi, P. gonderi, P. hylobati and P. simium. The results are discussed in the context of the parasite host species and their geographical distribution. Contrary to other phylogenies constructed with this 18S rDNA molecule, we observed that the topology of phylogenetic trees was not affected either by the quality of the nucleotide matrices, or by the species present in the outgroup. This analysis showed the following. (1) The polyphyly of human Plasmodium is confirmed. (2) The monophyly of Plasmodium from Old World monkeys is confirmed by the new added sequences and P. gonderi, an African species, possibly could be at the root of this group. (3) The most parsimonious biogeographical hypothesis is that P. vivax originated in Asia; thus, its related species P. simium appears to be derived through a transfer from the human P. vivax to New World monkey species in South America. (4) Sampling efforts of non-human primate Plasmodium could permit improvement of the knowledge of primate Plasmodium phylogeny and also consideration of the risks of malaria emergence from monkey reservoirs.

  3. D5S351 and D5S1414 located at the spinal muscular atrophy critical region represent novel informative markers in the Iranian population

    PubMed Central

    Sedghi, Maryam; Vallian, Sadeq


    Spinal muscular atrophy (SMA) is a degenerative neuromuscular disease associated with progressive symmetric weakness and atrophy of the limb muscles. In view of the involvement of numerous point mutations and deletions associated with the disease, the application of polymorphic markers flanking the SMA critical region could be valuable in molecular diagnosis of the disease. In the present study, D5S351 and D5S1414 polymorphic markers located at the SMA critical region in the Iranian populations were characterized. Genotyping of the markers indicated the presence of six and nine different alleles for D5S351 and D5S1414, respectively. Haplotype frequency estimation in 25 trios families and 75 unrelated individuals indicated the presence of six informative haplotypes with frequency higher than 0.05 in the studied population. Furthermore, the D′ coefficient and the χ2 value for D5S351 and D5S1414 markers revealed the presence of linkage disequilibrium between the two markers in the Iranians. These data suggested that D5S351 and D5S1414 could be suggested as informative markers for linkage analysis and molecular diagnosis of SMA in the Iranian population. PMID:26693404

  4. B chromosome in the beetle Coprophanaeus cyanescens (Scarabaeidae): emphasis in the organization of repetitive DNA sequences

    PubMed Central


    Background To contribute to the knowledge of coleopteran cytogenetics, especially with respect to the genomic content of B chromosomes, we analyzed the composition and organization of repetitive DNA sequences in the Coprophanaeus cyanescens karyotype. We used conventional staining and the application of fluorescence in situ hybridization (FISH) mapping using as probes C0t-1 DNA fraction, the 18S and 5S rRNA genes, and the LOA-like non-LTR transposable element (TE). Results The conventional analysis detected 3 individuals (among 50 analyzed) carrying one small metacentric and mitotically unstable B chromosome. The FISH analysis revealed a pericentromeric block of C0t-1 DNA in the B chromosome but no 18S or 5S rDNA clusters in this extra element. Using the LOA-like TE probe, the FISH analysis revealed large pericentromeric blocks in eight autosomal bivalents and in the B chromosome, and a pericentromeric block extending to the short arm in one autosomal pair. No positive hybridization signal was observed for the LOA-like element in the sex chromosomes. Conclusions The results indicate that the origin of the B chromosome is associated with the autosomal elements, as demonstrated by the hybridization with C0t-1 DNA and the LOA-like TE. The present study is the first report on the cytogenetic mapping of a TE in coleopteran chromosomes. These TEs could have been involved in the origin and evolution of the B chromosome in C. cyanescens. PMID:23131070

  5. Radiative lifetime of the 3s3p exp 3(exp 5 S sub 2 exp 0) metastable level of P(+)

    NASA Technical Reports Server (NTRS)

    Calamai, Anthony G.; Han, Xiaofeng; Parkinson, William H.


    The present experimental and theoretical results for the radiative lifetime of the 3s3p exp 3(exp 5 S sub 2 exp 0) metastable level of P(+) encompass an experimental determination of the (exp 5 S sub 2 exp 0) lifetime which represents the first measured lifetime of a low charge-state ion in the Si I sequence. This constitutes a fundamental test of the theoretical methods used to determine transition possibilities for intercombination lines involving this level, and suggests that theoretical techniques used to determine such transition probabilities in low-Z species of the Si I isoelectronic sequence should be reevaluated.

  6. In β-actin knockouts, epigenetic reprogramming and rDNA transcription inactivation lead to growth and proliferation defects.


    Almuzzaini, Bader; Sarshad, Aishe A; Rahmanto, Aldwin S; Hansson, Magnus L; Von Euler, Anne; Sangfelt, Olle; Visa, Neus; Farrants, Ann-Kristin Östlund; Percipalle, Piergiorgio


    Actin and nuclear myosin 1 (NM1) are regulators of transcription and chromatin organization. Using a genome-wide approach, we report here that β-actin binds intergenic and genic regions across the mammalian genome, associated with both protein-coding and rRNA genes. Within the rDNA, the distribution of β-actin correlated with NM1 and the other subunits of the B-WICH complex, WSTF and SNF2h. In β-actin(-/-) mouse embryonic fibroblasts (MEFs), we found that rRNA synthesis levels decreased concomitantly with drops in RNA polymerase I (Pol I) and NM1 occupancies across the rRNA gene. Reintroduction of wild-type β-actin, in contrast to mutated forms with polymerization defects, efficiently rescued rRNA synthesis underscoring the direct role for a polymerization-competent form of β-actin in Pol I transcription. The rRNA synthesis defects in the β-actin(-/-) MEFs are a consequence of epigenetic reprogramming with up-regulation of the repressive mark H3K4me1 (monomethylation of lys4 on histone H3) and enhanced chromatin compaction at promoter-proximal enhancer (T0 sequence), which disturb binding of the transcription factor TTF1. We propose a novel genome-wide mechanism where the polymerase-associated β-actin synergizes with NM1 to coordinate permissive chromatin with Pol I transcription, cell growth, and proliferation.-Almuzzaini, B., Sarshad, A. A. , Rahmanto, A. S., Hansson, M. L., Von Euler, A., Sangfelt, O., Visa, N., Farrants, A.-K. Ö., Percipalle, P. In β-actin knockouts, epigenetic reprogramming and rDNA transcription inactivation lead to growth and proliferation defects.

  7. (Cryptic) sex in the microsporidian Nosema granulosis--evidence from parasite rDNA and host mitochondrial DNA.


    Krebes, Lukas; Zeidler, Lisza; Frankowski, Jens; Bastrop, Ralf


    Microsporidia are single-celled, intracellular eukaryotes that parasitise a wide range of animals. The Nosema/Vairimorpha group includes some putative asexual species, and asexuality is proposed to have originated multiple times from sexual ancestors. Here, we studied the variation in the ribosomal DNA (rDNA) of 14 isolates of the presumed apomictic and vertically transmitted Nosema granulosis to evaluate its sexual status. The analysed DNA fragment contained a part of the small-subunit ribosomal gene (SSU) and the entire intergenic spacer (IGS). The mitochondrial cox1 gene of the host Gammarus duebeni (Crustacea) was analysed to temporally calibrate the system and to test the expectation of cophylogeny of host and parasite genealogies. Genetic variability of the SSU gene was very low within and between the isolates. In contrast, intraisolate (within a single host) variability of the IGS felt in two categories, because 12 isolates possess a very high IGS genetic diversity and two isolates were almost invariable in the IGS. This difference suggests variable models of rDNA evolution involving birth-and-death and unexpectedly concerted evolution. An alternative explanation could be a likewise unattended mixed infection of host individuals by more than one parasite strain. Despite considerable genetic divergence between associated host mitochondrial haplotypes, some N. granulosis 'IGS populations' seem not to belong to different gene pools; the relevant tests failed to show significant differences between populations. A set of recombinant IGS sequences made our data incompatible with the model of a solely maternally inherited, asexual species. In line with recent reports, our study supports the hypothesis that some assumed apomictic Microsporidia did not entirely abstain from the evolutionary advantages of sex. In addition, the presented data indicate that horizontal transmission may occur occasionally. This transmission mode could be a survival strategy of N

  8. High penetrance of a pan-canina type rDNA family in intersection Rosa hybrids suggests strong selection of bivalent chromosomes in the section Caninae.


    Crhak Khaitova, Lucie; Werlemark, Gun; Kovarikova, Alena; Nybom, Hilde; Kovarik, Ales


    All dogroses (Rosa sect. Caninae) are characterized by the peculiar canina meiosis in which genetic material is unevenly distributed between female and male gametes. The pan-canina rDNA family (termed beta) appears to be conserved in all dogroses analyzed so far. Here, we have studied rDNAs in experimental hybrids obtained from open pollination of F1 plants derived from 2 independent intersectional crosses between the pentaploid dogrose species (2n = 5x = 35) Rosa rubiginosa as female parent (producing 4x egg cells due to the unique asymmetrical canina meiosis) and the tetraploid (2n = 4x = 28) garden rose R. hybrida 'André Brichet' as male parent (producing 2x pollen after normal meiosis). We analyzed the structure of rDNA units by molecular methods [CAPS and extensive sequencing of internal transcribed spacers (ITS)] and determined the number of loci on chromosomes by FISH. FISH showed that R. rubiginosa and 'André Brichet' harbored 5 and 4 highly heteromorphic rDNA loci, respectively. In the second generation of hybrid lines, we observed a reduced number of loci (4 and 5 instead of the expected 6). In R. rubiginosa and 'André Brichet', 2-3 major ITS types were found which is consistent with a weak homogenization pressure maintaining high diversity of ITS types in this genus. In contrast to expectation (the null hypothesis of Mendelian inheritance of ITS families), we observed reduced ITS diversity in some individuals of the second generation which might derive from self-fertilization or from a backcross to R. rubiginosa. In these individuals, the pan-canina beta family appeared to be markedly enriched, while the paternal families were lost or diminished in copies. Although the mechanism of biased meiotic transmission of certain rDNA types is currently unknown, we speculate that the bivalent-forming chromosomes carrying the beta rDNA family exhibit extraordinary pairing efficiency and/or are subjected to strong selection in Caninae polyploids. PMID:24685720

  9. Reevaluation of the evolutionary position of opalinids based on 18S rDNA, and alpha- and beta-tubulin gene phylogenies.


    Nishi, Akane; Ishida, Ken-ichiro; Endoh, Hiroshi


    Opalinids are enigmatic endosymbiotic protists principally found in the large intestine of anuran amphibians. They are multinucleates and uniformly covered with numerous flagella (or cilia). Their appearance is somewhat similar to that of ciliates, leading to opalinid's initial classification as ciliates, or later as protociliates. However, on the basis of their monomorphic nuclei, absence of a ciliate-like life cycle characterized by conjugation, and an interkinetal fission mode, opalinids were subsequently transferred in the zooflagellates. As several common ultrastructural characteristics shared with proteromonads were elucidated, in particular of the flagellar base, such as their double-stranded flagellar helix, an alliance with proteromonads was widely accepted. Thus, opalinids are currently favored to be placed in the class Opalinea, within the heterokont kingdom Chromista. However, the question of their classification has not been fully resolved, because of a lack of molecular information. Here, we report their phylogenetic position inferred from 18S rDNA, and alpha- and beta-tubulin gene sequences. The 18S rDNA tree gives the opalinids an ancestral position in heterokonts, together with proteromonads, as suggested by the morphological studies. In great contrast, alpha- and beta-tubulin gene analyses suggest an affiliation of opalinids to alveolates, not to heterokonts. However, the AU test implies that opalinids are not closely related with any of other three phyla in the alveolates, suggesting an occupation of an ancestral position within the alveolates. Based on the present molecular information, in particular rDNA phylogeny, and the ultrastructural character of the double helix common to heterokonts, we conclude that opalinids would have a common origin with heterokonts, although analyses based on two tubulin genes do not as yet completely deny a possible placement outside heterokonts. The ambiguity of the evolutionary position shown by the discrepancy

  10. rDNA amplification in previtellogenic and vitellogenic oocytes of symphylans (Arthropoda, Myriapoda).


    Jabłońska, A; Szklarzewicz, T; Jankowska, W; Kukiełka, M; Biliński, S M


    Tube-shaped ovaries of symphylans house numerous developing oocytes that are accompanied by somatic follicular cells. Oocyte nuclei (germinal vesicles) are relatively large and ovoid. During early previtellogenesis they contain compact spherical bodies and lampbrush chromosomes immersed in a translucent karyoplasm. Fluorescent labeling with DAPI and propidium iodide has revealed the presence of both DNA and RNA in the spherical bodies. As previtellogenesis advances, small RNA- and AgNOR-positive nucleoli bud off from these bodies. Full-grown nucleoli consist of coarse-granular material and comprise electron-transparent vacuoles. Our results suggest that in symphylan germinal vesicles amplification of rDNA genes takes place, and that the spherical bodies represent accumulations of extrachromosomal rDNA (rDNA bodies) after commencement of transcriptional activity.

  11. Analysis of bacterial diversity in river biofilms using 16S rDNA PCR-DGGE: methodological settings and fingerprints interpretation.


    Lyautey, Emilie; Lacoste, Bénédicte; Ten-Hage, Loïc; Rols, Jean-Luc; Garabetian, Frédéric


    Reliability of bacterial diversity assessment using polymerase chain reaction (PCR) denaturing gradient gel electrophoresis (DGGE) analysis of 16S rDNA fragments was evaluated for a particular complex microbial assemblage: river epilithic biofilm. By comparing 3 routine protocols on replicates of one river biofilm sample, we found that common DNA extraction procedures gave comparable diversity (from 28.0 to 30.7 bands detected) and community composition (> 75% of homology) despite differences in the total amount of extracted DNA (from 0.9 to 4.2 microg). Therefore methodological improvements only concerned electrophoretic separation of DNA fragments (range of denaturing gradient from 35% to 70% and migration time=18h) and standardisation of DNA amounts used (PCR-template=50 ng, gel loading=700 ng). Using such a standardised methodology we found a good reproducibility of all steps of the procedure. When an Escherichia coli strain was introduced as a contaminant in a biofilm sample, we were able to recover ribotypes from the strain. As concerns fields sampling, a satisfactory repeatability of banding patterns from neighbouring pebbles (sampling point) allowed discriminating between the biofilm intrasite variability (various points from a cross-profile). These trials confirmed that PCR-DGGE is suitable to assess a reliable genetic fingerprint of epilithic biofilms in the river. Phylogenetic analysis of 40 partial sequences of 16S rDNA from DGGE gels of two sets of river biofilms samples proved evidences for the retrieval of DNA fragments related to phototroph Eukarya. However, in both cases plastidial 16S rDNA represented less than 25% of the analysed operational taxonomic units. Taking into account that Cyanobacteria, as members of the Bacteria, were also detected, sequence analysis of relevant bands from the pattern is required to target "bacteria", i.e. the functional group of prokaryotic microorganisms to which one commonly refers as a key component in sustaining

  12. Cyst-theca relationship of the arctic dinoflagellate cyst Islandinium minutum (Dinophyceae) and phylogenetic position based on SSU rDNA and LSU rDNA.


    Potvin, Éric; Rochon, André; Lovejoy, Connie


    Round brown spiny cysts constitute a morphological group common in high latitude dinoflagellate cyst assemblages. The dinoflagellate cyst Islandinium minutum (Harland et Reid) Head, Harland et Matthiessen is the main paleoecological indicator of seasonal sea-ice cover in the Arctic. Despite the importance of this cyst in paleoceanographical studies, its biological affinity has so far been unknown. The biological affinity of the species I. minutum and its phylogenetic position based on the small subunit ribosomal RNA gene (SSU rDNA) and the large subunit ribosomal RNA gene (LSU rDNA) were established from cyst incubation experiments in controlled conditions, optical and scanning electron microscopy, and single-cell PCR. The thecal motile cell obtained was undescribed. Although the motile cell was similar to Archaeperidinium minutum (Kofoid) Jörgensen, the motile cell of I. minutum lacked a transitional plate in the cingular series, which is present in Archaeperidinium spp. Islandinium minutum and Archaeperidinium spp. were paraphyletic in all phylogenetic analyses. Furthermore, Protoperidinium tricingulatum, which also lacks a transitional plate, was closely related to I. minutum and transfered to the genus Islandinium. Based on available data, it is clear that Islandinium is distinct from Archaeperidinium. Therefore, we considered Islandinium Head, Harland et Matthiessen as a non-fossil genus and emend its description, as well as the species I. minutum. This is the first description of a cyst-theca relationship and the first study that reports molecular data based on SSU rDNA and LSU rDNA on a species assigned to the genus Islandinium.

  13. Identification of the gene encoding the 5S ribosomal RNA maturase in Bacillus subtilis: mature 5S rRNA is dispensable for ribosome function.

    PubMed Central

    Condon, C; Brechemier-Baey, D; Beltchev, B; Grunberg-Manago, M; Putzer, H


    Over 25 years ago, Pace and coworkers described an activity called RNase M5 in Bacillus subtilis cell extracts responsible for 5S ribosomal RNA maturation (Sogin & Pace, Nature, 1974, 252:598-600). Here we show that RNase M5 is encoded by a gene of previously unknown function that is highly conserved among the low G + C gram-positive bacteria. We propose that the gene be named rnmV. The rnmV gene is nonessential. B. subtilis strains lacking RNase M5 do not make mature 5S rRNA, indicating that this process is not necessary for ribosome function. 5S rRNA precursors can, however, be found in both free and translating ribosomes. In contrast to RNase E, which cleaves the Escherichia coli 5S precursor in a single-stranded region, which is then trimmed to yield mature 5S RNA, RNase M5 cleaves the B. subtilis equivalent in a double-stranded region to yield mature 5S rRNA in one step. For the most part, eubacteria contain one or the other system for 5S rRNA production, with an imperfect division along gram-negative and gram-positive lines. A potential correlation between the presence of RNase E or RNase M5 and the single- or double-stranded nature of the predicted cleavage sites is explored. PMID:11233981

  14. Structural polymorphism in the major groove of a 5S RNA gene complements the zinc finger domains of transcription factor IIIA